Fundamentos teórico-práticos e

protocolos de extração e de
amplificação de dna por meio da técnica
de reação em cadeia da polimerase
Empresa Brasileira de Pesquisa Agropecuária
Embrapa Pecuária Sudeste
Ministério da Agricultura, Pecuária e Abastecimento
Fundamentos teórico-práticos e
protocolos de extração e de
amplificação de DNA por meio da
técnica de reação em cadeia da
polimerase
Embrapa Pecuária Sudeste
São Carlos, SP
2007
Embraµa Pecuar|a Sudeste
Podovia Washington Luiz, km 234
Caixa Posta| 339
Fone. (16) 3361-5611
Fax. (16) 3361-5754
Home page. http.\\vvv.cppse.embrapa.br
Endereco e|etrðnico. sac@cppse.embrapa.br
Ccm|té de Pub||cações da Un|dade
Presidente. A|berto C. de Campos Bernardi
Secretário-Executivo. Edison Beno Pott
Membros. Car|os Eduardo Si|va Santos, Maria Cristina Campane||i Brito,
Odo Primavesi, Sðnia Borges de A|encar
Pevisor de texto. Edison Beno Pott
Norma|izacão bib|iográIica. Sðnia Borges de A|encar
Capa. Maria Cristina Campane||i Brito
Editoracão e|etrðnica. Maria Cristina Campane||i Brito
Tcdcs cs d|re|tcs reservadcs.
A reproducão não-autorizada desta pub|icacão, no todo ou em parte,
constitui vio|acão dos direitos autorais (Lei no 9.610).
Dadcs Internac|cna|s de Cata|cgaçãc na Pub||caçãc - CIP
Embraµa Pecuar|a Sudeste
Fundamentos teorico-práticos e protoco|os de extracão e de amp|iIicacão
de DNA por meio de reacão em cadeia da po|imerase }recurso
e|etrðnicoJ. / Márcia Cristina de Sena O|iveira }et a|.J ÷ São Car|os.
Embrapa Pecuária Sudeste, 2007.
Modo de Acesso.
http.//vvv.cppse.embrapa.br/servicos/pub|icacaogratuita/
e-books/LVFundDNA.pdI
Pub|icacões gratuitas (acesso em _/10/2007)
Disponive| tambem em CD-POM (500 exemp|ares)
ISßN: 9?B-B5-B6?64-12-?
1. DNA - Extracão - Po|imerase. 2. DNA ÷ Amp|iIicacão ÷
Po|imerase. l. O|iveira, Márcia C. de Sena. ll. Titu|o.
CDD. 591.8
´ Embrapa 2007
Autores
Márcia Cristina de Sena Oliveira
Médica Veterinária, Dra., Embrapa Pecuária Sudeste, Rod. Washington Luiz, km
234, Caixa Postal 339, CEP: 13560-970, São Carlos, SP.
Endereço eletrônico: marcia@cppse.embrapa.br
Luciana Correia de Almeida Regitano
Médica Veterinária, Dra., Embrapa Pecuária Sudeste, Rod. Washington Luiz, km
234, Caixa Postal 339, CEP: 13560-970, São Carlos, SP.
Endereço eletrônico: luciana@cppse.embrapa.br
Alexandre Dinnys Roese
Engenheiro Agrônomo, Mestre, Embrapa Trigo, Rod. BR 285, km 294, Caixa
Postal 451 CEP 99001-970 − Passo Fundo, RS
Endereço Eletrônico: alex@cnpt.embrapa.br
Denilson Gouvêa Anthonisen
Bacharel em Química, Mestre, Embrapa Clima Temperado, Rod. BR 392, km 78,
9º Distrito, Monte Bonito, Caixa Postal 403 CEP 96001-970 − Pelotas, RS
Endereço Eletrônico: denilson@cpact.embrapa.br
Epaminondas do Patrocínio
Bacharel em Química, Embrapa Mandioca e Fruticultura, Rua Embrapa, s/n, Caixa
Postal 007 CEP 44380-000 − Cruz da Almas, BA
Endereço Eletrônico: epami@cnpmf.embrapa.br
Márcia Maria Parma
Bacharel em Química, Embrapa Meio Ambiente, Rod. SP 340, km 127m5,
Tanaquinho Velho, Caixa Postal 69 CEP 13820-000 − Jaguariúna, SP
Endereço Eletrônico: mmparma@cnpma.embrapa.br
Sandra Maria Mansur Scagliusi
Bióloa, Mestre, Dra., Embrapa Trigo, Rod. BR 285, km 294, Caixa Postal 451 CEP
99001-970 − Passo Fundo, RS
Endereço Eletrônico: mansur@cnpt.embrapa.br
Wilston Henrique Belem Timóteo
Licenciado em Matemática, Mestre, Embrapa Milho e Sorgo, Rod. MG 424, km 45,
Caixa Postal 151 CEP 35701-970 − Sete Lagoas, MG
Endereço Eletrônico: wilston@cnpms.embrapa.br
Silvia Neto Jardim
Bióloga, Dra., Embrapa Milho e Sorgo, Rod. MG 424, km 45, Caixa Postal 151
CEP 35701-970 − Sete Lagoas, MG
Endereço Eletrônico: silvia@cnpms.embrapa.br
SUMÁRIO
1. INTRODUÇÃO ......................................................................................................................... 1
2. CARACTERIZAÇÃO MOLECULAR DOS ÁCIDOS NUCLÉICOS ..................................... 2
3. OBTENÇÃO DE AMOSTRAS PARA EXTRAÇÃO DE DNA............................................... 3
4. CUIDADOS DURANTE E APÓS A EXTRAÇÃO DE DNA.................................................. 4
5. MATERIAL NECESSÁRIO PARA EXTRAÇÃO DE DNA................................................... 4
6. EXTRAÇÃO DE DNA DE AMOSTRAS DE TECIDOS DE MAMÍFEROS.......................... 5
6.1. Material (ver Apêndice) ...................................................................................................... 5
6.2. Digestão da amostra ............................................................................................................ 5
6.3. Extração do DNA com fenol ............................................................................................... 5
6.4. Purificação do DNA por meio de precipitação com etanol................................................. 6
7. PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAÇÃO DE DNA DE
AMOSTRAS DE SANGUE...................................................................................................... 7
7.1. Extração de DNA de amostras de sangue com a utilização de colunas de extração........... 7
7.2. Protocolo de extração de DNA de sangue mediante precipitação com sal ......................... 8
7.3. Extração de DNA de amostras congeladas de sangue....................................................... 10
8. PROTOCOLOS EMPREGADOS NA EXTRAÇÃO DE DNA DE AMOSTRAS DE
ARTRÓPODES COM UTILIZAÇÃO DE COLUNAS DE PURIFICAÇÃO ....................... 11
8.1. Protocolo para extração de DNA de amostras de carrapatos com colunas de purificação11
8.2. Protocolo de extração de DNA de ovos de carrapatos com a utilização de colunas de
purificação........................................................................................................................ 12
9. EXTRAÇÃO DE DNA DE AMOSTRAS DE SÊMEN ........................................................ 13
10. EXTRAÇÃO DE DNA DE PLANTAS.................................................................................. 14
11. LEITURA DA CONCENTRAÇÃO DE DNA NAS AMOSTRAS ....................................... 16
12. INTRODUÇÃO À TECNICA DE PCR ................................................................................. 16
13. ESCOLHA DOS PRIMERS OU INICIADORES................................................................... 19
14. PCR “MULTIPLEX” .............................................................................................................. 20
15. NESTED− −− −PCR ........................................................................................................................ 20
16. PCR QUANTITATIVA.......................................................................................................... 21
17. ELETROFORESE DE ÁCIDOS NUCLÉICOS..................................................................... 21
17.1. Eletroforese em gel de agarose....................................................................................... 22
17.2. Variáveis que afetam a migração do DNA através do gel de agarose ........................... 23
18. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO E
FRAGMENTOS DE DIGESTÃO EM GEL DE AGAROSE................................................. 25
19. ELETROFORESE EM SISTEMA CAPILAR ....................................................................... 26
20. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO EM SISTEMA
CAPILAR................................................................................................................................ 28
21. PROTOCOLOS DE AMPLIFICAÇÃO DE DNA PARASITÁRIO...................................... 28
21.1. PCR para Babesia bigemina........................................................................................... 28
21.2. Nested− −− −PCR para Babesia bigemina.............................................................................. 29
22. ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAÇÃO DOS PRODUTOS
AMPLIFICADOS.................................................................................................................... 31
23. APÊNDICE............................................................................................................................. 33
24. REFERÊNCIAS BIBLIOGRÁFICAS.................................................................................... 37
25. BIBLIOGRAFIA CONSULTADA......................................................................................... 37
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
1
FUNDAMENTOS TEÓRICO-PRÁTICOS E PROTOCOLOS DE EXTRAÇÃO E DE
AMPLIFICAÇÃO DE DNA POR MEIO DA TÉCNICA DE REAÇÃO EM CADEIA DA
POLIMERASE
1
1. INTRODUÇÃO
A extração e a purificação de ácidos nucléicos a partir de diversas amostras
experimentais (bactérias, fungos, tecidos vegetais e tecidos animais) é uma etapa
fundamental para se obter alta eficiência de amplificação nos protocolos que usam a
reação em cadeia da polimerase (PCR). Essa técnica tem sido amplamente empregada
em estudos moleculares, em razão da facilidade relativa com que é possível amplificar
in vitro regiões específicas do genoma de qualquer organismo. A PCR possibilita a
amplificação de seqüências de DNA que estejam presentes em misturas complexas e
permite estudos de natureza variada, tais como desenvolvimento de métodos de
diagnóstico altamente sensíveis e específicos, obtenção de grandes quantidades de
DNA para seqüenciamento e análises sobre a diversidade genética de populações.
Apesar da facilidade de amplificação de DNA possibilitada pela técnica de PCR, existe
a necessidade da adequada padronização dos protocolos a serem utilizados em todas
as fases dos procedimentos, desde a obtenção do ácido nucléico até a reação de
amplificação propriamente dita. O DNA, em sua forma original de dupla fita, apresenta
alta estabilidade e é muito resistente e se mantém inalterado em várias condições de
meio. No entanto, alguns cuidados são aconselháveis, para que seja evitada a
degradação das amostras obtidas em laboratório. A extração de DNA inclui
basicamente dois procedimentos principais: a lise das células presentes na amostra e a
purificação do DNA. Após a lise das células, o DNA deve ser separado dos restos
celulares e das proteínas, precipitado e suspenso em volume adequado de água
ultrapura ou soluções-tampão adequadas. As amostras de DNA podem também ser
submetidas a processos de concentração e de purificação, com a finalidade de se obter
melhores resultados nas amplificações. Para cada tipo de amostra, vários protocolos
podem ser testados, adaptados e otimizados, de maneira a se conseguir DNA de boa
qualidade. Neste manual apresentam-se, de maneira simples, alguns fundamentos da
análise de DNA.

1
Polimerase chain reaction, PCR.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
2
2. CARACTERIZAÇÃO MOLECULAR DOS ÁCIDOS NUCLÉICOS
As células vivas são capazes de preservar e de transferir a informação genética
para as novas gerações por meio da complementaridade estrutural das moléculas de
ácidos nucléicos: o DNA e o RNA. A unidade básica tanto do DNA como do RNA são
polímeros de subunidades monoméricas, denominadas nucleotídeos, que estão
arranjados em seqüência precisa. Em organismos eucarióticos (cujas células
apresentam-se organizadas com membrana, citoplasma e núcleo), o DNA é encontrado
no núcleo das células e também nas mitocôndrias e nos cloroplastos. As moléculas de
DNA e de RNA consistem de apenas quatro tipos de nucleotídeos. Os nucleotídeos são
compostos precursores da síntese dos ácidos nucléicos que contém um grupo fosfato,
uma pentose (molécula de açúcar com cinco carbonos) e uma base nitrogenada.
Durante o processo de polimerização do ácido nucléico, a ligação de um nucleotídeo à
cadeia em extensão ocorre pela ação nucleofílica de uma hidroxila da pentose (3’-OH),
do resíduo de nucleotídeo mais externo da cadeia, sobre o fosfato α ligado ao carbono
5` da pentose (5`-PO
4
) do nucleotídeo que será incorporado, resultando na liberação
de um íon difosfato. A pentose que compõe o RNA é sempre a ribose e o DNA, a
desoxirribose. As bases adenina, guanina e citosina são encontradas tanto nas
moléculas de DNA como de RNA, enquanto timina aparece exclusivamente nas
moléculas de DNA e uracila, nas de RNA. Tanto o DNA quanto o RNA são utilizados na
pesquisa, dependendo, principalmente, do objetivo de cada trabalho.
O DNA apresenta diferentes seqüências de nucleotídeos, que formam diferentes
unidades, conhecidas por genes. O gene é definido como o segmento de DNA que
codifica a informação requerida para a produção de determinado polipeptídeo ou de um
segmento de RNA. Formas alternativas dos genes são denominados alelos e a
totalidade do DNA presente na célula é chamada de genoma. Os genes estão
organizados em cromossomos e a sua posição no cromossomo é denominada lócus.
Na maioria dos organismos, chamados diplóides, cada célula contém duas cópias de
cada tipo de cromossomo. Nestes organismos, cada indivíduo possui dois alelos para
cada lócus, um originário da mãe e outro do pai. Se os dois alelos de um lócus não
podem ser diferenciados pela sua seqüência de nucleotídeos, ele é chamado de
homozigoto para o lócus considerado; e, caso contrário, ele é denominado
heterozigoto. O princípio da segregação estabelece que cada célula reprodutiva
originária de indivíduos heterozigotos contém apenas um dos dois alelos, enquanto as
demais células contém os dois alelos em igual freqüência. Em seu estado nativo, o
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
3
DNA apresenta-se arranjado em dupla hélice, com as fitas das seqüências
complementares ligadas entre si por pontes de hidrogênio entre as bases nitrogenadas.
O DNA de todas as bactérias (organismos procarióticos) e de muitos vírus são
arranjados de forma circular. O cromossomo da Escherichia coli contém cerca de
0,0044 picogramas de DNA, cerca de 4 x 10
6
pares de bases que codificam cerca de
3.300 proteínas diferentes. Os seres humanos apresentam ao redor de três bilhões de
pares de bases que codificam de 50 a 100 milhares de genes em 24 cromossomos. Os
vírus apresentam quantidade reduzida de informação genética, quando comparados
aos organismos celulares, porque usam recursos da célula hospedeira para se
reproduzir. Apesar do tamanho relativamente pequeno da informação genética contida
em bactérias e vírus, o DNA desses organismos precisa ser compactado para que
possa ser contido nessas células.
Com base nas características estruturais dos ácidos nucléicos, algumas técnicas
moleculares são utilizadas na manipulação do DNA dos organismos. A hibridização é a
técnica que se baseia na complementaridade entre as fitas de DNA. Um fragmento de
DNA marcado por uma substância radioativa é usado como sonda para determinar a
presença da fita complementar em uma amostra específica. Essa técnica foi muito
utilizada em testes de diagnóstico, porém, atualmente em conseqüência de sua baixa
sensibilidade e de problemas advindos do uso de radioatividade, ela caiu em desuso. A
clivagem é outra técnica que pode facilitar a manipulação do DNA. Para esse fim,
existem as chamadas enzimas de restrição, que são capazes de cortar o DNA em
sítios específicos, definidos geralmente pela seqüência de bases distribuídas ao longo
da molécula, produzindo fragmentos de comprimento menor. As enzimas de restrição
são sintetizadas naturalmente por muitas bactérias e centenas (com especificidade
para diferentes sítios de restrição) estão disponíveis comercialmente. Outros tipos de
manipulação de DNA incluem a amplificação (utilizando a técnica de PCR) e a
eletroforese, que serão apresentados em detalhe.
3. OBTENÇÃO DE AMOSTRAS PARA EXTRAÇÃO DE DNA
As amostras perecíveis devem ser acondicionadas de forma adequada até o
momento de serem submetidas à extração do DNA. Amostras de sangue e de outros
tecidos animais devem ser refrigeradas até chegarem ao laboratório. Amostras de
tecidos vegetais também devem ser cuidadosamente colhidas, armazenadas e
refrigeradas. As partes da planta devem ser lavadas e enxaguadas com água destilada
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
4
ou submetidas a processo de esterilização superficial, de acordo com o objetivo dos
estudos a serem realizados. Para melhor conservação, as amostras devem ser
mantidas em temperatura de –20°C a –80°C, dependendo do tempo de
armazenamento. Para utilização de amostras conservadas em estoque, é interessante
o fracionamento em pequenas alíquotas, para que o material não sofra
descongelamentos sucessivos, que poderiam contribuir para a oxidação do tecido e
para a degradação do DNA. O manuseio dessas amostras deve ser feito
preferencialmente com o uso de luvas, para que uma parte dos ácidos nucléicos não
sejam degradados por nucleases, enzimas que normalmente estão presentes nos
fluidos corporais liberados principalmente nas mãos das pessoas.
4. CUIDADOS DURANTE E APÓS A EXTRAÇÃO DE DNA
Com a finalidade de se obter amostras de DNA adequadas aos protocolos de
amplificação, é importante que exista uma sala exclusiva para esse fim. O DNA
apresenta grande afinidade pelo vidro e pode ser adsorvido na presença de alguns
sais; por isso, esse material não deve ser empregado durante o processo de extração.
Todo o material plástico (polipropileno) utilizado deve ser esterilizado e novo (não deve
ser usado material reciclado), para que as amostras apresentem boa qualidade e para
que se diminuam os riscos de contaminação entre amostras no momento da análise.
5. MATERIAL NECESSÁRIO PARA EXTRAÇÃO DE DNA
Para executar os protocolos de extração de DNA, é necessário que o laboratório
tenha os equipamentos básicos, o material plástico e todas as soluções utilizadas nos
procedimentos. O material mínimo necessário é o seguinte:
a) Centrífuga com rotor para vários tipos de tubos (ou para o tipo de tubo empregado
no laboratório). É aconselhável que a centrífuga tenha controle de refrigeração.
b) Capelas de exaustão.
c) Banho-maria com termostato ou com termômetro para aferição da temperatura.
d) Vidraria para preparo das amostras (provetas, pipetas, bastões de vidro).
e) Microtubos de polipropileno.
f) Micropipetas automáticas para volumes diversos (com ponteiras).
g) Gelo e nitrogênio líquido, quando necessário.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
5
6. EXTRAÇÃO DE DNA DE AMOSTRAS DE TECIDOS DE MAMÍFEROS
6.1. Material (ver Apêndice)
a) Tampão de digestão 1.
b) Solução de fenol, clorofórmio e álcool isoamílico (25:24:1); para essa solução, usar
fenol tamponado.
c) Acetato de amônio 7,5 M.
d) Etanol absoluto.
e) Etanol a 70%.
f) Tampão TE (tris−HCl 10 mM, EDTA 1 mM, com pH 8,0; tris =
hidroximetilaminometano).
g) Solução de dodecilsulfato de sódio (SDS) a 0,1%.
h) Nitrogênio líquido.
i) Frascos e bastões esterilizados.
j) Microtubos de polipropileno.
6.2. Digestão da amostra
As amostras de tecidos de origem animal ou vegetal que serão submetidas à
extração de DNA devem sofrer fragmentação e digestão enzimática das proteínas.
Para produzir a fragmentação, as amostras podem ser cortadas, submetidas a
congelamento em nitrogênio líquido e rapidamente pulverizadas por processo manual
(utilizando um bastão) ou mecânico (utilizando equipamentos para esse fim).
Quantidades da amostra (entre 200 mg e 1 g) são adicionadas a uma solução-tampão
de digestão (na proporção de 1,2 mL de tampão para cada 100 mg de tecido) e
colocadas em banho-maria em temperatura próxima a 50°C, para que ocorra a
digestão. O tempo de incubação pode variar entre oito e dezesseis horas, ou até que a
amostra se apresente totalmente digerida, ou seja, apresente aspecto viscoso.
6.3. Extração do DNA com fenol
O método mais utilizado para purificação do DNA é a extração com fenol
tamponado, que provoca a desnaturação das proteínas de maneira eficiente. O
clorofórmio também é usado como agente desnaturante das proteínas contidas na
amostra. A mistura de fenol e de clorofórmio é muito eficiente para desproteinizar e sua
ação se fundamenta na propriedade hidrófoba das proteínas que apresentam afinidade
por solventes orgânicos. O álcool isoamílico previne a formação de espuma quando a
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
6
mistura é agitada, o que torna mais fácil a separação da fase orgânica e da fase
aquosa. A proteína que foi desnaturada pelo tratamento com fenol e clorofórmio forma
uma camada na interface das duas fases, separando-se do DNA que se mantém na
fase aquosa. Para extrair o DNA de uma amostra, usar igual volume de solução de
fenol, de clorofórmio e de álcool isoamílico (25:24:1). A extração com o fenol é
dependente do pH. O fenol empregado nas extrações de DNA deve ter o pH próximo
de 8,0 (fenol tamponado), já que faixas mais baixas de pH deslocam o DNA para a
interface na hora da centrifugação. Em pH 7,0 ou acima, o DNA permanece na fase
aquosa e em pH abaixo de 7,0, ele é desnaturado e migra para a fase orgânica. Nesse
último caso, o RNA permanece na fase aquosa. Metodologia para tamponamento do
fenol está descrita no Apêndice. Após a adição da solução de extração, centrifugar a
amostra por dez minutos a 1.700 g e transferir o sobrenadante para um novo tubo.
Cuidado: A manipulação de soluções que contêm fenol exige cuidado, pelo fato de
serem extremamente cáusticas, voláteis e irritantes para as mucosas.
6.4. Purificação do DNA por meio de precipitação com etanol
A precipitação do DNA é feita por meio da utilização de etanol absoluto
associado a uma solução com alta concentração de um sal catiônico. O etanol induz a
transição estrutural nas moléculas de ácido, fazendo-as se agregarem, com
conseqüente precipitação. A precipitação com etanol absoluto, além de concentrar o
DNA, ajuda a remover resíduos de fenol e de clorofórmio presentes na amostra. O
etanol a 70% é utilizado para remover resíduos de sais. Embora tanto o cloreto de
sódio como o acetato de sódio e o acetato de amônio sejam eficazes na precipitação
do DNA, é mais difícil remover o cloreto de sódio, em razão da sua menor solubilidade
em etanol.
Procedimento:
Adicionar meio volume de solução de acetato de amônio 7,5 M e dois volumes
de etanol absoluto. Centrifugar a 1.700 g por cerca de dois minutos (o tempo deve ser
ajustado de acordo com a amostra). Eliminar a solução alcoólica e preservar o pellet de
DNA. Ressuspender o pellet em etanol a 70% (para eliminar impurezas presentes na
amostra), centrifugar novamente a 1.700 g por dois minutos. Descartar o sobrenadante
e deixar secar o pellet de DNA. Ressuspender o DNA em tampão TE (ver item 6.1.f).
Para facilitar a completa dissolução do DNA nesse tampão, as amostras podem ser
incubadas em agitador a 65°C por algumas horas.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
7
7. PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAÇÃO DE DNA DE
AMOSTRAS DE SANGUE
Existem muitos tipos de protocolos e muitos kits comerciais para a extração de
DNA que se adaptam a diversos tipos de amostras. Para cada tipo de tecido podem ser
testadas adaptações, de acordo com as características de cada espécime a ser
analisado. A extração de DNA a ser empregada na PCR com fins de diagnóstico deve
seguir um protocolo em que a obtenção de amostras de alta pureza é fundamental. O
volume a ser submetido à extração é muito importante, mesmo porque em alguns
procedimentos ele é extremamente restrito (amostras podem ser colhidas com swabs
ou de esfregaços de sangue e de cortes histológicos). A grande dificuldade verificada
em alguns casos é que, quando se extrai DNA de uma amostra, existe a mistura de
ácidos nucléicos do hospedeiro e de ácidos nucléicos de outros microrganismos que
podem estar presentes no tecido. Para exemplificar, a extração do DNA de sangue de
um bovino, para pesquisa de hemoparasitas, produz a mistura de DNA que contém o
ácido nucléico do hospedeiro e o ácido nucléico de todos os microrganismos presentes
na amostra de sangue. O genoma de qualquer microrganismo é muito menor do que o
de um mamífero e, para que se consiga a amplificação adequada, é preciso obter
amostras muito puras. Existem vários métodos para extração de ácidos nucléicos que
podem ser usados no estudo de parasitas, no entanto, em razão da pequena
quantidade de DNA algumas vezes presente nesses agentes, é necessária a
otimização do processo. Nos protocolos de extração de DNA com a finalidade de
amplificação por meio da técnica de PCR, são usados como anticoagulantes o citrato
de sódio e o ácido etilenodiaminotetracético (EDTA). A heparina não é indicada como
anticoagulante, por causa da sua propriedade inibitória sobre a PCR. O sangue colhido
com citrato de sódio (ver Apêndice) ou com EDTA pode ser armazenado por cerca de
sete dias a –4°C ou durante vários anos a –80°C.
7.1. Extração de DNA de amostras de sangue com a utilização de colunas de
extração
Este protocolo foi adaptado para extração de DNA de amostras de sangue de
bovinos, para o diagnóstico da tristeza parasitária dos bovinos, no Laboratório de
Sanidade Animal da Embrapa Pecuária Sudeste. Vários kits disponíveis no mercado,
por exemplo o GFX

