You are on page 1of 13

Aryabhatt College of Engineering and Technology

What Is Bioinformatics?

The mathematical, statistical and computing methods that aim to solve biological problems using DNA and amino acid sequences .

Structural bioinformatics of DNA

Structural bioinformatics of DNA: a web-based tool for the analysis of molecular dynamics results and structure prediction

Computational evolutionary biology


Through physiological observations alone Build complex computational models of populations to predict the outcome of

Bioinformatics for DNA Sequence Analysis


Provides practical guidance and the analysis of DNA sequences Does not require a special background in statistics, mathematics or computer science,

Related Fields: Medical Informatics

The study and application of computing methods to improve communication and management of medical data .

Related Fields: Computational Biology


The study and application of computing methods for classical biology Primarily concerned with evolutionary, population and theoretical biology.

Related Fields: Cheminformatics

The study and application of computing methods, along with chemical and biological technology, for drug design and development

History of Bioinformatics
Genetics Computers and Computer Science Bioinformatics

Putting it all Together

Bioinformatics is basically where the findings in genetics and the advancement in technology meet in that computers can be helpful to the advancement of genetic

All atom models of 19mer (AAAAAGGCCAAAAAAGGCCC), 20mer (AAAAAGGGCCAAAAAGGGCC), 21mer (AAAAAGGCCCAAAAAGGGCCC), 22mer (AAAAAGGGCCCAAAAAAGGCCC) and the 23mer (AAAAAGGGCCCAAAAAAGGGCCC) DNA sequences, each 300 bp long.

Thank You