Food Science and Technology - New Research

FOOD SCIENCE AND TECHNOLOGY: NEW RESEARCH
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.
FOOD SCIENCE AND TECHNOLOGY: NEW RESEARCH
Lorenzo V. Greco
and
Marco N. Bruno
EDITORS
Nova Science Publishers, Inc.

New York
Copyright 2008 by Nova Science Publishers, Inc.

All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Food science and technology : new research / Lorenzo V. Greco and Marco N. Bruno (editors). p. cm. Includes bibliographical references and index. ISBN 978-1-61668-106-7 (E-Book) 1. Food--Composition. 2. Food--Analysis. I. Greco, Lorenzo V. II. Bruno, Marco N. TX551.F68787 2008 664--dc22 2008016269
Published by Nova Science Publishers, Inc.
New York
CONTENTS
Preface Chapter 1 LC-MS Profiling and Quantification of Food Phenolic Components Using a Standard Analytical Approach for All Plants Long-Ze Lin and James M. Harnly Nutritional and Antinutritional Composition of Legumes and Factors Affecting it Demetra Nikolopoulou and Kriton Grigorakis Low-cost Adsorbents from Agri-food Wastes Leandro S. Oliveira and Adriana S. Franca Molecular Traceability in the Post-genomic Era: An Application of Technology to Food Science Valeria Terzi, Caterina Morcia and Primetta Faccioli Psychophysical and Electrophysiological Responses to Odor in Food Science John Patterson and Caroline Owen Food Bioactive Peptides: Recent Trends in Research, Production, Functionality, and Applications Kasipathy Kailasapathy Recent Trends in the Probiotic and Prebiotic Functional Food Product Development Kasipathy Kailasapathy Diffusive and Chemical Exchange Model: Practical Hits to Investigate Water Dynamics in Foods Elvino Brosio, Monica Belotti, and Raffaella Gianferri vii 1
Chapter 2
105 171
Chapter 3 Chapter 4
211
Chapter 5
243
Chapter 6
271
Chapter 7
299
Chapter 8
323
vi Chapter 9
Contents Effect of Some Reactional Parameters in an Enzyme Assisted Process for Hydrolysing whey Proteins Raquel Linhares Carreira, Eliza Augusta Rolim Biasutti, Wendel de Oliveira Afonso, Viviane Dias Medeiros Silva and Marialice Pinto Coelho Silvestre Techno-functional Properties from Hydrolyzed Wheat Gluten Fractions S. R. Drago, R. J. Gonzlez amd M. C. An Fortification of Mexican Bread with Sources News of Proteins and Soluble Fiber N. Guemes Vera,, G. Dvila-Ortiz, J. Martnez-Herrera, A. Bernardino-Nicanor, S. Soto-Simental, J. F. Hernndez Chvez and Alfonso Totosaus-Sanchez An Overview and Prospect on Banana Processing Technologies in China Wen Jun Zhang, Xi Yan Zhang and Yong Kai Xia Organic Fresh Vegetables: Green Technologies M. R. Moreira, A. G. Ponce and S. I. Roura The Use of Fish Powders and Gruel as Growth Substrate for the Production of Alkaline Serine Proteases by Bacillus Licheniformis NH1 Nedra El Hadj-Ali, Noomen Hmidet, Nabil Souissi, Alya Sellami-Kamoun and Moncef Nasri Coffee Oil, Cafestol, and Kahweol:Extraction Using Supercritical Carbon Dioxide Jlio M. A. Arajo, Dlcio Sandi and Jane S. R. Coimbra
341
Chapter 10
355
Chapter 11
383
Chapter 12
393 407
Chapter 13 Chapter 14
427
Chapter 15
441 459
Index
PREFACE
Food scientists and food technolgists study the physical, microbiological, and chemical makeup of food. Depending on their area of specialization, food scientists may develop ways to process, preserve, package, or store food, according to industry and government specifications and regulations. Consumers seldom think of the vast array of foods and the research and development that has resulted in the means to deliver tasty, nutritious, safe, and convenient foods. This book provides leading edge research in this field. Chapter 1 - Phenolic compounds are secondary metabolites that are ubiquitous in the plant kingdom. The total number of chemically different phenolic acids, flavonoids, and polymeric flavonoids has been estimated to be as high as 8,000. Although the total count is high, usually only a few dozen are found in a specific plant. The types of phenolics tend to follow taxonomic lines, a trait shared by many of the secondary metabolites. Many of these compounds display a variety of biological activities and are purported to be beneficial to human health. Their impact on health has driven the need for databases and, in turn, a need for analytical methods. Their number and variety has presented a challenge to the analytical community. A standardized phenolic profiling method, based on liquid chromatography with photodiode array and electrospray ionization/mass spectrometric (LC-DAD-ESI/MS) detection was developed specifically for glycosylated flavonoids and is applicable to phenolic compounds in general. This method is described as standardized because the same methodology is applied initially to all plant materials. The same extraction, separation, and detection scheme is used to provide the same overview of every sample or standard material. This enhances the capability for cross comparison of compounds in samples, standards, and results reported in the literature. Every sample analyzed contributes to a growing library of data of chromatographic and spectral data. The large volume of data furnished by the method and available in the literature make it possible to achieve positive identification of almost all of the common phenolics and provisional identification of many of the less common phenolics in a single chromatographic analysis using the standardized method. In this chapter, the authors describe the development and application of the standardized phenolic profiling method. To date they have analyzed more than 360 plant materials and over 200 standards. In the Experimental section, they describe the optimization of the method parameters. The first half of the Results Section describes the approach for identifying the structural characteristics of each compound. In the second half of the Results Section the
viii
Lorenzo V. Greco and Marco N. Bruno
authors present chromatographic profiles for a wide variety of fruits, vegetables, and herbal materials. Chapter 2 - The present review focuses on presenting the contents of various legumes in nutritional and antinutritional factors. Specifically, their protein, oil, total carbohydrate and ash contents are reviewed. Furthermore, their carbohydrates, i.e. starch (total and resistant), non-starch polysaccharides, dietary fiber, sucrose, raffinose-series oligosaccharides, as mentioned by literature, are described. Also, fatty acid and amino acid composition of legumes, as well as the nutritional value of their proteins are evaluated. Antinutritional factors, such as phytic acid, tannins, lectins, trypsin inhibitors etc. are reviewed. The differences in nutrients and antinutrients of legumes species are discussed. The effect of various intrinsic factors (i.e. varieties, cultivars, biotypes etc.) in the nutritional and antinutritional value of legumes are presented. The influence of culture conditions (crop season and soil characteristics) and environmental factors (meteorological / climatic conditions) are also reviewed. This paper also examines how the usual processing methods (soaking, cooking, pressure-cooking, autoclaving, microwave cooking, roasting, extrusion, irradiation, dehulling and fermentation) affect the nutrients and antinutrients of legumes. The existing literature on the former subjects is used to evaluate the present status of knowledge, to show its areas of weakness, and to present the future perspectives and potential areas of research. Chapter 3 - Agricultural and food wastes are high volume, low value materials that are highly prone to microbial spoilage which limits their exploitation. Further exploitation can also be precluded by legal restrictions and the costs of collection, drying, storage and transportation. Thus, for the most part, these materials are either used as animal feed, combustion feedstock or disposed to landfill causing major environmental issues. These materials usually contain high levels of cellulose, hemicellulose, lignin and proteins and as such can constitute renewable natural resources for a plethora of inexpensive eco-friendly and sustainable materials. Examples of such inexpensive materials are low cost adsorbents. Adsorption has been deemed one of the best techniques for the removal of organic pollutants of wastewaters and of undesirable chemical components in the agri-food industry. Because of their excellent adsorption ability, activated carbons are the most widely used sorbents and have been employed in the agri-food industry for a variety of applications such as the decolorization of sugar and vegetable oils, the removal of copper ions in the distilled alcoholic beverages industry and others. However, although activated carbon is certainly the preferred sorbent, its widespread use is restricted by its inherently high cost and, hence, the production of low cost adsorbents has been recently intensively sought. Since agricultural and food wastes are generated in large scales, thus, being largely available and rather inexpensive, these materials are considered potential precursors for the preparation of low-cost sorbents and are being thoroughly studied as such. In the last decade, a significant amount of information has been published on the potentiality of agri-food residues to be suitably modified and used as low-cost sorbents in a variety of applications. Thus, it is the aim of this essay to critically analyze the current situation and future applications of low-cost sorbents prepared from agri-food materials, with an emphasis on applications of interest to the food industry. Chapter 4 - The recent worldwide progress of food regulation legislation is directed toward the need to guarantee satisfactaion for consumers from both a safety and quality point of view. The composition in animal and plant species of a specific food is one of the key
Preface
ix
factors in determining the quality and the safety of the final product. Therefore, the traceability of ingredients is required along the whole production chain: the reliable identification of plant and animal ingredients at the level of species, but even at the level of genotypes is in fact essential for the handling, marketing, and processing of raw materials and derived products. Moreover, the identification of microbial species that are mycotoxigenic or potentially dangerous for human and animal health in agricultural products, food, and feed is an essential task from a safety point of view. Taking advantage of genomic research, DNA profiling techniques are now widely proposed not only for traceability and genotyping purposes, but even for the assessment of superior genotypes carrying genes related to quality traits. The recent advances in the application of genomic tools for the above- mentioned purposes are reviewed. Chapter 5 - There are underlying factors which may effect the quality, quantity, and the relevance of the results obtained from flavor research, particularly if it is consumer related. These are experience, language, and culture. The importance of the lexicon available to the participant is often the output filter determining how well the opinion of the experience is communicated in traditional sensory testing. This may not be a problem except when the difference between the knowledge and ability to express the participants opinions is compared with that of an expert. The expert may be the major contributor to the composition of the food or beverage being consumed by the less experienced individual. The issue extends into areas of identification, preference, or even detection. While this is well recognized, it is not one that necessarily is avoided in research with the very young, very old, or those whose first language is different from that of the researcher. There have been approaches developed still more comfortably undertaken in the laboratory which may minimize the impact of the experience and technical knowledge of the participant. In fact, these were developed specifically to be used on untrained people. It is indisputable that an odor stimulates a cascade of physiological responses in the brain, with the final outcome of the process of smelling an odor being a high-level cognitive response. One physiological recording technique which allows brain activity to be inexpensively, rapidly, and conveniently monitored is the recording of the electroencephalogram (EEG), which although not the best from a spatial perspective is very good in the time domain. The use of EEG recordings for olfactory and gustatory recordings is well established, but its application to issues of preference and threshold determination is less common. As a supplement to traditional sensory testing techniques and as a way of revealing new information, the EEG has a great deal of potential. The information in the following chapter gives detail of the benefits and challenges of language-free sensory testing interfaced with advanced neurophysiological and chemical techniques. Chapter 6 - In the recent past, increasing attention is being focussed on physiologically active peptides from a range of plant and food sources. Proteins and peptides from plants and foods have been observed to be physiologically active (bioactive) either directly or indirectly after their hydrolysis in vivo or in vitro (eg. cheese ripening & food fermentation). For example, milk proteins exert a wide range of nutritional, functional and biological activities. Many milk proteins possess specific biological properties that make these components potential ingredients of health-promoting foods. Food-derived bioactive peptides refer to different plant or animal origins that may have regulatory functions in the human system beyond normal and adequate nutrition. This chapter includes: the introduction of bioactive peptides, structure and physicochemical properties of bioactive peptides, and it will discuss various food-derived
bioactive peptides including opioid, ACE-inhibitory, mineral-binding, anti-microbial, immunomodulatory, cytomodulatory, anti-thrombotic, antioxidant, and hypocholesterolemic peptides. This chapter also includes the various sources of enzymes needed to produce bioactive peptides, and their applications. The production of bioactive peptides using enzyme hydrolysis, microbial fermentation and the fractionation and enrichment of bioactive peptides are discussed. Functionality of bioactive peptides and their physiological, biochemical, and immunological effects are also discussed. The food and nutraceutical applications and potential directions of new food and therapeutic products are discussed in this chapter. Finally, a future outlook on the development and utilization of bioactive peptides and their novel applications is discussed. Chapter 7 - In the recent past functional food product development in the world food market has significantly increased. It is estimated that the functional food market world wide will reach several hundred billion dollars in the near future. Functional foods provide health benefits to humans in addition to the nutritional benefits. Of all the recent functional food products, probiotics and prebiotics incorporated food products have assumed a significant market share worldwide particularly in Europe, Asia (Japan), Australia, and recently in the US. Probiotics includes beneficial bacteria that enhance gut-health by their selective action on harmful microorganism in the gut in contrast to the action of antibiotics. Continued ingestion of probiotic bacteria has been shown to improve gut-health, prevent certain modern-day life style diseases, and show immuno-stimulatory activity. Prebiotics are essentially complex carbohydrates that are resistant to human digestive enzymes and pass to colonic regions undigested and provide nutrients for the colonic commensal bacteria. Thus the probiotic approach and the prebiotic approach through development of functional foods are fundamentally different, though both contribute to overall enhancement of gut health. Recently, a combination of both approaches, ie a synbiotic (probiotic and prebiotic) approach has been promoted and a number of synbiotic products are being developed for functional food markets. This chapter will focus on the science of probiotics and prebiotics, gastrointestinal microbiota, applications in probiotic, and prebiotic foods including some examples. The science aspect of the probiotics includes introducing probiotics, their health benefits, commercial probiotic strains and their efficacy, challenges in incorporating probiotics into foods, and factors affecting viability and survival of the probiotic bacteria and techniques such as microencapsulation to improve their viability in products and in the gut. The science aspect of prebiotics includes introducing concept of prebiotics, how it is different to probiotic approach, type of prebiotics utilized commercially, and health-related benefits and claims. The chapter also discuss the synbiotic approach and future issues in the development of functional foods. Chapter 8 - In the present paper it is reported a full description of the model of the magnetic site exchange, as well as of the relations that, in the different limit conditions, allow the analysis and the physical interpretation of the relaxation curves as measured for water protons in food systems. It will be hereafter demonstrated that a correct measurement and analysis of both the longitudinal and transversal relaxation curves are likely to provide information on the morphology, size and distribution of the diffusive domains, and also on the physical-chemical parameters of the exchange processes involved. Chapter 9 - Whey proteins were hydrolyzed by an enzymatic process using two proteases and the influence of some reactional parameters, such as enzyme type, E:S ratio and reaction
Preface
xi
time was evaluated. Aiming the analysis of peptide profiles, the protein hydrolysates were fractionated by size-exclusion-HPLC and the rapid Correct Fraction Area method was used for quantifying peptides and free aminoacids. The peptide profiles obtained by the two enzymes were similar giving rise to average amounts of 21.42%, 39.70%, 10.73% of large, oligo and di-/tripeptides, respectively, as well as 39.34% of free aminoacids. For subtilisin, the best result was obtained for an E:S of 2:100 and 15h of hydrolysis, while for pancreatin this same result was observed for an E:S of 2:100 with a reaction time of either 10h and 15h as well as for an E:S of 4:100 after 15h of hydrolyisis. Chapter 10 - Many protein sources that are found in the market are obtained as byproducts and there is a great interest in using them as protein ingredients with adequate functionality for food formulation. Structure modification permits one to add value and to diversify their uses. The diversification of wheat gluten applications depends on the improvement of its solubility in a wider pH range. One of the alternatives that allow protein modification in these products is the enzymic hydrolysis. The objective of this work was to evaluate foaming properties of protein fractions obtained by extracting, at 3 pH, different hydrolyzed gluten samples. Two commercial enzymes (acid -Ac- and alkaline -Al- proteases) were used to reach 3 different hydrolysis degrees (DH). Extracts pHs (4, 6.5 and 9) were diluted to a protein concentration of 4 g/l. RP-HPLC, free amino groups content, sulphydryl and disulfur content, average peptide chain length were used to characterize each extract. Foam was produced by sparging nitrogen at a known rate through a dilute protein solution. The maximal volume of liquid incorporated into the foam (Vmax) and the rate of liquid incorporation into the foam (Ri) were determined and used as indicators of foaming capacity. The times for half-drainage of the liquid that was incorporated into the foam at the end of the bubbling period (t1/2) and the rate of liquid drainage from the foam were also measured. Regarding Ri, all pH 4 extracts from hydrolyzed samples showed higher Ri than an unhydrolyzed sample. Extracts from Al hydrolyzed extracts showed higher Ri than those from Ac. In the case of Al extracts, an inverse relation between DH and Ri was observed, but practically no influence of DH on Ri, was observed in the case of Ac extracts. For pH 6.5 extracts, the relation between DH and Ri were in opposite directions, depending on the enzyme, for Ac, Ri decreased with DH, while for Al, Ri increased with DH. At this pH, it was observed that the extracts which foamed more quickly, were those with the highest times for half-drainage of the liquid (t1/2). Some foam parameters correlated between themselves, depending on the extracts. Foaming capacity and stability depend on pH, DH and enzyme and it was possible to correlate parameters with composition evaluated by RP-HPLC Chapter 11 - At present, foodstuffs are fortified with essential nutrition elements in order to fight micronutrient (vitamin and mineral) deficiencies. These are due to an increasing need in some countries, and it helps to fulfill the nutritional requirements of the underprivileged groups. The nutrient that is required to add must be present in levels in which it is not excessive or insignificant. Enrichment of wheat flour with legume ingredients rich in proteins has been given much attention in the last three decades. This practice improves the amino acid balance and increases the protein content of baked products from the blended flours. Lupin, Jatropha curcas, Guava seed and whey proteins, flours have an excellent potential for improving the nutritional value of wheat bread. The Lupin flour has high-lysine, low methionine content complements that of wheat flour proteins, which are poor in lysine and relatively higher in the sulphur-containing amino acids. In lupins, the main limiting amino
xii
acids are methionine and cystine followed by valine and tryptophan. Its known Lupin lack of sulphur-containing amino acids and valine seems to be adequate in L. albus. Previous papers have been reported an increase in the use of Lupinus flour in the elaboration of cereal-based products. The yellow color that this legume showed to the final product has been considered of at value in mixed products and pasta. Everyday, new discovers of Lupin find it contributes to the texture, flavor, and often to the color of baked products. The addition flours of 5% Jatropha curcas, Guava seed and fiber soluble to wholesome wheat flours results in bread with a small increase of weight, a larger water absorption and a greater shelf life. Sensory analysis revels a good the acceptability of products added with whey proteins up to 10%. Based on the previous facts, it can be considered that Lupinus, Jatropha curcas, Guava seed, whey proteins and fiber soluble posses a high potential for its use in baked products. Chapter 12 - Banana is mainly served as a fresh fruit in China. However, it is easily degenerated, decayed, and thus not storage- and transportation-tolerable because it is a fruit with the respiration- jumping property. Postharvest loss of banana is always serious and thus results in a situation of high-yield without high-income. Postharvest loss of banana in China reached as high as 50% in recent years. China should largely expand its postharvest processing industry of banana in order to reduce the loss from decay, and to increase economic benefits. There have been a large number of banana processing technologies and products in the past twenty years, however, because of the backward technologies, deficiency of processing machinery, as well as huge investment cost and other factors, banana processing was rarely put into large-scale industrialization and processed banana products seldom marketed in China. There were currently many raw banana products but less high-end products. With the rapid development of the banana production in China, the postharvest loss problem will become more serious. It is urgent to conduct comprehensive and in-depth studies on banana processing technologies and to develop new products. In this study, the technologies, technical flows, products, and the problems emerged in banana processing industry of China were reviewed, summarized, and analyzed. Banana processing potentialities were estimated and projected. Development strategies of banana processing industry were proposed for the future studies and applications. Chapter 13 - The exploration of green technologies for food preservation receives increasing attention due to consumer awareness of natural food products and a growing concern of microbial resistance towards conventional preservatives. Cut vegetable tissues trigger chemical reactions and release nutrients that support the growth of the microflora present on raw produce. Wounding lettuce leaves induce the synthesis of specific enzymes and the accumulation of specific phenolic compounds associated with tissue browning. Many spices and herbs exert antimicrobial activity due to their essential oil fractions, also some native microflora naturally present on fresh produce surfaces are capable of producing antimicrobial compounds playing an important role maintaining fresh vegetable quality and safety. Moreover, natural antimicrobials and antioxidants like oleoresins imbedded in edible films can be gradually released on the food surface, therefore, requiring smaller amounts of them to achieve the target shelf life. The use of edible films in food preservation has increased since they offer several advantages over synthetic materials. Other innovative methods to control natural microflora and browning reactions on vegetables include mild heat shock treatments. They lack the offensive chemical residue doing this technique, an attractive alternative of preservation.
Preface
xiii
The use of essential oils to preserve organic vegetables was investigated through in vitro and in vivo experiments. Some oils presented antimicrobial and antioxidant activities indicating their potential to become technologically useful products as sanitizing agents. Clove and tea tree essential oils were highly inhibitory to E. coli; while olive and rosemary oleoresins presented antimicrobial effects against L. monocytogenes and against native microflora of squash. Chitosan film enriched with rosemary and olive improved the antioxidant protection of the minimally processed squash offering a great advantage in the prevention of browning reactions. The potential use of lactic acid bacteria occurring naturally in organic vegetables was investigated. E. faecium, L. lactis, E. hirae and E. canis showed novel antagonistic effects against Gram-negative bacteria with a potential role as food biopreservatives. Heat shock treatments prevented browning of minimally processed lettuce. The impact of wounding was reduced by the application of heat shock treatments at 50 C, without changes in the sensory attributes. This work presented evidence for the potential application of mild heat shocks as a novel preservation technology for minimally processed vegetables compatible with organic and low input farming systems. Chapter 14 - The present study is concerned with the selection of new economical media based on agricultural and marine-processing by-products for the production of alkaline proteases by Bacillus licheniformis NH1. Powders from different fish species were prepared then tested as growth media at a concentration of 10 g/l for protease production by NH1 strain. Powder prepared from whole Sardinelle was found to be the best substrate for the production of the alkaline protease. The NH1 strain exhibited a slightly greater protease production (2927 U/ml) in medium containing only whole Sardinelle powder than that obtained in control medium (2800 U/ml). Proteases were produced even when strain NH1 was cultivated in medium containing only powder prepared from combined heads and viscera Sardinelle (CHVSP), about 2117 U/ml. Protease production was also carried out in media containing gruel, a by-product of semolina factories, as carbon source. Maximum activity (2517 U/ml) was achieved when the strain was grown in medium containing (g/l): gruel 10, casein peptone 2, K2HPO4 0.5 and KH2PO4 0.5. Moreover, protease production was considerably enhanced when the strain was grown in medium containing both gruel and CHVSP as carbon and nitrogen sources, respectively (4771 U/ml). The study shows that gruel and powders from fishery by-products could be utilized as bacterial substrates for the production of alkaline protease by B. licheniformis NH1. Chapter 15 - Green and roasted coffee oil was extracted using supercritical CO2 at four temperatures (333, 343, 353, 363 K) and four SC-CO2 densities ranging from 680 to 880 kg.m-3 for each temperature. Del Valle-Aguilera and Chrastil mathematical models were applied to predict oil concentration. The former led to elevated deviations between the predicted concentration values and those observed experimentally. The latter model provides better results, with better fitting being observed. In the second part of the experiment, commercial green and roasted coffee beans were used to maximize oil extraction and conditions were studied to obtain the highest and lowest diterpene levels on green and roasted coffee oil, respectively. Oil content levels and diterpene oil concentration obtained by SC-CO2 was compared to the results with the extraction with Soxhlet apparatus, using hexane as solvent. In general, an inverse correlation was observed between the amount of extracted oil and diterpene concentration levels.
In: Food Science and Technology: New Research Editors: L. V. Greco and M. N. Bruno
ISBN 978-1-60456-715-1 2008 Nova Science Publishers, Inc.
Chapter 1
LC-MS PROFILING AND QUANTIFICATION OF FOOD PHENOLIC COMPONENTS USING A STANDARD ANALYTICAL APPROACH FOR ALL PLANTS
Long-Ze Lin* and James M. Harnly
Food Composition and Methods Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, USDA
ABSTRACT
Phenolic compounds are secondary metabolites that are ubiquitous in the plant kingdom. The total number of chemically different phenolic acids, flavonoids, and polymeric flavonoids has been estimated to be as high as 8,000. Although the total count is high, usually only a few dozen are found in a specific plant. The types of phenolics tend to follow taxonomic lines, a trait shared by many of the secondary metabolites. Many of these compounds display a variety of biological activities and are purported to be beneficial to human health. Their impact on health has driven the need for databases and, in turn, a need for analytical methods. Their number and variety has presented a challenge to the analytical community. A standardized phenolic profiling method, based on liquid chromatography with photodiode array and electrospray ionization/mass spectrometric (LC-DAD-ESI/MS) detection was developed specifically for glycosylated flavonoids and is applicable to phenolic compounds in general. This method is described as standardized because the same methodology is applied initially to all plant materials. The same extraction, separation, and detection scheme is used to provide the same overview of every sample or standard material. This enhances the capability for cross comparison of compounds in samples, standards, and results reported in the literature. Every sample analyzed contributes to a growing library of data of chromatographic and spectral data. The large
*
Corresponding author.
Long-Ze Lin and James M. Harnly

volume of data furnished by the method and available in the literature make it possible to achieve positive identification of almost all of the common phenolics and provisional identification of many of the less common phenolics in a single chromatographic analysis using the standardized method. In this chapter, we describe the development and application of the standardized phenolic profiling method. To date we have analyzed more than 360 plant materials and over 200 standards. In the Experimental section, we describe the optimization of the method parameters. The first half of the Results Section describes the approach for identifying the structural characteristics of each compound. The second half of the Results Section we present chromatographic profiles for a wide variety of fruits, vegetables, and herbal materials.
1. INTRODUCTION
Phenolic compounds constitute a major class of phytochemicals found in plants and consist of three major subclasses, phenolic acids (and their derivatives), flavonoids (and their glycosides), and flavonoid polymers (proanthocyanidins or condensed tannins). In addition, a wide variety of other phenolic compounds, such as coumarins, anthraquinones, xanthones, lignans, and stilbenes, also exist but at lower concentrations and frequencies. They are secondary metabolites that are ubiquitous in the plant kingdom and tend to follow taxonomic lines. Among the phenolic compound subclasses, flavonoids and phenolic acid derivatives are most widely distributed in food plants. All three subclasses have been documented to have biological activities that impact human health [1-15]. Based on the USDA food flavonoid database [16] and other published research [17-18], the US public consumes as much as 250 mg of flavonoids per person per day in a wide variety of forms (fruits, vegetables, nuts, drinks, spices, herbal and botanical supplements, and vitamin and mineral supplements) [1]. Flavonoid consumption by adults in other countries has been reported to exceed that in the US [19-26]. Consumption data for phenolic acids and proanthocyanidins is not known due to the lack of an appropriate food composition database. Food consumption data plus a food composition database are necessary to provide an assessment of phenolic intake. Thus, accurate food composition data is essential for the support of clinical and epidemiological studies to establish the relationship between ingestion of phenolic compounds and human health [27-33]. Chemically, all of the plant phenolic compounds contain one or two phenyl (C6) groups. The simplest structures contain one phenyl group with a backbone of C6-C1 for phenolic acids, C6-C2 for phenylacetic acids, and C6-C3 for cinnamic acids. Flavonoids have a C6-C3C6 structure and the proanthocyanidins consist of multiples of this structure (C6-C3-C6)n. The structural skeletons of the most common plant phenolic compounds are shown in Figures 1, and 2, and some of the common non-glycosylated members of each group, their substitutions and molecular weights are listed in Table 1 [2-6, 35-39].
Table 1. Flavonoid functional groups*

Carbon Position (see Figure 1) 8 2 3
3 Flavones Apigenin Luteolin Diosmetin Tricin Sinensetin Tangeretin Nobiletin Flavonols Fisetin Kaempferol Morin Herbacetin Quercetin Robinetin Isorhamnetin Myricetin Gossypetin Flavanones Naringenin Isosakuranetin eriodictyol hesperitin
5 OH OH OH OH OCH3 OCH3 OCH3
4 OH OH OCH3 OH OCH3 OCH3 OCH3 OH OH OH OH OH OH OH OH OH OH OCH3 OH OCH3
Mass 270 286 300 330 372 372 402 286 286 302 302 302 302 316 318 318 272 286 288 302
OCH3 OCH3 OCH3
OH OH OH OH OCH3 OCH3 OCH3 OH OH OH OH OH OH OH OH OH OH OH OH OH
OH OH OCH3 OCH3 OCH3 OCH3 OCH3 OH OH OH OH OH OCH3 OH OH
OCH3
OH OH OH OH OH OH OH OH OH
OH OH OH OH OH OH OH OH OH OH OH
OH OH
OH
OH OH
Table 1. Continued
Carbon Position (see Figure 1) 8 2 3 OH OH OH OH OH OCH3 OH OCH3 OCH3
3 Flavan-3-ols catechin epicatechin gallocatechin epicgallocatechin Anthocyanidins Pelargonidin Cyanidin Peonidin Delphinidin Petunidin Malvidin Isoflavones Daidzein Genistein Glycitin Chalcones Butein Licochalcone Okanin Chalconaringenin Dihydrochalcones Phloretin
See Figure 1.
5 OH OH OH OH OH OH OH OH OH OH OH
4 OH OH OH OH OH OH OH OH OH OH OH OH
Mass 290 290 306 306 270 286 300 302 316 330 254 270 284
OH OH OH OH OH OH OH OH OH OH
OH OH OH OH OH OH OH OH OH OH OH OH 4 OH OH OH OH OH 5 6 2
OH OH
OH OH OCH3
2 OH OCH3 OH OH OH
3 OH OH OH
4 OH OH OH OH OH
6 272 272 286 288 274
OH
OH OH
COOH
4 3
HOOC
(Trans)-Hydroxycinnamic acids
7 8 6 A 5
O
C
4 2 3
2' 3' 4' B 5' 6'
Hydroxybenzoic acids (C6-C1)
(C6-C2)
O Flavones (C6-C3-C6) O
2 3
O O R O
Flavonols (R=OH, Ogly) (C6-C3-C6) Isoflavones (C6-C3-C6)
R O Flavanones (R=H)
Flavanonols (R=OH) (C6-C3-C6)
Figure 1. (Continues on next page.)
O+
7 6
O
2 4
R
Chalcones Dihydrochalcones (with a dihydro-double bond) (C6-C3-C6)
Anthocyanidins (R=OH for the common ones) Anthocyanins (R=Ogly) (C6-C3-C6)
Proanthocyanidins (4-8, or 4-6 C-C bonds, or additional C2-O-C7 bond) (C6-C3-C6)
R1 R Flavan-3-ols (Catechins) (R or R1=OH)
O Xanthones (C6-C1-C6)
O Anthraquinones (C6-C2-C6)
Stilbenes (e.g. resveratrol) (C6-C2-C6)
O C O
Chromones
C C
O
Coumarins
O Phenylpropanes (C6-C3)
(C6-C3) C C C
(C6-C3) O
C
Lignans
C C O Naphthoquinones (C6-C4)
(C6-C3)2
FIGURE 1. STRUCTURAL SKELETONS OF THE FLAVONOIDS AND OTHER PHENOLIC COMPOUNDS.
O HO OR O Malic acid (R=H) (MW=134)

OH
5 4 3 1
O OH HO
2
OH
3
HO OH HO
3 4 5
COOH
OH O Tartaric acids (MW=150) in 3 forms: 2R, 3R or 2S,3S or 2R, 3S (meso-)
OH Shikimic acid, MW=174 COOH CH2 COOH
COOH
OH
HOOC
H HO H
C OH C
3 4 5
Malonic acid, MW=104
HO
Quinic acid, MW=192
OH
CH3 CH3
C OH C OH COOH
CH
CH2 COOH
Isovaleric acid, MW=102
D-glucaric acid and its isomers, MW=210
CH3 CH C
CH3 COOH
Tiglic acid, MW=100
HO HO
O OH OH
HO
H3C
O OH OH
HOH2C HO HO
O OH OH
Xylose, other pentose MW=150

OH Rhamnose, MW=164
Glucose, other hexose, MW=180
HO2C HO HO
O OH
HO HO
O O OH OH O O
OH Glucuronic acid, other oxyhexoses, MW=194
Ellagic acid, MW=302
OH HO HO HO O OH
Phynelmethanoid glucosides, n=1 Phynelethanoid glycosides, n=2 Phenylpropanoid glycosides, n=3
Figure 2. Common phenolic conjugates.
OH O OH
HO HO O HOOC O
OH
(CH2)n
Rosmarinic acid (MW=360)
10
There are at least eight subgroups of flavonoids arising from variations in the structural arrangement and positions of the functional groups (mainly OH, OMe), glycosylation at multiple sites with a variety saccharides, and further acylation of the saccharides. These variations produce more than 5000 chemically distinguishable flavonoids [1-5, 34-42]. Similarly, the phenolic acids form derivatives with aliphatic acids, sugars, and other compounds, and polymerize to produce more than 3000 distinguishable compounds. The large number and numerous isomeric forms of the phenolic compounds make their identification in plants a complex undertaking [1-5, 34-42]. The different patterns of functional groups and glycosylation of the flavonoids create a range of polarities and solubilities. This range of solubilities is problematic for quantitative extraction of phenolics from plant materials but is useful when separating them chromatographically. Within a flavonoid subclass, the UV/Vis and mass spectra may be quite similar, but appropriate chromatographic columns, solvents, and solvent gradients can usually be selected that will separate small groups of targeted compounds. A large number of original research and reviews [2-5,40-42,44-51] have been published on the qualitative and quantitative analysis of flavonoids and other food phenolic compounds. Liquid chromatography (LC) with photodiode array (DAD) and/or mass spectrometric (MS) detection is the most frequently used method. Usually, a reverse phase column is used for separation, a DAD is used to acquire the molecular spectra, and MS, tandem MS (MS2), or ion trap MS (MSn), with electrospray (ESI) or atmospheric pressure chemical ionization (APCI), is used to acquire mass data for the parent ion and major fragments. In addition, newer instruments can acquire both positive and negative mass spectra with varying fragmentation energies, using in-source collision induced dissociation (CID), further enhancing the usefulness of MS for qualitative analysis. An analytical system based on LC-DAD-ESI/MS can be used to measure retention times, UV/Vis spectra, and positive and negative mass spectra at high and low fragmentation energies. This data can be used to provide provisional identification or, with the availability of standards or reference plants (with previously identified compounds), positive identification of phenolic compounds. Some reviews [48,49] have discussed the value of fragmentation patterns for elucidating flavonoid structures. In general, LC-DAD-ESI/MS lacks the ability to identify some isomers, such as the isomeric methoxylated flavones with their methoxy functions at the diffirent positions in the A or B ring, and the isomeric saccharides of the flavonoids. Usually, lacking authentic standards, NMR, either on- or offline, is needed to identify the point of attachment. LC-DAD-ESI/MS can be used to identify many food phenolic components based on a single chromatographic injection since the most common compounds have been well characterized. Many phenolics have been isolated and their structure identified using UV, IR, MS and NMR [3,5,35-37,36]. On-line NMR, usually as LC-DAD-NMR or LC-DAD-MSNMR [52-56], can, in principle, provide positive identification of all phenolic compounds. A major disadvantage is the lack of sensitivity of NMR (compared to ESI/MS). LC-MS provides simpler operation and is more convenient, more sensitive, less expensive, and has wider applicability. Thus, based on current technology and available archived data, LC-DADESI/MS is the method of choice for breadth and accuracy of identification of food phenolic compounds. The majority of the published methods for flavonoids [2-5,40-42,44-51] have focused on a specific plant material (e.g. oranges) or family of materials (e.g. citrus) and, consequently,
LC-MS Profiling and Quantification of Food Phenolic Components ...
11
on flavonoids from only a few subgroups. This is due to the fact that, despite the large number of glycosylated flavonoids, there are usually less than a dozen (representing only two or three subgroups) in a particular plant material. Consequently, most methods are optimized for separation of only two or three flavonoid subgroups. Since the focus is limited, the potential application of these methods to other flavonoid subgroups and other phenolics has not been explored. The current challenge is to achieve separation and identification on a larger scale using an LC-MS method that is applicable to all flavonoid subgroups and phenolic compounds. A more general method will offer the possibility of easier identification of plant phenolic by cross comparison with different plant sources analyzed using the same LC-MS conditions. After positively identifying most or all of the phenolic components of a plant, the established LC-MS profile (retention times and UV/Vis and mass spectra) would be used as a reference for future comparisons. Recently, we reviewed methods that have been used, or have the potential to be used, as profiling methods for phenolic compounds in food materials [57]. We evaluated 14 selected methods with respect to their suitability to serve as general profiling methods [17,58-69]. For each method, we considered their purpose, samples (matrix) analyzed, number of the subgroups analyzed, pre-extraction treatment, extraction, pre-analysis treatment, separation column, mobile phase, running time, method of detection, compounds identified and/or quantified, and the standards used. Only 4 of the methods were used for identification of at least 7 subgroups of naturally existing phenolic compounds in plant extracts [50,61,62,67]. Since many phenolic compounds are not commercially available, an increasingly important aspect of a general profiling method is the archiving of data to permit cross-comparison of samples and standards and retrospective analysis. In this chapter, we describe the development and application of a standardized phenolic profiling method based on a LC-DAD-ESI/MS [67] that is intended for the initial analysis of all plant materials. We have applied this method to the identification of the phenolic compounds in more than 360 foods. In addition, quantification of the phenolics and the usages of the plant profiles are discussed.
2. EXPERIMENTAL CONDITIONS
2.1. Method Overview
All samples and standards are subjected to the same analytical procedures as outlined in Figure 3. First, the flavonoids were extracted from the dried, powdered plant matrix. The extract was injected directly (without modification), after hydrolysis, and after heating, onto a reverse phase column and the separated peaks were detected using DAD and MS. Standards were solubilized and then analyzed using the same separation and detection scheme. Characterized samples (or reference plant materials), containing positively identified compounds that had been reported in the literature, were extracted using the same scheme and then analyzed directly and after hydrolysis using the same separation and detection scheme. When necessary, ambiguity in the elution order was clarified by duplicating the published separation procedure. The collected data (retention time and UV/Vis and mass spectra) were
12
used to identify the flavonoid, phenolic acid derivatives, or flavonoid polymer and compared to data for standards and characterized samples [67].
2.2. Instrumentation
2.2.1. Overview All the data presented in this chapter were acquired with an HPLC coupled to a DAD (Model 1100, Agilent, Palo Alto, CA) and an MS (MSD, SL, Agilent). A Waters (Waters Corp., Milford, MA) Symmetry column (C18, 5 m, 250 x 4.6 mm) with a sentry guard column (Symmetry 5 m, 3.9 x 20 mm) was used at flow rate of 1.0 ml/min. The column oven temperature was set at 25 C. The mobile phase consisted of a combination of A (0.1 % formic acid in water) and B (0.1% formic acid in acetonitrile). The gradient was varied linearly from 10 % to 26 % B (v/v) in 40 min, to 65 % B at 70 min, and finally to 100 % B at 71 min and held at 100% B to 75 min [67].
Figure 3. Standardized phenolic profiling method.
13
2.2.2. Diode Array Detector The DAD was set at 270, 310, 350, and 520 nm for real time monitoring of the chromatogram. These wavelengths were selected in order to monitor UV band I and II (the wavelengths of maximum absorption for the main phenolic groups) and the visible band for anthocyanins (Table 2). The molecular absorption spectra of 7 common flavonoids and one caffeoylquinic acid are shown in Figure 4. At 350 nm, absorption by flavonols, flavones, and most of the hydroxycinnamic acids and their derivatives could be seen. At 310 nm, less oxygenated flavones and cinnamic acids could be monitored and at 270 nm the flavanones, flavanols, proanthocyanidins, and benzoic acids and their derivatives could be observed. At 520 nm it was possible to pick up the anthocyanins. Consequently, this set of wavelengths in the UV/Vis was suitable for efficiently monitoring most plant phenolics [2,43,67]as shown in Figure 5, the LC chromatograms of Fuji apple skin. In addition, the software acquired data continuously using the DAD for all wavelengths from 200-650 nm. While only the 4 wavelengths listed above could be monitored in real time, the full UV/Vis spectra were available after acquiring the chromatogram. 2.2.3. Mass Spectrometer The MSD(SL) used electrospray ionization (ESI) and was programmable to acquire data sequentially, at a high frequency, using positive and negative ionization (PI and NI) at low (100 V) and high (250 V) fragmentation voltages. Data were routinely acquired for m/z 1002000. A drying gas flow of 13 L/min, a drying gas temperature of 350 C, a nebulizer pressure of 50 psi, and capillary voltages of 4000 V for PI and 3500 V for NI were used. The LC system was directly coupled to the MSD without stream splitting [67].
Norm. 350
4 2 1
A
Norm.
B 3 4 1
600
800
300
250
200
150
400
100
3
200
50
0 250 300 350 400 450 500 550 600 nm
0 220 240 260 280 300 300 340 360 380 nm
Figure 4. UV/Vis absorption spectra for: A) 1=quercetin 3-O-galactoside (flavonol), 2=sinengetin (flavone), 3=cyanidin 3-O-galactoside (anthocyanin), 4=chlorogenic acid (hydroxycinnamic acid derivative); B) 1= hesperidin (flavanone), 2=epicatechin (flavanol), 3= genistin (isoflavone), 4=phloridzin (dihydrochalcone).
14
m AU 100 50 0

DAD1 C, Sig=270,8 Ref=700,100 (LIN\ETEST-2\ETEST136.D)
11 3 4 13 5 6 7 8
20
10
25
12
14
30
15 17 16
A
18
35
19
m in
5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\ETEST-2\ETEST136.D) m AU 6 4 2 0
1 2
5 10 15 20 MSD1 TIC, MS File (LIN\ETEST-2\ETEST136.D) API-ES, Pos , Scan, Frag: 70, "PI 70" 25 30 35
m in
350000 300000 250000 200000 150000 100000 5 10 15 20 MSD2 TIC, MS File (LIN\ETEST-2\ETEST136.D) API-ES, Pos , Scan, Frag: 250, "PI SIM" 300000 200000 100000 5 10 15 20 MSD3 TIC, MS File (LIN\ETEST-2\ETEST136.D) API-ES, Neg, Scan, Frag: 70, "NI70" 150000 100000 50000 5 10 15 20 MSD4 TIC, MS File (LIN\ETEST-2\ETEST136.D) API-ES, Neg, Scan, Frag: 250, "NI 250" 150000 100000 50000 0 5 10 15 20 25 30 35 25 30 35 25 30 35 25 30 35
m in
m in
m in
m in
Figure 5. Chromatograms of extracts (250 mg/5.0 ml solvent/50 l injected) of Fuji apple skins: A) 270 nm, B) 520 nm, C) TIC for PI100, D) TIC for PI250. E) TIC for NI100, F) TIC for NI250.
Table 2. UV/Vis absorptions bands* of phenolic compounds and the most sensitive ionization modes for mass data
Compounds Benzoic acids Cinnamic acid Flavones Flavonols Flavanones Chalcones Dihydroxychalcones Isoflanones Anthocyanins Coumarins Anthraquinones UV II (nm) 270-280 (290-300) 250-270 250-270 270-295 340-390 270-280 245-270 240-280 220-230 420-460 I** ---305-330 304-350 350-380 (300-370) (300-320) 340-390 ---(300-340) (315-325) 310-350 ---Vis ---------------+ ------450-560 + + PI ------+ + + + + + + + NI + + + + +
+ + +
* References [2,43]. ** As a shoulder in the range indicated in ( ).
LC-MS Profiling and Quantification of Food Phenolic Components ... Table 3. Phenolic Compounds in Fuji Apple Peel
Peak no tR (min) [M+H]+/[MH]- (m/z) 449/447 419/417 ---/353 [A+H]+/[AH]- and other NI ions (m/z) 287/285 287/285 ---/191, 179, 173, 135 ---/-----/--289/--579,289/--867,579,289/-1155, 867,579,289/-465, 303/301 303/301 303/301 303/301 303/301 303/301 303/301 303/301 275/253 275/253 UV/Vis Abs max (nm) 280, 516 udb 240, 298sh, 306 280 280 280 280 280 280 Identification
15
Anthocyanins 1 6.01 2 7.99
cyanidin 3-Ogalactosidea cyanidin 3-Oarabinoside chlorogenic acida catechina epicatechina procyanidin dimer procyanidin trimer procyanidin tetramer procyanidin pentamer rutina quercetin 3-Ogalactosidea quercetin 3-Oglucoside a quercetin 3-Oxyloside quercetin 3-Oarabinopyranoside quercetin 3-Oarabinofuranoside quercetin 3-Opentanosideb quercetin 3-Orhamnosidea phloretin pentosylhexoside phloridzin a
Caffoeylquinc acids 3 11.10
Flavan-3-ols (group V) 4 11.12 291/289 6 15.79 291/289 Proanthocyanidins (group V) 5 13.25 579/577 7 17.70 867/865 8 9 19.30 21.10 1155/1153 1443/1441
Glycosylated flavonols (group II) 10 25.50 611/609 11 12 13 14 15 16 17 26.02 27.40 28.71 29.73 31.29 31.29 30.15 465/463 465/463 435/433 435/433 435/433 435/433 449/447
256, 266sh, 352 256, 266sh, 352 256, 266sh, 352 256, 266sh, 352 256, 366sh, 352 256, 266sh, 352 256, 266sh, 352 256, 266sh, 352 220, 284 220, 284
Glycosylated dihydrochalcones 18 33.04 569/567

a
19
38.48
437/435
Identified with standard. b: not positively identified.
16
The suite of 4 MS data streams (labeled as PI100, PI250, NI100, and NI250 in the text) allowed detection of the molecular ions and fragments for each of the detected phenolic components in the injected solution in a single chromatographic run. Availability of both PI and NI data guaranteed that ions were detected regardless which mode offered the greater ionization efficiency. The preferred ionization mode for the flavonoids and other phenolic components are listed in Table 2. When data for both ionization modes were available, it was possible to cross check results and identify the molecular and aglycone ions with greater confidence. The use of high and low fragmentation voltages offered data similar to that available from MSn techniques. The low fragmentation voltage in both the PI and NI mode provided intense peaks for the molecular ions while the high fragmentation voltage provided significantly more fragments from the cleavage of the molecular ion allowing the aglycones and other important fragments to be observed. Typical chromatograms for the 4 MS detection modes (PI100, PI250, NI100, and NI250) are shown in Figure 5 for Fuji apple skins. Table 3 shows a compilation of the retention times, positive and negative molecular ions, and positive and negative ion fragments (aglycone ions and other fragments). The phenolic acids and their derivatives always provided higher counts and specific mass ions with negative ionization.
2.2.4. LC Columns Numerous reverse phase C18 and C8 columns have been described in the literature for the separation of phenolic compounds in plant materials [2,40-42,44-69,90-118]. We have reported testing seven commercially available reverse phase C18 columns (Waters Symmetry, SymmetryShield, XterraTM phenyl, YMC, Phenomenex Luna, Synergi, and Agilent Zorbax), all with similar characteristics (4.6 id x 250 mm, particle size of 5 M). They were compared for the separation of ten groups of flavonoid isomers and two groups of mono- and dicaffeoylquinic acids. This was a particularly appropriate test since the isomeric mixtures of phenolic compounds that frequently exist in plants are difficult to identify because they have the same UV and mass spectra. For each column, the same gradient of acetonitrile-water was used with a constant concentration of 0.1% formic acid. The results showed that, in general, the Symmetry and Zorbax XSD-C18 columns offered the best separations, followed closely by the SymmetryShield and Luna columns. None of the columns, however, were able to separate all the isomeric flavonoids and caffeoylquinic acids. For the best results over the entire range of polarities of the extracted compounds more than one column was needed. For the most accurate identification, two or more columns should be used to check the primary separation. For the standardized profiling method, we chose to use the Waters Symmetry column (Waters Corp., Milford, MA) with a sentry guard column (Symmetry 5 m, 3.9 x 20 mm) at a flow rate of 1.0 ml/min. The column oven temperature was set at 25 C. 2.2.5. LC Mobile Phase The most frequently used mobile phases for LC-MS reported in the literature have been aqueous acetonitrile, aqueous methanol, or a mixture of the two with formic (0.1 to 0.5%), acetic (0.25 to 0.5%), trifluoroacetic acid (0.05%), ammonium acetate (10 or 50 mM), or formate (10 or 50 mM) [2,40-42,44-51,95-110]. For the profiling method, we selected an acetonitrile-water mobile phase with 0.1% formic acid. This selection was based on careful
17
examination of total counts for individual peaks in the TIC and SIM mode for chromatograms of a mixture of five glycosylated flavonoids (rutin, quercetin 3-O-rhamnoside, luteolin 7-Oglucoside, genestin, and hesperidin) and one hydroxycinnamate (chlorogenic acid) obtained using each of the mobile phases listed above. In general, 0.1% formic acid offered the highest peak counts for most of the tested phenolics. Furthermore, aqueous-acetonitrile with 0.1% formic acid offered the best separation [51, 67]. For the standardized profiling method, the mobile phase consisted of a combination of A (0.1 % formic acid in water) and B (0.1% formic acid in acetonitrile). The gradient was varied linearly from 10 % to 26 % B (v/v) in 40 min, to 65 % B at 70 min, and finally to 100 % B at 71 min and held at 100% B to 75 min [67]. In cases where foods contained interesting but very polar or non-polar compounds outside the range off our standard conditions, a second chromatographic run was made with a modified gradient. For example, 3-qalloylquinic acid and theanine in tea eluted at 2.5-3.0 min using standard conditions, so an additional 10 or 20 min was added to the beginning of the gradient, i.e., going from 0% to 10% B in 10 or 20 min, to 26% B at 50 or 60 min, and to 65% B at 80 or 90 min. Similarly, when some interesting compounds (such as biflavones of Ginkgo biloba) eluted at 70 min or after, the gradient was extended from 65% to 100% B between 70 and 100 min [119,120]. If interesting compounds (as indicated by mass spectra) were severely overlapped and their confident identification could not be made, then a second run was made using a reduced gradient at the time of interest to enhance the separation.
2.3. Sample Preparation

2.3.1. Drying Over 360 food materials, including spices and herbs, were bought from local food stores in Maryland or natural product companies in the US. Each food had its own name as its primary plant identification. Many of the materials, such as dried beans, grains, nuts, spices and herbs, were in their dried forms, while others, such as most of the vegetables and fruits, were in their un-dried forms. An initial study was made of the common methods of drying food materials. We compared two drying methods for five foods: Chinese celery (containing 13 phenolic compounds), sugar pea pods (4 phenolic compounds), Israel tomatoes (8 phenolic compounds), Chinese cilantro (10 phenolic compounds), and fragrant pear skins (14 phenolic compounds). Each material was dried by air drying at room temperature (22-23 C) for several days in a hood and freeze-drying (freezing in a conventional freezer followed by lyophilization). Analysis by LC-DAD showed that the peak areas of each of the 50 phenolic peaks from all 5 samples agreed well for both drying methods. A published comparison of the phenolic contents of freeze-dried and air-dried (at 77 C for short period, then 49 C for 88 hours) marionberries and strawberries indicated that freeze-dried samples had higher peak areas [70]. These results differed from ours and may be the result of the longer storage time for our samples resulting in reduced activity of endogenous enzymes and/or that changes in the phenolic distribution were completed prior to our drying test.
18
It is indisputable that fresh plant materials will always have the potential for containing active enzymes that can alter the apparent composition during the preparation step. Thus, to obtain profiles representative of the naturally existing components at the time of harvest, the safest approach is to freeze the fresh materials immediately and then lyophilize them. Certainly, the characterization of the chemical composition of a plant material at the time of harvest is arbitrary since the composition is a dynamic process and there is no way of guaranteeing that the harvest point is reproducible. However, some time point is necessary and the time of conventional harvest is still the most logical point.
2.3.2. Particle Size The powders of the leaves, flowers, and other parts of herbaceous plants, were passed through 20 mesh sieves prior to determination of phenolic compounds. For hard woods and nuts, finer powders were preferred so the ground material was passed through 40 or 60 mesh sieves. Finer powders were necessary for the harder, denser materials to allow the solvent to penetrate the wall of plant cell and extract all the phenolics [67,71]. 2.3.3. Solvent Extraction Analysis of the phenolic components of the plant leaves, flowers, and fruit skins, which contain relatively high concentrations of phenolics, was usually based on a simple solvent extraction. Many extraction methods for plant materials have been reported in the literature. The primary differences between these methods are the extraction solvents and techniques [2,40-42,44-51,72-91]. For the extraction of the phenolic compounds from their host plant materials, the most commonly used solvents were methanol (MeOH), ethanol (EtOH) , acetone, acetonitrile (ACN), and dimethyl sulfoxide (DMSO) diluted at various ratios with water. Techniques for extraction have ranged from simple agitation with shaking, stirring, vortexing, or sonication to more aggressive heating techniques such as reflux extraction (including Soxhlet), microwave-assisted extraction (MAE), and high temperature-pressure extraction (specifically accelerated solvent extraction or ASE) [74-87]. Supercritical fluid extraction (SFE) has been shown to be useful for the extraction of non-polar compounds and, with the addition of polar modifiers such as MeOH or EtOH, have been used for the extraction of more polar molecules. Extraction using SFE has proven useful for some flavonoids (biflavones and methoxyflavonoids) but, in general, has not been satisfactory for the more polar glycosylated flavonoids [88-91]. Extraction conditions were initially evaluated using the 23 flavonoids (flavones, flavonols, flavanones, and dihydrochalcones) in Mexican Oregano (Lippia graveolens H.B.K.) (Verbenaceae) as a test material [92]. Extraction efficiencies for each of the flavonoids were determined for MEOH, EtOH, ACE, ACN, and DMSO varying from 0-90 % (v/v) in water. The best extraction solvents were then combined with each of the extraction techniques (shaking, stirring, sonication, MAE, and ASE). The temperature for extraction was kept under 40 C for all techniques. It was determined that MeOH-water (60:40, v/v) and sonication at room temperature for one hour provided the high extraction efficiency for the Mexican oregano glycosylated flavonoids with the greatest simplicity and least cost [67]. The selected extraction method was further evaluated by examining the extraction efficiency of the main glycosylated flavonoids, flavonoid aglycones, and hydroxycinnamates from five plant materials (cranberries, elder flowers, Fuji apple skins, navel orange peels, and
19
soybean seeds). In this study, 100 mg of the dried sample were extracted with 5.0 mL of solvent. The level of extraction defined as 100% efficiency was based on the LC peak areas obtained from three extraction cycles with MeOH-water (60:40, v/v) or a single extraction with DMSO-water (60:40, v/v); both methods using sonication. Using a single extraction cycle, the extraction efficiencies for 24 glycosylated flavonoids, 9 flavonoid aglycones, and 11 hydroxycinnamates in the five plant materials exceeded 95%. The exceptions were 3 flavonones in the navel orange peels, which had extraction efficiencies between 60% and 80%, depending on the temperature. Based on these results, the following extraction method was adopted for the extraction of the samples for the standardized phenolic profiling method. Dried plant materials (100-250 mg) were extracted with 5.0 ml of MeOH-water (60:40, v/v) at room temperature (starting at 22C and ending below 35 C) using sonication for one hour. For leaves and flowers, 100 mg was used while 250 mg was used for dry beans, fruit skins, and other materials [67]. For some plant materials, especially those containing relatively high phenolic concentrations, smaller volumes were used, usually 0.50 ml or less, with 10-25 mg of plant material. This was a sufficient volume for a full analysis including hydrolysis. Some plant phenolic compounds are unstable in acidic or basic solutions or when heated. Consequently, the extraction was carried out at room temperature (less than 35 C), without addition of any acid and base. The sample analysis was completed in less than 24 h after the extracts were prepared [67]. If repeat analyses were anticipated, the extract was stored in a freezer at -80 C or the sample was analyzed using a new extraction.
2.3.4. Enrichment Some fruits, nuts, and grains contain much lower concentration of phenolic compounds compared to the leaves and flowers. Thus, phenolic compounds might be not able to be detected in the extracts obtained by the sample preparation methods described in the previous sections. Several methods were used for enriching the phenolic compounds to allow detection. The simplest approach was to concentrate the extract by evaporating the solvent to dryness under vacuum and re-dissolving the residue in a much smaller volume of solvent. A second approach was the use of solid phase extraction. This approach was used for the preparation of cashew apple and cranberry extracts [93] and has been used to extract phenolic compounds from fruit juice, wine and other liquid food products. Solid phase extraction with hydrophobic materials can concentrate the phenolics and clean up the sample by leaving behind most of the water soluble polar compounds, such as sugars, amino acids, and some non-polar plant components, such as chlorophyll. Polyamide-6 cartridges have been used to enrich the phenolic components in foods. Other methods for concentrating the minor phenolic compounds are thin layer chromatography (TLC), preparative HPLC, and flash column chromatography [93, 94].
2.4. Additional Preparation Methods

Acid hydrolysis converts flavonoid glycosides into their aglycones, while alkaline hydrolysis converts the acylated glycosides or phenolic acid derivatives into their parent glycosides and phenolic acids, respectively. Heating will also convert malonylated and
20
acetylated glycosides to the parent glycosides but this is not effective for other acylated forms. Thus, acid hydrolysis can be used for positive identification of the aglycones. Similarly, alkaline hydrolysis of the acylated glycosides can be used to identify the parent glycosides. Based on results from the initial profiling analysis, one or more of the following three samples treatments, followed by repeat analysis by LC-DAD-ESI/MS, was necessary for characterization of the phenolic components. Accurate volumes of the hydrolyzed samples were necessary to relate the concentrations of the resulting aglycones to the glycosylated forms in the original extracts [67]. Acid Hydrolysis: Filtered extract solution (0.50 mL) was mixed with concentrated HCl (0.10 mL) and heated in a capped tube at 85 C for 2 h. Then, 0.40 mL of methanol was added to the mixture, and sonicated for 10 min. The solution was re-filtered prior to HPLC injection [67]. Alkaline Hydrolysis: Filtered extract solution (1.00 mL) was taken to dryness and mixed with 2N or 4N NaOH (0.30 mL) solution and kept at room temperature under a N2 atmosphere for 18 h. Concentrated HCl (0.15 mL) was added to the reaction mixture to adjust the pH to 1.0. MeOH (0.55 mL) was added and the solution was filtered prior to LC injection [67]. Heating: Filtered extract solution (0.50 mL) was heated in a capped glass tube at 80-85 C for 16 h to remove the malonyl (or acetyl) group from the glycosides. After cooling at room temperature for 30 min, the solution was filtered before LC injection [67].
2.5. Detection limits