(GE Healthcare), podem ser empregados. A purificação do DNA é
feita por meio do uso de uma coluna que contém fragmentos de sílica (coluna de
purificação). Inicialmente, o DNA se liga à membrana da coluna de extração e depois
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
8
ele é lavado até que apresente alta pureza. No final do protocolo, o DNA é eluído com
água quente ou com tampão TE. A utilização de kits permite a purificação do DNA nas
amostras de maneira homogênea e rápida.
Procedimento:
a) Colocar 300 µL de sangue e 900 µL de solução de lise, em microtubo de 1,5 mL.
b) Homogeneizar e centrifugar a 20.800 g por cinco minutos e descartar o
sobrenadante, deixando cerca de 50 µL.
c) Homogeneizar a amostra e adicionar 500 µL de solução de extração.
d) Incubar por cinco minutos, em temperatura ambiente, e transferir o conteúdo do
microtubo para a coluna de extração. Acoplar a coluna de extração ao tubo coletor.
e) Centrifugar a 5.000 g por um minuto; descartar o conteúdo do tubo coletor.
f) Adicionar à coluna 500 µL de solução de extração e centrifugar a 5.000 g por um
minuto; descartar o conteúdo do tubo coletor.
g) Adicionar à coluna 500 µL de solução de lavagem e centrifugar a 20.800 g por três
minutos; descartar o conteúdo do tubo coletor.
h) Transferir a coluna para um microtubo de 1,5 mL, limpo e livre de enzimas que
decomponham o DNA.
i) Adicionar 100 µL de água ultrapura, autoclavada e aquecida a 70ºC; incubar por um
minuto, em temperatura ambiente, e centrifugar a 5.000 g por um minuto, obtendo-
se assim a solução de DNA. O DNA pode ser eluído em tampão TE também
aquecido a 70°C.
7.2. Protocolo de extração de DNA de sangue mediante precipitação com sal
Este protocolo, adaptado de Olerup & Zetterquist (1992), é usado no Laboratório
de Biotecnologia da Embrapa Pecuária Sudeste e pode ser empregado com volumes
pequenos de sangue.
Soluções:
• Solução A (tampão de hemólise) para cada amostra de 25 mL:
a) Tris−HCl 1 M, com pH 7,6 (concentração final de 10 mM) 250 µL.
b) MgCl
2
0,5 M (concentração final de 5 mM) 250 µL.
c) NaCl 5 M (concentração final de 10 mM) 50 µL.
d) Completar com água ultrapura (q.s.p. 25 mL).
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
9
• Solução B (para cada amostra de 500 µl):
a) Tris−HCl 1 M, com pH 8,0 (concentração final de 10 mM) 5 µL.
b) NaCl 5 M (concentração final de 100 mM) 10 µL.
c) EDTA 0,5 M, com pH 8,0 (concentração final de 10 mM) 10 µL.
d) Dodecilsulfato de sódio a 20% (concentração final de 0,5%) 12,5 µL.
e) Proteinase K (concentração final de 20 mg/mL) 2,0 µL.
f) H
2
O ultrapura 460,5 µL.
• Para a precipitação do DNA:
a) Etanol absoluto gelado (manter a 5°C).
b) Etanol a 70% gelado (manter a 5°C).
Obtenção de leucócitos:
a) Colher 5 mL de sangue em tubos com anticoagulante EDTA. Acertar os volumes
dos tubos, completando com solução salina (solução de cloreto de sódio 0,9 M).
b) Centrifugar durante cinco minutos a 390 g e descartar o plasma, usando pipeta,
com cuidado, para não descartar as células brancas (esta etapa é opcional).
c) Lisar os glóbulos vermelhos com 10 mL (5 mL no tubo de colheita e 5 mL em tubo
de polipropileno com capacidade para 15 mL) da solução A, e homogeneizar,
misturando bem por inversão ou agitando os tubos no vortex.
d) Centrifugar durante dez minutos a 700 g na temperatura de 4°C.
e) Dispensar o sobrenadante. Se o pellet for muito pequeno, centrifugar novamente.
f) Ressuspender o pellet em 5 mL do tampão de hemólise. Para isso, tampar os tubos
com Parafilm

e misturar bem por inversão e, se preciso, usar o vortex. Centrifugar
a 2.000 rpm por dez minutos a 4ºC.
g) Repetir a lavagem, até obter somente células brancas.
h) Ressuspender o pellet em 500 µL de tampão de hemólise (solução A) e passar para
microtubos de 1,5 mL. Centrifugar por um minuto a 16.000 g e descartar o
sobrenadante.
i) O pellet pode ser conservado a −20°C ou em temperatura menor, por vários meses.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
10
Obtenção do DNA:
a) Ressuspender o pellet em 500 µL de solução B e misturar no vortex. Obs.: destruir
bem o pellet antes de incubar.
b) Incubar a 55°C, até dissolver o pellet (durante quatro a seis horas ou de um dia
para o outro). De vez em quando, misturar as amostras no vortex, para que o pellet
fique bem dissolvido.
c) Ajustar o volume para 760 µL com tampão TE (210 µL). Acrescentar 240 µL de
NaCl 5 M.
d) Incubar por quinze minutos em gelo.
e) Agitar os tubos por inversão, até formar pequenos coágulos de proteína.
Centrifugar por quinze minutos a 16.000 g.
f) Dividir todo o sobrenadante em dois tubos novos (devidamente marcados), 500 µL
em cada um.
g) Ligar o banho-maria a 37ºC. Adicionar 1 mL de etanol absoluto gelado e inverter o
tubo várias vezes. Centrifugar por quinze minutos a 16.000 g. Descartar o
sobrenadante. Secar com papel (com cuidado).
h) Lavar com 500 µL de etanol a 70%, gelado. Revolver o tubo. Centrifugar por cinco
minutos a 16.000 g. Descartar e colocar a secar (temperatura máxima de 40ºC).
Adicionar 250 µL de tampão TE + solução de enzima que degrada RNA (RNAse –
10 µg por mL de amostra) e incubar por uma hora a 37ºC.
7.3. Extração de DNA de amostras congeladas de sangue
Soluções utilizadas (Ver Apêndice):
• Tampão PBS.
• Tampão de lise 1.
• Solução de proteinase K (20 mg/mL).
• Solução de acetato de amônio 10 M.
• Etanol absoluto.
• Tampão TE, com pH 8,0.
Procedimento:
a) Descongelar a amostra de sangue em temperatura ambiente e adicionar igual
volume de tampão PBS.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
11
b) Centrifugar a 3.500 g por quinze minutos, a 4°C.
c) Remover o sobrenadante e suspender o pellet em 15 mL de tampão de lise (incubar
por cerca de uma hora a 37°C).
d) Transferir o lisado para tubos de centrifugação em quantidade que ocupe apenas
1/3 do tubo.
e) Adicionar solução de proteinase K, de modo a obter a concentração final de 100
µg/mL e misturar.
f) Incubar a 50°C por três horas, misturando algumas vezes.
g) Adicionar igual volume de fenol tamponado. Misture duas fases, invertendo o tubo
várias vezes.
h) Centrifugar a 5.000 g por quinze minutos.
i) Transferir o sobrenadante para um tubo limpo, com cuidado.
j) Repetir a extração com fenol, por mais duas vezes.
k) Adicionar à fase aquosa dois décimos de volume de solução de acetato de amônio
10 M e dois volumes de etanol absoluto.
l) Retirar com uma alça o DNA desidratado, que se apresenta em suspensão na
solução aquosa, e transferir para outro microtubo ou, então, centrifugar a 5.000 g
por cinco minutos e descartar o sobrenadante.
m) Deixar evaporar todo o etanol residual.
n) Adicionar 1 mL de tampão TE com pH 8,0 para cada 0,1 mL de células extraídas.
8. PROTOCOLOS EMPREGADOS NA EXTRAÇÃO DE DNA DE AMOSTRAS DE
ARTRÓPODES COM UTILIZAÇÃO DE COLUNAS DE PURIFICAÇÃO
A preparação de amostras de artrópodes para extração de DNA exige boa
digestão de todo o material, por período de tempo variável, que dependerá
basicamente do peso da amostra. Uma limitação dos kits que possuem a membrana de
sílica é que as amostras devem apresentar peso limitado à capacidade máxima
indicada no manual. Como regra, cerca de 20 mg de tecido de carrapato macerado são
usados para extração. Outros artrópodes menores podem ser processados inteiros.
8.1. Protocolo para extração de DNA de amostras de carrapatos com colunas de
purificação
Nesse protocolo foi empregado o kit GFX

(GE Healthcare). Soluções que não
estão no kit (ver o Apêndice):
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
12
a) Solução de proteinase K (20 mg/mL).
b) Tampão de digestão 2.
Procedimento:
a) Pesar 20 mg da amostra e colocar em um microtubo de 1,5 mL.
b) Macerar com a ponta cônica de um bastão. As amostras podem ser mergulhadas
em pequenas quantidades de nitrogênio líquido, para serem congeladas
rapidamente. O congelamento facilita a maceração das amostras, que se tornam
mais quebradiças.
c) Adicionar 10 µL de tampão lisozima e incubar por quinze minutos em temperatura
ambiente.
d) Adicionar 15 µL de solução de proteinase K e incubar de um dia para o outro, na
temperatura de 56°C.
e) Adicionar 500 µL de solução de extração e incubar por quinze minutos em
temperatura ambiente.
f) Centrifugar a 5.000 g por dois minutos.
g) Recolher o sobrenadante, colocar na coluna de extração e centrifugar a 5000 g por
um minuto. Descartar o conteúdo do tubo coletor.
h) Novamente adicionar 500 µL de solução de extração e incubar por quinze minutos
em temperatura ambiente. Centrifugar a 5.000 g por um minuto. Descartar o
conteúdo do tubo coletor.
i) Adicionar 500 µL de solução de lavagem e centrifugar novamente a 20.000 g por
cinco minutos. Descartar o tubo coletor e colocar a coluna em um microtubo de 1,5
mL, novo e livre de enzimas que possam atuar sobre DNA e RNA.
j) Para eluição do DNA, adicionar 100 µL de água ultrapura aquecida a 70°C, incubar
por um minuto e centrifugar a 5.000 g por um minuto.
8.2. Protocolo de extração de DNA de ovos de carrapatos com a utilização de
colunas de purificação
O mesmo protocolo utilizado para extração de DNA de carrapato foi adaptado
para extração de DNA de alíquotas de ovos de carrapatos (kit GFX

