P. 1
cahier d'exercice4

cahier d'exercice4

4.0

|Views: 3,090|Likes:
Published by mohamed

More info:

Published by: mohamed on Dec 18, 2008
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/25/2014

pdf

text

original

FACULTE DE MEDECINE PIERRE & MARIE CURIE

PCEM1

4. Biologie Moléculaire
L'étude des acides nucléiques

CAHIER D'EXERCICES de BIOCHIMIE
2005-2006
EDITE PAR LES ENSEIGNANTS DE BIOCHIMIE

http://www.chusa.jussieu.fr/disc/bio_cell

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 2

CAHIER D'EXERCICES POUR PCEM1 BIOCHIMIE

IV. BIOLOGIE

MOLECULAIRE:

l'étude des acides nucléiques SOMMAIRE
Page 1. Structure des acides nucléiques . . . . . . . . . … … … … . 2. Transcription ....................……........ 3 3 4 11

3. Traduction . . . . . . . . . . . . . . . . . … … . . . . . . . . . . . . . . . . 4. Réplication et Réparation ..........….........

5. Altérations du matériel génétique et Outils de Biologie moléculaire ......………... 6. QCM ………………………….......………...

12 17

7. Annales du concours… … … … … … . . . . . . . … … … . . 25 ANNEXES. I • Code génétique . . . . . . . . . . . . . . . . … … … . . . . . II • Codes des acides aminés . . . . . . … … … . . . . .

28 28

Image de couverture : Photographie en microscopie électronique d'une fourche de réplication déficiente chez un mutant de levure. Une anomalie lors de la réplication d'ADN serait l'un des mécanismes contribuant à l'instabilité génomique (Science-26 juil 2002 www.sciencemag.org) Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 3

1. STRUCTURE DES ACIDES NUCLEIQUES
1.1 Structure de l’ADN a. Par convention la séquence d’une molécule d’ADN est écrite dans le sens 5’ (gauche) - 3’ (droite). Quels sont les groupements chimiques correspondant à ces extrémités ? b. Un échantillon d’ADN contient 28,9 moles pour 100 d’adénine. Quels sont les pourcentages de thymine, guanine et cytosine ? Quelles caractéristiques structurales permettent de différencier ces bases ? c. Est-ce que la proposition suivante est vraie : « si la séquence d’un déoxyribonucléotide est p C p T p G p G p A p C , alors sa séquence complémentaire est p G p A p C p C p TpG»? 1.2 Soit le fragment d'ADN suivant: 5'ACTTC3' 3'TGAAG5' a. Par l'intermédiaire de quels atomes et de quel type de liaison cette structure est-elle stabilisée? b. Comment peut-on dénaturer cette molécule? c. Quel intérêt présente la possibilité de ré-associer des simples brins d'ADN entre eux ?

2. TRANSCRIPTION
2.1 Déroulement de la transcription d’un gène a. Quelle est la définition d’un gène ?
b.

Quels sont les composants moléculaires nécesssaires à la transcription ?

c. Comment se fait l’initiation de la transcription ? d. Quel est le sens de lecture de l’ADN lors de l’élongation ? e. Montrer comment un signal hormonal peut réguler l’expression d’un gène. 2.2 Citer les 3 évènements indispensables à la maturation post-transcriptionnelle des transcrits primaires d'ARN conduisant à la formation des ARN messagers chez les Eucaryotes. Vous préciserez le déroulement chronologique, les étapes ainsi que le rôle de chacune de ces modifications nucléaires. Compléter les propositions suivantes. a. La synthèse d’ARN, qui est aussi appelée ____________________, est un processus hautement sélectif. b. La transcription commence quand une molécule d’_________________________ se lie à une séquence ____________________ sur la double hélice d’ADN ; c. L’___________________________ transcrit les gènes dont les ARN seront traduits en protéines, l’______________________________ synthétise les grands ARN ribosomiques, et l’_____________________________ produit une variété d’ARN stables très petits. d. L’addition d’un nucléotide G méthylé à l’extrémité 5’ d’un transcrit initial forme la ___________________ , qui semble protéger de la dégradation l’ARN en élongation, et joue un rôle important dans l’initiation de la synthèse protéique. e. L’extrémité 3’ de la plupart des transcrits de la polymérase II est définie par une modification, au cours de laquelle le transcrit en élongation est clivé à un site spécifique, et une _________________ est ajoutée à l’extrémité 3’ coupée par une polymérase distincte.
Faculté de Médecine Pierre & Marie Curie

2.3

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 4

f. Les modifications des extrémités 5’ et 3’ d’une chaîne d’ARN terminent la formation du _____________________ . g. Les séquences codantes d’ARN de chaque côté de l’intron sont réunies l’une à l’autre après que la séquence intronique ait été retirée ; Cette réaction est connue sous le nom d’_____________________________ . h . Les séquences conservées aux deux extrémités d’un intron sont appelées _______________________ et _____________________. 2.4 Compléter les propositions suivantes. a. Les protéines _______________________ stimulent ou inhibent la transcription de certains groupes de gènes spécifiques. b. Le motif de liaison à l’ADN en ________________________ a été retrouvé dans des protéines de liaison à l’ADN chez les eucaryotes et les procaryotes; il contient dans sa structure un ou plusieurs ions métalliques. c. Le motif ______________________________ est ainsi appelé car deux hélices chaque monomère, se rejoignent pour former une bobine enroulée. d. Le motif ____________________________ consiste en une courte hélice boucle à une deuxième hélice , plus longue. , provenant de reliée par une

3. TRADUCTION
3.1 Expression du gène de l’apolipoprotéine E Séquence du gène codant pour l’Apolipoprotéine E humaine(allèle Epsilon 4).
(Genbank : HUMAPOE4) 1 81 161 241 321 401 481 561 641 721 801 881 961 1041 1121 1201 1281 1361 1441 1521 1601 1681 1761 1841 1921 2001 2081 2161 2241 2321 2401 2481 2561 2641 2721 2801 2881 2961 3041 3121 3201 GGAACTTGAT CAATTTGACT GGGAGGTGCT AAAACCCAGG CCAGCCGCCT ATCTCGGCTC CGCCCGCCAC TCCTGACCTT CCATCCCACT TTACATTCAT CTTGGCCCCC AAAGACCTCT GGGCTGCCCA AGTCCTACTC AGCTCAGGGG GGCTTGGGGA GACCCGCTAG TTATCGAGCA CCGTCGATTG AGAATGTGAA TTGAACCCCG TTAAATAGGG GGCTAACCTG TCCCCAGACT GGCGGGGCTT GGCCCCCTCT TCCTTGAGAT CTGTCGCCCA CTCAGCCTCC GTTTCACCAT TTACAGGCGT GGGCAGCTGT CGCTGGGCCG ACACCAGCCT GCTCTCAGCT CGCTGCACTC CCCTCACCCT CGGGGTCAGA AGAGCCGGAG ATTACCTGCG TGAGTGTCCC GCTCAGAGAG CCAGAATCCT GGAATCTCAT TCCCATTTGC AGCCCCACTT ACTGTAACCT CACGCCTGGC AAGTGATTCG TCTGTCCAGC CCAGGCACAG AGAATGGAGG ATGCCCCACC GCCCGCCCTA AGCCCCAGCG CCTCTAGAAA GAGGAGGAGC AAGGTGGGGT CCTACTGGGT GAGAACTTTA GGGAGAATGA GGAGAGGAAG AATGGGTTGG GGGTGAGGCC GGCCAATCAC GCTCGGTTCC TCTGAGGCTT AGGAGTTAGA GGCTGGAGTG CAAGTAGCTG GTTGGCCAGG GAGCCACCGC GATCTTTATT GTGGCTCACC GGGCAACATA ACTCAGGAGG CAGCCTGGGT GCCCACCATG AGGACCCTGA CCCGAGCTGC CTGGGTGCAG CATCCTGGCC GACAAGTCAT AACCTTAACC TTCACATGTG AAAGCCTCGA TCTTTTTTTT CCGCCTCCCG TAACTTTTGT CCCACTGTGG CCCCTAGCCC GAAAGGACAG AGGGTGTCTG TCCTTCCTCC TCCCTGGGGG GAGGTGAAGG GAGCTGGGAC GGGGGTGAGG GGGGAGAGCA GTCCCCAGTG AAATGAGGAC GGAATGCGAG ATGGAATTTT GGGCGGCTTG GGGTTGGGGG AGGCAGGAAG CCCCGCTCCT CTGTGCTGCT AGTTGTTTTG CAGTGGCGGG GGACTACAGG CTGGTCTGGA ACCTGGCTGG CTCCATCACC CCTGTAATCC GTGAGACCCT CTGAGGCAGG GACAGAGCAA GCTCCAAAGA CCCGACCTTG GCCAGCAGAC ACACTGTCTG CTTGACCCTC TTGCCCAAGG CAGAAGCACG GGGAGGGGGC CTTTTAGCAG CTTTTTTTGA GGTTCAAGCG ATTTTTAGTA CCTCCCAAAG TACTTTCTTT GGTCAGGAAA TATTACTGGG CTCTGCCCTG AGGGGGCGGG ACGTCCTTCC CCTGGGAAGC CAAGCAGCAG GCTGGACTGG TCCTCAGATC TGAATTAGCT ACTGGGACTG CTATGGAGGC GTAAATGTGC CGCTGGGGGT ATGAAGGTTC CCCCCTCTCA TCCTGGCTCT TTGTTGTTGT ATCTCGGCTC CACATGCCAC ACTCCTGACC GAGTTAGAGG CCCACACAGC CAGCACTTTG GTCTCTACTA AGGATCGCTT GACCCTGTTT AGCATTTGTG AACTTGTTCC CGAGTGGCAG AGCAGGTGCA CTGGTGGGCG TCACACAGCT GCTTCAAGCC TCCTGTGCTC GTGCATCATA GACAGTCTCC ATTCTCCTGC GAGATGGGGT TGCTGGGATT CTGGGATCCA GGAGGACTCT CGAGGTGTCC CTGTGCCTGG ACAGGGGGAG CCAGGAGCCG CCTGGCCTCC GGGACTGGAC GATGTAAGCC TCCATAACTG CATAAATGGA AGATGGAACC CGACCTGGGG TGGGATTAGG GGGAGGAGTC TGTGGGCTGC TCCTCACCTC GAACAGCGAT TTGTTGTTGT ACTGCAAGCT CACACCCGAC TCAGGTGATC TTTCTAATGC CCTGCCTGGG GGAGGCCAAG AAAATACAAA GAGCCCAGAA ATAAATACAT GAGCACCTTC ACACAGGATG AGCGGCCAGC GGAGGAGCTG GCTATACCTC GGCAACTGGC CTGGAAACCA AAGGTCACAA CTGTTCCCAC CTCTTGCTGA CTCAGCCTCC TTCACCATGT ACAGGCGTGA GGAGTCCAGA GGGCGGCAGC TCCCTTCCTG GGCAGGGGGA CCCTATAATT GTGAGAAGCG AGGTAGTCTC CTGGGAAGGG ATAGCAGGAC GGGAGCCAGG ACACGGCGCT GGCGGTGGGG ATGGGGAGAT CTGTTGCAGA CTCACTGGCG GTTGCTGGTC AACCTCCTGG TTGACGCTCT TGTTTTGTTT CCGCCTCCCA TAACTTTTTT TGCCCGTTTC ATTGCAGGCA GCACACAAGG GTGGGAGGAT AATTAGCCAG GGTCAAGGTT AATGCTTTCC TGTGTGCCCC CCAGGCCAAG GCTGGGAACT CTCAGCTCCC CCCAGGTCCA AGACGAGATT CAATACCTGT CCAAAGAGGA CCCTCCCATC GGCTGGAGTG CAAGTAGCTA TGGCCAGGCT GCTACCGCCC TCCCCAGCCC CTCCACATTC GGGACTGTGG GAACAGCCCA GGACAAGTCT CAGTCGGGGG AGGAGAGCTA CTGGGCAGCA TCCACGAGTT GGCAGCGACA TAACTGTGAG AGGGGGTGGG AAGAGAAGAC TAATGCAACA GTTGATTGAC ACATTCCTGG CCCCATTCAG CTGGGCCTCG TTTTGAGATG GGTCCACGCC GTATTTTCAG GATCTCCCAA GATAGTGAAT ACACTCAATA CACTTGAGCC GCATGGTGCC GCAGTGAACC AAGTGATTAA TAGGTAGCTA GTGGAGCAAG GGCACTGGGT AGGTCACCCA GGTTTCATTC CACGCCCTGG GGCAGCCAGG AGCTGTGATT CCACTTCTGT CAGTGGCGAG GGATTACAGG GGTCTCAAAC CCAGCCCCTC CCTCTCCAGA CCCTTCCACG GGGGTGGTCA CCTCGTGACT GGGATCCTTG CACGGGGATG CTCGGGGTCG GAGACGACCC GTCACTATCA CGGTAGCTAG GTTGGAGCTT GGGATGGAAT CAGGAGGGAG AGGCTTGGAA AGTTTCTCCT CAGGTATGGG ACAGACCCTG GTTTCCCCCA AAGTCTCGCT ATTCTCCTGC TAGAGACGGG AGTGCTGGGA ACCAGACACG CATGCTTTTC CAGGAGTTCA ACACACCTGT ATGTTCAGGC ACCGACTCCC GATGCCTGGA CGGTGGAGAC CGCTTTTGGG GGAACTGAGG TGCCCCTGTC 80 160 240 320 400 480 560 640 720 800 880 960 1040 1120 1200 1280 1360 1440 1520 1600 1680 1760 1840 1920 2000 2080 2160 2240 2320 2400 2480 2560 2640 2720 2800 2880 2960 3040 3120 3200 3280