The detection limits for rutin, quercetin 3-O-rhamnoside, luteolin 7-O-glucoside, genestin, hesperidin, and chlorogenic acid were determined. Based on absorption at 350 nm (except hesperidin, detected at 270 nm) or MS total ion count (TIC), the limit of detection was approximately 4 - 6 ng (~0.01 nanomole). Detection with MS in the selective ion monitoring (SIM) mode produced a detection limit of 0.4-0.6 ng (~0.001 nanomole), approximately 10 times lower than for UV and TIC detection [67]. These values are consistent with other reported values [51]. Table 4. Relationship between the extract mass and solvent volume, injection volume, and detection limitation
Extract (1.0 ml) made from a dried plant in mg 20** 20** 50 50 100 200 400 1000 Injection volume, ul 10 50 10 50 50 50 50 50 Detection* limitation (% dried plant) 0.005 0.001 0.002 0.0004 0.0002 0.0001 0.00005 0.00001 Detection* limitation (mg/g) 0.05 0.01 0.02 0.004 0.002 0.001 0.0005 0.0001
* For the flavonoid glycosides and phenolic compounds with molecular weight among 450-650. ** For most of common plant materials, the indicated concentration is suitable for quantitative determination.
21
The detection limit can be expressed in terms of concentration in the extract or in the sample based on the most commonly used injection volumes, sample masses and extraction solvent volumes as shown in Table 4. In most cases, the detection limit for extracts of 250 mg of sample with 5.0 ml of solvent and a 50 l injection volume was 0.0002 % on a dry weight basis, i.e. 2 mg of a phenolic compound in one kg of a dry plant material. This limit was sufficient to measure the main phenolic compounds in most plant materials and to calculate the total phenolic content of food, intake levels. Of course, some minor compounds were still below the detection limit. These minor compounds required enrichment in order to be detected and quantified.
3. PHENOLIC PROFILES AND COMPOUND IDENTIFICATION

3.1. Application of the Standardized Phenolic Profiling Method
The profiling method described in the Experimental Section provides a reasonable separation of phenolic compounds with UV/Vis and mass spectrometric detection in a single chromatographic run [67]. As an example, consider the analysis of phenolic compounds in Fuji apple skins. Figure 5 shows two DAD (270 nm and 520 nm) and four MS (PI100, PI250, NI100, and NI250) chromatograms acquired using the standardized profiling method. The chromatogram at 270 nm (A) shows 2 dihydrochalcone glycosides, 2 catechins, 4 proanthocyanidins, and an additional 10 flavonoid and chlorogenic acid peaks in the extract while the chromatogram at 520 nm (B) shows 2 anthocyanins. Flavonol glycoside and chlorogenic acid peaks were also found in the chromatograms at 310 and 350 nm although their relative peak intensity ratios were quite different. All the peaks, except the proanthocyanidins, in the chromatographic profiles of Fuji apple skins in Figure 5 were positively identified (Table 3). Identification of 10 of the 19 labeled peaks was made by direct comparison with authentic standards. Assignment of the remaining peaks was based on previously characterized compounds in Fuji and other apples [35,40,62,81,98]. In the case of the two quercetin 3-O-arabinosides, identification was made by comparison with positively identified compounds in cranberries [67, 93, 145]. The peak absorbances at 270 nm and 520 nm (Figure 5) permit absolute quantification of phenolic compounds if standards are available, as was the case for the flavonoids in Mexican oregano, cashew apple, and three celery samples [92,93,122]. Lacking standards, the peak areas were used to establish relative concentrations of each component in the extract. Since the peak area is dependent on the extraction mass of the plant material, the extraction and injection volumes, and the LC and detector conditions, this information must be available. The data for the six apple varieties in Figure 6 were acquired at 270 nm and 520 nm with a 50 L injection of a 5.0 ml methanol-water (60:40, v/v) extract of 100 mg of plant material using the column and MS conditions described in the Experimental Section. Thus, this data, when combined with standards that become available at a future date, will permit quantification.
22
DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09042.D) m AU 60 40 20 0

17 16 18
35
11 5 6 7 8
20
10
25
12
13 14
15
F uji apple skin

19 20
40 45 50
5 10 15 DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09043.D) m AU 20 10 0 -10 5 10 15 DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09044.D) m AU 10 0 5 10 15 DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09045.D) m AU 20 10 0 5 10 15 DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09046.D) m AU 60 40 20 0 5 10 15 DAD1 C, Sig=270,8 Ref=400,100 (LIN\07-09048.D) m AU 20 10 0 5 10 15
30
m in
Golden apple skin

20
20 25 30 35 40 45 50
B
21
m in
Gala apple skin
20
25
30
35
40
45
50
m in
Cameo apple skin
20
25
30
35
40
45
50
m in
Rome apple skin
20
25
30
35
40
45
50
m in
Mcintosh apple skin
20
25
30
35
40
45
50
m in
Figure 6. Chromatograms (270 nm) of the skin extracts (250 mg/5.0 ml solvent/50 l injected) of: A) Fuji, B) golden, C) gala, D) cameo, E) Rome, and F) Micintosh apples.
As previously mentioned, the phenolic compounds found in plants tend to follow taxonomic lines. They can be used for botanical identification by comparison to reference profiles (acquired under the same conditions) of authentic plant materials. With the standardized method, not just the chromatographic profiles, but the full collection of UV/Vis and MS data can be used for comparison. For example, the LC-MS profiles for the skins of golden delicious, Royal Gala, Cameo, Rome, Mcintosh, pink lady, Granny Smith, Pacific rose, Empire and red delicious apples are very similar to that of Fuji apples (Figure 6). All belong to Malus pumila L. varieties; all are trees of the Malus genus [35,40,62,81,98]. Thus, the phenolic profile of the Fuji apple skin makes it possible to determine the phenolic compounds of any apple skin worldwide. Differences among the apple profiles are expected to occur as a function of the cultivar, growing conditions (location, soil, weather, and fertilization), maturation at harvest, and storage conditions [123-125]. Pattern recognition techniques can be used to identify these conditions. Conversely, it is possible to use the chemical profiles of the apples as a yardstick for optimizing concentrations of desired compounds.
3.2. Identification of the Plant Phenolic Components

Flavonoids and phenolic derivatives of many plants have been studied in detail and many of them positively identified and their structure fully elucidated using MS and NMR [2,4,6,34-43,51,67]. Compared to other plant components, such as alkaloids and terpenoids, the flavonoids and phenolic derivatives are structurally simpler and their subgroups (aglycones, glycoside types, glycosidic sequences, and acylation) readily identified using
23
UV/Vis, MS, and MSn. Isomeric details, however, are more suitably determined using NMR. Analysis of the UV/Vis and MS data cannot provide identification of specific pentosyls or hexosyls or the position of the glycosidic and acyl linkages. Morever, UV and MS data cannot identify the positions of some of the methoxy or hydroxy groups on non-glycosylated flavonoids. Although many isomers cannot be identified by UV/Vis, MS, or MSn, their presence can be inferred by differences in the retention times of compounds with identical masses. Positive identification can be achieved by comparison to known standards or positively identified compounds from the literature. However, based on retention times, elution order, UV/Vis and MS data, and taxonomic similarities, provisional identification, with a high degree of certainty, can be made. This section will consider the characteristics of each subclass of phenolic compounds as well as the flavonoid subgroups and how to use these characteristics for their identification.
3.2.1. Flavonols and Flavones The largest and most ubiquitous flavonoid subgroup in the plant kingdom is the flavonols. Common flavonol aglycones are listed in Table 1. They have a 3-hydroxy group (Figure 1) and are usually found in their glycoside form in fruits, vegetables, spices and herbs [2,4,6,34-43,51,67]. Flavonol glycosides are usually present at relatively low concentrations, i.e. at 15-30 mg /kg (fresh weight) [1,2, 40]. The concentration of flavonols (and flavones, flavanones, flavan-3-ols, and anthocyanidins), as aglycones, in 59 US fruits, nut and vegetables has been reported [17]. These data have been incorporated, as a supplemental database, in the USDA National Nutrient Database for Standard Reference (16). The flavonoid supplemental database contains values collected from published literature after critical evaluation. These data are updated routinely and are available online. More than 80 sugars, including 10 mono-saccharides, 50 di-saccharides, 30 trisaccharides and one tetra-saccharde, have been reported [2,4,6,34-43] with linkages at one, two, or more positions on the flavonols. Moreover, some glycosylated flavonols have one or more different acyl groups (such as acetyl, malonyl and the acyls of phenolic acids) attached to the saccharides. Consequently, more than 200 glycosides have been reported for both quercetin and kaempferol [35]. The most common glycoside is glucose, followed, in decreasing frequency, by rhamnose and rutinose (6-O--L-rhamnosyl-D-glucose). The glycosides formed from D-saccharides (Dglucose, D-g lactose, D-glucuronic acid, D-xylose, and D-apiose) are known as -Dglycosides while those formed from L-saccharides (L-rhamnose and L-arabinose) are known as -L-glycosides. Most of the glycosides, however, are -D-glycosides. The glycosylated flavonols most commonly have saccharides at the C3 position, a small number at the C7 position, fewer still at the C3, or C4 position, and very rarely at the C5 position. Diglycosides (at the 3,3-, 3,4-, and 7,4- positions) and triglycosides (3,7,4-) have been reported. The glycosides of quercetin and kaempferol, including quercetin 3-O-glucoside, quercetin 3-O-rutinosides (rutin), kaempferol 3-O-glucoside, and kaempferol 3-O-rutinoside, are the most abundant flavonoids in the plant kingdom. Rutin is one of the most common flavonoids found in foods, such as asparagus sprout (Asparagus officinalis L.) (Liliaceae) [126, 127], buckwheat (Fagopyrum esculentum Moenth) (Poligonaceae) [128, 129], grape
24
tomato and several other tomatos (Lycopersicon spp.) [130-132], and avocado leaf (Persea americana Mill.). Two other aglycones, isorhamnetin and myricetin, are the second most common flavonoids in vegetables. The glycosides of some methylated flavonols, such as 3,5,7,3,4-pentahydroxy-6-methoxyflavone (patuletin), 3,5,2', 3'-tetrahydroxy-4'-methyoxy6,7-methylenedioxyflavone, and their isomers, have been reported as the main flavonol glycosides of baby spinach (Spinacia oleracea L.) (Chenodiaceae), a common vegetable throughout the world [133-135]. Most fruit and many vegetables contain 5-10 different flavonol or flavone glycosides as their major flavonoid constituents. In general, the flavonols accumulate in the outer and aerial tissues (peel and leaves) and the content changes significantly with maturation [2,57,67]. Flavonoid content is always highest in vegetables grown in the summer months and in the green outer leaves, as compared to the light-colored inner leaves, of leafy vegetables such as lettuce and cabbage. Flavones are the second largest group of flavonoids found in fruit and vegetables. Some common non-glycosylated flavones are listed in Table 1. Glycosylated flavones are usually found with saccharides at the C7 position. The O-glycosides of luteolin and apigenin are among the chief members of this group. Some vegetables, spices, and herbs, such as celery (Apium graveolens L) (Umbelliferae or Apiaceae) [122], parsley (Petroselinum crispum Mill) (Umbelliferae) [122,136], cumin (Cuminum cyminum L.) (Umbelliferae) [137], chrysanthemum flowers (Chrysanthemum morifolium Ramat) (Compositae) [138], and red bell peppers (Capsicum anumuum L.) [122, 139-141] contain glycosylated flavones as their main flavonoids. The most important edible sources of flavones, however, come from a relatively small group of foods, such as celery, mung bean [142], and parsley. Some foods, such as lemon grass (Cymbopogon citrates (DC.) (Gramineae), citrus [143], and some melons [144], contain C-glycosides of flavones as their main flavonoids. The peels of citrus fruits contain large quantities of polymethoxylated flavones, such as, tangeretin, nobiletin, and sinensetin [67, 143]. The flavonols have absorption maxima at 250-270 nm (UV Band II) and 350-380 nm (UV band I), while the flavones have absorption maxima at 250-270 nm (band II) and 330350 nm (band I) (Table 2) [43, 67]. For example, the UV spectra of quercetin 3-O-galactoside (flavonol) and sinnengetin (flavone) are shown in Figure 4A and luteolin and luteolin 7-Oglucoside are shown in and Figure 7. The position of the UV absorption bands and the shifts caused by oxygenation, methylation, or glycosylation, are important. There are several general rules concerning shifts caused by substitution that can be used for identification. Shift reagents [43], such as sodium acetate (NAOAc) and aluminum chloride (AlCl3) have been used postcolumn to deduce the oxygenation pattern of the flavone skeleton [98]. This is not necessary for most of the common food flavonoids.
3.2.1.1. Identification of Non-glycosylated Flavonols and Flavones (Aglycones) Compared to the ubiquitous glycosylated forms of the flavones and flavonols, the aglycones are present in far fewer plant materials and at much lower concentrations. Since relatively more aglycone standards are available, however, their identification and quantification in plant materials is easier than it is for any other group of phenolic compounds. In addition, complete data is available on the retention times and UV and MS spectra for most aglycones. Thus, most aglycones in most plant materials can be positively identified.

*DAD1, 32.247 (359 m AU, - ) Ref=0.001 & 50.954 of STDGF081.D *DAD1, 29.342 (75.9 m AU, - ) Ref=0.002 & 50.956 of STDGF086.D *DAD1, 19.768 (88.9 m AU,Apx) Ref=0.001 & 50.955 of STDGF140.D *DAD1, 27.586 (97.2 m AU, - ) Ref=0.006 & 50.953 of STDGF133.D Norm . 350 300 250 200 150 100 50 0 225 250 275 300 325 350 375 400 425 nm
*DAD1, 26.395 (279 m AU, - ) Ref=1.756 & 36.689 of LCOLU337.D *DAD1, 30.022 (342 m AU, - ) Ref=1.769 & 54.582 of LCOLU184.D *DAD1, 25.459 (60.4 m AU, - ) Ref=0.006 & 43.106 of 07-10062.D *DAD1, 26.239 (113 m AU, - ) Ref=0.006 & 43.106 of 07-10062.D
25
A
2 1
Norm .
B
1 3
300
250
4 3
200
150
100
50
0 225 250 275 300 325 350 375 400 425 nm
Figure 7. UV spectra of: A) 1=kaempferol, 2=kaempferol 3-O-glucoside, 3=luteolin, and 4=luteolin 7O-glucoside; B) 1=ellagic acid, 2=quercetin, 3=morin, and 4=bobinetin.
Mabry et al [43] summarized the relationship between the UV spectra and degree of oxygenation of the aglycones making it possible to deduce the structural skeleton based on UV data alone. For example, increased oxygenation of the B-ring produces a bathochromic (longer wavelength) shift of max of band I, no shift of max of band II, and an added peak at a wavelength below band II. The additional peak can be used to distinguish common isomeric flavones and flavonols. For example, kaempferol has one hydroxyl function at the C4' position of the B-ring and one peak (band II ) with max around 266 nm. Luteotin has two hydroxyl groups at the C3' and C4' positions of the B-ring and an additional peak (max 254 nm) just below the band II peak (max 264 nm) (Figure 7A). Increasing hydroxylation of the A-ring produces a notable bathochromic shift for the maximum of band II and a smaller shift for Band I. Hydroxylation at C5 has a significant effect on both Band I (a 3-10 nm shift) and band II (a 6-17 nm shift) while O-methylation at C5 produces a 5-15 nm hypsochromic (shorter wavelength) shift in both Bands I and II. Addition of an O-methyl group at C3 and C4' produces 12-17 and 3-10 nm hypsochromic shifts in Bands I and II, respectively. Oxygenation at other positions (such as C7, C3', C6, or C5') has little or no effect on the UV spectra. There are additional publications that provide UV data for more than 50 flavonols and flavones [43,144-147] and for HPLC separation of common aglycones [147]. These sources can provide assistance on the assignment of the hydroxy functions in the flavonoid skeleton. There are more than 200 biflavonyls found in plants [35] and a limited number of flavones and flavonols also contain one or more alkyl groups, such as prenyl [CH2CH=C(CH3)2, add 68], 1,1-dimethylprop-2-en-1-yl (add 68), 3-hydroxy-3-methylbutyl (add 86), geranyl [CH2CH=C(CH3)CH2CH2CH=C(CH3)2, add 134], lavandulyl {CH2CH[C(CH3)=CH2]CH2CH=C(CH3)2, add 136}, 3-methylsuccinoyl (HO-CH(COOH)CH2-CHO, add 114), 5-hydroxy-2-isopropenyl-5-methylhexyl (add 154), 4hydroxyphenylmethyl (add 104), 4-hydroxyphenylethyl (add 120), and prenyloxy (add 84),
26
m AU 350 300 250 200 150 100 50 0

DAD1 C, Sig=270,8 Ref=450,100 (D:\QUANT-2\QUANT372.D)
1 2
5 6 3 7 4
20 25
9 8 10 11 12
35
Ledum leaf extract
5 10 15 DAD1 A, Sig=350,4 Ref=450,100 (D:\QUANT-2\QUANT378.D) m AU
30
40
45
m in
5
120 100 80 60 40 20 0 5 10 15 DAD1 A, Sig=350,4 Ref=450,100 (D:\QUANT-2\QUANT381.D) m AU 175 150 125 100 75 50 25 0 5 10 15 20 25 30 35 40 45 m in 20 25 30 35 40 45 m in
9 Cranberry extract 1 10 6 7 8
5 9 1 4 6 7 8 10 Fuji apple peel extract
Figure 8. Chromatograms (270 nm) recorded with a Zorbax-XSD-C18 column (Agilent Corp) of A) ledum leaves, B) cranberries, and C) Fuji apple skins. Peaks were identified as 1=chlorogenic acid, 2=(+)-catechin, 3=(-)-epicatechin, 4=rutin, 5=quercetin-3-O-galactose, 6=quercetin-3-O-glucoside, 7=quercetin-3-O-xylopyranoside, 8=quercetin-3-O-arabinopyranoside, 9=quercetin-3-Oarabinofuranoside, 10=quercetin 3-O-rhamnoside, 11=quercetin-3-O-6-acetylglucoside, and 12=quercetin-3-O-acetylglucoside.
methylenedioxy (add 44). These functional groups are found most commonly at the C6 or C8 (or both) positions, and occasionally at other positions on the flavonoid skeleton [35]. Thus, it is worth remembering that the mass of these subsitutions, which might be attached to the flavonoid skeleton and add the related mass contribution, although they dont occur frequently.
3.2.1.2. Identification of O-monoglycosylated Flavonols and Flavones Most of the naturally existing O-glycosylated flavonoids are mono or disaccharides with linkages at the C3, C7, C3', or C4' positions (when present on the aglycone). The monosaccharides are usually one of several isomeric pentoses, hexoses, oxyhexoses, or rhamnoses (the only deoxyhexosyls to form flavonoid glycosides) [35, 51, 67]. These flavonol glycosides can be easily distinguished by their UV and mass spectra. The saccharide type can be easily deduced from the mass difference between the molecular ion and aglycone ion (Table 5). For example, a mass difference of 132 amu is indicative of a pentosyl, a difference of 146 amu is indicative of a rhamnosyl, 162 amu for a hexosyl, and 178 amu for an oxyhexosyl. UV spectra and retention time are, in general, the primary basis for assignment of the linkage positions of saccharides to the aglycone. As Mabry et. al. summarized [43] and we have observed [67], 3-O-Glycosides and 4'-O-Glycosides produced 12-17 and 3-12 nm
27
hypsochromic shifts, respectively, in UV band I. Attachment of a saccharide in another position (such as the C7, C3', C6, or C5' position) has little or no effect on the UV spectra. As an example, consider the following results obtained using the standardized profiling method. Quercetin 3-O-glucoside has a retention time (tR) of 27.40 min, a UV absorbance maximum (max) at 256 nm, a shoulder at 266 nm (266sh), and a second max at 354 nm (a hypsochromic shift of 16 nm). It elutes earlier than quercetin 4'-O-glucoside (tR 32.95 min, max 256, 266sh, 364 nm, a hypsochromic shift of 8 nm). Luteolin 7-O-glucoside (tR 27.44 min, max 254, 266, 348 nm, no hypsochromic shift) elutes earlier than its 4'-O-glucoside (tR 30.32 min, max 254, 268, 336 nm, a hypsochromic shift of 12 nm). In both cases, the UV shifts and the retention times accurately indicate the position of the saccharide linkages. Thus, the UV shifts and elution order can be used to accurately identify these isomeric flavonoid glycosides.
DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST429.D) m AU 100 80 60 40
2 Cashew apple extract 3 4 5 6
8 14 9 10
11
12 13
20 0 20 22 24 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST435.D) m AU 120 100 80 60 40 20 0 20 22 24 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST430.D) m AU 120 100 80 60 40 20 0 20 22 24
26
28
30
32
34
m in
Cashew apple extract + Cranberry extract
26
28
30
32
34
m in
Cranberry extract
9
28
10
11
12 a
32
14
26
30
34
m in
Figure 9. Chromatograms (350 nm) of the extracts of: A) cashew apples, B) cashew apples and cranberries (combined), and C) cranberries. Peaks were identified as: a=quercetin 3-O-6acetylgalactoside, 2=myricetin 3-O-galactoside, 3=myricetin 3-O-glucoside, 4=myricetin 3-Oxylopyranoside, 5=myricetin 3-O-arabinopyranoside, 6=myricetin 3-O-arabinofuranoside, 7=myricetin 3-O-rhamnoside, 8=quercetin 3-O-galactoside, 9=quercetin 3-O-glucoside, 10=quercetin 3-Oxylopyranoside, 11=quercetin 3-O-arabinopyranoside, 12=quercetin 3-O-arabinofuranoside, 13=kaempferol 3-O-glucoside, and 14=quercetin 3-O-rhamnoside.
Changes in elution times have also been observed to be a function of the type of saccharide when linked at the same position. For example, as the saccharides at the C3 position of quercetin change, the retention times also change. The elution order, as observed using the standardized profiling method, from earliest to latest, is galactoside, glucoside, xyloside, arabinopyranoside, arabinofuranoside, rhamnoside, and finally the glucuronide. There are no standards available for any quercetin 3-O-pentosides. Instead, we found that
28
cranberries can serve as a reference plant material in which the three quercetin 3-O- pentoside isomers have been positively identified [67, 93, 148]. Initially, chromatograms were acquired for the cranberry extract using the same column (Agilent Zorbax-XSD C18 column) and gradient reported in the literature to confirm the elution order and relative peak intensities of the glycosides in the extract. Then, chromatograms were acquired for the extract using the standardized phenolic profiling method with both the Agilent column and the Waters Symmetry column. The three 3-Opentoside isomers and two hexoside isomers were identified on both columns and their retention times and UV spectra and MS spectra recorded using the standardized profiling method. Based on these data, it was possible to use the standardized method to identify these isomers in other plant materials such as cashew apples, Fuji apple skins, and ledum leaves as shown in Figures 8 and 9. For the best comparison, the extracts of cranberries, Fuji apple skins, ledum leaves, and cashew apples were screened in rapid sequence and spiked with the cranberry extract. In this manner, identification of two arabinosides in Fuji apple skins and most of the quercetin 3-O-glycosides in cashew apples and ledum leaves was made for the first time [67,93]. The ledum leaves (Ledum glandulosum L.) (Ericaceae), are used to make a native American Indian tea that is drunk in some areas of the US. The elution order identified for the quercetin 3-O-monoglycosides should apply to the glycosides of other flavonols, such as kaempferol, myricetin and isorhamnetin. These flavonol 3-O-monoglycosides are widely distributed in many other fruits (e.g. plums, peaches, pears, persimmons, loquats, and grapes), vegetables (e.g. dill, fennel, onions, lettuce, and common beans), and other plant materials. Positive identification of the flavonol aglycones, following hydroysis of the extract, greatly simplifies identification of the glycosides in plant materials. Using tea as an example, the determination that kaempferol, quercetin and myricetin were the only tetrahydroxy-, pentahydroxy- and hexahydroxy-flavones in the hydrolyzed tea extract made it possible to confirm that the 13 tea flavonol 3-O-glycosides that provided PI/NI aglycone ions ([A+H]+/[A-H]-) at m/z 303/301, should be formed from quercetin. Similarly, the 27 tea glycosides with [A+H]+/[A-H]- at m/z 287/285 could only be the 3-O-glycosides of kaempferol and the 4 glycosides with [A+H]+/[A-H]- at m/z 319/317 could only be myricetin 3-O-glyocosides [120].
3.2.1.3. Identification of O-di-, tri- and Polyglycosylated Flavonoids As mentioned previously, more than 50 disaccharides and 30 trisaccharides are found as all the O-monoglycosides [35,39], O,O-diglycosides, or more complex glycosides, and each of the saccharide can form number of the glycosides with diffirent flavonol or flavone [35,39]. Therefore, when a polyglycosylated flavonoid has the same sugar type (such as pentosyl) and sequence as a known flavonoid glycoside, a first approximation is that the unknown might also has the same glycosyls and linkage positions in its saccharide as the known flavonoid glycoside. This approximation is based on general biogenetic pathways in plant metabolism that lead to formation of flavonoid glycosides with common features. They are found in many foods, such as the brassicas [149, 150], spinach [133-135], snow pea pods [142], green beans [151], quinoa seeds (Chenopodium quinoa wild) [152] (Centrospemeae), leeks (Allium porrum L.), papaya fruit, pineapple, pomegranates, teas [120], and Ginkgo biloba leaves [119].
29
The identification of flavonol diglycosides and other polyglycosides is based on the analysis of retention times and UV and MS data as described for the monoglycosides in the previous section. Thus, many glycosides can be identified with respect to their components, the flavonol and the saccharide. The remaining problem is to identify the isomers, i.e. the linkage positions and the exact sugars. The best approach to solving this problem is to obtain appropriate standards or reference compounds. Since standards are not available for many of the less common flavonoids, a wide variety of plant materials were screened using our standardized profiling method to find the key glycosides with suitable substitutions of the glycosides and elution orders. Groups of isomeric quercetin diglycosides were found in some foods.
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT267.D) m AU 600 500 400 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT268.D) m AU 400 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT269.D) m AU 500 400 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT270.D) m AU 250 200 150 100 50 0 10 20 30 40 50 60 m in 30 40 50 60 m in 30 40 50 60 m in 30 40 50 60 m in
Red pearl onion

3 10 16 1 2 4 6 7 8 9 11 12 13 14 15 17 18 19 20 21
Red onion
Yellow onion
Shallot
Figure 10. Chromatograms (350 nm) of the extracts (250 mg/5.0 ml solvent/50 l injected) of A) red pearl onions, B) red onions, C) yellow onions, and D) shallots. Peaks were identified as 1=quercetin 3,7,4'-O,O,O-triglucoside, 2=quercetin 7,4'-O,O-diglucoside, 3=quercetin 3,4'-O,O-diglucoside, 4=isorhamnetin 3,4'-O,O-diglucoside, 5=quercetin 3-O-galactoside, 6=quercetin 3-O-glucoside, 7=quercetin 3-O-diglucoside, 8=isorhamnetin 3-O-glucoside, 10=quercetin 4'-O-glucoside, 12=isorhamnetin 4'-O-glucoside, 16=quercetin. The remaining peaks were not identified.
Red pearl onions, shallots (Allium ascalonicum L.) (Liliaceae), and several other onions (A. cepa L. and varieties) were found to contain quercetin 7,4'-O,O-diglucosides (tR 16.66 min, max 256, 266sh, 366 nm, a hypsochromic shift of 6 nm), 3,4'-O,O-diglucosides (tR 18.76 min, max 256sh, 266, 344 nm, a hypsochromic shift of 28 nm), quercetin 3,3',4'-O,O,Otriglucoside (tR 6.23 min, max 256, 266sh, 346 nm, a hypsochromic shift of 28 nm), and isorhamnetin 7,4'- and 3,4'-O,O-diglucoside (tR 18. 90 min and 20.70 min) [153,154] (Figure
30
10). Arugula [Eruca vesicaria (L.) Maton] (Crucifeae) contained quercetin 3,7-O,Odiglucoside (tR 10.03 min, max 256, 266sh, 354 min, a hypsochromic shift of 18 nm) and green lettuce contained quercetin 3,7-O,O-diglucoside malonate (tR 13.42 min, max 256, 266sh, 354 min), which were converted to the parent quercetin 3,7-O,O-diglucoside [150]. The elution order and UV shifts of these quercetin diglucosides and triglucosides can be used to identify the same flavonol glucosides in other foods and plant materials. The strength of the sugar-O-aglycone bond is position dependent in the order C7>C4'>C5'=C3'>C3>C5 [51]. With MS, the removal of saccharides will follow the reverse order, i.e. the saccharide at the C5 position is lost first and the 7 spostion is lost last. This cleavage order is helpful in the deduction of the positions of two different monosaccharides on the aglycone. For example, a quercetin 3,7-diglycoside formed from rhamnose and glucose has a molecular ion [M+H]+ = m/z 611 and fragments at m/z 449 and 303. According to the cleavage order listed above, the difference of 162 amu (glucosyl) between PI molecular ion of m/z 611 and the fragment of m/z 449 was from the loss of the gluocosyl at the C3 position and the mass difference of 146 amu (rhamnosyl) between the fragment of m/z 449 and the aglycone (m/z 303) indicates the rhamnosyl is at the C7 position. Thus, this glycoside was identified as quercetin 7-O-rhamnoside-3-O-glucoside. In the following paragraphs, four flavonol polyglycosides are used to explain the determination of the sugar sequence and the assignment of the structures. First, a Ginkgo biloba leaf flavonoid (tR 19.14 min, max 254, 266sh, 354 nm, [M+H]+ = m/z 757, [A+H]- = m/z 303) has two fragments at m/z 611 and m/z 465. The aglycone ion is formed by the loss of its 3 sugars. These data were used to deduce the sugar sequence. The retention time and UV and MS data suggested that this glycoside was formed from a pentahydroxyflavone (MW=302) and glycosylation at 3 positions by two rhamnosyls and one hexosyl (i.e, dirhamnosyllhexosyl, Table 5). As shown in Figure 11, the PI fragment ion at m/z 611 (Y2) is formed by the loss of the third glycosyl (757-146=611), a rhamnosyl from the glycoside, and the fragment ion at m/z 465 (Y1) is formed by loss of the secondary glycosyl (611-146=465), a rhamnosyl from first fragment, and finally the fragment at m/z 303 (Y0 = [A+H]+) is formed by the loss of the last hexosyl (465-162=303) to form the aglycone. The aglycone was confirmed to be quercetin since it is the only pentohydroxyflavone in the hydrolyzed extract. Thus, this glycoside is a quercetin 3-O-dirhamnosylhexoside and was finally identified as quercetin 3-O-2",6"-dirhamnosylglucoside since this flavonoid was previously reported in Ginkgo biloba and the only flavonol triglycoside detected in the extract that matched the recorded retention time and UV and MS data of the peak [119]. Two polyglycosylated flavonols were detected in three lentils. The retention time (13.37 min) of the first, an unknown triglycoside was much less than that (21.77 min) of kaempferol 3-O-sophorotrioside ([M+H]+ m/z 773) found in sugar snap and snow peas [142] The retention time was 7 min shorter than that of kaempferol 3-O-triglucoside in sugar bean pods suggesting that this triglycoside might have saccharides at the C3, C7, or C4' position. The unknown triglycoside had the same UV absorption spectra as kaempferol 3-O-sophorotrioside which indicates glycosylation at the C3 and C7 positions [43,67,142]. MS data showed a parent ion peak at m/z 757 ([M+H]+), with fragments at 611 (loss of the rhamnosyl of the glycoside, the third sugar at the C3 position), 449 (loss of the hexosyl of the glycoside, the second sugar at the C3 position), and 287 ([A+H]+), formed by loss of the hexosyl of the
31
OH OH HO O rhamnosyl O OH O Y0 O
2"
Y2 OH
6"
Y1
OH rhamnosyl
Y0+
15 10 5 0 300 400
Y1+ 355.1 411.2

500
303.2
465.2
Y2+ 611.0
[M+H]+ 757.1
600
700
m/z
Figure 11. Mass spectrum (PI100) of quercetin 3-O-2",6"-dirhamnosylglucoside in Ginkgo leaf extract and the related fragmentation scheme.
glycoside, the first sugar at the C7 position). Thus, the analyzed glycoside was provisionally identified as kaempferol 3-O-rhamnosylhexoside-7-O-hexoside. The compound was then positively identified as kaempferol 3-O- rutinoside-7-O-galactoside which has been reported in lentils and has matching retention times and UV and MS data [142]. The retention times and UV spectra of the other unkown lentil glycoside also matched those of kaempferol suggesting that theis tetraglycoside also had saccharides at the C3 and C7 positions. As shown in Figure 12, kaempferol O-tetraglycoside lost its first glycosyl, a hexosyl of the trisaccharides at the C3 or C7 position, to form the fragment at m/z 741 (Y3, 903-162=741). The glycoside lost a second glycosyl, a rhamnosyl of the disaccharide at the C3 or C7 position, to form the fragment at m/z 595 (Y2, 741-146=595), followed by loss of its third glycosyl, the hexosyl, connected to the C3 position to form the fragment at m/z 433 (Y1, 597-162=433), and finally, lost its last glycosyl, a rhamnosyl at the C7 position to form its aglycone ion at m/z 287 (Y0, i.e., [A+H]+, 433-146=287). Thus, this flavonoid should be kaempferol 3-O-hexosyl-rhamnosyl-hexoside-7-O-rhamnoside or one of its isomers. Since kaempferol 3-O-rutinoside-7-O-rhamnoside has been reported in lentils [35, 142], the unknown compound is most likely kaempferol 3-O-hexosylrutinoside-7-O-rhamnoside, and less likely to be kaempferol 3-O-rutinoside-7-O-hexosylrhamnoside, for biogenetic reasons.
32
Recently, two lentil kaempferol tetraglycosides were isolated as a mixture and their structures were elucidated by NMR [152]. They were identified as kaempferol 3-O-betaglucopyranosyl(12)-O-[alpha-rhamnopyranosyl(16)]-beta-galactopyranoside-7-O-alpharhamnopyranoside and kaempferol 3-O-beta-glucopyranosyl(12)-O-[alpharhamnopyranosyl(16)]-beta-glucopyranoside-7-O-alpha-rhamnopyranoside [155], a pair of isomers, which were not separated using our LC conditions. Table 5. Masses of saccharides and acylsaccharides
Group Added mass value 132 146 162 176 264 278 292 294 308 322 324 338 352 454 488 Added value of the acylglycosyl 174 188 204 176 Added value of the maloylglycosyl 218 232 248 Added value of the caffe-oylglycosyl 294 308 324
Pentosyl (xylosyl, arabinosyl, others) Deohexosyl (rhamnosyl) Hexosyl (glucosyl, galactosyl) Oxyhexosoyl (glucurononyl, galacturonyl) Pentosylpentosyl Deoxyhexosylpentosyl Deoxyhexosyldeoxyhexosyl Pentosylhexosyl Deoxyhexosylhexosyl Deoxyhexosyl-hexuronosyl Hexosylhexosyl Hexuronosyl-hexosyl Hexuronosyl-hexuronosyl Dideoxyhexosylhexosyl Trihexosyl
Table 6. Masses of phenolic acyls

Group Added mass value 104 120 134 136 152 180 208 146 160 162 176 178 190 192 206 The added mass of the acylhexosyl 266 282 296 298 314 342 360 308 322 324 338 340 352 354 368 NI mass of the related acid 121 137 151 153 169 197 213 163 177 179 193 195 207 209 223
Benzoyl p-Hydroxybenzoyl p-Methoxybenzoyl Dihydroxybenzyol Galloyl/trihydroxybenzoyl Dihydroxymethoxybenzoyl Deoxyhexoyldeoxyhexosyl Coumaroyl or other hydroxycinnamoyl p-Methoxycinnamoyl Caffeoyl Feruloyl or isoferuloyl Trihydroxycinnamoyl 3,4-dimethoxycinnamoyl Dihydro-methoxycinnamoyl Sinapoyl
33
Yo rhamnosyl O
7 3
OH O O O O OH
6"
Y1 OH O
hexosyl Y3 2"
Y2
OH O rhamnosyl
287.0
[A+H]+, i.e.,
80 60 40 20 0 300 400 500 600 700 800 900 m/z 288.2
[Y0, M+H-hexosyl-rhamnosyl-hexosyl-rhamnosyl]+ [Y1, M+H-hexosyl-rhamnosyl-hexosyl]+ + 433.1 [Y2, M+H-hexosyl-rhamnosyl]+ [Y3, M+H-hexosyl]

595.1 741.2
[M+Na]+
925.1
[M+H]+
903.2
Figure 12. Mass spectrum (PI100) of kaempferol 3-O-hexosylrutinoside-7-O-rhamnoside in red lentil.
It is necessary to consider the nomenclature used in the preceding paragraph for the long chain and side chain triglycosylated flavonols. The format Quercetin 3-O-6"-(4"'xylosylrhamnosyl]-glucoside or quercetin 3-O-xylosyl-(14)rhamnosyl-(16)-glucoside are used for long chain triglycosides while quercetin 3-O-2"-xylosyl-6"-rhamnosylglucoside, quercetin 3-O-[xylosy1(12)]-rhamnosyl (16)glucoside, or quercetin 3-O-(2G-xylosyl)rhamnosyl (16) glucoside are used for side-chain triglycosides. Here, the pyran or furan form for each sugar was omitted and the superscript G is used for a glucoside and 2G is used for a xylosyl at the C2 position of the glucosyl. Similarly, R is used for rhamnosyl and Gal for galactosyl [35, 36]. The elution orders for some common isomeric diglycosylated flavonoids were determined in this laboratory. Quercetin 3-O-6"-rhamnosylgalactoside (tR 24.69 min) eluted first, followed by quercetin 3-O-6"-rhamnosylglucoside (rutinoside) (tR 26.20 min), and finally quercetin 3-O-2"-glucosylrhamnoside (tR 29.48 min). Hesperidin (Hesperitin 7-Orutinoside) (tR 33.87 min) eluted earlier than hesperitin 3-O-neohesperidoside (2"rhamnosylglucoside) (tR 35.55 min) using our LC conditions. Blackeye peas and cow peas, dry seeds of Vigna unguiculata or its variety, were found to contain 4 quercetin3-O-dihexylhexoside isomers (see Section 5.5.2.). The elution order was similar to that for flavonol 3-O-monohexosides mentioned previously. Quercetin 3-O-6"galactosylglucoside (18.54 min) was eluted first, followed by quercetin 3-O-2"-
34
galactosylglucoside (18.95 min), quercetin 3-O-6"-glucosylglucoside (tR 19.22 min), and finally quercetin 3-O- 2"-glucosylglucoside (sophoroside) (tR 20.51 min) [142].
3.2.1.4. Identification of Acylated Glycosylated Flavonoids Acylated flavonoid glycosides are widely distributed in food and plant materials [35, 36]. Acylation can occur at one or more sites on the glycosides to create a large number of flavonoid glycoside isomers. Commonly reported acyl groups are malonyl, acetyl, and the phenolic acyls (p-coumaroyl, caffeoyl, feruloyl, sinapoyl, and galloyl). Acylated flavonoid glycosides can be detected by MS (Tables 5 and 6) as a result of the increased mass of the glycosides and sometimes from shifts in the UV spectra. The UV spectra of malonylated and acetylated glycosides are the same as their parent glycosides. Phenolic acylation, however, can cause shifts in the wavelength maximum and absorption coefficient of the UV band I. Malonylated and acetylated glycosides can be easily converted to their parent glycoside by mild heating (85 C for several hours). All acylated glycosides can be converted to glycosides by alkaline hydrolysis. The specific acylation group can be found as the difference in mass before and after hydrolysis. The detection and identification of the flavonoid glycoside malonates of celery can be used as an example. Celery, Chinese celery, and celery seeds contain 10 or more malonylated flavonoid glycosides that constitute more than half their total flavonoid content (Figure 13 and Table 7). All the malonylated glycosides exceed the mass of their parent ions, [M+H]+ by 86 amu. Acylation at the C6" position is most common for the mono-acylated flavonoid glycosides. This form is the most stable of the isomers [156-160]. Therefore, peaks 11, 15A, 16 and 12 could be provisionally identified as luteolin 7-O-6"-malonylapiosylglucoside, apigenin7-O-6"-malonylapiosylglucoside (6"-malonylapiin), chrysoeriol 7-O-6"-malonyl apiosylglucoside, and luteolin 7-O-6"-malonylglucoside. The identification of peaks 11 and 15A was further confirmed by a direct comparison of their retention time and UV/Vis and mass spectra with those of the luteolin 7-O-6"-malonylapiosylglucoside in red bell pepper [161, 162] and 6"-malonylapiin in parsley [163], as shown in Figure 14. Since their structures have been determined by NMR [153, 162-164], it can be confirmed that the apiosyl group for celery was also connected at the C2" position of the glucosyl. This comparison also indicated the existence (previously unreported) of a minor isomer of luteolin 7-O-6"-malonylapiosylglucoside (peak 9, Figure 14B) in red bell peppers and two minor malonylapiins in parsley (peaks 13 and 14A, Figure 14C). Diosmetin 7-O-6"malonylapiosylglucoside (peak b, Figure 14C) was also identified in the parsley extract. The isomeric malonates of each 7-O-apiosylglucoside have the same molecular and mass spectra as the major isomeric malonate (6"-malonate). The malonyl linkage for the minor isomers might be at the C3 or 4C position of the glucose or at a position on the apinose. They were each converted to their parent glycoside by mild heating (Figure 13). Heating of the malonylated glycosides will yield the parent glycoside. As an example, based on MS data, Comice pear skins (Figure 15A) were determined to contain quercetin 3O-galatoside (peak 21), quercetin 3-O-glucoside (peak 22), isorhamnetin 3-O-galatoside (peak 31), isorhamnetin 3-O-glucoside (peak 35), quercetin hexoside malonate (peak 29), and three isorhamnetin 3-O-hexoside malonates (peaks 42, 43, 44). Based on the disappearance of peaks 29, 42, 43, and 44 (Figure 15B) and the proportional increases of peaks 22, 34, and 35 after heating, it is possible to identify peak 29 as quercetin 3-O-6"malonylglucoside, peak 42
LC-MS Profiling and Quantification of Food Phenolic Components ... as isorhamnetin 3-O-6"malonylgalactoside, peak 43 as isorhamnetin malonylglucoside, and peak 44 as isorhamnetin 3-O-malonylglucoside [165].
DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST219.D) mAU 250 200 150 100 50 0
35 3-O-6"-
8 Celery seed extract 1 2 3

25
4 5
30
11
6 9 12 7 10
35
14-A 15-A 14-B 16 15-B 17 13

40 45 min
5 10 15 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST221.D) mAU 60 50 40 30 20 10 0
6 11 Celery extract 1 2
25
15-A 15-B 14-A

40
16
4 5
30
8 9
35
12
5 10 15 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST227.D) mAU 250 200 150 100 50 0
45
min
11 Chinese celery extract 2 4 5

25 30
15-A 16 15-B 12 14-A

40 45 min
8 9
35
5 10 15 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST237.D) mAU 300 200 100 0 5 10 15 20
Celery seed malonate-free sample
8 4 5 6
30
10
35 40 45 min
25
Figure 13. Chromatograms (350 nm) of the extracts (100 mg/5.0 ml solvent/10 l injected) of: A) celery seed, B) celery C) Chinese celery, and D) malonate-free celery seed sample. Peaks were identified as: 1=chlorogenic acid, 2=coumaroylquinic acid, 4=luteolin 7-O-apiosylglucoside, 5=luteolin 7-O-glucoside, 6= apigenin7-O-apiosylglucoside (apiin), 7=luteolin 7-O-malonylapiosylglucoside-A, 8=chrysoeriol 7-O-apiosylglucoside, 9=luteolin 7-O-malonylapiosylglucoside-B, 10=chrysoeriol 7-Oglucoside, 11=luteolin 7-O-6-malonylapiosylglucoside, 12=luteolin 7-O-6-malonylglucoside, 13=malonylapiin-A, 14A=malonylapiin-B, 14B=chrysoeriol 7-O-malonylapiosylglucoside-A, 15A=6malonylapiin, 15B=chrysoeriol 7-O-malonylapiosylglucoside-B, 16=chrysoeriol 7-O-6-malonylapiosylglucoside, and 17=chrysoeriol 7-O-6-malonylglucoside. The remaining peaks were not identified.
36

DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST211.D)
mAU 250 200 150 100 50 0 5 10 15 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST216.D) mAU 60 50 40 30 20 10 5 10 15 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST215.D) mAU 400 350 300 250 200 150 100 50 0 5 10 15 20 25 30 25 30 25 30
11 HPLC chromatogram (350 nm) of Chinese celery extract (A) 1 6 4 2 5 8 9

35
15-A 16 15-B
12
14-A 13
40 45 min
HPLC chromatogram (350 nm) of red bell pepper extract (B) 4
11
9
35 40 45 min
6 HPLC chromatogram (350 nm) of parsley extract (C)
15-A
14-A 8 a
35
13
40
16
b
45 min
Figure 14. Chromatograms (350 nm) of the extracts of: A) Chinese celery, B) red bell peppers, and C) parsley. Peaks were identified as: a=Diosmetin 7-O-apiosylglucoside and b=diosmetin 7-O-6"malonylapiosylglucoside. The remaining peaks were not identified.
Ginkgo biloba leaves, teas, and some brassica vegetables contained over 20 acylated flavonol glycosides, that can be easily recognized by their UV and MS spectra (see Section 5.2.). The p-coumaroylglycosides in Ginkgo biloba leaves have max UV band I at 312-318 nm and their molecular ions were 146 and 292 amu larger than their parent glycosides. This data suggested that they were mono- and di-p-coumaroyl glycosides, respectively, and lead to identification of these peaks as myricetin 3-O-2"-(6"'-p-coumaroylglucosyl) rhamnoside, quercetin 3-O-2"-(6"'-p-coumaroylglucosyl) rhamnosides, and kaempferol 3-O-2"-(6"'-pcoumaroylglucosyl) rhamnoside, respectively.
37
Table 7. Glycosylated Flavonoid Contents of Dried Celery, Chinese Celery, and Celery Seeds (mg/g Dry Weight)*
Compound Luteolin 7-Oapiosylglucosidec Luteolin 7-O-6"malonylapiosylglucosidec Luteolin 7-Omalonylapiosylglucoside(s)c Luteolin 7-O-glucosid Luteolin 7-O-6"malonylglucosidec Total Luteolin glycosides Apigenin 7-Oapiosylglucoside Apigenin-7 O-6"malonylapiosylglucosided Apigenin-7 Omalonylapiosylglucoside(s)d Total apigenin glycosides Chrysoeriol 7-Oapiosylglucosidec Chrysoeriol 7-O-6"malonylapiosylglucosidec Chrysoeriol 7-Omalonylapiosylglucoside(s)b,c Chrysoeriol 7-O-glucosidec Chrysoeriol 7-O6'malonylglucosidec Total chrysoeriol glycoside Total glycosylated flavonoids Celery 0.14 0.74 0.06 -.--a 0.02 0.960.05 0.53 1.40 0.12 2.280.03 0.27 0.71 -.--a -.--a -.--a 0.980.05 4.220.08 Chinese celery 0.70 3.98 0.28 0.13 0.74 5.830.03 0.93 3.51 0.34 5.360.05 0.88 3.95 -.--a -.--a -.--a 4.830.04 16.020.07 Celery seed 6.32 4.27 0.40 0.80 0.92 12.710.07 1.11 0.47 0.09 1.750.04 4.67 2.38 0.31 -.--a -.--a 7.360.06 21.820.10
* Unless otherwise stated, all values are based on UV absorption. Values for individual compounds are expressed as the mean value (n=6 for celery seed and n=18 for Chinese celery and celery) in mg/g on a dry weight basis. All standard deviations for the individual values were less than 0.06 mg/g. For total values, mean standard deviation is provided. a Not quantified, below the limitation of quantification. b Concentration determined by SIM detection (see text). c Calculated as the molar equivalent of luteolin-7-O-glucoside. d Calculated as the molar equivalent of apiin.
Similarly, 28 acylated flavone glycosides were identified in tea extracts. Of these, two contained p-coumaroyl groups. Only 4 have been reported previously in teas [123,166]. Peak 65 (tR 47.80 min, max 266, 312 nm, m/z 595, 449, 287) and peak 77 (tR 56.44 min, max 266, 312 nm, m/z 739, 449, 287) were the main peaks in tea-3 (Figure 16), and other tea belonging to group 1 (maofeng tea, white tea, and higher grade tea) (see Section 5.1.). They were converted to kaempferol 3-O-glucoside upon alkaline hydrolysis. Based on the enhancement
38
of kaempferol 3-O-glucoside (peak 44), the two peaks were identified as kaempferol 3-O-6p-coumaroylglucoside, and kaempferol 3-O-6,2 (or 6,4)-di-p-coumaroylglucoside, respectively (Figure 16). The remaining peaks were minor compounds and disappeared following hydrolysis.
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT508.D)
9.
98 05
m AU
80
5 31 22 21
ea 68 .0
60
ea : Ar 45 e a 5 .0 : 5 93 14 .4 5
Ar
ea
:1
:2 A 15 re .6 a : 38 4
Ar
ea
:4
40
60
29
21
42A
Ar
.0
14
Ar
Comice pear skin extract (350 nm)
9.
35
ea
43
46
:1
66
85
82 ea Ar
40
:8
0 5 10 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT535.D) m AU 175 150 125 15 20 25 30 35 m in
Hydrolyzed Comice pear skin extract (350 nm)

5 21 3
Ar 78
Ar
75 50 25 0 5 10 DAD1 D, Sig=520,4 Ref=700,100 (LIN\07-11113.D) m AU 6 15 20 25
:8
ea
:2
20
.8
43
ea
30
Ar
22
.5
74
ea
:1
100
31
05
9.
02
Ar
ea
:2
35
76
9.
92
35
40
Ar
ea
m in m in
46
Ar
Red D'Anjou pear skin extract (350 nm)

2
5 4 3 2 1 0 5 10 15 20 25 30 35 40
Figure 15. Chromatograms of the extracts of: A) Comice pear skins (350 nm), B) malonyl-free Comice pear skins (350 nm), C) dAnjou pear skins (520 nm), and D) red pear skins (520 nm). Peaks were identified as: 2= cyanidin 3-O-galactoside, 3=3-caffeoylquinic acid, 4=peonidin 3-O-galactoside, 5=chlorogenic acid, 7=4-caffeoylquinic acid, 21=quercetin 3-O-galactoside, 22=quercetin 3-Oglucoside, 29=quercetin 3-O-6"-malonyl glucoside, 31=isorhamnetin 3-O-galactoside, 35=isorhamnetin 3-O-glucoside, 42=isorhamnetin 3-O-6"-malonylgalactoside, 43=isorhamnetin 3-O-6"malonylglucoside,44=isorhamnetin 3-O-malonylgalactoside, and 46=isorhamnetin 3-Omalonylglucoside.
Many Brassica vegetables were found to contain 10 or more acylated flavonols. These were predominantly 3,7-O,O-diglycosides and 3-O-glycosides of kaempferol and their acyl groups were mainly feruloyl, sinapoyl and caffeoyl. Some of the glycosides had two or more acyl functions [150, 167, 168]. Most of the acylated glycosides had max UV band I at 328332 nm and their molecular ions were 176, 206, and 162 amu larger than that of their parent glycosides for mono-acylated glycoside and twice those values for the di-acylated glycosides. Other vegetables, such as arugula (Eruca vesicaria (L.) Maton) (Crucifeae), leeks, and green onions, also contained monocaffeoyl-, feluroyl- and sinapoyl-glycosides.
:3
1.
20
45
6.
74

DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT728.D) m AU
39
Tea-3
50
A
77
40
30
65
20
10
43
44 45 74
78 79
0 10 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT772.D) m AU 20 30 40 50 m in
B
Tea-3-Alk-HY
44
80
60
40
43
20
0 10 20 30 40 50 m in
Figure 16. Chromatograms of: A) tea samples Tea-3 and B) alkali hydrolyzed tea samples Tea-3. Peaks were assigned as 44=kaempferol 3-O-glucoside, 65= kaempferol 3-O-glucoside-p-coumaroyl, and 77=kaempferol 3-O-glucoside-di-p-coumaroyl.
Some of the less common, non-phenolic acyls also increase the mass of the parent compounds. For example, butyryl (CH3-CH2-CH2-CO, +70 amu), isobutyryl ((CH3)2C-CO, +70 amu), lactyl (CH3-CH2(OH)-CO, +72 amu), oxalyl (COOH-CO, +72 amu), tiglyl (CH3C=CCH3-CO, +82 amu), 2-methylbutyryl (CH3CH2-CH(CH3)-CO, +84 amu), 7epoxymethylbytyl ((CH3)2COCHCO, +84 amu), isovaleryl ((CH3)2CH-CH2-CO, +84 amu), succinoyl (COOH-CH2-CH2-CO, +100 amu), maloyl (COOH-CH2-CHOH-CO, +116), 3hydroxy-3-methyl-glutaryl (COOH-CH2-C(OH)(CH3)-CO, +144 amu), as well as sulfate (SO3, +80 amu), are found to form acylated flavonoid glycosides (connected to the hydroxyl group of the sugar moiety) in a limited cases [35]. It is worth remembering these masses although they dont occur frequently.
3.2.1.5. Identification of C-glycosylated Flavonoids C-glycosylated flavones are frequently found in many foods, such as the peels of citrus fruits and kumquats [143], star fruit, lemongrass [137], mung beans [Vigna radiata (L.) R. Wilczek] [142], aloe vera leaves [Aloe vera (L.) N. L. Burm., or variety] (Liliaceae), mun choy (Amaranth spp.), anise seeds (Pimpinella anisum L.), beets (Beta vugaris), Swiss chard, red Swiss chard (B. vulgaris var. cicla L.), chayote [Sechium edule (Jacq) Swartz] (Cucurbitaceae), winter melon skins (Beniceasa lispida L.), and Hami melon skins (Cucubita melo L.) [169]. C-glycosylated flavones are differentiated from O-glycosylated flavones by their resistance to acid hydrolysis.
40
HO HO