, GE Healthcare).
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
13
Procedimento:
a) Pesar 20 mg da amostra e colocar em um microtubo de 1,5 mL.
b) Macerar com a ponta cônica de um bastão. A maceração pode ser feita após
congelamento com nitrogênio líquido.
c) Adicionar 10 µL de tampão de digestão 2 e incubar por quinze minutos em
temperatura ambiente.
d) Adicionar 15 µL de proteinase K (20 mg/mL) e incubar por quatro horas na
temperatura de 56°C.
e) Adicionar 500 µL de solução de extração, incubar por quinze minutos em
temperatura ambiente.
f) Centrifugar a 5.000 g por dois minutos.
g) Recolher o sobrenadante, colocar em coluna de extração e centrifugar a 5.000 g por
um minuto. Descartar o material do tubo coletor.
h) Novamente adicionar 500 µL de solução de extração e incubar por quinze minutos
em temperatura ambiente. Centrifugar a 5.000 g por um minuto.
i) Adicionar a solução de lavagem e centrifugar a 20.000 g por três minutos (16.000
rpm).
j) Transferir a coluna para um tubo limpo de 1,5 mL e colocar 100 µL de água a 70°C
(ou tampão TE). Após um minuto, centrifugar o tubo com a coluna a 5.000 g por um
minuto.
9. EXTRAÇÃO DE DNA DE AMOSTRAS DE SÊMEN
Soluções utilizadas (ver Apêndice):
• Tampão PBS.
• Tampão de lise 2.
Procedimento:
a) Descongelar uma palheta de sêmen (cerca de 0,54 mL) e colocar em um microtubo
de 1,5 mL.
b) Centrifugar durante oito minutos a 16.000 g.
c) Lavar o pellet quatro vezes em 1 mL de tampão PBS (a cada lavagem passar no
vortex e centrifugar novamente).
d) Ressuspender em 100 µL de tampão PBS (nesta fase, a amostra pode ser
armazenada no freezer).
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
14
e) Adicionar 400 µL de tampão de lise 2 e incubar por trinta minutos a 50°C para
dissolver o pellet.
f) Adicionar solução de proteinase K a 200 µg/mL (100 µg = 5 µL da solução de
estoque de 20 mg/mL). Agitar no vortex até dissolver. Incubar por dezesseis horas
a 50ºC.
g) Dividir as amostras em dois tubos, colocando 250 µL em cada tubo.
h) Adicionar 80 µL de NaCl 5 M por tubo. Agitar vigorosamente por inversão.
Centrifugar a 16.000 g por cinco minutos.
i) Transferir o sobrenadante para tubos limpos. Acrescentar 1 mL de etanol absoluto a
cada tubo e agitar por inversão. Centrifugar a 16.000 g por cinco minutos.
j) Desprezar o sobrenadante. Acrescentar 100 µL de etanol a 70% a cada tubo (não
agitar no vortex).
k) Centrifugar a 16.000 g por cinco minutos. Desprezar o sobrenadante. Secar o pellet
e suspender em 100 µL de tampão TE + enzima que atue sobre RNA (10 µg/mL de
amostra).
l) Incubar por uma hora em temperatura ambiente.
10. EXTRAÇÃO DE DNA DE PLANTAS
A extração de DNA de plantas envolve a lise das células vegetais por meio do
tratamento com detergente e posterior separação e precipitação do DNA. A
preparação do DNA das plantas pela técnica de centrifugação em gradiente de cloreto
de césio produz DNA de alta pureza. Outro protocolo que tem sido largamente utilizado
por sua facilidade e rapidez é aquele que usa o detergente CTAB (brometo de
cetiltrimetilamônio), que libera o DNA celular e se complexa a ele. Posteriormente, o
DNA é separado por meio do tratamento com isopropanol e etanol. Este protocolo pode
ser adaptado de várias maneiras, para diversos tipos e para várias quantidades de
amostra.
Protocolo que emprega o detergente CTAB:
Soluções (ver Apêndice):
a) solução-tampão de extração vegetal.
b) Solução de clorofórmio e álcool isoamílico a 24:1.
c) Isopropanol.
d) Etanol a 95%.
e) Tampão TE.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
15
Procedimento:
a) Pesar 300 mg do tecido vegetal (a quantidade de tecido vegetal pode chegar a até
3 g).
b) Macerar com auxílio de nitrogênio líquido, até que a amostra esteja pulverizada.
c) Colocar a amostra em microtubo de 2 mL e adicionar 700 µL de solução-tampão de
extração vegetal e homogeneizar durante dez minutos por inversão.
d) Incubar as amostras em banho-maria a 65ºC por uma hora, homogeneizando
algumas vezes.
e) Retirar do banho-maria e deixar a temperatura da amostra se igualar à temperatura
ambiente.
f) Adicionar 700 µL de solução de clorofórmio e de álcool isoamílico (24:1), e
homogeneizar suavemente.
g) Centrifugar a 5.000 g por dez minutos em temperatura ambiente, para separar a
fase orgânica e a fase aquosa.
h) Remover a fase aquosa (superior) para um novo microtubo, evitando tocar a
interface com a ponta da ponteira.
i) Repetir a extração com solução de clorofórmio e álcool isoamílico (24:1) mais uma
ou duas vezes, considerando que maior número de extrações pode purificar mais o
DNA, porém com alguma perda.
j) Após a remoção final do sobrenadante, adicionar 450 µL de isopropanol (gelado),
equivalente a aproximadamente 2/3 do volume coletado. Homogeneizar
suavemente.
k) Manter a –20ºC por dois minutos (para evitar a precipitação de polissacarídeos).
l) Centrifugar a 8.600 g por dez minutos.
m) Descartar o sobrenadante.
n) Lavar o pellet uma vez com etanol a 70%.
o) Lavar novamente o pellet com etanol a 95%.
p) Deixar secar por uma hora.
q) Ressuspender em 50 a 100 µL de tampão TE (pode-se adicionar RNAse na
concentração final de 10 µg/mL de amostra).
r) Incubar a 37ºC por uma hora.
s) Manter a −20ºC.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
16
11. LEITURA DA CONCENTRAÇÃO DE DNA NAS AMOSTRAS
Todas as amostras de DNA obtidas no laboratório podem ser avaliadas quanto à
sua concentração e à sua pureza por meio da análise da densidade óptica (DO) em
espectrofotômetro. O DNA absorve luz no comprimento de onda de 260 nm e as
proteínas, de 280 nm. Diluições das amostras de DNA são preparadas com água
ultrapura. Pequenas alíquotas de 10 µL (diluição 1:50) ou 5 µL (diluição 1:100) são
misturadas com 490 ou 495 µL de água ultrapura, e lidas em espectrofotômetro, nos
comprimentos de onda citados. Para estimar a concentração de DNA, utiliza-se a
seguinte relação: 1 DO
260
= 50 µg de DNA de dupla hélice. A concentração de DNA na
amostra pode ser obtida pelo seguinte cálculo:
Concentração de DNA = leitura da DO
260
x 50 x fator de diluição usado na leitura.
A relação entre a quantidade de DNA e de proteína é usada como parâmetro
para avaliação da qualidade do DNA extraído e, desse modo, a relação DO
260
/DO
280
pode ser usada para esse fim. Amostras cujos valores dessa relação são inferiores a
1,8 apresentam contaminação com proteínas.
O DNA pode ser quantificado e analisado quanto à sua qualidade, por meio da
análise em gel de agarose. Para esse fim, um gel de agarose entre 0,8% e 1% é
preparado e, com as amostras de DNA, é aplicada também uma amostra cuja
concentração é conhecida. O DNA do bacteriófago Lambda em concentrações
conhecidas de 20, 50, 100 e 200 ng/µL é geralmente utilizado. Após a eletroforese, o
gel é corado com brometo de etídio, visualizado em luz ultravioleta, e as amostras são
comparadas aos padrões, determinando-se dessa maneira as concentrações
aproximadas de DNA em cada amostra.
12. INTRODUÇÃO À TECNICA DE PCR
A PCR apresenta ampla gama de aplicações em vários ramos da pesquisa
científica. Essa reação possibilita que determinada região do genoma de qualquer
organismo seja multiplicada em milhões de cópias, o que facilita a análise genética e
permite o desenvolvimento de técnicas de diagnóstico muito mais sensíveis e mais
específicas do que as tradicionalmente utilizadas. A alta sensibilidade, a especificidade,
a facilidade de execução e a análise de grande número de amostras simultaneamente
fazem dessa técnica uma opção atrativa para estudos epidemiológicos e para
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
17
caracterização de microrganismos causadores de doenças. Para que se possa
amplificar dado segmento de DNA, é necessário que as partes finais da seqüência
sejam conhecidas. Os elementos envolvidos nessa reação são basicamente os
mesmos componentes do processo de replicação que ocorre nas células vivas. A
solução em que ocorre a reação (master mix), é preparada em banho de gelo e
colocada em microtubos de plástico esterilizados.
São componentes da PCR:
a) Amostra de DNA que contém o segmento a ser amplificado (DNA extraído de
amostras de sangue, de culturas de microrganismos, de espécimes clínicos, de
plantas, etc.)
b) Mistura que contenha os nucleotídeos (dNTPs: dATPs, dTTPs, dCTPs e dGTPs)
necessários para a síntese das novas fitas de DNA.
c) Enzima DNA-polimerase, que é responsável pela síntese das novas fitas de DNA
(Taq-DNA-polimerase) em solução-tampão.
d) Cloreto de magnésio, co-fator da reação.
e) Dois iniciadores ou primers, que são pequenas seqüências conhecidas de DNA
(oligonucleotídeos), que delimitam e são complementares à região-alvo de
amplificação. Os primers são sintetizados em laboratórios especializados, sob
encomenda, e após a sua diluição são mantidos a −20°C.
A PCR pode ser feita em tubos de 0,5 µL ou de 0,2 µL ou em placas,
empregando-se volume total de 25 µL, sendo 20 µL de master mix e 5 µL da amostra
de DNA a ser analisada. Outras variações de volume têm sido utilizadas em diferentes
trabalhos científicos, como 10 µL de master mix e 2,5 µL de DNA. O volume das
reações pode ser reduzido, desde que as concentrações adequadas de todos os
componentes da reação sejam mantidas:
a) 14,7 µL de água ultrapura esterilizada.
b) 2,5 µL de tampão 10 X concentrado (tris−HCl 10 mM, KCl 500 mM, MgCl
2
15 mM).
c) 0,25 µL de solução 20 mM de nucleotídeos (dNTPs).
d) 1,0 µL de primer (10 µM) sense.
e) 1,0 µL de primer (10 µM) antisense.
f) 0,3 µL de Taq-DNA-polimerase (5 U/µL).
A água a ser empregada no master mix deve ser a ultrapura, que apresenta
baixa condutividade elétrica. O tampão 10 X, utilizado para o preparo do master mix, é
comprado com a Taq-DNA-polimerase. Algumas marcas comerciais de polimerases
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
18
trazem o tampão 10 X já adicionado de cloreto de magnésio, outras trazem essa
solução separada. Nesses casos, a solução deve ser adicionada ao master mix logo
após o tampão 10 X e o volume total deve ser ajustado com água. O íon magnésio não
pode faltar no master mix, porque ele é essencial para a ação da enzima DNA-
polimerase.
Para que ocorra a amplificação, com a síntese de novas fitas de DNA, as
amostras devem ser submetidas à combinação adequada de temperatura e de tempo.
Cada ciclo da PCR apresenta três fases fundamentais, que são: desnaturação,
anelamento e extensão. Essas fases ocorrem em temperatura diferente e são
programadas no aparelho chamado termociclador, onde as amostras são incubadas.
Na hora de preparar o programa para a amplificação, devem estar estabelecidos a
temperatura e o tempo exato de cada uma dessas fases e também o número de
repetições dos ciclos:
a) Desnaturação: é a fase na qual o DNA perde sua estrutura de dupla hélice, por
meio da elevação da temperatura, para cerca de 94°C a 95°C. A desnaturação
permite que os primers se liguem à região complementar à sua seqüência na
amostra de DNA. Desnaturação mais longa (hot start) no primeiro ciclo pode ser
utilizada com a finalidade de otimizar essa fase, permitindo o melhor anelamento
dos primers. O DNA genômico permanece desnaturado por todos os ciclos
subseqüentes, porque as fitas complementares estão em concentrações muito
baixas, o que impede a sua reunião. Os oligonucleotídeos ou primers, por sua vez,
estão em concentrações muito altas no master mix, fato que facilita o encontro das
regiões complementares (anelamento).
b) Anelamento. Uma vez desnaturado o DNA, a temperatura da reação é reduzida (a
temperatura de anelamento é sempre específica para cada par de primers). Dessa
forma, cada primer se encaixa nas respectivas seqüências complementares à
região-alvo da amplificação. A determinação da temperatura de anelamento para
um par ou conjunto de primers pode ser feita com o auxílio de programas de
computador específicos para essa finalidade. A temperatura de anelamento
depende, entre outros fatores, do tamanho do primer e de sua seqüência de
nucleotídeos.
c) Extensão. A temperatura é elevada até cerca de 72°C, para que a enzima DNA-
polimerase (Taq-DNA-polimerase) se posicione junto aos primers que se anelaram
anteriormente e, com o auxílio do magnésio, seja iniciada a síntese da nova fita. A
síntese da nova fita de DNA se inicia a partir dos primers ou iniciadores. A síntese
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
19
se dá por meio da utilização dos nucleotídeos (dNTPs) que foram adicionados ao
tampão e que são sempre complementares à fita-molde. Dessa maneira, são
formadas novas fitas de DNA de dupla hélice, correspondente a região-alvo de
amplificação (delimitada pelos primers).
Após o término de um ciclo (desnaturação, anelamento e extensão), todo o
processo é repetido várias vezes (40 vezes, em média), até que se obtenha grande
quantidade do DNA a ser amplificado. A cada ciclo de amplificação, o número de
cópias da seqüência-alvo é duplicado e, com a evolução dos ciclos da reação, ocorre
aumento exponencial do número dessas seqüências. O aumento do número de ciclos
não é aconselhado, em decorrência da redução da especificidade da reação.
13. ESCOLHA DOS PRIMERS OU INICIADORES
Algumas técnicas podem ser utilizadas para o desenvolvimento de primers ou
seqüências iniciadoras de PCR. Para fins de diagnóstico, a seqüência do gene rDNA é
rotineiramente utilizada, em razão da sua disponibilidade para grande número de
protozoários e outros parasitas. Os iniciadores podem ser designados a partir dessas
seqüências, porém, em virtude da grande conservação observada nesses genes,
reações cruzadas com outros organismos que não são alvo de interesse podem
ocorrer. Um método alternativo é a construção de bibliotecas de DNA genômico, em
que certas regiões do genoma do microrganismo obtidas por meio da digestão
enzimática são amplificadas por PCR e seqüenciadas. Esse método é caro, e demanda
tempo e grande quantidade de DNA, que pode ser difícil de se obter, dependendo do
microrganismo em questão. O uso da técnica de amplificação de DNA ao acaso
(RAPD) tem sido uma opção simples a ser utilizada. Essa técnica detecta
polimorfismos em seqüências de nucleotídeos de diferentes organismos isolados, sem
a necessidade de informação prévia sobre a seqüência analisada. Como é uma técnica
baseada em PCR, pequenas quantidades de DNA são suficientes para a análise.
Muitos dos produtos gerados pela RAPD−PCR são derivados de seqüências repetitivas
do DNA, portanto espécie-específicas e dessa maneira adequados para o
delineamento de técnicas de diagnóstico. As bandas de DNA geradas por RAPD−PCR
podem ser eluídas do gel e seqüenciadas, para que seqüências que tenham potencial
de uso como primers sejam selecionadas, analisadas e sintetizadas, com base nos
parâmetros de especificidade e de anelamento com a seqüência-alvo.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
20
14. PCR “MULTIPLEX”
A técnica de “multiplex” foi desenvolvida com a finalidade de, com um único
teste, altamente específico, promover a diferenciação entre várias espécies ou entre
vários gêneros simultaneamente. Essa forma de PCR envolve a amplificação
simultânea de mais de uma seqüência-alvo por reação, pela mistura de vários pares de
primers. Essa técnica é especialmente útil para análise de amostras que contenham
parasitas cuja distinção morfológica é difícil ou que se apresentem em número muito
baixo. Desse modo, primers altamente específicos são usados para amplificar
seqüências conhecidas do DNA, produzindo padrões únicos para cada espécie. Essa
técnica também pode ser utilizada em análises genômicas.
15. NESTED− −− −PCR
A PCR possibilita a amplificação de seqüências específicas contidas em uma
mistura complexa de DNA. Pode-se utilizar primers para amplificar um único lócus de
um genoma inteiro. A partir de uma única cópia do DNA contida na amostra, é possível
produzir rapidamente cerca de um bilhão de cópias de produtos de PCR. No entanto, a
capacidade de amplificar todas essas cópias aumenta a possibilidade de amplificação
de DNA que não seja o desejado. A especificidade da reação é determinada pela
especificidade dos primers. Por exemplo, se os primers usados se ligam a mais de um
lócus, mais segmentos de DNA podem ser amplificados. Para contornar esses
problemas, primers internos (nested) são desenhados e empregados para testar a
especificidade (o segmento de PCR que foi amplificado era realmente o que se
desejava amplificar?). Nessa reação ou sucessão de reações, dois pares de primers
amplificam uma região conhecida do genoma de um organismo qualquer. O primeiro
par de primers amplifica determinada região com número conhecido de pares de
bases. O segundo par nested primers se liga a região dentro do primeiro produto
produzindo um segundo produto de PCR que será menor do que o primeiro. Dessa
maneira, se o primeiro lócus a ser amplificado não for a seqüência esperada, a
probabilidade de o segundo par de primers funcionar é muito baixa. Essas reações
também servem para aumentar a sensibilidade das reações em cadeia, já que a
segunda reação (nested− −− −PCR) pode aumentar em cerca de 100 vezes a sensibilidade
das reações. Elas têm sido muito usadas para o diagnóstico de microrganismos em
amostras de DNA extraídas de espécimes clínicos diversos.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
21
No teste de PCR para diagnóstico de Babesia bigemina, a sensibilidade
estimada para as reações foi de 6 x 10
3
eritrócitos parasitados em 18 x 10
6
eritrócitos,
que corresponde à parasitemia de 0,00003%. Na nested− −− −PCR, a sensibilidade
estimada foi de 0,0000003%.
16. PCR QUANTITATIVA
A análise quantitativa por meio do estudo cinético da PCR pode ser feita
adicionando-se um corante fluorescente à reação. Com isso, conforme a reação
progride, a amplificação produz quantidades crescentes de DNA de dupla fita, que se
liga ao corante, resultando em aumento da fluorescência. Se for colocado em um
gráfico o aumento da fluorescência em relação ao número de ciclos, pode-se obter o
panorama completo da PCR, inclusive a quantidade inicial do DNA-alvo. Vários
equipamentos que realizam esse tipo de análise estão disponíveis comercialmente. As
reações quantitativas são muito utilizadas na determinação da expressão de genes
específicos e também em técnicas de diagnóstico, em que se pretende saber a
quantidade inicial de DNA presente na amostra.
17. ELETROFORESE DE ÁCIDOS NUCLÉICOS
Eletroforese é um método simples e muito eficiente para separar, para identificar
e para purificar fragmentos de DNA e de proteínas. Ela consiste na separação de
moléculas ionizadas (aminoácidos, peptídeos, proteínas − incluindo lipoproteínas e
glicoproteínas −, nucleotídeos, ácidos carboxílicos e outras substâncias de relevância
biológica), de acordo com sua carga elétrica e seu peso molecular. Moléculas com
carga negativa migram para o pólo positivo (ânodo) e moléculas com carga positiva
migram para o pólo negativo (cátodo).
Para haver migração, é preciso desequilibrar eletricamente duas regiões
extremas de um meio que contenha eletrólitos, no qual esteja dissolvida ou dispersa
uma substância com potencial para migrar. Para tanto, é estabelecida a diferença de
potencial entre dois eletrodos ligados aos terminais de uma fonte de corrente contínua
e dispostos em dois compartimentos, catódico e anódico; ambos os compartimentos
contém, em geral, uma solução-tampão. O meio físico de separação, igualmente
tamponado, se comunica através de suas extremidades com as soluções-tampão dos
eletrodos, fechando assim o circuito elétrico. A corrente elétrica, ao passar pelo meio,
conduzida pelos pequenos íons presentes na solução, dá ensejo ao deslocamento, por
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
22
exemplo, de partículas protéicas carregadas para determinado pólo. Pelo fato de as
proteínas serem substâncias anfóteras, ou seja, capazes de adquirirem carga positiva
ou negativa de acordo com o pH, é indispensável manter constante o pH do meio
durante a eletroforese, por meio do uso de soluções-tampão.
Os ácidos nucléicos, por possuírem carga total negativa (em decorrência do
grupamento fosfato), migram sempre em direção ao polo positivo (ânodo).
O sistema tampão usado consiste em duas partes: o tampão usado na
preparação do gel e o tampão da cuba eletrolítica, na qual se encontram os eletrodos
(ânodo e cátodo). Nos tampões das cubas e do gel, a corrente elétrica é conduzida por
íons, e nos eletrodos, por elétrons. Na presença de um sistema tampão adequado, a
hidrólise da água, que se dá na superfície dos eletrodos, permite a troca entre elétrons
e íons. O sistema tampão pode ser contínuo (o mesmo tampão é utilizado no gel e nos
eletrodos) ou descontínuo (quando diferentes composições ou concentrações de
tampão são utilizadas no gel e nos eletrodos).
O principal fator a ser considerado na escolha do tampão é a sua capacidade de
tamponamento. Os dois tampões mais usados na separação eletroforética de
moléculas de DNA são TAE (tampão tris-acetato-EDTA) e TBE (tampão tris-borato-
EDTA). Esses dois tampões possuem efeito ligeiramente diferente na mobilidade do
DNA. Apesar de o TAE ser mais utilizado, ele é mais facilmente exaurido durante
reações longas ou com alta voltagem. O TBE tem melhor capacidade tamponante, mas
deve ser evitado para purificação de DNA de géis.
A eletroforese pode ser conduzida em solução com gradiente de densidade ou
em diferentes meios de suporte, tais como papel-filtro, sílica-gel, membranas de
acetato de celulose, gel de agarose, amido ou poliacrilamida. O suporte deve ser
química e fisicamente inerte, de modo a não interferir na mobilidade das moléculas.
Em relação aos géis de agarose ou à poliacrilamida, a porosidade do gel
determina o poder de resolução das bandas e este geralmente é decorrente do grau de
polimerização entre os monômeros.
17.1. Eletroforese em gel de agarose
Quanto ao gel de agarose, o protocolo pode ser dividido em três estágios:
a) O gel é preparado com agarose na concentração adequada ao tamanho dos
fragmentos de DNA a serem separados.
b) As amostras de DNA são aplicadas nos pocinhos do gel. A voltagem e o tempo são
estabelecidos de modo a propiciar a separação ideal das amostras.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
23
c) O gel é corado e, se o brometo de etídio tiver sido incorporado, as seqüências de
DNA serão visualizadas na presença de luz ultravioleta.
17.2. Variáveis que afetam a migração do DNA através do gel de agarose
17.2.1. Concentração de agarose
Moléculas de DNA de fita dupla linear migram através da matriz de gel à taxa
inversamente proporcional ao logaritmo (base 10) do seu peso molecular. O peso
molecular do fragmento de interesse pode ser determinado por meio da comparação
entre a sua mobilidade e a mobilidade de padrões de DNA de peso molecular
conhecido. Essa é a característica mais importante da eletroforese em gel de agarose.
Ela propicia a caracterização dos fragmentos de DNA por tamanho reprodutível e de
forma acurada.
A concentração de agarose participa de modo importante na separação
eletroforética, porque é ela que determina a faixa de tamanho das moléculas de DNA
que podem ser separadas. As relações entre concentração de agarose e resolução de
moléculas lineares de DNA são apresentadas na Tabela 1.
Tabela 1. Limites de eficiência da separação de DNA em diferentes concentrações de
agarose.
Concentração de agarose no gel (%) Separação de moléculas de DNA (Kb).
Limites de eficiência
0,3 60 – 5,0
0,6 20 – 1,0
0,7 10 – 0,8
0,9 7 – 0,5
1,2 6 – 0,4
1,5 4 – 0,2
2,0 0,1
Fonte: Maniatis et al. (1982).
17.2.2. Conformação do DNA
Moléculas de DNA de mesmo peso, mas com conformação diferente, possuem
taxas de migração diferente. Na ausência de brometo de etídio, moléculas de DNA
circulares superenoveladas, como o dos plasmídios, migram mais rapidamente do que
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
24
moléculas lineares de mesmo peso molecular. O superenovelamento faz com que as
moléculas tenham mais facilidade para migrar através da matriz de gel.
O corante brometo de etídio é comumente adicionado ao gel ou ao tampão de
reação, mas pode também ser adicionado em uma solução para corar o gel após a
eletroforese. O corante reduz a mobilidade dos dúplices lineares e tem efeito
pronunciado na mobilidade de moléculas de DNA circulares fechadas. Com o aumento
da concentração de brometo de etídio, os superenovelamentos negativos são
gradualmente removidos, causando a diminuição na mobilidade do DNA. Isso ocorre
até a concentração crítica de corante livre, na qual não há mais superenovelamento,
geralmente entre 0,1 e 0,5 µg/mL. A partir desse ponto, a adição de brometo de etídio
acarreta a formação de superenovelamento positivo, causando aumento na mobilidade
das moléculas. Quando na reação existe gel com diferentes concentrações de brometo,
as moléculas de DNA circulares fechadas podem ser facilmente distinguidas dos seus
topoisômeros.
O brometo de etídio é usado comumente para visualização direta do DNA nos
géis. O corante é intercalado entre as bases empilhadas dos ácidos nucléicos e emite
fluorescência vermelho-alaranjada (560 nm) quando iluminado com luz ultravioleta (260
a 360 nm). Isso possibilita que sejam detectadas quantidades muito pequenas de DNA
(menos de 5 ng).
17.2.3. Intensidade de corrente
Em geral, fragmentos de DNA migram através do gel à taxa de migração
proporcional à voltagem aplicada. O aumento de voltagem faz com que a taxa de
migração de grandes fragmentos de DNA seja maior do que a de pequenos
fragmentos. Conseqüentemente, voltagens maiores são menos efetivas na separação
de grandes fragmentos de DNA. Para separar fragmentos de DNA grandes, o ideal é
realizar eletroforese com baixa concentração de agarose e sob baixa voltagem (~1
V/cm, em 0,5% de agarose).
A intensidade da corrente elétrica (i), a resistência do meio à migração (R) e a
diferença de potencial (ddp) ou a voltagem (V) são variáveis importantes no processo
eletroforético. A fonte de corrente contínua produz força eletromotriz, que é medida em
volts. A diferença de potencial (em volts) entre os eletrodos, ou melhor, o gradiente de
voltagem do meio (volts/m) é o resultado da multiplicação da resistência (em ohms) do
meio pela intensidade de corrente (em ampères) que flui por esse meio. A potência P
(em watts) desse sistema é o produto da voltagem (volts) e da intensidade de corrente
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
25
(em ampères). Para ocorrer migração eletroforética, deve haver compromisso entre a
intensidade de corrente i e a voltagem do meio V. Em resumo:
V = Ri e P = Vi ou Ri
2
.
Outras equações da eletricidade são de ajuda no entendimento da eletroforese.
Assim, a resistência de um sistema condutor é igual à sua resistividade (θ) multiplicada
pela razão 1/S, em que 1 é o comprimento do condutor e S é a área da sua seção reta.
Por sua vez, a resistividade é função inversa da condutividade (χ). Daí surge:
V = Ri = li / χS.
Esta equação mostra como a condutividade de um meio, função da concentração
eletrolítica, influencia a ddp (V) de um meio, ou melhor, como influencia o gradiente de
voltagem desse meio ou a intensidade de campo elétrico (E = V/1).
18. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO E
FRAGMENTOS DE DIGESTÃO EM GEL DE AGAROSE
Para a análise dos produtos de PCR em géis de agarose, a concentração do gel
deve ser escolhida de acordo com o tamanho do produto amplificado (ver Tabela 2).
Gel a 1% → →→ → 0,3 g de agarose para 30 mL de gel, que deve ser preparado com
tampão tris−borato−EDTA 1 X. Para isso, aplicar 5 µL de produto de amplificação +
1 µL de loading buffer (tampão de corrida).
Gel a 3% → →→ → 0,9 g de agarose de baixo ponto de fusão para 30 mL de gel, que deve
ser preparado com tampão tris−borato−EDTA 1 X. É utilizado para analisar o
resultado das digestões com enzimas de restrição. Aplicar todo o produto da
digestão (13 µL) + 2,6 µL de loading buffer.
Procedimento:
a) Pesar a agarose.
b) Colocá-la em um erlenmayer que contenha o volume necessário de tampão TBE 1
X.
c) Aquecer no forno de microondas, até iniciar a ebulição (aproximadamente trinta
segundos em potência média para gel de 30 mL). Agitar o frasco e retornar ao forno
de microondas por mais alguns segundos.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
26
d) Aguardar a redução da temperatura para aproximadamente 60°C e adicionar
brometo de etídio, na quantidade indicada para cada gel. Pode ser necessário
acrescentar água destilada, para repor aquela perdida por evaporação.
e) Verter no molde previamente nivelado e colocar os pentes.
f) Após a solidificação, colocar o gel na cuba de eletroforese e cobrir com tampão TBE
1 X.
g) Aplicar as amostras acrescidas de tampão de corrida e estabelecer a corrente de
acordo com o tamanho do gel.
h) A eletroforese deve ser realizada em TBE 1 X, em voltagem constante, na faixa de
2 a 5 V/cm (considerando a distância entre os eletrodos). Caso o fundo do gel
esteja muito corado, pode-se lavar o excesso de brometo por submersão em TBE 1
X por cinco a dez minutos.
CUIDADOS
O brometo de etídio é um potente agente mutagênico. Usar luvas e máscara
para preparar a solução de estoque e para manipular os géis.
A luz ultravioleta produz queimaduras severas. Usar máscara e óculos de
proteção adequados.
19. ELETROFORESE EM SISTEMA CAPILAR
Durante décadas, a eletroforese em placas de gel de poliacrilamida ou de
agarose foi intensamente utilizada como uma das ferramentas mais importantes dos
laboratórios de biotecnologia e de bioquímica para a análise de macromoléculas. Nos
últimos anos, porém, a eletroforese capilar tem apresentado vantagens em relação à
técnica de eletroforese em placas. Para a análise simultânea de amostras,
instrumentos de eletroforese capilar com arranjo de capilares são os mais utilizados.
Existem aparelhos que possuem desde um único capilar até 384 capilares,
possibilitando a maximização do tempo necessário para as mais diferentes análises,
desde detecção de resíduos de drogas até testes de paternidade.
A separação das macromoléculas é conduzida em tubos com dimensões de 15
a 100 µm de diâmetro interno e 36 a 100 cm de comprimento, preenchidos com um
eletrólito. O uso do capilar fornece vantagens sobre as placas de gel, por razões
geométricas: há elevada relação entre a área superficial e o volume interno, o que
permite a dissipação eficiente do calor gerado pela corrente elétrica e possibilita a
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
27
aplicação de campos elétricos elevados (100 a 500 V/cm). Isso resulta em separações
de alta eficiência, em alto poder de resolução e em reduzido tempo de análise.
Em geral, um aparelho de eletroforese capilar básico consiste de uma fonte de
alta tensão, capilares (geralmente de sílica fundida), eletrodos (de platina,
normalmente), e um detector apropriado. A fonte de alta tensão é aplicada nos
eletrodos de platina situados nos reservatórios com solução eletrolítica apropriada. As
extremidades do capilar são imersas nos reservatórios da solução, para completar o
contato elétrico. As amostras normalmente são introduzidas no capilar por métodos
eletrocinéticos, nos quais uma diferença de potencial é estabelecida entre o capilar e o
recipiente que contém a amostra, durante um tempo predeterminado.
O detector localiza-se em algum ponto do capilar, próximo ao reservatório de
saída.
A eletroforese capilar em gel é utilizada exclusivamente para separação de
macromoléculas, tais como oligonucleotídeos, fragmentos de DNA e proteínas. Essa
técnica teve início com a aplicação nas separações de DNA por tamanho molecular,
por meio de colunas preenchidas com gel, denominados géis químicos: um capilar é
tratado com um reagente que estabiliza o gel junto à parede do capilar, através de
ligações covalentes. Esse método foi descartado, dado o grande número de problemas
que surgiram, tais como aparecimento de bolhas (perda de condutividade), introdução
limitada de amostra, retenção de fragmentos com alto peso molecular e degradação do
gel por hidrólise. Tais problemas levaram à formulação de novos sistemas e que foram
denominados géis físicos.
Géis físicos são matrizes poliméricas hidrofílicas, dissolvidas em tampão
apropriado, que não são ligados à parede do capilar. Assim, eles podem ser
substituídos a cada separação, o que permite o aproveitamento do mesmo capilar por
centenas de vezes, sem perda de eficiência. A uma dada concentração de polímero, as
fitas poliméricas individuais começam a interagir umas com as outras e formam uma
estrutura em rede dentro do capilar, o que possibilita a separação dos fragmentos de
DNA. A concentração polimérica ótima depende do tamanho do DNA a ser separado.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
28
20. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO EM
SISTEMA CAPILAR
Antes da injeção no capilar, as amostras são desnaturadas em presença de
formamida, para evitar que a formação de estruturas secundárias afete a velocidade de
migração. Um padrão com fragmentos de tamanho conhecido é aplicado com as
amostras para permitir a estimativa do tamanho dos fragmentos analisados. Esse
protocolo é utilizado no equipamento IBI 3100 Avant