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1
3281 3361 3441 3521 3601 3681 3761 3841 3921 4001 4081 4161 4241 4321 4401 4481 4561 4641 4721 4801 4881 4961 5041 5121 5201 5281 5361 5441 GCTAAGTCTT ATTCTCTCTC CCCTAGCTCT GATCCTCCCG TCTGCCTCTG TCTTGGGTCT TCCCGCCCTC ACTGACCCCG TGGAGGACGT GTGCGCCTCG GTACCAGGCC GCCGCGTGCG CGCGCGCGGA CAAGCTGGAG TGGTGGAAGA CCCAGCGACA GCAGCGGGAG ATCTGCTGGC CAGCCCCCTC CACCCAGGCT GTAGCTGGGA CCAGGCAGGT TGCCCGGCCT GCCTCCACCT CTAGGATTAA CTCAAGCGAT TTTGTAGAGA CAAAGTGCTG GGGGGGCCTG TCAGCTTTGT TTTATATAGA CCTCGGCCTC CCCTCTGCAT CTCTGGCTCA TCGGCCGCAG GTGGCGGAGG GCGCGGCCGC CCTCCCACCT GGGGCCCGCG GGCCGCCACT TGGAGGAGAT GAGCAGGCCC CATGCAGCGC ATCACTGAAC ACCCTGTCCC CTCCCCCTGT CTCTCCATCT AGAGTGCAGT TTACAGGCTC CTCAAACTCC CTGCCCCTCT CCTGGACTCA TTTGGGGGGG ACTCCCACCT CAAGGTCTCA GGATTCCAGG GGTCTCTGCT CTCTCTCTCT GACAGAGAGA CCAAAGTGCT CTGCTCTCTG TCCCCATCTC GGCGCTGATG AGACGCGGGC CTGGTGCAGT GCGCAAGCTG AGGGCGCCGA GTGGGCTCCC GGGCAGCCGG AGCAGATACG CAGTGGGCCG GCCGAAGCCT CGCCCCAGCC GATTTCCTCT GTGTCTGTGT GGCACGATCT ACACCACCAC TGACCAAGTG TTCTTTTTTA AGTGATAAGT GGTGGTGTGT TGGCCTCCTG ATATGTTGCC CATGGGCTCC GGTTCTAGCT TCCCTTCTGA TGGGGTCTCA GGGATTAGAG CATCTGTCTC GCCCGCCCCA GACGAGACCA ACGGCTGTCC ACCGCGGCGA CGTAAGCGGC GCGCGGCCTC TGGCCGGCCA ACCCGCGACC CCTGCAGGCC GGCTGGTGGA GCAGCCATGC GTCCTCCTGG AAGCCCCAGC GTATCTTTCT TGGCTCACTG ACCCGGCTAA ATCCACCCGC GGGGGCAGGG GATCCTCCCG GTGGAGATGG AGTAGCTGAG CAGGCTAGTC GAGCGGCCTG TCCTCTTCCC CTCAGTCTCT CTGTGTTGCC GCATGAGCAC TGTCTCCTTC TCCCAGCCCT TGAAGGAGTT AAGGAGCTGC GGTGCAGGCC TCCTCCGCGA AGCGCCATCC GCCGCTACAG GCCTGGACGA GAGGCCTTCC GAAGGTGCAG GACCCCACGC GGTGGACCCT CTCAGTTTCT CTCTGCCCTT CAACCTCTGC TTTTTGTATT CGGCCTCCCA AAAGGTCTCA CCTCAGCCTT GGTCTGGCTT ACTACTGGCT TCAAACCCCT CCCAACTTAA ATTTCTGACT CACACTCGTC CAGGCTGGTC CTTGCCCGGC TCTCGGCCTC TCTCCCCCGC GAAGGCCTAC AGGCGGCGCA ATGCTCGGCC TGCCGATGAC GCGAGCGCCT GAGCGGGCCC GGTGAAGGAG AGGCCCGCCT GCTGCCGTGG CACCCCGTGC AGTTTAATAA CTTTCTGCCC TTTTTTTTTT CTCTTGGGTT TTTAGTAGAG AAGTGCTGAG CCCTGTCACC TCCAGTAGCT TGTTGGCCAG AGCACCACCA GGCTCAAGAG TAATATTGTT CCTGGCTTTA CTGGCTCTGT TTGAACTTCT CTCCTAGCTC TGCCCCGTTC CTCCCCACTG AAATCGGAAC GGCCCGGCTG AGAGCACCGA CTGCAGAAGC GGGGCCCCTG AGGCCTGGGG CAGGTGGCGG CAAGAGCTGG GCACCAGCGC CTCCTGCCTC AGATTCACCA ACATACTGCC TAGACGGAGT CAAGCGATTC ACGAGCTTTC ATTACAGGCC CGCCATCACA GAGACTACAG GCTGATGTGG CACCCAGCTT ATCCTCCGCC CCTAGAGTTG

Biologie Moléculaire / 5
GCTCTCTGGA CTCTGTCCTT GGGCTCAAGC CTTCTTCGTC CTTCTCTCCC TGCGACACCC TGGAGGAACA GGCGCGGACA GGAGCTGCGG GCCTGGCAGT GTGGAACAGG CGAGCGGCTG AGGTGCGCGC TTCGAGCCCC CGCCCCTGTG CGCGCAGCCT AGTTTCACGC ACACAATTCT CTGGCTCTGT TGCTGCCTCA ACCATGTTGG TGAGCCACCA GCTCACTGCA GCGCATACCA AATTCCTGGG TTTATTATTA ATCGGCCTCC CACTC 3360 3440 3520 3600 3680 3760 3840 3920 4000 4080 4160 4240 4320 4400 4480 4560 4640 4720 4800 4880 4960 5040 5120 5200 5280 5360 5440 5515

La séquence ci-jointe est celle du gène de l'apolipoprotéine E humaine, allèle e4. Le dernier nucléotide de chaque ligne est numéroté sur la droite (n° de position). 3.1.1 Certaines parties de cette séquences ont été soulignées d'un trait simple; examinez avec soin le début et la fin des séquences qui sont situées entre ces séquences soulignées : à quoi correspondent les séquences soulignées ? 3.1.2 Quelles sont les fonctions (rôles) des protéines qui se fixent en premier sur ce gène dans la région allant du nucléotide 975 au nucléotide 1046 ? 3.1.3 Quel est le rôle du triplet de nucléotides en 1871-1873 ? 3.1.4 Quelle est la traduction de la séquence 1847-1913 de ce gène ? 3.1.5 3.1.6 Le nucléotide en position 1913 est un G qui fait partie de la séquence traduite : quel est sa position dans le cadre de lecture : N1, N2 ou N3 ? Le nucléotide en position 3007 est un G qui fait partie de la séquence traduite : quel est sa position dans le cadre de lecture : N1, N2 ou N3 ?

3.1.7 Il existe dans le domaine de l'apolipoprotéine E codé par l'exon 4 du gène deux Arginines qui peuvent être mutées en Cystéines par une simple substitution d'un nucléotide : quelle est à ces endroits (soulignés deux fois), la séquence du brin sens du gène muté ? 3.1.8 Quelle sera la longueur après transcription et maturation (comprenant l'addition de 1000 AMP du côté 3'-OH) de l'ARN messager de l'apolipoprotéine E ?

3.1.9 Quel est le rôle du codon (souligné deux fois) TGA en 4495 3.1.10 Quels sont les numéros des nucléotides de la boîte de polyadénylation ? 3.1.11 La sécrétion de la protéine hors des cellules est suivie de l'hydrolyse d'un peptide de 18 acides aminés du côté N-terminal. Quel est le rôle de ce peptide ? 3.1.12 De combien d'acides aminés se compose l'apolipoprotéine E mature ?

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 6

3.2

Soit le schéma ci-contre représentant un ARNt (avec son anticodon). a. Quel est le nom de l'acide aminé transporté par cet ARNt ? b. Quel est le nom du nucléotide situé à l'extrémité 3' de cet ARNt ? c. Par quel type de liaison l'acide aminé sera-t-il lié à cet ARNt ?

3.3

Combien de liaisons phosphates riches en énergie sont consommées dans la synthèse d'une protéine de 75 résidus d’acide aminé ? Commenter votre réponse.

3.4. 3.4.1 Soit une séquence de bases présente sur un brin d’ADN (brin 1)

....-G-A-C-T-T-A-C-A-C-G-C-G-A-T-T-T-T-A-T-A-T-A-G-C-....
a. Recopiez cette séquence et écrivez la séquence du brin d’ADN complémentaire (brin 2) b. Sachant que l’ARNm issu de la transcription de ce fragment d’ADN code le début d’une protéine : - déterminez quel est le brin matrice (justifiez votre réponse) et écrivez la séquence de l’ARNm. - orientez toutes les séquences des acides nucléiques ; - écrivez la séquence du polypeptide traduit à partir de cet ARNm. c. A la suite d’une mutation, la 10ème base (G) du brin 1 représenté ci-dessus, a été remplacée par une adénine. Dans un autre mutant, cette même base G a été remplacée par une cytosine. Chez un troisième mutant, la même base G a été remplacée par une thymine. Enfin, chez un quatrième mutant, ce même nucléotide G a été perdu. Ecrivez pour chaque cas les modifications introduites dans les séquences. Qu’advient-il de la protéine dans chaque cas ? 3.4.2 Le code génétique est dit redondant ou dégénéré. Comment s’exprime cette dégénérescence et quelle remarque peut-on faire à son sujet ?