R
CH2OH O OH
3'
0 1
HO
3
aglycone
HO HO HOH2C HO
4 5 2
0 ,2
0 ,2 Xb: [Xa -120]
OCH3
4'
HO
OH
8 7 6
O0 OH
1
A
5
HO
OH
Hexosyl: R=CH2OH 0,2 X: [M H-120] 0,3 X: [M H-90] 1,5 X: [M H-134] Pentosyl: R=H 0,2 X: [M H-90] 0,3 X: [M H-60] 1,5 X: [M H-104]
Xa: [M +H-120]
80 60 [Xb-H2O]+ 40 366.7 Xb+ 20 356.8 384.7 350 400
[M+H]+ 624.7 Xa+ 504.7 [Xa-H2O]+ 486.7 [Xa-2H2O]+ 468.7 408.7 450 500 528.7 514.9
[M+H-H2O]+
606.7 [M+H-2H2O]+ 588.7 [M+Na]+ 646.6
550
600
m/z
Figure 17. Mass spectrum (PI250) of diosmetin 6,8-di-C-glucoside in navel orange skins and the related fragmentation scheme produced by cross-ring cleavage.
The C-glycosyls are located at the C6, C8, or both positions on the flavones. Many flavone C-glycosides are formed from apigenin, but some of them are also formed from methoxyapigenin and hydroxyapigenin. Compounds such as acacetin (4'-methylapigenin), luteloin (3'-hydroxyapigenin), diometin (4'-methylluteolin), chrysoeriol (3'-methylluteolin) have been reported [67, 143]. The major mass fragmentation patterns of the C-glycosylated flavones are cross-ring cleavages of the saccharide residues (0,2Xa, or 0,3X, 1,5X, mainly 0,2X, or simply expressed as X, as shown in Figure 17 for hexose and pentose) with the loss of water between the 2"-hydroxyl of the saccharide at the C6 or C8 position and the 5- or 7hydroxyl of the aglycone to form a C-O-C linkage [51]. Mono-C-glycosylated flavones, glycosylated at the C6 or C8 positions, are widely distributed in plant kingdom. C-6-glucosylapigenin (isovitexin) and C-8-glucosylapigenin
41
(vitexin) are isomers and have the same protonated momolecular ion at m/z 433 and fragment peak at m/z 313 indicating the existence of apigenin with only one C-glucosylation. Their identity was easily confirmed by direct comparison with available authentic standards since they have different retention times. Citrus peel C-glucosylated flavones had an Xa+ ion peak at m/z 343 suggesting C-glucosylated diosmetin, which was identified as diosmetin 6-Cglucoside since it was previously reported in citrus [67, 143]. The retention time and UV and MS data agreed well with previously reported data. Similarly, a di-C-glycosylated flavone was found in orange peel with glycosylation at the C6 and C8 positions. The mass fragments in Figure 17 support provisional identification as 6,8-di-C-glucoside. This peak showed a protonated molecular ion [M+H]+ at m/z 625, a sodiated ion [M+Na]+ at m/z 647, and fragments [M+H-H2O]+ at m/z 607, [M+H-2H2O]+ at m/z 589, the C-glycoside diagnostic fragment Xa+ (loss of 120) at m/z 505, [Xa-H2O]+ at m/z 487, [Xa-2H2O]+ at m/z 469, Xb+(loss of 120x2) at m/z 385, and [Xb-H2O]+ at m/z 367. These masses are predicted by the fragmentation scheme of Cuyckens and Claeys [49] shown in Figure 17. These data suggest that this compound is glucosylated at the C6 and C8 positions and has hydroxyl groups at the C5 and C7 positions. Thus, this flavonoid was provisionally identified as diosmetin 6,8-di-C,C-glucoside. The 6,8-di-C,C-glycosylflavones are found with the same and with mixed glycosyls. Two apigenin 6,8-di-C,C-arabinosylglucosides (tR 19.39 min and 19.63 min, respectively) were found in tea extracts. Both peaks had the same UV spectra and mass fragments at m/z 565 [M+H]+, 547[M+H-H2O]+, 529 [M+H-2H2O]+, 475 [Xa+ for pentosyl mainly, loss of 90 amu], 445 [Xa+ for hexosyl, loss of 120 amu], 355, and other masses. The isomer with a glucosyl at the C6 position has a greater chance to form a C-O-C bond with the hydroxy functions at C5 or C7, thus producing a higher fraction of Xa+ ions at m/z 445 (45 % to 12 %) compared to glucosylation at C8. Conversely, the isomer with the arabinsyl at C6 will have a higher ratio for the ions at m/z 475 (30 % to 28 % for the latter one). Thus, based on reported strategies for identification of glycosyls of isomeric 6,8-di-C,C-glycosylflavones [170, 171], the first peak was identified as apigenin 6-C-glucosyl-8-C-arabinoside and the second peak was apigenin 6-C-arabinosyl-8-C-glucoside. Both glycosides were isolated from green tea and identified [293, 294] A third group of mixed O-glycosylated and C-glycosylated flavones can be further subdivided. The first sub-group has an O-glycosyl at C7 while the second sub-group has its additional glycosyl at the C6" (or other position) of the C-glycosyl and can be recognized as a flavone C-disacharide. Both sub-groups produced the same molecular ion and major fragment ion, the C-monoglycosylated flavone ion. The major fragment is reached by loss of the additional glycosyl from the C-glycosyl, or the glycosyl at C7. Both then produce the characteristic ions mentioned above for C-4-monoglycosylated flavones. When subjected to acid hydrolysis, compounds in both sub-groups were converted into C-monoglycosylated flavones, which were positively identified by direct comparison with standards.
3.2.1.6. Flavone/flavonol Esters Some flavone sulfates and esters, such as acetate (COCH3), butyrate (COCH2CH2CH3), isobutyrate [COC(CH3)2], angelate [COC(CH3)=CH(CH3)], isovalerate [COCH2C(CH3)2] and tiglate [COC(CH3)=CH(CH3)], were found in limited number of plants. They are formed with one or more hydroxyls of the flavone skeleton and with some phenolic and other acids
42
(Figure 2) [35]. A flavone sulfate was detected in Yali pear skins (Section 5.3.). The sulfate characteristically adds 80 amu to the molecular weight of the flavone.
3.2.2. Anthocyanins The anthocyanins are the most abundant and widely distributed flavonoid subgroup after flavonols and flavones. There are more than 600 anthocyanins based on glycosylation of 18 aglycones (anthocyanidins), mainly cyanidin, delphinidin, malvidin, pelargonidin, peonidin and petunidin (Table 1) [35,172-174]. They are commonly found as the red to blue pigments (although apigeninidin is yellow) in flower petals, but also occur in the fruit of higher plants, such as colored apples, grapes, pears, cherries, peaches, plums, and many berries [172-184]. They are found in many colored vegetables and grains, such as red cabbage [185], sweet potatoes [186, 187], black beans [124], and black rice [188,189]. Systematic identification and quantification of the anthocyanins in common foods in the US has been reported and normal human consumption has been estimated [182-184]. Anthocyanins have been reported to have many health functions for humans, such as protection against liver injuries, significant reduction of blood pressure, suppression of proliferation of human cancer cells, and scavenging of radicals [1-7,190-196]. The consumption of anthocyanins are purported to play a significant role in preventing lifestylerelated diseases, such as cancer, diabetes, and cardiovascular and neurological diseases. Consequently, anthocyanin enriched food extracts from some foods, such as cranberries, grape skins and grape seeds, have been prepared and sold as functional foods or antioxidant dietary supplements. The anthocyanins are different from the other flavonoids. They have a strong visible absorptions band at 450-650 nm in addtion to UV band II at 240-280 nm (Table 2) and band I at 310 to 330 nm when they contain cinnamoyls. The UV spectrum of cyanidin 3-Ogalactoside is shown in Figure 4A. The absorption band in the visible wavelength region can be used to easily distinguish the anthocyanins from the other flavonoids and other plant phenolic compounds. The standardized profiling method uses a DAD setting of 520 nm specifically for detection of anthocyanins (196). Our studies confirmed that blueberries (Vaccinium species), cranberries and apples contain anthocyanidin 3-O-galactosides and arabinosides as their main anthocyanins [35]. Strawberries (Fragaria spp) [179], black grapes (Vitis vinifera and varieties), mulberries (Morus alba L.), black rice (Oryza sativa L. indica), black sweet rice, and black beans, however, contain 3-O-glucosides as their major anthocyanins. The anthocyanidin 3-Ogalactosides (cyanidin 3-O-galactoside, tR 6.20 min) can be easily distinguished from their glucosides which elute approximately a minute later (cyanidin 3-O-glucoside, tR 7.40 min) using the standardized method. Mono-glycosylated anthocyanins are usually linked at the C3 position. Glucose, arabinose and galactose are the most common saccharides. If two hydroxyls are glycosylated, the saccharides are always at C3 and C5. As an example, the fruit of Syzygium jambolanum (Myrtaceae) contained 3,5-O,O-diglucosides of delphinidin, malvidin, and petunidin. Concord grapes contained 3,5-O,O-diglucosides as well [35]. Acylated anthocyanins are found in many foods and can be identified in the same manner as described previously for the acylated flavonol glycosides. Black grapes contain pcoumaroyl derivatives of anthocyanidin 3-O-glucosides [183]. Chrysobalanus icaco (Chrysobalanaceae) contains acylated derivatives of 3-O-glucosides of cyanidin, delphinidin,
43
peonidin, and petunidin with either one or two acetyls. Sweet potato skins and leaves (Ipomoea batatas L. or varieties) contain hydroxybenzoyl, feruloyl, and caffeoyl derivatives of 3-O-sophorosides and 3-O-sophoroside-5-O-glucosides of cyanidin, pelargonidin, and peonidin [186, 187]. The sample preparation of the standardized phenolic profiling method (less than 35 C) is well suited for the analysis of anthocyanins in foods since most of the extracts were slightly acidic (pH = 3-5) when the analyzed within 24 hour of preparation. For longer storage, however, a pH of less than 2 (using HCl) is preferred for optimum stability with the formation of the stable flavylium ion [anthocyanin+Cl-] [197]. Acid hydrolysis was also helpful for identification of anthocyanins in some special cases. For example, one of the anthocyanins of cashew apples had a tR of 13.05 min, max 280, 516 nm, [M+H]+ at m/z 463 and [A+H]+ at m/z 301. The MS data suggested that this compound might be peonidin 3-O-hexoside. The only detectable anthocyanidin in the hyrdrolyzed cashew apple extract, however, had characteristics (tR 20.16 min, max 280, 334, 518 nm, [M+H]+ at m/z 301) that differed from those of the pure peonidin standard (tR 20.78 min; max 274, 430, 524 nm, [M+H]+ at m/z 301). The UV data suggested that this was a methyl derivative of cyanidin, most likely 5-methylcyanidin, the only other naturally occurring methylcyanidin other than peonidin [35,172]. Thus, this anthocynin is most likely a 5methylcyanidin 3-O-hexoside. More specifically, it is probably 5-methylcyanidin 3-Ogalactoside based on the fact that the concentrations of galactosides of myricetin and quercetin are much higher than those of their related glucosides in cashew apples [93].
3.2.3. Flavanones Flavanones and flavanonols exist in small numbers compared to the other flavonoid subgroups (Table 1). They are found in all the citrus fruits, such as oranges, blood oranges, tangerines, tangelos, minneolas, temple oranges, limes, lemons, pummelos, and grapefruit [143]. Flavanones are also found in citrus leaves, such as the leaves of Citrus hystrix, a spice in Thailand, and in some non-citrus plants like Mexican oregano [92] and licorine (containing liquiritigenin 7-O-pentosylglucoside) [35]. Flavanones are important flavonoids since they have been reported to be beneficial to human health [1-7, 199]. Milk thistle (Silybum marianum) contains some unusual flavanones, such as silybin, silychristin and silandrin. These compounds are reported to have hepatoprotective characteristics [200, 201]. Naturally existing flavanones have an optically active 2S configuration, as shown in Figure 1. They are usually glycosylated at the C7 position. Some 6-prenylated flavanones are also found in plants [35]. The naturally existing 3-hydroxyflavanones are found in a 2, 3trans-form, i.e. as (2R,3R)-dihydroflavonols (Figure 1) in most plants, but have been found as (2S,3S)-fustin, taxifolin, 8-hydroxyfustin in other plants, such as Mexican oregano [93]. Recently, methods for the separation and analysis of these chiral flavonoids were reviewed [199]. Flavanones (2,3-dihydroflavones) can be readily identified from either their UV or mass spectra. Their absorption spectra show a UV band II max at 270-295 nm and band I max at 300-370 nm as a shoulder (Table 2). The C5-OH group produces a 10-15 nm bathochromic shift in UV band II, but the increasing oxygenation in the B-ring has no noticeable effect on the UV spectra [43]. The distinctive UV spectra of the flavanones make it possible to
44
distinguish them from the other flavonoids. The UV spectrum of hesperidin, an important flavonone glucoside, is shown in Figure 4B. The flavanones also have distinctive mass spectra. Unlike the flavones and flavonols, the C-ring of the flavanones does not have a C2-C3 double bond and this leads to the production of mass fragments from cleavage of the flavanone skeleton much easier than that of the related flavones. For example, two flavanone glycosides in Mexican oregano [92] have the usual molecular and aglycone ions at m/z 467/465 and 305/303, respectively, when subjected to low and high fragmentation voltages. In addition, the NI250 mass spectrum (Figure 18A) contains ion fragments at m/z 167 and 135 that correspond to fragments 1 and 2 of the flavanone backbone shown as isomer A in Figure 18D. These mass fragments indicate that the aglycone has three OH functions on the A ring and two on the B-ring [108]. Examination of the UV spectrum of peak 1 in Figure 18A revealed a strong UV absorption maximum at 288 nm and a weak absorption maximum at 360 nm. This suggested that peak 1 had more than two OH groups on the A ring fragment since the spectra of flavanones (such as taxifolin, naringenin, and eriodioctyol) with only two OH groups on the A ring, only have a shoulder at 335 nm instead of a peak maximum at 360 nm. Thus, the spectra of peak 1 suggested that it was a hexoside of a pentahydroxyflavanone with three OH function on the A-ring and two OH functional groups on the B-ring. This conclusion was in agreement with the MS data. Either a 5,6,7,3,4- or 3,5,6,7,4-pentahydroxyflavanone was the most likely of the possible structures. Based on biogenetic considerations, the fact that 5,6,7,3,4-pentahydroxyflavone glycoside is a major flavonoid of Mexican oregano makes it likely that its dihydro-derivative, 5,6,7,3,4-pentahydroxyflavanone glycoside would also be present. It is still preferred, however, that a final structural identification be based on analysis by NMR or comparison to an authentic standard. Figure 18B shows the NI250 mass spectra of the aglycone (peak 1) after hydrolysis. Compared to its corresponding glycoside (Figure 18A) there were more fragments and significantly greater intensities. Among the fragments, ions at m/z 135 and 167 confirmed the structure for peak 1 as interpreted above. The NI250 mass spectra of peak 7 (Figure 18C), a 3,5,7,3,4-pentahydroxyflavanone identified as taxifolin, lacked the fragments at m/z 135 and 167, but had a strong ion signal at m/z 151, like isomer 1 in Figure 18D. Taxifolin (II-5) has two hydroxyl groups at C5 and C7 on the A-ring, three hydroxyl groups at C3 and C4 on the B-ring, and C3 of the C-ring. Consequently, its mass spectrum shows a major fragment at m/z 151 as predicted in Figure 19D for isomer 2. Peaks 3 and 4 (Figure 19A) had UV and mass spectra similar to those of peak 1 and were also pentahydroxyflavanone-hexosides. Each of the aglycones (following hydrolysis) had three OH groups on the A ring and two OH groups on the B ring. Thus, they might have the same aglycone as peak 1, with the saccharides at different positions, or their aglycones may be isomers of peak 1. The identification of the three glycosylated pentahydroxyflavanones was made by LC-MS analysis (Figure 19B) of the partially purified glycoside fraction (band 7) separated from the non-flavonoid fraction by thin layer chromatography (TLC). The glycosides of band 7 were subjected to acid hydrolysis to produce their aglycones and then reanalyzed. The major pentahydroxyflavanone (most likely 5,6,7,3,4-pentahydroxyflavanone, labeled A-1 in Figure 19C) (tR 20.23 min, max 288, 360 nm; [A+H]+/[A-H]- at m/z 305/303)
45
A
*MSD4 SPC, tim e=11.835 of LIN\FOODN678.D API-ES, Neg, Scan, Frag: 250, "NI 250" 465.0 Max: 21728 80 167.0 60 135.0 40 20 0 100 150 200 250 300 350 400 450 301.9 302.9
B
*MSD4 SPC, tim e=27.083 of LIN\FOODN770.D 135.1 API-ES, Neg, Scan, Frag: 250, "NI 250" Max: 43088 80 60 111.1 153.1 181.0 285.0 303.1 300 300 304.1 303.1 40 20 0 100 150 200 250 134.1 139.1 167.1
C
*MSD4 SPC, tim e=26.869 of LIN\FOODN771.D 125.1 145.1 150.1 151.1 API-ES, Neg, Scan, Frag: 250, "NI 250" Max: 12337 188.0 193.0 194.1 285.0 80 60 109.1 40 20 0 100 150 200 250 171.0 176.1 175.1 181.0 275.1
213.0 218.0 217.1
123.1
202.0 201.0
328.9
161.1
231.0
241.0
259.0
126.2
133.1
[M-H] =303 3 x OH at A ring O

A C
b=135
B
[M-H] =303 2 x OH at A ring O

A C
b=151
B
2 x OH at "B-ring" O a=167
O a=151
3 x OH at "B-ring"
Isomer-1 with three OH at A-ring and two OH at B-ring part
Isomer-2 with two OH at A-ring and three OH at the B-ring part
Figure 18. Mass spectra (NI250) of: A) pentahydroxyflavanone-A hexoside (peak 1 in Figure 19A), B), pentahydroxyflavanone-A (peak A1 in Figure 19C), C) taxifolin (peak 7 in Figure 19A), and D) related fragmentation scheme. produced by cross-ring cleavage.
276.0
286.0
465.9
46
m AU 350 300 250 200 150 100 50 0

DAD1 C, Sig=270,8 Ref=700,100 (LIN\QUANT-4\QUANT406.D)
21 1 2 3 4 5 6 10 9 7 8 11
30
A
12 DAD at 270 nm 13
40
22 17 16 14 15
50
18 19
60
20
23
m in
10 20 DAD1 C, Sig=270,8 Ref=700,100 (LIN\QUANT-4\QUANT407.D) m AU 600 500 400 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\FOODN-2\FOODN697.D) m AU 350 300 250 200 150 100 50 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\FOODN-2\FOODN695.D) m AU 350 300 250 200 150 100 50 0 10 20
10 8
B
DAD at 270 nm
30
40
50
60
m in
9 A-1 A-2 13
C
DAD at 350 nm A-3 16 A-5 A-4
50 60 m in
30
40
D
9 13 DAD at 350 nm
16 15
30
40
50
60
m in
Figure 19. Chromatograms of Mexican oregano extracts (100 mg/5.0 ml solvent/10 l injected): A) extract detected at 270 nm, B) TLC band 7 detected at 270 nm, C) TLC band 7 hydrolyzed detected at 350 nm, and D) TLC band 6 detected at 350 nm. Peaks were assigned as: 1=pentahydroxyflavanone-A, 2=6-hydroxyluteolin 7-O-hexoside, 3=pentaflavanone hexoside-2, 4=pentaflavanone hexoside-3, 5=scutallarein 7-O-hexoside, 6=luteolin 7-O-glucoside, 7=taxifolin, 8=6-hydroxyluteolin 7-Orhamnoside, 9=6-hydroxyluteolin, 10=3-hydroxyphloretin 6-O-hexoside, 11=apigenin 7-O-glucoside, 12=phloridzin, 13=scutellarein, 14=eriodictyol, 15=luteolin, 16=quercetin, 17=naringenin, 18=6methylscutellarein, 19=6,7-dimethylscutellarein, 20= sakuranetin, 21=pinocembrin, 22=galangin, 23=methylgalangin, A1=pentahydroxyflavanone-A, A2=pentahydroxyflavanone-B, A3=3hydroxyphloretin, A4=apigenin, and A5=phloretin.
was determined to be the aglycone of the glycoside of peak 1. Its retention time was very close to that of taxifolin (tR 20.34), an isomers found in the original extract and also in TLC band 6 (Fig. 19D). Hydrolysis of the original extract, without TLC fractionation, could lead to the mistaken identification of the aglycone of peak 1 as taxifolin. Separation of the two isomers (tR 32.87 min and tR 35.06 min) was achieved using a Waters SymetryShield C18 column for conclusive identification. The second pentahydroxyflavanone (most likely 3,5,6,7,4-pentahydroxyflavanone, labeled as A-2 in Figure 19C) (tR 26.13 min, max 288, 360 nm, [A+H]+/[A-H]- at m/z 305/303) was identified as the aglycone of the two minor pentahydroxyflavanone-hexosides (peaks 3 and 4, respectively). Since neither the aglycones nor the glycosides showed signification differences in their UV and mass spectra, the identification of these peaks was based on the fact that the ratio of the major aglycone to the minor aglycone (1.9:1.0) was consistent with the ratio of the major glycoside to the sum of the two minor glycosides
47
(2.2:1.0). This strongly indicated that there was no exchange between the glycosides and aglycones during extraction and hydrolysis.
3.2.4. Isoflavones Isoflavones are sometimes considered a subgroup of the flavonoids (Table 1). By 1999, approximately 350 structures had been reported, but only 50 of them, mainly the glycosides of daidzein, formononetin, and gensitein, were glycosides [35]. A more recent review reported many new isoflavonoids from the plants of Papionoideae and Leguminosae [202]. Isoflavones have a limited distribution in the plant kingdom. They are the main flavonoids in soybeans [67], and some legume (i.e., Leguminosae) plants, such as red clover (Trifolium pretense L.), alfalfa (Medicago sativa L.), and the important Chinese herb, astragali roots (Astragalus membranaceus and A. mongholicus) [154,157]. They have been studied extensively since isoflavonoids, soybeans, and soybean related foods were reported to be beneficial for humans [203-207]. Numerous analytical methods have been reported [95, 202, 203-209]. Isoflavones have a UV Band II max at 245-270 nm and a Band I max at 300-340 nm as a shoulder [43] (Table 2). Typical UV spectra of the isoflavonoids are similar to that of genistin [67] in Fugure 4B. Their characteristic UV spectra can be used to readily distinguish the isoflavoids, as a group, from flavonoids in the other subgroups. Identification of individual isoflavone agycones, however, is much more challenging since they are found widely in plants, but there are few standards for direct comparison. Isoflavonoids are different from the other flavonoids in that they can be further subdivided based on distinctive structural variations. These compounds are the neoflavonoids, rotenoids, isoflavans, 3-arylcoumarins, isoflavanones, pterocarpans, isofllavan-4-ols, coumestans listed in Figure 20 [35]. Some isoflavans and pterocarpans were found in astragali roots [154] and red clover [157] as their main flavonoids. In addition, over 30 homoisoflavonoids were found in Ophiopogon species (Liliaceae). These compounds have their B and C rings connected by an additional CH2 group [210]. 3.2.5. Flavanols and Proanthocyanidins Flavanols can be further subdivided base on structural variations. Flavan-3-ols are largest class of monomeric flavans, while naturally existing flavan-3,4-diols and flavans are rare [35]. Flava-3-ols exist in the monomeric (catechins) and polymer (proanthocyanidins) form. Catechin (C), epicatechin (EC), epigalocatechin (EGC), and some of other flavan-3-ols (Table 1) are widely distributed in plants [35]. Their C2 and C3 configurations are shown in Figure 1. Most notably, (-)-epigallocatechin-3-O-galllate (EGCG), (-)-epicatechin-3-Ogalllate (ECG), (-)-EC are the main flavonoids found in green tea. In addition, theaflavins and thearubigins, the enzyme oxidation products of catechins, are found in fermentated teas, such as oolong tea and black tea [226]. These compounds have been reported to be of benefit to human health [211-214]. Some green tea contains more that 10 % EGCG by dry weight. Recently, new flavanol-anthocyanin condensed pigments and anthocyanins have been reported in Guatemalan beans [225]. Catechins containing one or more prenyls at the C6 and C8 positions and one or more methyl ethers, methylgallates, gallates, and other acyls and sugars at the C5, C7, C3, C4, and C5 positions have been found in plants. However, 3-O-glycosylated flavan-3-ols are not
48
common to foods. Cocoa contains some C-glycosylated flavan-3-ols [35, 117]. Their entisomers (i.e., variations in the C2 and C3 configuration, see Figure 1) are only found in plants of palm family [35]. Proanthocyanidins, or condensed tannins, are mixtures of oligomers and polymers composed of the six flavan-3-ol, i.e., afzelechin, epiafzelechin, catechin, epicatechin, gallocatechin and epigallocatechin, and their ent-isomers, and gallates. Most of the polymers are linked through C4-C8 or C4-C8 bonds, while a lesser number are linked through C4-C6 or C4-C6 bonds, and they are called B-type proanthocyanidins. Some are linked doubly by an additional C2-O-C7 bond, and are called the A-type proanthocyanidins [35]. Proanthocyanidins are widely distributed in foods with dimers, trimers, and tetramer reported in grapes and berries [215, 216] and higher polymers (pentamers and higher) detected in other foods [217, 218]. The proanthocyanidin content in common foods has been compiled and consumption by the public has been estimated [219, 220]. The USDA database for the proanthocyanidin contents of selected foods (2004) is available online: http://www.nal.usda.gov/finic/foodcomp [16]. A normal phase column has been used for separation and quantification of proanthocyanidins in plants [221-224]. Under these conditions, all the monomers through nonamers separated as groups. Individual compounds in each group were not detected. The decamers and higher constituted the last analytical peak. Catechins and their polymers have a UV band II max at 270-280 nm (Table 2). A typical UV spectrum of epicatechin is shown in Figure 4B. Once again, the distinctive spectra of these compounds allow them to be distinguished from the other flavonoids. Of the 360 food extracts tested using the standardized phenolic profiling method, jujube skin contained the highest concentration of proanthocyanidins. Using a 5 mL methanol-water (60:40, v/v) extract of 250 mg of plant material and an injection volume of 50 l, 14 proanthocyanidins were clearly detected and included dimers, trimers, and tetramers. Proanthocyanidins were clearly detected in extracts of Fuji apple skins, teas, and some fruits. Other foods contained traces of proanthocyanidins, but they were not concentrated enough to allow clear identification. Concentration of the extracts permitted more proanthocyanidins to be detected.
3.2.6. Chalcones Chalcones have an open C3 chain connecting the two phenyl groups (Figure 1) and represent an intermediate step in flavonoid biosynthesis. As such, they have a transitory existence [35, 227]. Consequently, very few food plants have naturally occurring chalcones as their main phenolic components [35]. Humulus lupulus L. (Cannabaceae), a plant used to add bitterness and flavor to beer, contains xanthohumol, a simple prenylated chalcone, as its main phenolic component. Other related prenylated compounds are found at lesser concentrations. These compounds have reported benefits for human health [228]. The glycosides of phloretin, a dihydroxychalcone, are the main flavonoids in many apple skins. Some chalcones have cytotoxic and chemoprotective properties [229]. Isoliquiritigenin, a 4,4', 6'trihydroxychalcone from tonka beans has demonstrated activity for cancer chemoprevention [230]. The standardized method revealed the existence of several chalcones in Scutellaria lateriflora (Section 5.8.), a Chinese herbal medicine for detoxification and relief of fever.
49
O
2
O
2
O
2
O B
11a 6 6a
R
7
A
1
O
3-Arylcoumarin Neoflavonoid
O O
2'
11
10
Pterocarpan: R=H2 Coumestan: R=O
O
2 4 3
8 9 D 10 11
O C
12 6a
B
1
O A
2 4 3
R
Isoflavan: R=H2 Isoflavan-4-ol: R=H,OH Isoflavanone: R=O
4 5
Coumaronochromone Rotenoid
A
6
3 2 2' 6'
6 5
A
4 3
O
2 2' 6'
O
9
B 4'
B 4'
2-Arylbenzofuran -Methyldeoxybenzoin
O Homoisoflavonoid
Figure 20. Structures of some isoflavones: neoflavonoids, rotenoids, isoflavans, 3-arylcoumarins, isoflavanones, pterocarpans, isofllavan-4-ols, and coumestans.
Chalcones have UV Band I max at 220-270 nm and another max at 340-400 nm. Dihydrochalcones have a UV Band II max at 220-270 nm [43, 67] (Table 2). The UV spectrum of phloridzin (phloretin 6'-O-glucoside) is shown in Figure 4B.
50
[M-H] =515 HO c=173
3 1

COOH a=353
5
OH OH C HO Q COOH
5
Q
4
HO Q
COOH
5
HO d=179 HO HO C d=179
O O O OH OH C e=135 HO
OH
HO
Ob=191
c=173
OH
80 60 40 20
d179.1 ce- 173.1 135.1 161.0 b 191.1

-
a353.1
[M-H]515.1
375.1
150
200
250
300
350
400
450
500 m/z
Figure 21. Mass spectrum (NI250) of 4,5-dicaffeyolquinic acid in elder flowers and the related fragmentation scheme.
3.2.7. Aurones and Benzalcoumanones Aurones or benzalcoumanones have a golden yellow color and are found in some flowers and bryophytes. Only five aglycones are known to exist in plants and none have been found in the tested foods [35]. 3.2.8. Phenolic Acids and their Derivatives and Conjugates Phenolic acids and their derivatives have always co-existed with flavonoids in food plants. Hydroxybenzoic acids, such as p-hydroxybenzoic, protocatechuic (3,4dihydroxybenzoic), vanillic (3-methoxy-4-hydroxybenzoic), gallic (3,4,5-trihydroxybenzoic), and syringic (3,5-dimethoxy-4-hydroxybenzoic) acid, are found in many plant-derived foods [2,5, 34]. Derivatives of hydroxycinnamic acids, such as caffeic, p-coumaric, ferulic, and sinapic acids with quinic, tartaric, malic and shikimic acids, and some sugars and amines are found in many fruits, vegetables and flowers [2,5,34,66,67,77,78,105,232-264]. Ellagic acid derivatives are also found in some food plants, most notably strawberries [237, 262-264]. Derivatives of hydroxycinnamic acids with 2,3,4,5-tetrahydroxy-hexanedioic acids are found in common beans, citrus fruits, and some vegetables [67, 249-252]. Chlorogenic acid (5-
51
caffeoylquinic acid) is the most common phenolic compound and is found in many plants as their main phenolic compound. Cinnamic acids are found primarily in their trans-form (i.e., E-form) as shown in Figure 1), although some have been reported as cis isomers (i.e., Zform). The widely distribution of hydroxycinnamic acids in plants at relatively high concentration suggests that they may be precursors for many of the other phenolic compounds.
3.2.8.1. Hydroxycinnamic Acid/Hydroxybenzoic Acid Conjugates with Quinic Acid These phenolic compounds are widely distributed in many plants and are also found as the main phenolic compounds in many foods, such as artichoke, some Asian pears [162], plums [105], eggplants, burdock roots (Arctium lappa L.) and loquats. They are also found in many spices and herbs from flowers, such as, elder (Sambucus Canadensis L.) [67, 231], arnica (Arnica montana L.) [231], Mexican arnica (Heterotheca inuoides L.) [231], honey suckle (Lonicera japonica L. ) [231], and bricikella (Bricikellia spp), and in coffee beans [244]. There are numerous phenolic acid-quinnic acid derivatives found in plants. One or more acyl groups of the phenolic acids can be connected to one or more of the 4 hydroxyl functions (C1, C3, C4, and C5) of quinic acid. Thus, the same acyl can form 4 monoacylquinic acid isomers, and 6 (1,3-, 1,4-, 1,5-, 4,5-, 3,5- and 3,4-) diacylquinic acid isomers. Two different acyls can form double members of the isomeric hetero-diacylquinic acids. Some conjugates containing 3 acyls groups have been found in plants too. Furthermore, one or more malonyls, acetyls, or acyls can attach to these derivatives to form more compounds. The UV and mass data of the phenolic acids offer ready identification of the isomeric group and the mass data can establish the number and type of acyls attached to the quinic acid. Typical UV absorption spectra of hydroxycinnamic acid and their derivatives (consisting of quinic acid or other polyhydroxy-aliphatic acids) have a max between 305 and 330 nm (band I) and a shoulder between 290 and 300 nm (band II) as listed in Table 2, and shown in Figure 4A for chlorogeic acid. With MS detection, negative ionization offers much stronger ion peaks and many more fragments than positive ionization (Table 2). The deprotonated molecular ion [M-H]- and fragments formed by the loss of the acyl indicate the number of the acyl groups. For example, the NI250 spectrum (Figure 21) of 4,5-dicaffeoylquinic acid showed [M-H]- at m/z 515 and diagnostic fragments at m/z 353 (a- from the loss of one caffeoyl acid residue), m/z 191 (b- from quinic acid after the loss of the last caffeoyl), m/z 179 (d- from caffeic acid), m/z 173 (c-), m/z 161 (from caffeoyl), and m/z 135 (e-). These fragments suggested that this compound had two caffeoyl substitutions and one quinic acid unit [67]. This is consistent with the scheme shown in Figure 21. The PI100 and PI250 spectra showed a weak protonated molecule [M+H]+ m/z 517 with a strong fragment [M+H-H2O]+ m/z 499 (spectra not shown). Positive identification of the phenolic acid isomers of each group is difficult because they have very similar UV and MS spectra. To make positive identification of the most common compounds in food plants, we either purchased or isolated and purified 10 standards for the caffeoylquinic acid isomers. Artichokes, which contain all 6 dicaffeyolquinic acids and 4 monocaffeoylquinic acids [240, 241], were chosen to check the quality of separation offered by 4 columns (Figure 22). Recorded retention times were then used for positive identification of these compounds in other plant materials.
52
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT331.D) m AU 300 250 200 150 100 50 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT335.D) m AU 300 250 200 150 100 50 0

A
Recorded with Symmetry column
3 1 2 4 5
20 25
7 9 8 F-5 10
35 40 45 m in
F-1 F-2 F-3

30
F-4
Recorded with SymmetryShield column

3 2 1 8
4
20 25
5
30
F-1 F-2
35
F-3
6
40
F-5
45
10
m in
5 10 15 DAD1 A, Sig=350,4 Ref=450,100 (D:\QUANT-2\QUANT329.D) m AU 250 200 150 100 50 0 5 10 15 DAD1 A, Sig=350,4 Ref=450,100 (D:\QUANT-2\QUANT253.D) m AU 250 200 150 100 50 0 5 10 15
Recorded with Zorbax Eclipse column

3 F-3 F-1 F-2
20 25 30
C
9 8 F-5 F-4
35 40 45 m in
1 2
6 7
10
Recorded with Luna C18 (2) column

3 9 8 1 2 4 5
20 25
F-1 F-2 F-3

30
67
10 F-4 F-5
35 40 45 m in
Figure 22. Chromatograms (350 nm) of artichoke extract (250 mg/5.0 ml solvent/50 l injected) recorded with: A) Waters Symmetry column, B) SymmetryShield column, C) Agilent Zorbax Eclipse XDB-C18 column, and D) Phenomenex Luna C18 (2) column. Peaks were identified as: 1=1caffeoylquinic acid, 2=3-caffeoylquinic acid, 3=5-caffeoylquinic acid (chlorogenic acid) 4=4caffeoylquinic acid, 5=1,4-dicaffeoylquinic acid, 6=3,4-dicaffeoylquinic acid, 7=1,3-dicaffeoylquinic acid, 8=3,5-dicaffeoylquinic acid, 9=1,5-dicaffeoylquinic acid, 10=4,5-dicaffeoylquinic acid, F1=luteolin 7-O-rutinoside, F2=luteolin 7-O-glucoside, F3=luteolin 7-O-glucuronide, F4=apigenin 7O-glucoside, and F5=apigenin 7-O-glucuronide.
Coffee, made from roasted beans, is one of the two most important common beverages in the world. Phenolic acids are its main phenolic compounds [244]. We tested five non-roasted coffee beans from Kenya, Tanzanian, Indonesia, Costa Rican and Brazil using our standardized phenolic profiling method and found 26 hydroxycinnamoylquinic acids. The phenolic profiles (Figure 23) of all five beans were very similar. These profiles were based on extracts of 100 mg of powder with 5.0 ml of methanol-water (60:40, v/v) and injection of 10 l onto the column. Chlorogenic acid was the most common phenolic acid, followed by 3and ,4-caffeoylquinic acid, 3,4-, 3-,5-, and 4-,5-dicaffeoylquinic acid, 4-,5-p-coumaroylquinic acid, and 4- and 5-feruloylquinic acid (Figure 23A). Traces were found for 15 phenolic compounds, in which 5 were p-coumoylcaffeoylquinic acids, 6 were caffeoylferuloylquinic
53
acids, 4 were diferuloylquinic acids (Figure 23B, chromatogram A, B, C, and D with injection volumes were 60, 30, 10, and 100 l, respectively). It is worth noting that these represented all the p-coumaroylcaffeoylquinic acids that have been reported for coffee bean [244].
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT879.D) m AU 800 600 400 200 0 5 m AU 600 400 200 0 5 m AU 800 600 400 200 0 5 m AU 800 600 400 200 0 5 m AU 800 600 400 200 0 5 10 15 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT883.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT882.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT881.D) 20 25 30 35 40 45 50 m in
Coffee bean-1
2 1 3 4 5 6 8
20 25 30
A
9
35
10
40 45 50 m in
10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT880.D)
Coffee bean-2
Coffee bean-3
Coffee bean-4
Coffee bean-5
Figure 23A. Chromatograms (350 nm) of 5 non-roasted coffee bean extracts: A) bean-1 from Kenya, B) bean-2 from Tanzanian, C) bean-3 from Indonesia, D) bean-4 from Costa Rica, and E) bean-5 from Brazil. Peaks were identified as: 1=3-caffeoylquinic acid, 2=chlorogenic acid, 3=4-caffeoylquinic acid, 4=5-p-coumaroylquinic acid, 5=4-p-coumaroylquinic acid, 6=5-feruloylquinic acid, 7=4-feruloylquinic acid, 8=3,4-dicaffeoylquinic acid, 9=3,5-dicaffeoylquinic acid, and 10=4,5-dicaffeoylquinic acid.
Arnica flowers, a spice found in US markets, is used as a flavor component in food products, such as beverages, desserts, candies, baked goods and puddings. It is also a herb used as a diaphoretic, diuretic and stimulant [231, 242]. Using our standardized profiling method, we identified 27 hydroxycinnamates including mono-, di- and tri-caffeoylquinic acids, and 8 flavonoids in the extract (Figure 24) [242]. The high phenolic content of arnica flowers may be responsible for reports of high biological activity [231]. Some hydroxybenzoic acids, such as gallic acid, form similar derivatives in plants. Monoqalloylquinic acids have been detected in tea samples [120, 246]. Some di-, trigalloylquinic acids and some quinic acid conjugates containing galloylgalloyl or (galloyl)2glalloyl groups instead of galloyl were detected in Pastacia meinmannifolia leaves (Anacardiaceae), a herb used in Yuannan province of China [247]. Such qalloylquinic acids were also reported in the extracts of tara tannins and tannic acid [246].
54
DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-09030.D) m AU 15 10 5 0 -5 -10 38 40 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT891.D) m AU 2 0 -2 -4 -6 -8 -10
13 11 12 15 14
16
Coffee bean-1, 60 ul
17 18 19 20 21 22 23 24
25 26 27
28
A
29 33
54 min
30 31
52
32
42
44
46
48
50
13 12
B
27 30 31
52
29
50
33
54 min
38 40 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT879.D) m AU -4 -6 -8 -10
42
44
46
48
38 40 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-09031.D) m AU 20 15 10 5 0 -5 -10 38 40
42
44
46
48
50
52
54
min
D
29 30 31
52
32
33
54 min
42
44
46
48
50
Figure 23B. Expanded chromatograms (37-55 min) of coffee bean-1 with the injection volumes of: A) 60, B) 30, and C) 10 l. Identified as: peaks 11, 13, 14, 19, 20=p-coumaroylcaffeoylquinic acids ([MH]-=499), peaks 12, 15, 16, 17, 21 and 22=caffeoylferuloylquinic acids ([M-H]-=529), and peaks 26, 27, 28, 29=diferuloylquinic aicds ([M-H]-=543). Peaks 26, 27, 30, 31, 32 and 33 were not identified.
3.2.8.2. Tetrahydroxy-hexanedioic Acids The peels of navel [Citrus sinensis (L.) Osbeck (navel group)] and other oranges have been reported to contain hydrolyzable hydroxycinnamates that also produce p-coumaric acid, ferulic acid, and sinapic acid upon alkaline hydrolysis [67, 249-251]. Some of the hydroxycinnamates were identified as 2'-(E)-O-feruloylgalactaric acid (MW=386), 2'-(E)-Op-coumaroylgalactaric acid, and (E)-O-p-coumaroyl-derivatives of glucaric acid (MW=356) [121, 249-251]. Altraric acid, another isomeric acid, has also been reported to form the hydroxycinnamic acid derivatives in yacon root [252]. Anywhere from 2 to10 such derivatives formed from different acyls and acids have been detected in orange peel extracts. Chemically, the 2,3,4,5-tetrahydroxy-hexanedioic acids can have several isomers, and three of them, D-galactaric acid, D-glucaric acid, D-altraric acid have been reported in food plants. Each of the isomeric tetrahydroxy-hexanedioic acids can produce mono-isomers with the same acyl function. Consequently, they can only be identified by NMR [52-56].

DAD1 B, Sig=330,16 Ref=450,100 (D:\QUANT-2\QUANT395.D) m AU
55
175 150 125 100 75 50 25 0 10 20 DAD1 A, Sig=350,4 Ref=450,100 (D:\QUANT-2\QUANT392.D) m AU 120 30 40 50 m in
4-5
Recorded with Waters SymmetryShield column
19 26 18 21 20 35
11 1-2 3 6 7 10 8 9 12 13
14
16 22-23 24 25 27 30 28 29 31 32 33 34
15 17
100
80
19 Recorded with Agilent column 18
60
40
22 1 2
10
20
24 15 17
20 30 40
23
50 m in
Figure 24. Chromatograms of arnica flower extract (100 mg/5.0 ml solvent/10 l injected)recorded with A) Waters SymmetryShield column and B) Zorbax Eclipse XDB-C18 column (Agilent Corp.). Peaks were identified as: 1=1-caffeyolquinic acid, 2=3-caffeyolquinic acid, 3=caffeoyl-hexose, 4=4caffeoylqunic acid, 5=chlorogenic acid, 6=caffeic acid, 7=5-sinapoylquinic acid, 8=5-feluloylquinic acid, 9=1,4-dicaffeoylquinic acid, 10=patuletin 3-O-glucoside, 11=quercetin 3-O-glucoside, 12=patuletin 3-O-glucuronide, 13=6-methoxykaempferol-3-O-glucoside, 14=quercetin-3 Oglucuronide, 15=3,4-dicaffeoylquinic acid, 16=kaempferol-3-O-glucoside, 17=1,3-dicaffeoylquinic acid, 18=3,5-dicaffeoylquinic acid, 19=1,5-dicaffeoylquinic acid, 20=caffeoylsinapoylquinic acid, 21=kaempferol 3-O-glucuronide, 22=caffeoylsinapoylquinic acid, 23=6-methoxykaempferol 3-Oglucuronide, 24=4,5-dicaffeoylquinic acid, 25=caffeoylsinapoylmalonylquinic acid, 26=1,5dicaffeoylmalonylqinic acid, 27=caffeoylsinapoylmalonylquinic acid, 28=3,5-dicaffeoylmanolyquinic acid, 29=caffeoylferuloylquinic acid, 30=4,5-dicaffeoylmalonylqinic acid, 31=caffeoylsinapoylmalonylquinic acid, 32=dimalonyldicaffeoylqinic acid, 33=1,4,5-tricaffeoylquinic acid, 34=tricaffeoylquinic acid, and 35=1,4,5-tricaffeoylmalonylquinic acid.
Figures 25A and 25C show the partial chromatograms (5.5 19.0 min) for the hydrolyzable hydroxycinnamtes for navy bean and navel orange peel extracts, respectively. There were 10 detectable hydrolysable hydroxycinnamates (peaks P1-P11, Figure 25A) in navy bean and 16 in navel orange peel (Figure 25C). The peaks appeared between 6 and 18 min using the standardized method. They were identified as several groups related to the attached acyl. For example, peaks P1, P3, and P4, P5, P8 and P10 had deprotonated molecules [M-H]- at m/z 355 and UV/Vis max at 312-314 nm and 230 nm. These data suggested that they were p-coumaroylglucaric acids and/or p-coumaroylgalactaric acids and their isomers (MW=356). The remaining peaks had deprotonated ions [M-H]- at m/z 385 and UV/Vis max at 306-330 nm and 336-238 nm. These data suggested that these peaks were
56
feruloylgalactaric or glucaric acids (MW=386) derivatives. In addition, deprotonated ions [M+H]- at m/z 415, co-eluted with the ferulic acid derivatives, indicating the presence of sinapic acid analogs. Several peaks (P1-P3, P6, P7, and P10) in both the orange peels and beans had similar retention times and UV/Vis and MS data. Spiking the navy bean extract with the navel orange peel extract (Figure 25B) confirmed the correspondence of these peaks. This strongly suggested that both orange peel and navy bean contain hydroxycinnamic acids derivatized with 2,3,4,5-tetrahydroxy-hexanedioic acids. It is noteworthy that six of the peaks were also found in navy bean and other common beans (Phaseolus vulgaris L. and its cultivars/varieties) [121]. Characteristically, they produced ferulic acid (P14), p-coumaric acid (P12) and sinapic acid (P13) upon alkaline hydrolysis (Figure 26).
DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN022.D) m AU 30 25 20 15 10 5 0 6 8 DAD1 B, Sig=310,16 Ref=700,100 (LIN\ETEST-7\ETEST630.D) m AU 35 30 25 20 15 10 5 10 12 14 16 18 m in
P-6 P-7 P-2 P-5 P-1 P-3 P-8
P-10 Navy bean (A)
Navy bean + Navel orange peel (B)
6 8 DAD1 B, Sig=310,16 Ref=700,100 (LIN\ETEST-7\ETEST631.D) m AU 60 50 40 30 20 10 0 6 8
10
12
14
16
18
m in
Navel orange peel (C) P-6 P-3 P-1 P-2 P-7 P-10
10
12
14
16
18
m in
Figure 25. Chromatograms (310 nm) of extracts (250 mg/5.0 ml solvent/50 l injected) of A) navy beans, B) a mixture of navy beans and navel orange skins, and C) navel orange skins. Six peaks of navy bean and navel orange peel extracts were same. Peaks P-1, P-3, P-4, P-5, P-8 and P-10=P-coumaric acid derivative and peaks P-2, P-6, P-7, and P-10=ferulic acid derivatives.

DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN012.D) m AU 15 10 5 0 10 20 DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN022.D) m AU 40 30 20 10 0 10 20 DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN033.D) m AU 80 60 40 20 0 10 20 DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN030.D) m AU 60 40 20 0 10 20 DAD1 B, Sig=310,20 Ref=700,100 (D:\L-BEAN\LBEAN032.D) m AU 200 150 100 50 0 10 20 30 40 50 60 30 40 50 60 30 40 50 60 30 40 50 60 30 40 50 60
57
P-16
P-6 P-7 P-10 P-5 P-9 P-2 P-4 P-3 P-8 P-1
P-15 Light red kidney bean extract P-14
m in
P-2 P-1
P-6
P-7 P-10 P-8 P-13 Nave bean extract
P-15 P-14
P-5 P-3
P-16
m in
P-13 P-11 P-12

m in
Alkaline hydrolyzed nave bean extract
P-13 P-11 P-12
Alkaline hydrolyzed black bean extract
m in
P-13 P-12 P-17 (isoferulic acid) P-11 Four hydroxycinnamic acid standards
m in
Figure 26. Chromatograms (310 nm) of the extracts(250 mg/5.0 ml solvent/50 l injected) of: A) light red kidney, B) navy beans, C) alkali hydrolyzed extracts of navy beans, D) alkali hydrolyzed extracts of black beans, and E) four hydroxycinnamic acid standards. Peaks P-1 through P-10 were identified as in Figure 25, peak P-11=P-coumaric acid, P-12=Sinapic acid, P-13=Ferulic acid, P-17=isoferulic acid, and P-14, P-15, and P-16 might be isoflavones.
Besides the beans and orange peels, peas, most of citrus fruit peels (such as blood oranges, tangerines, tangelos, minneolas, temple oranges, limes, lemons, pumnelos, and grapefruit, the leaves of C. hystrix, okra (Hibiscus esculentus L) (Malvaceae), chive and Chinese chive (Allium tuberosum Rottl, or varieties) (Liliaceae), Red Sen Choy (Hong MiSi) (Amaranthus tricolor L.) (Amranthaceae), and spice curry leaves (Murraya koenigii.) (Rutaceae) were also found to contain these compounds. Furthermore, it was found that some of them were formed with caffeoyl. They had deprotonated ions [M-H]- at m/z 371 and UV/Vis max at 290-300 nm and 324-232 nm (Table 2). This may be the first time these derivatives have been detected in foods.
3.2.8.3. Tartaric Acid, Malic Acid, and Dimeric Phenolic Acids Hydroxycinnamic acids also form conjugates and derivatives (such as caffeoylmalic acid, 2-caffeoyltartaric acid, and 2,3-dicaffeoyltartaric acids) with malic and tartaric acid. These compounds have been detected as major components in all the lettuces, such as red, iceberg, romaine, frieze, and Chinese lettuce (Lactuca sativa L., and varieties) (Compositae), chicory, and endive (Cichorium endivia L. and varieties) (Compositae) [2, 5,150,253-255]. Dandelion greens, the leaves of Taraxacum officinale, also contained 2, 3-dicaffeoyltartaric acids as their main phenolic components. In addition, these vegetables also contain mono- and di-
58
caffeoylquinic acids as well as some flavonoid glycosides. This is the first reported detection of 2,3-caffeoylferuloyltaric acids in Chinese lettuce (Figure 27). 2-Caffeoyltartaric acid and 2, 3-dicaffeoyltartaric acids are considered to be the biologically active components of Echinacea angustifolia DC and two other Echinacea species (Compositae) with possible immunostimulatory function. These herbs are popular products on the US and European markets [231]. The phenolic acid glycosides are formed from free saccharides and the glycosyls of phenylethanoids (or phenylpropanoids, phenylmethanoids) existing in foods and herbs [256259]. For example, broccoli and most brassica vegetables contain some cinnamoroylgentiobioses (6-glucosylglucose) with 2-3 acyls connected to the sugar [147, 260]. Brown rice and sweet brown rice contain hydroxycinnamoroyl-sucroses (-D-glucopyransyl--Dfructofuranside). These glycosides contain a sinapoyl, feruloyl, or other hydroxycinnamoyl group [261].
DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08029.D) m AU 100 50 0 5 m AU 100 50 0 5 m AU 50 25 0 5 m AU 100 50 0 5 m AU 50 0 5 m AU 10 0 -10 5 10 15 20 25 30 35 40 45 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08035.D) 20 25 30 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08034.D) 20 25 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08030.D) 20 25 30
Chinese lettuce
2 34 9 11 12 14 13 15
16
20 17 19 18
35
A
22 24
40
25
26
45 m in
3 4 68
Green lettuce
11 15 16
30
17
20 19 21
35
B
22 24
40 45 m in
Escarole
3 4
20 17 19 18
35
C
23 24
40 45 m in
3 5 7
10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08028.D)
Chicoryl
10
20 25 30
20 17 19 18
35
23 24
40 45
m in
Frieze luttuce
34 5 7
20 25 30
20 17 19 18
35
23 24
40
E
25
45 m in
10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08027.D)
1 2
4 3
Red leaf lettuce

11
13
14
15
16
17
19
20 22
F
27
Figure 27. Chromatograms (350 nm) of the extracts (100 mg/5.0 ml solvent/10 l injected) of: A) Chinese lettuce, B) green lettuce, C) escarole, D) chicoryl, E) frieze lettuce, and F) red leaf lettuce. Peaks were identified as: 1=caffeoylglucoside, 2=3-caffeoylquinic acid, , 3=chlorogenic acid, 4=caffeoyltartaric acid, 5=kaempferol 3, 7-O,O-diglucoside, 6=quercetin diglucoside malonate, 7=kaempferol 7-O-glucoside-3-O-glucuroside, 8=quercetin 7-O-glucoside3-O-glucuroside malonate, 9=caffeic acid, 10=kaempferol 3, 7-O,O-diglucoside acetate, 11=caffeoylmalic acid, 12=kaempferol 7glucoside, 13=quercetin 3-O-glucoside, 14=luteolin 7-O-glucoside, 15=quercetin 3-O-glucuronide, 16=luteolin 7-O-glucuronide, 17=quercetin 3-O-6"-malonylglucoside, 18A=quercetin 3-Omalonylglucoside, 18B=3,4-dicaffeoylquinic acid, 19=3,5-dicaffeoylquinic acid, 20=4,5-Ocaffeoyltartaric acid, 21=quercetin 3-O-malonylglucoside, 22=4, 5-dicaffeoylquinic acid, 23=kaempferol 3-O-6"-malonylglucoside, 24=meso-di-O-caffeoyltartaric acid, 25=2-caffeoyl-3-pcoumaroyltartaric acid, 26A= 2-caffeoy-3-feruloyltartaric acid, 26B=meso-2-caffeoyl-3-pcoumaroyltartaric acid, and 27=luteolin.
59
Ellagic acid (Figure 2) has been reported in some foods [237], such as strawberries (Fragaria ananassa) [262], pomegranates (Punica granatum L.) [263], and longans (thr fruits of Euphoria longana Lam.) [264]. The standardized profiling method detected ellagic acid and ellagic acid glycosides as the main phenolic components of these fruits and swamp grape skins (see Section 5.7.) [373]. Ellagic acid had the same molecular weight as the pentahydroxyflavones/flavonols, but its UV spectrum had a strong absorption at 254 m and a weak absorption at 368 nm (Figure 7). This spectrum is quite different from that of quercetin, morin or robinetin (Figure 7) and can be used to distinguish ellagic acid and its glycosides from pentahydroxyflavones and their related glycoside. Some dimeric cinnamic acids were found in some food plants. Several herbs from the Labiatae family, such as basil (Ocimum basilicum L.), oregano (Origanum vulgare L.), marjoram (Origanum majorana L.), and sage (Salvia officinalis L.) contained rosmerinic acid as their main phenolic components [137, 265]. Some ferulic acid C-C and C-O-C bonded dimeric acids (MW=386) and their trimers and derivatives have been reported in the cell walls of some foods, such as sugar beet (Beta vulgaris) [5, 266]. In addition, some N-acyl-amines, such as N-caffeoylputrescine (MW=250), feruloylputrescine (MW=264), feruloyltyramine (MW=312), feruloyloctopamine (MW=328), N-feruloylaminobutane (MW=292), N-p-coumaroyl-N-feruloylputrescine (MW=410), diferuloylputrescine (MW=438), and avenantramides were reported in maize and its leaves (Zea mays. L.), oats (Avena sativa), and potatos [5, 266-270]. This method also detected some diferuloylputrescines in corn.
3.2.9. Other Phenolic Compounds Mango skins (Mangilera indica L. Cv.. Tommy Atkins) were reported to contain xanthone glycosides, their gallates, and six quercetin 3-O-monoglycosides containing galactosyl, glucosyl, xylosyl, two arabinosyls, and rhamnosyl, as their major phenolic compounds. The xanthones are the isomeric C-glycosides of 2,3,5,7-tetrahydroxyxanthone. The xanthone with a glucosyl at the C6 position is called mangoferin and the C8 isomer is isomangiferin [271]. The skins of mango and Mexican yellow mango (Mangilera indica L. and variety) were tested with the standardized profiling method and it was confirmed that the xanthones and flavonoids were present in their extracts. The standardized method was able to detect some coumarins (imperatorin, psoralen), anthraquinones (emodin, aloe-emodin, physcion, aloin), lignans (arctiin), and stilbenes (resveratrol and its glucoside) in their standard solutions (Figure 1). Flaxseeds and sesame seeds were found to contain lignans, and grapes were found to contain resveratrol [2,5]. The presence of these compounds in herbs was previously reported using LC-DAD-MS methods [272-278]. 3.2.10. Related Compounds in Foods Betanin (tR 4.07 min, max 268, 536 nm, [M+H]+ m/z 551, [A+H]+ m/z 389) and isobetanin (tR 4.83 min) were detected in beets (Beta vugaris). The malonates (tR 6.67 and 8.35 min, [M+H]+ m/z 637) of these compounds were detected as major compounds in dragon fruit peels (Hylocereus undatus) (Cactaceae) [279, 280].
60
3.3. Elution order of Phenolic Compounds

As discussed above, the compiled retention times and elution orders obtained for phenolic compounds using the standardized profiling method can be applied to the identification of phenolic compounds in a wide variety of foods and plant materials. The general rules obtained with the Wasters Symmetry C18 reverse phase column can be applied to C18 or C8 columns frequently used for the analysis of phenolic compounds [51, 67, 106, 110]. The general rules obtained for the standardized method are listed below: 1) More polar compounds are eluted first and the retention times decrease with increasing oxygenation and glycosylation and increase with increasing acylation and methylation. 2) Polarity of cinnamic and benzoic acids increase in order with hydroxylation at the C2, C3, and C4 positions. Methoxy groups reduce the polarity and increase the retention time. Among the isomeric monoacylquinic acids, the retention time increased with acylation at the C1, C3, C4, and C5 positions of quinic acid. For diacylquinic acids, the 1,4-diacyls elute first, followed in order by the 3,4-, 1,3-, 1,5-, 3,5-, and 4,5- diacylquinic acid. 3) Glycosylated flavonoids with the same sugar at different positions elute in the order 7-glycoside, 3-glycoside, and 4-glyocoside. 4) Glycosylated flavonoids with a monosaccharide at the same position elute in the order galactoside, glucoside, xyloside, arabinopyranoside, arabinofuranoside, rhamnoside, and then glucuronide. 5) Flavonoind O-diglycosides elute in the order rhamnsylgalactoside, rutinoside (6"rhamnosyl-glucoside), and then neohesperidoside (2"-rhamnosylglucoside). A similar order is also observed for the 4 quercetin 3-O-dihexosylhexoside isomers as mentioned above. 6) 3,7-diglycosides of flavonols or flavonones elute earlier than their isomeric 3diglycosides followed by 7,4'-diglycosides. 7) Anthocyanidin 3,5-O,O-diglucosides elute earlier than their 3-O-diglucosides. 8) Flavone and flavonol isomers elute earlier if they contain more OH groups in A-ring. 9) Flavanones elute earlier than their related flavones when hydroxylated at the same positions. 10) Catechins eluted earlier than their related gallates. Catechin monomers elute earlier than dimers, followed by trimers, tetramers, and so on.
4. QUANTIFICATION OF PHENOLIC COMPONENTS

After identification of the phenolic components in a food, quantification can be achieved by selecting appropriate calibration standards (pure authentic compounds) that are identical or closely related to the compounds of interest [46, 48, 50, 57, 58, 60, 61, 66, 72, 92, 93, 96, 97, 122, 281-283]. Quantification is important for accurate estimation of dietary flavonoid/phenolic compond intake and to evaluate the relationship between flavonoid ingestion and human health. Numerous reports have characteized phenolic compounds in
61
many foods. These data has been comprehensively surveyed, evaluated with respect to quality, and published in the USDA database [16]. This database is available on-line for no charge.
4.1. Quantitative Extraction

The extraction efficiency was evaluated using a series of 3 extractions. The first extraction was made as described in the Sample Preparation section; between 100 mg and 250 mg of sample were sonicated with 5.00 mL of solvent, centrifuged and then 4.00 mL of the solution (Extract 1) was drawn off. The volume of solvent removed was accurately determined by weight. Then 4.00 mL of fresh solvent was added to the sample and remaining solvent from the first extraction. After sonication, 4.00 ml was again drawn off (Extract 2). A final volume of 4.00 mL of fresh solvent was added to the samle, sonicated, and 4.00 mL removed for a third time (Extract 3). All 3 extracts were analyzed by HPLC, and peak areas determined for each peak in the chromatogram. The mass in the first extract (corrected for volume) was compared to the sum of all three. If 95%, or more, of the mass was seen in the first extract this indicated that a single extraction was suitable for a quantitative determination.
4.2. Quantitative Absorption Measurements