(Applied Biosystems).
Procedimento:
a) Preparar a mistura de formamida e o padrão interno com fragmentos de tamanho
conhecido: para cada amostra, colocar 8,85 µL de formamida Hi-Dy e 0,15 µL de
padrão (GS 500 ROX).
b) Aplicar esses 9 µL de mistura em um poço da placa de corrida.
c) Aplicar 1 µL de produto de PCR da sua amostra por poço.
d) Desnaturar as amostras (já na placa de corrida), durante cinco minutos, a 95ºC.
e) Colocar as amostras imediatamente no gelo após a desnaturação e manter aí por
cinco minutos.
f) Preparar a injeção das amostras no analisador e a obtenção dos dados no
computador, com o software Data Collection

(Applied Biosystems).
21. PROTOCOLOS DE AMPLIFICAÇÃO DE DNA PARASITÁRIO
21.1. PCR para Babesia bigemina
a) Separar as amostras de DNA, preparar o banho de gelo para os microtubos e retirar
os reagentes do master mix do congelador. As amostras de DNA não devem ter
contato com os reagentes do master mix.
b) Limpar a bancada com álcool.
c) Lavar as mãos e colocar luvas novas.
d) Marcar os microtubos para PCR (microtubo de 0,2 µL).
e) Preparo do master mix para PCR:
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
29
1 X X
H
2
O ultrapura
7,1 µL ____ µL
Tampão 10 X
1,25 µL ____ µL
MgCl
2 0,375 µL ____ µL
DNTP (20 mM )
0,125 µL ____ µL
BiIA (10 µM) 0,5 µL ____ µL
BiIB (10 µM) 0,5 µL ____ µL
Taq (5 U/µL) 0,15 µL ____ µL
f) Distribuir 10 µL do master mix por microtubo de 0,2 µL (PCR).
g) Adicionar 2,5 µL de DNA por tubo com o master mix (em local isolado, para evitar
contaminações).
h) Preparar o programa no termociclador, indicando as temperaturas de desnaturação,
de anelamento e de extensão, e incubar as amostras, de acordo com o esquema da
Fig. 1.
Fig. 1. Demonstração esquemática da programação dos ciclos da PCR com
temperatura (°C) e tempo de desnaturação, de anelamento e de extensão.
21.2. Nested− −− −PCR para Babesia bigemina
a) Preparar o banho de gelo e retirar os reagentes do master mix do congelador.
b) Limpar a bancada com etanol.
c) Lavar as mãos e colocar luvas novas.
95,0 95,0
64,0
72,0 72,0
4,0

30” 30”
30”
34 ciclos
4’

65,0
6466
30”
1
o
ciclo
72,0
30"
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
30
d) Marcar os microtubos para PCR.
e) Preparar o master mix para nested− −− −PCR (em tubo de 1,5 mL).
1 X X
H
2
O ultrapura
8,6 µL ____ µL
Tampão 10 X
1,25 µL ____ µL
MgCl
2 0,375 µL ____ µL
DNTP (20 mM )
0,125 µL ____ µL
BiIAN (10 µM) 0,5 µL ____ µL
BiIBN (10 µM) 0,5 µL ____ µL
Taq (5 U/µL) 0,15 µL ____ µL
f) Distribuir 11,5 µL do master mix em cada tubo de PCR.
g) Adicionar 1,0 µL da PCR aos tubos com o master mix (em local isolado para evitar
contaminações).
h) Preparar o programa no termociclador e incubar as amostras, de acordo com o
esquema da Fig. 2.
Fig. 2. Demonstração esquemática da programação dos ciclos da PCR com
temperatura (°C) e tempo de desnaturação, de anelamento e de extensão.
95,0 95,0
68,0
72,0 72,0
4,0

30”
30"
30”
34 ciclos


64,00
00
30”
1
o
ciclo
72
30"
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
31
A Tabela 2 mostra a seqüência dos primers de PCR e de nested−PCR de
Babesia bigemina e o tamanho dos produtos amplificados.
Tabela 2. Seqüência dos primers de PCR e de nested−PCR de Babesia bigemina e
tamanho dos produtos amplificados.
Seqüência* Primer Oligonucleotídeos (5' – 3') Produto (pb)
BiIA CATCTAATTTCTCTCCATACCCCTCC
PCR BiIB CCTCGGCTTCAACTCTGATGCCAAAG
278
BiIAN CGCAAGCCCAGCACGCCCCGGTGC
Nested− −− −PCR)
BiIBN CCGACCTGGATAGGCTGTGTGATG
170
* Seqüência amplifica a região do fragmento de restrição denominado Spel-Aval de Babesia bigemina.
Fonte: Figueroa et al. (1993).
22. ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAÇÃO DOS
PRODUTOS AMPLIFICADOS
Gel de agarose a 1,5%.
O gel de agarose é preparado na concentração de 1,5% para a visualização dos
produtos da PCR com aproximadamente 278 e 170 pares de bases.
Procedimento:
a) Pesar 0,45 g de agarose em um erlenmayer.
b) Dissolver em 30 mL de tampão tris−borato−EDTA (TBE) 1 X.
c) Aquecer no forno de microondas até iniciar a ebulição (aproximadamente trinta
segundos).
d) Agitar o frasco com cuidado (a agarose em ebulição tem tendência a transbordar).
e) Retornar ao forno de microondas por mais dois a três segundos.
f) Aguardar a redução da temperatura para aproximadamente 60°C e adicionar
brometo de etídio (acrescentar 1 µL de brometo para cada 10 mL de gel).
g) Verter no molde previamente nivelado e colocar os pentes.
h) Após a solidificação (o gel se torna opaco), colocar na cuba de eletroforese e cobrir
com tampão TBE 1 X (também pode ser utilizado tampão 0,5 X).
i) Aplicar 8 µL de amostra acrescidos de 2 µL de loading buffer (tampão da amostra).
j) Ligar a fonte e manter a 80 V por cerca de uma hora.
k) Visualizá-lo em transiluminador sob luz ultravioleta (Fig. 3).
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
32
CUIDADOS
O brometo de etídio é um potente agente mutagênico. Utilizar luvas e máscara
para preparar a solução de estoque e para manipular os géis.
Não olhar diretamente para a luz ultravioleta.
.
Fig. 3. Eletroforese dos produtos de
amplificação de DNA de Babesia
bigemina pelas técnicas de PCR (poços
2 e 3) e de nested− −− −PCR (poços 4 a 8).
1) Padrão de pares de bases; 2) DNA
de sangue de bovino; 3) Controle
positivo de B. bigemina; 4) DNA de
sangue bovino; 5) DNA de carrapato
Rhipicephalus (Boophilus) microplus; 6)
DNA de ovos de R. (B.) microplus; 7)
Controle positivo de B. bigemina; 8)
Controle negativo da reação (água
ultrapura esterilizada)
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
33
23. APÊNDICE
Preparo do fenol tamponado:
a) Colocar 250 mL de fenol líquido (ou 250 g de cristais de fenol fundido em banho-
maria a 65°C) em um frasco de vidro.
b) Adicionar 0,25 g de 8-hidroxiquinolina (antioxidante).
c) Adicionar 250 mL de tris−base (hidroximetilaminometano) 50 mM.
d) Agitar em temperatura ambiente por cerca de quinze minutos (usar agitador
magnético). Deixar repousar a 4°C até a separação das fases. Aspirar a fase
aquosa com cuidado.
e) Adicionar 250 mL de solução tris− −− −HCl 50 mM com pH 8,0 e novamente repetir os
procedimentos dos itens ”c” e ”d”. Verificar o pH da fase fenólica (para isso pode ser
usado o papel indicador) e repetir itens ”c” e “d” até que o fenol atinja o pH 8,0.
f) Finalmente, recuperar a fase fenólica, adicionar 125 mL de solução tris− −− −HCl 50 mM
com pH 8,0 ou tampão TE (tris− −− −HCl 10 mM, EDTA 1mM com pH 8,0) e estocar em
frascos escuros a 4°C para uso por até dois meses.
g) Nos protocolos de extração, utilizar a fase fenólica (amarelada) da solução de
estoque.
Solução anticoagulante com ácido cítrico:
a) Ácido cítrico 0,48 g.
b) Citrato de sódio 1,32 g.
c) Glicose 1,47 g.
d) Água ultrapura 100 mL.
e) Usar 3,5 mL para cerca de 20 mL de sangue.
Solução de estoque TBE (tris− −− −borato− −− −EDTA) concentrada 10 X:
Tris− −− −base
108 g
Ácido bórico 55 g
EDTA 0,5 M, com pH 8,0 40 mL
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
34
Solução de EDTA (ácido etilenodiaminotetracético) 0,5 M (pH 8,0):
a) Dissolver 186,1 g de Na
2
EDTA.2H
2
0 em 700 mL de água.
b) Ajustar o pH para 8,0 com solução de NaOH 10 M.
c) Adicionar água ultrapura, q.s.p. 1000 mL.
d) Esterilizar em autoclave a 121°C por quinze minutos.
Observações:
1) O EDTA é um agente quelante que impede a ação de enzimas sobre o DNA.
2) O EDTA é insolúvel em pH inferior a 8,0; por essa razão, é importante ajustar o pH
antes de completar o volume.
Solução-tampão tris−HCl (hidroximetilaminometano− −− −ácido clorídrico) 1 M:
a) Dissolver 121 g de tris− −− −base em 800 mL de água ultrapura.
b) Ajustar o pH com HCl concentrado. Cerca de 70 mL de HCl são necessários para
pH 7,4; e 42 mL, para pH 8,0.
c) Adicione água ultrapura até completar 1000 mL.
d) Autoclavar a 121°C por quinze minutos.
Obs.: O tris tem a função de manter constante o pH das soluções.
Solução-tampão TE (tris− −− −EDTA):
a) Tris−HCl 10 mM, com pH 7,4, 7,5 ou 8,0.
b) EDTA 1mM.
Tampão de corrida da amostra 6 X concentrado (estocar a 4ºC):
Azul de bromofenol a 0,25% 25 mg
Xileno cianol a 0,25% 25 mg
Solução aquosa de glicerol a 30% 10 mL
Tampão de lise 1:
Tris−HCl, com pH 8,0
10 mM
EDTA, com pH 8,0 10 mM
Dodecilsulfato de sódio (SDS) 0,5%
Solução de RNAse (adicionar no momento do uso)
20 µg/mL
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
35
Tampão de lise 2:
2-mercaptoetanol 2%
Tris−HCl, com pH 8,0
10 mM
NaCl 100 mM
EDTA, com pH 8,0 10 mM
SDS 0,5%
Obs.: Preparar no momento do uso.
Solução-tampão de fosfato (PBS):
KCl 2,7 mM
KH
2
PO
4
1,5 mM
NaCl 137 mM
Na
2
HPO
4
8 mM
pH 7,0
Solução de proteinase K (20 mg/mL):
Proteinase K 100 mg
Tris−HCl 10 mM (pH 7,5)
5 mL
Cloreto de cálcio 20 mM
Glicerol 50%
Obs.: Estocar a –20°C.
Tampão de digestão 1:
NaCl 100 mM
Tris−HCl, com pH 8,0
10 mM
EDTA, com pH 8,0 25 mM
SDS 0,5%
Proteinase K 0,1 mg/mL
Tampão de digestão 2:
Tris−HCl
10 mM
EDTA, com pH 8,5 1mM
Triton X-100 5%
Obs.: Estocar a –4°C.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
36
Solução de RNAse 1 (10 mg/mL):
RNAse 10 mg
Tris−HCl, com pH 7,5
10 mM
NaCl 15 mM
Obs.: Estocar a –20°C.
Solução de RNAse 2 (10 mg/mL):
RNAse 10 mg
Acetato de sódio (CH
3
COONa) 0,01 M, com pH 5,2 1 mL
Tris−HCl 1 M, com pH 7,4
0,1 mL
Obs.: Estocar a –20°C.
Solução de acetato de sódio 0,01 M:
Acetato de sódio (CH3COONa) 0,082 g
Água ultrapura 100 mL
Solução de CTAB a 10%:
CTAB (brometo de cetiltrimetilamônio) 10 g
Água ultrapura 100 mL
Solução de NaCl 5 M:
NaCl 292,25 g
Água ultrapura 1.000 mL
Solução-tampão para extração vegetal:
Soluções e reagentes Concentração final Volume (final = 10 mL)
CTAB a 10% 2% 2,0 mL
NaCl 5 M 1,4 M 2,8 mL
Tris−HCl 1 M, com pH 8,0
0,1 M 1,0 mL
EDTA 0,5 M 20 mM
400 µL
2-mercaptoetanol 0,4%
40 µL
Polivinilpirrolidona 1,0% 0,1 g
Água ultrapura 3,76 mL
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
37
24. REFERÊNCIAS
FIGUEROA, J. V.; CHIEVES, L. P.; JOHNSON, G. S.; BUENING, G. M. Multiplex
polymerase chain reaction based assay for the detection of Babesia bigemina, Babesia
bovis and Anaplasma marginale DNA in bovine blood. Veterinary Parasitology, v. 50,
p. 69-81, 1993.
MANIATIS, T.; FRITSCH, E. F.; SAMBROCK, J. Molecular cloning: a laboratory
manual. New York: Cold Spring Harbor Laboratory, 1982. 545 p.
OLERUP, O.; ZETTERQUIST, H. HLA-DR typing by PCR amplification with sequence-
specific primers (PCR-SSCP) in 2 hours: An alternative to serological DR typing in
clinical practice including donor-recipient matching in cadaveric transplantation. Tissue
Antigens, v. 39, p. 225-235, 1992.
25. BIBLIOGRAFIA CONSULTADA
AUSUBEL, F. M.; BRENT, R.; KINGSTON, R. E.; MOORE, D. D.; SEIDMAN, J. G.;
SMITH, J. A.; STRUHL, K. Current protocols in Molecular Biology. New York: Wiley
& Sons, 1996. 4800 p.
BRAMMER, S. P. Atualizações em técnicas celulares e moleculares aplicadas ao
melhoramento genético vegetal. Passo Fundo: Embrapa Trigo, 2002. 404 p.
DOYLE, J. J.; DOYLE, J. L. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochemical Bulletin, v. 191, p. 11-15, 1987.
FERREIRA, M. C.; GRATTAPAGLIA, D. Introdução ao uso de marcadores RAPD e
RFLP na análise genética. Brasília: Embrapa, Cenargen, 1995. 220 p.
KWOK, S.; HIGUCHI, R. Avoiding false with PCR. Nature, v. 339, p. 237-8, 1989.
LODISH, H; BALTIMORE, D., BERK, A; ZIPURSKY, S. L; MATSUDAIRA, P;
DARNELL, J. Molecular Cell Biology. New York: Scientific American Books, 1995.
1344 p.
MANIATIS, T.; FRITSCH, E. F.; SAMBROCK, J. Molecular cloning: a laboratory
manual. New York: Cold Spring Harbor Laboratory, 1982. 545 p.
MORGAN, U. M.; THOMPSON, R. C. A. Molecular detection of parasitic protozoa.
Parasitology, v. 117, p. 73-85, 1998.
MULLIS, K.; FALOONA, F. Specific synthesis of DNA in vitro via polymerase catalysed
chain reaction. Methods of Enzymology, v. 55, p. 335-350, 1987.
NELSON, D. L.; COX, M. M. Lehninger princípios de Bioquímica. 3
a
ed. São
Paulo: Sarvier Editora de Livros Médicos Ltda., 2004. 975 p.
OLIVEIRA, M. C. S.; OLIVEIRA-SEQUEIRA, T. C.; ARAUJO JR., J. P.; AMARANTE, A.
F. T.; OLIVEIRA, H. N. Babesia spp. infection in Boophilus microplus engorged females
and eggs in São Paulo State, Brazil. Veterinary Parasitology, v. 130, p. 61-67, 2005.
Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia
da polimerase
38
SILVA JÚNIOR, J. G. da. Eletroforese de proteínas: guia teórico e prático. Rio de
Janeiro: Interciência, 2001. 125 p.
WELSH, J.; MCCLELLAND, M. Fingerprinting genomes using PCR with arbitrary
primers. Nucleic Acids Research, v. 18, p. 7213-7218, 1990.
WILLIAMS, J. G. K.; KUBELIK, A. R.; LIVAK, K. J.; RAFALSKI, J. A.; TINGEY, S. V.
DNA polymorphisms amplified by arbitrary are useful as genetic markers. Nucleic
Acids Research, v. 18, p. 6531-6535, 1990.
ZARLENGA, D. S.; CHUTE, M. B.; MARTIN, A.; KAPEL, C. M. O. A multiplex PCR for
unequivocal differentiation of six encapsulated and three non encapsulated genotypes
of Trichinella. International Journal for Parasitology, v. 29, p. 141-149, 1999.
ZARLENGA, D. S.; HIGGINS, J. PCR as a diagnostic and quantitative technique in
veterinary parasitology. Veterinary Parasitology, v. 101, p. 215-230, 2001.
ZARLENGA, D. S.; STRINGFELLOW, F.; NOBARY, M.; LICHTENFELS, J. R. Cloning
and characterization of ribosomal RNA genes from three species of Haemonchus
(Nematoda, Trichostrongyloidea) and identification of PCR primers for rapid
differentation. Experimental Parasitology, v. 78, p. 28-36, 1994.