3.4.3 On estime que l’ensemble des molécules d’ADN présentes dans le noyau d’une cellule humaine (avant la phase de réplication) représente 6 x 109 paires de nucléotides. Quelle longueur totale d’ADN cela représente-t-il ? Justifiez vos calculs en présentant votre raisonnement. 3.4.4 Quels sont les différents types d’ARN matures présents dans une c e l l u l e eucaryote ? Précisez en 2 lignes maximum (pour chaque type) leur fonction respective. 3.5 PROBLEME SUR LA SEQUENCE, LA TRANSCRIPTION ET LA TRADUCTION DU GENE SPO II G. Cet exercice est organisé autour de l’exploitation d’une séquence nucléotidique. On se propose d’analyser cette séquence en vue d’étudier successivement : - le sens de transcription, - le cadre de lecture - l’enchaînement des acides aminés - une propriété biologique de la protéine, les nucléotides modifiés chez quelques mutants.

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 7

La séquence d’ADN représentée ci-dessous est celle d’un fragment de 120 paires de bases entièrement contenu dans la partie traduite du gène spo II G de la bactérie Bacillus subtilis. 5’P
1 11 21 31

GAAAAAACTG
41

AAATTACGGT
51

TGACGCACCT CTGGTATAAG
61 71

CTGCTGATGA
81

AACTTGGGCT GAAAAGTGAT GAAGTCTATT
91 101 111

ACATAGGCGG

GAGTGAAGCC CTGCC GCCTCCATTATCTAA 3’ OH

3.5.1 Le sens de transcription
a. Sachant que la séquence donnée est celle du brin sens, indiquer par une flèche sur la séquence ci-dessous le sens de progression de la transcription. Justifier.
G A A A A A A C T G A A A T T A C G G T...............G C C C T G C C G C C T C C A T T A T C T A A
1 11 101 111

3.5.2 Le cadre de lecture
a. Théoriquement l’information génétique portée par l’ARNm peut être traduite de trois façons différentes. Pourquoi ? b. Donner dans le tableau I ci-dessous les différentes séquences prises par les trois codons stop au niveau des trois brins d’acide nucléique.

TABLEAU I 5’ P 3’ OH 1er type ARNm brin d’ADN sens brin d’ADN transcrit Séquences des codons non-sens 2ème type 3ème type

c. Avec des barres verticales, définir les trois cadres de lecture potentiels de la séquence étudiée. Dans chaque cas encadrer les codons stop.

1er CADRE DE LECTURE POTENTIEL
1 11 21 31

GAAAAAACTG
41

AAATTACGGT
51

TGACGCACCT CTGGTATAAG
61 71

CTGCTGATGA
81

AACTTGGGCT GAAAAGTGAT GAAGTCTATT
91 101 111

ACATAGGCGG

GAGTGAAGCC CTGCCGCCTC CATTATCTAA

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 8

2ème CADRE DE LECTURE POTENTIEL
1 11 21 31

GAAAAAACTG
41

AAATTACGGT
51

TGACGCACCT CTGGTATAAG
61 71

CTGCTGATGA
81

AACTTGGGCT GAAAAGTGAT GAAGTCTATT
91 101 111

ACATAGGCGG

GAGTGAAGCC CTGCCGCCTC CATTATCTAA

3ème CADRE DE LECTURE POTENTIEL
1 11 21 31

GAAAAAACTG
41

AAATTACGGT
51

TGACGCACCT CTGGTATAAG
61 71

CTGCTGATGA
81

AACTTGGGCT GAAAAGTGAT GAAGTCTATT
91 101 111

ACATAGGCGG

GAGTGAAGCC CTGCC GCCTCCATTATCTAA

d. Quel est le cadre de lecture effectivement utilisé pour la synthèse de la protéine ? e. Si au cours d’une expérience préliminaire on établit la séquence d’un seul brin d’un fragment d’ADN que l’on sait être interne à un gène, il est possible, au moins en théorie de déterminer le sens de la transcription. Comment ?

3.5.3 L’enchaînement des acides aminés
a. Identifier sur la séquence ci-dessous l’extrémité qui code pour la région N-terminale du fragment protéique. Justifier.
1 11 111

GAAAAAACTG AAAT ................................CCTC CATTATCTAA
b. Donner dans le tableau II la composition en acides aminés du fragment protéique analysé. TABLEAU II
Acide aminé ala arg asn asp cys gln glu gly his ile Alanine Arginine Asparagine Acide Aspartique Cystéine Glutamine Acide Glutamique Glycocolle Histidine Isoleucine Nombre leu lys met phe pro ser thr trp tyr val Acide aminé Leucine Lysine Méthionine Phénylalanine Proline Sérine Thréonine Tryptophane Tyrosine Valine Nombre

3.5.4 Une propriété biologique de la protéine
La protéine codée par le gène spo II G interagit avec l’ADN. Ce fait est-il compatible avec la composition en acides aminés du fragment analyse ? Pourquoi ?
Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 9

3.5.5 Les nucléotides modifiés chez quelques mutants.
Cette protéine peut-être purifiée à partir de la souche sauvage et de 3 mutants affectés dans le gène spo II G. Elle est soumise à une électrophorèse en conditions non dénaturantes; dans ces conditions la migration s’effectue selon la charge électrique. a. Quel nucléotide doit-on trouver en position 71 chez les mutants pour obtenir les profils d’électrophorèse présentés dans le figure I ?

FIGURE I Sauvage + Mutant 1 Mutant 2 Mutant 3

Nucléotide n°71

+
G

3.5.6 En résumé :
Le tableau III concerne 18 des 120 nucléotides de la séquence

TABLEAU III
ADN DOUBLE -BRIN ARNm ANTICODON des ARNt ACIDE AMINE a. Déterminer le sens de transcription. Justifier. b. Orienter l’ARNm, les deux brins de la molécule d’ADN et compléter le tableau III. c. Schématiser par un trait la chaîne polypeptidique en l’orientant et en donnant la position relative des acides aminés déterminés. lys trp ... ... GUC CAG GAA ... ... ... CAT ATA ...

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 10

3.6 TRADUCTION 3.6.1 Compléter directement sur le schéma ci-dessous (Figure 1) les légendes qui doivent indiquer : les sous-unités ribosomales et le principal type d’ARN ribosomal (A R N r) dont elles sont constituées les sites de fixation peptidique (site P) et acide aminé (site A) du ribosome les molécules d’ARN messager (A R N m ) et d’ARN de transfert (ARNt) les extrémités N t e r m i n a l e et C terminale de la chaîne peptidique en cours de synthèse

-

-

-

3.6.2 Ajouter directement sur le schéma ci-dessous (Figure 2) - le résidu 7-méthylguanosine triphosphate ( Gppp) à l’emplacement correct. - la séquence nucléotidique du premier codon de l’ARN messager. - la séquence nucléotidique de l’extrémité 3’ de l’ARN messager. Déduire des informations dont vous disposez sur la séquence d’ARN messager : - la séquence des huit premiers acides aminés du peptide. - la séquence du gène codant ces huit premiers acides aminés. 3.6.3 - Citer quatre étapes nécessaires à l’incorporation du quatrième acide aminé à partir de cet acide aminé libre. Indiquer pour chacune des quatre étapes, si elle est directement couplée à l’hydrolyse de liaison(s) riche(s) en énergie, en précisant le cas échéant, le nombre de liaison(s) riche(s) en énergie hydrolysées. - Citer le nom de l’enzyme et le numéro des étapes qui permettent d’assurer la spécificité du quatrième acide aminé incorporé. 3.6.4 - Dans quel(s) compartiment(s) de la cellule a lieu la synthèse de cette chaîne peptidique? - Dans quel(s) compartiment(s) de la cellule a eu lieu la synthèse du ribosome et quel est son devenir immédiat une fois que la synthèse de la chaîne peptidique sera achevée ? - Dans quel(s) compartiment(s) de la cellule a eu lieu la synthèse de l’ARN messager et quel est son devenir immédiat une fois que la synthèse de la chaîne peptidique sera achevée ? 3.6.5 Le tableau suivant illustre trois mutations différentes des codons 6 et 7 telles qu’elles apparaissent dans la séquence nucléotidique de l’ARN messager.

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 11

Position du codon ARNm Normal ARNm avec Mutation X Suppression de 3 nucléotides ARNm avec Mutation Y Remplacement de 2 nucléotides ARNm avec Mutation Z Remplacement d’1 nucléotide

1 ---------

2 GCU GCU GCU GCU

3 GUU GUU GUU GUU

4 GCU GCU GCU GCU

5 AAU AAU AAU AAU

6 AUC AU AUC AUC

7 UUU U UAG UUC

8 GGU GGU GGU GGU

Citer pour chacune des mutation X, Y et Z : - le type de mutation : - ses conséquences éventuelles sur le cadre de lecture : - ses conséquences éventuelles sur le peptide synthétisé :

4. REPLICATION ET REPARATION
4.1 On incube des extraits solubles de colibacilles contenant de l’ADN avec un mélange de dATP, dTTP, dGTP et dCTP marqués tous avec du 32P sur le phosphore . Après une période d’incubation, le mélange est traité à l’acide trichloracétique qui précipite l’ADN et laisse en solution les petites molécules. a. Si un des quatre précurseurs manque, on ne trouve pas de radioactivité dans le précipité. Commenter. b. Aurait-on trouvé de la radioactivité si c’était le phosphore ou qui avait été marqué ? c. Dans la chaîne synthétisée de manière continue suivante, où est l’erreur ? Comment cette erreur sera-t-elle corrigée ? Matrice (3’) C - G - T - A - C - A - A - A- C - C - T - G - G - T - T - ...... (5’) Néosynthètisé (5’) G - C - A - T - G - T - T- T- G - G - A - A - ...... (3’) d. Cette chaîne, sous l’influence des UV, peut présenter d’autres altérations. Lesquelles ? Comment seront-elles réparées ? 4.2 4.3 Quelles sont les caractéristiques principales de la télomérase? Compléter les propositions suivantes. a. L’enzyme responsable de la synthèse d’ADN dans la réplication comme dans la réparation est l’___________________. b. Lors de la réplication, la région active du chromosome est une structure en forme d’Y appelé une ______________________. c. L’enzyme qui scelle les brèches dans l’hélice lors de la synthèse et de la réparation de l’ADN s’appelle : l’_____________________ . d. Lors de la réplication de l’ADN, le brin fils synthétisé en continu s’appelle :___________, et le brin synthétisé de manière discontinue est appelé_______________ . e. Si l’ADN polymérase positionne un nucléotide incorrect à l’extrémité 3’, un domaine catalytique distinct possédant une activité_________________ enlève la base mal appariée. f. L’initiation de la synthèse d’ADN sur le brin à réplication discontinue requiert de petites_________________ fabriquées par une enzyme appelée__________________, qui a pour substrat des _______________________ . g. La séparation de 2 brins d’ADN au niveau de la fourche de réplication est catalysée par l’__________________, qui se déplace unidirectionnellemment le long de l’ADN grâce à l’énergie fournie par l’hydrolyse d’ATP ;
Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 12

h. Les________________, qui participent au relâchement de l’ADN, se lient à l’ADN simple brin de sorte que ses bases restent disponibles pour servir de matrice. k. Chez les bactéries et les levures, comme chez plusieurs virus infectant les cellules eucaryotes, on a montré que les fourches de réplication se forment au niveau de séquences particulières de l’ADN appelées__________________ l. Les________________peuvent être considérées comme des « nucléases réversibles » qui créent des cassures transitoires, soit monocaténaires (type I), soit bicaténaires (type II). 4.4 Compléter les propositions suivantes. a. La plupart des modifications spontanées de l’ADN sont rapidement éliminées par un processus de correction appelé la _____________________ ; il est exceptionnel que les mécanismes de maintenance échouent, et permettent une modification de séquence permanente, qui est appelée une ______________________. b. Deux modifications spontanées courantes de l’ADN sont : la ____________________ qui résulte d’une rupture des liaisons N-glycosidiques de l’adénine ou de la guanine au désoxyribose, et la _____________________ qui transforme la cytosine en uracile. c. Le processus de réparation des fragments d’ l’ADN implique trois étapes : les enzymes appelées __________________ reconnaissent et excisent la portion modifiée du brin d’ADN, les __________________ resynthétisent la région excisée, et l’______________________ comble l’espace laissé. d. La simple excision de base implique 3 enzymes : ______________________

5.