Quantification of phenolic compounds is often difficult because of the lack of appropriate glycosylated and acylated standards. A general solution to this problem is to use the aglycone for calibration provided glycolsylation and acylation has a negligable effect on the UV max and absorption coefficient. In general, aglycones, or common glycosides (glucoside or rutinoside), are more available than other flavonoid forms. For example, if flavonols are present, quercetin 3-O-glucoside, which is commercially available, can be used for quantification of all quercetin 3-O-glycosides (i.e. those with different saccharides at the same position) and their malonylated and acetylated forms. All of these compounds have the same UV band I max and absorption coefficients. The calculated concentrations only have to be corrected for the molecular weight [46,48,50,57,58,60, 61,66,72,92,93,96,97,122,281-283]. For example, quantitative results for the flavonoid content of celery, Chinese celery, and celery seeds are presented in Table 7 [122]. In this case, apiin (apigenin 7-Oapiosylglucoside) was used as a standard for quantifying the malonates of apiin and luteolin 7-O-glucoside was used as a standard for the 7-O-apiosylglucosides and malonates of luteolin and chrysoeriol. In both cases, the concentrations had to be corrected by the molecular weight ratios of the analyte and standard compounds. Our approach to calibration is to prepare a stock solution of the standard and to prepare at least 3 different dilutions (calibration standards) that provide a range of signals (absorbance or ion counts) that encompasses the signals for the food extracts. Each of the calibration standards should be injected three times. The relative standard deviations ( RSDs) for the peak areas should be less than 3%, and the average intensities should have a linear relationship. The RSDs ion counts (MS detection in SIM mode) may exceed 3% but should be less than 5%. Each sample extract is prepared in triplicate and each preparation is analyzed
62
in duplicate or triplicate. Concentrations, expressed as mg/100 g fresh food or mg/g dried food, are then calculated. In general, UV detection is used for quantification because of its stability and robustness. When two compounds are not well separated, however, MS detection in the SIM mode is the only means to accurately measure the peak area. For quantification using SIM, the standard should be structurally identical to the compound being analyzed. To assure a stable MSD fragmentation voltage, all standard and sample extracts should be run at least twice using as short a sample injection sequence as possible. Two of the peaks in Figure 13 are composed of unresolved, overlapping peaks (14A and 14B and 15A and 15B) that could not be quantified directly by UV absorption. For these peaks, MS detection in the SIM mode was used to determine the percent contribution of each compound to the peak. The total concentration of the peak, based on UV absorption, was then multiplied by the appropriate fraction to provide a concentration for each compound.
4.3. A General Approach

We have developed an approach to quantification using a limited number of common standards to quantify most of the phenolic compounds in foods (flavones, flavonols, flavanones, isoflavones, anthocyanins, hydroxycinnamic acids, and hydroxybenzoic acids) [150]. The basis for this approach are: 1) a great number of non-UV sensitive substitutions (such as O-methyl, O-glycoside, O-malonylglycoside or O-acetylglycoside) occur at the C3 position of the flavonols, and the C7 position of the flavonones, isoflavones, flavanones and 2) the sites of substitution follow very predictable patterns for the flavonoid subgroups. For example, as mentioned previously the C3 position of quercetin may have many different substitutions, but all of the resulting compounds have the same UV band I max and absorption coefficients as that of quercetin 3-O-glucoside. The polymeric flavan-3-ols made through a single bond linkage between the units, have the same or very similar max and absorption coefficients as their monomers. The conjugates of hydroxycinnamic or hydroxybenzoic acids formed with non-UV sensitive aliphatic acids (quinic acid, tartaric acid, malic acid, and glucaric acid) also have the same or very similar max and absorption coefficients as those of their parent phenolic acids. The proceeding discussion illustrates how quantification can be achieved using a related, but different, compound. It is only necessary to correct the results by the ratio of their molecular weights (i.e. their absorption coefficients only differ by their molecular weight). In some cases, however, the substitutions may cause minor shifts in the max of the absorption band or a change in the absorption coefficient. Then it is necessary to establish correction factors for specific compounds or groups of compounds. Correction factors that relate the absorption coefficients of quercetin 3-O-glucoside to other quercetin glycosides, either singly (e.g. 7-, or 4'-glucoside) or multiply (e.g. 3,7-, or 3,4'-, 7,4'-diglucoside) substituted, to substituted flavonols, to substituted flavones (e.g. glycosides of kaempferol and luteolin), and to aglycones, will allow quantification with a single standard. In principle, only a few standard compounds will be necessary to quantify most of the food flavonoids. The critical aspect of this approach is selecting those few standards and establishing the correction factors.
63
In some cases, substitutions may produce significant differences in the UV band I max and absorption coefficients. For example, the acylated flavonoids formed with hydroxycinnamoyls and hydroxybenzoyls have absorption spectra that are significantly different from their parent compounds. Some biflavones have large wavelength shifts in the UV band I max compared to their monomers. Fortunately, these compounds are not commonly found among food flavonoids. Still, it is possible to establish correction factors that permit quantification within the desired error ranges. Alternatively, it is possible to convert the substituted compounds into their parent glycosides that can be quantified.
4.4. Estimation of the Range of Error

It is well known that commercially available standards (usually as powders), especially the polar flavonoid glycosides, polyhydroxyflavonoid aglycones, and the chlorides of the anthocyanins, contain crystalline water or other solvents. For example, a Sigma commercial standard for quercetin dihydrate with a minimum purity of 98%, contained two crystalline waters per molecule. A Sigma standard for rutin trihydrate with a minimum purity of 95%, contained 3 crystalline waters per molecule. Thus, the crystalline water ranged from 7% to 11%. Unfortunately, most of other suppliers do not specify the degree of hydration. Further complicating the accuracy of an analysis is the fact that the polar phenolics readily absorb moisture from air. Thus, standard purity is usually lower than expressed on most labels and will be further dependent on storage and handling conditions. Indigenous and absorbed water in standards cannot be easily determined. Consequently, the accuracy of standards and the resultant quantification is problematic. In general, little attention has been paid to the moisture content of the standards. In our opinion, the accuracy of the data for most reported flavonoids is biased low by 85-90 %.
5. PHENOLIC PROFILES OF SOME FOODS

Each plant material has its own characteristic phenolic composition. This composition can be characterized by the standardized phenolic profiling method. These profiles, however, can be influenced by the cultivar and by growing and processing conditions [123-125, 284287]. Flavonoids are well known to be environmentally sensitive and are sometimes called environmental compounds. It is possible to modify the cultivar (through conventional breeding methods or genetic modification) and growing conditions to select for desired compounds. Over the past 5 years, we have tested more than 360 food samples and tried to acquire profiles for most foods in the US market. In this section, phenolic profiles acquired by he standardized method will be shown for a variety of foods and their usage will be discussed.
64
5.1. Tea Phenolic Profiles

Tea is one of the most popular and widely consumed beverages in the world. It has been consumed for over a thousand years and is considered to have many health benefits for the human body [288-292]. Tea is also used as traditional medicine in China, India, and some Asian countries. It is made from the dried fresh young buds and leaves, or their enzymatically oxidized forms, from the tea evergreen shrubs or trees (Camellia sinensis L., cultivars or varieties) (Theaceae), originally grown in the south of China. Based on the production procedures, tea has been divided into green tea (the fresh leaves subjected initially to dry heating or steam heating to destroy the enzymes), oolong tea, including ti-kuan-yin (partially fermented by using the existing enzymes in the fresh leaves for further oxidation), and black tea (or red tea) (fully fermented) [231, 288, 289]. Pu-erh tea is the fresh dried and partially or fully fermented leaves of one variety of the evergreen tea tree, C. sinensis var. assamica (Masters) Kitamura, growing in the Yunnan Province of China [289, 290]. Many chemical studies on tea have been carried out, and more than 35 phenolic components have been reported [35,231,288,289,293-304]. Biological studies on tea have indicated that epigallocatechin gallate (EGCG), the most common flavonoid component of green tea, has beneficial health effects. The remaining flavonoids and phenolic compounds are also considered beneficial [211-214,288-292]. We studied the phenolic contents of teas using the standardized phenolic profiling method. In this study, we analyzed 40 green teas, including 6 decaffeinated green teas, 15 partially fermented, and 11 fully fermented teas in the Chinese and US food market [67,120]. The profiles for green teas showed the same pattern for the major phenolic components. All contained EGCG as their major phenolic component (60-170 mg/g, dry weight). Most of the other tea phenolic components were similar, with the exception of the acylated glycosides. The 66 tea samples from this study could be divided into 5 groups, two groups for the green teas and 3 groups for the oolong, black, and fully fermented black teas. The profiles of a tea from each of the 5 tea groups are shown in Figures 28 and 29. The chromatograms were recorded at 270 nm for the catechins and their dimers, gallic acids, and purine (xanthine) alkaloids and at 350 nm for all the flavonols, flavones, and the rest of the phenolic compounds. More than 90 phenolic components, including 77 flavonoids and 15 other phenolic compounds, were detected and identified [120]. Looking at the profiles, it is easy to see the 5 general groupings described above. The first tea group contained 3 mao-feng or high grade teas and 2 white teas. The maofeng teas consisted of younger buds and leaves harvested in the early leaf growing stage. They contained fewer glycosylated flavonols, lower concentrations of EGCG and total glycosylated flavonols, and higher ratios of the p-comaroylglucosides to their related glycosides (Figures 28A and 29A). Group 2 contained 35 common green teas harvested at a relatively more mature stage of the leaves. They displayed much higher concentrations of EGCG and glycosylated flavonols than the teas in group 1. Higher catechin and flavonoid content was also found in the teas in Yunan province, where the tea trees are exposed to much greater levels of sunshine as compared to other locations in China (Figures 28B and 29B). Group 3 was composed of 15 partially fermented oolong, tikuanyin, and some partially fermented pu-erh teas. They contained considerably less EGCG but some theaflavins, the oxidation products of EGCG and other catechins (Figures 28C and 29C). Group 4 was composed of 9 fully fermented black teas. They contained only a trace EGCG, more
65
theavaflavins than Group 3, and thearubigens (Figures 28D and 29D). Finally, group 5 consisted of the two black teas (tou and chitsebenng tea) that were highly over-fermented. This last group contained only a trace of EGCG and theaflavins and significant amounts of 3 flavonols produced by partially hydrolysis of some of the glycosides (Figures 28E and 29E).
DAD1 A, Sig=350,4 Ref=700,100 (LIN\TEA-NE~1\PLANT960.D) m AU 30 20 10 0 -10 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\TEA-NE~1\PLANT927.D) m AU 300 250 200 150 100 50 0 30 40 50 m in
20
35 27 31 34 26 29
40 43 44
Tea-1
77 65 74 73 76 78 79
40 20 24 27 21 23 26 29 31 35 36 43
30
Tea-6
44 45
40
B
61 62
50
12 14
17
52
77
m in
10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\TEA-NE~1\PLANT989.D) m AU 80 60 40 20 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\TEA-NE~1\PLANT980.D) m AU 60 40 20 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\TEA-NE~1\012-8001.D) m AU 60 40 20 0 10 20
12 14
17
35 40 25 31 38 24 27 30 34 43 23 26 33 36 29 41 42 20
30
Tea-26
44 49 52 58 72 63 66 50 57 59 64
50
C
75
m in
40
34 8 12 14 17 24 27 20 23 26 30 33 36 31 32
40 43 41 44 45
Tea-46
52 58 66 57 64
72
30
40
50
m in
34 24 17 23 40 27 31 33 36 43 44 48
Tea-33
67
75
30
40
50
m in
Figure 28. Chromatograms (350 nm) of the extracts (100 mg/5.0 ml solvent/30 l injected) of teas from the 5 tea groups: A) group 1 (tea-1), B) group 2 (tea-6), C) group 3 (tea-26), D) group 4 (tea-46), and E) group 5 (tea-33). Peaks were identified as: 1=8=3-caffoylquinic acid, 12A=p-coumaroylquinic acid, 12B=5-caffeoyloylquinic acid, 14A=4-caffoylquinic acid, 17A=6,8-C-diglucosylapigenin, 17B=5-pcoumaroylquinic acid, 20=p-coumaroylquinic acid, 21B=myricetin 3-O-galactosylrutinoside, 23=apigenin 6-C-arabinoyl-8-C-glucoside, 24=apigenin 6-C glucosyl-8-C-arabinoside, 25=myricetin 3O-rhanmosylhexoside, 26=myricetin 3-O-galactoside, 27=myricetin 3-O-glucoside, 29=quercetin 3-Ogalactosylrutinoside, 30=vixiten 2-glucoside, 31=quercetin 3-O-glucosylrutinoside, 32=quercetin 3-Odirhanmosylglucoside, 33A=vitexin 2-O-rhamnoside, 33B=quercetin 3-O-rhamnosylgalactoside, 34A=apigenin 6,8-C-dipentoside 34B=quercetin 3-O-rhamnosylhexoside, 35=kaempferol 3-Ogalactosylrutinoside, 36= quercetin 3-O-galactoside, 38=quercetin 3-O-glucoside, 40=kaempferol 3-Oglucosylrutinoside, 41=kaempferol 3-O-rhamnosylgalactoside, 42=kaempferol 3-O-xylosylrutinoside, 43A=kaempferol 3-O-rutinoside, 43B=kaempferol 3-O-galactoside, 44=kaempferol 3-O-glucoside, 45A=quercetin 3-O-rahmnoside, 45B=3,5-dicaffeoylquinic acid, 48=myricetin, 58=theaflavin, 59=theaflavate B, 66=theaflavin-3-gallate, 67=quercetin, 69=theaflavate A, 72A=theaflavin-3, 3gallate, 72B=theaflavin-3'-gallate, and 75=kaempferol. Peaks 49, 50, 52, 57, 62, 63, 64, 65, 73, 74, 76, 77, 78, and 79 were acylated flavonol glycosides. Peaks 47, 51, 53, 54, 55, 56, 60, 61, 68, 69, 70, 71 were not detected in these 5 teas.
66
m AU 1500 1000 500 0

DAD1 C, Sig=270,8 Ref=700,100 (LIN\TEA-NE~1\PLANT960.D)
11 3 2 4 5 9 10 12 13 14 16
15
19 18 22
20
Tea-1
37
A
45 46
25 30 35 m in
5 10 DAD1 C, Sig=270,8 Ref=700,100 (LIN\TEA-NE~1\PLANT927.D) m AU 2000 1500 1000 500 0 5 10 DAD1 C, Sig=270,8 Ref=700,100 (LIN\TEA-NE~1\PLANT989.D) m AU 2000 1500 1000 500 0 5 10 DAD1 C, Sig=270,8 Ref=700,100 (LIN\TEA-NE~1\PLANT980.D) m AU 2000 1500 1000 500 0 5 10 DAD1 C, Sig=270,8 Ref=700,100 (LIN\TEA-NE~1\010-7801.D) m AU 2000 1500 1000 500 0 5 10
19 3 2 5 6 7 9 11 12
15
Tea-6
37 21 22
20 25
B
39
30
18
45
35 m in
11 23 4 5 9
15
19 18
20
Tea-26
37
25
30
35 m in
11 34 5 2
15
Tea-46
19
20 25
D
37
30 35 m in
11 23 4 5
15 20
Tea-33
37
25 30
35 m in
Figure 29. Chromatograms (270 nm) of the extracts (100 mg/5.0 ml solvent/30 l injected) of teas from the 5 tea groups: A) group 1 (tea-1), B) group 2 (tea-6), C) group 3 (tea-26), D) group 4 (tea-46), and E) group 5 (tea-33). Peaks were assigned as 1=theanine (not shown), 2A=galloylglucose, 2B=3galloylquinic acid, 3=5-galloylquinic acid, 4A=gallic acid, 4B=4-galloylquinic acid, 5=theobromine, 6=gallocatechin, 7=theophylline, 9=gallocatechin, 10=1,6-digalloylglucose, 11A=gallocatechin dimmer, 11B=caffeine, 11C=methylepicatechin gallote glucoside, 12C=catechin, 13=gallic acid methyl ester, 14B=procyanidin dimmer, 15=gallocatechin-catechingallate, 16=procyanidin trimer, 18A=epicatechin, 18B=gallocatechin-catechingallate, 19=epigallocatechin gallate, 21A=gallocatechin gallate, 22A=digallocatechin-catechin, 22B=1,2,6-trigalloylglucose, 28=epiafzelechin, 37=epicatechin gallate, 39=catechin gallate (27.25 min), 45C=methoxyafzelechin, 46=epiafzelechin gallate, respectively.
This is the first report for tea that covers their extremely wide range of phenolic compounds, including C- and O-glycosylated flavonoids, catechins, proanthocyanidins, phenolic acid conjugates with quinic acids, galloylglucosides, purine alkaloids, and theanine, the tea amino acid. The tea C-glycosylated flavones have not been detected by previous LSMS studies. This was the first time that over 30 phenolic compounds have been reported in a single study using a single method. It is worth noting that the green and oolong teas, made from the leaves of pu-erh tea trees, contained relatively higher catachin concentrations. They contained higher amounts of EGCG, ECG, epiafzelechin, and epiafzelechin gallate. The latter two were clearly detected in pu-erh tea extracts by their UV and MS traces. The profiles of some green teas grown in southwest China, including one from Yunnan province, contained relatively higher concentrations of kaempferol 3-O-xylosylrutinoside (peak 42, tR 42.09 min, Figure 28). The profiles for seven decaffeinated teas were analyzed. It was determined that only two were prepared using an efficient decaffeination process. The remaining decaffeinated teas,
67
either still contained significant amounts of caffeine or lost significant quantities of EGCG, or both. Theanine, the tea amino acid, was detected by MS with either PI or NI in both the TIC and SIM mode. To observe the theanine peak, the standard gradient was altered by adding an initial step that increased Solvent B from 0-10 % in 20 min (see Experimental Section). The retention time of theanine was 4.67 min. Many green teas contained as much as 20 % total phenolic compounds by dry weight. Most of these phenolic compounds can be dissolved in hot water. Thus, a tea infusion made of 1 gram of tea in 100 ml of hot water (85-90 C for ten minutes) contains most of the tea phenolics, with the exception of some of the acylated flavonol glycosides in group 1. Green tea is one of very few foods, out of the 360 tested, that is able to supply over 250 mg of flavonoids daily to the consumer (based on consumption of one cup per day of a tea infusion of 250 ml from 2-3 g tea). The daily total flavonoid intake of the average tea drinker is 40-60 % higher than that of a non-tea drinker.
5.2. Ginkgo Leaf Phenolic Profiles

Ginkgo biloba leaves and their extracts are one of the most widely used herbal products and/or dietary supplements in the world. The flavonoids and terpene lactones are considered to be the main beneficial components [74, 305]. The voluntary industry standard is 24% flavonoid glycoside and 6 % terpene lactones (by weight) in the powdered extracts [305]. Approximately 30 flavonoids, including flavonols, flavonol glycosides, flavones, biflavones, and catechins, have been reported in the leaves [35,74,304-316]. Numerous studies have reported on the flavonoid components of G. biloba leaves [304-316], but none have attempted a systematic study of all the phenolic components in an aqueous methanol extract. Using the standardized phenolic profiing method, 46 glycosylated flavonols, 3 flavonol aglycones, a catechin, 12 flavones, 10 biflavones, a dihydroxybenzoic acid, and 4 terpene lactones were detected and identified in an aqueous methanol extract (Figure 30). This was the first report for more than 20 of these flavonoids in G. biloba [119]. It is interesting to compare the profiles of 6 leaf samples growing in quite different areas. Sample 1 is a NIST standards reference plant material, sample 2 is an American Herbal Pharmacopoeia (AHP) verified botanical reference standard, sample 3 was picked up from ginkgo trees growing in Maryland, USA, sample 4 was collected from a tree growing in Kunmin, China (at a height close to 2000 meters above sea level in acidic red soil), and samples 5 and 6 were picked from female and male trees, respectively, growing in Chongging City, China (Figure 32). The female tree produces fruit yearly and the male tree never does. Still, their phenolic leaf profiles were very similar. They contained almost all the same flavonoids; the only difference being the quantities of specific compounds such as the acylated glycosides.
68
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT622.D) m AU 150 100 50 0

LC chromatogram (350 nm) of the extract 41 35 39 44 43 55 56 37 40 51 34 38 42 45 54 49 46 50 32 36 52 53 47 48
33
40 50 60 70
7 1 3 56
20 31 11 14 16 21 17 24 26 12 19 22 28 30 15 25 8 10 9 13 18 23 27 29
30
A
57
10 20 DAD1 C, Sig=270,8 Ref=700,100 (LIN\PLANT622.D) m AU 400 300 200 100 0 10 20 DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT644.D) m AU 300 200 100 0
m in
LC chromatogram (270 nm) of the extract

2 4
30 40 50 60 70
m in
LC chromatogram (310 nm) of the alkaline hydrolyzed extract

AH-2 AH-1
10 20 30 MSD3 TIC, MS File (LIN\PLANT636.D) API-ES, Neg, SIM, Frag: Var, "NI SIM" 40 50 60 70
26
m in
800000 600000 400000 200000 0
SIM chromatogram (for flavones) of the acidic hydrolyzed extract

A-5 A-1
10 20 30 MSD3 TIC, MS File (LIN\PLANT640.D) API-ES, Neg, SIM, Frag: Var, "NI SIM" 40
D
A-3
50
A-8 A-9 A-7 A-6 A-10

60 70 m in
80000 60000 40000 20000 0
SIM chromatogram (for flavones) of the extract

A-1 A-2
10 20 30 MSD3 TIC, MS File (LIN\PLANT680.D) API-ES, Neg, SIM, Frag: 100, "NI SIM" 40
A-5 A-4 A-3

50
A-8 A-12 A-7 A-9 A-11 A-6 A-10

60
E
A-14 A-13
70
m in
150000 100000 50000 0 10 20 30 40
SIM chromatogram (for terpene lactones) of the extract

BB GC GB GA
50
60
70
m in
Figure 30. Chromatograms of Ginkgo biloba leaf extracts (100 mg/5.0 ml solvent/50 l injected) monitored at: A) 350 nm, B) 270 nm, E) SIM for flavone aglycones, and F) SIM for terpenoids. Chromatograms of: C) Ginkgo biloba alkali hydrolyzed leaf extracts (310 nm) and D) Ginkgo biloba acid hydrolyzed leaf extracts (SIM for flavone aglycones). Peaks were identified as: 2=3,4dihydroxybenzoic acid, 3=quercetin 3-O-rhanosylhexoside- 7-O-glucoside, 4=catechin, 5=kaempferol 3-O- rhanosylhexoside - 7-O-glucoside, 6=isorhamnetin 3-O- rhanosylhexoside - 7-O-glucoside, 7=quercetin 3-O-2", 6"-dirhamnosylglucoside, 8=myricetin 3-O-rutinoside, 9=myricetin 3-O-glucoside, 10=myricetin 3-6-[4-glucosyl-p-coumaroyl]glucosyl(12)rhamnoside, 11=kaempferol 3-O-2", 6"dirhamnosylglucoside, 12=isorhamnetin 3-O-2", 6"-dirhamnosylglucoside, 13=kaempferol 3-O-6"rhamnosyl-2"-(6"'-p-coumaroylglucosyl)glucoside, 14=quercetin 3-O-rutinoside, 15=patuletin 3-Orutinoside, 16=patuletin 3-O-hesperidoside, 17=quercetin 3-O-glucoside, 19=quercetin 2"glucosylrhamnoside, 20=kaempferol 3-O-rutinoside, 21A=isorhamnetin 3-O-rutinoside, 21B=isorhamnetin 3-O-hesperinoside, 22=kaempferol 3-O-glucoside, 23=quercetin 3-O-rhamnoside, 24A=isorhamnetin 3-O-glucoside, 24B=syringetin 3-O-2"-glucosylrhamnoside, 25=apigenin 7-Oglucoside, 26=kaempferol 3-O-2"-glucosylrhamnoside, 28A=isorhamnetin 3-O-2"-glucosylrhamnoside, 28B=myricetin, 29=tetrahydroxyflavone hexoside, 27=30-46=acylated flavonol glycosides, 43B=quercetin, 48=kaempferol, 49=amentoflavone, 51=bilobetin, 54=sequojuflavone, 55=ginkgetin, 56=isoginkgetin, 57=sciadooitysin, AH-1=kaempferol 3-O-2,6-glucosylrhamnosyglucoside, AH-2=pcoumaric acid, A3=patuletin, A4=luteolin, A6=apigenin, A7=syringetin, A8=sorhamnetin, terpenes BB=bilobalide, and GC, GA and GB=ginkgolide C, A and B. Peaks 1, 18, 47,50, 52, 53 and 54, A2, and A10-A14 were not identified.

DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT622.D) m AU 150 100 50 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT641.D) m AU 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT626.D) m AU 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT722.D) m AU 100 50 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT723.D) m AU 100 50 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT724.D) m AU 100 50 0 10 20 30 40 50 60 30 40 50 60 30 40 50 60 30 40 50 60 30 40 50 60 30 40 50 60
69
Ginkgo biloba leave sample-1
m in
m in
m in
m in
m in
m in
Figure 31. Chromatograms (350 nm) of the extracts (125 mg/5.0 ml solvent/50 l injected) of Ginkgo biloba leaf samples: A) NIST SRM #3246 (powdered leaf material), B) AHP authentic standard, C) collected in MD, USA, D) collected in Kunming, China, E) collected from female tree in Chongqing, China, and F) collected from male tree in Chongqing, China.
In general, unlike the profiles of the green teas, those for ginkgo leaves were very similar to each other. This is undoubtedly due to the fact that there is only one Gingko biloba species in the world and their leaves were collected at maturation. Thus, their profiles are suitable for confirmation of the authenticity of the powdered leaves and other products in the market. It has been documented that some Gingo products have a much higher fraction of rutin or quercetin in their flavonoids, suggesting that adulteration has occurred. The Ginkgo products contained all the glycosylated flavonoids, even the acylated flavonoid glycosides (tR 37-50 min), found in the raw materials (Figure 32) with the exception of the biflavones. The commercial extraction processes did not remove the biflavones from the leaves. This is fortunate since the biflavones have been implicates as COX-2 inhibitors and are detrimental to human health.
70
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT622.D) m AU 175 150 125 100 75 50 25 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT634.D) m AU 140 120 100 80 60 40 20 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT639.D) m AU 500 400 300 200 100 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT642.D) m AU 1200 1000 800 600 400 200 0 10 20
30
40
50
60
m in
Ginkgo biloba leave product-1
30
40
50
60
m in
30
40
50
60
m in
30
40
50
60
m in
Figure 32. LC chromatograms of Ginkgo biloba leaf sample and three Ginkgo biloba product materialss: A) NIST SRM xxxx (powdered leaf material), B) product-1, NIST SRM xxxx (compressed pellet), C) product-2, commercial capsule, D) product-3, commercial capsule.
5.3. Pear Peel Phenolic Profiles

Pear is a common, highly consumed fruit that contains flavonoids and other phenolic compounds [2, 5, 35, 40, 41]. There are more than ten different commercial pears on the US market. Among them, the Forelle, Peckinghams (Peckham), Comice, Taylors, Bosc, dAnjou, red DAnjou, Bartlett, green Bartlett, Conference, Bon, and Taylors pears are varieties of P. communis L. (Rosaceae). The Chinese Yali and Yali pears are varieties of P. bretschrideri [323]. Fragrant pears (Xiejiang Xiali, China) are varieties of P. serotina. The remaining Asian pears, such as the Asia, Asia brown, Korea, Korea Shinko are also from the trees of the Pyrus genus [317-324]. Previous chemical studies on pears, including several LC-MS studies, reported the existence of arbutin, several phenolic acid derivatives, and 10 more flavonoids [317-324]. Application of the profiling method to the skins of the 16 pears listed above revealed 10 hydroxycinnamates, more than 20 flavones and flavonol glycosdies, cyanidin 3-Ogalactoside, catechin, epicatechin, and arbutin [162].

DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT505.D) m AU 150 100 50 0 5 10 DAD1 C, Sig=270,8 Ref=700,100 (LIN\PLANT505.D) m AU 200 150 100 50 0 5 10 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT509.D) m AU 100 80 60 40 20 0 15 20 25 30 35 40 15 20 25
71
A
Fragrant pear skin extract (350 nm)

13 5 15 16 17 19 18 23 26 21 22 20 24 25
30
28 34 36 39 32 35 37
35 40
m in
1 5
Fragrant pear skin extract (270 nm)

13 6 10 11 16
19 23 22
28 26
18
m in
Red D'Anjou pear skin extract (350 nm)

19 9 10 14
20
C
18
25
21
22
26 27
33
35
43 40 42
40 m in
5 10 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT506.D) m AU 100 80 60 40 20 0 5 10 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT526.D) m AU 150 100 50 0 5 10
15
30
Yali pear skin extract (350 nm)

5 8 12
15 20 25 30
33 30 38
35
D
40 41
44
40
47
m in
Asian pear skin extract (350 nm)
E
33
15
20
25
30
35
40
m in
Figure 33. Chromatograms of the skin extracts (100 mg/5.0 ml of solvent, 50 l injected) of: A) fragrant pears (350 nm) B) fragrant pears (270 nm), C) DAnjou pears (350 nm), D) Yali pears (350 nm), and E) Asian brown pears (350 nm). Peaks were identified as: 1=arbutin, 2=cyanidin 3-Ogalactoside (see Fig. 15C), 3=3-caffeoylquinic acid, 4=peonidin 3-O-galactoside (see Fig. 15C), 5=chlorogenic acid, 6= catechin, 7=4-caffeoylquinic acid, 8=caffeic acid, 9=Z-caffeoylquinic acid, 10A=epicatechin, 10B=p-coumaoylquinic acid, 12=quercetin 3-O-glucosylgalacoside, 13=quercetin 3O-2"-xylosyl-6"-rhamnosylglucoside, 14=caffeoylmalic acid, 15=quercetin 3-O-galactosylglucoside, 16=quercetin 3-O-pentosylglucoside, 17A=quercetin O-pentoside, 18=quercetin 3-Orhanosylgalactoside, 19=quercetin 3-O-rutinoside, 20=luteolin 7-O-rutinoside, 21= quercetin 3-Ogalactoside, 22=quercetin 3-O-glucoside, 23=luteolin 7-O-glucoside, 24=luteolin 7-Oacetylmalonylglucoside, 26=kaempferol 3-O-rutinoside, 27=isorhamnetin 3-O-robinioside, 28=isorhamnetin 3-O-rutinoside, 29=quercetin 3-O-6"-malonyl glucoside, 30=3,4-dicaffeoylquinic acid, 31=isorhamnetin 3-O-galactoside, 32=chrysoeriol 7-O-rutinoside, 33=3,5-dicaffoylquinic acid, 34=kaempferol 3-O-glucoside, 35=isorhamnetin 3-O-glucoside, 36=apigenin 7-O-glucoside, 37= luteolin 4-O-glucoside, 38=trihydroxymethoxyflavone sulfate, 39=chrysoeriol 7-O-glucoside, 40=4,5dicaffeoylquinic acid, 41=caffeic acid methyl ester, 42A=isorhamnetin 3-O-6"-malonylgalactoside, 42B=kaempferol 3-O-6"-malonylglucoside, 43=isorhamnetin 3-O-6"-malonylglucoside, 44=unknown, 45=isorhamnetin 3-O-malonylgalactoside (see Fig.15-A for Comice pear), 46=isorhamnetin 3-Omalonylglucoside (see Fig. 15-A for Comice pear), and 47=tricaffeoylquinic acid. Peaks 11, 17B, and 25 were not identified.
72
Arbutin (1,4-dihydroxyphenol O-glucoside) and chlorogenic acid were the main phenolics in all the pears. The other phenolic compounds varied widely among the different samples. Asia pears contained only traces of the other phenolics. Yali pears contained significant amounts of dicaffeoylquinic acids, and the remaining pears contained significant amounts of the isorhamnetin glycosides, their malonates, and lesser amounts of the quercetin glycosides. In addition, Yali pear skins contained a flavone sulfate (tR =34.61 mn, max 266, 336 nm, PI/NI molecular and aglycone ions at m/z 381/379 and 301/299, respectively) (Figure 33D, peak 38). Red DAnjou and Seckel pears contained cyanidin 3-O- glucoside and red pears contained detectable amounts of kaempferol glycosides. Fragrant pears contained the glycosides of luteolin, apigenin and chrysoeriol (Figures 33, 15). This is the first time that the phenolic compounds of 17 pears from a local food market in US had been characterized. In addition, this is the first report for more than 20 of these phenolic compounds in pears [162].
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT214.D) m AU 100 50 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT215.D) m AU 150 100 50 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT218.D) m AU 20 25 30 35 40 45 50 m in 20 25 30 35 40 45 50 m in
13 1 2 3 4 5 11 12
15
17
20 21 23 22
Black plum
24
A
25
1 2 3 4 7
11 13 12 15
20 19 21
23
Red plum skin

24
B
25
11
20 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT216.D) m AU 100 50 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT220.D) m AU 75 50 25 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT219.D) m AU 40 20 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT217.D) m AU 20 25 20 25 20 25 20
13 12
9
25
20 15 17 21 23 16 19 22
30 35
Pluot plum skin
40
45
50
m in
1 8
11
17 20 21 13 15 23 12 14
30 35
Green plum skin

24
40 45 50
m in
13 11 12 9
15 17 20 21 23 16 22
30 35
Dinosaur plum skin
24
E
25
50 m in
40
45
2 3
11
Yellow plum skin

13 15
30
F
24
20
21
35 40 45
50
m in
1
100 0 5 10
11 2 3
15 20
Italian plum skin

12 13 18
30
10
25
19
35 40 45 50
m in
Figure 34. Chromatograms (350 nm) of the plum skin extracts (250 mg/5.0 ml of solvent, 50 l injected) of: A) black, B), red, C), Pluot, D) green, E), dinosaur, F) yellow, and G) Italian plums. Peaks were identified as: 1=3-caffeoylquinic acid, 2=chlorogenic acid, 3=4-caffeoylquinic acid, 4=pcoumaroylquinic acid, 8=quercetin 3-O-pentosylglucoside, 10=quercetin 3-O-rhamnosylglalactoside, 11=quercetin 3-O-rutinoside (rutin), 12=quercetin 3-O-galactoside, 13=quercetin 3-O-glucoside, 14=quercetin 3- O-rhamnosylpentoside, 15=quercetin 3-O-xyloside, 16=quercetin 3-O-2"rhamnosylglucoside, 17=quercetin 3-O-dipentoside, 18=isorhamnetin 3-O-rhamnosylgalactoside, 19=rhamnetin 3-O-rutinoside, 20=quercetin 3-O-arabinoside, 21=quercetin 3-O-rhamnoside, 22=quercetin 3-O-6"-manolylglucoside, 23=quercetin3-O-6"-acetoylglucoside, 24=quercetin, 25=quercetin 3-O-6"-coumaroylarabinoside, respectively. Peaks 5-7 and 9 were not identified.
73
5.4. Peach, Cherry, and Plum Phenolic Profiles

Peaches (Prunus persica (L.) Batsch.), cherries [(P. avium (L.) L.], plums (P. domestica L.), apricots (P. armeniaca L.), and prunes (P. mume Sieb. et Zucc.) are fruits of the trees in the Prunus genus (Rosaceae) and contain flavonoids and other phenolic compounds [2, 35, 40, 41, 105, 325-344]. Three peach (white, yellow, and Donot peaches), a nectarine, 7 plum (black, red, Italian, pluot, green, yellow, and dinosaur), two apricot, and one cherry sample were analyzed using the standardized profiling method. Plum skins contained quercetin 3-O-rutinoside, neohesperiside, galactoside, glucoside, xyloside, two arabinosides, and rhanmoside, quercetin 6"-p-coumaroylglycoside, and several caffeoyl-, p-coumaroyl-quinic acids (Figure 34). In addition, some anthocyanins, such as cyanidin 3-O-galactoside, cyanidin 3-O-glucoside (tR 7.83 min, max 280, 516 nm, [M+H]+ at m/z 449), cyanidin 3-O-rutinoside (tR 8.62 min), cyanidin 6"-acetylglucoside (tR 18.49 min, [M+H]+ at m/z 491), and peonidin 3-O-rutinoside (tR 12.25 min), were detected in the dark colored plums (Italian, red, and black plums) (not shown).
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT422.D) m AU 40 20 0 5 m AU 100 50 0 5 m AU 15 10 5 0 5 m AU 10 0 5 m AU 50 0 5 m AU 100 0 5 10 15 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT416.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT421.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT423.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT424.D) 20 25 30 35 40 45 50 m in 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT414.D) 20 25 30 35 40 45 50 m in
6 7 8 3 4 5
10 12 11 13
White peach skin

15
17 16 18
19 20
Nectarine skin
Donut peach skin

14 19
Yellow peach skin
Aprocot skin
Sweet cherry
2 3
Figure 35. Chromatograms (350 nm) of the extracts (250 mg/5.0 ml solvent/50 l injection) of: A) white peach skins, B) nectarine skins, C) donut peach skins, D) yellow peach skins, E) apricot skins, and F) sweet cherries. Peaks were identified as: 1=3-caffeoylquinic acid, 2=chlorogenic acid, 3=4chlorogenic acid, 5=quercetin 3-O-sophorodiside, 6=quercetin 3-O-rutinoside (rutin), 7=quercetin 3-Ogalactoside, 8=quercetin 3-O-glucoside, 9=kaempferol 3-O-rutinoside, 10=kaempferol 3-O-galactoside, 11=Isorhamnetin 3-O-rutinoside, 12=kaempferol 3-glucoside, 13=isorhamnetin 3-O-glucoside, 14=kaempferol 3-O-acetoylglucoside, 15=isorhamnetin 3-O-6"-acetoylglucoside, 16=quercetin 3-Ocoumaroyllglucoside, 17=quercetin 3-O-6"-coumaroyllglucoside, 18=kaempferol 3-O-6"coumaroyllglucoside, 19=quercetin, and 20=isorhamnetin 3-O-6"-coumaroyllglucoside. Peak 4 was not identified.
74
Profiles for peach skins (Figures 35) were slightly different from those for plum skins (Figure 34). Besides quercetin and the quercetin glyocosides, peach skins contained some glycosides of kaempferol and isorhamnen and their p-coumaroyl derivatives. In addition, cyanidin 3-O-glucoside, caffeoylquinic acids, and other acylated quinic acids were detected in the peach peel extracts (Figures 35). White peach skins contained detectable amounts of quercetin 3-O-dihexoside (tR 19.25 min) and quercetin 3,4-diglucoside (Figure 35, A). Apricots contained rutin, chologernic acids, and 3-caffeoyquinic acids as its main phenolic compounds (Figure 35). Minor phenolic components were 4-caffeoylquinic acid, quercetin 3-glucoside, kaemferol 3-O-rutinoside, quercetin 3-O-6"-acetylglucoside, and quercetin. Cherries contained 3-caffeoylquinic acid as its major phenolic compound as well as chlorogenic acid, 4-caffeoylquinic acid and rutin. It also contained quercetin 3-O-hexosylrutinoside (tR 18.28 min, [M+H]+ m/z 773 and fragments at m/z 611, 465, 303) (Figure 35), cyanidin 3-O-rutinoside, peonidin 3-O-rutinoside, and some of the glycosides listed for peaches. This may be the first time that p-coumaroylflavonolglycosides and several of the flavonoids have been reported in peaches and plums [325].
5.5. Bean and Pea phenolic Profiles

5.5.1. Common Beans Common beans (Phaseolus vulgaris L.) are by far the most important pulse crop (i.e., annual leguminous food crops, such as chickpeas, cowpeas, lentils, peas and others that are harvested for dry seeds) in the world [345-347]. Of all the major food legumes, the common beans are the worlds third most important beans after soybeans (Glycine max (L) Merr.) and peanuts (Arachis hypogea L.). The common beans are an important source of protein, dietary fiber, iron, complex carbohydrates, minerals, and vitamins for millions of people in developing and developed countries and are one of the basic foods of the indigenous populations of South America and Eastern and Southern Africa. Common beans are primarily consumed as dry seeds (dry beans) but also as green pods (snap beans) and green shelled seeds. There are 10 major US commercial market classes of dry beans: black, pinto, light and dark red kidney, pink, navy, great northern, alubia, cranberry, and small red (also known as red Mexican) beans. Common dry beans contain a wide range of flavonoids, including flavonols, their glycosides, anthocyanins, proanthocyanidins, and isoflavones, as well as some phenolic acids (Figures 36) [35, 348356]. As part of a project to determine naturally occurring flavonoids and other polyphenolic compounds in food plants, we examined 24 dry beans (17 were identified varieties, and 7 were generic off-the-shelf items from the local grocery store) representing the 10 US commercial market classes using the profiling method [121]. Our study showed that they all contained very similar hydroxycinnamic acid derivatives in the extracts and the same hydroxycinnamic acids in the hydrolyzed extract. The hydroxycinnamic acid derivatives constituted the main phenolic components of beans [67, 121]. By comparison, their flavonoid components were less prominent, with the exception of small red dry bean cultivars (Red Merlot and pink beans). Their flavonoid components, however, showed distinct differences
75
that allowed us to separate the common beans into 6 groups (Figure 36). In general, these groups follow the lines of the market classes. The black bean group (Jaguar, T-39, and Eclipse) contained the 3-O-glucosides of delphinidin, petunidin and malvidin as their main flavonoid components. In addition, they each contained myricetin 3-O-glucoside and trace amounts of 3-O-glucosides of quercetin and kaempfeorl and their malonyl esters. The pinto bean group (Othello, Maverick, Buster, and generic) contained kaempferol 3O-glycosides and their free aglycones. The chromatograms of 3 other pinto beans (not shown) were very similar, except buster and maverick bean had a much lower kaempferol aglycone content (much smaller absorbance peak). The pink bean group was composed of pink beans (UI 537) and dark red kidney bean (Red Hawk). These beans contained 3-O-pentosylhexosides of quercetin and kaempferol and quercetin 3-glusode and its malonyl derivatives. The Red Hawk beans, however, had a much higher quercetin 3-O-pentosylhexoside content (the peak absorbance was approximately 17 times greater) than the other two beans.
DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN045.D) m AU 100 75 50 25 0
Flavonol standards F-3

10 20 DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN005.D)
F-5 F-7
F-8
F-11
F-12
30
40
50
m in
m AU 15 10 5 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN016.D) m AU 30 20 10 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN002.D) m AU 30 20 10 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN012.D) m AU 10 7.5 5 2.5 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (D:\L-BEAN\LBEAN009.D) m AU 100 75 50 25 0 10 20 30 40 50 m in 30 40 50 m in 30 40 50 m in 30 40 50 m in
F-1
F-5
Black bean F-7 F-6 F-8 F-9
F-7 F-9 F-10
Pinto bean
F-12
F-2
F-5 F-4
Red Hawk bean F-6
F-5 F-3 F-6 F-7
Red kidney bean F-11
F-7 F-4
30
F-9 F-10
40
Red merlot bean F-12

50 m in
Figure 36. Chromatograms (350 nm) of A) 6 flavonol standards and extracts of: B) black, C) pinto, D) red hawk, E) red kidney, and F) red merlot beans. Peaks were identified as: 1=myricetin 3-O-glucoside, 2=quercetin 3-O-xylosylglucoside, 3=rutin, 4= kaempferol 3-O-xylosylglucoside, 5=quercetin 3-Oglucoside, 6=quercetin 3-O-(6-O-malonyl)glucoside, 7=kaempferol 3-O-glucoside, 8=myricetin, 9=kaempferol 3-O-(6-O-malonyl)glucoside, 10=kaempferol 3-O-(malonyl)glucoside, 11=quercetin, and 12=kaempferol.
76
C:\Xcalibur\dat a\BEANS\pinbeansrm-2

06/06/2006 11:49:32 AM
100 Relative Abundance 80 60 40 20 178.63 0 200 250 255.40
300.04
282.54 300
340.89 350 400 m/z
427.11
462.63
595.36 500 550 600
450
100 Relative Abundance 80 60 40 20 0 100 120 140 160 180 200 m/z 220 240 260 150.80 203.13 179.00 228.80 244.00 255.27
271.20
257.07 280
300.27 300
100 Relative Abundance 80 60 40 257.13 20 178.69 0 200 250 227.33 236.84
283.94 429.10
447.20 326.92 298.11 300 368.03 350 m/z 380.74 401.10 400 458.91 450 500
579.19
265.25
524.24 534.95 561.10 550 600
100 Relative Abundance 80 60 40 20 0 100 120 140 160 180 200 m/z 220 240 150.87 163.07 184.00 197.53 215.07 213.13 229.20 241.07
255.13
255.87 266.93 260 280 300
Figure 37. MS2 and MS3 spectra of peaks F-2 (quercetin 3-O-pentosylhexoside) and F-4 (kaempferol 3O-xylosylglucoside) of red hawk beans: A) MS2 of F-2, B) MS3 of F-2, C) MS2 of F-4, and D) MS3 of F-4.
The light red kidney bean group consisted of Cal Early and light red kidney beans. Both beans contained quercetin 3-O-glucoside and its malonyl derivatives. The chromatogram of Cal Early beans (not shown) was close to that of red kidney The small red bean group (Red Merlot and UI 239) contained 3-O-glucosides of pelargonidin, cyanidin, and kaempferol and the malonyl derivative of the kaempferol glucoside. The kaempferol 3-O-glucoside content of this group was about 5 times higher than that of the pinto bean group and the total flavonoid content was the highest of all the beans. The chromatogram of UI 239 (not shown) is very similar to that of Red Merlot beans. The navy bean group consised of Norstar, Vista, and Seahawk beans and the great northern bean group was comprised of Matterhorn, Weihing, Beluga, and Taylor Hort beans. Except for ferulic acid (present as a trace quantity in navy bean), all of the beans in this group had chromatographic profiles (not shown) very similar to that of navy beans. They contained
77
the same hydroxycinnamic acid derivatives as navy beans and no detectable flavonoids (Figure 26). Pink bean contained trace amount of quercetin 3-O-pentosylhexoside and kaempferol 3O-xylosylglucoside. The profiling method, however, did not allow the sugar sequences to be unambiguously determined. Positive identification of the sugar sequence was made using MS2 and MS3 with an LCQ ion trap MS (ThermoQuest Corp., San Jose, CA, USA) (Figure 37) [121]. The remaining beans contained hydroxycinnamic acid derivatives as their main phenolic components as did all the common beans. Based on their flavonoid profiles, Dominica red, Central American red, small red, and canary beans contained flavonoids similar to the red merlot bean group. Like the navy beans, white cargamanto, red cargamanto, cannellimi, and romam beans lacked detectable amounts of glycosylated flavonols in their extracts.
DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT475.D) m AU 150 100 50 0 10 20 DAD1 C, Sig=270,8 Ref=700,100 (LIN\PLANT468.D) m AU 100 80 60 40 20 0
9 13 2 34 10 5 6 7 8 11 12
30
A
Snow pea tip extract at 350 nm
15 16 17
40 50 60 m in
2 1 34
10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT019.D)
9 8 10 11 12 14
30
Sugar pea pod extract at 270 nm

15
40 50
19 18
60
B
20
m in
m AU 10 8 6 4 2 0 10 20 DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT483.D) m AU 60 50 40 30 20 10 0 30 40 50 60 m in
5 9 8 10 14
Green pea extract at 350 nm
2 5 8
D
Snow pea pod extract at 350 nm
10 20 DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT480.D) m AU 200 150 100 50 0 10 20
30
40
50
60
m in
5 2
A-1 A-2 A-3

30
Alkaline hydrolyzed snow pea tip extract at 310 nm
40
50
60
m in
Figure 38. Chromatograms for extracts (250 mg/5.0 ml solvent/50 l injected) of: A) snow pea tips, B) sugar pea pods (270 nm), C) green peas (350 nm), D) snow pea pods (350 nm), and E) alkali hydrolyzed show pea tips (310 nm). Peaks were identified as: 2= quercetin 3-O-sophorotrioside, 3=quercetin 3-O-2"-glucosylglucoside, 4=quercetin 3-O- sophoroside, 5= kaempferol 3-Osophorotrioside, 6=kaempferol 3-O-sophoroside, 8=quercetin 3-O-6"-sinapoylsophorotrioside, 9=quercetin 3-O-6"-p-coumaroylsophorotrioside, 10=quercetin 3-O-6"-feruloylsophorotrioside, 11=quercetin 3-O-p-coumaroylsophorotrioside, 12=kaempferol 3-O-6"-sinapoylsophorotrioside, 13=kaempferol 3-O-6"-p-coumaroylsophorotrioside, 14=quercetin 3-O-p-methoxycinnamoylsophorotrioside, 15=quercetin 3-O-p-coumaroyl-sophorotrioside, 16=kaempferol 3-O-6"-pcoumaroylsophorotrioside, 17=kaempferol 3-O-p-coumaroylsophorotrioside, 18=saynedine, and 19=anhydropisatin. Peaks 1, 7 and 20 were not identified.
78
m AU

DAD1 A, Sig=350,4 Ref=700,100 (LIN\PLANT-~1\PLANT022.D)
A
1
40
Red lentil extract
30
20
10
2
0 10 12.5 15 17.5 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST-6\ETEST533.D) m AU 700 600 500 400 300 200 100 0 10 12.5 15 17.5 DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST-6\ETEST547.D) m AU 600 500 400 300 200 100 0 10 12.5 15 17.5 20 22.5 20 22.5 20 22.5
25
27.5
30
32.5
m in
B
Mung bean extract with Symmetry column
4 5
3
25
6
27.5 30 32.5 m in
Mung bean extract with SymmetryShield column
4 5
1 3
25 27.5 30
6
32.5 m in
Figure 39. Chromatograms (350 nm) of extracts (250 mg/5.0 ml solvent/50 l injected) of: A) red lentils with Symmetry column, B) mung beans with Symmetry column, and C) mung beans with SymmetryShield column. Peaks of red lentils were identified as: 1=kaempferol 3-O-hexosyl-hexosylrhamnoside-7-O-rhamnoside, 2=kaempferol 3-O- rutinoside-7-O-galacoside, 3=kaempferol 3-O-pcoumaroylhexosyl-hexosyl-rhamnoside-7-O-rhamnoside, 4=kaempferol 3-O- 6"-coumaroyl-hexosylhexosyl-rhamnoside-7-O-rhamnoside, or kaempferol 3-O-beta-glucopyranosyl(12)-O-[alpharhamnopyranosyl(16)]-beta-galactopyranoside-7-O-alpha-rhamnopyranoside, or kaempferol 3-Obeta-glucopyranosyl(12)-O-[alpha-rhamnopyranosyl(16)]-beta-glucopyranoside-7-O-alpharhamnopyranoside. Peaks for mung beans were identified as: 1=homoorientin, 2=orientin, 3=vitexin 2glucoside, 4=vitexin, 5=Isovitexin, and 6=vitexin 2"-rhamnoside.
The major phenolic components of baby lima and large lima beans (P. limensia L. and its varieties) were many of the hydroxycinnamic acid derivatives mentioned previously. They had no detectable flavonoids in their extracts. Green beans and fresh bean pods from the same plant (Phaseolus vulgaris L.), had significantly different phenolic profiles compared to the dry beans. They contained quercetin 3-O-2"-xylosyl-6"-rhamnosylglucoside (tR 19.64 min, max 256, 266sh, 354 nm, [M+H]+/[MH]- at m/z 743/741, [A+H]+ at m/z 303 and other PI fragments m/z 611, 465), and kaempferol 3-O-2"-xylosyl-6"-rhamnosylglucoside (tR 23.98 min, max 266, 348 nm [M+H]+/[M-H]- at m/z 727/725, [A+H]+ at m/z 287, and other PI fragments m/z 595, 449) as their major flavonoids with quercetin 3-O-rutinoside, kaempferol 3-O-pentosylhexoside, quercetin 3-Oglucuronide, kaempferol 3-O-rutinoside, and kaempferol 3-O-glucuronide present in lesser quantities.

DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT501.D) m AU 70 60 50 40 30 20 10 0 5 10 15 DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT502.D) m AU 80 60 40 20 0 5 10 15 DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT554.D) m AU 30 25 20 15 10 5 0 -5 5 10 15 DAD1 B, Sig=310,16 Ref=700,100 (LIN\PLANT496.D) m AU 120 100 80 60 40 20 0 5 10 15 20 25 30 35 40 20 25 30 35 40 20 25 30 35 40 20 25 30 35 40
79
A
3 1 2
6 5 8 9 12 20 4 7 10 11 13 18 15 14 16 17 19 21 22 23
Blackeye pea extract at 310 nm

24 26 25
27 28
29
m in
Cow pea extract at 310 nm
m in
3 1 2 45
6 78 12 9 10 11
13 14 16 15 17 18 20
Long bean extract at 310 nm

22
19
21
m in
A-1
A-2
D
Alkaline hydrolyzed blackeye pea extract at 310 nm
A-4
m in
Figure 40. Chromatograms (310 nm) of the extracts (250 mg/5.0 ml solvent/50 l injected) of: A) blackeye peas, B) cowpeas, C) long bean pods, and D) alkali hydrolyzed blackeye peas. Peaks for A) and B) were identified as: 1, 3, 5, 7, 9-11=p-coumaric acid derivatives, 2, 4, 6, 8, 12=caffeic acid derivatives, 13-15, 22-24=dimethoxycinnamic acid derivatives, 16=quercetin 3-O-pentasyldihexoside, 17=quercetin 3-O-6"-galactosylglucoside, 18=quercetin 3-O-2"-galactosylglucoside, 19=quercetin 3-O6"-glucosylglucoside, 20=quercetin 3-O- sophoroside, 21=myricetin 3-O-glucoside, 22=quercetin 3-Ogalctoside, 23=quercetin 3-O-glucoside, 24=quercetin 3-O-6"-malonylglucoside, and 25=quercetin 3O-6"-feruloyldihexoside. Peaks for C) were identified as: 1-12=p-coumaric acid derivatives, 13=quercetin 3-O-pentasyldihexoside, 14=quercetin 3-O- 6"-glucosylglucoside, 15=quercetin 3-O-6"sophoroside. 16=(cis)-p-coumaroylquinic acid, 17=isorhamnetin 3-O-sophoroside, 18=quercetin 3-O6"-p-coumaroyl-pentasyldihexoside, 19=quercetin 3-O-6"-feruloylpentasyldihexoside, 20= quercetin 3O-feruloyl-pentasyldihexoside, 21= quercetin 3-O-6"-p-coumaroyldihexoside, 22= quercetin 3-O-6"feruloyl-dihexoside, A1=p-coumaric acid, A2=caffeic acid, A4=caffeic acid methyl ester, respectively.
5.5.2. Peas, lentles, Fava Beans and Others Peas consist of the seeds and/or pods of Pisum sativum L., Vigna spp., and the seeds of Cicer arietinus and Cajanus cajan, and their varieties. In the US food market, the young pea pods from Pisum sativum and its varieties are called snow peas or snow pea pods and sugar snap peas or sugar pea pods, while the dry seeds are called peas, green peas, and yellow peas. The tip of Pisum sativum, with name of snow pea tip, is also a vegetable in China and some other Asian countries [142]. Dry seeds of Vigna unguiculata are called cowpeas, the seeds of V. unguiculata unguiculata are called blackeye peas, the seeds of [V. radiata (L.) R. Wilczek] are called mung beans, and the fresh pods of V. sesquipedalis, or V. sinensis, are called long, yard long, Chinese long, snake, or pea beans. Lentils, red lentils, and Pardina lentils are the dry seeds of Lens calinaris and its varieties. Pigeon peas are the dry seeds of Cajanus cajan,
80
while chick peas are the dry seeds of Cicer arietinus. Fava beans are the dry seeds of Vicia fava L. Many of these peas or beans appear widely in the food market in their raw or cooked forms. Chemically, 3-O-sophorosides of kaempferol and quercetin, quercetin 3-Osophorotrioside-7-O-glucoside, their acyl derivatives, more than 10 anthocyanins, isoflavones, and some structural variations of isoflavone derivatives were reported in peas (Pisum sativum L. and Pisum spp.) [35, 40, 62, 357, 359]. Kaempferol 3-O-rutinoside-7-Ogalactoside, kaempferol 3-O-rutinoside 7-O-rhamnoside, and some proanthocyanidins were reported in lentils (Lens calinaris L.) [35, 152, 360]. Glycosylated flavonols, isoflavonones, flavanones, anthocyanins, and chalcones were reported to exist in seeds and plants of Vigna spp., Cicer arietinus and Cajanus cajan [35, 359, 361]. The standardized profiling method was used to analyze the phenolic components of snow pea tips, snow pea pods, sugar pea pods, dry green peas, yellow peas, cowpeas, blackeye peas, long bean pods, mung beans, chick peas, pigeon peas, lentils, red lentils, Pardina lentils, and fava beans (Figures 38, 39 and 40). Glycosylated flavanones and their acyl derivatives were detected in most of the samples, except yellow peas, chick peas, pigeon peas, and fava beans. Mung beans contained mainly C-glycosylated flavones, while other peas contained mainly O-glycosylated flavanones (Figure 39). Cowpeas, blackeye peas, and long beans contained detectable amounts of hydrolysable hydroxycinnamates similar to these found for common beans and orange skins (Figure 40). Fresh fava bean pods contained over 20 glycosylated flavonols and flavones while the fava beans did not. This is the first time that hydroxycinnamates have been reported in the peas of Vigna species and the first time some of these flavonoids have been reported in peas and beans.
5.6. Brassica Phenolic Profiles

Vegetables from the Brassica genus (Brassicaceae or Cruficeae family) are one of most consumed vegetables worldwide. Of them, broccoli, Brocolini, broccoflowers, Brussels sprouts, cabbages, Savoy cabbage, cauliflower, kale, collard greens, and kohlrabi are the most common varieties of Brassica oleracea L. In addition, there are other Brassica vegetables such as mustard greens [B. juncea (L.) Czern. et Coss.], Chinese broccoli (Gai lon) (B. campestris L.), Chinese flowering cabbage (Yu choy) (B. campestris L. Rape), bok choy (B. L.), Chinese mustard (Gai choy) (B. juncea L.), rapini broccoli raab (B. ruvo L.H. Bailey), nappa [B. pekinsenis (Lour.) Rupr], rutabagas (B. caulorapa Pasq.), turnips, turnip greens (B. rapa L.), and Swedish turnips (B. napus L.) [149]. Epidemiological studies have stressed the capabilities of Brassica vegetables to prevent cardiovascular diseases as well as to protect against some types of cancer, especially cancers of the gastrointestinal tract. Biological studies have indicated that the glucosinolates, flavonoids, and other phenolic compounds in these vegetables had antioxidant and free radical scavenging properties [167, 168, 364-372]. For this reason, some of the Brassica vegetables have been called functional foods. In addition to the glucosinolates, phenolic components have also been the subject of many chemical studies, including LC-MS studies. Five cinnamic acid-gentiobiosides, more than 20 glycosylated flavonoids (mainly kaempferol glycosides) and their acyl derivatives, and a small number of quercetin glycosides and their acyl derivatives have been found in
81
cabbages [106, 149, 365, 368]. Mustard greens and some related vegetables contain glycosides of isorhamnetin too [149, 370, 371]. The standardized profiling method was used to analyze 19 of the Brassica vegetables mentioned above. We found similar profiles that contained flavonol glycosides and hydroxycinnamoyl glucosides, although the relative amounts of individual phenolics varied (Figure 41) [147]. Broccoli, cauliflower, Brussel sprouts, Savoy cabbage, green cabbage, white cabbage, and kohlrabi skins contained the gentiobiosides of sinapic and ferulic acids as their main phenolic compounds and some flavonoids as their minor phenolic components (Figure 42).
DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-09004.D) m AU 200 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08043.D) m AU 200 100 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-09002.D) m AU 400 200 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08040.D) m AU 150 100 50 0 20 25 30 35 40 45 m in 20 25 30 20 25 30 35 40 45 m in
4 5 6 7
89 10 11 1213
Boy choy-Alk.HY
Boy choy
6 P-1 P-2
35 40 45
m in
14
2 6
7 8
Collard green-Alk.HY
2 15
5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08047.D) 20
P-2 Collard geen 6

25 30
D
45 m in
P-1
35
P-3
40
P-4
P-5
m AU 40 20 0 5 10 15 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-08058.D) m AU 50 0 5 10 15 20 25 30 20 25 30
P-1 16 17 6
35
P-2
Broccoli
P-3 P-4
40
P-5
E
45 m in
N-2 N-1 N-3 P-1

35
Nappa
P-4
40 45
m in
Figure 41. Chromatograms of extracts (250 mg/5.0 ml solvent/50 l injected) of: A) alkali hydrolyzed boy choy, B) boy choy, C) alkali hydrolyzed collard greens, D) collard greens, E) broccoli, and F) nappa. Peaks were identified as: 1=quercetin 3-O-diglucoside-7-glucoside, 2=kaempferol 3-Odiglucoside-7-glucoside, 3=kaempferol 3,7-O,O-diglucoside, 4=isorhamnetin 3-O-glucoside-7glucoside, 5=caffeic acid, 6=p-coumaric acid, 7=kaempfeol 3-O-diglucoside, 8=sinapic acid, 9A=ferulic acid, 9B=cis-p-coumaric acid, 11=cis-ferulic acid, 12=isorhamnetin 3-O-glucoside, 13=kaempferol 3-O-glucoside, 14=kaempferol 3-O-triglucoside 7-diglucoside, 15=3-pcoumaroeylquinic acid, 17=quercetin 3-O-diglucoside, P-1=1,2-disinapoyl gentiobiose, P-2=1Sinapoyl-2-feruloyl gentiobiose, P-3=1,2-diferuloyl gentiobiose, P-4=1,2,2-trisinapoyl gentiobiose, and P-5=1,2-disinapoyl-2-feruloyl gentiobiose. Peaks 10 and 16 were not identified. Most of unlabeled peaks in boy choy and collard green are the acylated derivatives of kaempferol 3-O-diglucoside-7glucoside. A few are the acylated derivatives of the other flavonoid glycosides.
82
DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-09\07-09061.D) m AU 25 20 15 10 5 0 5 10 15 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-09\07-09054.D) m AU 12.5 10 7.5 5 2.5 0 5 10 15 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-09\07-09059.D) m AU 8 6 4 2 0 5 10 15 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-09\07-09060.D) m AU 5 4 3 2 1 0

A
Red seedless grape

1 8
20
14 11 13
25
15 16
30
18 17 19
20
35
22
40 45
24
m in
15 1 4
20 25
Green seedless grape skin
11 13
14
30
35
40
45
m in
1 8
14 15
Black grape
19 18 21
20
25
30
35
40
45
m in
1 7 3 6 11 13
20 25
15 14 16
30
Campagne grape
24 17
35 40 45
5 10 15 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-09\07-09055.D) m AU 30 25 20 15 10 5 0 5 10
m in
Red Swamp grape skin

18 2
15
5
20
10
12 14
25 30 35
22
23
40 45 m in
Figure 42. Chromatograms of the extracts of A) red seedless grapes, B) green seedless grape skins, C) black grapes, D) champagne grapes, and E) red swamp grape skins. Peaks were identified as: 1=caffeoyltartaric acid, 9=ellagic acid-pentoside, 10=ellagic acid-rhamnoside, 12=pentahydroxyflavone glycosides, 11=quercetin 3-O-rutinoside, 12=ellagic acid, 13=quercetin 3-O-galactoside, 14=quercetin 3-O-glucoside , 15=quercetin 3-O-glucuronide, 16=isorhamnetin 3-O-galactoside, 17=kaempferol 3-Oglucoside, 18=quercetin 3-O-rhamnoside, 19=isorhamnetin 3-O-glucoside, 20=kaempferol 3-Oglucuronide, and 24=quercetin. The remaining peaks were not identified.
The brassica vegetables that have edible green leaves contained significant amounts of glycosylated flavonols. They could be divided into two groups. The first group, collard greens, kale, and Chinese broccoli, contained kaempferol glyocosides and their acylated derivatives, gentiobiosides, 3-caffeoylquinic acid, and 3-p-coumaroylquinic acids as the main phenolics and quercetin glycosides as minor flavonoids (Figure 41). The second group, mustard greens, baby mustard greens, bok choy, yu choy, gai choy, rapini broccoli, and turnip greens, contained kaempferol glyocosides and their acylated derivatives as the main flavonoids and quercetin glycosides as the minor flavonoids. In the latter group, the concentration of the gentiobiosides was less and the isorhamnetin glycosides were greater than the quercetin glycosides (Figure 41). Nappa and kohlrabi skins also contained gentiobiosides and small amounts of flavonoids (Figure 41). The main phenolic components of nappa may be hydroxycinnamic acid derivatives that consist of an aliphatic compound with a molecular weight of 134 amu (possibly malic acid or deoxypentose). The major peaks, with molecular ions at m/z 339 and 309, produced sinapic and ferulic acid upon base hydrolysis. These derivatives were also
83
found in mustard greens, baby mustard greens, bok choy, yu choy, gai choy, rapini broccoli, and turnip greens. Unlike all the other Brassica vegetables, red cabbage contained anthocyanins, mainly acylated cyanidin 3-O-glycosides as its main flavonoids (not shown). Other flavonoids and gentiobiosides were found as minor components [150].
DAD1 A, Sig=350,4 Ref=700,100 (LIN\ETEST-5\ETEST433.D) m AU 80 60 40 20 0 5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\07-09\07-09057.D) m AU 120 100 80 60 40 20 0 20 25 30 35 40 45 m in
3 2 1
4 6 5 7
9 1112 8 10
F ruit of Cissus sicyoides (350 nm)

15 17 20 13 14 16 18 19 21 24 22 23 25 26 27
28
A21 A7 A13
5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\07-09\07-09050.D) 20
Black grape skin (520 nm)
A15
A16 A18 A19

25 30 35 40 45 m in
m AU 15 10 5 0 5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\07-09\07-09051.D) m AU 20 15 10 5 0 5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\07-09\07-09055.D) m AU 4 3 2 1 0 5 10 15 20 25 30 20 25 30 20 25 30
A7
A11
A13 A15 A16 A18 A20
A21 A22
Red grape wine (520 nm)

A23 A24
35
A2
A5
A25
40 45 m in
A2
A4 A5 A6 A7 A8 A9 A10 A12
A15 A17 A14 A18 A21
Red Concord grape juice (520 nm)
35
40
45
m in
Red Swamp grape skin (520 nm)

A1 A3
35
40
45
m in
Figure 43. LC chromatograms of the extracts of: A) berries of Cissus sicyoides (350 nm), B) black grape skins (520 nm), C) red wine (520 nm), D) red concord grape juice (520 nm), and E) red concord grape skins (520 nm). Flavonol peaks were identified as: 1, 2=myricetin 3-O-dihexosides, 3=myricetin 3-O-galactoside, 4=myricetin 3-O-glucoside, 5=myricetin 3-O-xyloside, 6=isorhamnetin 7-O-glucoside, 7=quercertin 3-O-rhamnosylgalactoside, 8=quercertin 3-O-rutinoside, 9=myricetin 3-O-rhamnoside, 11=quercertin 3-O-galactoside, 12=quercertin 3-O-glucoside, 13=kaempferol 3-O-rutinoside, 14=quercetin 3-O-xyloside, 15=kaempferol 3-O-galactoside, 16=kaempferol 3-O-galactoside, 17=quercetin 3-O-arabinopyranoside, 18=isorhamnetin glycoside , 19=kaemferol 3-O-glucoside, 20=quercetin 3-O-anabinofuranoside, 21=quercetin 3-O-rhamnoside, and 22=kaemferol glycoside. The anathocyanin peaks were identified as: A1=cyanidin 3,5-diglucoside, A2=delphinidin 3-O-glucoside, A3=peonidin3,5-diglucoside, A4=cyanidin 3-O-glucoside, A5=petunidin 3-O-glucoside, A6=peonidin 3-O-glucoside, A7=malvidin 3-O-glucoside, A8=delphinidin 3-O-6"-acetoylglucoside, A9=cyanidin 3O-6"-acetoylglucoside, A10=delphinidin 3-O-p-coumaloyoldiglucoside, A13=malvidin 3-O-6"acetoylglucoside, A14=delphinidin 3-O-6"-p-coumaloyoldiglucoside, A15=delphinidin 3-O-6"-pcoumaroylglucoside, A16=malvidin 3-O-6"-caffeoylglucoside, A17=cyanidin 3-O-6"-pcoumaloyoldiglucoside, A18=petunidin 3-O-6"-p-coumaloyoldiglucoside, A19=petunidin 3-O-6"-pcoumaloyoldiglucoside, A20=malvidin 3-O-p-coumaloyolglucoside, A21=malvidin 3-O-6"-pcoumaloyoldiglucoside. The remaining peaks were not identified.
84
5.7. Grape and Grape Product Phenolic Profiles

Grapes, the fruits of Vitis vinifera L. and its varieties and cultivars, are another common, highly consumed fruit with an even more popular juice and fermented juice (wine). There are several different grapes, such as green, green seedless, red, black, champagne, Concord, and Swamp grapes on the market. Many studies on the phenolic components of grapes and wines have identified their phenolic components as flavonol glycosides, anthocyanins, catechins, proanthocyanidins, and resveratrols [35, 40, 113, 183, 373-394]. We analyzed green seedless, red seedless, black, champagne, and red swamp grape skins, Concord grape juice, one red grape wine, one grape seed, and the fruit of Cissus sichyoides L. from same family of Vitaceae. The samples contained caffeoyltartaric acid and the rhamnosylgalactosides, rutinosides, galactosides, glucosides, xylosides, two kinds of arabinopyranosides, arabinofuranosides, and rhamnosides of quercetin, myricetin, kaempferol, and isorhamnetin. They also contained and the glucosides and rutinosides of delphinidin, cyanidin, petunidin, malvidin, peonidin, and their acylated derivatives (Figures 42 and 43). After purification and concentration using solid phase extraction (SPE) with a polyamide 6 cartridge, the extracts from 2000 mg of grape seed powders (extracted with 45 ml of methanol-water, 60:40, v/v) were found to contain at least 1.0 mg of phenolic material. From 20 ml of Paisano 100% grape table wine (vented), 7.5 mg of phenolic material was isolated using SPE. A 25 ml sample of Welchs Concord grape juice (40 % juice) yielded 16.0 mg of phenolic extract. Red seedless, green seedless, champagne, and swamp grapes (V. labrusca) and the fruits of Cissus sichyoides L contained more flavonol glycosides than anthocyanins. Black grapes, Concord grape juice, and one red grape wine contained anthocyanins as their main flavonoids (Figures 42 and 43). Grape seeds contained very small amounts of phenolics which were not identified. Swamp grape skins contained ellagic acid and its glycosides (Figure 43). Ellagic acid conjugates were also detected in Muscadine grapes (Vitis rotundifolia) [382]. The fruits of Cissus sichyoides L. contained over 20 flavonol glycosides (Figure 43) and the glucosides of delphinidin and cyanidin. This might be the first time that most of these flavonols have been reported in Cissus sichyoides fruit and that some of the flavonol glycosides and anthocyanins have been reported in grapes.
5.8. Profiles of Skullcap (Scutellaria Lateriflora) and Germander (Teucrium Canadense, T. Chamaderys)
Skullcap, the aerial part of Scutellaria lateriflora L. is commonly used as an herbal supplement to treat anxiety, sleeplessness, and muscular spasms. Historically, and in modern times, skullcap has been subject to adulteration with various species of germander (Teucrium canadense, T. chamaderys), which contain potentially hepatotoxic diterpenes, such as teucrin A [395-399]. The aim of our study was to develop an analytical method capable of detecting adulteration of skullcap with very low fractions of germander.

DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10\07-10016.D) m AU 400 300 200 100
85
Scutellaria lateriflora
m f e g
30 35 40 45
A
n p r t
50
v
55 60 m in
0 15 20 25 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10\07-10031.D) m AU 500 400 300 200 100 0 15 20 25 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10\07-10032.D) m AU 350 300 250 200 150 100 50 0 15 20 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10\07-10043.D) m AU 80 60 40 20 0 15 20 25 30 35 40 45 50 55 60 m in 30 35 40 45 50 55 60 m in 30 35 40 45 50 55 60 m in
Scutellaria alpina
f s j m
bc
Scutellaria galericulata
f j a d e
C
s
Scutellaria baicalensis
bc e
k f j l o h
Figure 44. Chromatograms (350 nm) of the extracts (100 mg/5.0 ml solvent/50 l injected) of A) Scutellaria laterifora (SL #2322), B) S. alpine supine (SA#3000), C) S. galericulata (SG#2487b), and D) S. baicalensis (SB#2340, diluted tincture). Peaks were identified as a=apigenin 6,8-di-C-glucoside, b=apigenin 6-C-arabinoyl-8-C-glucoside, c=apigenin 6-C-glucosyl-8-C-arabinoside, d=chrysin 6,8-diC-glucoside, e=dihydroscutellarein 7-O-glucuronide, f=scutellarein 7-O-glucuronide, g=isoscutellarein O-glucuronide, h=dihydroscutellarein 7-O-glucuronide, i=tetrahydroxyflavone O-glucuronide, j=trihydroxyflavone 7-O-glucuronide, k=scutellarein, l=tetrahydroxyflavone O-glucuronide, m=baicalin, n=trihydroxyflavone O-glucuronide, o=dihydrobaicalin 7-O-glucuronide, p=luteolin, q=dihydroxymethoxyflavanone, r=hydroxy-dimethoxyflavanone glucoronide, s=chrysin 7-Oglucuronide, t=hydroxy-dimethoxyflavanone glucoronide, u=apigenin, v=bailcaein, w=tetrahydroxymethoxychalcone, x= chrysin, and y=methoxydihydroxyflavone.
Our standardized profiling method found that of the 10 Scutellaria laterifora samples that were tested (only one is shown in Figure 44), 9 had similar phenolic component profiles. These 9 samples had phenolic components and profiles that were different from those of S. baicalensis, S. alpine supine, and S. galericulata (Figure 44)_ [36, 171, 400-405]. The tenth sample, with the unusual profile, appears to have been misidentified. Five Teucrium canadense samples were tested (Figure 45), and 4 of them had similar phenolic component profile. The exception had a profile similar to those of T. chamaedrys and appears to have been misidentified. All seven T. chamaedrys samples showed similar phenolic component profiles (2 shown in Figure 45). The diterpenoid MS data for the misidentified T. canadense also matched those for T. chamaedrys (not shown).
86
DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10027.D) m AU 20 10 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10026.D) m AU 75 50 25 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10028.D) m AU 600 400 200 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10029.D) m AU 1000 500 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10025.D) m AU 300 200 100 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10033.D) m AU 100 50 0 10 DAD1 A, Sig=350,4 Ref=400,100 (LIN\07-10037.D) m AU

A
P-2
TCA #2312a
30 40 50
20
m in
P-2
TCA #2312
B
50 m in
20
30
40
P-2
TCA #420
C
50 m in
20
30
40
P-2
TCA #407
20
30
40
50
m in
P-1
TCA #2893
20
30
40
50
m in
P-1
TCH #2311
F
50 m in
20
30
40
P-1
200 100 0 10 20 30 40
TCH #2708
G
50 m in
Figure 45. Chromatograms (350 nm) of the extracts (100 mg/5.0 ml solvent/50 l injected) of 5 samples of T. canadense, A) #2312a, B) #2312, C) #420, D) #407, E) #2893, and 2 samples of T. chamaedrys, F) #2311 and G) #2708.
Skullcap, S. baicalensis, S. Alpina, and S. galelriculata contained mainly flavonoids (Figure 44) while T. canadense and T. chamaderys contained chlorogenic acids, caffeic acid, teucrioside, verbascoside, their derivatives, and diterpenoids (teucrin A, teuflin and teucvidin). T. canadense contained verbascoside (P-2 in Figures 45 and 46), a phenylethanoid (Figure 2), as its major phenolic component while T. chamaderys contained teucrioside as the main phenolic component (Figure 45) [395-397]. The verbascoside content ranged from 4-42 times that of the lowest sample (Figure 45) while the teucrioside (P-1 in Figures 45 and 46) content ranged from 2-4 times that of the lowest sample [395-397]. Phenylethanoids have been previously reported as possible markers for the determination of Teucrium adulteration of S. laterifora [395-397]. Using verbascoside (peak P-2 in Figures 45 and 46) and teucrioside (peak P-1 in Figures 46 and 47) as markers for T. canadense and T. chamaedrys, respectively, it was possible to detect as little as 5% Teucrium mixed with S. laterifora using either UV (Figure 46) or MS detection in the TIC mode. MS detection in the SIM mode, could detect as little as 1% adulteration.

DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10060.D) m AU 60 40 20 0 24 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10056.D) m AU 40 20 0 24 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10081.D) m AU 60 40 20 0 24 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10061.D) m AU 60 40 20 0 24 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10055.D) m AU 40 20 0 24 25 DAD1 A, Sig=350,4 Ref=700,100 (LIN\07-10084.D) m AU 100 50 0 24 25 26 27 28 29 30 26 27 28 29 30 26 27 28 29 30 26 27 28 29 30 26 27 28 29 30 26 27 28 29 30
87
SL (#2322) + 5% TCA (#2312a)
P-2
2 A r 7 .6 7 0 ea :3 7. 27 7
4
m in
SL (#2322) + 5% TCA (#2312)
P-2
2 A r 7 .6 9 4 ea :1 13 .9 6
4
m in
SL (#2322) + 1% TCA (#407)

2 A r 7 .9 0 4 ea :3 19 .8 2
P-2
m in
SL (#2322) + 5% TCH (#2490)
P-1
2 A r 6 .1 9 8 ea :9 7. 47 8
5
m in
SL (#2322) + 5% TCH (#2311)
P-1
2 A r 6 .1 5 4 ea :1 31 .0 9
9
m in
SL (#2322) + 1% TCH (#2708)
P-1
2 A r 6 .3 9 3 ea :1 54 .8 1
6
m in
Figure 46. Chromatograms of the S lateriflora extracts containing different percentages of T. canadens and T. chamaedrys: A) #2312a with 5% T. canadense, B) #2312 with 5% T. canadense, C) #420 with 5% T. canadense, C) #407 with 5% T. canadense, E) #2490 with 5% T. chamaedrys, F) #2311 with 5% T. chamaedrys, and G) #2708 with 5% T. chamaedrys, Peaks were identified as: P-1=teucrioside and P2=verbascoside. Peak areas as indicated.
The preceding levels of detection for adulteration were based on the lowest measured concentration of phenylethanoid in T. canadense. Higher levels of the phenylethanoid will produce lower levels of detection for adulteration as shown in Figure 46C and 46F. In both chromatograms, 1% mixes of T. canadense and T. chamaedrys were clearly detected using both UV and MS in the TIC mode (not shown). A conservative adulteration detection limit would have to be based on the lowest concentration levels of the phenylethanoid glycoside. Our standardized profiling method was also able to detect diterpenoids (Figure 47) in the chromatograms of T. canadense and T. chamaedrys using MS detection in the TIC and SIM modes with positive ionization. The major peaks detected were teuflin (peak 1, tR 60.89 min, [M+H]+ at m/z 329), teucvidin (peak 2, tR 61.90 min, [M+H]+ at m/z 329), dihydroteugin (peak 3, tR 48.91min, [M+H]+= at m/z 377), and teucrin G (peak 4, tR 51.86 min, [M+H]+ at m/z 391), and teucrin A (peak 5, tR 52.53 min, [M+H]+ at m/z 345) [398, 399, 405].
88
MSD1 TIC, MS File (LIN\07-10089.D) 600000 500000 400000 300000 200000 100000 10 20 MSD2 TIC, MS File (LIN\07-10089.D) 1000000 800000 600000 400000 200000 0 10 20 MSD1 TIC, MS File (LIN\07-10092.D) 1600000 1400000 1200000 1000000 800000 600000 400000 200000 10 20 MSD2 TIC, MS File (LIN\07-10092.D) 1200000 1000000 800000 600000 400000 200000 0 10 20

API-ES, Pos , Scan, Frag: 100, "PI"
TCA #420 PI TIC at 100V
1 2
30 API-ES, Pos , SIM, Frag: 100, "PI SIM"
40
50
60
m in
TCA #420 PI SIM at 100V
30 API-ES, Pos , Scan, Frag: 100, "PI"
40
50
60
m in
TCH #2708 PI TIC at 100V

3
C
5 4 1
30 API-ES, Pos , SIM, Frag: 100, "PI SIM"
40
50
60
m in
TCH #2708 PI SIM at 100V

3
5 4 1
30
40
50
60
m in
Figure 47. PI Chromatograms of T. canadense, A) TIC of sample #420 and B) SIM of sample #420, and T. chamaedrys, C) TIC of sample #2708 and D) SIM of sample #2708. Peaks were identified as: 1=teuflin, 2=teucvidin, 3=dihydroteugin, 4=teucrin G, and 5=teucrin A, based on reference 403.
6. CONCLUSION
The standardized phenolic profiling method we have developed is able to separate and identify the main phenolic components of foods and provides chromatographic and spectral profiles (retention times and UV and MS spectra) that can be archived and used for rapid characterization of a food material. As the phenolic compounds found in plants tend to follow taxonomic lines, the profiles of an authentic plant material can also be used for botanical recognition and to characterize phenolic components of a similar foods worldwide. Phenolic profiles of plants can change as a function of cultivar and growing, harvesting, and processing conditions. Thus, the profiling method can identify these variations and monitor specifically induced modifications. This makes it possible to develop better conditions for obtaining increased yields of desirable phenolic compounds and to detect unexpected changes. Methodologically, the LC-DAD-MS method is very sensitive, reproducible, and convenient to use. In most cases, it is possible to obtain a phenolic profile for a plant material with 100-250 mg of dried plant material. The method and instrumentation is user friendly and convenient to operate. The facility of operation has made it possible to collect a large amount of data in a relatively short time.
89
7. ACKNOWLEDGMENT
This research was supported by the Agriculture Research Service of the U.S. Department of Agriculture and the Office of Dietary Supplements at the National Institutes of Health.
8. REFERENCES
[1] Erdman, J.; Balentine, D.; Arab, L.; Beecher, G.; Dwyer, J.; Folts, J.; Harnly, J.; Hollman, P.; Keen, C.; Mazza, G.; Messina, M.; Scalbert, A.; Vita, J.; Williamson, G.; Burrowes, J. J Nutri 2007, 137, 718S-737S. Robards, K.; Prenzler, P.D.; Tucker, G.; Swatsitang, P.; Glover, W. Food Chem 1999, 66, 401-436. Manach, C.; Scalbert, A.; Morand, C.; Remesy, C.; Jimenez, C. Am J Cli Nutr 2004, 79, 727-747. Beecher, G.R. J Nut 2003, 133, S3248-54. Shahidi, F.; Naczk, M. (Ed) Phenolics in Food and Nutraceuticals. CRC Press: 2003. Bors W, Saran M. Free Radic Res Commun 1987,2, 289-294. Steinmetz, K.A.; Potter, J.D. J Am Diet Assoc 1996, 96, 1027-1039. Ruel, G.; Couillard, C. Mol Nutr Food Res 2007, 51, 692-701. Galli, R.L.; Shukitt-Hale, B.; Youdim, K.A.; Joseph, J.A. Ann N Y Acad Sci 2002, 959, 128-132. Duthie, S.J. Mol Nutr Food Res 2007, 51, 665-674. Friedman, M. Mol Nutr Food Res 2007, 51, 116-134. D'Alessandro, N.; Poma, P.; Montalto, G. World J Gastroenterol 2007, 13, 2037-2043. Johnston, K.; Sharp, P.; Clifford, M.; Morgan, L. FEBS Lett, 2005, 579, 1653-1657. Galati, G.; OBrien, P.J. Free Radic Biol Med 2004, 37, 287-303. Hertog, M.G.; Feskens, E.J.; Kromhout, D. Lancet 1997, 349, 699. Department of Agriculture. USDA database for the flavonoid content of selected foods. 2003. Available from: http://www.nal.usda.gov/fnic/foodcomp/Data/Flav/flav.pdf. Release #2, database for the flavonoid content of selected foods. www.nal. usda.gov/fnic/foodcomp. the proanthocyanidin content of selected foods. 2004. Available from: http://www.nal.usda.gov/fnic/foodcomp/Data/PA/PA.pdf. the isoflavone content of foods. 2002. Available from: http://www.nal.usda.gov/ fnic/foodcomp/Data/isoflav/isoflav.html. Harnly, J.; Doherty, R.; Beecher, G.;Holden, J.; Haytowitz, D.; Bhagwat, S.; Gebhardt, S. J Agri Food Chem 2006, 54, 966-977 Pennington, J.A.T. J Food Comp Anal 2002, 15, 419-434. Lin, J.; Rexrode, K.M.; Hu, F.; Albert, C.M.; Chae, C.U.; Rimm, E.B.; Stampfer, M.J.; Manson, J.E. Am J Epidemiol 2007, 165, 1305-1313. Arabbi, P.R.; Genovese, M.I.; Lajola, F.M. J Agric Food Chem 2004, 52, 1124-1131. Franke, A.A.; Custer, L.J.; Arakaki, C.; Murphy, S.P. J. Food Comp Anal 2004, 17, 135. Clarke, D.B.; Lloyd, A.S. Food Addit Contam, 2004, 21, 305-316 Scalbert, A.; Williamson, G. J Nutr 2000, 130(8 Suppl), S2073-2085.
[2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16]
[17] [18] [19] [20] [21] [22] [23]
90
[24] Kimira, M.; Arai, Y.; Shimoi, K.; Watanabe, S. J Epidemiol 1998, 8, 168-175. [25] Hertog, M.G.L.; Kromhout, D.; Aravanis, C.; Blackburn, H.; Buzina, R.; Fidanza, F.; Giampaoli, S.; Jansen, A.; Menotti, A.; Nedeljkovic, S.; Pekkarinen, M.; Simic, B.S.; Toshima, H.; Feskins, E.J.M.; Holman, P.C.H.; Katan, M.B. Arch Intern Med 1995, 155, 381-386. [26] Hakim, I.A.; Alsaif, M.,A.; Alduwaihy, M.; Al-Rubeaan, K.; Al-Nuaim, A.R.; AlAttas, O.S. Prev Med 2003, 36, 64-70. [27] Knekt, P.; Jarvinen, R.; Reunanen, A.; Maatela, J. Br Med J, 1996, 312, 478-481. [28] Kris-Etherton, P.M.; Lefevre, M.; Beecher, G.R.; Gross, M.D.; Keen, C.L.; Etherton, T.D. Annu Rev Nutr 2004, 24, 511-538. [29] Arts, I.C.; Hollman, P.C. Am J Clin Nutr 2005, 81(1 Suppl), S317-325. [30] Knekt, P.; Kumpulainen, J.; Jarvinen, R.; Rissanen, H.; Heliovaara, M.; Reunanen, A.; Hakulinen, T.; Aromaa, A. Am J Clin Nutr 2002, 76, 560-568. [31] Lagiou, P.; Samoli, E.; Lagiou, A.; Katsouyanni, K.; Peterson, J.; Dwyer, J.; Trichopoulos, D. Nutr Cancer 2004, 49, 139-143. [32] Lagiou, P.; Samoli, E.; Lagiou, A.; Tzonou, A.; Kalandidi, A.; Peterson, J.; Dwyer, J.; Trichopoulos, D. Eur J Clin Nutr 2004, 58, 1643-1648. [33] Sesso, H.D.; Gaziano, J.M.; Liu, S.; Buring, J.E. Am J Clin Nutr 2003, 77, 1400-1408. [34] Bors, M.; Heller, W.; Michel, C.; Stettmaier, K. Flavonoids and polyphenols: Chemistry and Biology, In Handbook of Antioxidants, ed. by E. Cadenas, E., Packer, L. Dekker Inc., New York, 1996. [35] Harborne, JB; Baxter, H. The handbook of natural flavonoids, Vol. 1 and 2, John Wiley & Sons, LTD: New York, NY, USA, 1999. [36] Harborne J.B.; Williams, C.A. Natural Products Report 2001, 18, 310-333. [37] Anderson, O. M.; Markham, K.R. (Ed) Flavonoids, Chemistry, Biochemistry and Applications. CRC Press, Boca Raton, FL, USA, 2005. [38] Heim, K. E.; Tagliaferro, A.R.; Bobilya, D.J. J Nutritional Biochem 2002, 13, 572-584. [39] Williams, C.A.; Graayer, R.J. Nat Prod Rep 2004, 21, 539-573. [40] Escarpa, A.; Gonzales, M.C. Crit Rev Anal Chem 2001, 31, 57-139. [41] Robards, K. J Chromatogr A 2003, 1000, 657-691. [42] Stobiecki, M. Phytochemistry 2000, 54, 237-256. [43] Mabry, T.J., Markham, K.R.; Thomas, M.B.The Systematic Identification of Flavonoids. Springer-Verlag: New York, NY, 1970, Chapter V and VI, pp. 41-45 and 165-166. [44] de Rijke,E.; Out, P.; Niessen, W.M.A.; Ariese, F.; Gooijer, C.; Brinkman, U.A. J Chromatogr A 2006, 1112, 31-63. [45] Merken, H.M.; Beecher, G.R. J Agric Food Chem 2000, 48, 578-599. [46] Molnr-Perl, I.; Fzfai, Z.S. J Chromatogr A 2005, 1073, 201-227. [47] Nyiredy, S. J Chromatogr B 2004, 812, 35-51. [48] Naczk, M.; Shahidi, F. J Chromatogr A 2004, 1054, 95-111. [49] Gmez-Caravaca, A.M.; Gmez-Romero, M.; Arrez-Romn, D.; Segura-Carretero, A.; Fernndez-Gutirrez, A. Aournal of Pharmaceutical and Biomedical Anlisis 2006, 41, 1220-1234. [50] Sakakibara, H.; Honda. Y.; Nakagawa, S.; Ashida, H.; Kanazawa, K. J Agric Food Chem 2003, 51, 571-581. [51] Cuyckens, F.; Claeys, M. J Mass Spectrom 2004, 39, 1-15.
91
[52] Le Gall, G.; DuPont, M.S.; Davis, A.L.; Mellon, F.A.; Collins, G.J.; Verhoeyen, M.E.; Colquhoun, I.J. J Agri. Food Chem 2007. 51 (9), 2438 -2446. [53] Andrade, F.D.; Santos, L.C.; Datchler, M.; Albert, K.; Vilegas, W. J Chromatogr A 2002, 953, 287-291. [54] Wolfender, J.L.; Ndjoko, K.; Hostettmann, K. J Chromatogr A 2003, 1000, 437-455. [55] Queiro, E.F.; Wolfender, J.-L.; Atindehou, K.K.; Traore, D.; Hostettmann, K. J Chromatogr A 2002, 974, 123-134. [56] Weber, B.; Hartmann, B.; Stckigt, D.; Schreiber, K.; Roloff, M.; Bertram, H-J.; Schmidt, C.O. J AgricFood Chem 2006, 54, 274-278. [57] Harnly, M.J.; Seema, B.; Lin, L.-Z. Anal Bioanal Chem 2007, in press. [58] Hertog, M.; Hollman, P.; Venema, D. Food Chem 1992, 40, 1591-1598 [59] Lamuela-Raventos, R,; Waterhouse A. Am J Enol Vitic 1994, 45,1-5 [60] Mouly, P.; Gaydou, E.; Auffray, A. J Chromatogr A 1998, 800, 171-179. [61] Escarpa, A.; Gonzalez ,M. J Chromatogr A 2000, 897, 161-170 [62] Schieber, A.; Keller, P.; Carle, R. J Chromatogr A 2001, 910, 265-273 [63] Cuyckens, F.; Claeys, M. Rapid Commun Mass Spectrom 2002, 16, 2341-2348 [64] Wu, Q.; Wang, M.; Simon, J. J Chromatogr A 2003, 1016, 195-209 [65] Tolonen, A.; Uusitalo, J. Rapid Commun Mass Spectrom 2004, 18, 3113-3122 [66] Papagiannopoulos, M., Wollseifen, H., Mellenthin, A., Haber, B., Galensa, R. J Agri Food Chem 2004, 52, 3784-3791 [67] Lin, L-Z.; Harnly. J. J Agri Food Chem 2007, 55, 1084-1096 [68] Stobiecki, M.; Skirycz, A.; Kerhoas, L.; Kachlicki, P.; Muth, D.; Einhorn, J.; MuellerRoeber, B. Metabolomics 2007, 2, 197-219 [69] Farag, M.; Huhman, D.; Lei, Z.; Sumner, L. Phytochem 2007, 68, 342-354. [70] Asami, D.K.; Hong, Y.-J.; Barrett, D.D.; Mitchell, A. E. J Agric Food Chem 2003, 51, 1237-1241. [71] Institute for Nutraceutical Advancement published analytical methods for herb components on www.nsfina.org. [72] Naczk, M.; Shahidi, F. J Chromatogr A 2004, 1054, 95-111. [73] Smith, R. M. J Chromatogr A, 2003, 1000, 3-27. [74] van Beek, T.A. J Chromatogr A 2002, 967, 21-55. [75] Rostagno, M.A.; Palma, M.; Barroso, C.G. J Chromatogr A 2003, 1000, 657-691. [76] Vinatoru, M. Ultrason sonochem, 2001, 8, 303-313. [77] Naczk, M.; Shahidi, F. J Pharm Biomed Anal 2006, 41, 1523-1542. Erratum in: J Pharm Biomed Anal 2007, 43,798. [78] Naczk, M.; Shahidi, F. J. Chromatogr A 2004, 1054, 95-111. [79] Kaufmann, B.; Christen, P. Phytochem Anal 2002, 13, 105-113. [80] Kwon, J.H.; Belanger, J. M.R.; Pare, J. R.J. J Agric Food Chem 2003, 51, 1807-1810. [81] Alonso-Salces, R. M.; Korta, E.; Barranco, A.; Berrueta, L. A.; Gallo, B.; Vicente, F. J Agric Food Chem 2001, 49, 3761-3767. [82] Bergeron, C.; Gafner, S.; Clausen, E.; Carrier, D.J. J Agric Food Chem 2005, 53, 30763080. [83] Carabias-Martinez, R.; Rodrguez-Gonzalo, E.; Revilla-Ruiz, P.; Hernandez-Mendez, J. J Chromatogr A, 2005, 1089, 1-17. [84] Kaufmann, B.; Christen, P. Phytochem Anal 2002, 13, 105-113. [85] Kwon, J.H.; Belanger, J.M.R.; Pare, J.R. J Agric Food Chem 2003, 51, 1807-1810.
92
[86] Bruni, R.; Guerrini, A.; Scalia, S.; Romagnoli, C.; Sacchetti, G. Phytochem Anal 2002, 13, 257-261. [87] Giannuzzo, A.N.; Boggetti, H.J.; Nazareno, M.A.; Mishima, H.T. Phytochem Anal 2003, 14, 221-223. [88] Modey, W.K.; Mulholland, D.A.; Raynor, M.W. Analytical Phytochem Anal 1996, 7,115. [89] Scalia, S.; Giuffreda, L.; Pallado, P. J Pharm Biomed Anal 1999, 21, 549-558. [90] Schaneberg, B.T.; Khan, I.A. J Agric Food Chem 2002, 50, 1345-1349. [91] Waksmundzka-Hajnos, M.; Petruczynik, A.; Dragan, A.; Wianowska, D.; Dawidowicz, A.L.; Sowa. I. J Chromatogr B 2004, 800, 181-187. [92] Lin, L.-Z.; Mukhopadhyay, S.; Robbins, R.J.; Harnly, J.M. J Food Composition and Anal 2007, 20, 361-369. [93] de Brito, E.S.; Pessanla de Araujo, C.C.; Lin, L.-Z.; Harnly, J. Food Chem 2007, 105, 1112-1118. [94] Lin, L.-Z.; He, X.-G.; Lian, L.-Z.; King, W.; Elliot, J. J Chromatgr A 1998, 810, 71-79. [95] Lai, J.P.; Lim, Y.H.; Su, J.; Shen, H.M.; Ong, C.N. J Chromatogr B, 2007, 848, 21525. [96] Merken, H.M.; Merken, C.D.; Beecher, G.R. J Agric Food Chem 2001, 49, 2727-32. [97] Crozier, A.; Jensen, E.; Lean, M.E.J.; Mcnald, M.S. J Chromatogr A 1997, 761, 315301. [98] Alonso-Salces, R.M.; Ndjoko, K.; Queiroz, E.F.; Ioset, J.R.; Hostettmann, K.; Berrueta, L.A.; Gallo, B.; Vicente, F. J Chromatogr A 2004, 1045, 89-100. [99] Careri, M.; Bianchi, F.; Corradini, C. J Chromatogr A 2002, 970, 3-64. [100] Cuyckens, F.; Rozenberg, R.; de Hoffmann, E.; Claeys, M. J Mass Spectrom 2001, 36, 1203-1210. [101] Cuyckens, F.; Shahat, A.A.; Pieters, L.; Claeys, M. J Mass Spectrom 2002, 37, 12741279. [102] Han J.; Ye, M.; Guo, H.; Yang, M.; Wang, B.R.; Guo, D.A. J Pharm Biomed Anal 2007, 44, 430-438. [103] Davis, D. B.; Brodbelt. Anal Chem 2005, 77, 1883-1890. [104] de Rijke, E.; Zappey, H.; Ariese, F.; Gooijer, C.; Bringkman, U.A.Th. J Chromatog A 2003, 984, 45-58. [105] Fang, N.; Yu, S.; Prior, R.L. J Agric Food Chem 2002, 50, 3579-3585. [106] Frreres, F.; Llorach, R.; Gil-Izquierdo, A. J Mass Spectrom 2004, 39, 312-321. [107] He, X.-G. J Chromatogr A 2004, 880, 203-230. [108] Justesen, U. J Mass Spectrom 2001, 36, 169-178. [109] Kite, G.C.; Porter, E.A.; Denison, F.C.; Grayer, R.J.; Veitch, N.C.; Butler, I.; Simmonds, M.S. J Chromatogr A 2006, 1104, 123-131. [110] Stobiecki, M. Phytochemistry, 2000, 54, 237-256. [111] Mattila, P.; Astola, J.; Kumpulainen, J. J Agric Food Chem 2000, 48, 5834-5841. [112] Rauha, J.-P.; Vuorela, H.; Kostiainen, R. J Mass Spectrom 2002, 37, 1274-1279. [113] Reed, J.D.; Krueger, C.G.; Vestling, M.M. Phytochemistry 2005, 66, 2248-2263 [114] Tian, Q.; Giusti, M.M.; Stoner, G.D.; Schwartz, S.J. J Chromatogaphy A 2005, 1091, 72-82. [115] Petsalo, A.; Jalonen, J.; Tolonen, A. J Chromatogr A 2006, 1112, 224-231.
93
[116] Bottcher, C.; Roepenack-Lahaye, E.V.; Willscher, E.; Scheel, D.; Clemens, S. Anal Chem 2007, 79, 1507-1513. [117] Stark, T.; Hofmann, T. J Agric Food Chem 2007, 54, 9510-9521. [118] March, R.E.; Lewars, E.G.; Stadey, J.C.; Miao, X.-S.; Zhao, X.; Metcalfe, C.D. Int J Mass Spectrom 2006, 248, 61-85. [119] Lin, L.-Z.; Chen, P.; Ozcan, M.; Harnly, J.M. J Chromatogr A, submitted. [120] Lin, L.-Z.; Chen, P.; Harnly, J.M. J Agric Food Chem, submitted. [121] Lin, L.-Z.; Harnly, J.; Pastor-Corralesm, M.S.; Luthria, D. Food Chem 2007, 2008, 107, 399-410. [122] Lin, L.-Z.; Lu, S.; Harnly, J.M. J Agric Food Chem 2007, 55, 1321-1326. [123] Mogren, L.M.; Olsson, M.E.; Gertsson, U.E. J Agric Food Chem 2006, 54, 6185-6191. [124] Anttonen, M.J.; Karjalainen, R.O. J Agric Food Chem 2006 54, 7530-7548. [125] Hernanz, D.; Recamales, A.F.; Melendez-Martinez, A.J.; Gonzalez-Miret, M.L.; Heredia, F.J. J Agric Food Chem 2007,55,1846-1852. [126] Sun, T.; Powers, J.R.; Tang, J. J Agric Food Chem 2007, 55, 56-60. [127] Wang, M.; Tadmor, Y.; Wu, Q.L.; Chin, C.K.; Garrison, S.A.; Simon, J.E. J Agric Food Chem 2003, 51, 6132-6. [128] Danila, A.M.; Kotani, A.; Hakamata, H.; Kusu, F. J Agric Food Chem 2007, 55, 11391143. [129] Fabjan, N.; Rode, J.; Kosir, I.J.; Wang, Z.; Zhang, Z.; Kreft, I. J Agric Food Chem 2003, 51, 6452-6455. [130] Stewart, A.J.; Bozonnet, S.; Mullen, W.; Jenkins, G.I.; Lean, M.E.; Crozier, A. J Agric Food Chem 2000, 48, 2663-2669. [131] Le Gall, G.; DuPont, M.S.; Mellon, F.A.; Davis, A.L.; Collins, G.J.; Verhoeyen, M.E.; Colquhoun, I.J. J Agric Food Chem 2003, 51,2438-2446. [132] Moco, S.; Bino, R.J.; Vorst, O.; Verhoeven, H.A.; de Groot, J.; van Beek, T.A.; Vervoort, J.; de Vos, C.H. Plant Physiol 2006, 141,1205-1218. [133] Bergquist, S. .; Gertsson, U. E.; Knuthsen, Z.P.; Olsson, M. E. J AgricFood Chem 2005, 53, 9459-9464. [134] Pandjatan, N.; Howard, L.R.; Morelock, T.; Gil, M.I. J Agric. Food Chem 2005, 53, 8618-8623. [135] Edenharder, R.; Keller, G.; Platt, K. L.;Unger, K. K. J Agric Food Chem 2001, 49, 2767-2773. [136] Eckey-Kaltenbach, H.; Heller, W.; Sonnenbichler, J.; Zetl, I.; Schaefer, W.; Ernst, D.; Sandermann, H.Jr. Phytochemistry 1993, 34, 687-691. [137] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [138] Lin, L.-Z.; Harnly, J.M. J Pharm Biomed Anal in preparation [139] Matin, A.; Ferrenes, F.; Tomas-Barberan, F.A.; Gil, M.I. J Agric Food Chem 2004, 52, 3861-3869. [140] Materska, M.; Piacente, S.; Stochmal, A.; Pizza, C.; Oleszek, W.; Perucka, I. Phytochemistry 2003, 63, 893-898. [141] Schelz, Z.; Molnar, J.; Fogliano, V.; Ferracane, R.; Pernice, R.; Shirataki, Y.; Motohashi, N. In Vivo 2006, 20, 651-656. [142] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [143] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [144] Greenham, J.; Harborne, J.B.; Williams, C. A. Phytochem Anal 2003, 14, 100-118.
94
[145] Nikolova, M.T.; Grayer, R.J.; Genova, E.; Porter, E.A. Biochem System Ecol 2006, 34, 360-364. [146] Grayer, R.J.G.; Veitch, N.C.; Kite, G.C.; Price, A.M.; Kokubun, T. Phytochemistry, 2001, 56, 559-567. [147] Merken, H.M.; Beecher, G.R. J Chromatogr A 2000, 897,177-184. [148] Vvedenskaya, I.O.; Rosen, R.T.; Guido, J.E.; Russell, D.J.; Mills, K.A.; Vorsa, N. J Agric Food Chem 2004, 52, 188-195. [149] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [150] Charron, C.S.; Clevidence, B.A.; Britz, S.J.; Novotny, J.A. J Agric Food Chem 2007, 55, 5354-5362. [151] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [152] De Simone, F.; Dini, A.; Pizza, C.; Saturnino, P.; Schettino, O. Phytochemistry 1990, 29, 3690-3692. [153] Lin, L.-Z.; Harnly, J.M. J Agric Food Chem, in preparation. [154] Bonaccorsi, P.; Corrado Caristi, C.; Claudia Gargiulli, C.; Leuzzi, U. Food Chemistry, in Press. [155] Taylor, W.G.; Fields, P.G.; Sutherland, D.H. J Agric Food Chem 2007, 55, 5491-5498. [156] Svelikova, V.; Bennett, R.N.; Mellon, F.A.; Needs, P.W.; Piacente, S.; Kroon, P.A.; Bao, Y. Phytochemistry 2004, 65, 2323-2332. [157] Lin, L.-Z.; He, X.-Q.; Lindenmaier, M.; Yang, J.; Cleary, M.; Qiu, S.-X.; Cordell, G.A. J Agric Food Chem 2000, 48, 3541-365. [158] Klejdus, B; Vitamvsov-trbov, D.; Kub, V. Anal Chim Acta 2001, 450, 81-97. [159] Toebes, A.H.W.; Boer, V.D.; Verkleij, J.A.C.; Lingeman, H.; Ernst, W.H.O. J Agri. Food Chem 2003, 53, 4660-4666. [160] Lin, L.-Z.; He, X.-Q.; Lindenmaier, M.; Yang, J.; Cleary, M.; Qiu, S.-X.; Cordell, G.A. J Chromatogr A 2000, 876, 87-95. [161] Matin, A.; Ferrenes, F.; Tomas-Barberan, F.A.; Gil, M.I. J Agric Food Chem 2004, 52, 3861-3869. [162] Materska, M.; Piacente, S.; Stochmal, A.; Pizza C.; Oleszek, W.; Perucka, I. Phytochemistry 2003, 63, 893-898. [163] Eckey-Kaltenbach, H.; Heller, W.; Sonnenbichler, J.; Zetl, I.; Schaefer, W.; Ernst, D.; Sandermann, H.Jr. Phytochemistry 1993, 34, 687-691. [164] de Rijke, E.; Kamter, F.D.; Ariese, F.; Brinkman, U.A.; Gooijer, C. J Sep Sci 2004, 27, 1061-1070. [165] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [166] Rio, D.D.; Stewart, A.J.; Mullen, W.; Burns, J.; Lean, M.E.; Brighenti, F.; Crozier, B. J Agric Food Chem 2004, 52, 2807-15. [167] Rochfort, S.J.; Imsic, M.; Jones, R.; Trenerry, V.C.; Tomkins, B. J Agric Food Chem 2006, 54, 4855-4860. [168] Romani, A.; Vignolini, P.; Isolani, L.; Ieri, F.; Heimler, D. J Agric Food Chem 2006, 54,1342-1346. [169] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [170] Ferreres, F.; Silva, B.M.; Andrade, P. B.; Seabra, R. M.; Ferreira, M. A. Phytochem Anal 2003, 14, 352-359. [171] Han, J.; Ye, M.; Xu, M.; Sun, J.; Wang, B.; Guo, D. J Chromatography B 2007, 848, 355-362.
95
[172] Kong, J.-M.; Chia, L.-S.; Goh, N.-K.; Chia, T.-F.; Brouillard, R. Phytochemistery 2003, 64, 923-933. [173] Konczak, I.; Zhang, W. J. Biomed Biotec 2004, No.5, 239-240. [174] Blando, F.; Gerardi, C.; Nicoletti, I. J Biomed Biotec 2004, No.5, 253-258. [175] Garcia-Beneytes, E.; Cabello, F.; Revilla, E. J Agric Food Chem 2003, 51, 5622-5629. [176] Hillebrand, S.; Schwarz, M.; Winterrhalter, P. J Agric Food Chem 2004, 52, 73317338. [177] Kallithraka, S.; Mohdaly, A.A.-A.; Makris, D.P.; Kefalas, P. J Food Composition and Analysis 2005, 18, 375-386. [178] Kay, C.D.; Mazza, G.; Holub, B.J. J Nutr 2005, 135, 2582-2588. [179] Mt-Riihinen, K.R.; Kamal-Eldin, A.; Trrnen, A.R. J Agric Food Chem 2004, 52, 6178-6187. [180] Mazzuca, P.; Ferrati, P.; Picariello, G.; Chianese, L.; Addeo, F. J Mass Spectrom 2005, 40, 83-90. [181] Nakajima, J.-I.; Tanaka, I.; Seo, S.; Yamazaki, M.; Saito, K. J Biomed Biotec 2004, No.5, 241-247. [182] Wu, X.; Gu, L.; Prior, R.; McKay, S. J Agric Food Chem 2004, 52, 7846-7856. [183] Wu, X.; Prior, R. J Agric Food Chem 2005, 53, 2589-2599. [184] Wu, X.; Prior, R. J Agric Food Chem 2005, 53, 3101-3113. [185] McDougall, G.J.; Fyffe, S.; Dobson, P.; Stewart. D. Phytochemistry 2007, 68, 12851294. [186] Tian. Q.; Konczak, I.; Schwartz, S.J. J Agric Food Chem 2005, 53, 6503-6509. [187] Dini, I.; Tenore, G.C.; Dini, A. J Agric Food Chem 2006, 54, 8733-8737. [188] Abdel-Aal, el-S.M.; Young, J. C.; Rabalski, I. J Agric Food Chem 2006, 54, 46964704. [189] Guo, H.; Ling, W.; Wang, Q.; Liu, C.; Hu, Y.; Xia, M.; Feng, X.; Xia, X. Plant Foods Hum Nutr 2007, 62, 1-6. [190] Zafra-Stone, S.; Yasmin, T.; Bagchi, M.; Chatterjee, A.; Vinson, J.A.; Bagchi, D. Mol Nutr Food Res 2007, 51, 675-683. [191] McGhie, T.K.; Walton, M.C. Mol Nutr Food Res 2007, 51, 702-713. [192] Neto, C.C. Mol Nutr Food Res 2007, 51, 652-64. [193] Ghosh, D.; Konishi, T. Asia Pac J Clin Nutr 2007, 16, 200-208. [194] Bovell-Benjamin, A.C. Adv Food Nutr Res 2007, 52,1-59. [195] Matsui, T.; Ogunwande, I.A.; Abesundara, K.J.; Matsumoto, K. Mini Rev Med Chem 2006, 6, 349-356. [196] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [197] Ju, Z.Y.; Howard, L.R. J Agric Food Chem 2003, 51, 5207-5213. [198] Manthey, J.A.; Grohmann, K.; Guthrie, N. Curr Med Chem 2001, 8, 135-153. [199] Yanez, J.A.; Andrews, P.K.; Davies, N.M. J Chromatogr B 2007, 848, 159-181. [200] Lee, D. Y.-W.; Liu, Y. J Nat Prod 2003, 66, 1171-1174. [201] Lee, J.I.; Hsu, B.H.; Wu, D.; Barrett, J.S. J Chromatogr A 2006, 1116, 57-68. [202] Veitch, N. C. Nat Prod Rep 2007, 24, 417-464. [203] Wuttke, W.; Jarry, H.; Seidlova-Wuttke, D. Ageing Res Rev 2007, 6, 150-188. [204] Rochfort, S.; Panozzo, J. J Agric Food Chem 2007, 55, 7981-94. [205] Nielsen, I.L.; Williamson, G. Nutr Cancer 2007, 57, 1-10. [206] Messina, M.; Kucuk, O.; Lampe, J.W. J AOAC Int 2006, 89, 1121-1134.
96
[207] Cassidy, A.; Hooper, L. J Br Menopause Soc 2006, 12, 49-56. [208] Delmonte, P.; Rader, J.I. J AOAC Int 2006, 89, 1138-1146. [209] Sepehr, E.; Robertson, P.; Gilani, G.S.; Cooke, G.; Lau, B.P. J AOAC Int. 2006, 89, 1158-1167. [210] Ye, M..; Guo, D.; Ye, G.; Huang, C. J Am Soc Mass Spectrom 2005, 16, 234-243. [211] Nagle, D.G.; Ferreira, D.; Zhou, Y.D. Phytochemistry 2006, 67, 1849-1855. [212] Cabrera, C.; Artacho, R.; Gimenez, R. J Am Coll Nutr 2006, 25, 79-99. [213] Cooper, R.; Morre, D.J.; Morre, D.M. J Altern Complement Med 2005, 11, 521-528. [214] Cooper, R.; Morre, D.J.; Morre, D.M. J Altern Complement Med 2005, 11, 639-652. [215] Hosseinian, F.S.; Li, W.; Hydamaka, A.W.; Tsopmo, A.; Lowry, L.; Friel, J.; Beta, T. J Agric Food Chem 2007, 55, 6970-6976. [216] Wu, Q.; Wang, M.; Simon, J. E. Anal Chem 2003, 75, 2440-2444. [217] Gu, L.; Kelm, M.K.; Hammerstone, J.F.; Zhang, Z.; Beecher , G.; Holden, J.; Haytowitz, D.; Prior, R.L. J Mass Spectrmetry 2003, 38, 1272-1280. [218] Gu, L.; Kelm, M.K.; Hammerstone, J.F.; Zhang, Z.; Beecher , G.; Holden, J.; Haytowitz, D.; Prior, R.L. J Agric Food Chem 2003, 51, 7513-7521. [219] Gu, L.; Kelm, M.K.; Hammerstone, J.F.; Beecher , G.; Holden, J.; Haytowitz, D.; Gebhardt, S.; Prior, R.L. J Nutr 2004, 134, 613-617. [220] Prior, R.L.; Gu, L. Phytochemistry 2005, 66, 2264-2280. [221] Shoji, T.; Masumoto, S.; Moriichi, N.; Kanda, T.; Ohtake, Y. J Chromatogr A 2006, 1102, 206-213. [222] Hellstrom, J.; Sinkkonen, J.; Karonen, M.; Mattila, P. J Agric Food Chem 2007 55, 157-164. [223] Karonen, M.; Ossipov, V.; Sinkkonen, J.; Loponen, J.; Haukioja, E.; Pihlaja, K. Phytochem Anal 2006, 17, 149-156. [224] Vrhovsek, U.; Rigo, A.; Tonon, D.; Mattivi, F. J Agric Food Chem 2004, 52, 65326538. [225] Macz-Pop, G. A.; Gonzlez-Params, A.M.; Prez-Alonso, J.J.; Rivas-Gonzalo, J.C. J Agric Food Chem 2006, 54, 536-542. [226] Menet, M.-C.; Sang, S.; Yang, C.S.; Ho, C.-T.; Rosen, R.T. J Agric. Food Chem 2004, 52, 2455-2461. [227] Schijlen, E,G.; Ric de Vos, C.H.; van Tunen, A.J.; Bovy, A.G. Phytochemistry 2004, 65, 2631-2648. [228] Stevens, J.F.; Page, J.E. Phytochemistry 2004, 65, 1317-1330. [229] Go, M.L.; Wu, X.; Liu, X.L. Curr Med Chem 2005, 12, 481-99. [230] Cuendet, M.; Oteham, C.P.; Moon, R.C.; Pezzuto, J.M. J Nat Prod 2006, 69, 460-463. [231] Leung, A.Y.; Foster, S. Encyclopedia of Common Natural Ingredients used in Food, Drugs and Cosmetics; Leung A.Y; Foster, S. Ed.; Second edition, John Wiley & Sons, Inc: New York, NY, 1996 [232] Herrmann, K. Crit Rev Food Sci Nutr 1989, 28, 315-347. [233] Robbins, R.J. J Agric Food Chem 2003, 51, 2866-87. [234] Baderschneider, B.; Winterhalter, P. J Agric Food Chem 2001, 49, 2788-2798. [235] Kweon, M.-H.; Hwang, H.-J.; Sung, H.-C. J Agric Food Chem 2001, 49, 4646-4655. [236] Mt-Riihinen, K., R.; Kamal-Eldin, A.; Trrnen, A.R. J Agric Food Chem 2003, 51, 6736-6744.
97
[237] Mullen, W.; Stewart, A.J.; Lean, M.E.J.; Gardner, P.; Duthie, G.G.; Cgozier, A. J Agric Food Chem, 2002, 44, 5191-5196. [238] Negishi, O.; Negishi, Y.; Yamaguchi, F.; Sugahara, T. J Agric Food Chem, 2004, 52, 5513-5518. [239] Parejo, I.; Jauregui, O.; Snchez-Rabaneda, F.; Viladomat, F.; Bastida, J.; Codina, C. J Agric Food Chem 2004, 52, 3679-3687. [240] Schtz, K.; Kammerer, D.; Carle, R.; Schieber, A. J Agric Food Chem 2004, 52, 40904096. [241] Lin, L.-Z.; Harnly, J. J Chromatogr A, in preparation. [242] Whitaker, B.D.; Stommet, J.R. J Agric Food Chem, 2003, 51, 3448-3454. [243] Zhang, G.; Zhang, F.; Yang, L.; Zhu, E.;Wang, Z.; Xu, L.; Hu, Z. Anal Chim Acta, 2006, 571, 17-24. [244] Clifford, M. N.; Johston, K.L.; Knight, S.; Kuhnert, N. J Agric Food Chem 2003, 51, 2900-2911. [245] Romani, A.; Pinelli, P.; Galardi, C.; Mulinacci, N.; Tattini, M. Phytochem Anal 2002, 13, 79-86. [246] Clifford, M.N.; Stoupi, S.; Kuhnert, N. J Agric Food Chem 2007, 55, 2797-2807. [247] Hou, A.-J.; Pen, L.-Y.; Liu, Y.-Z.; Lin, Z.-W.; Sun, H.-D. Planta Medica, 2000, 66, 624-625. [248] Pawlowska, A.M.; De Leo, M.; Braca, A. J Agric Food Chem 2006, 54, 10234-10238. [249] Manthey, J. A. J Agric Food Chem 2004, 52, 7586-7592. [250] Risch, B.; Hermann, K.; Wray, V. Phytochemistry 1988, 10, 3327-3329. [251] Risch, B.; Hermann, K.; Wray, V.; Grotjahn, L. Phytochemistry 1987, 26, 509-510. [252] Takenka, M.; Yan, X.; Ono, H.; Yoshida, M.; Nagaro, T.; Nakanishi, T. J Agric Food Chem, 2003, 51, 793-796. [253] Baur, S.; Klaiber, R.G.; Koblo, A.; Carle, R. J Agric Food Chem 2004, 52, 7017-7025. [254] Llorach, R.; Toms-barbern, F.A.; Ferrenes, F. J Agric Food Chem, 2004, 52, 51095116. [255] Cai, Y.-Z.; Sun, M.; Zhan, Z.-Q.; Corke, H. J Agric Food Chem 2005, 53, 9940-9948. [256] Kirmizibekmez, H.; Montoro, P.; Piacente, S.; Pizza, C.; Dnmez, A.; Calis, I. Phytochem Anal 2005, 16, 1-6. [257] Bily, A. C.; Burt, A.J.; Ramputh, A-I.; Livesey, J.; Regnault-Roger, C.; Philogene, B. R.; Arnason, J. Phytochem Anal 2004, 15, 9-15. [258] Tolonen, A.; Pakonen, M.; Hohtola, A.; Jalonen, J. Chem Pharm Bull 2003, 51, 467470. [259] Plaza, A.; Montoro, P.; Benavides, A.; Pizza, C.; Piacente, S. J Agric Food Chem, 2005, 53, 2853-2858. [260] Price, K.R.; Casuscelli, F.; Colquhoun, I. J.; Rhodes, M.C. Phytochemistry, 1997, 45, 1683-1687. [261] Tian, S.; Nakamura, K.; Kayahara, H. J Agric Food Chem 2004, 52, 4808-4813. [262] Aaby, K.; Ekeberg, D.; Skrede, G. J Agric Food Chem 2007, 55, 4395-4406. [263] Adams, L.S.; Seeram, N.P.; Aggarwal, B.B.; Takada, Y.; Sand, D.; Heber, D. J Agric Food Chem 2006, 54, 980-985. [264] Rangkadilok, N.; Worasuttayangkurn, L.; Bennett, R.N.; Satayavivad, J. J Agric Food Chem 2005, 53, 1387-1392. [265] Justensen, U. J Chromatogr A 2000, 902, 369-379.
98
[266] Ralet, M.-C.; Andr-Leroux, G.; Qumner, B.; Thibault, J.-F. Phytochemistry 2005, 66, 2800-2814. [267] Mellon, J. E.; Moreau, R. A. J.Agric Food Chem 2004, 52, 6660-6663. [268] Mattila, P., Pihlava, J.-M., Hellstrm, J. J Agric Food Chem 2005, 53, 8290-8295. [269] Grabber, J. H.; Rajph, J.; Hatfield, R.D. J Agric Food Chem 2000, 48, 6106-6113. [270] King, R.R.; Calhoun, L.A. Phytochemistry, 2005, 66, 2468-2473. [271] Schieber, A.; Beradini, N.; Carle, R. J Agric Food Chem 2003, 51, 5006-5011. [272] Milder, I.E.; Arts, I.C.; Venema, D.P.; Lasaroms, J.J.; Wahala, K.; Hollman, P.C. J Agric Food Chem 2004, 52, 4643-4651. [273] Muir, A.D. J AOAC Int 2006, 89,1147-1157. [274] Willfor, S.M.; Smeds, A.I.; Holmbom, B.R. J Chromatogr A 2006, 1112, 64-77. [275] de Jager, L.S.; Perfetti, G.A.; Diachenko, G.W. J Chromatogr A 2007, 1145, 83-88. [276] Elsohly, M.A.; Gul, W.; Avula, B.; Khan, I.A. J AOAC Int 2007, 90, 28-42. [277] Derksen, G.C.; Niederlander, H.A.; van Beek, T.A. J Chromatogr A 2002, 978, 119127. [278] Wang, Y.; Catana, F.; Yang, Y.; Roderick, R.; van Breemen, R.B. J Agric Food Chem 2002, 50, 431-435. [279] Stintzing, F.C.; Schieber, A.; Carle, R. J Agric Food Chem 2002, 50, 2302-2307. [280] Stintzing, F.C.; Herbach, K.M.; Mosshammer, M.R.; Carle, R.; Yi, W.; Sellappan, S.; Akoh, C.C.; Bunch, R.; Felker, P. J Agric Food Chem 2005, 53, 442-451. [281] Ruiz, D.; Egea, J.; Gil, M.I.; Tomas-Barberan, F.A. J Agric Food Chem 2005, 53, 9544-52. [282] Knust, U.; Erben, G.; Spiegelhalder, B.; Bartsch, H.; Owen, R.W. Rapid Commun Mass Spectrom, 2006, 20, 3119-3129. [283] Stratil, P.; Klejdus, B.; Kuban, V. J Agric Food Chem 2006, 54, 607-616. [284] Chassy, A.W.; Bui, L.; Renaud, E.N.; Van Horn, M.; Mitchell, A.E. J Agric Food Chem 2006, 54, 8244-8252. [285] Tabart, J.; Kevers, C.; Pincemail, J.; Defraigne, J.O.; Dommes. J. J Agric Food Chem 2006, 54, 6271-6276. [286] Reyes, L.F.; Cisneros-Zevallos, L. J Agric Food Chem 2007, 55, 6132-6139. [287] Moreno, D.A.; Villora, G.; Ruiz, J.M.; Romero, L. Chemosphere 2003 52, 1031-1040. [288] Dufresne, C. J.; Farnworth, E. R. J. Nutr. Biochem 2001, 12, 404-421. [289] Editorial committee of encyclopedia of Chinese medicinal plants (Editors). Tea leaves (#2159) in Encyclopedia of Chinese Medicinal Plants, Shanghai press of Science and Technology: Shanghai, China, 1999, Vol.3, pp. 565-574. [290] Jie, G.; Lin, Z.; Zhang, L.; Lv, H.; He, P.; Zhao, B. J Agric Food Chem 2006, 54, 80588064. [291] Friedman, M. Mol Nutr Food Res 2007, 51, 116-134. [292] Friedman, M.; Mackey, B. E.; Kim, H.-J.; Lee, I.-S.; Lee, K.-P.; Lee, S.-U.; Kozukue, E.; Kozukue, N. J Agric Food Chem 2007, 55, 243-253. [293] Engelhardt, U.H.; Finger, A.; Kuhr, S. Z Lebensm Unters Forch 1993, 197, 239-44. [294] Si, W.; Gong, J.; Tsao, R.; Kalab, M.;Yang, R.; Yin, Y. J Chromatogr A 2006, 1125, 204-210 [295] Pongsuwan, W.; Fukusaki, E.; Bamba, T.; Yonetan, T.; Yamahara, T.; Kobayashi, A. J Agric Food Chem 2007, 55, 231-236.
99
[296] Del Rio, D.; Stewart, A.J.; Mullen, W.; Burns, J.; Lean, M. E. J.; Brighenti, F.; Crozier, A. J Agric Food Chem 2004, 52, 2807-2815 [297] Stewart, A.J.; Mullen, W.; Crozier, A. Mol Nutr Food Res 2005, 49, 52-60. [298] Menet, M.C.; Sang, S.; Yang, C.S.; Ho, C.-T.; Rosen, R.T. J Agric Food Chem 2004, 52, 2455-2461. [299] Zeeb, D. J.; Nelson, B. C.; Albert, K.; Dalluge, J. J. Anal Chem 2000, 72, 5020-5026. [300] Miketova, P.; Schram, K.H.; Whitney, J.; Li, M.; Huang, R.; Kerns, E.; Valcic, S.; Timmermann, B.N.; Rourick, R.; Klohr, S. J Mass Spectrom 2000, 35, 860-869. [301] Neilson, A.P.; Green, R.J.; Wood, K.V.; Ferruzzi, M.G. J Chromatogr A 2006, 1132, 132-140. [302] Yanagida, A.; Shoji, A.; Shibusawa, Y.; Shindo, H.; Tagashira, M.; Ikeda, M.; Ito, Y. J Chromatogr A 2006, 1112, 195-201. [303] Yao, L.; Caffin, N.; D'Arcy, B.; Jiang ,Y.; Shi, J.; Singanusong, R.; Liu, X.; Datta, N.;, Kakuda, Y.; Xu, Y. J Agric Food Chem 2005, 53, 6477-6483. [304] Mizukami, Y.; Sawai, Y.; Yamaguchi, Y. J Agric Food Chem. 2007, 55, 4957-64. [305] van Beek, TA. Bioorg Med Chem 2005 13, 5001-5012. [306] Gray, D. E .; Upton, R; Chandra, A.; Porter, A.; Harris, R. K. Phytochem. Anal 2006, 17, 56-62. [307] Chen, P.; Ozcan, M.; Harnly, J. Anal Bioanal Chem, 2007, 389, 251-261. [308] Dubber, M.J.; Kanfer, I. J Pharmaceut Sci 2004, 7, 3030-3039. [309] Dubber, M.J.; Sewram, V.; Mshicileli, N.; Shephard, G.S.; Kanfer, I. J Pharm Biomed Anal 2005, 37, 723-731. [310] Hasler, A.; Sticher, O. J Chromatogr1992, 605, 41-48 [311] Mauri, P.; Migliazza, B.; Pietta, P. J Mass Spectrom 1999, 34, 1361-1364. [312] Li, W.; Fitzloff, J.F. J Pharm Biomed Anal 2002. 30, 67-75 [313] Ding, C.; Chen, E.; Zhou, W.; Lindsay, R.C. Anal Chem 2004, 76, 4332-4336 [314] Chen, E.; Ding, C.; Chen, E.; Lindsay, R.C. Anal Chem 2005, 77, 2966-2970. [315] Rimmer,C.A.; Howerton, S.B.; Sharpless, K.E.; Sander, L.C.; Long, S.E.; Murphy, K.E.; Porter, B.J.; Putzbach, K.; Rearick, M.S.; Wise, S.A.; Wood, L.J.; Zeisler, R.; Hancock, D.K.; Yen, J.H.; Betz, J.M.; Nguyenpho, A.; Yang, L.; Scriver, C.; Willie, S.; Sturgeon, R.; Schaneberg, B.; Nelson, C.; Skamarack, J.; Pan, M.; Levanseler, K.; Gray, D.; Waysek, E.H.; Blatter, A.; Reich, E. Anal Bioanal Chem 2007, 389, 179-196. [316] Jensen, A,G.; Ndjoko, K.;Wolfender, J.L.; Hostettmann, K.; Camponovo, F.; Soldati, F. Phytochem Anal 2002, 13, 31-38 [317] Cui, T.;Nakamura, K.; Ma, L.; Li, J.Z.; Kayahara, H. J Agric Food Chem 2005 53, 3882-3887. [318] Oleszek, W.; Amiot, M. J.; Aubert, S.Y. J Agric Food Chem 1994, 42, 1261-1265. [319] Schieber, A.; Keller, P.; Carle, R. J Chromatogr A 2001, 910, 265-73. [320] Ferreira, D.; Guyot, S.; Marnet,N.; Delgadillo, I.; Renard, C. M.; Coimbra, M. A. J Agric Food Chem 2002, 50, 4537-44. [321] Es-Safi, N.E.; Guyot, S.; Ducrot, P.H. J Agric Food Chem 2006, 54, 6969-77. [322] Rychlinska, I.; Gudej, J. Acta Pol Pharm 2002, 59, 53-56. [323] Chen, J.; Wang, Z.; Wu, J.; Wang, Q.; Hu, X. Food Chemistry. 2007, 104, 268-275. [324] Imeh, U.; Khokhar, S. J Agric Food Chem. 2002, 50, 6301-6306. [325] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation.
100
[326] Monagas, M.; Garrido, I.; Lebron-Aguilar, R.; Bartolome, B.; Gomez-Cordoves, C. J Agric Food Chem 2007, 55, 8498-8507. [327] Sang. S.; Lapsley, K.; Rosen, R.T.; Ho, C.T. J Agric Food Chem 2002, 50, 607-609. [328] Wijeratne, S.S.; Abou-Zaid, M.M.; Shahidi, F. J Agric Food Chem 2006, 54, 312-318. [329] Milbury, P.E.; Chen, C.Y.; Dolnikowski, G.G.; Blumberg, J.B. J Agric Food Chem 2006, 54, 5027-5033. [330] Ruiz, D.; Egea, J.; Gil, M.I.; Tomas-Barberan, F.A. J Agric Food Chem 2005, 53, 9544-9552. [331] Chen, C.Y.; Milbury, P.E.; Lapsley, K.; Blumberg, J.B. J Nutr 2005, 135, 1366-1373. [332] Frison-Norrie, S.; Sporns, P. J Agric Food Chem 2002, 50, 2782-2787. [333] Goncalves, B.; Landbo, A.K.; Knudsen, D.; Silva, A.P.; Moutinho-Pereira, J.; Rosa, E.; Meyer, A.S. J Agric Food Chem 2004, 52, 523-530. [334] Kim, D.O.; Heo, H.J.; Kim, Y.J.; Yang, H.S.; Lee, C.Y. J Agric Food Chem 2005 53, 9921-9927. [335] Serrano, M.; Guillen, F.; Martinez-Romero, D.; Castillo, S.; Valero, D. J Agric Food Chem 2005, 53, 2741-2745. [336] Kim D.O.; Chun, O.K.; Kim, Y.J.; Moon, H.Y.; Lee, C.Y. J Agric Food Chem 2003, 51, 6509-6515. [337] Kayano, S.; Yamada, N.F.; Suzuki, T.; Ikami, T.; Shioaki, K.; Kikuzaki, H.; Mitani, T.; Nakatani, N. J Agric Food Chem 2003, 51, 1480-1485 [338] Kayano, S.; Kikuzaki, H.; Yamada, N.F.; Aoki, A.; Kasamatsu, K.; Yamasaki, Y.; Ikami, T.; Suzuki, T.; Mitani, T.; Nakatani, N. Biofactors 2004, 21, 309-913. [339] Lombardi-Boccia, G.; Lucarini, M.; Lanzi, S.; Aguzzi, A.; Cappelloni, M. J Agric Food Chem 2004, 52, 90-94. [340] Rashid, F.; Ahmed, R.; Mahmood, A.; Ahmad, Z.; Bibi, N.; Kazmi, S.U. Arch Pharm Res 2007, 30, 932-937. [341] Olszewska, M. Acta Pol Pharm 2005, 62, 435-441. [342] Del Caro, A.; Piga, A.; Pinna, I.; Fenu, P.M.; Agabbio, M. J Agric Food Chem 2004, 52, 4780-4784. [343] Nakatani, N.; Kayano, S.-I.; Kikuzaki, H.; Sumino, K.; Katagiri, K.; Mitani, T. J Agric Food Chem 2000, 48, 5512-5516. [344] Singh, S.P. Common bean improvement in the twenty-first century; Kluwer, Dordrecht, the Netherlands, 1999; pp. 1-24, and pp. 275-288. [345] Lin, P.Y.; Lai, H.M. J Agric Food Chem 2006, 54, 3807-3814. [346] Ranilla, L,G.; Genovese, M.I.; Lajolo, F. M. J Agric Food Chem 2007, 55, 90-98. [347] Aparicio-Fernades, X.; Garica-Gasca, T.; Yousef, G. G.; Lila, M. A.; Gonzales de Mejia, E.; & Loarca-Pina, G. J Agric Food Chem 2006, 54, 2116-2122. [348] Aparicio-Fernandez, X.; Yousef, G. G.; Loarca-Pina, G.;Gonzales de Mejia, E.; Lila, M. A. J Agric Food Chem 2005, 53, 4615-4622. [349] Beninger, C. W.;Gu, L.; Prior, R.L.; Junk, D.C.; Vandenberg, A.; Bett, K. J Agric Food Chem 2005, 53, 7777-7782. [350] Choung, M.-G.; Choi, B.-R.; An, Y.-N.; Chu, Y.-H.; Cho, Y.-S. J Agric Food Chem 2003, 51, 7040-7043. [351] Diaz-Batalla, L.; Widholm, J.M.; Fahey, Jr.; G.C.; Casano-Tostado, E.; Paredes-Lpez, O. J Agric Food Chem 2006, 54, 2045-2052.
101
[352] Luthria, L.D., & Pastor-Corrales, M.A. (2006). Phenolic acids content of fifteen dry edible bean (Phaseolus vulgaris L.) varieties. J Food Compos Anal 2006, 19, 205-211. [353] Macz-Pop, G.A.; Gonzlez-Params, A.M.; Prez-Alonso, J.J.; Rivas- Gonzalo, J.C. (2006). J Agric Food Chem 2006, 54, 536-542. [354] Romani, A.; Vignolini, P.; Galardi, C.; Mulinacci, N.; Benedettelli, S.; Heimier, D. J Agric Food Chem 2004, 52, 3838-3842. [355] Ferreres, F.; Esteban, E.; Carrena-Ruil, R.; Jimnez, M. A.; Toms-Brnern, F. A. Acylated flavonol sophorotriosides from pea shouts. Phytochemistry 1995, 39, 14431446. [356] Terahara, N.; Honda, T. N.; Hayashi, M.; Ishimaru, K. Biosci Biotechnol Biochem 2000, 64, 2569-2574. [357] Murakami, T.; Kohno, K.; Ninomiya, K.; Matsuda, H.; Yoshikawa, M. Chem Pharm Bull 2001, 49, 1003-1008. [358] Duenas, M.; Sun, B.; Hernndes, T.; Estrella, I.; Sprancger, M.I. J Agric Food Chem 2003, 51, 7999-8004. [359] Chang, Q.; Wong, Y.-S. J Agric Food Chem 2004, 52, 6694-6699. [360] Zallocchi, E.; Pomilio, A.B. Evolution of flavonoids in the phaseolinae. Phytochemistry 1994, 37. 449-453. [361] Webb, D. HerbalGram 2004, 61, 23. [362] Moreno, D.A.; Carvajal, M.; Lopez-Berenguer, C.; Garcia-Viguera, C. J Pharm Biomed Anal 2006, 41, 508-522. [363] Zhang, J.; Satterfield, M.B.; Brodbelt, J.S.; Britz, S.J.; Clevidence, B.; Novotny, J.A. Anal Chem 2003, 75, 6401-6407. [364] Abdel-Farid, I.B.; Kim, H.K.; Choi, Y.H.; Verpoorte, R. J Agric Food Chem 2007, 55, 7936-7943. [365] Rochfort, S.J.; Imsic, M.; Jones, R.; Trenerry, V.C.; Tomkins .B. J Agric Food Chem 2006, 54, 4855-4860. [366] Kim, J.E.; Jung, M.J.; Jung, H.A.; Woo, J.J.; Cheigh, H.S.; Chung, H.Y.; Choi, J.S. Arch Pharm Res 2002, 25, 621-624. [367] Ferreres, F.; Valentao, P.; Llorach, R.; Pinheiro, C.; Cardoso, L.; Pereira, J.A.; Sousa, C.; Seabra, R.M.; Andrade, P.B. J Agric Food Chem 2005, 53, 2901-2907. [368] Vallejo, F.; Tomas-Barberan, F.A.; Ferreres, F. J Chromatogr A 2004, 1054, 181-193. [369] Ponce, M.A.; Scervino, J.M.; Erra-Balsells, R.; Ocampo, J.A.; Godeas, A.M. Phytochemistry 2004, 65, 3131-3134. [370] Harbaum, B.; Hubbermann, E.M.; Wolff, C.; Herges, R.; Zhu, Z.; Schwarz, K. Agric Food Chem 2007, 55, 8251-8260. [371] Barbieri, G.; Pernice, R.; Maggio, A.; De Pascale, S.; Fogliano, V. Food Chemistry, In Press. [372] Llorach, R.; Gil-Izquierdo, A.; Ferreres, F.; Toms-Barbern, F.A. J Agric Food Chem 2003, 51, 3895-3899. [373] Lin, L.-Z.; Harnly, J. Food Chemistry, in preparation. [374] Masa, A.; Vilanova, M.; Pomar, F. J Chromatogr A 2007, 1164, 291-297. [375] Alcalde-Eon, C.; Escribano-Bailon, M.T.; Santos-Buelga, C.; Rivas-Gonzalo, J. C. J Mass Spectrom 2007, 42, 735-748. [376] Kallithraka, S.; Mamalos, A.; Makris, D.P. J Agric Food Chem 2007, 55, 3233-3239.
102
[377] McCallum, J.L.; Yang, R.; Young, J.C.; Strommer, J.N.; Tsao, R. J Chromatogr A 2007, 1148, 38-45. [378] Castillo-Munoz, N.; Gomez-Alonso, S.; Garcia-Romero, E.; Hermosin-Gutierrez, I. J Agric Food Chem 2007,55, 992-1002. [379] He, J.; Santos-Buelga, C.; Silva, A.M.; Mateus, N.; de Freitas, V. J Agric Food Chem 2006, 54, 9598-9603. [380] Mattivi, F.; Guzzon, R.; Vrhovsek, U.; Stefanini, M.; Velasco, R. J Agric Food Chem 2006, 54, 7692-7702. [381] Maier, T.; Sanzenbacher, S.; Kammerer, D.R.; Berardini, N.; Conrad, J.; Beifuss, U.; Carle, R.; Schieber, A. J Chromatogr A 2006, 1128, 61-67. [382] Lee, J.H.; Johnson, J.V.; Talcott, S.T. J Agric Food Chem 2005, 53, 6003-6010. [383] Flamini, R. Mass Spectrom Rev 2003, 22, 218-250. [384] Flamini, R.; Panighel, A. Mass Spectrom Rev 2006, 25, 741-774. [385] Canton, E.; Espin, J.C.; Tomas-Barberan, F.A. J Agric Food Chem 2002, 50, 56915696. [386] Rozek, A.; Achaerandio, I.; Almajano, M.P.; Guell, C.; Lopez, F.; Ferrando, M. J Agric Food Chem 2007, 55, 5147-5155. [387] Mateus, N.; Silva, A.M.; Santos-Buelga, C.; Rivas-Gonzalo, J.C.; de Freitas, V. J Agric Food Chem 2002, 50, 2110-2116. [388] Vidal, S.; Meudec, E.; Cheynier, V.; Skouroumounis, G.; Hayasaka, Y. J Agric Food Chem 2004, 52, 7144-7151. [389] Iriti, M..; Rossoni, M.; Borgo, M.; Ferrara, L.; Faoro, F. J Agric Food Chem 2005, 53, 9133-9139. [390] Mullen, W.; Marks, S.C.; Crozier, A. J Agric Food Chem 2007, 55, 3148-3157. [391] Gafner, S.; Bergeron, C.; Batcha, L.L.; Angerhofer, C.K.; Sudberg, S.; Sudberg, E.M.; Guinaudeau, H.; Gauthier, R. J AOAC Int 2003, 86, 453-460. [392] Wang, H.; Race, E.J.; Shrikhande, A.J. J Agric Food Chem 2003, 51, 1839-1844. [393] Wang, Y.; Catana, F.; Yang, Y.; Roderick, R.; van Breemen, R.B. J Agric Food Chem 2002, 50, 431-435 [394] Munoz-Espada, A.C.; Wood, K.V.; Bordelon, B.; Watkins, B.A. J Agric Food Chem 2004, 52, 6779-6786. [395] Gafner, S.; Bergeron, C.; Batcha, L.L.; Angerhofer, C.K.; Sudberg, S.; Sudberg, E.M.; Guinaudeau, H.; Gauthier, R. J AOAC Int 2003, 86, 453-460. [396] Bedir, E.; Manyam, R.; Khan, I.A. Phytochemistry 2003, 63, 977-983. [397] Serrilli, A.M.; Ramunno, A.; Rullo, R.; Ballero, M.; Serafini, M.; Bianco, A. Nat Prod Res 2007, 21, 814-818. [398] Sundaresan, P.R.; Slavoff, S.A.; Grundel, E.; White, K.D.; Mazzola, E.; Koblenz, D.; Rader, J.I. Phytochem Anal 2006, 17, 243-250. [399] Bosisio, E.; Giavarini, F.; Dell'Agli, M.; Galli, G.; Galli, C.L. Food Addit Contam 2004, 21, 407-414. [400] Bergeron, C.; Gafner, S.; Clausen, E.; Carrier, D.J. J Agric Food Chem 2005 53, 30763080. [401] Gafner, S.; Bergeron, C.; Batcha, L.L.; Reich, J.; Arnason, J.T.; Burdette, J.E.; Pezzuto, J.M.; Angerhofer ,C.K. J Nat Prod 2003, 66, 535-537. [402] Awad, R.; Arnason, J.T.; Trudeau, V.; Bergeron, C.; Budzinski, J.W.; Foster, B.C.; Merali, Z. Phytomedicine 2003, 10, 640.
103
[403] Gafner, S.; Bergeron, C.; Batcha, L.L.; Reich, J.; Arnason, J.T.; Burdette, J.E.; Pezzuto, J.M.; Angerhofer, C.K. J Nat Prod 2003, 66, 535-537.403. [404] Hosokawa, K.; Minami, M.; Kawahara, K.; Nakamura, I.; Shibata. T. Planta Med 2000, 66, 270-272. [405] Kim, Y.H.; Jeong, D.W.; Paek, I.B.; Ji, H.Y.; Kim, Y.C.; Sohn, D.H.; Lee, H.S. J Chromatogr B 2006, 844, 261-267. [406] Lin, L.-Z.; Harnly, J.M.; Upton, R. in preparation.
Chapter 2
NUTRITIONAL AND ANTINUTRITIONAL COMPOSITION OF LEGUMES AND FACTORS AFFECTING IT