Empresa Brasileira de Pesquisa Agropecuária Embrapa Pecuária Sudeste Ministério da Agricultura, Pecuária e Abastecimento

Fundamentos teórico-práticos e protocolos de extração e de amplificação de DNA por meio da técnica de reação em cadeia da polimerase

Embrapa Pecuária Sudeste São Carlos, SP 2007

& .

!" !" ' - /

! #$ ! ! #$ % $ ' (() ) ) *+ ' ' * , - ' *, -0 + + 1 + ' ' * , - ' *, -

2 , 4 + - 5 - #. + 6 ,. 7 40 8 /9 ' 6 . - /9

-

* ' 3 - . 3 - 4 4 6 3 2 + -

-

-

'

3-

. 3 , , -5 : + 4 0 3 ' 3-0 + 6 -

2 '

+ 3-

2 - '+

/9

9 #

/9

-

' , + /9 -

' *! ; "* !

.

< - + #' -5 + '+ =82 ' - /9 -0 + ?* @ 6 5 -+ 4 ,- ' + 5- 4 ;;%* 6 2 + ' @@) ) ) *+ ' ' * , - ' *, -@ #, @ B = 8 2 *' :

+ 7

-

- /9 ' : + /9 ' >- + > *? A 4 9 -

- +

@' , + +

-

@

, + /C = ' E

,<

+ =# 7 6

D@ ; @ ; ; % " $;; ' "

" # $ % & ' !' ( !' ) & ) * !+ , !& * = 8 2 # . - /9 # * G* 7 - 6 5 -+ 4 * * =82 * GG* H E * == $ F *I
J . ,- ' ;;%

2

' : + /9

F

*

Autores
Márcia Cristina de Sena Oliveira Médica Veterinária, Dra., Embrapa Pecuária Sudeste, Rod. Washington Luiz, km 234, Caixa Postal 339, CEP: 13560-970, São Carlos, SP. Endereço eletrônico: marcia@cppse.embrapa.br Luciana Correia de Almeida Regitano Médica Veterinária, Dra., Embrapa Pecuária Sudeste, Rod. Washington Luiz, km 234, Caixa Postal 339, CEP: 13560-970, São Carlos, SP. Endereço eletrônico: luciana@cppse.embrapa.br Alexandre Dinnys Roese Engenheiro Agrônomo, Mestre, Embrapa Trigo, Rod. BR 285, km 294, Caixa Postal 451 CEP 99001-970 − Passo Fundo, RS Endereço Eletrônico: alex@cnpt.embrapa.br Denilson Gouvêa Anthonisen Bacharel em Química, Mestre, Embrapa Clima Temperado, Rod. BR 392, km 78, 9º Distrito, Monte Bonito, Caixa Postal 403 CEP 96001-970 − Pelotas, RS Endereço Eletrônico: denilson@cpact.embrapa.br Epaminondas do Patrocínio Bacharel em Química, Embrapa Mandioca e Fruticultura, Rua Embrapa, s/n, Caixa Postal 007 CEP 44380-000 − Cruz da Almas, BA Endereço Eletrônico: epami@cnpmf.embrapa.br Márcia Maria Parma Bacharel em Química, Embrapa Meio Ambiente, Rod. SP 340, km 127m5, Tanaquinho Velho, Caixa Postal 69 CEP 13820-000 − Jaguariúna, SP Endereço Eletrônico: mmparma@cnpma.embrapa.br Sandra Maria Mansur Scagliusi Bióloa, Mestre, Dra., Embrapa Trigo, Rod. BR 285, km 294, Caixa Postal 451 CEP 99001-970 − Passo Fundo, RS Endereço Eletrônico: mansur@cnpt.embrapa.br Wilston Henrique Belem Timóteo Licenciado em Matemática, Mestre, Embrapa Milho e Sorgo, Rod. MG 424, km 45, Caixa Postal 151 CEP 35701-970 − Sete Lagoas, MG Endereço Eletrônico: wilston@cnpms.embrapa.br Silvia Neto Jardim Bióloga, Dra., Embrapa Milho e Sorgo, Rod. MG 424, km 45, Caixa Postal 151 CEP 35701-970 − Sete Lagoas, MG Endereço Eletrônico: silvia@cnpms.embrapa.br

.............................................................4 EXTRAÇÃO DE DNA DE AMOSTRAS DE TECIDOS DE MAMÍFEROS.................................... INTRODUÇÃO À TECNICA DE PCR ..........10 8......................2..................... Extração de DNA de amostras de sangue com a utilização de colunas de extração...........7 7.............28 21............ PCR “MULTIPLEX” .................. Protocolo de extração de DNA de sangue mediante precipitação com sal . Digestão da amostra ................................. 2............................................................. EXTRAÇÃO DE DNA DE PLANTAS...................................... 5..........19 14.......14 11............................................................................................3 CUIDADOS DURANTE E APÓS A EXTRAÇÃO DE DNA................. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO EM SISTEMA CAPILAR ....................................2........................................3................................................................. REFERÊNCIAS BIBLIOGRÁFICAS........28 21................................31 23................2 OBTENÇÃO DE AMOSTRAS PARA EXTRAÇÃO DE DNA.................................. PCR para Babesia bigemina.................................20 15.....................1.....................................................5 6........................................................2................... PCR QUANTITATIVA .......................... Material (ver Apêndice) ..............................................................5 6............ Protocolo de extração de DNA de ovos de carrapatos com a utilização de colunas de purificação............................................................16 13.. PROTOCOLOS DE AMPLIFICAÇÃO DE DNA PARASITÁRIO........................2................................. ELETROFORESE DE ÁCIDOS NUCLÉICOS ............ PROTOCOLOS EMPREGADOS NA EXTRAÇÃO DE DNA DE AMOSTRAS DE ARTRÓPODES COM UTILIZAÇÃO DE COLUNAS DE PURIFICAÇÃO ...................8 7..........................21 17......................................................................... Purificação do DNA por meio de precipitação com etanol................................................................................................................................................ ELETROFORESE EM SISTEMA CAPILAR ... Protocolo para extração de DNA de amostras de carrapatos com colunas de purificação11 8.......................... ESCOLHA DOS PRIMERS OU INICIADORES...... Extração do DNA com fenol .........23 18.................... APÊNDICE ...........................SUMÁRIO INTRODUÇÃO ......................................... PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO E FRAGMENTOS DE DIGESTÃO EM GEL DE AGAROSE.....1........................................... 4...............................................6 7.........................4 MATERIAL NECESSÁRIO PARA EXTRAÇÃO DE DNA ..28 21..............21 17.........29 − 22............................20 − 16..................33 24.............. ............................16 12..........37 1....25 19.................................... Eletroforese em gel de agarose.... LEITURA DA CONCENTRAÇÃO DE DNA NAS AMOSTRAS ..................................................4..................... 6.........................................................................................................1..........................................11 8.........2............................................................... 3................. PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAÇÃO DE DNA DE AMOSTRAS DE SANGUE................... Nested−PCR para Babesia bigemina......................................... ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAÇÃO DOS PRODUTOS AMPLIFICADOS........22 17.............................................5 6............................................... Extração de DNA de amostras congeladas de sangue...1.....1 CARACTERIZAÇÃO MOLECULAR DOS ÁCIDOS NUCLÉICOS .....................................................................................................13 10......... Variáveis que afetam a migração do DNA através do gel de agarose ....12 9......................................... NESTED−PCR .....................................................5 6................................... EXTRAÇÃO DE DNA DE AMOSTRAS DE SÊMEN .......1.......................................................................................................... BIBLIOGRAFIA CONSULTADA.........................37 25....................................................................................3.............................26 20........7 7......................

em razão da facilidade relativa com que é possível amplificar in vitro regiões específicas do genoma de qualquer organismo. com a finalidade de se obter melhores resultados nas amplificações. No entanto. Neste manual apresentam-se. Após a lise das células. alguns cuidados são aconselháveis. de maneira simples. apresenta alta estabilidade e é muito resistente e se mantém inalterado em várias condições de meio. para que seja evitada a degradação das amostras obtidas em laboratório. fungos. de maneira a se conseguir DNA de boa qualidade. Essa técnica tem sido amplamente empregada em estudos moleculares. O DNA. em sua forma original de dupla fita. desde a obtenção do ácido nucléico até a reação de amplificação propriamente dita. adaptados e otimizados. INTRODUÇÃO A extração e a purificação de ácidos nucléicos a partir de diversas amostras experimentais (bactérias. alguns fundamentos da análise de DNA. A PCR possibilita a amplificação de seqüências de DNA que estejam presentes em misturas complexas e permite estudos de natureza variada. . A extração de DNA inclui basicamente dois procedimentos principais: a lise das células presentes na amostra e a purificação do DNA. precipitado e suspenso em volume adequado de água ultrapura ou soluções-tampão adequadas. existe a necessidade da adequada padronização dos protocolos a serem utilizados em todas as fases dos procedimentos. Para cada tipo de amostra. o DNA deve ser separado dos restos celulares e das proteínas.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 1 FUNDAMENTOS TEÓRICO-PRÁTICOS E PROTOCOLOS DE EXTRAÇÃO E DE AMPLIFICAÇÃO DE DNA POR MEIO DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE1 1. tecidos vegetais e tecidos animais) é uma etapa fundamental para se obter alta eficiência de amplificação nos protocolos que usam a reação em cadeia da polimerase (PCR). tais como desenvolvimento de métodos de diagnóstico altamente sensíveis e específicos. vários protocolos podem ser testados. As amostras de DNA podem também ser submetidas a processos de concentração e de purificação. PCR. 1 Polimerase chain reaction. obtenção de grandes quantidades de DNA para seqüenciamento e análises sobre a diversidade genética de populações. Apesar da facilidade de amplificação de DNA possibilitada pela técnica de PCR.

A unidade básica tanto do DNA como do RNA são polímeros de subunidades monoméricas. caso contrário.2 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 2. conhecidas por genes. guanina e citosina são encontradas tanto nas moléculas de DNA como de RNA. citoplasma e núcleo). Durante o processo de polimerização do ácido nucléico. Em seu estado nativo. cada célula contém duas cópias de cada tipo de cromossomo. nas de RNA. a desoxirribose. sobre o fosfato α ligado ao carbono 5` da pentose (5`-PO4) do nucleotídeo que será incorporado. chamados diplóides. O DNA apresenta diferentes seqüências de nucleotídeos. enquanto timina aparece exclusivamente nas moléculas de DNA e uracila. O gene é definido como o segmento de DNA que codifica a informação requerida para a produção de determinado polipeptídeo ou de um segmento de RNA. do objetivo de cada trabalho. Formas alternativas dos genes são denominados alelos e a totalidade do DNA presente na célula é chamada de genoma. um originário da mãe e outro do pai. CARACTERIZAÇÃO MOLECULAR DOS ÁCIDOS NUCLÉICOS As células vivas são capazes de preservar e de transferir a informação genética para as novas gerações por meio da complementaridade estrutural das moléculas de ácidos nucléicos: o DNA e o RNA. do resíduo de nucleotídeo mais externo da cadeia. Nestes organismos. o DNA é encontrado no núcleo das células e também nas mitocôndrias e nos cloroplastos. enquanto as demais células contém os dois alelos em igual freqüência. a ligação de um nucleotídeo à cadeia em extensão ocorre pela ação nucleofílica de uma hidroxila da pentose (3’-OH). dependendo. Tanto o DNA quanto o RNA são utilizados na pesquisa. uma pentose (molécula de açúcar com cinco carbonos) e uma base nitrogenada. As bases adenina. As moléculas de DNA e de RNA consistem de apenas quatro tipos de nucleotídeos. Na maioria dos organismos. Em organismos eucarióticos (cujas células apresentam-se organizadas com membrana. Os genes estão organizados em cromossomos e a sua posição no cromossomo é denominada lócus. resultando na liberação de um íon difosfato. ele é denominado heterozigoto. e. o . que estão arranjados em seqüência precisa. Os nucleotídeos são compostos precursores da síntese dos ácidos nucléicos que contém um grupo fosfato. O princípio da segregação estabelece que cada célula reprodutiva originária de indivíduos heterozigotos contém apenas um dos dois alelos. A pentose que compõe o RNA é sempre a ribose e o DNA. Se os dois alelos de um lócus não podem ser diferenciados pela sua seqüência de nucleotídeos. denominadas nucleotídeos. principalmente. que formam diferentes unidades. cada indivíduo possui dois alelos para cada lócus. ele é chamado de homozigoto para o lócus considerado.

Os vírus apresentam quantidade reduzida de informação genética. Com base nas características estruturais dos ácidos nucléicos. porém. produzindo fragmentos de comprimento menor. O cromossomo da Escherichia coli contém cerca de 0.300 proteínas diferentes. que serão apresentados em detalhe.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 3 DNA apresenta-se arranjado em dupla hélice. ela caiu em desuso. existem as chamadas enzimas de restrição. cerca de 4 x 106 pares de bases que codificam cerca de 3. Um fragmento de DNA marcado por uma substância radioativa é usado como sonda para determinar a presença da fita complementar em uma amostra específica. porque usam recursos da célula hospedeira para se reproduzir. com as fitas das seqüências complementares ligadas entre si por pontes de hidrogênio entre as bases nitrogenadas. Outros tipos de manipulação de DNA incluem a amplificação (utilizando a técnica de PCR) e a eletroforese. A hibridização é a técnica que se baseia na complementaridade entre as fitas de DNA. definidos geralmente pela seqüência de bases distribuídas ao longo da molécula. Amostras de sangue e de outros tecidos animais devem ser refrigeradas até chegarem ao laboratório.0044 picogramas de DNA. Apesar do tamanho relativamente pequeno da informação genética contida em bactérias e vírus. As partes da planta devem ser lavadas e enxaguadas com água destilada . A clivagem é outra técnica que pode facilitar a manipulação do DNA. O DNA de todas as bactérias (organismos procarióticos) e de muitos vírus são arranjados de forma circular. Os seres humanos apresentam ao redor de três bilhões de pares de bases que codificam de 50 a 100 milhares de genes em 24 cromossomos. OBTENÇÃO DE AMOSTRAS PARA EXTRAÇÃO DE DNA As amostras perecíveis devem ser acondicionadas de forma adequada até o momento de serem submetidas à extração do DNA. que são capazes de cortar o DNA em sítios específicos. Para esse fim. 3. Essa técnica foi muito utilizada em testes de diagnóstico. o DNA desses organismos precisa ser compactado para que possa ser contido nessas células. armazenadas e refrigeradas. algumas técnicas moleculares são utilizadas na manipulação do DNA dos organismos. quando comparados aos organismos celulares. atualmente em conseqüência de sua baixa sensibilidade e de problemas advindos do uso de radioatividade. As enzimas de restrição são sintetizadas naturalmente por muitas bactérias e centenas (com especificidade para diferentes sítios de restrição) estão disponíveis comercialmente. Amostras de tecidos vegetais também devem ser cuidadosamente colhidas.

. Todo o material plástico (polipropileno) utilizado deve ser esterilizado e novo (não deve ser usado material reciclado). 5. c) Banho-maria com termostato ou com termômetro para aferição da temperatura. b) Capelas de exaustão. para dependendo que o do tempo não de armazenamento. e) Microtubos de polipropileno. É aconselhável que a centrífuga tenha controle de refrigeração. bastões de vidro). Para melhor conservação. enzimas que normalmente estão presentes nos fluidos corporais liberados principalmente nas mãos das pessoas. –80° C. o material plástico e todas as soluções utilizadas nos procedimentos. para que uma parte dos ácidos nucléicos não sejam degradados por nucleases. O material mínimo necessário é o seguinte: a) Centrífuga com rotor para vários tipos de tubos (ou para o tipo de tubo empregado no laboratório). O manuseio dessas amostras deve ser feito preferencialmente com o uso de luvas. as amostras devem ser mantidas em temperatura o fracionamento em de –20° C a alíquotas. g) Gelo e nitrogênio líquido. CUIDADOS DURANTE E APÓS A EXTRAÇÃO DE DNA Com a finalidade de se obter amostras de DNA adequadas aos protocolos de amplificação. 4. quando necessário. MATERIAL NECESSÁRIO PARA EXTRAÇÃO DE DNA Para executar os protocolos de extração de DNA. f) Micropipetas automáticas para volumes diversos (com ponteiras). para que as amostras apresentem boa qualidade e para que se diminuam os riscos de contaminação entre amostras no momento da análise. d) Vidraria para preparo das amostras (provetas.4 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase ou submetidas a processo de esterilização superficial. esse material não deve ser empregado durante o processo de extração. Para utilização de amostras conservadas em estoque. é importante que exista uma sala exclusiva para esse fim. O DNA apresenta grande afinidade pelo vidro e pode ser adsorvido na presença de alguns sais. é necessário que o laboratório tenha os equipamentos básicos. que poderiam contribuir para a oxidação do tecido e para a degradação do DNA. pipetas. é interessante pequenas material sofra descongelamentos sucessivos. por isso. de acordo com o objetivo dos estudos a serem realizados.

g) Solução de dodecilsulfato de sódio (SDS) a 0. Extração do DNA com fenol O método mais utilizado para purificação do DNA é a extração com fenol tamponado.2 mL de tampão para cada 100 mg de tecido) e colocadas em banho-maria em temperatura próxima a 50° para que ocorra a C. A mistura de fenol e de clorofórmio é muito eficiente para desproteinizar e sua ação se fundamenta na propriedade hidrófoba das proteínas que apresentam afinidade por solventes orgânicos. submetidas a congelamento em nitrogênio líquido e rapidamente pulverizadas por processo manual (utilizando um bastão) ou mecânico (utilizando equipamentos para esse fim).1%.5 M. Material (ver Apêndice) a) Tampão de digestão 1. O clorofórmio também é usado como agente desnaturante das proteínas contidas na amostra. j) Microtubos de polipropileno. apresente aspecto viscoso.1. b) Solução de fenol. h) Nitrogênio líquido. EXTRAÇÃO DE DNA DE AMOSTRAS DE TECIDOS DE MAMÍFEROS 6. d) Etanol absoluto. Quantidades da amostra (entre 200 mg e 1 g) são adicionadas a uma solução-tampão de digestão (na proporção de 1. as amostras podem ser cortadas.2. O álcool isoamílico previne a formação de espuma quando a . Para produzir a fragmentação. e) Etanol a 70%.3. 6. usar fenol tamponado. EDTA 1 mM. tris = hidroximetilaminometano). clorofórmio e álcool isoamílico (25:24:1). c) Acetato de amônio 7. f) Tampão TE (tris−HCl 10 mM. digestão. com pH 8. 6.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 5 6. ou até que a amostra se apresente totalmente digerida. para essa solução.0. que provoca a desnaturação das proteínas de maneira eficiente. i) Frascos e bastões esterilizados. ou seja. Digestão da amostra As amostras de tecidos de origem animal ou vegetal que serão submetidas à extração de DNA devem sofrer fragmentação e digestão enzimática das proteínas. O tempo de incubação pode variar entre oito e dezesseis horas.