ALTERATIONS DU MATERIEL GENETIQUE ET

OUTILS DE BIOLOGIE MOLECULAIRE
5.1 Compléter la séquence palindromique : A G A T ? ? ? ? ? ? 5.2 ? ? ? ? ? ?

Etablir une séquence d'acide nucléique sur laquelle une endonucléase de restriction sera active. Si cette séquence était présente dans l'ADN d'une bactérie, serait-elle systématiquement coupée par l'endonucléase correspondante?

5.3

Séquençage d'un ADN par la technique de Sanger: a. Expliquez en quelques lignes le principe de la technique. b. Soit représenté ci-dessous sur la ligne, un segment d'ADN monobrin. Son séquençage est effectué par la technique de Sanger, avec une amorce XY. En examinant le schéma représentant une partie de l'autoradiogrmme du gel de migration, écrire : • la séquence nucléotidique lue directement sur ce schéma du film. • la séquence réelle du segment d'ADN monobrin correspondant.

A

G

C

T

sens de migration

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 13

5.4 Diagnostic d'une maladie génétique 5.4.1- Au cours de l’exploration d’une famille atteinte d’hypercalcémie hypocalciurique familiale, des mutations inactivatrices du récepteur sensible au calcium, (responsables d’une augmentation du niveau de calcémie à partir duquel la sécrétion de PTH et la réabsorption du calcium par le tubule rénal sont inhibées) ont été mises en évidence par la technique de séquençage de Sanger chez un sujet atteint de la maladie. a. En comparant les gels de séquence ci-contre d’un sujet normal et d’un patient atteint, dites où est située la mutation ? b. De quel type est-elle ? c. Quel est le mode probable de transmission de cette maladie ?

5.4.2 Pour rechercher la mutation chez les apparentés du sujet étudié, une étude par PCRRFLP a été pratiquée. a. Quel est le principe de cette méthode et son intérêt par rapport au southern blot ? b. Avec la séquence mutée apparait un site supplémentaire de digestion par l’enzyme de restriction BslI qui coupe le palindrome (imparfait) suivant : 5’ CCnnnnn/nnGG 3’ n= nucléotide indéterminé Fragment d’ADN amplifié de 504 pb: Séquence normale : "/"= site de coupure.
Bsl I 87 pb 313 pb Bsl I 104 pb

L’amplification par PCR de l’exon concerné du gène du récepteur du calcium, conduit à l’obtention d’un fragment de 504 paires de bases. Ce fragment est soumis ensuite à une digestion par BslI qui génère différents types de fragments (cf. schéma).

Séquence mutée : Bsl I 87 pb 133 pb Bsl I 180 pb Bsl I 104 pb

Sur l’arbre généalogique ci-contre est représenté le résultat de la migration sur gel d’agarose de ce produit de PCR, non digéré puis digéré par BslI, issu de l’amplification de l’ADN génomique des individus A, B, C et D. Lesquels de ces sujets présentent la mutation ?

B A
615 bp 492 bp 369 bp 246 bp 123 bp

C D

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 14

5.5

Vous voulez étudier un fragment d'ADN de 536 paires de base correspondant à la région régulatrice située en amont (5') du gène de votre protéine favorite. Cette séquence est la suivante :

Brin sens : 5' GATTCAGGAGATTCACAC - - 500 nucléotides - - TCGGTACAGCTATACAGG 3' Brin antisens: 3' CTAAGTCCTCTAAGTGTG - - 500 nucléotides - - AGCCATGTCGATATGTCC 5'
5.5.1 Parmi les 8 amorces suivantes quelles sont les 2 amorces (à désigner par leurs lettres) qui permettront l'amplification par PCR de ce fragment ? a) b) c) d) e) f) g) h) 5' GA TTC AG G AGATTC AC AC 3' 5' C T AAG TC C TC TAAG TG TG 3' 5' C A C AC TTA GAGGAC TTAG 3' 5' TC GGTAC A G C TATA C AGG 3' 5' AG C C ATG T C G ATAT G TC C 3' 5' G T G TG AAT C TC C TG AATC 3' 5' C C TGTATA GC TGTA C C G A 3' 5' G G AC ATAT C G AC AT G G C T 3'

5.5.2 Décrire brièvement mais précisément les différents ingrédients requis et le principe de base de cette méthode de PCR. 5.5.3 Quelle expérience simple vous permettra de savoir si l'amplification spécifique de votre fragment a réussi. 5.6 Les ARN extraits du cytosol de différents tissus sont analysés par la technique dite du "Northern" en utilisant comme sonde un oligonucléotide correspondant à une partie du premier exon du gène de la calcitonine (hormone hypocalcémiante).

Thyroïde Cerveau Foie

Rein

Muscle

Rate
Sens de migration

a. Interprétez cette image en indiquant les différentes hypothèses possibles. b. Lorsque la même expérience est réalisée sur des ARN nucléaires de thyroïde ou de cerveau, on observe surtout des bandes très faibles et diffuses, de plus haut poids moléculaire qu'en partant d'ARN cytosolique. A quoi correspondent-elles ? 5.7 La question porte sur un gène codant une protéine humaine synthétisée exclusivement par le foie. Vous devez étudier un segment d’ADN codant de ce gène, dont la séquence la plus fréquente dans la population générale est la suivante :
5’ ACT AAG GCA AAA TTC CGA GAG GCC CTA GAA GAT ACA CGA 3’

La première étape de l’étude va consister à amplifier, à partir de l’ADN génomique, la totalité de ce segment par PCR (Réaction de Polymérisation en Chaîne). 5.7.1 Pouvez-vous utiliser indifféremment l’ADN extrait de cellules sanguines, de la peau, du foie ou d’autres tissus pour cette étude ? 5.7.2 Vous devez synthétiser des amorces oligonucléotidiques dont la longueur vous est imposée : chacune d’elles doit comporter 9 nucléotides. Compte tenu de cet impératif, donnez la séquence de chacune des amorces.
Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 15

5.7.3 Outre l’ADN génomique et les amorces oligonucléotidiques, vous devrez ajouter au milieu de la réaction, une enzyme et les molécules précurseurs nécessaires à la synthèse d’ADN. • Citez le nom de l’enzyme. • Citez le terme générique qui désigne l’ensemble des molécules précurseurs nécessaires à la synthèse d’ADN . 5.7.4 Décrivez en une phrase chacune des 3 étapes qui se répète à chaque cycle de PCR : 5.7.5 Un polymorphisme de restriction Hae III bi-allélique de ce gène, résulte d’une substitution C T qui fait disparaître le site de restriction Hae III (GGCC) dans l’ADN de 5 % des sujets, comme cela est schématisé ci-dessous : Pour étudier ce polymorphisme, le fragment amplifié par PCR est soumis à une digestion enzymatique par Hae III, puis à une électrophorèse. Sachant que l’enzyme HaeIII coupe sans décalage l’ADN double brin entre GG et CC, indiquez quels sont le nombre et la taille du ou des fragments obtenus par électrophorèse, chez chacun des trois sujets suivants: Homozygote pour la version allélique fréquente. Homozygote pour la version allélique rare. Hétérozygote.

• • •

5.7.6 Existe-t-il des différences dans la séquence protéique correspondant à ce segment d’ADN (dont les codons sont représentés sur la figure) entre les 3 sujets ? Comment qualifiez-vous dans ce cas, la substitution C T? 5.7.7 Chez un sujet donné la même séquence correspondant à ce segment d’ADN, pourra-telle être détectée • dans une préparation d’ADN complémentaire de son foie? • dans une préparation d’ADN complémentaire de ses cellules sanguines? Justifiez vos réponses. 5.8 Ci-dessous est représenté un gène de ménage (dont l’expression est, par définition, ubiquitaire) qui code une enzyme humaine E.

5.8.1. Combien ce gène comporte d’introns ? 5.8.2. Si la taille de chaque intron est de 10 kpb, et celle du promoteur de 100 pb, quelle est, sans compter d’autres séquences régulatrices éventuelles, la taille du gène ? 5.8.3. Si tous les exons sont conservés au cours de l’épissage, quelle sera, sans compter la coiffe et la queue poly A, la taille du transcrit primaire et la taille de l’ARN messager ?

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 16

5.8.4. En adoptant la même représentation que celle du gène de l’enzyme E, représentez la structure du transcrit primaire, celle de l’ARNm et celle d’un ARNm qui résulterait d’un épissage alternatif de votre choix ? Pour chacune des trois molécules, positionnez s’il y lieu, la coiffe et la queue polyA, en abrégé. 5.8.5. a) Quel est le nom de la molécule complète qui constitue la coiffe ? b) Quel est le nom de chacune des molécules simples qui composent la coiffe ? c) Citez deux fonctions de la coiffe 5.8.6. Que signifie polyA ? 5.8.7. Quelle est la taille totale des séquences codantes du gène qui code l’enzyme E ? 5.8.8. Quel est le nombre d’acides aminés de l’enzyme E ? 5.8.9. Compte tenu des éléments dont vous disposez sur le schéma, quelle est la séquence d’acides aminés en N-et en C-terminal de la protéine ? 5.8.10. Une paire d’amorces correspondant aux deux séquences nucléotidiques indiquées sur le schéma, est utilisée pour réaliser une amplification par PCR, d’ADN complémentaire (ADNc). a) Pouvez-vous utiliser l’ADNc de n’importe quel tissu de l’organisme (entourez) Justifiez en une phrase votre réponse Quelle est la taille attendue du fragment amplifié ? b) Pour réaliser la PCR, quels sont les réactifs que vous devez ajouter au milieu qui contient déjà l’ADNc à amplifier et les amorces ? c) Combien de températures différentes utiliserez-vous pour chaque cycle de PCR ? 5.8.11. Vous analysez la séquence de l’extrémité 3’ du premier exon par méthode enzymatique. Vous disposez pour cela de l’ADN complémentaire et d’une amorce simple brin ATg gCA a) Indiquez le nom complet et le nom abrégé (entre parenthèses), du nucléotide spécifique qui a été utilisé pour réaliser la réaction de séquençage dont le produit a été déposé dans chacun des 4 puits du gel d’électrophorèse représenté ci-dessous (voir b) b) Représentez l’emplacement attendu des bandes sur le gel d’électrophorèse (en noircissant les cases correspondantes)

5.9. Un gène de 10 kilobases (Kb) a subi une mutation au niveau d’un seul nucléotide : remplacement d’une cytosine par une guanine. On cherche à identifier la mutation en soumettant le gène normal et le gène muté à l’action d’une série d’ endonucléases de restriction (étudiées indépendamment). Après électrophorèse en gel d’agarose, on obtient les résultats suivants exprimés en kb (précision de la méthode + 0,05 kb)
Enzyme utilisée EcoR I Bgl II Pst I Sac I Spécificité GAATTC AGATCT CTGCAG GAGCTC Gène normal 7,4+2,6 10 6+4 10 Gène muté 7,4+2,6 10 10 6+4

a- Quelles sont vos conclusions en ce qui concerne l’effet de chaque enzyme sur chaque gène ? b- A la lumière de ces conclusions, reconstituez une séquence de 9 nucléotides en précisant le siège de la mutation.