Demetra Nikolopoulou and Kriton Grigorakis
Hellenic Centre for Marine Research, Agios Kosmas, 16777, Hellinikon, Athens, Greece
ABSTRACT
The present review focuses on presenting the contents of various legumes in nutritional and antinutritional factors. Specifically, their protein, oil, total carbohydrate and ash contents are reviewed. Furthermore, their carbohydrates, i.e. starch (total and resistant), non-starch polysaccharides, dietary fiber, sucrose, raffinose-series oligosaccharides, as mentioned by literature, are described. Also, fatty acid and amino acid composition of legumes, as well as the nutritional value of their proteins are evaluated. Antinutritional factors, such as phytic acid, tannins, lectins, trypsin inhibitors etc. are reviewed. The differences in nutrients and antinutrients of legumes species are discussed. The effect of various intrinsic factors (i.e. varieties, cultivars, biotypes etc.) in the nutritional and antinutritional value of legumes are presented. The influence of culture conditions (crop season and soil characteristics) and environmental factors (meteorological / climatic conditions) are also reviewed. This paper also examines how the usual processing methods (soaking, cooking, pressure-cooking, autoclaving, microwave cooking, roasting, extrusion, irradiation, dehulling and fermentation) affect the nutrients and antinutrients of legumes. The existing literature on the former subjects is used to evaluate the present status of knowledge, to show its areas of weakness, and to present the future perspectives and potential areas of research.
106
INTRODUCTION
Legumes constitute an important human food source. The total world production of pulses was estimated to exceed 176 million tones in 2003, 40 million of which were produced in Africa and more than 63 million in India (Reddy et al., 2003). About 70% of the total world legume production is used for human consumption (Monti & Grillo, 1983). The global production of legumes is presented in Table 1. Large seeded legumes were part of the human diet long before the Neolithic agricultural revolution (Lev et al., 2005). Some 11,000 years ago, humans had first domesticated, among seven plant species, three legumes (pea, lentil and chickpea) (Zohary & Hopf, 2000). It is interesting that, among the so-called founder crops package (Zohary & Hopf, 2000), the chickpea, which was rare and agronomically problematic, was chosen. Kerem et al. (2007) provided evidence that this was due to its nutritive value (its total contents and essential amino acid tryptophan content). Selection of tryptophan was achievable to prehistoric humans through the relation of tryptophan level to increased satiety, accelerated growth and higher brain serotonin levels (regulating sleep-wake rhythm in infants and adults) (Kerem et al., 2007). Among legumes cultivated for human nutrition, some are today broadly cultivated in many countries, while others cultivation is limited in local societies of some poor countries. A minority of wild seeds is also consumed as human food. Chickpeas Cicer arietinum L. are an important food source in southern Europe, Middle East, North Africa and India, but they are also consumed worldwide. Common beans, Phaseolus vulgaris L., are an important part of diets in Latin America, East Africa and India and also in some Mediterranean and Middle Eastern countries (Graham & Ranalli, 1997). Lentils (mainly Lens culinaris) are worldwide an important dietary source for humans. Soybeans are widely cultivated all over the world, but soybean food products are widely used in Eastern Asia. Other worldwide-cultivated legumes for human food are faba beans (Vicia faba), which are mostly consumed in developing countries of Asia and Africa, with China being the largest producer (Duc, 1997). Cowpea (Vigna unguiculata L.) is one of the most widely adapted grain legumes. However, two thirds of its production and more than three-fourths of the production area spreads over the vast Sudan Savana and Sahelian zones of sub-Saharan Africa, while substantial quantities are produced in South America (mostly Brazil), Asia and southwestern regions of North America (Ehlers & Hall, 1997). Pigeon pea or red gram (Cajanus cajan), a tropical bush legume, is widely used as a food source in India, in east and southern Africa and in the Caribbean. Most of its production, more than 90%, originates from India (Muller et al., 1990). Jackbeans (Canavalia spp.) are cultivated mainly in Asia, but also in the West Indies, Africa and Latin America (Sridhar & Seedna, 2006). Velvet bean (Mucuna pruriens) has been traditionally used as food in India, the Philippines, Nigeria, Ghana, Brazil and Malawi (Pugalenthi et al., 2005). Lupins (Lupinus spp.) consumption by humans is generally limited, despite their high protein content and nutritive value, due to their high content of quinolizidine alkaloids that make the seeds bitter and potentially toxic (Friedman, 1996). Other legumes are locally produced and consumed, such as African yam bean (Sphenostylis stenocarpa) that is mainly produced in Central and Western Africa, bambara
Nutritional and Antinutritional Composition of Legumes and Factors Affecting It
107
groundnut (Vigna subterranean) and lima bean (Phaseolus lunatus) cultivated in certain African areas, and Cassia spp. produced in India. A plethora of literature exists regarding the nutrients and the antinutrients in legumes, and therefore it would be very difficult to completely incorporate that information in a single review. Especially extensive attention has been given on the antinutrients of legumes and their importance in human nutrition (Deshpande, 1992). Herein, we will try to give a spherical presentation of the nutrients and antinutrients composition of legumes and the factors affecting it based on a review of the most recent literature covering the last decade. Also a critical evaluation of the current knowledge within these aspects will be attempted.
COMPOSITION OF LEGUMES AND FACTORS AFFECTING IT

The protein in legumes varies considerably, but legumes have generally high protein contents when compared to all other plant foods, thus they are characterized as the poor mans meat (Duranti & Gius, 1997). The lowest protein content, among the most common legumes cultivated for human consumption, have been observed for the common chickpea, being less than 15 % on dry matter basis in some cases (Monti & Grillo, 1983; Mesquita & Giada, 2005). Among all legumes, the soybean is the one with the highest protein content, varying for mature seed from 32 % up to 50 % (Table 2; Karr-Lilienthal et al., 2004). High protein content is one of the main reasons why the soybean is the broadest cultivated legume (Duranti, 2006). Lupins (Lupinus spp.) also have a very high protein content, similar to soybean (Rdriguez-Ambriz et al., 2005), reaching up to 45.4 % (Ruiz & Sotelo, 2001). Another high protein-containing legume is the jackbean Canavalia spp. whose protein levels often exceed 35 % (Rajaman & Janardhanan, 1992; Arun et al., 2003;)
Table 1. List of pulses world production in 2004 according to FAO
Grain legumes Dry beans (including Vigna spp.) Dry broad bean Dry peas Chickpea Cowpea Pigeon pea Lentil Vetch Lupins Soybean
Table adapted from Duranti (2006)
Latin names Phaseolus spp. Vigna spp. Vicia faba Pisum sativum Cicer arietinum Vigna unguiculata Cajanus cajan Lens culinaris Vicia sativa Lupinus spp. Glycine max
World crop production in metric tones x 10-3 1162 255 892 478 350 103 199 99 45 6209
108
Depending on oil content, we could say that soybean is an oilseed, with its oil contents varying from 12.8 % (Obatulu & Osho, 2006) up to 28.5 % (Dardanelli et al., 2006). Two local Nigerian legumes Afzelia africana and Pentsclethra macrophylla are also oilseeds with oil levels higher than 30% (Aja & Madubuike, 1997). All other legumes contain significantly lower oil contents, less than 10 % (Table 2). Among them, higher oil contents have been observed for lupins. Rdriguez-Ambriz et al. (2005) have mentioned ranges of 20%, although most of the literature (Table 2) shows lower oil contents in lupins, not exceeding 15% (Porres et al., 2006). Proximate composition varies considerably not only among the various legumes, but also within the same genus (Table 2). Furthermore, significant compositional differences have been observed even within varieties, cultivars, or genotypes of the same species, for pigeon pea Cajanus cajan (Amarteifio et al., 2002; Fasoyiro et al., 2006; Marinder et al., 2007), chickpea Cicer arietinum (Nikolopoulou et al., 2006), jackbean Canavalia ensiformis (Alejandra et al., 1997), cassia Cassia obtusiflora (Vavidel & Janardhanan, 2005), soybean Glycine max (Vasconcelos et al., 1997; Giami, 2002; Kumar et al., 2006; Obatulu & Osho, 2006; Vasconcelos et al., 2006;), lentil Lens culinaris (Wang & Daun, 2006), narrow-leafed lupin Lupinus angustifolius (Frazer et al., 2005), Bengal bean Mucuna pruriens (Pugalenthi et al., 2005), common bean Phaseolus vulgaris (Yoshida et al., 2005), Tepary bean P. acutifolius (De Mejia et al., 2005), Lima bean P. lunatus (Giami, 2001; Betancur-Ancona et al., 2003), field pea Pisum sativum (Al-Karaki & Erefej, 1999; Hickling, 2003; Yemane & Skjelvg, 2003; Wang & Daun, 2004; Nikolopoulou et al., 2007), African yam bean Sphenostylis stenocarpa (Oniyeike & Omubo-Dede, 2002), faba bean Vicia faba (Hossein & Mortuza, 2006), grass pea Lathyrus sativa (Hanbury et al., 2000), and cowpea Vigna unguiculata (Giami et al., 2001; Ojimelukwe, 2002). The former show that proximate composition of legumes is strongly regulated by genetic factors. The nutritional value of proteins from a large number of legumes (pigeon pea, jackbean, chickpea, common bean, cowpea, faba bean, lentils, lupins, mung bean, pigeon pea, rice bean, soybean, lentil, white lupin, field pea, lima bean, Phaseolus mungo, common bean, faba bean, Vicia angustifolia, cowpea) has been reviewed (Friedman, 1996; Duranti & Gius, 1997; Phillips et al., 2003). The major proteins of legumes can be traditionally classified, based on their solubility properties, into albumins, globulins, and prolamins. Among them, globulins, being storage proteins, are the most abundant legume proteins consisting the 70% of total protein in legumes. (Duranti, 2006) The legumes seed proteins are relatively low in sulphur-containing amino acids and tryptophan. A very rich literature exists on amino acid composition of various legumes and focuses on their deficiencies in sulfur amino acids. Also some literature reviews are available on this subject, although not very recent ones (Monti & Grillo, 1983; Deshpande, 1992; Duranti & Gius, 1997). Chickpea (Cicer arietinum) proteins were found rich in essential amino acids such as isoleucine, lysine, and total aromatic amino acids (El-Adawy, 2002; Hickling, 2003; Iqbal et al., 2006). However, leucine and sulfur amino acids, threonine and valine were slightly deficient when compared to the general nutritional requirements (Table 3). Similar deficiencies have been reported for field peas (Alonso et al., 2000; Yemane & Skjelvg, 2003; Wang & Daun, 2004), soybeans (Vasconcelos et al., 1997; Karr-Lilienthal et al., 2004; Mahmoud et al., 2006; Vasconcelos et al., 2006), and various beans (Phaseolus spp.)
Nutritional and Antinutritional Composition of Legumes and Factors Affecting It
109
(Koehler et al., 1987; Duranti & Gius, 1997; Siddhuraju et al., 2001). The amino acid profile of Lupinus campestris flour is characterized by low methionine and high lysine contents (Rodrguez-Amriz et al., 2005). In all lupins the limiting amino acids are the sulfur ones (methionine and cysteine) (Ruiz & Sotelo, 2001). In lentils Lens culinaris tryptophan was found to be the first limiting amino acid followed by the sulphur containing amino acids (Wanf & Daun, 2006). Pigeon pea Cajanus cajan proteins are deficient in methionine and tryptophan (Friedman, 1996). Canavalia proteins are low in methionine and cysteine and high in lysine (Rajaram & Janardhanan, 1992; Eknayake et al., 1999). Other findings on Canavalia species partly contradict, showing lysine to be the first limiting amino acid in C. virosa and the second limiting amino acid after cysteine and methionine in C. ensiformis and C. gladiata (Siddhuraju & Becker, 2001; Vavidel & Janardhanan, 2005). In velvet beans (Mucuna spp.) the contents of threonine, lysine and leucine in black seed coat varieties and phenylalanine and tyrosine in white colored seed coat varieties seem to be deficient (Pugalenthi et al., 2005). Beyond the limiting amino acids the nutritive value of legume proteins is further reduced by low digestibility, low bioavailability of essential amino acids and by the presence of toxic and antinutritional factors (Friedman, 1997; Phillips et al., 2003). It has been shown that the utilization, by non-ruminant mammals, of certain amino acids from legumes is limited (Friedman, 1996). Thus, methionine was not fully available to rats from any of chickpeas, faba beans and lentils, while threonine was not fully available from chickpeas and arginine and lysine was not fully available from faba beans (Combe et al., 1991). The formations of undigestible protein complexes by legume components influence amino acid utilization (Friedman, 1996) and in general legumes show a compact proteolysis-resistant structure of seeds (Duranti & Gius, 1997). The role of antinutritional factors is going to be discussed later. The nutritional deficiency of legumes, due to the low sulfur amino acid levels, can be overcome by the complimentary use of cereal grains. In cereals lysine, present at high levels in legumes, is the limiting amino acid, and sulfur amino acids, deficient in legumes, is contained in high proportions (Friedman, 1996). The complement of legumes and cereals seems to have been known even in Neolithic human populations (Zohary & Hopf, 2000) The fatty acid composition of the most common legumes is presented in table 4. Legumes are rich in polyunsaturated fatty acids (PUFAs) and in particular in linoleic acid (18:2) which in the cases of chickpea, field pea, lentil and Gila bean consist of about 50% of the total fatty acid contents (Siddhuraju et al., 2001; Amir et al., 2007). Polyunsaturated fatty acid are important for human health, seriously contributing to reduction of coronary disease risk and having immunologic and anti-inflammatory effects (Simopoulos, 2002) In general, beyond the linoleic acid the other dominant fatty acids of legumes are palmitic acid (16:0) and oleic acid (18:1). The Canavalia spp. are also rich in linolenic acid (18:3), an essential fatty acid that is converted to eicosapentaenoic (20:5, EPA) and in turn docohexaenoic acid(22:6, DHA) (Sridhar & Seena, 2006). The carbohydrates of legumes can be classified into low-molecular weight carbohydrates, which include mono- di and oligosaccharides, and polysaccharides (Asp, 1996). The main form of oligosaccharide met in the legumes is the raffinose series oligosaccharides (RSO). The polysaccharides can be divided into starches, which are linear (amylose) or branched (amylopectin) glucose homopolymers, and non-starch polysaccharides (NSP) (Asp, 1996). The NSP can be divided into dietary fibre (plant cell wall NSP, consisting mainly of cellulose, and a range of heteropolysaccharides withouth -glucosidic linkages) and others (Asp, 1996; Englyst & Hudson, 1996).
Table 2. Proximate composition of various legumes used for human foods, from various regions in the world
Scientific name Afzelia africana Atylosia scarabaeoides Brachystegia eurycoma Cajanus cajan Common name Crude protein 15.016.6 17.3 8.7510.0 11.8 19.021.7 19.924.0 21.926.1 29.3 14.9 29.6 13.2718.5 19.824.4 Oil 37.139.5 4.56 11.513.0 5.87 1.2-1.3 0.870.98 1.912.70 2.36 Starch /CHO Crude fiber 3.505.65 8.21 2.702.90 17.0 9.813.0 Ash 2.52.60 3.18 2.202.30 3.68 3.9-4.3 3.113.31 4.064.60 3.99 Origin Nigeria India Nigeria Nigeria Botswana India Nigeria 2 varieties Venezuela 2 areas, dehulled seeds whole seeds 6 varieties 2varieties, seed flour notes 2 areas, dehulled seeds References Aja & Madubuike, 1997 Arinathan et al., 2003 Aja & Madubuike, 1997 Ajayi et al., 2006 Amarteifio et al., 2002 Maninder et al., 2007 Oloyo, 2004 Fasoyiro et al., 2006 Torres et al., 2007 Monti & Grillo, 1983 Mesquita &Giada, 2005 De Almeida Costa et al., 2006 Nikolopoulou et al., 2006 Christodoulou et al., 2005 El-Adawy, 2002 Iqbal et al., 2006
/57.8
Pigeon pea, Red gram
/48.349.4 41.3/
4.068.30 39.1
Cicer arietinum
Chickpea
5.966.69 4.407.33
/68.43
9.88
2.943.15 2.7 -3.3
Brazil
42.750.8 / 54.0 62.3
13.2
Greece
3x3 (cv. x cult. areas) 1 cv.
23.6 24.0
6.48 5.2
3.82
3.72 3.6
Egypt Pakistan
Scientific name Canavalia cathartica
Common name jackbean
Crude protein 35.5 33.435.5 26.335.0
Oil 1.3 1.31.74 3.265.8
Starch /CHO /52.8 /51.252.8 36.9 /49.253.9
Crude fiber 1.7 7.010.3 5.088.76
Ash 3.08 3.13.34 3.94.64
Origin
notes Seed flour
References Seena et al., 2005 Arun et al., 2003 Bhagya et. al., 2006 Rajaman & Janardhanan, 1992 Siddhuraju & Becker, 2001 Arinathan et al., 2003 Vavidel & Janardhanan, 2005 Aja & Madubuike, 1997 Alejandra et al., 1997 Rajaman & Janardhanan, 1992 Siddhuraju & Becker, 2001 Vavidel & Janardhanan, 2005 Vavidel & Janardhanan, 2004 Eknayake et al., 1999 Arun et al., 2003 Siddhuraju & Becker, 2001
India India
wild, seed flour
C .ensiformis
jackbean
C. gladiata
swordbean
24.626.5 31.4 12.935.0
7.209.60 2.469.31 31.832.8 /61.261.8
7.609.60 8.10 2.059.7
2.0 2.93 3.275.2
Nigeria Venezoula India
2 areas, dehulled seeds 5 genotypes
C. maritima C. virosa
29.2 26.8 34.1 24.9
3.1 2.8 1.7 2.06
/53.2 /33.4 /50.5 32.0/
10.2 33.1 10.2 10.47
4.3 3.9 3.5 3.03
Sri Lanka India India
cotyledon whole seed wild, seed flour
Table 2. Continued
Scientific name Cassia spp. Cassia floribunda C. obtusifolia Common name Cassia Crude protein 32.3 21.7 18.622.9 Oil Starch /CHO 17.6/ /61.0 /60.3 Crude fiber 10.8 6.839.45 Ash Origin Korea S. India S. India 4 assecions notes wild References Shim et al., 2003 Vavidel & Janardhanan, 2005 Vavidel & Janardhanan, 2002 Vavidel & Janardhanan, 2005 Siddhuraju et al., 2001
3.1 5.357.40
3.4 5.145.83
Entada phaseoloides Merril Glycine max
Gila bean
34.1*
7.16*
8.53*
2.49*
India
soybean
32.6 36.048.5 19.723.2 /15.840.0
23.3 22.6 3.095.22
Argentina Brazil 5 local cv. (mature) 9 cultivars (mature)
Karr-Lilienthal et al., 2004 Vasconcelos et al., 1997 Karr-Lilienthal et al., 2004 Vasconcelos et al., 2006 Karr-Lilienthal et al., 2004 Karr-Lilienthal et al., 2004 Kumar et al., 2006
44.9 37.539.6 15.422.0
23.4 22.424.9
China India 7x3 (cv. x locations)
Scientific name
Common name
Crude protein 35.642.4
Oil 19.522.3
Starch /CHO /19.826.7
Crude fiber 4.1-4.5
Ash 3.95.69
Origin Nigeria
notes 3 cultivars (mature) 1 cultivar (mature) 5 cv. (green immature)
References Giami, 2002 Obatolu & Osho, 2006
11.615.3 37.1 36.837.1
12.815.3
/6.3-11.3 22.4
5195.74
Nigeria U.S.
Obatolu & Osho, 2006 Karr-Lilienthal et al., 2004 Redondo-Cuenca et al., 2006
Lablab purpureus Lathyrus cicera L. sativus
lablab Flat pod pea vine Chickling pea, grass pea lentil
24.8 21.733.0 26.334.3 25.0 29.3 25.928.7 31.4 22.127.4 26.1 20.6
0.930.98 18.621.7 8.33 0.7-1.4 0.7-5.3
/38.5 /8.9213.3
9.2-9.5 13.716.5 3.21 6.7-7.3 5.310.0
3.083.39 4.725.28 3.99 2.9-3.8 2.0-3.9
various various India various various
Green (immature) Yellow (matured) var. lignosus 4 cultivars 10 cultivars
Arinathan et al., 2003 Hanbury et al., 2000 Hanbury et al., 2000
44.2 41.2
Lens esculenta or Lens culinaris Medic.
Monti & Grillo, 1983 1.0-1.2 1.15 1.2-2.9 3.2 2.15 42.744.8/ 46.2/56.5 /57.762.8 13.515.0 6.75 0.861.38 6.83 2.6-3.0 Canada Egypt India Pakistan Brazil 4 varieties var. Giza9 21 genotypes Wang & Daun, 2006 El-Adawy et al., 2003 Solanki et al., 1999 Iqbal et al., 2006 De Almeida Costa et al., 2006
2.7-5.0 2.8 2.8
Table 2. Continued
Scientific name Lupinus albus Common name White lupin Crude protein 17.0 38.7 32.2 38.1 34.4 30.035.8 33.8 45.4 38.440.5 39.3 41.5 36.7 37.338.8 42.8 40.7 37.2 Oil Starch /CHO Crude fiber Ash Origin notes References Monti & Grillo, 1983 6.0 4.52 14.6 5.4 5.6 4.52 5.79 8.5 5.35 6.80 7.90 5.50 6.29 8.89 14.5 17.1 3.1 3.59 3.51 3.7 3.8 3.3 4.20 3.593.8 4.52 3.51 4.11 3.617.22 4.01 3.59 3.30 Wiryawan, 1997 Brand et al., 2004 Porres et al., 2006 Frazer et al., 2005 Brand et al., 2004 Ruiz & Sotelo, 2001 Ruiz-Lpez et al., 2000 Ruiz & Sotelo, 2001 Brand et al., 2004 Ruiz & Sotelo, 2001 Ruiz-Lpez et al., 2000 Ruiz-Lpez et al., 2000 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001
31.6
L. angustifolius
Narrowleafed lupin
S. Africa Spain U.K. S. Africa Mexico Mexico S. Africa Mexico Mexico Mexico Mexico Mexico Mexico
2 varieties
L. elegans L. exaltatus L. luteus L. madrensis L. mexicanus L. reflexus L. rotundiflorus L. simulans L. splendens Mucuna monosperma M. flagellipes Yellow lupin
/34.6 /31.7 /32.8 /28.0 /32.8 /34.6 /32.6 /35.0 /38.1
24.3 12.9 14.618.5 20.2 15.4 16.8 15.216.6 15.1 14.4 12.7
wild
wild wild wild wild wild wild
24.9
3.77
/39.2
16.5
6.22
Nigeria
whole seeds
Ajayi et al., 2006
Scientific name M. pruriens
Common name Bengal bean, Cow itch cowhage
Crude protein 26.2 24.3 20.3 30.1 21.2 32.4 29.3
Oil 4.6 4.9 2.7 4.34 9.6 5.7 6.4 4.64 37.051.5
Starch /CHO
Crude fiber 7.9 7.0 5.8 7.35
Ash 4.5 3.8 3.5 3.52 2.7 3.6 4.2 3.33 3.665.90
Origin India India India India S. India S. India S. India India Nigeria
notes white bean, var. utilis black bean, var. utilis Red gram bean, var. utilis var. utilis, January
References Pugalenthi et al., 2005
/54.4 /50.6 /51.7
12.1 7.8 8.4 9.68 3.103.65
var. pruriens var. utilis Var. coimbatorensis 2 areas, dehulled seeds
Neonotonia wightii Pentaclethra macrophylla Phaseolus vulgaris
15.1 33.746.5 17.0 39.4 15.920.9 21.423.1 19.323.4 21.5
Siddhuraju & Becker, 2005 Vavidel & Janardhanan, 2005 Vavidel & Janardhanan, 2005 Vavidel & Janardhanan, 2005 Arinathan et al., 2003 Aja & Madubuike, 1997 Monti & Grillo, 1983
Kidneybean, common bean, white bean
1.262.49 2.0-2.5 1.982.12 1.4
/67.9
8.55
3.73.80
Brazil
Japan 43.5/60.7 16.4 3.794.54 Mexico
5 cultivars,
Mesquita & Giada, 2005 De Almeida Costa et al., 2006 Yoshida et al., 2005 De Mejia et al., 2005 Carmona-Garcia et al., 2007 Kahlon et al., 2005
22.2
Unspec.
Table 2. Continued
Scientific name Phaseolus aconitifolins Phaseolus acutifolius Phaseolus lunatus Phasulas aureus Pisum sativum Common name Moth bean Tepary bean Lima bean, butter bean Mung bean Field pea, dry pea, small blue pea Crude protein 23.3 18.921.7 23.827.3 26.4 15.5 39.7 14.721.9 14.528.5 34.7 22.923.5 24.332.5 24.9 24.7 19.3 19.731.7 Oil 0.9 1.564.19 1.5-2.1 1.75 /59.963.4 /53.457.3 53.0/61.2 Starch /CHO Crude fiber 16.3 Ash Origin Unspec. 2.934.07 2.4-2.7 4.50 Mexico Nigeria Egypt 7 genotypes 3 lines 2 locations var. V.C 2010 notes References Kahlon et al., 2005 De Mejia et al., 2005 Giami, 2001 Fasoyiro et al., 2006 El-Adawy et al., 2003 Monti & Grillo, 1983 Mesquita & Giada, 2005 De Almeida Costa et al., 2006 Hickling, 2003 Reichert & MacKenzie, 1982 El-Adawy et al., 2003 Yemane & Skjelvg, 2003 Nikolopoulou et al., 2007 Iqbal et al., 2006 Brand et al., 2004 Alonso et al., 2000 Al-Karaki & Ereifej,1999
2.4-2.7 6.15
1.682.34 1.4 4.09 2.40 1.531.67 0.763.95 1.5 1.23 0.84 0.932.29
/68.3
10.4
2.473.0 2.7-3.3
Brazil
46.059.8 53.9/54.7
5.5
Canada
4.25
Egypt Ethiopia 3.054.06 3.6 3.01 2.7 Greece Pakistan S. Africa Spain Syria
var. Lencolen 2 cultivars 3cv. X 3area x 2 years
33.447.5 45.4 /63.2 33.360.1 8.30 3.31
cv. Ballet 14 cultivars, 2 years
Scientific name Rhynchosia filipes Sphenostylis stanocarpa, L.
Common name
Crude protein 16.92 23.28 20.324.2
Oil 3.77 1.64 2.25.04
Starch /CHO
Crude fiber 10.72 15.19 2.247.20
Ash 4.34 3.20 2.03.86
Origin India ? Nigeria
notes
References Arinathan et al., 2003 Azeke et al., 2007
African yam bean
44.66 /33.661.6
2 varieties
Tamaridus indica Vicia faba
Tsamiya Faba bean, field bean, Horse bean Broad bean
24.3 22.0 37.0 25.5 27.67 27.17 26.0 20.125.8
7.20
/38.3
18.0
1.50
Nigeria
2 varieties whole seeds
Onyeike & Omubo-Dede, 2002 Achinewhu & Akah, 2003 Fasoyiro et al., 2006 Ajayi et al., 2006 Monti & Grillo, 1983
2.7 3.12 3.29 1.38 1.213.71
53.2/ 45.00 46.16 54.2 /20.264.6
15.4 5.67 1.12 13.3 1.022.6
5.1 5.67 5.46 2.79 1.483.6
India Pakistan Pakistan S. Africa Nigeria
genotype VH82-1 local faba (Kalimatar) Exotic faba 4 varieties 3 varieties
Saharan et al., 2002 Hossein & Mortuza, 2006
Vigna unguiculata
Cowpea, crowder pea, blackeyed pea
Brand et al., 2004 Giami et al., 2001 Ojimelukwe, 2002 Achinewhu &Akah, 2003 Ghavidel & Prakash, 2007 Arinathan et al., 2003 Iqbal et al., 2006 Kahlon et al., 2005
V. mungo
Black gram
25.7 28.4 15.9 24.7 22.0
1.16 1.48 4.55 4.8 1.1
38.1 37.0
27.38 22.82 4.56 11.4
3.62 3.47 3.18 4.2
whole dehulled India Pakistan Unspec.
Table 2. Continued
Scientific name V. radiata V. subterranean V. tilobata V. umbellata Common name Green gram mung bean Bambara groundnut Rice bean Crude protein 27.7 29.9 22.1 20.2 18.2 Oil 1.29 1.7 2.02 12.3 0.83 Starch /CHO 46.7 44.8 /55.63 Crude fiber 20.0 15.16 2.31 7.24 21.5 Ash 4.03 3.79 3.97 3.89 5.0 Origin notes whole Dehulled Nigeria India India References Ghavidel & Prakash, 2007 Fasoyiro et al., 2006 Arinathan et al., 2003 Saharan et al., 2002
/50.7
All values are expressed as % of dry matter. * Calculated from the compositional values provided for seed kernel and seed coat and the respective weight percentages of seed kernel and coat.
Table 3. Amino acid composition of legumes (g/16g N)