Centrifugar a 1. Embora tanto o cloreto de sódio como o acetato de sódio e o acetato de amônio sejam eficazes na precipitação do DNA. A extração com o fenol é dependente do pH. de clorofórmio e de álcool isoamílico (25:24:1). em razão da sua menor solubilidade em etanol.700 g e transferir o sobrenadante para um novo tubo. centrifugar novamente a 1.700 g por dois minutos. Metodologia para tamponamento do fenol está descrita no Apêndice.700 g por cerca de dois minutos (o tempo deve ser ajustado de acordo com a amostra). é mais difícil remover o cloreto de sódio. ajuda a remover resíduos de fenol e de clorofórmio presentes na amostra.0 (fenol tamponado). fazendo-as se agregarem.f). A precipitação com etanol absoluto. Após a adição da solução de extração. as amostras podem ser incubadas em agitador a 65° por algumas horas. o que torna mais fácil a separação da fase orgânica e da fase aquosa. 6. C . Em pH 7. Nesse último caso. Procedimento: Adicionar meio volume de solução de acetato de amônio 7.0. A proteína que foi desnaturada pelo tratamento com fenol e clorofórmio forma uma camada na interface das duas fases. Ressuspender o pellet em etanol a 70% (para eliminar impurezas presentes na amostra). o DNA permanece na fase aquosa e em pH abaixo de 7. com conseqüente precipitação.1. ele é desnaturado e migra para a fase orgânica. Para extrair o DNA de uma amostra. O etanol a 70% é utilizado para remover resíduos de sais. pelo fato de serem extremamente cáusticas. centrifugar a amostra por dez minutos a 1.5 M e dois volumes de etanol absoluto. Purificação do DNA por meio de precipitação com etanol A precipitação do DNA é feita por meio da utilização de etanol absoluto associado a uma solução com alta concentração de um sal catiônico.4. já que faixas mais baixas de pH deslocam o DNA para a interface na hora da centrifugação. voláteis e irritantes para as mucosas. usar igual volume de solução de fenol. Para facilitar a completa dissolução do DNA nesse tampão. o RNA permanece na fase aquosa. Eliminar a solução alcoólica e preservar o pellet de DNA.0 ou acima. O fenol empregado nas extrações de DNA deve ter o pH próximo de 8. Cuidado: A manipulação de soluções que contêm fenol exige cuidado. além de concentrar o DNA. Descartar o sobrenadante e deixar secar o pellet de DNA. O etanol induz a transição estrutural nas moléculas de ácido. Ressuspender o DNA em tampão TE (ver item 6.6 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase mistura é agitada. separando-se do DNA que se mantém na fase aquosa.

PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAÇÃO DE DNA DE AMOSTRAS DE SANGUE Existem muitos tipos de protocolos e muitos kits comerciais para a extração de DNA que se adaptam a diversos tipos de amostras. para que se consiga a amplificação adequada. quando se extrai DNA de uma amostra. Para exemplificar. é preciso obter amostras muito puras. A extração de DNA a ser empregada na PCR com fins de diagnóstico deve seguir um protocolo em que a obtenção de amostras de alta pureza é fundamental. por exemplo o GFX (GE Healthcare). Existem vários métodos para extração de ácidos nucléicos que podem ser usados no estudo de parasitas. Nos protocolos de extração de DNA com a finalidade de amplificação por meio da técnica de PCR.1. A purificação do DNA é feita por meio do uso de uma coluna que contém fragmentos de sílica (coluna de purificação). Vários kits disponíveis no mercado. para o diagnóstico da tristeza parasitária dos bovinos. Inicialmente. para pesquisa de hemoparasitas. A heparina não é indicada como anticoagulante. O volume a ser submetido à extração é muito importante. O sangue colhido com citrato de sódio (ver Apêndice) ou com EDTA pode ser armazenado por cerca de sete dias a –4° ou durante vários anos a –80° C C. em razão da pequena quantidade de DNA algumas vezes presente nesses agentes. é necessária a otimização do processo. por causa da sua propriedade inibitória sobre a PCR. no entanto. no Laboratório de Sanidade Animal da Embrapa Pecuária Sudeste. O genoma de qualquer microrganismo é muito menor do que o de um mamífero e. Para cada tipo de tecido podem ser testadas adaptações. a extração do DNA de sangue de um bovino. são usados como anticoagulantes o citrato de sódio e o ácido etilenodiaminotetracético (EDTA). de acordo com as características de cada espécime a ser analisado. podem ser empregados. o DNA se liga à membrana da coluna de extração e depois . produz a mistura de DNA que contém o ácido nucléico do hospedeiro e o ácido nucléico de todos os microrganismos presentes na amostra de sangue. A grande dificuldade verificada em alguns casos é que. Extração de DNA de amostras de sangue com a utilização de colunas de extração Este protocolo foi adaptado para extração de DNA de amostras de sangue de bovinos. mesmo porque em alguns procedimentos ele é extremamente restrito (amostras podem ser colhidas com swabs ou de esfregaços de sangue e de cortes histológicos). existe a mistura de ácidos nucléicos do hospedeiro e de ácidos nucléicos de outros microrganismos que podem estar presentes no tecido.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 7 7. 7.

8 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase ele é lavado até que apresente alta pureza. e transferir o conteúdo do microtubo para a coluna de extração. 25 mL). Protocolo de extração de DNA de sangue mediante precipitação com sal Este protocolo. 50 µL. com pH 7. incubar por um minuto. 7. em temperatura ambiente. e) Centrifugar a 5. . autoclavada e aquecida a 70ºC. descartar o conteúdo do tubo coletor. descartar o conteúdo do tubo coletor.000 g por um minuto. h) Transferir a coluna para um microtubo de 1. em temperatura ambiente. i) Adicionar 100 µL de água ultrapura. deixando cerca de 50 µL. o DNA é eluído com água quente ou com tampão TE. g) Adicionar à coluna 500 µL de solução de lavagem e centrifugar a 20.000 g por um minuto. c) Homogeneizar a amostra e adicionar 500 µL de solução de extração.p.2. No final do protocolo. b) Homogeneizar e centrifugar a 20. a) Tris−HCl 1 M. Soluções: • Solução A (tampão de hemólise) para cada amostra de 25 mL: 250 µL.800 g por cinco minutos e descartar o sobrenadante. limpo e livre de enzimas que decomponham o DNA. descartar o conteúdo do tubo coletor. d) Incubar por cinco minutos. Procedimento: a) Colocar 300 µL de sangue e 900 µL de solução de lise. A utilização de kits permite a purificação do DNA nas amostras de maneira homogênea e rápida. f) Adicionar à coluna 500 µL de solução de extração e centrifugar a 5. obtendose assim a solução de DNA.800 g por três minutos. em microtubo de 1. 250 µL.000 g por um minuto.5 M (concentração final de 5 mM) c) NaCl 5 M (concentração final de 10 mM) d) Completar com água ultrapura (q.s.5 mL. adaptado de Olerup & Zetterquist (1992). é usado no Laboratório de Biotecnologia da Embrapa Pecuária Sudeste e pode ser empregado com volumes pequenos de sangue. Acoplar a coluna de extração ao tubo coletor. e centrifugar a 5.5 mL.6 (concentração final de 10 mM) b) MgCl2 0. O DNA pode ser eluído em tampão TE também aquecido a 70° C.

para não descartar as células brancas (esta etapa é opcional). 460. usar o vortex. b) Centrifugar durante cinco minutos a 390 g e descartar o plasma. Se o pellet for muito pequeno. 12.5 mL. C .5 M. com pH 8. usando pipeta. Obtenção de leucócitos: a) Colher 5 mL de sangue em tubos com anticoagulante EDTA.5%) e) Proteinase K (concentração final de 20 mg/mL) f) H2O ultrapura • Para a precipitação do DNA: a) Etanol absoluto gelado (manter a 5° C). se preciso.000 rpm por dez minutos a 4ºC.0 µL. e homogeneizar. Para isso.000 g e descartar o sobrenadante. Centrifugar a 2. completando com solução salina (solução de cloreto de sódio 0. e) Dispensar o sobrenadante.9 M). Centrifugar por um minuto a 16.0 (concentração final de 10 mM) b) NaCl 5 M (concentração final de 100 mM) c) EDTA 0. g) Repetir a lavagem. com cuidado.5 µL. misturando bem por inversão ou agitando os tubos no vortex. i) O pellet pode ser conservado a −20° ou em temperatura menor. 10 µL. até obter somente células brancas. b) Etanol a 70% gelado (manter a 5° C). f) Ressuspender o pellet em 5 mL do tampão de hemólise. c) Lisar os glóbulos vermelhos com 10 mL (5 mL no tubo de colheita e 5 mL em tubo de polipropileno com capacidade para 15 mL) da solução A. com pH 8.0 (concentração final de 10 mM) d) Dodecilsulfato de sódio a 20% (concentração final de 0. tampar os tubos com Parafilm e misturar bem por inversão e.5 µL. centrifugar novamente.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 9 • Solução B (para cada amostra de 500 µl): 5 µL. por vários meses. 2. a) Tris−HCl 1 M. Acertar os volumes dos tubos. d) Centrifugar durante dez minutos a 700 g na temperatura de 4° C. 10 µL. h) Ressuspender o pellet em 500 µL de tampão de hemólise (solução A) e passar para microtubos de 1.

Procedimento: a) Descongelar a amostra de sangue em temperatura ambiente e adicionar igual volume de tampão PBS. h) Lavar com 500 µL de etanol a 70%. Centrifugar por quinze minutos a 16. d) Incubar por quinze minutos em gelo. Acrescentar 240 µL de NaCl 5 M. Centrifugar por cinco minutos a 16. Revolver o tubo. g) Ligar o banho-maria a 37ºC.3. com pH 8. Descartar o sobrenadante. De vez em quando.000 g. até formar pequenos coágulos de proteína. Solução de proteinase K (20 mg/mL). . Solução de acetato de amônio 10 M. c) Ajustar o volume para 760 µL com tampão TE (210 µL). Obs. b) Incubar a 55° até dissolver o pellet (durante quatro a seis horas ou de um dia C. e) Agitar os tubos por inversão. para que o pellet fique bem dissolvido. Adicionar 250 µL de tampão TE + solução de enzima que degrada RNA (RNAse – 10 µg por mL de amostra) e incubar por uma hora a 37ºC.0. f) Dividir todo o sobrenadante em dois tubos novos (devidamente marcados). Etanol absoluto. Tampão de lise 1. Adicionar 1 mL de etanol absoluto gelado e inverter o tubo várias vezes. misturar as amostras no vortex. Descartar e colocar a secar (temperatura máxima de 40ºC). 7. gelado. Centrifugar por quinze minutos a 16.10 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase Obtenção do DNA: a) Ressuspender o pellet em 500 µL de solução B e misturar no vortex.000 g. Extração de DNA de amostras congeladas de sangue Soluções utilizadas (Ver Apêndice): • • • • • • Tampão PBS. para o outro).: destruir bem o pellet antes de incubar. Tampão TE. 500 µL em cada um. Secar com papel (com cuidado).000 g.

a 4° C.500 g por quinze minutos. h) Centrifugar a 5.0 para cada 0. 8.1 mL de células extraídas. misturando algumas vezes. cerca de 20 mg de tecido de carrapato macerado são usados para extração. l) Retirar com uma alça o DNA desidratado. que dependerá basicamente do peso da amostra. com cuidado. por mais duas vezes. k) Adicionar à fase aquosa dois décimos de volume de solução de acetato de amônio 10 M e dois volumes de etanol absoluto. invertendo o tubo várias vezes. Uma limitação dos kits que possuem a membrana de sílica é que as amostras devem apresentar peso limitado à capacidade máxima indicada no manual. e) Adicionar solução de proteinase K.000 g por quinze minutos.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 11 b) Centrifugar a 3. Soluções que não estão no kit (ver o Apêndice): . e transferir para outro microtubo ou. Como regra. Outros artrópodes menores podem ser processados inteiros. que se apresenta em suspensão na solução aquosa.000 g por cinco minutos e descartar o sobrenadante. f) Incubar a 50° por três horas. Protocolo para extração de DNA de amostras de carrapatos com colunas de purificação Nesse protocolo foi empregado o kit GFX (GE Healthcare). Misture duas fases. por período de tempo variável. c) Remover o sobrenadante e suspender o pellet em 15 mL de tampão de lise (incubar por cerca de uma hora a 37° C). j) Repetir a extração com fenol. PROTOCOLOS EMPREGADOS NA EXTRAÇÃO DE DNA DE AMOSTRAS DE ARTRÓPODES COM UTILIZAÇÃO DE COLUNAS DE PURIFICAÇÃO A preparação de amostras de artrópodes para extração de DNA exige boa digestão de todo o material.1. d) Transferir o lisado para tubos de centrifugação em quantidade que ocupe apenas 1/3 do tubo. m) Deixar evaporar todo o etanol residual. centrifugar a 5. de modo a obter a concentração final de 100 µg/mL e misturar. n) Adicionar 1 mL de tampão TE com pH 8. i) Transferir o sobrenadante para um tubo limpo. C g) Adicionar igual volume de fenol tamponado. então. 8.

j) Para eluição do DNA. Descartar o conteúdo do tubo coletor. Descartar o conteúdo do tubo coletor. d) Adicionar 15 µL de solução de proteinase K e incubar de um dia para o outro. f) Centrifugar a 5. Descartar o tubo coletor e colocar a coluna em um microtubo de 1.000 g por um minuto. que se tornam mais quebradiças.2. . h) Novamente adicionar 500 µL de solução de extração e incubar por quinze minutos em temperatura ambiente.000 g por cinco minutos. novo e livre de enzimas que possam atuar sobre DNA e RNA. As amostras podem ser mergulhadas em pequenas quantidades de nitrogênio líquido.5 mL. c) Adicionar 10 µL de tampão lisozima e incubar por quinze minutos em temperatura ambiente. colocar na coluna de extração e centrifugar a 5000 g por um minuto. Centrifugar a 5. na temperatura de 56° C. b) Tampão de digestão 2.12 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase a) Solução de proteinase K (20 mg/mL). para serem congeladas rapidamente. O congelamento facilita a maceração das amostras. g) Recolher o sobrenadante.5 mL. b) Macerar com a ponta cônica de um bastão. i) Adicionar 500 µL de solução de lavagem e centrifugar novamente a 20. Protocolo de extração de DNA de ovos de carrapatos com a utilização de colunas de purificação O mesmo protocolo utilizado para extração de DNA de carrapato foi adaptado para extração de DNA de alíquotas de ovos de carrapatos (kit GFX . Procedimento: a) Pesar 20 mg da amostra e colocar em um microtubo de 1. adicionar 100 µL de água ultrapura aquecida a 70° incubar C. por um minuto e centrifugar a 5.000 g por dois minutos. 8. e) Adicionar 500 µL de solução de extração e incubar por quinze minutos em temperatura ambiente. GE Healthcare).000 g por um minuto.

000 g. . Tampão de lise 2.54 mL) e colocar em um microtubo de 1.5 mL.000 g por três minutos (16. centrifugar o tubo com a coluna a 5.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 13 Procedimento: a) Pesar 20 mg da amostra e colocar em um microtubo de 1. i) Adicionar a solução de lavagem e centrifugar a 20. b) Centrifugar durante oito minutos a 16.5 mL e colocar 100 µL de água a 70° C (ou tampão TE). Descartar o material do tubo coletor. h) Novamente adicionar 500 µL de solução de extração e incubar por quinze minutos em temperatura ambiente. e) Adicionar 500 µL de solução de extração.000 rpm). a amostra pode ser armazenada no freezer). j) Transferir a coluna para um tubo limpo de 1.000 g por dois minutos. incubar por quinze minutos em temperatura ambiente. A maceração pode ser feita após congelamento com nitrogênio líquido. f) Centrifugar a 5. Após um minuto. c) Adicionar 10 µL de tampão de digestão 2 e incubar por quinze minutos em temperatura ambiente. d) Ressuspender em 100 µL de tampão PBS (nesta fase.5 mL. colocar em coluna de extração e centrifugar a 5. EXTRAÇÃO DE DNA DE AMOSTRAS DE SÊMEN Soluções utilizadas (ver Apêndice): • • Tampão PBS.000 g por um minuto. Procedimento: a) Descongelar uma palheta de sêmen (cerca de 0. g) Recolher o sobrenadante. c) Lavar o pellet quatro vezes em 1 mL de tampão PBS (a cada lavagem passar no vortex e centrifugar novamente). b) Macerar com a ponta cônica de um bastão. Centrifugar a 5. d) Adicionar 15 µL de proteinase K (20 mg/mL) e incubar por quatro horas na temperatura de 56° C.000 g por um minuto.000 g por um minuto. 9.

Protocolo que emprega o detergente CTAB: Soluções (ver Apêndice): a) solução-tampão de extração vegetal.000 g por cinco minutos. para diversos tipos e para várias quantidades de amostra. i) Transferir o sobrenadante para tubos limpos. h) Adicionar 80 µL de NaCl 5 M por tubo. Este protocolo pode ser adaptado de várias maneiras. EXTRAÇÃO DE DNA DE PLANTAS A extração de DNA de plantas envolve a lise das células vegetais por meio do tratamento com detergente e posterior separação e precipitação do DNA.000 g por cinco minutos.000 g por cinco minutos. Secar o pellet e suspender em 100 µL de tampão TE + enzima que atue sobre RNA (10 µg/mL de amostra). 10. Acrescentar 1 mL de etanol absoluto a cada tubo e agitar por inversão. l) Incubar por uma hora em temperatura ambiente. Incubar por dezesseis horas a 50ºC. b) Solução de clorofórmio e álcool isoamílico a 24:1. k) Centrifugar a 16. Agitar vigorosamente por inversão. o DNA é separado por meio do tratamento com isopropanol e etanol. colocando 250 µL em cada tubo. Centrifugar a 16. j) Desprezar o sobrenadante. Posteriormente. Desprezar o sobrenadante. Agitar no vortex até dissolver. A preparação do DNA das plantas pela técnica de centrifugação em gradiente de cloreto de césio produz DNA de alta pureza. que libera o DNA celular e se complexa a ele. d) Etanol a 95%. Acrescentar 100 µL de etanol a 70% a cada tubo (não agitar no vortex). Outro protocolo que tem sido largamente utilizado por sua facilidade e rapidez é aquele que usa o detergente CTAB (brometo de cetiltrimetilamônio). e) Tampão TE. c) Isopropanol. . f) Adicionar solução de proteinase K a 200 µg/mL (100 µg = 5 µL da solução de estoque de 20 mg/mL).14 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase e) Adicionar 400 µL de tampão de lise 2 e incubar por trinta minutos a 50° para C dissolver o pellet. g) Dividir as amostras em dois tubos. Centrifugar a 16.

Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 15 Procedimento: a) Pesar 300 mg do tecido vegetal (a quantidade de tecido vegetal pode chegar a até 3 g). n) Lavar o pellet uma vez com etanol a 70%. homogeneizando algumas vezes. até que a amostra esteja pulverizada. s) Manter a −20ºC. adicionar 450 µL de isopropanol (gelado). para separar a fase orgânica e a fase aquosa.000 g por dez minutos em temperatura ambiente. equivalente suavemente. c) Colocar a amostra em microtubo de 2 mL e adicionar 700 µL de solução-tampão de extração vegetal e homogeneizar durante dez minutos por inversão. i) Repetir a extração com solução de clorofórmio e álcool isoamílico (24:1) mais uma ou duas vezes. b) Macerar com auxílio de nitrogênio líquido. Homogeneizar . e) Retirar do banho-maria e deixar a temperatura da amostra se igualar à temperatura ambiente. r) Incubar a 37ºC por uma hora. j) Após a remoção final do sobrenadante. l) Centrifugar a 8. k) Manter a –20ºC por dois minutos (para evitar a precipitação de polissacarídeos). a aproximadamente 2/3 do volume coletado. considerando que maior número de extrações pode purificar mais o DNA. f) Adicionar 700 µL de solução de clorofórmio e de álcool isoamílico (24:1). o) Lavar novamente o pellet com etanol a 95%. d) Incubar as amostras em banho-maria a 65ºC por uma hora. porém com alguma perda. evitando tocar a interface com a ponta da ponteira. e homogeneizar suavemente.600 g por dez minutos. h) Remover a fase aquosa (superior) para um novo microtubo. m) Descartar o sobrenadante. q) Ressuspender em 50 a 100 µL de tampão TE (pode-se adicionar RNAse na concentração final de 10 µg/mL de amostra). p) Deixar secar por uma hora. g) Centrifugar a 5.

Pequenas alíquotas de 10 µL (diluição 1:50) ou 5 µL (diluição 1:100) são misturadas com 490 ou 495 µL de água ultrapura. Após a eletroforese. O DNA do bacteriófago Lambda em concentrações conhecidas de 20. a especificidade. Essa reação possibilita que determinada região do genoma de qualquer organismo seja multiplicada em milhões de cópias. 50. um gel de agarose entre 0. é aplicada também uma amostra cuja concentração é conhecida. a facilidade de execução e a análise de grande número de amostras simultaneamente fazem dessa técnica uma opção atrativa para estudos epidemiológicos e para . o que facilita a análise genética e permite o desenvolvimento de técnicas de diagnóstico muito mais sensíveis e mais específicas do que as tradicionalmente utilizadas. utiliza-se a seguinte relação: 1 DO260 = 50 µg de DNA de dupla hélice. e as amostras são comparadas aos padrões. O DNA absorve luz no comprimento de onda de 260 nm e as proteínas. visualizado em luz ultravioleta. determinando-se dessa maneira as concentrações aproximadas de DNA em cada amostra.16 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 11. 12. Para esse fim. por meio da análise em gel de agarose. desse modo.8 apresentam contaminação com proteínas. O DNA pode ser quantificado e analisado quanto à sua qualidade. 100 e 200 ng/µL é geralmente utilizado. INTRODUÇÃO À TECNICA DE PCR A PCR apresenta ampla gama de aplicações em vários ramos da pesquisa científica. A alta sensibilidade. de 280 nm. nos comprimentos de onda citados. o gel é corado com brometo de etídio. e lidas em espectrofotômetro. A relação entre a quantidade de DNA e de proteína é usada como parâmetro para avaliação da qualidade do DNA extraído e. A concentração de DNA na amostra pode ser obtida pelo seguinte cálculo: Concentração de DNA = leitura da DO260 x 50 x fator de diluição usado na leitura. a relação DO260/DO280 pode ser usada para esse fim. Para estimar a concentração de DNA. com as amostras de DNA. LEITURA DA CONCENTRAÇÃO DE DNA NAS AMOSTRAS Todas as amostras de DNA obtidas no laboratório podem ser avaliadas quanto à sua concentração e à sua pureza por meio da análise da densidade óptica (DO) em espectrofotômetro. Diluições das amostras de DNA são preparadas com água ultrapura. Amostras cujos valores dessa relação são inferiores a 1.8% e 1% é preparado e.