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 17

6. QCM
1. Structure des acides nucléiques
1 Un nucléotide, compris dans la structure d’un acide ribonucléique a tous les caractères suivants sauf un, indiquer lequel : a. Il contient toujours des atomes de carbone, d’hydrogène, d’oxygène, de phosphore et d’azote b. Il contient trois fonctions acides dont deux estérifiées c. Il contient une liaison N-osidique d. Il contient une base azotée, purine ou pyrimidine e. Il contient un ose à six carbones (hexose) 2 Dans la structure d’un ADN normal, toutes les structures ci-contre existent, sauf une, indiquer laquelle : a. d. b. e. c c. Le désoxyribose correspond à une molécule de ribose dans laquelle le OH en position 3' est remplacée par un H. d. Dans une molécule d'ADN, le caractère polyanionique est dû à l’ionisation du résidu phosphate. e. Les deux chaînes d'une molécule d'ADN sont anti-parallèles. 6 Toutes les affirmations concernant la structure de l’ADN, ci-dessous sont vraies sauf une, indiquer laquelle : a. Les molécules d’ADN sont formées de 2 chaînes anti-parallèles. b. Les bases azotées liées 2 à 2 par des liaisons hydrogènes sont tournées vers l’extérieur c. Les bases azotées sont parallèles entre elles, leurs noyaux empilés comme des assiettes. d. Les désoxyriboses et les phosphates se trouvent à l’extérieur de la molécule d’ADN. e. Chaque nucléosome est constitué d’un fragment d’ADN de 145 nucléotides et de 8 molécules d’Histones. La base azotée représentée ci-dessous

7

3

Dans la structure du fragment d'ADN représenté par la séquence A C T C , il y a toutes les liaisons, fonctions, molécules simples ou groupes d'atomes suivants, sauf un, indiquer lequel : a. Quatre liaisons N-osidiques b. Quatre ß-D-riboses c. Un noyau purine d. Trois fonctions amine primaire libres e. Deux cytidines Dans l'ADN, indiquez le ou les couple(s) de trinucléotide(s) complémentaire(s) en tenant compte des conventions d'écriture des séquences (c'est-à-dire de 5' vers 3') a. AAC et GTT b. AAC et TTG c. CAT et GTA d. CAT et ATG e. CTA et GAT

a. est une base purique b. est la thymine c. s’apparie à une base pyrimidique dans la double hélice d’ADN d. forme 3 liaisons « hydrogène » avec la base complémentaire à laquelle elle s’apparie dans la double hélice d’ADN e. peut être méthylée dans l’ADN génomique 8 Le nucléotide composé représenté cidessous
NH2 N N

4

O O P OO

O P OO

O P OO CH2 O N N

OH

OH

5 Dans l'ADN, quelles sont les propositions justes a.Les bases G et C sont appariées par deux liaisons hydrogènes. b.Les bases pyrimidiques sont appariées entre elles.

a. est l’adénosine triphosphate b. contient du désoxyribose c. possède 2 liaisons riches en énergie d. possède 2 liaisons « phosphoester » e. sert de précurseur à la synthèse d’ARN

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices de Biochimie / PCEM1

Biologie Moléculaire / 18

2. Transcription
1 Un épissage alternatif à partir du site donneur de l’intron 2 dans un gène à 7 exons peut aboutir à tous les messagers suivants, sauf un, indiquer lequel:

6 2 Parmi les propositions suivantes concernant la séquence de tous les ARN messagers, lesquelles sont exactes a. elle débute par un codon AUG b. elle se termine par un site de polyadénylation c. elle est formée exclusivement d'une séquence codant une protéine d. elle possède à son extrémité 5' une coiffe formée d'un nucléotide à méthylguanosine e. elle contient toujours un codon stop Parmi les propositions suivantes sur la transcription certaines sont exactes, lesquelles? a. la transcription ne concerne que la production des ARN messagers b. la transcription des ARN de transfert est réalisée par l'ARN polymérase III c. la transcription utilise toujours les 2 brins du gène comme matrice, ce qui permet la production de 2 molécules d'ARN messager différentes d. la transcription nécessite l'ouverture de l'hélice d'ADN e. seuls les exons sont transcrits La transcription a. l’ARN polymérase II synthétise les ARN précurseurs des ARN messagers b. l’initiation de la transcription par l’ARN polymérase II nécessite l’assemblage d’un complexe de facteurs généraux de transcription sur le site promoteur du gène c. l’initiation de la transcription par l’ARN polymérase II n’est pas influencée par l’état de condensation de la chromatine d. les séquences d’ADN régulatrices peuvent être séparées du promoteur par plusieurs milliers de paires de nucléotides e.les facteurs de transcription peuvent se lier aux séquences d’ADN régulatrices par l’intermédiaire de liaisons hydrogène L’ARN messager chez les eucaryotes a.possède une séquence complémentaire du brin codant de l’ADN génomique b. ne comporte pas les introns c. peut comporter une partie seulement des exons d. est toujours entièrement traduit e. possède une longue répétition polyadénylique 7

Le facteur TFIID a. est un facteur de transcription. b. est nécessaire à l’activité de transcription de l’ARN polymérase II. c. se lie à une séquence d’ADN dans le promoteur des gènes. d. se lie à une séquence d’ADN qui peut être localisée à plusieurs milliers de paires de nucléotides du site d’initiation de la transcription. e. se lie à l’ADN par l’intermédiaire de son petit sillon. Les ARN messagers (ARNm) a. sont toujours synthétisés dans le sens 5’ 3’ b. sont toujours traduits dans le sens 5’ 3’ c. comportent toujours tous les exons du gène d. ont toujours une coiffe 7-méthylguanosine triphosphate en 5’ e. ont toujours au moins un codon AUG Un exon a. est retrouvé sous forme de séquence d'ARN dans l'ARN messager. b. est une séquence d'ADN obligatoirement codante. c. est une séquence d'ADN présente en dehors des gènes. d. est un domaine protéique particulier de l'enveloppe de certains virus. e. code pour un nombre entier d'acides aminés. La transcription d'un gène codant une protéine a. a lieu sur les ribosomes. b. met en jeu l'ARN polymérase II. c. u t i l i s e des désoxyribonucléotides triphosphates. d. a lieu sur les deux brins. e. fait intervenir la fixation de facteurs transcriptionnels sur le promoteur.

3

8

4

9

5

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1 10 Transcription d'un gène par l'ARN polymérase II a. On appelle "région promotrice" l'ensemble des séquences d'ADN situées immédiatement en amont du site d'initiation de la transcription et contrôlant la transcription. b. Un même gène peut donner deux protéines différentes selon le tissu où il est transcrit. c. les séquences stimulatrices ou "enhancers" peuvent agir en trans. d. les séquences stimulatrices ou "enhancers" peuvent être situées dans un intron. e. les séquences stimulatrices ou "enhancers" peuvent être situées à plusieurs centaines de paires de bases en 5' d'un gène. 11 Parmi les propositions concernant les ARN messagers des eucaryotes a. Leur biosynthèse est sous le contrôle de facteurs TFII b. Ils sont codés par des gènes dont le promoteur est situé à l'intérieur de la région transcrite. c. L'excision des introns se fait dans le cytoplasme après fixation du pré-ARNm sur le ribosome. d. Au cours de l'excision-épissage se crée une liaison 2'-5' phosphodiester. e. La séquence poly A n'est pas traduite . 12 Toutes les affirmations concernant la transcription ci-dessous sont vraies sauf une, laquelle a. Le brin sens est le brin sur lequel la boîte TATA est du côté 3 ‘ de la boîte CAAT b. L’ARN polymérase I synthétise les ARN ribosomiques 28S, 18S et 5,8S c. L’ARN polymérase II synthétise les ARN messagers d. Les séquences cis-régulatrices sont reconnues par des facteurs protéiques transrégulateurs ayant des effets sur la vitesse de transcription e. L’excision-épissage est une étape de la maturation des transcrits primaires où les exons sont coupés de la structure primaire et les introns liés les uns à la suite des autres 13 Le transcrit primaire du gène de la lipoprotéinelipase comprend toutes les séquences ou structures suivantes, sauf une, indiquer laquelle a. Boîte TATA. b. Site donneur de l’intron 1. c. Codon de la Méthionine. d. A du branchement. e. Boîte AAUAAA de polyadénylation. 14 Le promoteur du gène de l’apolipoprotéine A-II contient toutes les séquences suivantes, sauf une, indiquer laquelle a. TGACTCA où vient se fixer un facteur transrégulateur de la famille AP-1 b. ATG où vient se fixer le tARN de la méthionine c. GGCCC où vient se fixer la protéine Sp1 d. TATA où vient se fixer la TATA binding protein e. CATCCAT où vient se fixer la CAAT binding protein

Biologie Moléculaire / 19 15 Au cours de la transcription, toutes les espèces chimiques suivantes ont un rôle à jouer sauf une, indiquer laquelle : a. RNA polymérase II b. ribonucléotides c. désoxy- thymidine triphosphate (dTTP) d. protéine liant la boîte TATA (TBP) e. guanosine triphosphate 16 Les propriétés suivantes sont toutes en accord avec la définition des exons et des introns chez les Eucaryotes, sauf une, indiquer laquelle : a. l’exon est une séquence de nucléotides b. l’intron est compris entre 5’GT (site donneur) et AG 3’ (site receveur) c. la queue poly A ne fait partie d’aucun exon d. les introns sont transformés en lassos, puis détruits par la ribonucléase e. un exon est toujours situé entre deux introns 17 Au cours de la transcription d’un gène actif en période de jeûne, les facteurs suivants s’unissent deux à deux comme indiqué, sauf dans un cas, indiquer lequel : a.Le récepteur des glucocorticoïdes + le cortisol avec le Glucocorticoid Responsive Element (GRE) b. La RNA polymérase II avec le brin sens du gène à transcrire c. Une adénine du brin antisens avec un uracile du transcrit primaire d. Une sous-unité de la protéine TFIID avec la séquence TATA du promoteur e. Un nucléotide triphosphate avec l’extrémité 3’OH terminale du transcrit en cours de synthèse 18 La fin de la transcription est le résultat de tous les évènements suivants sauf un, indiquer lequel : a. l’ARN polymérase (RNA polymerase) a synthétisé un ARN contenant la séquence AAUAAA b. l’ARN polymérase (RNA polymerase) s'est dissociée de l’ADN c. l’ARN polymérase (RNA polymerase) a lu la séquence TTATTT sur le brin antisens du gène transcrit d. l’ARN polymérase (RNA polymérase) a reconnu un codon de terminaison e. l’ARN polymérase (RNA polymerase) ne synthétise plus de liaisons et le transcrit primaire est coupé à son extrémité 3’OH terminale 19 L’ARN messager mature a passé par toutes les étapes suivantes après la transcription, sauf une, indiquer laquelle : a. Le premier nucléotide de l’exon 3 a été hydrolysé de sa liaison avec le site donneur de l’intron 2 b. Il a traversé la membrane nucléaire c. Son extrémité 3’-OH a été allongée de plus de 1000 nucléotides d. Son extrémité 5’-phosphate a été complètée d’un nucléotide e. Sa séquence codante est devenue unique et continue

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1

Biologie Moléculaire / 20 5 Au cours de l’élongation, du début d’une protéine, un ribosome se trouve successivement dans les deux états ci-dessous