His 2.2 1.43.4 Ile 3.9 4.15.5 Leu 6.7 7.010.0 Lys 5.9 6.77.7 Cys 1.01.9 Met 1.21.6 Tyr 2.4 3.23.7 Phe 3.5 4.36.6 Thr 3.0 3.13.7 Trp 1.1 0.81.1 Val 3.87 3.66.9 E/NE* 0.63 0.610.69
Broad bean chickpea
Canavalia ensiformis C. gladiata
2.8 2.34.2 3.6 3.1 2.22.8
4.2 3.74.9 3.4 4.5 3.15.0
7.1 6.78.3 5.9 7.7 6.68.3
5.7 4.65.6 4.9 7.5 6.98.2
0.9 0.60.9 1.1 2.2 1.52.0
1.2 0.51.13 1.5
3.3 2.83.5 2.6 7.5 3.23.9
5.2 4.05.0 3.4
4.2 3.33.7 4.0 3.8 3.74.1
1.2 0.81.3 0.9 0.7 0.81.1
4.5 3.84.5 3.6 5.0 4.75.5
0.89 0.770.92 0.89 0.76 0.630.72
C. virosa Cowpea Field pea
0.71.0
4.75.3
Gila bean Green gram Lentil Lupinus campestris Lupinus elegans L. exaltatus
3.8 2.9 2.23.0 3.3
4.2 4.1 4.14.7 4.5 4.5 3.3
7.0 8.0 7.07.8 7.5 7.7 6.0
7.7 7.8 6.57.0 6.4 5.7 5.6
2.03 3.75 0.7 1.2 0.8-3.0 3.1 1.84 2.1 0.7
5.2 5.0 2.6 5.2 5.0-8.0 4.8 6.1 6.1 4.0
3.4 4.0 3.53.8 4.2 4.1 3.7
1.05 1.2 0.7
4.7 3.8 4.85.2 3.6 3.8 3.8
0.59 0.51
1.1 1.2
El-Moniem et al., 2000 Nestares et al., 1996 El-Adawy, 2002 Hickling, 2003** Iqbal et al., 2006 Siddhuraju & Becker, 2001 Eknayake et al., 1999 Siddhuraju & Becker, 2001 Siddhuraju & Becker, 2001 Iqbal et al., 2006 Yemane & Skjelvg, 2003 Alonso et al., 2000 Wang & Daun, 2004 Siddhuraju et al., 2001 Wiryawan, 1997 Iqbal et al., 2006 Wang & Daun, 2006 Rodrguez-Amriz et al.,2005 Ruiz & sotelo, 2001 Ruiz & sotelo, 2001
Table 3. Continued
His L. madrensis L. reflexus L. rotundifolius L. simulans L. splendens Mucuna pruriens Mucuna utilis Soybean Ile 3.9 4.0 3.7 3.6 3.9 9.7 3.85.4 3.75.0 Leu 6.7 6.2 6.6 6.6 6.2 7.8 6.67.0 4.58.6 Lys 4.9 5.3 4.8 5.0 4.8 7.9 5.45.9 5.96.8 Cys 2.2 2.1 1.9 2.1 1.7 0.0 Met Tyr 6.0 5.6 6.0 5.5 5.4 6.1 2.65.2 3.55.0 Phe Thr 3.7 3.6 3.8 3.8 3.2 4.7 3.34.9 3.34.0 Trp 1.4 1.4 1.2 1.2 1.2 2.1 Val 3.8 3.3 4.0 3.6 3.1 5.8 7.58.8 4.65.2 E/NE* Ruiz & sotelo, 2001 Ruiz & sotelo, 2001 Ruiz & sotelo, 2001 Ruiz & sotelo, 2001 Ruiz & sotelo, 2001 Pugalenthi et al., 2005 Pugalenthi et al., 2005 0.74 Vasconcelos et al., 1997 El-Moniem et al., 2000 Karr-Lilienthal et al., 2004 Mahmoud et al., 2006 Vasconcelos et al., 2006
3.7 4.24.8 2.43.0
0.0 0.70.8 1.31.5
7.1 3.7 4.86.1
1.32.0
0.21.6
FAO/WHO suggested Requirement*** 1 yr old 2-5 yrs old 10-12 yrs old adult
* **
1.9 1.9
4.6 2.8 2.8 1.3
9.3 6.6 4.4 1.9
6.6 5.8 4.4 1.6
4.2 2.5 2.2 1.7
7.2 6.3 2.2 1.9
4.3 3.4 2.8 0.9
1.7 1.1 0.9 0.5
5.5 3.5 2.5 1.3
Calculated from the individual amino acids given in each reference. Calculated from amino acids % of dry matter given by the reference. *** According to FAO/WHO, 1991. According to FAO/WHO/UNU, 1985.
Table 4. Fatty acid composition of legumes

C16:0 Palmitic 19.820.4 28.731.9 18.324.5 12.924.5 9.7 16.719.9 15.9 21.3 C16:1 Palmitoleic 0.05-0.5 1.0-1.1 0.3-0.6 0.0-0.22 0.1 2.79 2.02 1.82 C18:0 stearic 1.4-2.5 4.3-5.2 2.0-2.5 1.211.6 4.0 2.743.78 1.92 2.43 C18:1 Oleic 18.220.2 13.314.0 21.622.1 5.837.24 25.0 43.447.4 47.4 38.6 C18:2 Linoleic 55.056.2 42.846.6 47.855.7 18.526.8 58.1 16.316.4 11.6 24.8 C18:3 linolenic 0.4-0.7 2.8-3.6 0.3-1.9 39.758.6 0.1 6.7-7.0 13.3 3.5 C20:0 arachidic 1.4-2.0 1.7-1.8 0.6-1.2 0.1-0.2 1.0 0.760.78 0.83 0.75 0.43 2.642.91 4.08 1.56 O:L 0.320.36 0.290.33 0.390.45 S:U 0.310.32 0.540.63 0.270.38 0.20 0.19 0.320.39 0.29 0.41 References Amir et al., 2007 Amir et al., 2007 Amir et al., 2007 Pirman & Stibilj, 2003* Yoshida et al., 2005** Siddhuraju et al., 2001 Siddhuraju & Becker, 2001 Siddhuraju & Becker, 2001 Siddhuraju & Becker, 2001
Chickpea Field pea Lentil Common bean Gila bean Canavalia gladiata Canavalia ensiformis Canavalia virosa
*
**
Calculated from the individual mg FA / 100g dry sample given by the reference. Calculated from the percentages of individual fatty acids in polar lipid and triacylglycerol fractions and the relative amount of the these fractions.
Table 5. Carbohydrates of legumes. Expressed as percentage on dry mater basis

Total Starch Black gram Bengal gram Canavalia spp. C. cathartica C. ensiformis C. gladiata C. virosis chickpea RS Dietary fibre IDF 11.4 SDF NSP Sucrose raffinose 0.3-0.8 RSO stachyose 0.3-0.8 verbascose 1.12-3.32 Total Rao & Belavady, 1978 Grigowda et al., 2005 Kahlon et al., 2005 Kahlon et al., 2005 Siddhuraju & Becker, 2001 32 24.736.9 31.839.6 36.9 39.453.2 9.0 10.8 11.814.0 9.0 3.394.35 22.6 16.8 21.020.2 13.113.9 0.96 0.82 0.010.86 9.8213.4 15.58 3.6 4.6 Sridhar & Seena, 2006 Siddhuraju & Becker, 2001 Sridhar & Seena, 2006 Eknayake et al., 1999 Siddhuraju & Becker, 2001 Siddhuraju & Becker, 2001 Rao & Belavady, 1978 Farrell & Mannion, 1997 Saura-Calixto et al., 2000 De Almeida Costa et al., 2006 Fialho et al., 2006 Han & Baik, 2006 Nikolopoulou et al., 2006 Amir et al., 2007
25.4
0.8-3.0
0.8-1.8
3.3414.4
Total Starch Common bean 37.341.3
RS
Dietary fibre IDF 15.219.9 SDF
NSP
Sucrose raffinose 0.221.39
RSO stachyose 1.80-4.45 verbascose 0.0-0.25 Total 2.443.68
2.5-4.96
17.70
0.911.14
Cowpea Faba bean 53.2 21.5-25.0 10.916.0 8.719.5 19.96
1.141.51 0.991.37 6.23
0.520.77 0.52
3.00-3.74 1.46
0.30 1.85
4.07 3.78
Kuo et al., 1988 Abdel-Gawad, 1993 Saura-Calixto et al., 2000 Kahlon et al., 2005 De Almeida Costa et al., 2006 Amir et al., 2007 Abdel-Gawad, 1993 Abdel-Gawad, 1993 Farrell & Mannion, 1997 Saharan et al., 2002 Reichert & MacKenzie, 1982 Kuo et al., 1988 Farrell & Mannion, 1997 Saura-Calixto et al., 2000 Alonso et al., 2000 Hickling, 2003 Andersen et al., 2005 Urbano et al., 2005 De Almeida Costa et al., 2006 Han & Baik, 2006 Nikolopoulou et al., 2007 Siddhuraju et al., 2001
Field pea
33.447.5
2.4510.0
17.820.3
0.560.92
1.60-2.31
1.4-2.83
5.07.28
Gila bean
26.2
0.17
1.29
2.49
ND
Table 5. Continued
Total Starch Lentils 38.742.9 RS Dietary fibre IDF 18.919.0 SDF 12.77 0.911.14 NSP Sucrose raffinose 0.400.52 RSO stachyose 1.65-3.74 verbascose 0.45-0.62 Total 2.716.46
3.257.56
Lupins
32.0
40.2
5.21
28.4
1.013.16
0.331.36
3.45-7.26
0.19-3.54
5.2412.3
Mung beans Pigeon peas soybean 46.049.3 7.3412.5 2.114.20
1.291.39 0.922.06 6.427.27
0.39-4.2 0.3-1.8
1.67-2.0 0.72-1.20
2.66-3.5 3.6-6.0
4.72
Abdel-Gawad, 1993 Frias et al., 1996b Saura-Calixto et al., 2000 De Almeida Costa et al., 2006 Wang & Daun, 2006 Amir et al., 2007 Farrell & Mannion, 1997 Ruiz-Lpez et al., 2000 Martnez-Villaluenga et al., 2005 Andersen et al., 2005 Kuo et al., 1988 Rao & Belavady, 1978 Mulimani & Devendra, 1998 Kuo et al., 1988 El-Moniem et al., 2000 Redondo-Cuenca et al., 2006 Pugalenthi et al., 2005
1.292.16
4.18
0.83
5.267.17
Velvet bean
27.8
10.1
0.951.10
1.05-1.22
3.95-4.34
ND: not detected.
Nutritional and Antinutritional Composition of Legumes and Factors Affecting it
125
The non-cellulosic NSP can be classified according to many different criteria, for example in neutral, acidic (containing mainly uronic acid residues) and hemicellulose A, B and C depending on their solubility at various pH. (Asp, 1996) Starch is the polysaccharide, containing only -glucosidic linkages, which quantitatively is the most important digestible carbohydrate. However, for nutritional purposes, it can be divided into rapidly digestible starch (RDS), slowly digestible starch (SDS) and resistant starch (RS) (Englyst & Hudson, 1996). The latter is a fraction that contributes, together with the NSP and oligosaccharides, to the undigestible carbohydrate fraction (Asp, 1996). In table 5 the contents of the various carbohydrate fractions in legumes are presented. Legumes in general are rich in both total carbohydrates and dietary fibre. A strong variability has been observed for the various carbohydrate fractions even within the same legume species, especially regarding the measurement of dietary fibre and NSP. This can be due to either varietal differences or the different methodologies adopted in each case. These different methodology approaches, giving differential results, have been discussed up to a degree (Monte & Maga, 1980; Asp, 1996; Englyst & Hudson, 1996). Starch contents in legumes vary from negligible levels in soybean Glycine max and lupins to more than half of the dry seed weight in some legumes such as peas (Guillon & Champ, 2002). Most starches from grain legumes have relatively high amylose content compared to other starches. Amylose content in legumes starch varies from 24 % of starch in faba bean (Guillon & Champ, 2002) up to 78.4 % in wrinkled peas (Zhou et al., 2004). With some exceptions (sphero-pyramidal starch of winkled peas), morphologically they are kidneylike or ovoid with well-defined shells centered along an elongated hilum (Guillon & Champ, 2002). The starches of various beans Phaseolus vulgaris (Yaez-Farias et al., 1997; Hoover & Ratnayake, 2002; Zhou et al., 2004), beach peas Lathyrus maritimus (Chavan et al., 1999), chickpeas Cicer arietinum (Yaez-Farias et al., 1997; Hoover & Ratnayake, 2002; Huang et al., 2007), cowpeas Vigna unguiculata (Lecuona-Villanueva et al., 2006; Huang et al., 2007), grass peas Lathyrus sativus (Jayakody et al., 2007), lentils Lens culinaris (Hoover & Ratnayake, 2002; Zhou et al., 2004), lima beans Phaseolus lunatus (Ancona et al., 2001), mung beans (Hoover et al., 1997), peas (Hoover & Ratnayake, 2002; Ratnayake et al., 2002; Zhou et al., 2004; Huang et al., 2007; Tetchi et al., 2007) and soybeans Glycine max (Stevenson et al., 2006) have been well characterized. The raffinose series oligosaccharides of various legumes are presented in table 5. Lentils and chickpeas also contain another oligosaccharide (not presented in the table), ciceritol (Gulewicz et al., 2000; Han & Baik, 2006), while lupins also contain small quantities (0.722.27 % of whole seed oligosaccharides) of another oligosaccharide, ajucose (Ruiz-Lpez et al., 2000). Ciceritol is completely absent from peas and soybeans (Han & Baik, 2006). The raffinose series oligosaccharides contents in legumes are known to increase with maturation progress (Frias et al., 1996; Ekvall et al., 2006) and they have been also related to the ability of legumes to survive dry periods (Bailly et al., 2001). Furthermore in peas, they also appear to be dependent on the seed size and density, generally being higher in larger and denser (sinking) peas (Ekvall et al., 2006). Karr-Lilienthal et al. (2005) in a study in 55 soybean processing plants, have shown differentiations in soybean oligosaccharides and total dietary fibre depending on the maturity zone and collection times. However, in all cases, there are serious indications that verbascose, raffinose and stachyose do not follow the same accumulation pattern (Karr-Lilienthal et al., 2005; Ekvall et al., 2006).
126
In general the legumes are rich in dietary firbe, which contents usually exceed 20 % of total dry weight, while in lupins they can reach up to 40% (Farrell & Mannion, 1997). Insoluble fiber is the dominant fraction of fibre (Table 5) and consists more than 90% of the total amount of dietary fiber in beans and lentils (Bednar et al., 2001), as well as in Canavalia spp. (Sridhar & Seena, 2006). The composition of the dietary fibre fraction depends mostly on its localization in the seed coat or the cotyledons (Guillon & Champ, 2002). Dietary fiber is nutritionally one important aspect, due to its beneficial effect on bacterial colon population, its contribution on cholesterol reduction, its ability to absorb bile salt, and to prevent various diverticular degenerative diseases. The recommended daily intake of fiber is between 25 and 50 g (Sridhar & Seena, 2006). Unfortunately, dietary fiber intakes in Western countries only accounts to one third of the required substrates for colonic cell turnover. However, there is a recent tendency among nutritionists to extend the dietary fiber concept to include all the indigestible food constituents (i.e. those that reach the colon). Thus, it has arisen the, nutritionally more useful, concept of indigestible fraction, which includes besides the indigestible fiber, the resistant starch, the indigestible protein, certain polyphenols and other associated compounds (Saura-Calixto et al., 2000). There is a significant difference between the dietary fibre and the indigestible fraction contents, with the latter being sufficient to cover the requirements for the colon health (Table.6). Recent reviews occur concerning the human nutritional and health aspects of legume proteins (Friedman, 1996; Duranti, 2006) and carbohydrates (Guillon & Champ, 2002; Tharanathan & Mahadevamma, 2003) Regarding the mineral contents of legumes, we wont refer to them in detail, but in general legumes are rich in potassium and magnesium and consumption of even small quantities of less than a portion per day is sufficient to cover the adult recommended daily allowance for Mg, P and Fe (Wang & Daun, 2006). These micronutrients contents vary considerably even within each legume species and are strongly affected by their environmental contents (Johnson et al., 2005) Although most breeding programs have been focused on improving the yield of the crops, breeding for protein and fat contents in soybean (Burton, 1997; Scott & Kephart, 1997), for protein contents in faba beans (Duc, 1997), in common beans (Mebrahtu & Mohamed, 2003), and lupins (Monti & Grillo, 1983) and for protein quality in soybean (Burton, 1997) and faba bean (Monti & Grillo, 1983) have been mentioned.
Table 6. Indigestible fraction and total dietary fiber contents of legumes (percent on dry basis)
Indigestible fraction White beans Pinto beans Lentils Chickpeas peas 35.59 43.67 29.15 28.03 42.30 Total dietary fiber 22.98 25.04 21.55 15.27 23.36
The table is adopted from Saura-Calixto et al. (2000).
127
However, the efficiency of these programs is still questionable, since there is recent evidence that selection and breeding in soybean over the last 60 years had no major influence on protein contents and composition, due to limited genetic variation among the parental lines (Mahmoud et al., 2006). These indicate that future research in breeding should focus on these aspects. Since negative correlation between protein content and sulphur amino acids has been observed for various legumes, breeding for increasing sulphur amino acids content is focused on selection for high globulins and albumins that are rich in these amino acids (Monti & Grillo, 1983) Germination period in pigeon pea (Cajanus cajan) was negatively correlated with crude protein and crude carbohydrate, while on the contrary fat, crude fiber and ash increased with germination (Oloyo, 2004). In the same legume, other scientists (Torres et al., 2007) did not find differentiation in total protein, fat and total starch due to germination, but increase of total available soluble sugars and decrease in fiber and ash contents. In both pea, mung bean and lentil, germination time decreased protein, fat and carbohydrates and increased fibre and ash (El-Adawy et al., 2003). Some opposing results have been shown for cowpeas (Vigna unguiculata), where germination significantly increased crude protein, fiber and ash, and decreased fat and carbohydrates (Giami et al., 2001), and in chickpeas (Cicer arietinum) where sprouting increased protein and fat and decreased the nitrogen free extract i.e. the carbohydrates (Khalil et al., 2007). Urbano et al. (2005) found that germination process in peas increased total nitrogen content and soluble non-protein nitrogen content but decreased insoluble nitrogen content and soluble protein content, and this was attributed to severe protein hydrolysis taking place during germination. Also a notable decrease in galactosides, as well as increase of available starch during germination has been mentioned for various legumes (Rao & Belavady, 1978; Urbano et al., 2005; Guillon & Champ, 2002; ). The problem in monitoring and outlining the exact impact of germination in proximate composition of legumes is the different germination conditions and analytical methods mentioned by the various existing studies (Duranti & Gius, 1997). Confirming the former, Phillips et al (2003) have shown that different germination temperature and times have differential effects on sugars and oligosaccharides of cowpeas. However, what is important, beyond any proximate composition changes is that germination in many cases increased the protein digestibility (chickpeas: El-Adawy, 2002; peas: Urbano et al., 2005; beans: Sangronis & Machado, 2007; pigeon peas: Sangronis & Machado, 2007; cowpeas: Phillips et al., 2003) and this could be due to the partial or complete reduction of different antinutrients accompanying germination. In soybean it was shown that several environmental factors, icluding rainfall, temperature and photoperiod can result in differences in protein and oil accretion (Vollmann et al., 2000; Karr-Lilienthal et al., 2004). In specific oil content was positively correlated with temperature and protein increased in high temperatures (18 night / 33 day temperature) (Wolf et al., 1982). In agreement to these, in a study with 20 soybean cultivars across 60 locations, Piper & Boote (1999) found that oil concentration increased with cultivation temperature (which ranged from 14.6-28.7 C), approaching a maximum at 28 C. Similarly, in the same study, temperature had a positive effect on protein, although unaccounted variation occurred in protein content, probably due to other factors (photoperiod, water stress or high temperatures during seed fill) (Piper & Boote, 1999).
128
In a six year monitoring of soybean grown in Central Europe, Vollman et al. (2000) attributed a preferential protein synthesis against oil synthesis in years with high temperatures. Furthermore, they related enhanced oil contents to high level of rainfall. Similar results have been mentioned by Dornbos & Mullen (1992). Beyond the effect of temperature in the total oil content, higher temperatures during seed development in soybean have been associated with significant decreases in linoleic and linolenic acids and increase in oleic acid content (Oliva et al., 2006) Similarly to soybean, high temperatures and low rainfall has been related to elevated protein contents in field peas (Al-Karaki & Ereifej, 1999; Nikolopoulou et al., 2007). Furthermore, water stress during seed filling resulted into 48% starch reduction, 46% protein reduction, 46% fat reduction, and 67% fiber reduction in Kabuli type chickpeas and in 25%, 40%, 39 %, and 35% respective reductions in Desi type chickpeas (Nayyar et al., 2006). The same study showed accumulation of soluble sugars in the stressed seeds. Similarly, drought stress during the seed development reduced starch contents and increased soluble sugar contents in common bean, while soluble protein and amino acids contents were not affected (Kigel, 1999). However, in another study, conducted under the same conditions and in the same place with that of Nikolopoulou et al. (2007), meteorological changes between the years had no effect on the protein content of chickpeas (Nikolopoulou et al., 2006). Some opposing results have associated total protein increase, as well as total sugars increase, in chickpea, common bean and lentil, with higher rainfall (Amir et al., 2007). These differences possibly indicate the differential response of different legumes to environmental changes during growth. Also, most of the studies take into account the total amount of rainfall or the average temperatures, but also time and frequency of rainfall, plus daily and monthly temperature fluctuations can be important factors, often not taken into account. However, further and more systematic research is required to outline these environmental implications. It should be said that beyond specific environmental parameters, like rainfall and temperature, a complicated net of interacting parameters, including year and location (which mainly correspond to different climatic conditions, different phytopathological situations, or cultivation handling, as well as different soil characteristics) and genotype, affects the legumes seed composition. An analytical screening in the U.S. produced soybean, over the years (from 1948 to 1998), showed that for the period 1948-1973, oil concentration in the produced soya was increased, subsequently it decreased from 1974-1982, while thereafter in decreased in certain production areas (Yaklich et al., 2002). The same study showed differences among North Region and South Region-produced seeds, with the latter containing lower oil levels. Also differences were mentioned between maturity groups, with certain ones containing higher oil levels. Regarding the protein contents the former study showed certain years with low protein soybean production. The former scientist attributed these oil and protein differences throughout the years to certain climatic alterations. Similar findings have been reported in Argentina produced soybeans with maturity groups, environment and their interaction affecting the proximate composition (Dardanelli et al., 2006). In particular the maturity group mainly affected oil contents, and this was due to environmental temperature differences for each maturity group, while protein content was affected by maturity group-environment interaction.
129
Location has been correlated with protein content and fatty acid composition in soybean (Vollman et al., 2000; Kumar et al., 2006). Location-related compositional differences for the same cultivars have also been reported for chickpea (Nikolopoulou et al., 2006), field pea (Nikolopoulou et al., 2007) and common bean (Shellie & Hosfield, 1991). These location differences have been attributed to either soil characteristics (Kigel., 1999; Nikolopoulou et al., 2006), soil mechanical composition (Nikolopoulou et al., 2007). Locational variability in composition has also been related to water absorption, corresponding to average temperature and precipitation (Kigel, 1999). Compositional differences have been observed between wild Canavalia cathartica grown in the mangroves and that grown in sand dunes, location differences which have been attributed to environmental or edaphic features prevailing in different biomes (Seena & Sridhar, 2004). Location derived differences have been also mentioned in crude protein and fat of various tropical legume seeds grown in two states in Nigeria (Ajah & Madubuike, 1997). Sudari et al. (2006), who studied the effects of genotype by environment interactions in southeast Europe-cultivated soybean protein and fat contents, found that both traits were more affected by year than by location. Protein content, however, was more sensitive to environmental changes than oil contents. They also concluded that genotype by environment interactions were generally of less importance than effects of genotypes and years for protein and oil contents. Differential responses of genotypes at various specific locations have been mentioned for soybeans (Kumar et al., 2006), with some genotypes tending to be more stable for their protein and oil contents. Infestation in cowpeas significantly reduced their total protein and total fat contents, while increased free fatty acids and peroxide value (Ojimekwe, 2002). It also reduced the prolamin content by more than 25% Time of fodder has been shown to affect fodder yield but not fodder quality (Reddy et al., 2003). On the other hand, Kumar et al. (2005) found that planting date significantly affected the seed quality of soybean. In particular there was an indication that oil and linolenic acid contents declined with delays of planting, while oleic acid increased. Some effect on protein was also observed in the same study. Mycorrhiza and fertilization treatments in faba beans did not have any effects in total protein, but changed protein solubility profiles and had slight effects in globulin and albumin retention (El Fiel et al., 2003). In the contrary, it has been mentioned that application of nitrogen and sulphur, especially when these elements are limited in the soil, increases the protein contents and sulphur amino acids in common bean (Kigel, 1999). Furthermore the availability of nitrogen, and therefore the nitrogen application, has also been positively correlated with protein yield (Paek et al., 1997; Wesley et al., 1998; Vollman et al. 2000), but in some cases associated with poor protein quality (Paek et al., 1997). Application of phosphorus (up to 60 Kg / ha) in legumes improved, not only the fodder yield, but also increased the crude protein and crude fiber of seeds (Reddy et al., 2003).
LEGUMES ANTINUTRIENTS AND FACTORS AFFECTING THEM

Legume seeds contain several antinutritional protein and non-protein compounds. The presence of these antinutritional factors is often the result of an evolutionary adaptation enabling survival and completion of plant life cycle (Duranti & Gius,1997).
130
Antinutritional factors of legumes can be broadly divided into four groups: (a) factors affecting protein utilization and digestion, such as protease inhibitors, lectins and tannins, (b) factors affecting mineral utilization, such as phytates and glucosinolates, (c) antivitamin factors and (d) miscellaneous substances including cyanogens, alkaloids, phytoestrogens and saponins (Francis et al., 2001). The antinutrients reported for various legumes are presented in Table 7.
Table 7. Endogenous anti-nutritional factors reportedly present within legumes seeds (including some non human food legumes)
Legume Cajanus cajan Canavalia gladiata, C. ensiformis Canavalia cathartica, C. maritima Canavalia ensiformis Cassia floribunda, C. obtusifolia, C. spp. Cicer arietinum Dolichus biflorus Dolichus lablab Glycine max Antinutritional factor Protease inhibitors (trypsin, chymotrypsin), phytohaemagglutinins, cyanogens, phytic acid, tannins, amylase inhibitors Protease inhibitors (trypsin, chymotrypsin,, subtilisin), phytohaemagglutinins, cyanogens, saponins, tannins1, canavanine, dihydroxyphenylalanine (L-DOPA)1 Phytohaematogglutinin2 Protease inhibitors (trypsin, chymotrypsin)3, tannins3, saponins3, cyanogens3, canavanine3, alkaloids3 Protease inhibitors (trypsin) 1, phytic acid4, saponins4, tannins1, dihydroxyphenylalanine (L_DOPA)1 Protease inhibitors (trypsin, chymotrypsin), cyanogens, phytic acid, saponins, estrogenic factors, flatulence factor Phytohaemagglutinins5 Protease inhibitors (trypsin, chymotrypsin), phytohaemagglutinins, cyanogens Protease inhibitors (trypsin, chymotrypsin, elastin, papain, insect proteases), phytohaemagglutinins, glucosinolates, phytic acid, saponins, estrogenic factors, flatulence factor, anti-vitamin E factor, anti-vitamin A factor, anti-vitamin D factor, anti-vitamin B 12 factor, allergens Protease inhibitors (trypsin, chymotrypsin), lathyrogens Protease inhibitors (trypsin), phytohaemagglutinins, saponins, cyanogenetic factor6 Mimosin Protease inhibitors (trypsin), cyanogens7, saponins, estrogenic factors, tannins8, quinolizadine alkaloids Protease inhibitors (trypsin)7, phytohaemagglutinins7 cyanogens7, tannins8, alkaloids7 Protease inhibitors (trypsin)7, tannins8, phytohaemagglutinins7, cyanogens7, tannins8, alkaloids7 Protease inhibitors (trypsin)8, tannins8, phytohaemagglutinins8, alkaloids8
Lathyrus sativus Lens culinaris Leucaena leucocephala Lupinus albus Lupinus mexicanus Lupinus reflexus Other lupins (L. elegans, L splendens, L. rotundiflorus, L. simulans, L. madrensis)

Table 7. Continued
Legume Medicago sativa Mucuna pruriens
131
Phaseolus aureus Phaseolus coccineus Phaseolus lunatus Phaseolus mungo Phaseolus vulgaris
Pisum sativum Psosphocarpus tetragonolobus Sesbania spp. Stizobolium deeringianuum Vicia faba
Antinutritional factor Protease inhibitors (trypsin), saponins, estrogenic factors, antivitamin E factor Protease inhibitors(trypsin)1,9, tannins1,9, phytohaemagglutinins9, cyanigens9, phytic acid9, saponins9, flatulence factor8, dihydroxyphenylalanine (L-DOPA)1,9 Protease inhibitors (trypsin, endopeptidase), phytic acid, saponins, flatulence factor, antithiamin factor Protease inhibitors (trypsin, chymotrypsin), phytohaemagglutinins Protease inhibitors (trypsin, chymotrypsin), phytohaemagglutinins, cyanogens, phytic acid, tannins Protease inhibitors (trypsin, chymotrypsin,, subtilisin), phytic acid Protease inhibitors (trypsin, chymotrypsin, elastin) phytohaemagglutinins, cyanogens, phytic acid, saponins, tannins10, flatulence factor, anti-vitamin E factor, amylase inhibitor, arselins10 Protease inhibitors (trypsin), phytohaemagglutinins, cyanogens, phytic acid, saponins, anti-vitamin E factor Protease inhibitors (trypsin), phytohaemagglutinins Saponins, canavaline Protease inhibitors (trypsin), dihydroxyphenylalanine Protease inhibitors (trypsin, chymotrypsin,thrombin, pronase, papain, microbial proteases) phytohaemagglutinins, phytic acid, tannins, dihydroxyphenylalanine, favism inducing factors (Vicine, Convicine, L-DOPA)6 Phytic acid4, saponins4
Vicia hirsute, V. teterasperma, V. angustifolia Vigna unguiculata Vigna angularis, V. vexilata
Protease inhibitors (trypsin, chymotrypsin), Phytohaemagglutinins, phytic acid, flatulence factor Phytic acid4, saponins4
Adapted from Tacon.(1997), except from: 1. Vavidel & Janardhanan, 2005. 2. Arun et al., 2003. 3. Udedibie & Carlini, 1998. 4. Shim et al., 2003. 5 Jaffe. 6 Monti & Grillo, 1983. 7. Ruiz-Lopez et al., 2000. 8. Ruiz & Sotelo, 2001. 9. Pugalenthi et al., 2005. 10 Kigel, 1999.
132
The protease inhibitors are protein molecules with the ability to cause enzyme inhibition. Protease inhibitors of legumes have been widely investigated (Deshpande, 1992; Liener & Kakade, 1993). The main ones are trypsin and chymotrypsin inhibitors. Aside from reducing protein digestibility, they may cause pancreatic hypertrophy and reduced growth rate due to endogenous protein loss, both resulting from negative feedback control to induce enzyme pancreatic production (Hickling, 2003). Protease inhibitors, on the other hand can have health beneficial effects, i.e. anti-cancer, anti-inflamatory, anti-obesity and anti-degenerative biological activities (Duranti, 2006). Furthermore, once inactivated the protein inhibitors can have positive nutritional effect due to their high content of sulfur-containing amino acids relative to the majority of seed proteins (Duranti, 2006). In table 8 the trypsin inhibitory activity of various legumes is presented. Although numerous studies occur on trypsin-, and at lesser degree chymotrypsin-, inhibitors of various legumes, the results in many cases are not comparable because the expression of the activities can be different, the nature and concentrations of substances are variable etc. (Vavidel & Janardhanan, 2005). In general lectins or haemagglutinins are proteins with carbohydrate specific activity. Most lectins have hemagglutinating activity. Their toxicity is characterized by growth inhibition, by diarrhea, nausea, bloating and vomiting when injected in humans (Duranti & Gius, 1997). Their structure, properties and the antinutritional effects of legume lectins have been well reviewed (Jaffe, 1993; Lis and Sharon, 1998). On the other hand legume lectins can have health beneficial effects, mainly anti-cancer activity and immuno modulation, and these have been recently reviewed (Duranti, 2006). The lectin activity of the majority of legumes is shown in table 8. Polyphenols or condensed tannins are products of secondary plant metabolism. The polyphenolic compounds, mostly concentrated in seed coat, in addition to their sensory association with bitterness, cause reduced protein and amino acid digestibility by forming indigestible linkages with protein and in particular by reacting with lysine and methionine. (Duranti & Gius, 1997; Hickling, 2003). Also tannins decrease carbohydrate digestibility by forming enzyme-resistant complexes with starch (1994). Phenolic compounds also reduce the activity of digestive enzymes such as -amylase, trypsin, chymotrypsin and lipase. They also reduce the absorption of nutrients such as vitamin B12 (Duranti, 2006). However, strong evidence exist on their beneficial role due to their anti-oxidant and anti-mutagenic activities (Dueas et al., 2004; Saxena et al., 2007). In particular the antioxidant activity of plant foods, including legumes, has been correlated to their polyphenol contents (Saxena et al., 2007). Thus, polyphenols have been associated with decreasing incidence of several diseases, e.g. cancer, cardiovascular diseases, hypertension and diabetes (Dueas et al., 2004; Oboh, 2007; Saxena et al., 2007). The health beneficial effects of flavonoids, which is a large group of polyphenolic compounds have been reviewed (Yao et al., 2004). In table 8 are shown the total phenolic compounds contents, as well as the tannin contents of the majority of legumes. Phytates or else inostiol phosphates (inositol tris- tetrakis, pentakis and hexakisphosphate, i.e. IP3 - IP6), are mainly met in two forms; as phytic acid (IP6) and as phytin (phytate salts). Phytates are chelating agents; their antinutitional activity is mainly due to their ability to bind metals (Ca+2, Mg+2, Fe+2, Zn+2, Cu+2), thus leading to their deficient absorption (Morris, 1986). Additionally the formation of protein-phytate complexes causes negative effects on protein utilization (Selle et al., 2000). Also, phytates impact amylase, pepsin and trypsin activity (Urbano et al., 2000). The antinutritional mechanisms of phytate has been reviewed
133
relatively recently (Selle et al., 2000). On the other hand, beneficial effects have been reported for phytic acid (Urbano et al., 2000), such as anticancer function, implication in antineoplasmic ctivity mechanisms, suppression of OH formation through Fe+3 chelation, participation in intracellular inositol phosphate pool and hypocholesterolaemic effect. Other beneficial effects of isolated IP6 have been also reported (Urbano et al., 2000). The phytic acid contents of the most important legumes are presented in table 8. Although tannins and phytic acid have been associated with reduction of bioavailability of Ca, Fe and Zn (Frossard et al., 2000), in practice in various cooked legumes, phytic acid and tannins were not shown to have any effect on iron availability (Brazaca & Da Silva) Glucosinolates or thioglucosides are J-D-thioglucose containing glycosides. Although they are not harmful per se, on enzymatic hydrolysis (due to the release of myrosinase endogenously occurring in the plant) they produce toxic constituents which are goitrogenic (i.e. antithyroid agents) and growth inhibitors. These toxic products include goitrin, isothiocyanates, thiocyanate ions and nitriles (Tacon, 1997). Saponins are non-volatile, amphiphilic compounds, chemically referred to as triterpene glycosides, and consisting of non-polar algynones coupled with one or more sugar chains. On a study in 16 pea varieties, the bitterness of peas has been related to the content of saponins (Heng et al., 2006). Endogenous saponins of soybean have been shown to reduce the protein digestibility by chymotrypsin (Shimoyamada et al., 1998). Although saponins have been shown to produce adverse effect on the growth of non-ruminant animals, some positive effects have also been mentioned (Liener, 1994; Makkar et al., 1997; Pugalenthi et al., 2005). Also complex formation between saponins and other antinutrients could lead to inactivation of both substances toxic effects (Makkar et al., 1995). The saponin contents reported for various legumes are shown in table 9. Cyanogens are compounds that, when hydrolysed, produce toxic products such as hydrogen cyanide and probably other carbonyl compounds that suppress natural respiration and can cause cardiac arrest (Davies, 1991). Thiocyanate, a detoxification product of cyanide has an antithyroid agent action (Francis et al., 2001).Cyanogen contents of legumes as reported by the existing literature are presented in table 9. No cyanogenic glycosides have been detected in various lupin species (Ruiz-Lpez et al., 2000; Ruiz & Sotelo, 2001). Canavanine (2-amino-4-guanidinooxy-butyric acid) is an alkaline toxic free amino acid, which is thermo resistant, and is the structural analogue of L-arginine. Its antinutritional properties is believed to be due to antagonizing L-arginine in protein synthesis, thus acting as antimetabolite in many biological systems (DMello, 1991; Udedibie & Carlini, 1998; Bell, 2003). Canavanine constitutes about 5% of the dry matter weight of jackbean (Udedibie & Carlini, 1998), while in another study it was found to range between 2.02-4.86% in Canavalia ensiformis depending on the genotype (Alejandra et al., 1997). It consists the 2.63 % of dry matter in C. gladiata and the 3.27% in C. virosa (Siddhuraju & Becker, 2001). Lathryrogens are responcible for the so called lathyrism, caused by the consumption of the seeds of certain Lathyrus species, with symptoms of spastic paralysis as a result of neurological lesions of the spinal cord degeneration (Bell, 2003). The substance that has been associated with neurolathyrism is the free amino acid oxalyl di-amino propanoic acid (ODAP), when present in the seed at concentrations in excess of 0.2% (Tadesse & Bekele, 2003). ODAP acts as glutamate agonist in nerve cells. Another potentially toxic free amino acid present in Lathyrus species and at lower concentrations in lentil (Lens culinaris) is lHomoarginine (which basically acts as arginine agonist) (Bell, 2003). Another kind of
134
lathyrism is osteolathyrism, associated to the -N- (-L-glutamyl)aminopropionitrile (glutamyl-BAPN) and - aminopropionitrile (BAPN), free amino acids found in Lathyrus odoratus (sweet pea) and some other Lathyrus species. Their toxicity is exercised by inhibition of the formation of cross linkages between the polypeptide chains during the synthesis of collagen and elastin (Bell, 2003). L-Dopa (3,4-dihydroxyphenylalanine) is a basic nonprotein, toxic amino acid and is responsible for causing skin eruptions and increasing body temperature (Pugalenthi et al., 2005). However, on the other hand, L-DOPA is used in medicine drugs against Parkinson disease. L-DOPA is present in high concentrations in faba beans (Vicia faba) (Liener, 1993). It is also contained in high concentrations ranging from 2.5% up to 8.37 %, in velvet bean Mucuna pruriens (Pugalenthi et al., 2005; Vavidel & Janardhanan, 2005). A 3.28% is contained in the tribal pulse Rhynchosia filipes (Arinathan et al., 2003), while other legumes also contain smaller quantities like Canavalia spp (2.64-2.83%) and Cassia spp. (1.34-1.57%) (Vavidel & Janardhanan, 2005). The antinutritional and pharmacological implications of LDOPA have beeen discussed in detail (Pugalenthi et al., 2005) Other potentially toxic free amino acids present in legumes, and their toxic effects have been reviewed by Bell (2003). Alkaloids are secondary plant metabolites. With some exceptions, they are basic, containing nitrogen in the heterocyclic ring, and are amino acid derivatives. The legumes with the highest quinolizidine alkaloid contents are the lupins (Lupinus spp.). Among the various lupin species, Lupinus reflexus contains the highest contents of sparteine (26.63 g / Kg dry matter), while Lupinus campestris contains the highest contents of lupanine (11.5 g / Kg dry matter) which is the most abundant alkaloid in lupins (Ruiz & Sotelo, 2001). Among three Mexican lupin species, Lupinus mexicanus was found to contain the highest alkaloids contents, i.e. 44 g/ Kg DM, determined as lupanine (Ruiz-Lpez et al., 2000). All these are much higher than the concentration permitted for safe human consumption which is 0.2 g / Kg (Chango et al., 2003) Other alkaloids described in Mucuna spp. are bufotenine, choline, N,N-dimethyltryptonine, 5-oxy-indole-3-alkylamines, indole-3-alkylamine and B-carboline (Pugalenthi et al., 2005) Galactooligosaccharides, mainly raffinose, stachyose and verbascose, which contents in legumes have been formerly discussed, are considered inducers of gastrointestinal disorders, diarrhea and flatulence, inhibiting nutrient uptake (De Lumen, 1992; Fialho et al., 2006) Phytosterols, primarily -sitosterol, campesterol and stigmasterol are integral natural components of the legume cell membranes. Their beneficial biological effects include antiinflammatory anti-oxidative, anti-carcinogenic activities, as well as cholesterol lowering capacity (de Jong et al., 2003; Berger et al., 2004) The highest phytosterol contents have been mentioned for peas, reaching 242 mg/100g (Ryan et al., 2007). The phytosterol contents of some legumes appear in Table 8. Tannins and trypsin inhibitors are absent from Canavalia cathartica (Seena & Sridhar, 2004). There are significant varietal differences in saponin and trypsin inhibitor contents of pigeon peas (Duhan et al., 2001). Also significant varietal differences have been mentioned for tannins and phytic acid of chickpeas (Nikolopoulou et al., 2006), peas (Wang & Daun, 2004; Nikolopoulou et al., 2007) and velvet bean Mucuna pruriens (Pugalenthi et al., 2005). Varietal differences have been shown in Lens culinaris tannin contents (Solanki et al., 1999; Wang & Daun, 2006), phytic acid and trypsin inhibitor activity (Wang & Daun, 2006). The
135
genetic factor in common bean tannin content has been shown by the description of quantitative trait loci associated with tannin (Guzmn-Maldonado et al., 2003). Varietal differences have been also mentioned for total phenolic compounds and isofavons (Kim et al., 2006), phtytic acid (Kumar et al., 2006) and trypsin inhibitor activity (Kumar et al., 2005) of soybean seeds. In narrow-leafed lupin (Lupinus angustifolius) genotype was found to have strong effect on total phenolics, while location had also significant effect on total phenolics (Oomah et al., 2006). In Tepary Bean a strong genetic variability has been observed for tannins, trypsin inhibitors and lectins (De Mejia et al., 2005). In peas variety showed a significant effect on phytic acid, while trypsin inhibitor activity was not influenced by variety (Wang & Daun, 2004). Varietal differences in phytic acid have been explained by the size of the seed (Nikolopoulou et al., 2006). Varietal differences in phenolics-tannins have been attributed to germplast colour (Pugalenthi et al., 2005). Cultivation area and year were found to have siginificant effect on both phytic acid and tannins of chickpeas (Nikolopoulou et al., 2006) and peas (Nikolopoulou et al., 2007). In fifty Lathyrus sativus populations collected from different regions and altitudes in Ethiopia ODAP ranged from 0.149% up to 0.916% (Tadesse & Bekele, 2003). Location and genotype variability has been shown (Wuletaw, 1998). Phytic acid content differences in soybean have been explained on the basis of soil characteristics and temperature (Kumar et al., 2006). In particular alfisollic character of the soil has been related to low phytic acid, due to the unfavourable characteristics for phosphorus mineralization. Also low temperature has been associated with low phytic acid contents. Soil characteristics, and in particular soil phosphorus content, have been correlated to the phytic acid contents of common beans, chick peas and peas (Kigel, 1999; Nikolopoulou et al., 2006; Nikolopoulou et al., 2007). Tannin contents in pea (Nikolopoulou et al., 2007) and Vicia spp. (Berger et al., 1999) have been negatively correlated with the soil clay content. On the other hand solarity has been also mentioned to increase tannin contents in peas (Nikolopoulou et al., 2007). Rainfall has been related to trypsin inhibitor and tannin contents in cowpeas (Oluwatosin, 1999). Environment and in particular light intensity, affects, although not clear how, the L-Dopa contents in velvet beans (Pugalenthi et al., 2005). Environmental conditions seem to have a significant effect on ODAP concentration. Thus, water stress causes increase and salinity a decrease of the toxin (Bell, 2003), while increase has been induced by soil zinc and decrease by soil ferrous ions respectively (Lambein et al., 1994). However, there is evidence that environment plays secondary role to ODAP concentration in comparison to the genotype effect (Hanbury et al., 1999) Breeding for antinutritional factors reduction has been performing for soybeans (Clark & Wiseman, 2000). Also breeding for low tannin and phytic acid in beans have given some improvement for these attributes (Mebrahtu & Mohamed, 2004). Also selection of lupins with low alkaloid contents has been mentioned (Duranti & Gius, 1997).
Table 8. Total tannins, total phenolics, phytic acid, trypsin inhibitor and lectin activity, and phytosterol contents of legumes as mentioned in existing literature
Total tannins (mg/100g) Total phenolics (mg/100g) Phytic acid (mg/100g) Trypsin Inhibitor TIU/mg protein 4.7530.3 Lectin HAU/mg protein Sitosterol (mg/100g) phytosterols Campesterol (mg/100g) Stigmasterol (mg/100g) Duhan et al., 2002 Oloyo, 2004 Fasoyiro et al., 2006 Oboh, 2006 Sangronis & Machado, 2007 Torres et al., 2007 Arun et al., 2003 Seena & Sridhar, 2004 Bhagya et al., 2006 Siddhuraju & Becker, 2001 Vavidel & Janardhanan, 2005 Siddhuraju & Becker, 2001 Arinathan et al., 2003 Vavidel & Janardhanan, 2005 Arun et al., 2003 References
Cajanus cajan
460-1400
0.02-120
480-2400
Canavalia cathartica Canavalia ensiformis
Nd-43.0
14205000 260-1940 1092
Nd
+++ (strong) 40.6
Nd-160
5.7434.34
Canavalia gladiata
Nd-890
15272390
620-868
8.8526.83
80.581.9
Canavalia maritima
Nd
1400
Nd
+++ (strong)
Total tannins (mg/100g)
Total phenolics (mg/100g)
Phytic acid (mg/100g)
Trypsin Inhibitor TIU/mg protein 5.26 16.84 13.48
Lectin HAU/mg protein 40.8
phytosterols Sitosterol (mg/100g) Campesterol (mg/100g) Stigmasterol (mg/100g)
References
Canavalia virosa Cassia floribunda Cassia obtusifolia Cicer arietinum
211 420 600 485-864
1552 410 660
478
12101800
11.90
26.31*
159.4
21.4
23.4
Entada phasoloides Glycine max
401 100-270
2552 2310
1367 173-3520 17.1
0.09
Siddhuraju & Becker, 2001 Vavidel & Janardhanan, 2005 Vavidel & Janardhanan, 2005 Farrell & Mannion, 1997 El-Adawy, 2002 Khalil et al., 2007 Ryan et al., 2007 Siddhuraju et al., 2001 Obatolu & Osho, 2001 Fasoyiro et al., 2006 Kim et al., 2006 Kumar et al., 2006 Solanki et al., 1999 El-Adawy et al., 2003 Ryan et al., 2007 Sangronis & Machado, 2007 Oomah et al., 2006
Lens spp.
20-156
1185
33.3
1273.5*
123.4
15.0
20.0
Lupinus angustifolius
11901470
Table 8. Continued
Total tannins (mg/100g) Total phenolics (mg/100g) Phytic acid (mg/100g) Trypsin Inhibitor TIU/mg protein 2.40* 2.052.15* 2.80* 1.12 1.372.49* 1.82* 2.60* 3.14* 40.762.34 11.518.0 550-720 367-472 Lectin HAU/mg protein phytosterols Sitosterol (mg/100g) Campesterol (mg/100g) Stigmasterol (mg/100g) Ruiz & Sotelo, 2001 Ruiz-Lpez et al., 2000 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Ruiz-Lpez et al., 2000 Ruiz-Lpez et al., 2000 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Ruiz & Sotelo, 2001 Vavidel & Janardhanan, 2005 Pugalenthi et al., 2005 De Mejia et al., 2005 85.1 15.2 86.2 Giami, 2001 Oloyo, 2004 Ryan et al., 2007 References
L. elegans L. exaltatus
270 220
1169
L. madrensis L. mexicanus L. reflexus
160 1663 80 1109
L. rotundiflorus L. simulans L. splendens Mucuna pruriens Phaseolus acutifolius Phaseolus lunatus
70 80 20 30-240
31005960
310-710
14-164
117.61041 592-789
1403.118161.1
Total tannins (mg/100g)
Total phenolics (mg/100g)
Phytic acid (mg/100g)
Trypsin Inhibitor TIU/mg protein 4.1326.8
Lectin HAU/mg protein 8573.1
phytosterols Sitosterol (mg/100g) 86.5 Campesterol (mg/100g) 6.5 Stigmasterol (mg/100g) 41.4
References
Phaseolus vulgaris
17002618
7.80-9.11
Phasulas aureus Pisum sativum
353 50-2016 50.0
635 268-1200
16.5 3.5*31.3*
9696* 18443* 191.4 25.0 26.0
De Mejia et al., 2005 Ryan et al., 2007 Sangronis & Machado, 2007 El-Adawy et al., 2003 Farrell & Mannion, 1997 Alonso et al., 2000 Habiba, 2002 El-Adawy et al., 2003 Hickling, 2003 Urbano et al., 2003 Canniatti-Brazaca, 2006 Nikolopoulou et al., 2007 Ryan et al., 2007 Onyeike & OmuboDede, 2002 Fasoyiro et al., 2006 Oboh, 2006
Sphenostylis stenocarpa
532-899
700
418-505
24.430.8
Table 8. Continued
Total tannins (mg/100g) Total phenolics (mg/100g) Phytic acid (mg/100g) Trypsin Inhibitor TIU/mg protein 9.05 Lectin HAU/mg protein phytosterols Sitosterol (mg/100g) Campesterol (mg/100g) Stigmasterol (mg/100g) Farrell & Mannion, 1997 Saharan et al., 2002 Arinathan et al., 2003 Zia-Ur-Rehman & Shah Fasoyiro et al., 2006 Saharan et al., 2002 Giami et al., 2001 Arinathan et al., 2003 Sinha & Kawatra, 2003 Fasoyiro et al., 2006 Oboh, 2006 References
Vicia faba
1601
750
1012
Vicia trilobata Vigna mungo Vigna subterranean V. umbellata Vigna unguiculata
330 930-1165 647
1270
417 1698 30.0-2080 2018 115-2900
19.1 0.55 12.5
285-380
Calculated by Units / mg sample and sample protein content given by reference.
Table 9. Cyanogenic glucosides, oxalate and saponin contents of legumes

Cyanogenic glucosides (mg/100g) Cajanus cajan Canavalia ensiformis Canavalia gladiata Canavalia virosa Cicer arietinum Entada phasoloides Mucuna pruriens Glycine max Glycine soya Pisum sativum Sphenostylis stenocarpa Vicia faba Vigna umbellata Vigna vexillata Oxalate (mg/100g) 15400 Saponin (mg/100g) 2164-3494 571 813-1005 852 91 3220 1150-1310
0.71
205.2 580 143 129-175 263-361 400-410
70-180 555-576 1313 2168
170.6
Duhan et al., 2001 Oloyo, 2004 Siddhuraju & Becker, 2001 Siddhuraju & Becker, 2001 Arinathan et al., 2003 Siddhuraju & Becker, 2001 El-Adawy, 2002 Siddhuraju et al., 2001 Pugalenthi et al., 2005 Shim et al., 2003 Shim et al., 2003 Heng et al., 2006 Onyeike & Omubo-Dede, 2002 Saharan et al., 2002 Saharan et al., 2002 Shim et al., 2003
Table 10. Effects of Soaking on nutrients and antinutrients in different legume species
Protein Fat Ash Starch Total Dietary Fibre 0-16% increase Tannins Phytic acid Trypsin Inhibitors References
Legumes Common beans
0-6% increase
0-13% increase
0-24% reduction
0-4% increase or 2-19% reduction**
44% reduction
16% reduction
25% reduction
Carmona-Garcia et al., 2007 El-Adawy et al.., 2000 Barampama and Simard, 1995 Jood et al., 1986 Onwuka, 2006 Sinha and Kawatra, 2003 Egounlety and Aworth, 2003 Akinyele and Akinlosotu, 1991 Abd El-Hady and Habiba, 2003 Alonso et al., 2000 Jood et al., 1986 Abd El-Hady and Habiba, 2003 Alonso et al., 1998. Abd El-Hady and Habiba, 2003, Frias et al., 2000 Nestares et al., 1996 Duhan et al., 1989 Jood et al., 1986
Cowpeas
6% increase
1-72% reduction
Faba beans
ns*
3% reduction
4-29% reduction
ns
7-20% reduction or 33% increase** 5-33% reduction
4-18% reduction
5-20% reduction
Peas
ns
5% reduction 10% reduction 14-51% reduction
19-27% reduction 19% reduction
4-11% reduction 3 -16% reduction
2-15% reduction 9-12% reduction
Chickpeas
0-7% increase
Protein
Fat
Ash
Starch
Total Dietary Fibre
Tannins
Phytic acid 6-10% reduction 21% reduction 25-30% reduction 7-23% reduction *** 26% reduction 16-31% reduction 23-37% reduction 30% reduction or 26% increase**
Trypsin Inhibitors ns
References
Kidney beans Lupins Black gram Pigeon peas
ns
3% reduction 18% increase 5% increase 25% reduction 16-43% reduction 7-32% reduction 26% increase
0-20%
Abd El-Hady and Habiba, 2003 Alonso et al., 2000. El-Adawy et al., 2000. Rehman and Shah, 2001 Duhan et al., 1989 Jood et al., 1986 Onwuka, 2006 Duhan et al., 2001, 2002 Jood et al., 1986 Aminigo and Metzger, 2005 Ene-Obong and Obizoba, 1996 Vidal-Valverde et al., 1994 El-Adawy et al.., 2000 Egounlety and Aworth, 2003
2% increase
93% reduction 8-57% reduction 13-25% reduction
Not present
0.3-30% reduction *** 10-19% reduction
African yam bean Lentils Soybeans
0-6% increase
ns
0-15% reduction
0-11% increase
0-28% reduction 34-51% increase
3% increase
24% increase
ns
7% reduction
22% increase
55-69% reduction
ns: non significant. differences in the effects of soaking are due to different varieties of the same species. *** values refer to seeds after soaking and dehulling.
**
Table 11. Effects of Cooking on nutrients and antinutrients in different legume species
Protein Legumes Common beans Fat Ash Starch Total Dietary Tannins Fibre Phytic acid Trypsin Inhibitors Notes References
ns
0-12% 2-4% ns reduction increase or 4-25% reduction 18% 20% 0-47% 7% reduction reduction reduction increase 8-44% 5% reduction reduction 17-63% 16-23% reduction reduction 51% 30% reduction reduction 11-40% reduction 53-88% reduction
ns
raw
Soaked raw
Carmona-Garcia et al., 2007 Marconi et al., 2000 Barampama and Simard, 1995 Jood et al., 1986 Onwuka, 2006 Sinha and Kawatra, 2003 Morris and Hill, 1996
Cowpeas
Soaked Soaked and dehulled
Peas
4-6% reduction 5% ns reduction
18-26% reduction 5% 47-62% reduction reduction 6% reduction
12-26% 24-48% reduction reduction 8-57% 6-9% reduction reduction 44-85% 35-40% reduction reduction
90-100% reduction raw Soaked
Habiba, 2002
Black gram
Rehman. and Shah, 2001 Duhan et al., 1989 Jood et al., 1986
Protein
Fat
Ash
Starch
Total Dietary Tannins Fibre
Phytic acid
Trypsin Inhibitors 54-60% reduction 82-100% reduction
Notes raw
References Alajaji et al., 2006 El-Adawy, 2002 Bhatty et al., 2000 Frias et al., 2000 Nestares et al., 1996 Morris and Hill, 1996 Attia et al., 1994 Duhan et al., 1989 Marconi et al., 2000 Duhan et al., 1989 Jood et al., 1986 Onyeike and OmuboDede, 2001
Chickpeas 1-5% ns reduction or 8-11% increase 0-4% reduction
34-41% 4-7% reduction reduction 1-5% 0-68% reduction reduction 17-21% increase
59-63%* 7-34% reduction reduction 48% 14-29% reduction reduction
Soaked
African 9-10% 27-43% ns yam bean reduction reduction 8% increase Pigeon peas 46-50% reduction 10% 28% 5-10% reduction reduction increase 27% reduction
60-72% reduction 75-100% 30-47% reduction reduction 50-69% 4% reduction reduction 88-100% 84% reduction reduction 35% reduction
86-87% reduction 90-100% reduction 58-91% reduction 91-98% reduction 92-93% reduction 29-39% reduction
raw
Dehulled Azeke et al., 2007 and soaked raw Onwuka, 2006 Duhan et al.,2001,2002 Soaked Jood et al., 1986
Lentils
ns: non significant. * measured as polyphenols.
36-49% increase
Soaked and dehulled 100% Vidal-Valverde et al., reduction 1994
Table 12. Effects of Autoclaving and Pressure Cooking on nutrients and antinutrients in different legume species
Protein Legumes Mucuna beans Chickpeas Fat Ash Starch Total Dietary Tannins Fibre 0-8% increase 0-78% reduction 23% increase 67 77 % reduction 50% reduction Phytic acid 58 65% reduction 22- 41% reduction Trypsin Inhibitors 96 97% reduction 84% reduction Notes
References
Siddhuraju and Becker, 2005 Alajaji et al., 2006 El-Adawy, 2002 Duhan et al., 1989 Jood et al., 1986 Duhan et al., 1989 Jood et al., 1986 Habiba, 2002
8 - 9% increase ns
11 - 14% increase 5% reduction
34 - 41% reduction 4% reduction
Soaked and autoclaved Soaked and autoclaved
Black gram Peas 5-6% reduction ns 3-28% reduction 20-22% reduction
73-76% reduction 18-21% reduction 15-29% reduction
38-43% reduction 3-20% reduction 100% reduction 61-67% reduction
Soaked and autoclaved autoclaved
African yam bean
autoclaved
Onyeike and Omubo-Dede, 2001
Protein Chickpeas 3% reduction
Fat 7% increase
Ash 15% reduction
Starch ns
Total Dietary Tannins Fibre 6% reduction 48% reduction
Phytic acid 38% reduction
Trypsin Inhibitors 80% reduction
Notes Soaked and pressure cooked Pressure cooked Raw Soaked Soaked and dehulled Soaked and pressure cooked Soaked and pressure cooked Soaked and pressure cooked Soaked and pressure cooked
References Khatoon and Prakash, 2004
Cowpeas
ns
ns
16% reduction
7% reduction
26% reduction
10% reduction 22% reduction 39% reduction
Sinha and Kawatra, 2003 Khatoon and Prakash, 2004
Faba beans
ns
17% reduction
7% reduction
9% reduction
ns
Khatoon and Prakash, 2004
Field beans Green gram Horse gram
ns
ns
3% reduction 9% reduction ns
4% reduction ns
Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004
2% increase ns
ns
ns
ns
Table 12. Continued

Protein Lentils ns Fat 17% reduction ns Ash 22% reduction 3% reduction 0 - 6% reduction Starch 16% reduction ns Total Dietary Tannins Fibre ns Phytic acid Trypsin Inhibitors Notes Soaked and pressure cooked Soaked and pressure cooked Absent in raw Absent in raw Dehulled Soaked and pressure cooked pressure cooked 8% reduction 21% reduction 38% reduction 100% reduction " " Pressure cooked raw Soaked Soaked and dehulled
References
Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Seena et al., 2005, 2006.
Common beans Mangrove legume Canavalia cathartica Black gram Pigeon peas
ns
12% increase 34 - 44% reduction
13 - 18% reduction
0 - 20% increase
45 - 86% reduction
Rehman. and Shah, 2001 Duhan et al., 2001, 2002
Table 13. Effect of Microwave Cooking on nutrients and antinutrients in different legume species
Protein Legumes Peas Chickpeas Fat Ash Starch Total Dietary Fibre Tannins Phytic acid Trypsin Inhibitors Notes References
3-4% reduction ns 0-4% reduction
9-15% reduction 0-9% reduction ns 2% reduction or 17-21% increase 12% reduction ns
68-100% reduction 80-83% reduction Soaked
Cowpeas Faba beans
ns ns
ns 9% reduction ns ns ns 17% reduction ns
16% reduction 7% reduction 3% reduction 26% reduction ns 37% reduction 1-25% reduction
5% reduction 11% reduction 4% reduction 8% reduction ns 14% reduction 0-5% reduction
Soaked 57% reduction Soaked
Field beans Green gram Horse gram Lentils Common beans