Para que se possa amplificar dado segmento de DNA. Algumas marcas comerciais de polimerases . O tampão 10 X. dTTPs. b) 2. São componentes da PCR: a) Amostra de DNA que contém o segmento a ser amplificado (DNA extraído de amostras de sangue. é preparada em banho de gelo e colocada em microtubos de plástico esterilizados. de espécimes clínicos.0 µL de primer (10 µM) antisense. utilizado para o preparo do master mix. e após a sua diluição são mantidos a −20° C. dCTPs e dGTPs) necessários para a síntese das novas fitas de DNA. Os primers são sintetizados em laboratórios especializados. e) 1. f) 0. etc.) b) Mistura que contenha os nucleotídeos (dNTPs: dATPs. Os elementos envolvidos nessa reação são basicamente os mesmos componentes do processo de replicação que ocorre nas células vivas. co-fator da reação. Outras variações de volume têm sido utilizadas em diferentes trabalhos científicos. de culturas de microrganismos.2 µL ou em placas. A água a ser empregada no master mix deve ser a ultrapura. como 10 µL de master mix e 2. é necessário que as partes finais da seqüência sejam conhecidas.5 µL de DNA. sendo 20 µL de master mix e 5 µL da amostra de DNA a ser analisada. d) Cloreto de magnésio. e) Dois iniciadores ou primers. empregando-se volume total de 25 µL.25 µL de solução 20 mM de nucleotídeos (dNTPs). de plantas.0 µL de primer (10 µM) sense. sob encomenda. d) 1. O volume das reações pode ser reduzido. KCl 500 mM. c) Enzima DNA-polimerase.3 µL de Taq-DNA-polimerase (5 U/µL). MgCl2 15 mM). que é responsável pela síntese das novas fitas de DNA (Taq-DNA-polimerase) em solução-tampão.5 µL de tampão 10 X concentrado (tris−HCl 10 mM.5 µL ou de 0. que apresenta baixa condutividade elétrica. A solução em que ocorre a reação (master mix). desde que as concentrações adequadas de todos os componentes da reação sejam mantidas: a) 14. é comprado com a Taq-DNA-polimerase.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 17 caracterização de microrganismos causadores de doenças. A PCR pode ser feita em tubos de 0.7 µL de água ultrapura esterilizada. c) 0. que delimitam e são complementares à região-alvo de amplificação. que são pequenas seqüências conhecidas de DNA (oligonucleotídeos).

Desnaturação mais longa (hot start) no primeiro ciclo pode ser utilizada com a finalidade de otimizar essa fase. Nesses casos. anelamento e extensão.18 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase trazem o tampão 10 X já adicionado de cloreto de magnésio. polimerase (Taq-DNA-polimerase) se posicione junto aos primers que se anelaram anteriormente e. do tamanho do primer e de sua seqüência de nucleotídeos. outras trazem essa solução separada. porque ele é essencial para a ação da enzima DNApolimerase. A temperatura de anelamento depende. O DNA genômico permanece desnaturado por todos os ciclos subseqüentes. A temperatura é elevada até cerca de 72° para que a enzima DNAC. que são: desnaturação. Os oligonucleotídeos ou primers. com o auxílio do magnésio. Para que ocorra a amplificação. permite que os primers se liguem à região complementar à sua seqüência na amostra de DNA. c) Extensão. entre outros fatores. por sua vez. cada primer se encaixa nas respectivas seqüências complementares à região-alvo da amplificação. porque as fitas complementares estão em concentrações muito baixas. A síntese da nova fita de DNA se inicia a partir dos primers ou iniciadores. a temperatura da reação é reduzida (a temperatura de anelamento é sempre específica para cada par de primers). a solução deve ser adicionada ao master mix logo após o tampão 10 X e o volume total deve ser ajustado com água. estão em concentrações muito altas no master mix. as amostras devem ser submetidas à combinação adequada de temperatura e de tempo. com a síntese de novas fitas de DNA. para cerca de 94° a 95° A desnaturação C C. Dessa forma. o que impede a sua reunião. Essas fases ocorrem em temperatura diferente e são programadas no aparelho chamado termociclador. permitindo o melhor anelamento dos primers. devem estar estabelecidos a temperatura e o tempo exato de cada uma dessas fases e também o número de repetições dos ciclos: a) Desnaturação: é a fase na qual o DNA perde sua estrutura de dupla hélice. onde as amostras são incubadas. A síntese . Cada ciclo da PCR apresenta três fases fundamentais. seja iniciada a síntese da nova fita. Uma vez desnaturado o DNA. b) Anelamento. fato que facilita o encontro das regiões complementares (anelamento). O íon magnésio não pode faltar no master mix. por meio da elevação da temperatura. A determinação da temperatura de anelamento para um par ou conjunto de primers pode ser feita com o auxílio de programas de computador específicos para essa finalidade. Na hora de preparar o programa para a amplificação.

sem a necessidade de informação prévia sobre a seqüência analisada. O uso da técnica de amplificação de DNA ao acaso (RAPD) tem sido uma opção simples a ser utilizada. porém. em virtude da grande conservação observada nesses genes. ESCOLHA DOS PRIMERS OU INICIADORES Algumas técnicas podem ser utilizadas para o desenvolvimento de primers ou seqüências iniciadoras de PCR. analisadas e sintetizadas. correspondente a região-alvo de amplificação (delimitada pelos primers). Como é uma técnica baseada em PCR. Após o término de um ciclo (desnaturação. reações cruzadas com outros organismos que não são alvo de interesse podem ocorrer. 13. o número de cópias da seqüência-alvo é duplicado e. Esse método é caro. Os iniciadores podem ser designados a partir dessas seqüências. em decorrência da redução da especificidade da reação. As bandas de DNA geradas por RAPD−PCR podem ser eluídas do gel e seqüenciadas. Dessa maneira. pequenas quantidades de DNA são suficientes para a análise. ocorre aumento exponencial do número dessas seqüências. e demanda tempo e grande quantidade de DNA. que pode ser difícil de se obter. O aumento do número de ciclos não é aconselhado. a seqüência do gene rDNA é rotineiramente utilizada. até que se obtenha grande quantidade do DNA a ser amplificado. portanto espécie-específicas e dessa maneira adequados para o delineamento de técnicas de diagnóstico. Essa técnica detecta polimorfismos em seqüências de nucleotídeos de diferentes organismos isolados. Para fins de diagnóstico. em razão da sua disponibilidade para grande número de protozoários e outros parasitas. . com a evolução dos ciclos da reação. Muitos dos produtos gerados pela RAPD−PCR são derivados de seqüências repetitivas do DNA. dependendo do microrganismo em questão. são formadas novas fitas de DNA de dupla hélice. em que certas regiões do genoma do microrganismo obtidas por meio da digestão enzimática são amplificadas por PCR e seqüenciadas. com base nos parâmetros de especificidade e de anelamento com a seqüência-alvo. em média). todo o processo é repetido várias vezes (40 vezes. Um método alternativo é a construção de bibliotecas de DNA genômico.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 19 se dá por meio da utilização dos nucleotídeos (dNTPs) que foram adicionados ao tampão e que são sempre complementares à fita-molde. para que seqüências que tenham potencial de uso como primers sejam selecionadas. A cada ciclo de amplificação. anelamento e extensão).

com um único teste. O primeiro par de primers amplifica determinada região com número conhecido de pares de bases. produzindo padrões únicos para cada espécie. A partir de uma única cópia do DNA contida na amostra. Essa técnica é especialmente útil para análise de amostras que contenham parasitas cuja distinção morfológica é difícil ou que se apresentem em número muito baixo. promover a diferenciação entre várias espécies ou entre vários gêneros simultaneamente. . PCR “MULTIPLEX” A técnica de “multiplex” foi desenvolvida com a finalidade de. O segundo par nested primers se liga a região dentro do primeiro produto produzindo um segundo produto de PCR que será menor do que o primeiro. No entanto. dois pares de primers amplificam uma região conhecida do genoma de um organismo qualquer. 15. a capacidade de amplificar todas essas cópias aumenta a possibilidade de amplificação de DNA que não seja o desejado. Pode-se utilizar primers para amplificar um único lócus de um genoma inteiro. primers internos (nested) são desenhados e empregados para testar a especificidade (o segmento de PCR que foi amplificado era realmente o que se desejava amplificar?). Por exemplo. A especificidade da reação é determinada pela especificidade dos primers. se os primers usados se ligam a mais de um lócus. é possível produzir rapidamente cerca de um bilhão de cópias de produtos de PCR. já que a segunda reação (nested−PCR) pode aumentar em cerca de 100 vezes a sensibilidade − das reações. mais segmentos de DNA podem ser amplificados.20 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 14. Nessa reação ou sucessão de reações. primers altamente específicos são usados para amplificar seqüências conhecidas do DNA. Para contornar esses problemas. pela mistura de vários pares de primers. NESTED−PCR − A PCR possibilita a amplificação de seqüências específicas contidas em uma mistura complexa de DNA. altamente específico. Desse modo. Essa técnica também pode ser utilizada em análises genômicas. Essas reações também servem para aumentar a sensibilidade das reações em cadeia. Dessa maneira. se o primeiro lócus a ser amplificado não for a seqüência esperada. Elas têm sido muito usadas para o diagnóstico de microrganismos em amostras de DNA extraídas de espécimes clínicos diversos. Essa forma de PCR envolve a amplificação simultânea de mais de uma seqüência-alvo por reação. a probabilidade de o segundo par de primers funcionar é muito baixa.

para identificar e para purificar fragmentos de DNA e de proteínas. a sensibilidade − estimada foi de 0. nucleotídeos. que se liga ao corante. conforme a reação progride. uma solução-tampão. que corresponde à parasitemia de 0. peptídeos. PCR QUANTITATIVA A análise quantitativa por meio do estudo cinético da PCR pode ser feita adicionando-se um corante fluorescente à reação.00003%. ácidos carboxílicos e outras substâncias de relevância biológica). se comunica através de suas extremidades com as soluções-tampão dos eletrodos. 17. Ela consiste na separação de moléculas ionizadas (aminoácidos. ELETROFORESE DE ÁCIDOS NUCLÉICOS Eletroforese é um método simples e muito eficiente para separar. ao passar pelo meio. resultando em aumento da fluorescência. 16. A corrente elétrica. fechando assim o circuito elétrico. Moléculas com carga negativa migram para o pólo positivo (ânodo) e moléculas com carga positiva migram para o pólo negativo (cátodo). por . conduzida pelos pequenos íons presentes na solução. em que se pretende saber a quantidade inicial de DNA presente na amostra. ambos os compartimentos contém. As reações quantitativas são muito utilizadas na determinação da expressão de genes específicos e também em técnicas de diagnóstico. dá ensejo ao deslocamento. Se for colocado em um gráfico o aumento da fluorescência em relação ao número de ciclos. proteínas − incluindo lipoproteínas e glicoproteínas −. inclusive a quantidade inicial do DNA-alvo. O meio físico de separação. Para tanto. catódico e anódico. é preciso desequilibrar eletricamente duas regiões extremas de um meio que contenha eletrólitos. Com isso. Na nested−PCR. a amplificação produz quantidades crescentes de DNA de dupla fita. de acordo com sua carga elétrica e seu peso molecular.0000003%.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 21 No teste de PCR para diagnóstico de Babesia bigemina. Para haver migração. em geral. igualmente tamponado. é estabelecida a diferença de potencial entre dois eletrodos ligados aos terminais de uma fonte de corrente contínua e dispostos em dois compartimentos. pode-se obter o panorama completo da PCR. no qual esteja dissolvida ou dispersa uma substância com potencial para migrar. Vários equipamentos que realizam esse tipo de análise estão disponíveis comercialmente. a sensibilidade estimada para as reações foi de 6 x 103 eritrócitos parasitados em 18 x 106 eritrócitos.

por possuírem carga total negativa (em decorrência do grupamento fosfato). sílica-gel. A eletroforese pode ser conduzida em solução com gradiente de densidade ou em diferentes meios de suporte. de modo a não interferir na mobilidade das moléculas. b) As amostras de DNA são aplicadas nos pocinhos do gel. Eletroforese em gel de agarose Quanto ao gel de agarose. a corrente elétrica é conduzida por íons. migram sempre em direção ao polo positivo (ânodo). a porosidade do gel determina o poder de resolução das bandas e este geralmente é decorrente do grau de polimerização entre os monômeros. a hidrólise da água. gel de agarose. na qual se encontram os eletrodos (ânodo e cátodo). Nos tampões das cubas e do gel. membranas de acetato de celulose. amido ou poliacrilamida. de partículas protéicas carregadas para determinado pólo. Esses dois tampões possuem efeito ligeiramente diferente na mobilidade do DNA.22 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase exemplo. 17. Apesar de o TAE ser mais utilizado. A voltagem e o tempo são estabelecidos de modo a propiciar a separação ideal das amostras. mas deve ser evitado para purificação de DNA de géis. que se dá na superfície dos eletrodos. tais como papel-filtro. Pelo fato de as proteínas serem substâncias anfóteras.1. ele é mais facilmente exaurido durante reações longas ou com alta voltagem. O sistema tampão pode ser contínuo (o mesmo tampão é utilizado no gel e nos eletrodos) ou descontínuo (quando diferentes composições ou concentrações de tampão são utilizadas no gel e nos eletrodos). o protocolo pode ser dividido em três estágios: a) O gel é preparado com agarose na concentração adequada ao tamanho dos fragmentos de DNA a serem separados. por elétrons. Em relação aos géis de agarose ou à poliacrilamida. permite a troca entre elétrons e íons. . Os ácidos nucléicos. O suporte deve ser química e fisicamente inerte. Os dois tampões mais usados na separação eletroforética de moléculas de DNA são TAE (tampão tris-acetato-EDTA) e TBE (tampão tris-boratoEDTA). por meio do uso de soluções-tampão. O TBE tem melhor capacidade tamponante. é indispensável manter constante o pH do meio durante a eletroforese. ou seja. e nos eletrodos. O principal fator a ser considerado na escolha do tampão é a sua capacidade de tamponamento. capazes de adquirirem carga positiva ou negativa de acordo com o pH. Na presença de um sistema tampão adequado. O sistema tampão usado consiste em duas partes: o tampão usado na preparação do gel e o tampão da cuba eletrolítica.

Limites de eficiência da separação de DNA em diferentes concentrações de agarose.0 20 – 1. Limites de eficiência 60 – 5.2.2. Na ausência de brometo de etídio.2. As relações entre concentração de agarose e resolução de moléculas lineares de DNA são apresentadas na Tabela 1.8 7 – 0. se o brometo de etídio tiver sido incorporado. moléculas de DNA circulares superenoveladas.4 4 – 0. Tabela 1. possuem taxas de migração diferente.9 1. O peso molecular do fragmento de interesse pode ser determinado por meio da comparação entre a sua mobilidade e a mobilidade de padrões de DNA de peso molecular conhecido. (1982).2 0. Concentração de agarose no gel (%) 0. Separação de moléculas de DNA (Kb). as seqüências de DNA serão visualizadas na presença de luz ultravioleta.5 2.2 1. Ela propicia a caracterização dos fragmentos de DNA por tamanho reprodutível e de forma acurada.3 0.5 6 – 0. mas com conformação diferente. Essa é a característica mais importante da eletroforese em gel de agarose. Variáveis que afetam a migração do DNA através do gel de agarose 17. A concentração de agarose participa de modo importante na separação eletroforética. como o dos plasmídios. Conformação do DNA Moléculas de DNA de mesmo peso. migram mais rapidamente do que . Concentração de agarose Moléculas de DNA de fita dupla linear migram através da matriz de gel à taxa inversamente proporcional ao logaritmo (base 10) do seu peso molecular.1.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 23 c) O gel é corado e.1 17. porque é ela que determina a faixa de tamanho das moléculas de DNA que podem ser separadas. 17.7 0.6 0.0 Fonte: Maniatis et al.0 10 – 0.2.

5% de agarose). Conseqüentemente.5 µg/mL. as moléculas de DNA circulares fechadas podem ser facilmente distinguidas dos seus topoisômeros. O corante brometo de etídio é comumente adicionado ao gel ou ao tampão de reação. O aumento de voltagem faz com que a taxa de migração de grandes fragmentos de DNA seja maior do que a de pequenos fragmentos. O corante é intercalado entre as bases empilhadas dos ácidos nucléicos e emite fluorescência vermelho-alaranjada (560 nm) quando iluminado com luz ultravioleta (260 a 360 nm). ou melhor. Isso possibilita que sejam detectadas quantidades muito pequenas de DNA (menos de 5 ng). Para separar fragmentos de DNA grandes. o ideal é realizar eletroforese com baixa concentração de agarose e sob baixa voltagem (~1 V/cm. A partir desse ponto. Quando na reação existe gel com diferentes concentrações de brometo. 17. geralmente entre 0. A fonte de corrente contínua produz força eletromotriz. A intensidade da corrente elétrica (i). Intensidade de corrente Em geral. fragmentos de DNA migram através do gel à taxa de migração proporcional à voltagem aplicada. voltagens maiores são menos efetivas na separação de grandes fragmentos de DNA. O brometo de etídio é usado comumente para visualização direta do DNA nos géis. o gradiente de voltagem do meio (volts/m) é o resultado da multiplicação da resistência (em ohms) do meio pela intensidade de corrente (em ampères) que flui por esse meio. os superenovelamentos negativos são gradualmente removidos. O corante reduz a mobilidade dos dúplices lineares e tem efeito pronunciado na mobilidade de moléculas de DNA circulares fechadas. na qual não há mais superenovelamento. que é medida em volts. A potência P (em watts) desse sistema é o produto da voltagem (volts) e da intensidade de corrente . Isso ocorre até a concentração crítica de corante livre. causando a diminuição na mobilidade do DNA. mas pode também ser adicionado em uma solução para corar o gel após a eletroforese.24 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase moléculas lineares de mesmo peso molecular.1 e 0. a resistência do meio à migração (R) e a diferença de potencial (ddp) ou a voltagem (V) são variáveis importantes no processo eletroforético. a adição de brometo de etídio acarreta a formação de superenovelamento positivo. Com o aumento da concentração de brometo de etídio. A diferença de potencial (em volts) entre os eletrodos.3. causando aumento na mobilidade das moléculas. em 0.2. O superenovelamento faz com que as moléculas tenham mais facilidade para migrar através da matriz de gel.

9 g de agarose de baixo ponto de fusão para 30 mL de gel. Outras equações da eletricidade são de ajuda no entendimento da eletroforese. c) Aquecer no forno de microondas. Assim. deve haver compromisso entre a intensidade de corrente i e a voltagem do meio V. 18. a resistência de um sistema condutor é igual à sua resistividade (θ) multiplicada pela razão 1/S.3 g de agarose para 30 mL de gel. b) Colocá-la em um erlenmayer que contenha o volume necessário de tampão TBE 1 X. Aplicar todo o produto da digestão (13 µL) + 2. como influencia o gradiente de voltagem desse meio ou a intensidade de campo elétrico (E = V/1). ou melhor. até iniciar a ebulição (aproximadamente trinta segundos em potência média para gel de 30 mL). influencia a ddp (V) de um meio. a concentração do gel deve ser escolhida de acordo com o tamanho do produto amplificado (ver Tabela 2). função da concentração eletrolítica. Para isso.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 25 (em ampères). Daí surge: V = Ri = li / χS. . Esta equação mostra como a condutividade de um meio. Gel a 3% → 0. Em resumo: V = Ri e P = Vi ou Ri2.6 µL de loading buffer. em que 1 é o comprimento do condutor e S é a área da sua seção reta. que deve ser preparado com tampão tris−borato−EDTA 1 X. É utilizado para analisar o resultado das digestões com enzimas de restrição. Para ocorrer migração eletroforética. Procedimento: a) Pesar a agarose. Agitar o frasco e retornar ao forno de microondas por mais alguns segundos. Por sua vez. que deve ser preparado com tampão tris−borato−EDTA 1 X. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE FRAGMENTOS DE DIGESTÃO EM GEL DE AGAROSE AMPLIFICAÇÃO E Para a análise dos produtos de PCR em géis de agarose. a resistividade é função inversa da condutividade (χ). Gel a 1% → 0. aplicar 5 µL de produto de amplificação + 1 µL de loading buffer (tampão de corrida).