3. Traduction
1 Au cours du cycle d’initiation de la traduction, toutes les liaisons suivantes sont essentielles pour déterminer le cadre de lecture exact, sauf une, indiquer laquelle : a. Fixation d’un Met-ARNtMet dans le site peptidique b. Liaison du l’uracile du codon AUG avec le deuxième nucléotide de l’anticodon c. Liaison de la guanine du codon AUG avec le troisième nucléotide de l’anticodon d. Présence des trois nucléotides suivants (en 3’ du codon AUG) dans le site acide aminé du ribosome e. Liaison du fragment 5’-non-codant de l’ARNm avec les ARNr et protéines du ribosome 2 La lysyl-tRNA synthétase reconnaît spécifiquement tous les ligands suivants, sauf un, indiquer lequel : a. ARNt dont la boucle centrale porte l’anticodon UUU b. ATP ++ c. ion Mg d. Lysine e. ARNt dont la boucle centrale porte l’anticodon AAA 3 La tryptophanyl-tRNA synthétase possède toutes les propriétés suivantes sauf une, indiquer laquelle : a. elle possède un site de liaison spécifique du tryptophane b. elle reçoit de l’énergie lors de l’hydrolyse de l’ATP c. elle transfère spécifiquement le tryptophane sur le peptide au cours de la traduction d. elle active le tryptophane en le liant à un ARNt e. elle n’est active qu’en présence d’un ARN comprenant deux séquences 5’CCA 3’, à deux endroits différents de sa structure primaire 4 Toutes les liaisons suivantes sont hydrolysées ou rompues au cours de l’élongation d’une protéine, à chaque acide aminé incorporé, sauf une, indiquer laquelle : a. Liaison ester à l’extrémité 3’-OH de l’ARNt du site peptidique b. Liaison anhydride d’acides entre les phosphates du GTP lié au ribosome et au facteur eEF2 lors de la translocation du messager c. Liaisons hydrogène entre l’anticodon de l’ARNt devenu libre du site peptidique et le codon de l’acide aminé incorporé à l’étape précédente d. Liaison anhydride d’acides entre les phosphates du GTP fixé sur le facteur eEF1 e. Liaison amide entre l’extrémité COOH-terminale du peptide en cours de synthèse et la fonction amine de l’acide aminé incorporé

a. site P : ARNt~Val-COOH; site A : ARNt~Leu-Phe-Leu-Ala-Met-NH2 b. site P : ARNt non chargé ; site A : ARNt~Val- Met -Ala- Leu-Phe-Leu -NH2 c. site P : ARNt~Val- NH2; site A : ARNt~Leu-Phe-Leu-Ala-Met -COOH d. site P : ARNt non chargé; site A : ARNt~Val-Leu-Phe-Leu-Ala-Met-NH2 e. site P : ARNt~Val-Leu-Phe-Leu-Ala-Met- NH2; site A : ARNt non chargé 6 Au cours de la traduction de l'extrémité 5'terminale d'un messager dans un polyribosome lié, une ribonucléoprotéine du cytoplasme (Signal Recognition Particle = SRP) provoque tous les effets suivants, sauf un, indiquer lequel a. Transport et fixation du ribosome sur la ribophorine b. Arrêt de l'élongation de la protéine traduite c. Liaison spécifique de cette ribonucléoprotéine avec un récepteur du reticulum endoplasmique. d. Synthèse d'un chaînon d'acides aminés hydrophobes à l'extrémité NH2-terminale de la protéine traduite. e. Liaison spécifique de cette ribonucléo-protéine avec les acides aminés hydrophobes de l'extrémité NH2-terminale de la protéine traduite. 7 L'incorporation d'un acide aminé libre comme la leucine, dans la structure primaire d'une protéine en cours d'élongation requiert l'hydrolyse des liaisons riches en énergie suivantes, sauf une, indiquer laquelle : a. ATP AMP + pyrophosphate b. peptidyl-tARN tARN + peptide transféré sur la leucine c. GTP-eEF1 GDP-eEF1 d. GTP GDP + phosphate e. ATP ADP + phosphate 8 Le méthionyl-ARNt a. est nécessaire à l’initiation de la traduction b. comprend l’ARNt dont l’anticodon est 5’ CAU 3’ c. est synthétisé par une réaction enzymatique couplée à l’hydrolyse de 4 liaisons riches en énergie d. est synthétisée par une aminoacyl-ARNt synthétase spécifique de la méthionine e. comporte une liaison ester riche en énergie nécessaire à la formation d’une liaison peptidique entre la méthionine et un autre acide aminé

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1

Biologie Moléculaire / 21 e. La mobilisation du peptidyl-tRNA du site A au site P sur le ribosome est rendue possible par l'hydrolyse de L'ATP 15 Toutes les affirmations concernant la traduction ci-dessous sont vraies sauf une, laquelle a. L’ARN messager mature est toujours traduit dans sa totalité b. Le codon de terminaison de la traduction est UGA c. Le code génétique est fondé sur des mots de 3 lettres les codons d. Le codon de l’ARN m AUG est complémentaire de l’anticodon CAU de l’ARNt e. Le bilan énergétique de la traduction est fonction du nombre d’acides aminés incorporés dans la protéine. 16. Toutes les affirmations concernant la traduction ci-dessous sont vraies sauf une, laquelle a. Le signal peptide est un peptide d’adressage situé à l’extrémité NH2-terminale des protéines à excréter b. L’acylation du peptide néosynthétisé est une modification post– transcriptionnelle du peptide c. Le ribosome catalyse le transfert du peptide situé sur l’ARNt du site P sur la fonction amine de l’acide aminé de l’ARNt du site A. Il utilise l’énergie de la liaison riche en énergie entre le peptide et l’ARNt du site P d. Le complexe ribosomique qui se dissocie de l’ARN messager, nécessite un cofacteur eRF lorsque le site A se trouve en regard d’un codon non sens e. La séquence 5’ non traduite de l’ARN messager est reconnue par des cofacteurs eIF4A, eIF4B et eIF4F qui s’y fixent

9 Les ARN de transfert (ARNt) a. représentent le type d’ARN le plus abondant de la cellule b. sont au nombre de 20 c. chacun d’entre eux se lie à un seul aminé d. chacun d’entre eux se lie à un seul codon e. se lient aux acides aminés par l’intermédiaire d’une liaison riche en énergie 10 Quel est (ou quels sont) le(s) triplet(s) nucléotidique(s) du (ou des) anti-codon(s) du (ou des) ARNt Glu s'appariant avec les codons de l'acide glutamique GAA et GAG? a. CUU b. CUC c. UUC c. TTC c. CTC

11 Indiquez la ou les propositions exactes a. La fixation du complexe acide aminé ARNt sur l'ARN messager se fait par l'acide aminé. b. Il existe trois triplets différents codant la fin de la synthèse d'une chaîne peptidique. c. Le codon initiateur de la traduction code toujours pour la méthionine. d. Chez les eucaryotes, la transcription et la traduction ont lieu dans le même compartiment cellulaire. e. La transcription d'un gène se fait dans le sens 5' -------> 3'. 12 Parmi les codons suivants quels sont les 2 qui correspondent au codon d'initiation de la traduction d'une part et à l'un des codons de terminaison de chaîne protéique d'autre part? a. AUC b. AUG c. UAG d. GAU e. UAC 13 La séquence nucléotidique de l'anticodon d'un ARNt est 5' -CCU - 3' quelle est dans la séquence suivante d'un ARN messager le triplet nucléotidique qui pourra s'apparier à l'anticodon?

4. Réplication et réparation
1 La DNA-polymérase a toutes les activités suivantes au cours de la réplication d'un fragment de chromosome sauf une, indiquer laquelle : a. elle ajoute un nucléotide en liant son phosphate à la fonction alcool en 3' d'un brin d'ADN qu'elle synthétise b. elle hydrolyse les amorces du brin "retardé" en commençant par leur côté 5' c. elle ajoute un nucléotide en liant sa fonction alcool en 3' au phosphate 5' terminal d'un brin d'ADN qu'elle synthétise d. elle hydrolyse l'ARN des amorces du brin "avancé" en commençant par leur côté 5' e. elle ajoute un nucléotide en liant le phosphate à la fonction alcool en 3' d'une amorce d'ARN créée par la DNA-primase

a. b. c.

d. e.

14 Synthèse protéique : a. La synthèse protéique débute par l'aa N terminal et se termine par l'aa C terminal b. Les acides aminés sont activés par une liaison ester aux molécules d'ARN t c.La terminaison d'une synthèse protéique requiert la liaison d'un t RNA terminateurs à un codon stop du mRNA d. On trouve de la thymine dans la majorité des tRNA Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1 2 La synthèse du brin retardé par l'ADN polymérase se distingue de celle du brin rapide par toutes les différences suivantes, sauf une, indiquer laquelle : a. elle consomme moins de désoxyribonucléosides triphosphates b. elle fait intervenir beaucoup plus souvent les enzymes ADN-primase et ADN-ligase c. elle engendre la production des fragments d'Okazaki d. elle fait appel à des amorces plus nombreuses e elle se fait à contre-sens du déplacement de l'enzyme sur l'ADN 3 L'ADN polymérase humaine est capable de toutes les activités enzymatiques suivantes, sauf une, indiquer laquelle : a.Condensation du phosphate d'un désoxyribonucléotide sur la fonction 3' alcool libre d'un brin d'ADN hybridé à un autre brin servant de modèle b. Hydrolyse de la liaison anhydride entre le premier et les deux autres phosphates d'un désoxyribonucléoside triphosphate c. Condensation du phosphate du désoxyribonucléotide 5' initial d'un brin d'ADN avec le désoxyribonucléotide 3' terminal d'un autre brin d'ADN d. Hydrolyse du désoxyribonucléotide 3' terminal d'un brin d'ADN e. Hydrolyse du ribonucléotide 5' initial d'un ARN 4 L'ADN polymérase catalyse toutes les réactions suivantes, sauf une, indiquer laquelle : a. réparation d'une brèche étendue sur un ADN double brin lésé. b. synthèse d'une liaison ester entre un nucléoside triphosphate et l'extrémité 3'-OH d'un brin d'ADN c. hydrolyse de la liaison ester entre le dernier et l'avant-dernier nucléotides à l'extrémité 3'-OH d'un brin d'ADN d. hydrolyse de la liaison ester entre le premier et le deuxième nucléotides à l'extrémité 5'-phosphate d'un ARN e. synthèse de la liaison ester entre l'extrémité 3'OH d'un brin d'ADN et l'extrémité 5'-phosphate d'un autre brin d'ADN 5 Au cours de la réplication de l’ADN, l’incorporation d’un désoxyribonucléotide a. est catalysée par une ADN polymérase b. consomme l’énergie fournie par l’hydrolyse de deux liaisons riches en énergie c. peut avoir lieu à l’extrémité 3’-OH ou 5’-OH d’un brin amorce d’ADN d. peut avoir lieu à l’extrémité 3’-OH ou 5’-OH d’un brin amorce d’ARN synthétisé par une primase e. peut avoir lieu à l’extrémité 3’-OH d’un brin amorce d’ARN synthétisé par une télomérase Les ARN polymérases et les ADN polymérases ont en commun les caractéristiques suivantes a. catalysent l’addition d’unités nucléotidiques dans le sens 5’ 3’ b. catalysent la formation de liaisons « phosphodiester » c. nécessitent une chaîne polynucléo-tidique matrice d. nécessitent une chaîne polynucléo-tidique amorce e. possèdent une activité exonucléasique 3’ 5’

Biologie Moléculaire / 22 7 Les principes et mécanismes généraux de la réplication a. Il est nécessaire d'ouvrir la molécule d'ADN en un point précis pour procéder enzymatiquement à sa réplication in vivo. b La synthèse d'un brin nouveau d'ADN nécessite toujours la fabrication préalable d'une amorce d'ARN. c. Il existe au niveau d'une fourche de réplication, deux molécules d'ADN polymérases à fonctionnement simultané mais différent, l'une allongeant un brin d'ADN dans le sens 5' --->3' et l'autre allongeant l'autre brin dans le sens 3'--->5'. d. Le brin dit "précoce" est celui à synthèse discontinue et le brin dit "tardif" est celui à synthèse continue. e. Dans une boucle de réplication, les deux fourches progressent en direction opposée, à la même vitesse. 8 L'enzymologie de la réplication a. La primase est une catégorie d'ARN polymérase spécialisée dans la synthèse des amorces d'ARN sur le brin à synthèse discontinue. b. La destruction des amorces d'ARN sur le brin retardé est effectuée par l'enzyme nommée ligase. c. On appelle "ADN hélicase" la protéine séparant les deux brins appariés de la molécule d'ADN à répliquer, au niveau de la pointe de chaque fourche. d. Les enzymes de relaxation, fonctionnant en amont des fourches, suppriment les contraintes mécaniques induites par la progression de la réplication le long de l'ADN. e. Les protéines dites de "stabilisation" se fixent sur les deux double hélices récemment synthétisées pour les protéger de l'action des nucléases. 9 Quelle est l'activité enzymatique, retrouvée chez la plupart des ADN polymérases, qui leur permet d'assurer une très grande fidélité de la réplication? a. Activité d'exonucléase 3' ----> 5' b. Activité d'exonucléase 5' ----> 3' c. Activité de polymérase d. Activité d'endonucléase e. Activité de synthèse d'amorce 10 La réplication de l'ADN des eucaryotes a. u t i l i s e des désoxyribonucléotides triphosphates. b. fait intervenir de l'ARN. c. débute en un seul site. d. met en jeu des ADN polymérases bidirectionnelles. e. est semi-conservative. 11 Au cours de la réplication a. la croissance de la chaîne se fait toujours dans le sens 5' ----->3' b. les deux brins de l'ADN se séparent grâce à des protéines. c. les précurseurs sont les désoxyribonucléotides pour un brin et les ribonucléotides pour l'autre. d. il y a un épissage de l' ADN néoformé. e.la synthèse est continue pour un brin d'ADN et discontinue pour l'autre.