ELETROFORESE EM SISTEMA CAPILAR Durante décadas. na faixa de 2 a 5 V/cm (considerando a distância entre os eletrodos). Caso o fundo do gel esteja muito corado. na quantidade indicada para cada gel. preenchidos com um eletrólito. O uso do capilar fornece vantagens sobre as placas de gel. a eletroforese capilar tem apresentado vantagens em relação à técnica de eletroforese em placas. desde detecção de resíduos de drogas até testes de paternidade. Pode ser necessário acrescentar água destilada. Para a análise simultânea de amostras. h) A eletroforese deve ser realizada em TBE 1 X. A separação das macromoléculas é conduzida em tubos com dimensões de 15 a 100 µm de diâmetro interno e 36 a 100 cm de comprimento. o que permite a dissipação eficiente do calor gerado pela corrente elétrica e possibilita a . colocar o gel na cuba de eletroforese e cobrir com tampão TBE 1 X. possibilitando a maximização do tempo necessário para as mais diferentes análises. instrumentos de eletroforese capilar com arranjo de capilares são os mais utilizados. 19. pode-se lavar o excesso de brometo por submersão em TBE 1 X por cinco a dez minutos. Usar máscara e óculos de proteção adequados. f) Após a solidificação. CUIDADOS O brometo de etídio é um potente agente mutagênico. por razões geométricas: há elevada relação entre a área superficial e o volume interno. g) Aplicar as amostras acrescidas de tampão de corrida e estabelecer a corrente de acordo com o tamanho do gel. a eletroforese em placas de gel de poliacrilamida ou de agarose foi intensamente utilizada como uma das ferramentas mais importantes dos laboratórios de biotecnologia e de bioquímica para a análise de macromoléculas. Nos últimos anos.26 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase d) Aguardar a redução da temperatura para aproximadamente 60° e adicionar C brometo de etídio. porém. para repor aquela perdida por evaporação. Usar luvas e máscara para preparar a solução de estoque e para manipular os géis. Existem aparelhos que possuem desde um único capilar até 384 capilares. e) Verter no molde previamente nivelado e colocar os pentes. em voltagem constante. A luz ultravioleta produz queimaduras severas.

para completar o contato elétrico. eles podem ser substituídos a cada separação. A concentração polimérica ótima depende do tamanho do DNA a ser separado. A uma dada concentração de polímero. próximo ao reservatório de saída. Em geral. e um detector apropriado. Géis físicos são matrizes poliméricas hidrofílicas. através de ligações covalentes. em alto poder de resolução e em reduzido tempo de análise. Isso resulta em separações de alta eficiência. nos quais uma diferença de potencial é estabelecida entre o capilar e o recipiente que contém a amostra. durante um tempo predeterminado. o que possibilita a separação dos fragmentos de DNA. . que não são ligados à parede do capilar. retenção de fragmentos com alto peso molecular e degradação do gel por hidrólise. eletrodos (de platina. As amostras normalmente são introduzidas no capilar por métodos eletrocinéticos. denominados géis químicos: um capilar é tratado com um reagente que estabiliza o gel junto à parede do capilar. tais como oligonucleotídeos. normalmente).Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 27 aplicação de campos elétricos elevados (100 a 500 V/cm). Esse método foi descartado. As extremidades do capilar são imersas nos reservatórios da solução. introdução limitada de amostra. sem perda de eficiência. dado o grande número de problemas que surgiram. A eletroforese capilar em gel é utilizada exclusivamente para separação de macromoléculas. Assim. dissolvidas em tampão apropriado. Tais problemas levaram à formulação de novos sistemas e que foram denominados géis físicos. o que permite o aproveitamento do mesmo capilar por centenas de vezes. fragmentos de DNA e proteínas. Essa técnica teve início com a aplicação nas separações de DNA por tamanho molecular. capilares (geralmente de sílica fundida). A fonte de alta tensão é aplicada nos eletrodos de platina situados nos reservatórios com solução eletrolítica apropriada. O detector localiza-se em algum ponto do capilar. tais como aparecimento de bolhas (perda de condutividade). por meio de colunas preenchidas com gel. um aparelho de eletroforese capilar básico consiste de uma fonte de alta tensão. as fitas poliméricas individuais começam a interagir umas com as outras e formam uma estrutura em rede dentro do capilar.

PROTOCOLOS DE AMPLIFICAÇÃO DE DNA PARASITÁRIO 21. d) Marcar os microtubos para PCR (microtubo de 0. com o software Data Collection (Applied Biosystems). d) Desnaturar as amostras (já na placa de corrida). c) Lavar as mãos e colocar luvas novas. b) Limpar a bancada com álcool. e) Colocar as amostras imediatamente no gelo após a desnaturação e manter aí por cinco minutos. a 95ºC. PROTOCOLO PARA ANÁLISE DE PRODUTOS DE AMPLIFICAÇÃO EM SISTEMA CAPILAR Antes da injeção no capilar.85 µL de formamida Hi-Dy e 0. Esse protocolo é utilizado no equipamento IBI 3100 Avant (Applied Biosystems). e) Preparo do master mix para PCR: .2 µL). colocar 8. Procedimento: a) Preparar a mistura de formamida e o padrão interno com fragmentos de tamanho conhecido: para cada amostra.15 µL de padrão (GS 500 ROX). durante cinco minutos. c) Aplicar 1 µL de produto de PCR da sua amostra por poço. b) Aplicar esses 9 µL de mistura em um poço da placa de corrida.1. 21. PCR para Babesia bigemina a) Separar as amostras de DNA.28 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 20. Um padrão com fragmentos de tamanho conhecido é aplicado com as amostras para permitir a estimativa do tamanho dos fragmentos analisados. para evitar que a formação de estruturas secundárias afete a velocidade de migração. f) Preparar a injeção das amostras no analisador e a obtenção dos dados no computador. as amostras são desnaturadas em presença de formamida. preparar o banho de gelo para os microtubos e retirar os reagentes do master mix do congelador. As amostras de DNA não devem ter contato com os reagentes do master mix.

C) 21. e incubar as amostras.5 µL 0. c) Lavar as mãos e colocar luvas novas.25 µL 0. Demonstração esquemática da programação dos ciclos da PCR com temperatura (° e tempo de desnaturação.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 29 1X H2O ultrapura Tampão 10 X MgCl2 DNTP (20 mM ) BiIA (10 µM) BiIB (10 µM) Taq (5 U/µL) 7.0 ∞ 64. de anelamento e de extensão.15 µL ____ µL ____ µL ____ µL ____ µL ____ µL ____ µL ____ µL X f) Distribuir 10 µL do master mix por microtubo de 0.0 1´ 72.1 µL 1. Nested−PCR para Babesia bigemina − a) Preparar o banho de gelo e retirar os reagentes do master mix do congelador. 1.0 6466 30" 30” 95.2 µL (PCR).0 30” 72. 1.0 4’ 4.375 µL 0. de acordo com o esquema da Fig. h) Preparar o programa no termociclador.125 µL 0. 1o ciclo 95.0 30” 34 ciclos 72.2.0 65. para evitar contaminações). b) Limpar a bancada com etanol.0 30” Fig.5 µL de DNA por tubo com o master mix (em local isolado. . de anelamento e de extensão. g) Adicionar 2.5 µL 0. indicando as temperaturas de desnaturação.

2. de anelamento e de extensão.0 30" 72. h) Preparar o programa no termociclador e incubar as amostras.0 30” 34 ciclos 72. Demonstração esquemática da programação dos ciclos da PCR com temperatura (° e tempo de desnaturação.375 µL 0.0 ∞ 68.0 4´ 4.25 µL 0.5 µL do master mix em cada tubo de PCR.5 mL). e) Preparar o master mix para nested−PCR (em tubo de 1.125 µL 0. 2. de acordo com o esquema da Fig.5 µL 0. C) .0 30” Fig. − 1X H2O ultrapura Tampão 10 X MgCl2 DNTP (20 mM ) BiIAN (10 µM) BiIBN (10 µM) Taq (5 U/µL) 8. g) Adicionar 1.15 µL ____ µL ____ µL ____ µL ____ µL ____ µL ____ µL ____ µL X f) Distribuir 11. 1o ciclo 95.30 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase d) Marcar os microtubos para PCR.0 µL da PCR aos tubos com o master mix (em local isolado para evitar contaminações).0 1´ 64.6 µL 1.5 µL 0.00 00 30” 72 30" 95.

.5% para a visualização dos produtos da PCR com aproximadamente 278 e 170 pares de bases. j) Ligar a fonte e manter a 80 V por cerca de uma hora. h) Após a solidificação (o gel se torna opaco). ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAÇÃO DOS PRODUTOS AMPLIFICADOS Gel de agarose a 1. c) Aquecer no forno de microondas até iniciar a ebulição (aproximadamente trinta segundos). e) Retornar ao forno de microondas por mais dois a três segundos.45 g de agarose em um erlenmayer.5 X). Tabela 2. Fonte: Figueroa et al. Seqüência* Primer Oligonucleotídeos (5' – 3') Produto (pb) 278 BiIA PCR Nested−PCR) BiIB BiIAN BiIBN CATCTAATTTCTCTCCATACCCCTCC CCTCGGCTTCAACTCTGATGCCAAAG CGCAAGCCCAGCACGCCCCGGTGC CCGACCTGGATAGGCTGTGTGATG 170 * Seqüência amplifica a região do fragmento de restrição denominado Spel-Aval de Babesia bigemina. 22. Seqüência dos primers de PCR e de nested−PCR de Babesia bigemina e tamanho dos produtos amplificados. 3).5%. k) Visualizá-lo em transiluminador sob luz ultravioleta (Fig. b) Dissolver em 30 mL de tampão tris−borato−EDTA (TBE) 1 X. f) Aguardar a redução da temperatura para aproximadamente 60° e adicionar C brometo de etídio (acrescentar 1 µL de brometo para cada 10 mL de gel). colocar na cuba de eletroforese e cobrir com tampão TBE 1 X (também pode ser utilizado tampão 0. (1993). g) Verter no molde previamente nivelado e colocar os pentes. Procedimento: a) Pesar 0. O gel de agarose é preparado na concentração de 1. d) Agitar o frasco com cuidado (a agarose em ebulição tem tendência a transbordar). i) Aplicar 8 µL de amostra acrescidos de 2 µL de loading buffer (tampão da amostra).Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 31 A Tabela 2 mostra a seqüência dos primers de PCR e de nested−PCR de Babesia bigemina e o tamanho dos produtos amplificados.

− 1) Padrão de pares de bases. bigemina. 5) DNA de carrapato Rhipicephalus (Boophilus) microplus. Eletroforese dos produtos de amplificação de DNA de Babesia bigemina pelas técnicas de PCR (poços 2 e 3) e de nested−PCR (poços 4 a 8). 8) Controle negativo da reação (água ultrapura esterilizada) . bigemina. 2) DNA de sangue de bovino. 3) Controle positivo de B. Não olhar diretamente para a luz ultravioleta. 6) DNA de ovos de R. . 3. (B.) microplus. 7) Controle positivo de B. 4) DNA de sangue bovino.32 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase CUIDADOS O brometo de etídio é um potente agente mutagênico. Fig. Utilizar luvas e máscara para preparar a solução de estoque e para manipular os géis.

25 g de 8-hidroxiquinolina (antioxidante).0 e novamente repetir os − procedimentos dos itens ”c” e ”d”. Solução de estoque TBE (tris−borato−EDTA) concentrada 10 X: − − Tris−base − Ácido bórico EDTA 0.32 g. c) Adicionar 250 mL de tris−base (hidroximetilaminometano) 50 mM. 1. C) b) Adicionar 0. 100 mL. 1.0) e estocar em − frascos escuros a 4° para uso por até dois meses. e) Adicionar 250 mL de solução tris−HCl 50 mM com pH 8. APÊNDICE Preparo do fenol tamponado: a) Colocar 250 mL de fenol líquido (ou 250 g de cristais de fenol fundido em banhomaria a 65° em um frasco de vidro.5 mL para cerca de 20 mL de sangue. Verificar o pH da fase fenólica (para isso pode ser usado o papel indicador) e repetir itens ”c” e “d” até que o fenol atinja o pH 8. adicionar 125 mL de solução tris−HCl 50 mM − com pH 8. EDTA 1mM com pH 8. d) Agitar em temperatura ambiente por cerca de quinze minutos (usar agitador magnético). C g) Nos protocolos de extração. Solução anticoagulante com ácido cítrico: a) Ácido cítrico b) Citrato de sódio c) Glicose d) Água ultrapura 0. com pH 8. Deixar repousar a 4° até a separação das fases. recuperar a fase fenólica. f) Finalmente.0. e) Usar 3. Aspirar a fase C aquosa com cuidado. utilizar a fase fenólica (amarelada) da solução de estoque.48 g.47 g.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 33 23.0 108 g 55 g 40 mL .5 M.0 ou tampão TE (tris−HCl 10 mM.

c) Adicionar água ultrapura.0 com solução de NaOH 10 M. Solução-tampão tris−HCl (hidroximetilaminometano−ácido clorídrico) 1 M: − a) Dissolver 121 g de tris−base em 800 mL de água ultrapura. 7.1 g de Na2EDTA.: O tris tem a função de manter constante o pH das soluções. com pH 7. 2) O EDTA é insolúvel em pH inferior a 8.5 M (pH 8. c) Adicione água ultrapura até completar 1000 mL. C Obs.5 ou 8. q.25% Xileno cianol a 0.5% 20 µg/mL .0): a) Dissolver 186. para pH 8.4. d) Autoclavar a 121° por quinze minutos. é importante ajustar o pH antes de completar o volume. com pH 8.0. C Observações: 1) O EDTA é um agente quelante que impede a ação de enzimas sobre o DNA. Solução-tampão TE (tris−EDTA): − a) Tris−HCl 10 mM. 1000 mL. b) EDTA 1mM.0 EDTA.34 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase Solução de EDTA (ácido etilenodiaminotetracético) 0.25% Solução aquosa de glicerol a 30% 25 mg 25 mg 10 mL Tampão de lise 1: Tris−HCl. d) Esterilizar em autoclave a 121° por quinze minutos. por essa razão. com pH 8.0 Dodecilsulfato de sódio (SDS) Solução de RNAse (adicionar no momento do uso) 10 mM 10 mM 0. Tampão de corrida da amostra 6 X concentrado (estocar a 4ºC): Azul de bromofenol a 0. b) Ajustar o pH para 8. e 42 mL. − b) Ajustar o pH com HCl concentrado.0.p.4. Cerca de 70 mL de HCl são necessários para pH 7.2H20 em 700 mL de água.0.s.

com pH 8.0 EDTA.5 Triton X-100 Obs.5) Cloreto de cálcio Glicerol Obs. Tampão de digestão 1: NaCl Tris−HCl. com pH 8.1 mg/mL 100 mg 5 mL 20 mM 50% .5% Solução de proteinase K (20 mg/mL): Proteinase K Tris−HCl 10 mM (pH 7. com pH 8.: Estocar a –4° C. com pH 8. 10 mM 1mM 5% 100 mM 10 mM 25 mM 0. com pH 8.5% 0.0 SDS Obs.0 SDS Proteinase K Tampão de digestão 2: Tris−HCl EDTA.0 2% 10 mM 100 mM 10 mM 0.5 mM 137 mM 8 mM 7.: Estocar a –20° C.: Preparar no momento do uso.0 NaCl EDTA. Solução-tampão de fosfato (PBS): KCl KH2PO4 NaCl Na2HPO4 pH 2.Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 35 Tampão de lise 2: 2-mercaptoetanol Tris−HCl.7 mM 1.

com pH 5.25 g 1.0 mL 2.000 mL 10 g 100 mL 0. Solução de RNAse 2 (10 mg/mL): RNAse Acetato de sódio (CH3COONa) 0.2 Tris−HCl 1 M.1 mL 10 mg 10 mM 15 mM .76 mL 292.082 g 100 mL 10 mg 1 mL 0.0 EDTA 0.8 mL 1.1 M 20 mM 0.5 NaCl Obs.: Estocar a –20° C.5 M 2-mercaptoetanol Polivinilpirrolidona Água ultrapura Concentração final 2% 1. com pH 7.4 Obs. com pH 7.0 mL 400 µL 40 µL 0. Solução de acetato de sódio 0.4% 1.01 M.1 g 3. com pH 8.01 M: Acetato de sódio (CH3COONa) Água ultrapura Solução de CTAB a 10%: CTAB (brometo de cetiltrimetilamônio) Água ultrapura Solução de NaCl 5 M: NaCl Água ultrapura Solução-tampão para extração vegetal: Soluções e reagentes CTAB a 10% NaCl 5 M Tris−HCl 1 M.: Estocar a –20° C.4 M 0.0% Volume (final = 10 mL) 2.36 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase Solução de RNAse 1 (10 mg/mL): RNAse Tris−HCl.

p. G.. 1995. p.. 225-235. Multiplex polymerase chain reaction based assay for the detection of Babesia bigemina. 1992. R. F. FRITSCH. M.. L. OLIVEIRA.. BIBLIOGRAFIA CONSULTADA AUSUBEL. 1995. G. M. 117. STRUHL. New York: Wiley & Sons. ZIPURSKY. M. Avoiding false with PCR.. 11-15. v.. . N. OLIVEIRA-SEQUEIRA. M. M. Tissue Antigens.. F. 73-85. Cenargen. Specific synthesis of DNA in vitro via polymerase catalysed chain reaction. v. SMITH. 69-81. Molecular cloning: a laboratory manual. Current protocols in Molecular Biology. ARAUJO JR. R.. U. M. 1993. J. V. CHIEVES. Veterinary Parasitology. v.. MOORE. MANIATIS. MULLIS. LODISH. Babesia bovis and Anaplasma marginale DNA in bovine blood. P. 3a ed. HLA-DR typing by PCR amplification with sequencespecific primers (PCR-SSCP) in 2 hours: An alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. 39. C. p.. T. 1989. 25. C..Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase 37 24.. p. O. DARNELL. S. 1987. New York: Scientific American Books. 335-350. MATSUDAIRA.. THOMPSON. Brasília: Embrapa. T. T.. BRAMMER.. New York: Cold Spring Harbor Laboratory. ZETTERQUIST.. 130. 975 p. K. C. DOYLE.. S. 2002. KWOK. D. 1982. SAMBROCK. A. JOHNSON. FERREIRA. BRENT. E. v. 1344 p.. J. OLIVEIRA. 339.. A. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. H. São Paulo: Sarvier Editora de Livros Médicos Ltda. 545 p. AMARANTE. 1987. 220 p. 50. J. E.. New York: Cold Spring Harbor Laboratory.. OLERUP. J. P. 55. H. J. HIGUCHI. Atualizações em técnicas celulares e moleculares aplicadas ao melhoramento genético vegetal. D. Molecular detection of parasitic protozoa. v. 4800 p. Introdução ao uso de marcadores RAPD e RFLP na análise genética. L. Methods of Enzymology. 1998. Passo Fundo: Embrapa Trigo.. 1982. H. Molecular Cell Biology. T. Lehninger princípios de Bioquímica. 2005.. E. S.. M.. KINGSTON. L. 404 p. L. 2004. v. p. MORGAN. A. Brazil. BERK. Phytochemical Bulletin. 237-8. infection in Boophilus microplus engorged females and eggs in São Paulo State. G. Nature. REFERÊNCIAS FIGUEROA. K. GRATTAPAGLIA. Parasitology. J.. A. R. R. S. J. SEIDMAN. BUENING. F. FALOONA. S. C. P. 61-67. FRITSCH. v. F. J. NELSON. p. P. D. D. J. MANIATIS. p. Veterinary Parasitology. DOYLE. J. D. F. 191. COX. Molecular cloning: a laboratory manual. SAMBROCK. 1996. BALTIMORE. Babesia spp.. 545 p.

Experimental Parasitology. S. A... MCCLELLAND. p. WELSH. KAPEL. B. 18. J. R. 1999.. LIVAK. Nucleic Acids Research. 29. p.38 Fundamentos teórico-práticos e protocolos de extração e de amplificaçãode DNA por meio da técnica de Reação em cadeia da polimerase SILVA JÚNIOR. 78. CHUTE. F. 2001. R. International Journal for Parasitology. 1990.. 215-230. J. v. NOBARY. STRINGFELLOW. MARTIN. J. M. 18. G. 141-149. p. WILLIAMS. J.. J. v. . A. ZARLENGA. D. 125 p. C. v. 7213-7218.. Veterinary Parasitology. O. A multiplex PCR for unequivocal differentiation of six encapsulated and three non encapsulated genotypes of Trichinella. RAFALSKI. 2001. G. J. Cloning and characterization of ribosomal RNA genes from three species of Haemonchus (Nematoda. 1994. ZARLENGA. v. M. Fingerprinting genomes using PCR with arbitrary primers.. Nucleic Acids Research. V. D.. p.. 6531-6535. KUBELIK. Trichostrongyloidea) and identification of PCR primers for rapid differentation. p. A. TINGEY. M. Eletroforese de proteínas: guia teórico e prático.. Rio de Janeiro: Interciência. 28-36. S. S. DNA polymorphisms amplified by arbitrary are useful as genetic markers. D. K. 101. M. v. K. 1990. LICHTENFELS. ZARLENGA. da. S. PCR as a diagnostic and quantitative technique in veterinary parasitology.. HIGGINS. J..

Sign up to vote on this title
UsefulNot useful

Master Your Semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master Your Semester with a Special Offer from Scribd & The New York Times

Cancel anytime.