6

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1 12 On rencontre des acides nucléiques hybrides (brins de ribonucléotides et de désoxyribonucléotides liés de façon antiparallèle et complémentaire) dans toutes les circonstances suivantes sauf une, indiquer laquelle : a. entre l'amorce et le brin avancé de DNA au cours de la réplication b. au cours de la transcription inverse du RNA viral c. entre un élément cis-régulateur et un facteur trans-régulateur d. entre l'amorce et le brin retardé de DNA au cours de la réplication e. dans le site catalytique d'une RNA polymérase 13 Toutes ces affirmations concernant la réplication sont vraies sauf une, laquelle : a Les 2 brins de l’ADN parental servent chacun de modèle pour la synthèse d’un nouveau brin au cours de la réplication b. L’hélicase sert à stabiliser les brins séparés c. Les ADN Polymérases ont une activité exonucléasique d. Le Mg++ est essentiel pour l’activité des ADN polymérases e. L’ADN Polymérase est associée à la primase et L’ADN Polymérase est la principale enzyme de réplication en synthétisant sur le brin direct aussi bien que sur le brin retardé 14 Toutes les affirmations concernant la réplication et la réparation ci-dessous sont vraies sauf une, laquelle : a. La télomérase est une ADN polymérase qui peut continuer la synthèse d’un ADN simple brin ; b. Une structure avec entrecroisement de brins de 2 ADN homologues est appelée structure Holliday c. Le remplacement d’un A par un G est une transition d. Le remplacement d’un C par un T est une transversion e. Une mutation somatique n’est pas transmissible à la descendance d’un sujet

Biologie Moléculaire / 23 b. insertion d’un C dans le codon CCC d’une proline c. délétion de la boîte TATA d. transversion dans le codon d’un acide aspartique e. délétion du site receveur du dernier intron 3 Parmi les mutations nucléotidiques lesquelles vont changer la séquence en acides aminés de la protéine? a. mutation silencieuse b. mutation faux sens c. mutation non sens d. mutation somatique e. mutation conservatrice 4 Parmi les propositions suivantes concernant le séquençage de l'ADN par la méthode de Sanger, lesquelles sont exactes? a. les réactions parallèles de séquençage ne diffèrent entre elles que par la nature du didéoxynucléotide b. l'ADN à séquencer doit être sous forme double brin c. les réactions de séquence sont des réactions de polycondensation de l'ADN d. chacune des 4 réactions parallèles de séquence se fait en présence d'un seul nucléotide e. la région séquencée est déterminée par la matrice d'ADN et non l'amorce 5 Classer dans l’ordre les étapes de la méthode du « Southern blot » 1 - Electrophorèse 2 - Hybridation 3 - Transfert sur membrane 4 - Digestion de l’ADN par une enzyme de restriction 5 - Autoradiographie a. 4 – 3 – 1 – 2 – 5 b. 1 – 4 – 3 – 5 – 2 c. 4 – 1 – 3 – 2 – 5 d. 2 – 5 – 3 – 4 – 1 e. 1 – 4 – 5 – 3 – 2 6 L’ADN complémentaire a. l’ADN complémentaire est synthétisé par transcriptase inverse à partir d’ARN messager b. les banques d’ADN complémentaire sont identiques quel que soit le tissu humain (foie, poumon, cœur, rein…) à partir duquel elles sont préparées c. les banques d’ADN complémentaire préparées à partir de différents tissus humains (foie, poumon, cœur, rein…) ont en commun les séquences correspondant aux gènes domestiques d. la séquence en acides aminés d’une protéine peut être déterminée à partir d’une séquence d’ADN complémentaire e. la séquence d’un intron peut être déterminée à partir d’une séquence ADN complémentaire 7 Parmi les enzymes suivantes, laquelle ou lesquelles sont utilisées dans la technique de RT-PCR a. ligase b. ADN polymérase thermostable c. transcriptase inverse d. ARN polymérase e. hélicase

5. Altération du matériel génétique et outils de biologie moléculaire
1 Dans la séquence suivante du gène d’une protéine CAGGCCGAGGCCAAAGTAAATCTCA correspondant à l’extrémité 3’ de l’exon 3, qui se traduit par Gln Ala Glu Ala Lys, indiquer quelle transition G A (nucléotides soulignés) est susceptible d’entraîner un empêchement de l’excision épissage de l’intron 3 de cette protéine : a. CAAGCCGAGGCCAAAGTAAATCTCA b. CAGGCCGAGGCCAAAATAAATCTCA c. CAGACCGAGGCCAAAGTAAATCTCA d. CAGGCCGAGACCAAAGTAAATCTCA e. CAGGCCGAAGCCAAAGTAAATCTCA 2 Toutes les lésions moléculaires suivantes peuvent se traduire par un caractère ou une maladie chez l’enfant qui les reçoit dans son patrimoine génétique, sauf une, indiquer laquelle : a. transition G A dans un codon de terminaison Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1 8 Les didésoxyribonucléosides triphosphates a. possèdent trois liaisons riches en énergie b. ne possèdent pas de groupement OH en 3’ c. peuvent être incorporés par l’ADN polymérase à l’extrémité 3’-OH d’un brin d’ADN d. empêchent l’extension du brin d’ADN dans lequel ils sont incorporés e. peuvent être utilisés dans les techniques de séquençage de l’ADN 9 La transcriptase inverse a. est une ADN polymérase ARN dépendante . b. est une enzyme qui permet l'entrée d'un rétrovirus dans la cellule hôte. c. est utilisée pour la synthèse in vitro d'ADNc. d. a été isolée à partir d'un virus à ARN. e. est une enzyme qui permet la synthèse d'ADN à partir d'ARN. 10 Parmi les propositions concernant la technique de Southern, a. fait obligatoirement intervenir une ADN polymérase b. permet l'analyse des ARN messagers exprimés dans un tissu ou une cellule c. on peut utiliser comme sonde un oligonucléotide de synthèse d. On peut utiliser comme sonde un fragment d'ADN simple brin de séquence inconnue. e. permet de détecter des mutations 11 Parmi les propositions concernant la PCR a. permet l'amplification de fragments d'ADN de séquence complètement inconnue b. nécessite des amorces ARN. c. deux amorces différentes sont nécessaires d. fait intervenir une ADN-ligase e. l'élongation par la Taq-polymérase se fait à 72°C 12. Un ADNc est: a. une séquence fabriquée in vitro pour des besoins expérimentaux. b. une séquence ne contenant aucune information autre que celle qui est présente dans un ARN messager mature c. une séquence contenant l'ensemble des exons et des introns. d. une séquence dont on peut déduire une séquence polypeptidique. e. une séquence naturellement présente dans le génome humain. 13 Les enzymes de restriction a. interviennent dans la réplication. b. ont une fonction chez les bactéries d'où on les extrait. c. reconnaissent le plus souvent des palindromes. d. coupent l'ADN simple brin. e. peuvent couper un ADN circulaire.

Biologie Moléculaire / 24

14 L'autoradiographie d'un gel de polyacrylamide réalisée pour déterminer la séquence d'un fragment d'ADN selon la méthode de Sanger est représentée ci-contre. Chaque indication figurant sur le schéma en haut du gel: G, A, T, C correspond à l'incubation en présence d'un des 4 didéoxynucléotides triphosphate. Quelle est la séquence de 5' vers 3' du fragment d'ADN matrice?

a. 5'-T A C C T A G A C A T T G G T A C C C - 3' b. 5'-G G G T A C C A A T G T C T A G G T A -3' c. 5'-A T G G A T C T G T A A C C A T G G G -3' d. 5'-C C C A T G G T T A C A G A T C C A T - 3' e. 5'-T A C C T A C A C A T T G G T A C C C - 3' 15 La télomérase a. synthétise une séquence répétée d’ADN b. utilise une matrice d’ADN c. utilise comme amorce l’extrémité 3’-OH d’un brin d’ADN d. utilise une matrice d’ARN e. utilise comme amorce l’extrémité 3’-OH d’un brin d’ARN 16 La délétion d’un codon entier dans l’ADN génomique a. est une mutation ponctuelle b. peut entraîner une modification de la séquence peptidique c. peut modifier le cadre de lecture d. peut affecter l’excision-épissage d’un intron e. peut introduire un codon stop

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1

Biologie Moléculaire / 25

7. Annales 2005
QCM 1. La figure suivante représente un fragment d’acide nucléique de quatre nucléotides.
O C HN O - O P O H O CH 2 C H C O - O P O H O O H C H CH 2 C H C O - O P O H C H N HC N O H C H O C H H2N CH 2 C H C O - O P O H O O H C H CH 2 C H C O O H C H C H C H O HN C N N C NH O C N NH2 C C C N O C C C N N CH NH2 C CH CH N CH C CH CH 3

Ce fragment se situe dans une des deux séquences que voici : 5’-AAGCGGCTATAGCCGCTT-3’ 5’-UUCGCCUAUAGCGCGAA-3’ Quels sont dans cette séquence les cinq nucléotides suivants en allant du côté 3’ ? Indiquer ces cinq nucléotides parmi les propositions suivantes : a. CGCTT b. ATCGC c. CGCTA d. GCTAT e. GCGAA 2. Une mutation non-sens (CAG TAG) du gène de l’apolipoprotéine C-I (apoC-I) engendre une modification du site spécifique (CAG/CTG) de l’enzyme de restriction Pvu II. Parmi les techniques suivantes, toutes permettent de faire le diagnostic de la présence ou de l’absence de cette mutation chez un sujet, sauf une, indiquer laquelle a. extraction d’ARN + RT-PCR + digestion par Pvu II + électrophorèse avec BET b. extraction d’ADN + PCR + digestion par Pvu II + électrophorèse avec BET c. extraction d’ADN + PCR + électrophorèse + hybridation avec une sonde ASO d. extraction d’ARN + digestion par Pvu II + électrophorèse avec BET e. extraction d’ADN + digestion par Pvu II + Southern blot avec sonde du gène apoC-I ASO = allele specific oligonucleotide ; BET = bromure d’éthidium ; PCR = polymerase chain reaction ; RT = reverse transcription ; 3. Un polymorphisme du gène de l’apolipoprotéine CII (apoC-II) a été mis en évidence sur l’ADN des sujets après digestion par l’enzyme de restriction Taq I, puis électrophorèse et Southern blot révélé par une sonde cDNA de l’apoC-II. Le sujet n° 6 vu sur le film de l’autoradiographie a tous les caractères suivants sauf un, indiquer lequel : Faculté de Médecine Pierre & Marie Curie

a. il est le fils des sujets n° 1 et 3 b. il a un autre site de restriction Taq I, 300 pb plus loin c. il a un site de restriction Taq I de plus que les sujets n° 2 et 4 d. il est homozygote pour le fragment de restriction le plus court (3,5 Kb) e. il est homozygote pour le fragment de restriction le plus long (3,8 Kb) 4. Le promoteur du gène de l’apolipoprotéine A-II (apoA-II) contient toutes les séquences suivantes, sauf une, indiquer laquelle a. TGACTCA (élément cis-régulateur TRE) b. TATA (boîte TATA) c. CCAT (boîte CAT ou CAAT) d. GGCCC (boîte GC) e. ATG (codon d’initiation) 5 . Au cours de la transcription du gène d’une protéine extracellulaire, la RNA polymerase II agit en fonction de l’orientation indiquée des molécules suivantes, sauf une, indiquer laquelle : a. elle transcrit chaque intron en commençant par son site donneur b. elle parcourt le brin antisens du gène de 3’ vers 5’ c. elle achève la synthèse du transcrit primaire par son extrémité 5’-phosphate d. elle transcrit la séquence qui codera pour les acides aminés du signal-peptide avant celle qui codera pour le reste de la protéine e. elle commence la transcription en séparant les deux brins de l’ADN du gène à partir de l’extrémité 5’ de l’exon 1 6. Selon les gènes, des combinaisons de structure peuvent être obtenues par épissage alternatif aboutissant à des transcrits différents. Toutes les combinaisons d’exons suivantes sont possibles, sauf une, indiquer laquelle : a. l’exon 5 peut être suivi de l’exon 7 b. il peut y avoir plusieurs exons avec un codon de terminaison, dont un seul sera épissé à la suite de l’avant-dernier exon du même gène c. l’exon 4 peut être suivi de l’exon 3 d. plusieurs promoteurs peuvent initier la transcription du même gène par plusieurs exons 1, chacun étant épissé ensuite avec le même exon 2 e. le même lasso peut contenir l’intron 3, l’exon 4 et l’intron 4

Cahier d'Exercices en Biochimie / PCEM1 7. La prolyl-tRNA synthétase est spécifique de toutes les actions suivantes, sauf une, indiquer laquelle : a. elle hydrolyse deux liaisons riches en énergie b. elle condense la proline sur l’AMP par une liaison anhydride d’acide c. elle reconnaît la proline, acide aminé d. elle reconnaît un tRNA dont l’anticodon est GGG e. elle produit un acide pyrophosphorique 8. A différentes étapes de la traduction du fragment de messager suivant, les sites acide aminé et peptide d’un ribosome sont occupés de toutes les façons suivantes, sauf une, indiquer laquelle : …CUG ACU CCU GAG GAG AAG UCU… a. site P : tRNAPro~Pro-Thr-Leu-… site A : tRNAGlu~Glu b. site P : tRNAGlu~Glu site A : tRNAGlu~Glu-Pro-Thr-Leu-… c. site P : tRNAGlu~Glu-Pro-Thr-Leu-… site A : rien d. site P : tRNAGlu~Glu-Pro-Thr-Leu-… site A : tRNAGlu~Glu e. site P : tRNAGlu~Glu-Glu-Pro-Thr-Leu-… site A : tRNALys~Lys 9. Lors de la progression d’une fourche de réplication, les mécanismes suivants accompagnent la synthèse du DNA, sauf un, indiquer lequel : a. La DNA primase synthétise des amorces d’ARN sur le brin retardé

Biologie Moléculaire / 26 b. La DNA polymérase d hydrolyse les nucléotides mésappariés en 3’ des brins nouveaux c. La DNA ligase associe les fragments d’Okazaki sur le brin retardé d. L’hélicase (topoisomérase) déroule la double hélice en avant de la polymérase e. La DNA polymérase d ajoute des nucléotides à l’extrémité 5’ des fragments d’Okazaki 10. La réparation par excision de base permet de corriger toutes les lésions du DNA suivantes, sauf une, indiquer laquelle : a. hydrolyse d’une liaison N-osidique (site sans base) b. dimère de thymines (cyclobutylique) c. 5-bromouracile (analogue structural de l’uracile) d. désamination d’une adénine (hypoxanthine) e. méthylation d’une cytosine (5-méthylcytosine) 1 1 . Une structure Holliday peut se produire par croisement des brins de deux DNA homologues provenant des molécules suivantes, sauf une, indiquer laquelle : a. deux gènes homologues, sur des chromosomes différents b. deux chromosomes appariés au cours de la méiose c. deux DNA fils après la réplication d. deux gènes dupliqués l’un à la suite de l’autre (en tandem) e. deux chromosomes au cours de la réparation homologue

EXERCICE
9 questions à choix multiples (Cocher les cases vraies pour chaque QCM) Soit l’ADN complémentaire double brin (ADNc) qui a été synthétisé à partir de l’ARN messager de l’apolipoprotéine A-II (apoA-II). La séquence du brin sens de cet ADNc est :

1 AGGCACAGAC ACCAAGGACA GAGACGCTGG CTAGGCCGCC 41 CTCCCCACTG TTACCAACAT GAAGCTGCTC GCAGCAACTG 81 TGCTACTCCT CACCATCTGC AGCCTTGAAG GAGCTTTGGT 121 TCGGAGACAG GCAAAGGAGC CATGTGTGGA GAGCCTGGTT 161 TCTCAGTACT TCCAGACCGT GACTGACTAT GGCAAGGACC 201 TGATGGAGAA GGTCAAGAGC CCAGAGCTTC AGGCCGAGGC 241 CAAGTCTTAC TTTGAAAAGT CAAAGGAGCA GCTGACACCC 281 CTGATCAAGA AGGCTGGAAC GGAACTGGTT AACTTCTTGA 321 GCTATTTCGT GGAACTTGGA ACACAGCCTG CCACCCAGTG 361 AAGTGTCCAG ACCATTGTCT TCCAACCCCA GCTGGCCTCT 401 AGAACACCCA CTGGCCAGTC CTAGAGCTCC TGTCCCTACC 441 CACTCTTTGC TACAATAAAT GCTGAATGAA TCC
Pour faciliter les comptes, la séquence a été divisée en groupes de 10 lettres nucléotide de chaque ligne a été mentionné. 12. Parmi les constituants suivants, quels sont ceux qui ont été utilisés pour la synthèse de cet ADNc : a. une ARN polymérase b. une transcriptase réverse c. une ADN ligase d. les ribonucléosides triphosphates : ATP, UTP, GTP, CTP e. les désoxyribonucléosides triphosphates : dATP, dTTP, dGTP, dCTP et le numéro du premier

13. Cet ADNc: a. comporte la séquence du promoteur du gène de l’apoA-II b. reproduit la séquence de l’ARNm de l’apoA-II (hors mis la coiffe et la queue polyA) c. reproduit la séquence de tous les exons du gène de l’apoA-II d. reproduit en partie la séquence du brin sens du gène de l’apoA-II e. reproduit en partie la séquence du brin anti-sens du gène de l’apoA-II

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1 14. Les deux séquences de 3 nucléotides en caractères gras comprennent : a. un site d’initiation de la transcription du gène de l’apoA-II b. un signal de fin de traduction de la protéine apoA-II c. un site d’épissage du transcrit primaire de l’apoA-II d. un signal de polyadénylation du transcrit primaire de l’apoA-II e. un élément cis-régulateur d’expression du gène de l’apoA-II 15. Sachant que le gène de l’apoA-II comporte 4 er exons et que le 1 exon n’est pas traduit, cet ADNc : a. a la même longueur que le gène de l’apoA-II b. a la même longueur que la séquence du gène de l’apoA-II située entre les sites d’initiation et de terminaison de la transcription c. a la même longueur que le transcrit primaire de l’apoA-II d. a la même longueur que la séquence codante du gène de l’apoA-II e. a la même longueur que l’ARNm de l’apoA-II (hors mis la coiffe et la queue polyA) 16. Vous souhaitez à partir de ce cDNA, synthétiser par réaction de polymérisation en chaîne (PCR), le fragment situé entre les deux séquences en caractères gras. Parmi les constituants suivants, quels sont ceux que vous utiliserez pour cette synthèse : a. l’oligonucléotide : 5’ATGAAGCTGCTCGCAGC-3’ b. l’oligonucléotide : 5’CAGCCTGCCACCCAGTGA-3’ c. l’oligonucléotide : 5’TCACTGGGTGGCAGGCTG-3’ d. les didésoxyribonucléosides triphosphates : ddATP, ddTTP, ddGTP, ddCTP e. une ADN polymérase 17. La température de fusion du produit de PCR ainsi obtenu : a. est identique à celle d’un fragment de même taille, constitué uniquement de désoxythymidylate (polydT) b. est supérieure à celle d’un fragment de même taille, constitué uniquement de désoxythymidylate (polydT) c. est supérieure à celle d’un fragment de même taille, constitué uniquement de désoxyadénylate (polydA)

Biologie Moléculaire / 27 d. est supérieure à celle d’un fragment de même taille, constitué uniquement de désoxyguanylate (polydG) e. est supérieure à celle d’un fragment de même taille, constitué uniquement de désoxycytidylate (polydC) 18. Le produit de PCR ainsi obtenu, est soumis à une digestion par l’enzyme de restriction HypCH4 V pour laquelle il n’existe qu’un site de restriction dans l’ADNc de l’apoA-II (situé aux nucléotides 98101), puis à une électrophorèse en gel d’agarose. Sachant que l’enzyme HypCH4 V hydrolyse l’ADN de la façon suivante : 5’…TG CA…3’ 3’…AC GT…5’ vous observerez à l’électrophorèse : a. deux fragments de 41 pb et 262 pb b. deux fragments de 99 pb et 342 pb c. quatre fragments de 41 pb, 99 pb, 262 pb et 342 pb. d. trois fragments de 99 pb, 342 pb et 473 pb. e. trois fragments de 41 pb, 303 pb et 473 pb. 19. Une délétion des deux nucléotides numérotés 100-101 dans la séquence d’ADNc sera accompagnée : a. d’un décalage du cadre de lecture b. de la synthèse d’une protéine tronquée (plus courte que la protéine normale) c. d’un défaut d’épissage du transcrit primaire ème acide aminé de d. d’un changement du 14 er l’apoA-II (le 1 étant la méthionine) e. de la disparition du site de restriction de l’enzyme de restriction HypCH4 V dans l’ADNc 20. La séquence d’ADNc d’un sujet homozygote pour la délétion des nucléotides numérotés 100-101 est soumise comme dans la question 4 à une amplification du fragment situé entre les deux séquences en caractères gras, puis à une digestion par l’enzyme de restriction HypCH4 V. Vous observerez à l’electrophorèse en gel d’agarose : a. trois fragments de 41 pb, 262 pb et 303 pb b. un fragment de 301 pb c. un fragment de 473 pb d. deux fragments de 41 pb et 262 pb e. deux fragments de 99 pb et 342 pb

Faculté de Médecine Pierre & Marie Curie

Cahier d'Exercices en Biochimie / PCEM1

Biologie Moléculaire / 28

ANNEXE I
1er Nucléotide

. CODE GENETIQUE
U 2ème Nucléotide C A Ser “ “ “ Pro “ “ “ Thr “ “ “ Ala “ “ “ Tyr “ Stop Stop His “ Gln “ Asn “ Lys “ Asp “ Glu “ 3ème Nucléotide G Cys “ Stop Trp Arg “ “ “ Ser “ Arg “ Gly “ “ “ U C A G U C A G U C A G U C A G

U

Phe “ Leu “ “ “ “ “ Ileu “ “ Met Val “ “ “

C

A

G

ANNEXE II.
- Codes des acides aminés

A : ala C : cys D : asp E : glu

F : phe G : gly H : his I : ile

K : lys L : leu M : met N : asn

P : pro Q : gln R : arg S : ser

T : thr V : val W : trp Y : tyr

Faculté de Médecine Pierre & Marie Curie

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->