*
3% reduction 2% increase ns ns ns
2% increase ns ns ns 13% increase or ns* 92% reduction
Soaked Soaked Soaked Soaked Soaked
Habiba, 2002 Hernandea-Infante et al., 1998 Khatoon and Prakash, 2004 Alajaji et al., 2006 Marconi et al., 2000 El-Adawy, 2002 Hernandea-Infante et al., 1998 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Hernandea-Infante et al., 1998 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Khatoon and Prakash, 2004 Marconi et al., 2000
Measured as non-starch polysaccharides.
Table 14. Effects of Extrusion on nutrients and antinutrients in different legume species
Protein Fat Ash Starch Total Dietary Fibre 27% reduction of NDF* Tannins Phytic acid Trypsin Inhibitors Notes References
Legumes Faba beans
10% increase
3% increase
11-54 % reduction 12-25% reduction
0-27% reduction 10-21% reduction 6-14% reduction 11-16% reduction 1-11% reduction 5-11% reduction 1-21% reduction 0-4% reduction
99-100% reduction " 95-100% reduction " 100% reduction " 86-100% reduction "
raw Soaked raw Soaked raw Soaked raw Soaked
asoero et al., 2005 Abd El-Hady and Habiba, 2003 Alonso et al., 2000 asoero et al., 2005 Abd El-Hady and Habiba, 2003 Alonso et al., 2000 Alonso et al., 1998 Abd El-Hady and Habiba, 2003
Peas
0-16% increase ns
0-35% increase ns 0-5% reduction 3% reduction 0-4% reduction 0-7% reduction 2% reduction
4-5% reduction
3%** reduction
16- 90% reduction 13-26% reduction 6-27% reduction 0-7% reduction 4-84*% reduction 17-25% reduction 25% increase
Chickpeas
0-4% reduction 0-5% reduction 0-10% reduction 0-9% reduction ns
Kidney beans
Abd El-Hady and Habiba, 2003 Alonso et al., 2000. asoero et al., 2005
Lupins
22% increase
29% reduction
ns: non significant. * NDF neutral detergent fibre. ** Measured as non-starch polysaccharides.
Table 15. Effects of Dehulling on nutrients and antinutrients in different legume species
Protein Legumes African yambean Cowpeas Fat Ash Starch Total Dietary Fibre 27-50% reduction Tannins Phytic acid Trypsin Inhibitors 53% reduction 42%* reduction ns 10% increase 10% increase ns References
0-4% reduction ns*
0-14% reduction
0-6% 11% reduction reduction
10-17% increase 21%* reduction 6-12% increase 9% increase ns
Azeke et al., 2007 Aminigo and Metzger, 2005 Sinha and Kawatra, 2003 Akinyele and Akinlosotu, 1991 Plahar et al., 1997 Alonso et al., 1998 Booth et al., 2001 Alonso et al., 2000 Booth et al., 2001 Alonso et al., 2000
Peas Faba beans Kidney beans
2-9% increase 12-14% increase 6% increase
9% reduction ns
6% increase 3% reduction
68% reduction of ADF** 73% reduction
11-29% increase 80-92% reduction 90-93% reduction
Chickpeas 3-11% increase Vetch 4% increase Lupins

* *
5-6% increase ns 17% increase
6-11% 8-11% reduction increase ns 3% increase
81% reduction of ADF** 43% reduction of ADF 71% reduction of ADF
11-16%*** reduction
ns
Attia et al., 1994 Booth et al., 2001 Booth et al., 2001 Booth et al., 2001
22% increase
ns: non significant. values refer to cowpeas which were previously soaked. ** ADF: acid detergent fibre. *** measured as polyphenols.
Table 16. Effects of Solid Substrate Fermentation on nutrients and antinutrients in different legume species
Protein Fat Ash Starch Total Dietary Fibre 13% reduction 48% reduction Tannins Phytic acid Trypsin Inhibitors References
Legumes African yambean Chickpeas
4-6% reduction 16-20% increase
14% reduction 7-57% reduction
22% reduction 39-73% reduction
5% increase
100% reduction
Azeke et al., 2007.
Common beans Cowpeas
ns
ns
4% increase
ns
ns 100% reduction 13-54% reduction 0-52% reduction 90-100% reduction 72-83% reduction
Reyes-Moreno, et al., 2004 Paredes-Lopez et al., 1991 Barampama and Simard, 1995 Egounlety and Aworth, 2003 Egounlety and Aworth, 2003 Ruiz-Tern and Owens, 1996
Soybeans
3% reduction
100% reduction
ND: not detected.
153
Germination has a documented effect in legume antinutrients removal, primarily for those antinutrients considered to function as reserve nutrients, e.g. phytates oligosaccharides and up to a degree for other antinutrients (Duranti & Gius, 1997). Phenolics were found to increase drastically in germinated soybean seeds (Kim et al., 2006). Oloyo (2004) has mentioned increase of total phenolics and trypsin inhibitory activity during germination of pigeon pea while phytic acid and oxalate reduced with germination. Tannins on the other hand decreased during the first two days of germination and increased thereafter. On the other hand, tannins were found slightly decreased in 5 days germinated bean Phaseolus vulgaris and pigeon pea (Sangronis & Machado, 2007). Trypsin inhibitors and tannins have initially decreased after 72 hours of germination and subsequently increased (although not reaching initial levels) after 120 hours of germination in mung bean Phasulas aureus, pea and lentil (El-Adawy et al., 2003). Trypsin inhibitor activity was found reduced in 3 days germinated chickpeas (ElAdawy, 2002), in 2 and 4 days germinated pigeon peas (Duhan et al., 2001; Torres et al., 2007) and in 5 days germinated beans Phaseolus vularis and pigeon peas (Sangronis & Machado, 2007), while it was completely destroyed in 8 days germinated chick pea (Bansal et al., 1988). Opposite to these, another study found no change of trypsin inhibitor activity for 3 days germinated peas, and increase for 6 days germinated peas (Urbano et al., 2005). Germination in cowpeas for 72 hours decreased phytic acid to the half of its initial contents and also decreased polyphenol (Sinha & Kawatra, 2003). Drastic reduction of phytic acid and total polyphenols during germination has been also observed for Nigerian cowpea Vigna unguiculata (Giami et al., 2001), for pigeon pea Cajanus cajan (Duhan et al., 2002; Sangronis & Machado, 2007; Torres et al., 2007), common bean (Sangronis & Machado, 2007), mung bean, chickpea (El-Adawy, 2002; Khalil et al., 2007), pea and lentil (El-Adawy et al., 2003). Regarding phytic acid decrease during germination of chickpea, it was found that kabuli type chickpeas followed a much more pronounced reduction than desi type (Khalil et al., 2007). Canavanine rapidly decreases during germination of jackbean (Udedibie & Carlini, 1998) Heamaglutinin activity has decreased with increasing of germination time in mung bean, pea and lentil (El-Adawy et al., 2003) Germination of pigeon pea for 12, 36 and 48 hours had a lowering effect on saponin content, probably due to enzymatic degradation (Duhan et al., 2001). The maximum loss was 15-19 % and it was observed for 48 hours germination. Similarly saponin decrease during germination has been mentioned for peas (Bishnoy & Khetarpaul, 1994). The different analytical methodologies followed for the antinutrients determination, as well as the different germination conditions make comparisons on the effects of germination of various legumes very difficult (Duranti & Gius, 1997).
EFFECTS OF PROCESSING IN LEGUMES NUTRIENTS AND ANTINUTRIENTS

A wide range of processing techniques has been used to increase the utilisation of legumes. The use of legumes is limited due to the presence of antinutritional factors, such as protease inhibitors, lectins, phytate, and tannins, which reduce the bioavailability and digestibility of nutrients, thus lowering their nutritive value. Methods that have been traditionally used or been studied involve mechanical treatments of the legume seeds, heat
154
treatments and other. Their application results in reduction of the content of antinutrients by removing or inactivating them. The most common techniques that have been applied to various legume species are, soaking, cooking (boiling), pressure cooking, autoclaving, microwave cooking, roasting, extrusion, dehulling, fermentation, and radiation to a less extent. Herein an analysis of the effects of various processing techniques on legumes nutrients and antinutrients will be attempted. Regarding the effects of processing methods on the nutrient and antinutrient content of soybeans, a rich literature exists. Therefore only an indicative part of it is considered within the present analysis, in the respective tables. Soaking is one of the traditional methods of processing legumes prior to cooking. It is usually an overnight operation and reduces the time necessary for tenderizing the texture (reduces cooking time more than 50%). Soaking consists of hydration of the seeds and the results obtained depend on factors such as the legume species, variety, duration of soaking, temperature, pH and salinity of the soaking media. Various soaking conditions have been examined in the existing literature for different types of legumes. Soaking for i.e. 6, 12 and 18h has been studied in water, sodium chloride solution (usually 1% w/v), or sodium carbonate solution (0.5-1% w/v). Soaking in general has no affect or slightly increases the protein and fat content of legume species (Table 10). Ash content in most species was either not affected or reduced, except in lupins (5% increase). Considering the carbohydrate content, soaking reduced starch while a small increase was observed for common beans variety, whereas the fibre content was increased by 0 to 26%. The antinutritional factors, tannins, phytic acid contents and trypsin inhibitor in general were reduced. The decrease in these antinutrients after soaking is generally attributed to the internal process of leaching. Heat treatments are applied in order to destroy or inactivate heat-labile antinutritional factors such as lectins, trypsin and chymotrypsin inhibitors and amylase inhibitors (when present), and thus to improve the protein quality of legumes. Cooking in boiling water is a technique often used for legumes in human diet. The duration of cooking of various legumes seeds that have been applied are usually 20min to 3hr, depending on the species. In most studies the cooking process ended when the legume seeds were tender upon finger compression. Cooking resulted in significant reduction and total inactivation of trypsin inhibitors in cases where the seeds had been previously soaked or soaked and dehulled (Table 11). Tannin, phytic acid and ash contents are reduced after cooking in all cases. The effects of cooking on the nutrient composition vary according to literature between different legume species. Another type of cooking that has been used is pressure-cooking. It is usually done in a domestic pressure cooker for i.e. 10, 15 or 30 min at 1, 5 or 15 psi. Autoclaving of various legume species has also been studied at 120-121oC and 15psi for 10, 15, 20 or 35 min. The difference between autoclaving and pressure-cooking is that the latter does not involve a drying cycle. Pre-soaking of legume seeds and autoclaving results in significant decrease in trypsin inhibitor activity (Table 12). Autoclaving and pressure-cooking reduce tannin and phytic acid contents with the highest reduction reported for mucuna beans. Decrease in ash content has been also reported whereas no or slight changes were reported for the other nutrients. Microwave cooking has been studied for few legume species. Some studies have shown that microwave heating has lower impact on nutrient composition in food since preparation time is shorter and less water is used. The legume seeds are usually soaked before and
155
different power has been applied for, i.e., 4, 8, 12 and 15 min. A high percentage (57-100%) of trypsin inhibitors were inactivated (Table 13). Microwave cooking decreased trypsin inhibitors in soybeans by 70 and 96% in raw and soaked seeds, respectively (HernandezInfante et al., 1998). Ash and starch were reduced in most legume species while protein, fat and dietary fibre contents were in most species not affected. Roasting is a heat treatment also used to improve the nutritional quality of legumes. It usually involves heating at 180oC for 20min. Changes in proximate composition and antinutritional factors of seeds of the mangrove wild legume Canavalia cathartica have been studied after roasting and dehulling (Seena et al., 2005, 2006). The crude protein and fiber content of the processed seeds decreased compared to the raw seeds (8-14% and 2-7% reduction, respectively) while the ash content was not affected and the lipid increased up to 19%. As regards to the antinutritional factors no tannins as well as trypsin inhibitor activity were present in raw seeds. However total phenolic content showed a slight increase in roasted seeds. In three varieties of cowpeas the effect of roasting in a hot air oven at 150oC for 35 min was a 35-55% reduction of the tannin content. Further reduction was observed after dehulling of the roasted seeds, reaching 88-92% (Plahar et al., 1997). In the former study it was concluded that roasting destroyed the heat-labile protease inhibitors since the in vitro protein digestibility of cowpeas improved. Another study of the effects of roasting on the protein composition of African yambean showed that this process increased the protein content by 11% (Ene-Obong and Obizoba, 1996). Furthermore, it totally reduced the tannin content whereas phytate was increased by 4%. Extrusion cooking is a heat treatment in which the material is also subjected to intense mechanical shear. Usually a twin-screw extruder has been used and extrusion temperatures mostly applied to legumes were 140, 148, 180oC. The cost of extrusion is lower compared to other heating systems such as baking and autoclaving etc., due to the more efficient use of energy and better control of the process. Results of extrusion are the gelatinisation of starch, denaturation of protein, and inactivation of heat-labile antinutritional factors, therefore increasing the digestibility of starch and protein (Alonso, 2000a and 2000b, Masoero, 2005). As shown in Table 14 extrusion resulted in almost total reduction in trypsin inhibitor activity. Tannin and phytic acid contents were less decreased while no changes or minor reductions were observed in the proximate composition of the seeds. Radiation has been shown to improve the nutritional quality to some extent. Radiation involves the treatment of legumes using gamma irradiation at various dose levels (i.e. 2.5, 5, 7.5, 10, 15, 30, 60 kGy) at room temperature. The effects of radiation in various legume species as reported by El-Neily, 2007, and Farag, 1998 showed no appreciable alterations in the nutrient composition of peas, chickpeas, cowpeas, lentils, kidney beans and soybeans after the applied irradiation dose. However, tannins and phytic acid contents were reduced up to 28 and 38%, respectively. Dehulling is a mechanical treatment, which results in removing antinutritional factors present in the hull of legume seeds such as non-starch polysaccharides and tannins. The hulls contain mostly non-starch polysaccharides which percentage varies within different species and within varieties of the same species (Champ et al., 1986). The main polysaccharides are cellulose, hemicellulose and pectins. Lignin is found in small amounts partly linked to cellulose and non-cellulosic polysaccharides of the cell wall (Knudsen, 1997). Starch and protein are concentrated in the cotyledon of the seeds. Lectins and trypsin inhibitors are the antinutritional factors also concentrated mostly in the cotyledon rather than in the hull, so
156
dehulling is not an effective method for reducing these antinutritional factors (lonso et al., 1998, Andersen R.L. & Wolf W.J., 1995). As shown in Table 15, phytic acid levels were slightly reduced only in cowpeas and trypsin inhibitors decreased in cowpeas and African yam bean. The biggest decrease was observed in tannin and dietary fibre content of the dehulled seeds since these compounds are present mostly in the seeds testa. Solid substrate fermentation is an alternative for processing legumes in order to improve their nutritional quality. It involves the production of Tempeh by the traditional procedure usually used for soybean but currently used for other legume species also. The procedure involves dehulling of the seeds, overnight soaking, cooking and finally inoculation with a mold, usually with different strains of Rhizopus spp, and incubation at temperatures such as 31-36oC for various periods of time (12-72h). Fermentation of the seeds resulted in up to 100% reduction of the antinutritional factors (tannins, phytic acid and trypsin inhibitors) (Table 16). Various processing techniques have been already covered by the existing literature in respect to their impact on legumes nutrients and antinutrients. However, the absence of uniform conditions within the same treatment makes comparisons between legumes not possible. More systematic research on effects of conditions within treatments will be needed in order to allow us to make safer conclusions.
REFERENCES
Abd El-Hady E.A., & Habiba R.A. (2003). Effect of soaking and extrusion conditions on antinutrients and protein digestibility of legume seeds. Lebensm.-Wiss. U.-Technol. 36, 285-293. Abdel-Gawad A.S. (1993). Effect of domestic processing on oligosaccharide content of some dry legume seeds. Food Chem., 46, 25-31. Achinewhu S.C., & Akah G.N. (2003). Chemical, functional and sensory properties of processed African yam beans (Sphenostylis stenocarpa) and cowpeas (Vigna unguiculata). Plant Foods Hum. Nutr., 58, 1-6. Ajah P.O., & Madubuike F.N. (1997). The proximate composition of some tropical legume seeds grown in two states in Nigeria. Food Chem., 59(3), 361-365. Ajayi I.A., Oderinde R.A., Kajogbola D.O., & Uponi J.I. (2006). Oil content and fatty acid composition of some underutilized legumes from Nigeria. Food Chem., 99, 115-120. Akinyele, I.O., & Akinlosotu, A. (1991). Effect of soaking, dehulling and fermentation on the oligosaccharides and nutrient content of cowpeas (Vigna Unguiculata). Food Chemistry, 41, 43-53. Alajaji, S.A., & El-Adawy, T.A. (2006). Nutritional composition of chickpea (Cicer arietinum L.) as affected by microwave cooking and other traditional cooking methods. J. Food Comp.Anal. 19, 806-812. Alejandra O., Ramirez M., & Ortiz De Bertorelli L. (1997). Chemical and nutritional characteristics from grains of five genotypes of Canavalia ensiformis. Archiv. Latinoamer. Nutr., 47(3), 234-236
157
Al-Karaki G.N., & Ereifej K.I. (1999). Relationships between Seed Yield and Chemical Composition of Field Peas Grown Under Semi-arid Mediterranean Conditions. J. Agron. Crop Sci, 182, 279-284 Alonso R., Aguirre A., & Marzo F. 2000b. Effects of extrusion and traditional processing methods on antinutrients and in vitro digestibility of protein and starch in faba and kidney beans. Food Chem., 68, 159-165. Alonso R., Grant G., Dewey P., & Marzo F. (2000). Nutritional assessment in Vitro and in Vivo of Raw and Extruded Peas (Pisum sativum L.). J. Agric. Food Chem., 48, 22862290 Alonso, R., Grant G., Dewey, P. & Marzo F. (2000a) Nutritional assessment in vitro and in vivo of raw and extruded peas (pisum sativum L.). J. Agric. Food Chem. 48, 2286-2290. Alonso, R., Ore, E., & Marzo F. (1998). Effects of extrusion and conventional processing methods on protein and antinutritional factor contents in pea seeds. Food Chem., 63, No.4, 505-512. Amarteifio J.O., Munthali D.C., Karikari S.K., & Morake T.K. (2002). The composition of pigeon peas (Cajanus ajan (L.) Millsp.) grown in Botswana. Plant Foods Hum. Nutr., 57, 173-177. Aminigo, E.R. and Metzger, L.E. (2005). Pretreatment of African yam bean (Sphenostylis stenocarpa): Effect of soaking and blanching on the quality of African yam bean seed. Plant Foods Hum. Nutr. 60, 165-171. Amir Y., Haenni A.L., & Youyou A. (2007). Physical and biochemical differences in the composition of the seeds of Algerian leguminous crops. J. Food Comp. Anal., 20, 466471. Ancona, D.A.B., Guerrero, L.A.C., Matos, R.I.C., & Ortiz, G.D. (2001). Physicochemical and functional characterization of baby lima bean (Phaseolus lunatus) starch. Starch/Staerke, 53, 219-226. Andersen K.E., Bjergegaard C., Mller P., Srensen J.C., & Srensen H. (2005). Compositional Variations for -Galactosides in Different Species of Leguminosae, Brassicaceae, and Barley: A Chemotaxonomic Study Based on Chemometrics and HighPerformance Capillary Electrophoresis. J. Agric. Food Chem., 53, 5809-5817. Andersen, R.L. & Wolf W.J. (1995). Compositional changes in trypsin inhibitors, phytic acid, saponins and isoflavones related to soybean processing. In: Overview of Soybean processing and Products, American Institute of Nutrition, pg 581S- 588S. Arinathan V., Mohan V.R., & De Britto J. (2003). Chemical composition of certain tribal pulses in South India. Int. J. Food Sci. Nutr., 3, 209-217. Arun A.B., Sridhar K.R., Raviraja N.S., Schmidt E., & Jung K. (2003). Nutritional and antinutritional components of Canavalia spp. seeds from the west coast sand dunes of India. Plant Foods Hum. Nutr. 58, 1-13. Asp N.-G. (1996). Deitary carbohydrates: classification by chemistry and physiology. Food Chem., 57(1), 9-14. Attia, R.S., El-Tabey Shehata, A.M., Aman, M.E., & Hamza, M.A. (1994). Effect of cooking and decortication on the physical properties, the chemical compostition and the nutritive value of chickpea (Cicer arietinum L.). Food Chem., 50, 125-131. Azeke M.A., Fretzdorff B., Buening-Pfaue H., & Betsche T. (2007). Nutritional value of African yambean (Sphenostylis stenocarpa, L.): improvement by solid substrate
158
fermentation using the tempeh fungus Rhizopus oligosporus., J.Sc. Food Agric., 87, 297304. Azeke, M.A., Fretzdorff B., Buening-Pfaue, H. & Betsche, T. (2007). Nutritional value of African yambean (Sphenostylis stenocarpa L.): improvement by solid substrate fermentation using the tempeh fungus Rhizopus oligosporus. J. Sci. Food Agric. 87, 297304. Bailly C., Audigier C., Ladonne F., Wagner M.H., Coste F., Corbineau F., & Cme D. (2001). Changes in oligosaccharide content and antioxidant enzyme activities in developing bean seeds as related to acquisition of drying tolerance and seed quality. J. Exper. Botany, 52(357), 701-708. Bansal K.K., Dhindsa K.S., & Batra V.I.P. (1988). Trypsin inhibitor and haemagglutinin activities in chick pea (Cicer arietinum L.). J. Food Sci. Technol., 25, 46-48. Barampama, Z., & Simard, R. (1995). Effects of soaking, cooking and fermentation on composition, in-vitro starch digestibility and nutritive value of common beans. Plant Foods Hum. Nutr. 48, 349-365. Bednar G.E., Patil A.R., Murray S.M., Grieshop C.M., Merchen N.R., & Fahey G.C. (2001). Starch and fiber fractions in selected food and feed ingredients affect their small intestinal digestibility and fermentability and their large bowel fermentability in vitro in a canine model. J. Nutr., 131, 276-286. Bell E.A., Nonprotein Amino Acids of Plants: Significance in Medicine, Nutrition, and Agriculture. J. Agric. Food., Chem., 51, 2854-2865. Berger A., Jones P.J.H., & Abumweiss S.S. (2004). Plant sterols: factors affecting their efficiency and safety as functional food ingredients. Available from http://www.lipidworld.com/content/3/1/5 Berger J.D., Loss S.P., & Siddique K.H.M. (1999). Cool season grain legumes for Mediterranean environments: species x environment interaction in seed quality traits and antinutritional factors in the genus Vicia. Austr. J. Agric. Res., 50, 389-402. Bhagya B., Sridhar K.R., & Seena S. (2006). Biochemical and protein quality evaluation of tender pods of wild legume Canavalia cathartica of coastal sand dunes. Livestock Res. Rural Dev., 18(7). Available from: http://www.cipav.org.co/lrrd/lrrd18/7/bhag18093.htm Bhatty, N., Gilani, A.H., & Nagra, S.A. (2000). Effect of cooking and supplementation on nutritional value of gram (Cicer arietinum). Nutr. Res., 20, No. 2, 297-307. Bishnoi S., & Khetarpaul N. (1994). Saponin content and trypsin inhibitor of pea cultivars: effect of domestic processing and cooking methods. J. Food Sci. Technol., 31, 73-76. Booth, M.A., Allan, G.L., Frances, J., & Parkinson, S. (2001). Replacement of fish meal in diets for Australian silver perch, Bidyanus bidyanus IV. Effects of dehulling and protein concentration on digestibility of grain legumes. Aquaculture, 196, 67-85. Brand T.S., Brandt D.A., & Cruywagen C.W. (2004). Chemical composition, true metabolisable energy content and amino acid availability of grain legumes for poultry. S. Afr. J. Anim Sci., 34, 116-122. Brazaca S.G.C., & Da Silva F.C. (2003). Enhancers and Inhibitors of Iron Availability in Legumes. Plant Food Hum. Nutr., 58, 1-8. Burton J.W. (1997). Soyabean (Glycine max (L.) Merr.). Field Crops Res., 53, 171-186. Canniatti-Brazaca S.G. (2006). Nutritional value of pea products in comparison to fresh peas. Cinc. Technol. Aliment., Campinas, 26, 766-771.
159
Carmona-Garcia R., Osorio-Diaz P., Agama-Acevedo E., Tovar J., & Bello Perez L.A. (2007). Composition and effect of soaking on starch digestibility of Phaseolus vulgaris (L.) cv., Mayocoba. Int. J. Food Sci. Techn., 42, 296-302. Carmona-Garcia, R., Orsorio-Diaz, P., Agama-Acevedo, E., Tovar, J. & Bello-Prez L.A. (2007). Composition and effect of soaking on starch digestibility of Phaseolus vulgaris (L.) cv. Mayocoba. Intern. J. Food Sci. Tech., 42, 296-302. Champ, M., Brillouet, J.M., & Rouau, X. (1986). Nonstarchy Polysaccharides of Phaseolus vulgaris, Lens esculenta, and Cicer arietinum seeds. J. Agric. Food Chem., 34, 326-329. Chango A., Villaume C., Bau H.M., Nicolas J.P., & Mesian L. (1993). Debittering of Lupin (Lupinus luteus l.) protein by calcium alginate and nutritional evaluation. J. Sci. Food Agric., 63, 195-200. Chavan, U.D., Shahidi, F., Hoover, R., & Perera, C. (1999). Characterization of beach pea (Lathyrus maritimus L.) starch. Food. Chem., 65, 61-70 Christodoulou V., Bampidis V.A., Huko B., Ploumi K., Iliadis C., Robinson P.H., & Mudik Z. (2005). Nutritional value of chickpeas in rations of lactating ewes and growing lambs.
Anim. Feed Sc. Technol., 118, 229-241.
Clarke E.J., & Wiseman J. (2000). Developments in plant breeding for improved nutritional quality of soya beans II. Anti-nutritional factors. J. Agric. Sci. Cambridge, 134, 125-136. Combe E., Achi T., & Pion R. (1991). Metabolic and digestive utilization of faba beans, lentils and chickpea. Reprod. Nutr. Dev., 31, 631-646. DMello, F.J.P. (1991). Toxic aminoacids. In DMello F.P.J., Duffus J.H., editors. Toxic Substances in Crop Plants. Cambridge U.K.: The Royal Society of Chemistry; 22-48. Dardanelli J.L., Balzarini M., Martnez M.J., Cuniberti M., Resnik S., Ramunda S.F., Herrero R., & Baigorri H. (2006). Soybean Maturity Groups, Environments, and Their Interaction Define Mega-environments for Seed Composition in Argentina. Crop Sci., 46, 19391947. Davies R.H. (1991). Cyanogens. In DMello F.P.J., Duffus J.H., editors. Toxic Substances in Crop Plants. Cambridge U.K.: The Royal Society of Chemistry; 202-225. De Almeida Costa G.E., Queiroz-Monici K.S., Reis S.M.P.M., & de Oliveira A.C. (2006). Chemical composition, dietary fibre and resistant starch contents of raw and cooked pea, common bean, chickpea and lentil legumes. Food Chem., 94, 327-330. de Jong N., Plat J., Mensink R.P. (2003). Metabolic effects of plant sterols and stanols. J. Nutr. Biochem., 4, 362-369. De Lumen O.B. (1992). Molecular strategies to improve protein quality and reduce flatulence in legumes: a review. Food Struct., 11, 33-46. De Mejia E.G., Valadez-Vega M.C., Reynoso-Camacho R., & Loarca-Pina G. (2005). Tannins, Trypsin Inhibitors and Lectin Cytotoxicity in Terapy (Phaseolus acutifolius) and Common (Phaseolus vulgeris) Beans. Plant Foods Hum. Nutr., 60, 137-145. Deshpande S.S. (1992). Food Legumes in Human Nutrition: A Personal Perspective. Crit. Rev. Food Sci. Nutr., 32(4), 333-363. Dornbos Jr D.L., & Mullen RE. (1992). Soybean seed protein and oil contents and fatty acid composition adjustments by drought and temperature. J Am. Oil Chem. Soc., 69, 228-231. Duc G. (1997). Faba bean (Vicia faba L.). Field Crop Res., 53,99-109.
160
Dueas M., Estrella I., & Herndez T. (2004). Occurrence of phenolic compounds in the seed coat and cotyledon of peas (Pisum sativum L.). Eur. Food Res. Technol., 219, 116-123. Duhan A., Khetarpaul N., & Bishnoi S. (2001). Saponin content and trypsin ihibitor activity in processed and cooked pigeon pea cultivars. Int. J. Food Sci. Nutr., 52, 53-59. Duhan A., Khetarpaul N., & Bishnoi S. (2002). Changes in phytates and HCl extractability of calcium, phosphorus, and iron of soaked, dehulled, cooked, and sprouted pigeon pea cultivar (UPAS-120). Plant Foods Hum. Nutr., 57, 275-284. Duhan, A., Chauhan, B.M., Punia, D. & Kapoor, A.C. (1989). Phytic acid content of chickpea (Cicer arietinum) and black gram (Vigna mungo): Varietal differences and effect of domestic processing and cooking methods. J. Sci.Food Agric., 49, 449-455. Duranti M. (2007). Grain legume proteins and nutraceutical properties, Fitoterapia, 77, 6782. Duranti M., & Gius C. (1997). Legume seeds : protein content and nutritional value. Field Crops Res., 53, 31-45. Egounlety, M., & Aworth, O.C. (2003). Effect of soaking, dehulling, cooking and fermentation with Rhizopus oligosporus on the oligosaccharides, trypsin inhibitor, phytic acid and tannins of soybean (Glycine max Merr.), cowpea (Vigna unguiculata L. Walp) and groundbean (Macrotyloma geocarpa Harms). J. Food Engin., 56, 249-254. Ehlers J.D., & Hall A.E. (1997). Cowpea (Vigna unguiculata L. Walp.). Field Crops Res., 53, 187-204. Eknayake S., Jansz E.R., & Nair B.M. (1999). Proximate composition, mineral and amino acid content of mature Canavalia gladiata seeds. Food Chem., 66, 115-119. Ekval J., Stegmark R., & Nyman M. (2006). Content of low molecular weight carbohydrates in vining peas (Peasum sativum) related to harvest time size and brine grade. Food Chem., 94, 513-519. El Fiel H.E.A., El Tinay A.H., & Elsheikh A.E. (2003). Effect of cooking on protein solubility profiles of faba beans (Vicia faba L.) grown under different nutritional regimes. Plant Foods Hum. Nutr., 58, 63-74. El-Adawy T.A. (2002) Nutritional composition and antinutritional factors of chickpeas (Cicer arietinum L.) undergoing different cooking methods and germination. Plant Foods Hum. Nutr., 57, 83-97. El-Adawy T.A., Rahma E.H., El-Bedawey A.A., & El-Beltagy A.E. (2003). Nutritional potential and functional properties of germinated mung bean, pea and lentil seeds. Plant Foods Hum. Nutr., 58, 1-13. El-Adawy, T.A., Rahma, E.H., El-Bedawy, A.A., & Sobihah, T.Y. (2000). Effect of soaking process on nutritional quality and protein solubility of some legume seeds. Nahrung, 44, 339-343. El-Moniem G.M.A, Honke J., & Bednarska A. (2000). Effect of frying various legumes under optimum conditions on amino acids, in vitro protein digestibility, phytate and oligosaccharides. J. Sci Food Agric., 80, 57-62 El-Neily, H.F.G. (2007). Effect of radiation processing on antinutrients, in-vitro protein digestibility and protein efficiency ratio bioassay of legume seeds. Rad. Phys. Chem., 76, 1050-1057.
161
Ene-Obong, H.N., & Obizoba, I.C. (1996). Effect of domestic processing on the cooking time, nutrients and antinutrients and in vitro protein digestibility of the African yambean (Sphenostylis stenocarpa). Plant Foods Hum. Nutr., 49, 43-52. Englyst H.N., & Hudson G.J. (1996). The classification and measurement of dietary carbohydrates. Food Chem., 57(1), 15-21. FAO/WHO. (1991). Protein Quality Evaluation. Rome, Italy: Food and Agricultural Organization of the United Nations. FAO/WHO/ONU. (1985). Energy and protein requirements. Rome, Italy: FAO/WHO/UNU Technical Report Series Nr 724. Farag, M.D. El-Din H. (1998). The nutritive value of chicks of full-fat soybeans irradiated at up to 60kGy. Anim. Feed Sci. Tech., 73, 319-328. Farrell D.J., & Mannion P.F. (1997). Final report to Rural Industry. RAD Council Egg Industry and Chicken Meat Programs. Available from: www.rirdc.gov.au/reports/CME/DAQ-28E.doc Fasoyiro S.B., Ajibade S.R., Omole A.J., Adeniyan O.N., & Farinde E.O. (2006). Proximate, minerals and antinutritional factors of some underutilized legumes in south-western Nigeria. Nutr. Food Sci., 36, 18-23. Fialho L.D.S., Guimares V.M., de Barros E.G., Moreira M.A., Dias L.A.D.S., Oliveira M.G.D.A., Jos I.C., & de Rezende S.T. (2006) Biochemical Composition and Indigestible Oligosaccharides in Phaseolus vulgaris L. Seeds. Plant Foods Hum. Nutr., 61, 87-89. Francis G., Makkar H.P.S., & Becker K. (2001). Antinutritional factors present in plantderived alternate fish feed ingredients and their effects in fish. Aquaculture, 199, 197227. Frazer M.D., Fychan R., & Jones R. (2005). Comparative yield and chemical composition of two varieties of narrow-leafed lupin (Lupinus angustifolius) when harvested as wholecrop moist grain and dry grain. Anim. Feed Sci. Techn., 120, 43-50. Frias J., Vidal-Valverde C., Kozlowska H., Gorecki R.J., Honke J., & Hedley C.L. (1996). Evolution of soluble carbohydrates during the development of pea, faba bean and lupin seeds. Zeitsch. Lebensm.-Unters. Forsch., 203(1), 27-32. Frias J., Vidal-Valverde C., Kozlowska H., Tabera J., Honke J., & Hedley C.L. (1996b). Natural Fermentation of Lentils. Influence of Time, Flour Concentration, and Temperature on the Kinetics of Monosaccharides, Disaccharide, and -Galactosides. J. Agric. Food Chem., 44, 579-584. Frias, J., Vidal-Valverde, C., Sotomayor, S., Diaz-Polan, C. & Urbano, G. (2000). Influence of processing on available carbohydrate content and, antinutritional factors of chickpeas. Europ. Food Res. Tech., 210, 340-345. Friedman M. (1996). Nutritional Value of Proteins from Different Food Sources. A Review. J. Agric. Food Chem., 44, 6-29. Frossard E.M., Bucher F., Mcher F., Mozafar A., & Hurrell A. (2000). Potential for increasing the content and bioavailability of Fe, Zn, and Ca in plants for human nutrition. J. Sci. Food Agric., 80, 861-879. Ghavidel R.A., & Prakash J. (2007). The impact of germination and dehulling on nutrients, antinutrients, in vitro iron and calcium bioavailability and in vitro starch and protein digestibility of some legume seeds. LWT, 40, 1292-1299.
162
Giami S.Y. (2001). Quality attributes of three new improved lines of Nigerian lima beans (Phaseolus lunatus L. Walp.). Plant Foods Hum Nutr., 56, 325-333. Giami S.Y. (2002). Chemical composition and nutritional attributes of selected newly developed lines of soybean (Glycine max (L) Merr). J. Sci Food Agric., 82, 1735-1739. Giami S.Y., Akusu M.O., & Emelike J.N. )2001). Evaluation of selected food attributes of four advanced lines of ungerminated and germinated Nigerian cowpea (Vigna unguiculata (L.) Walp.). Plant Foods Hum Nutr., 56, 61-73. Graham P.H., & Ranalli P. (1997). Common bean (Phaseolus vulgaris L.). Field Crop Res., 53, 131-146. Grigowda K., Prashanth S.J., & Mulimani V.H. (2005). Oligosaccharins of Black Gram (Vigna mungo L.) as Affected by Processing Methods. Plant Foods Hum. Nutr., 60, 173180. Guillon F., & Champ M.-J. (2002). Carbohydrate fractions of legumes: uses in human nutrition and potential for health. Br. J. Nutr., 88, Supl. 3, S239-S206. Gulewicz P., Ciesioka, Frias J., Vidal-Valverde C., Frejnagel S., Trojanowska K., & Gulewicz K. (2000). Simple Method of Isolation and Purification of -galactosides from Legumes. J. Agric. Food Chem., 48, 3120-3123. Guzmn-Maldonado S.H., Martnez O., Acosta-Gallegos J.A., Guevara-Lara F., & ParedesLpez. (2003). Putative Quantitative Trait Loci for Physical and Chemical Components of Common Bean. Crop Sci., 43, 1029-1035. Habiba R.A. (2002). Changes in anti-nutrients, protein solubility, digestibility, and HClextractability of ash and phosphorus in vegetable peas as affected by cooking methods. Food Chem., 77, 187-192. Han I.H., & Baik B-K. (2006). Oligosaccharide content and composition of legumes and their reduction by soaking, cooking ultrasound and high hydrostatic pressure. Cereal Chem., 83, 428-433. Hanbury C.D., Siddique K.H.M., Galwey N.W., & Cocks P.S. (1999). Genotype-environment interaction for seed yield and ODAP concentration of Lathyrus sativus L. and L cicera L. in Mediterranean-type environments. Euphytica, 110, 45-60. Hanbury C.D., White C.L., Mullan B.P., & Siddique K.H.M. (2000). A review of the potential of Lathyrus sativus L., and L. cicera L. for use as animal feed. Anim. Feed Sci. Technol., 87, 1-27. Heng L., Vincken J-P., van Koningveld G., Legger A., Gruppen H., van Boekel T., Roozen J., & Voragen F. (2006). Bitterness of saponins and their content in dry peas. J. Sci. Food Agric., 86, 1225-1231. Hernandez-Infante, M., Sousa, V., Montalvo, I, & Tena, E. (1998). Impact of microwave heating on hemagglutinins, trypsin inhibitors and protein quality of selected legume seeds. Plant Foods Hum. Nutr., 52, 199-208. Hickling D. (2003). Canadian Feed Peas Industry Guide. Winnipeg, Manitoba, Canada: Pulse Canada; 1-35. Hoover R., & Ratnayake W.S. (2002). Starch characteristics of black bean, chick pea, lentil, navy bean and pinto bean cultivars grown in Canada. Food Chem., 78, 489-498. Hoover, R., Li, Y.X., Hynes, G., Senanayake, N. (1997). Physicochemical characterization of mung bean starch. Food Hydrocol., 11, 401-408. Hossein M.S., & Mortuza, M.G. (2006). Chemical composition of Kalimatar, a locally grown strain of faba bean. Pakist. J. Biol. Sci., 9(9), 1817-1822.
163
Huang, J., Schols, H.A., van Soest, J.J.G., Jin, Z., Sulmann, E., & Voragen, A.G.J. (2007). Physicochemical properties and amylopectin chain profiles of cowpea, chickpea and yellow pea starches. Food Chem., 101, 1338-1345. Iqbal A., Khalil I.A., Ateeq N., & Khan M.S. (2006). Nutritional quality of important food legumes. Food Chem., 97, 331-335. Jaffe W.G. (1993). Hemagglutinins (Lectins). In: I.E. Liener editor. Toxic constituents of plant foodstuffs 2nd Edition, , NY: Academic Press; pp.73-102. Jayakody, L., Lan, H., Hoover, R., Chang, P., Liu, Q., & Donner, E. (2007). Composition, molecular structure, and physicochemical properties of starches from two grass pea (Lathyrus sativus L.) cultivars grown in Canada. Food Chem., 105, 116-125. Johnson S.E., Lauren J.G., Welch R.M., & Duxbury J.M. (2005). A comparison of the effects of micronutrient seed priming and soil feritlization on the mineral nutrition of chickpea (Cicer arietinum), lentil (Lens culinaris), rice (Oryza sativa)and wheat (Triticum aestivum) in Nepal., Exp. Agric., 41, 427-448. Jood, S., Mehta, U., & Singh, R. (1986). Effect of processing on available carbohydrates in legumes. J. Agric. Food Chem., 34, 417-420. Kahlon T.S., Smith G.E., & Shao Q. (2005). In vitro binding of bile acids by kidney bean (Phaseolus vulgaris), black gram (Vigna mungo), Bengal gram (Cicer arietinum) and moth bean (Phaseolus aconitifolins). Food Chem., 90, 241-246 Karr-Lilienthal L.K., Grieshop C.M., Merchen N.R., Mahan D.C., & Fahey G.C.Jr. (2004). Chemical Composition and Protein Quality Comparisons of Soybeans and Soybean Meals from Five Leading Soybean-Producing Countries. J. Agric. Food Chem., 52, 61936199. Karr-Lilienthal L.K., Grieshop C.M., Spears K., & Fahey G.C.Jr. (2005). Amino Acid, Carbohydrate, and Fat Composition of Soybean Meals Prepared at 55 Commercial U.S. Soybean Processing Plants. J. Agric. Food. Chem., 53, 2146-2150. Kerem Z., Lev-Yadun S., Gopher A., Weinberg P., & Abbo S. (2007). Chickpea domestication in the Neolithic Levant through the nutritional perspective. J. Archeo. Sci., 34, 1289-1293. Khalil A.W., Zeb A., Mahmood F., Tariq S., Khattak A.B., & Shah H. (2007). Comparison of sprout quality characteristics of desi and kabuli type chickpea cultivars (Cicer arietinum L.). LWT, 40, 937-945. Khatoon N., & Prakash, J. (2004). Nutritional quality of microwave-cooked and pressure cooked legumes. Intern. J. Food Sci. Nutr., 55, No 6, 441-448. Kigel J. (1999). Culinary and nutritional quality of Phaseolus vulgaris seeds as affected by environmental factors. Biotechnol. Agron. Soc. Environ., 3(4), 205-209. Kim E.H., Kim S.H., Chung J.I., Chi H.Y., Kim J.A., & Chung I.M. (2006). analysis of phenolic compounds and isoflavones in soybean seeds (Glycine max (L.) Merill) and sprouts grown under different conditions. Eur. Food Res. Tehcnol., 222, 201-208. Knudsen, K.E.B. (1997). Carbohydrate and lignin contents of plant materials used in animal feeding. Anim. Feed Sci. Techn., 67, 319-338. Koehler H.H., Chang C., Scheier G., & Burkee D.W. (1987). Nutrient composition, protein quality and sensory properties of thirty-six cultivars of dry beans (Phaseolus vulgaris L.). J. Food Sci., 52, 1335-1340 Kumar V., Rani A., Pandey V., Mande P., & Chauhan G.S. (2005). Compositional traits of soybean seeds as influenced by planting date in India. Exp. Agric., 42, 19-28.
164
Kumar V., Rani A., Solanki S., & Hussain S.M. (2006). Influence of growing environment on the biochemical composition and physical characteristics of soybean seed. J. Food Compos. Anal., 19, 188-195. Kuo T.M., VanMiddlesworth F., & Wolf W.J. (1988). Content of Raffinose Oligosaccharides and Sucrose in Various Plant Seeds. J. Agric. Food Chem., 36, 32-36. Lambein F., Haque R., Khan J.K., Kebebe N., & Kuo Y-H. (1994). From soils to brain: zinc deficiency increases the neurotoxicity of Lathyrus sativus and may affect the susceptibility for the motorneurone disease lathyrism. Toxicon, 1994, 32, 461-466. Lecuona-Villanueva, A., Torruco-Uco, J., Chel-Guerrero, L., & Betancur-Ancona, D. (2006). Physicochemical characterization of mexican cowpea (Vigna unguiculata) tailing starch. Starch/Staerke, 58, 25-34 Lev E., Kislev M., & Bar-Yosef O. (2005). Mousterial vegetal food in Kebara Cave. Mt. Carmel. J Archeol. Sci., 32, 475-484. Liener I.E. (1994). Implications of antinutritional components in soybean foods. CRC Crit. Rev. Food Sci. Nutr., 34, 31-67. Liener I.E., & Kakade M.L. (1993). Protease Inhibitors, In: I.E. Liener editor. Toxic constituents of plant foodstuffs 2nd Edition, NY: Academic Press; pp.7-71. Lis H., & Sharon N. (1998). Lectins: Carbohydrate-Specific Proteins That Mediate Cellular Recognition. Chem Rev., 98, 637-674. Mahmoud A.A., Natarajan S.S., Bennett J.O., Mawhinney T.P., Wiebold W.J., & Krishnan H.B. (2006). Effect of Six Decades of Selective Breeding on Soybean Protein Composition and Quality: A Biochemical and Molecular Analysis. J. Agric. Food Chem., 54, 3916-3922. Makkar H.P.S., Becker K., Abel H., & Pawelzik E. (1997). Nutrient contents, rumen protein digestibility and antinutritional factors in some color and white flowering cultivars of Vicia faba beans. J Sci Food Agric., 75, 511-520. Makkar H.P.S., Blmmel M., & Becker K. (1995). In vitro effects of and interactions between tannins and saponins and fate of tannins in the rumen. J. Sci. Food Agric., 69, 481-493. Maninder K., Sandhu, K.S, & Singh N. (2007). Comparative study of the functional, thermal and pasting properties of flours from different field pea (Pisum sativum L.) and pigeon pea (Cajanus cajan L.) cultivars. Food Chem., 104(1), 259-267. Marconi, E., Ruggeri, S., Capelloni, M., Leonardi, D., & Carnovale, E. (2000). Physicochemical, nutritional, and microstructural characteristics of chickpeas (Cicer arietinum L.) and common beans (Phaseolus vulgaris L.) following microwave cooking. J. Agric. Food Chem., 48, 5986-5994. Martnez-Villaluenga C., Fras J., & Vidal-Valverde C. (2005). Raffinose family oligosaccharides and sucrose contents in 13 Spanish lupin cultivars. Food Chem., 91, 645-649. asoero, F., Pulimeno, A.M., & Rossi, F. (2005). Effect of extrusion, expansion and toasting on the nutritive value of peas, faba beans and lupins. Ital. J. Anim. Sci., 4, 177-189. Mebrahtu T., & Mohamed A. (2003). A seven-parental diallel analysis of nutritional composition of common beans. Plant Foods Hum. Nutr., 58, 1-11 Mesquita V.L.V., & Giada M.L.R. (2005). Organic-mineral content of the main Brazilian cereals and legumes. Nutr. Food Sci., 35(4), 264-270.
165
Monte W.C., & Maga J.A. (1980). Extraction and Isolation of Soluble and Insoluble Fiber Fractions from the Pinto Bean (Phaseolus vulgaris). J. Agric. Food Chem., 28, 11691174. Monti L.M., & Grillo S. (1983). Legume seed improvement for protein content and quality. Qual. Plant Plant Foods Hum. Nutr., 32, 253-266. Morris E.R. (1986). Phytate and dietary mineral bioavailability. In Graf E. editor. Phytic acid; Chemistry and Applications. Minneapolis,MN: Pilatus Press. pp.57-76. Morris, E.R., & Hill, D.A. (1996). Inositol phosphate content of selected dry beans, peas, and lentils, raw and cooked. J. Food Comp.Anal., 9, 2-12. Mulimani V.H., & Devendra S. (1998). Effect of soaking, cooking and crude -galactosidase treatment on the oligosaccharide content of red gram flour. Food Chem., 61, 475-479. Muller, R. A. E., Parthasarthy Rao, P., & Subba Rao, K. V. (1990). Pigeonpea: Markets and outlook. pp. 457479. In Nene, Y. L., Hall, S. D., and Sheila, V. K. (eds.), The Pigeonpea, CAB International, Wallingford, Oxon, UK, 490 pp. Nayyar H., Kaur S., Singh S., & Upadhyaya H. (2006). Differential sensitivity of Desi (smallseeded) and Kablui (large-seeded) chickpea genotypes to water stress during seed filling: effects on accumulation of seed reserves and yield. J. Sci. Food Agric., 86, 2076-2082. Nestares, T., Lpez-Frias, M., Barrionuevo, M., & Urbano, G. (1996). Nutritional assessment of raw and processed chickpea (Cicer arietinum L.) protein in rats. J.Agric. Food Chem., 44, 2760-2765. Nikolopoulou D., Grigorakis K., Stasini M., Alexis M., & Iliadis K. (2006). Effects of cultivation area and year on proximate composition and antinutrients in three different kabuli-type chickpea (Cicer arientinum). Eur. Food Res. Technol., 223: 737-741. Nikolopoulou D., Grigorakis K., Stasini M., Alexis M.N., & Iliadis K. (2007). Differences in chemical composition of field pea (Pisum sativum) cultivars: Effects of cultivation area and year. Food Chem., 103(3): 847-852. Obatulu V., & Osho S.M. (2006). Chemical and physical characteristics of five Nigerian varieties of fresh green immature soybean (Glycine max (L.) Merrill). British Food J., 108(6), 440-450. Oboh G. (2006). Antioxidant properties of some commonly consumed and underutilized tropical legumes. Eur. Food Res. Technol., 224, 61-65. Ojimelukwe P.C. (2002). Changes induced by infestation on some chemical properties of cowpea seeds. Plant Foods Hum. Nutr., 57, 129-140 Oliva M.L., Shannon J.G., Sleper D.A., Ellersieck M.R., Cardinal A.J., Paris R.L., & Ledd J.D. (2006). Stability of Fatty Acid Profile in Soybean Genotypes with Modified Seed Oil Composition. Crop Sci., 46, 2069-2075. Oloyo R.A. (2004). Chemical and nutritional quality changes in germinating seeds of Cajanus cajan L., Food Chem., 85, 497-502. Oluwatosin O.B. (1999). Genotype x environment influence on cowpea (Vigna unguiculata (L) Walp) antinutritional factors: 1-Trypsin inhibitors, tannins, phytic acid and haemagglutinin. J. Sci. Food Agric., 79, 265-272. Onwuka, G.I. (2006). Soaking, boiling and antinutritional factors in pigeon peas (Cajanus cajan) and cowpeas (Vigna unguiculata). J. Food Proc. and Preserv., 30, 616-630. Onyeike, E.N., & Omubo-Dede, T.T. (2002). Effect of heat treatment on the proximate composition, energy values, and levels of some toxicants in African yam bean (Sphenostylis stenocarpa) seed varieties. Plant Foods for Human Nutrition. 57, 223-231.
166
Oomah B.D., Tiger N., Olson M., & Balasubramanian P. (2006). Phenolics and Antioxidative Activities of Narrow-Leafed Lupins (Lupinus angustifolius L.). Plant Foods Hum. Nutr., 61, 91-97 Paek N.C., Imsande J., Shoemaker R.C., Shibles R. (1997). Nutritional control of soybean seed storage protein. Crop Sci., 37, 498-503. Paredes-Lpez, O., Gonzlez-Castaneda, J., & Cradez-Trejo, A. (1991). Influence of solid substrate fermentation on the chemical composition of chickpea. J. Ferment. Bioeng., 71, No1, 58-62. Pastuszewska, B., Vitjazkova, M., Swiech, E., & Taciak, M. (2004). Composition and in vitro digestibility of raw versus cooked white- and colour-flowered peas. Nahrung/Food No3., 221-225. Phillips R.D., McWaters K.H., Chinnan M.S., Hung Y-C, Beuchat L.R.,Sefa-Dedeh S., SkyiDawson E., Ngoddy P., Nnanyelugo D., Enwere J., Komey N.S., Liu K., Mensa-Wilmot Y., Nnanna I.A., Okeke C., Prinyawiwatkul W., & Saalia F.K. (2003). Utilization of cowpeas for human food. Field Crop Res., 82, 193-213 Piper E.L., & Boote K.J. (1999). Temperature and cultivar effects on soybean seed oil and protein concentrations. JAOCS, 1233-1242. Pirman T., & Stibilj V. (2006). An influence of cooking on fatty acid composition in three varieties of common beans and in lentil. Eur. Food Res. Technol., 217, 498-503. Plahar, W.A., Annan, N.T., & Nti, C.A. (1997). Cultivar and processing effects on the pasting characteristics, tannin content and protein quality and digestibility of cowpea (Vigna Unguiculata). Plant Foods Hum. Nutr., 51, 343-356. Porres J.M., Aranda P., Lpez-Jurado M., & Urbano G. (2006). Nutritional evaluation of protein, phosphorus, calcium and magnesium bioavailability from Lupin (Lupinus albus var. multolupa)-based diets in growing rats: effect of -galactoside oligosaccharide extraction and phytase supplementation. Br. J. Nutr., 95, 1102-1111. Pugalenthi M., Vavidel V., & Siddhuraju P. (2005). Alternative Food/Feed Perspectives on an Underutilized Legume Mucuna pruriens var. Utiltis-A Review. Plant Foods Hum Nutr., 60, 201-218. Rajaram N., & Janardhanan K. (1992). Nutritonal and chemical evaluation of raw seeds of Canavalia gladiata (Jacq) DC. and C. ensiformis DC: the underutilized food and fodder crops in India. Plant Foods Hum. Nutr., 42, 329-336. Rao U.P., & Belavady B. (1978). Oligosaccharides in Pulses: Varietal Differences and Effects of Cooking and Germination., J. Agric. Food Chem., 26, 316-319. Ratnayake, W.S., Hoover, R., Shahidi, F., Perera, C., & Jane, J. (2002). Composition, molecular structure, and physicochemical properties of starches from four field pea (Pisum sativum L.) cultivars. Food Chem., 74, 189-202 Reddy B.V.S., Reddy P.S., Bidinger F., & Blmmel M. (2003). Crop management factors influencing yield and quality of crop residues. Field Crops Res., 84, 57-77. Redondo-Cuenca A., Villanueva-Surez, Rodrguez-Sevilla M.D., & Mateos-Aparicio I., (2006). Food Chem., 101, 1216-1222. Rehman, ZU., & Shah, W.H., (2001). Tannin contents and protein digestibility of black grams (Vigna mungo) after soaking and cooking. Plant Foods Hum. Nutr., 56, 265-273. Reichert R.D., & MacKenzie S.L. (1982). Composition of Peas (Pisum sativum) Varying Widely in Protein Content. J. Agric. Food Chem., 30, 312-317.
167
Reyes-Moreno, C., Cuevas-Rodriguez, E.O., Miln-Carrillo, J., Crdenas-Valenzuela, O.G., & Barrn-Hoyos, J. (2004). Solid state fermentation process for producing chickpea (Cicer arietinum L) tempeh flour. Physicochemical and nutritional characteristics of the product. J. Sci. Food Agric., 84, 271-278. Rdriguez-Ambriz S.L., Martnez-Ayala A.L., Milln F., & Dvila-Ortz. (2005). Composition and Functional Properties of Lupinus campestris Proteins Isolates. Plant Foods Hum. Nutr., 60, 99-107 Ruiz M.A., & Sotelo A. (2001). Chemical Composition, Nutritive Value, and Toxicology Evaluation of Mexican wild Lupins. J. Agric. Food Chem., 49, 5336-5339. Ruiz-Lpez M.A., Garca- Lpez P.M., Castaeda-Vasquez H., Zamora N.J.F., Garzn-Dela Mora P., Bauelos Pineda J., Burbano C., Pedrosa M.M., Cuadrado C.m, & Muzquiz M. (2000). Chemical Composition and Antinutrient Content of three Lupinus Species from Jalisco, Mexico. J. Food Comp. Anal., 13, 193-199. Ruiz-Tern, F., & Owens, J.D. (1996). Chemical and enzymic changes during the fermentation of bacteria-free soya bean tempe. J. Sci. Food Agric., 71, 523-530. Ryan E., Galvin K., OConnor T.P., Maguire A.R., & OBrien N.M. (2007). Phytosterol, squalene, Tocopherol Content and Fatty Acid Profile of selected Seeds, Grains and Legumes. Plant Foods Hum. Nutr., in press. Saharan K., Khetarpaul N., & Bishnoi S. (2002). Variability in Physico-chemical Properties and Nutrient Composition of Newly Released Ricebean and Fababean Cultivars. J. Food Comp. Anal., 15, 159-167. Sangronis E., & Machado C.J. (2007). Influence of germination on the nutritional quality of Phaseolus vulgaris and Cajanus cajan. LWT, 40, 116-120. Saura-Calixto F., Garca-Alonso A., Goi I., & Avo L. (2000). In Vitro Determination of the Indigestible Fraction in Foods: An Alternative to Dietary Fiber Analysis. J. Agric. Food Chem., 48, 3342-3347. Saxena R., Venkaiah K., Anitha P., Venu L., & Raghunath M. (2007). Antioxidant activity of commonly consumed plant foods of India: contribution of their phenolic content. Int. J. Food Sci. Nutr., 58, 250-260. Scott R.A., & Kephart K.D. (1997). Selection for yield, protein, and oil in soybean crosses between adapted and introduced parents. Field Crops Res., 49, 177-185. Seena, S., Sridhar, K.R., Arun, A.B., & Jung, K. (2005). Nutritional and antinutritional evaluation of raw and processed seeds of a wild legume, Canavalia cathartica of coastal dunes of India. Food Chem. 92, 465-472. Seena, S., Sridhar, K.R., Arun, A.B., & Young, C.C. (2006). Effect of roasting and pressurecooking on nutritional and protein quality of seeds of mangrove legume Canavalia cathartica from southwest coast of India. J. Food Comp. Anal. 19, 284-293. Selle P.H., Ravindran V., Caldwell R.A., & Bryden W.L. (2000). Phytate and phytase: consequences for protein utilization. Nutr. Res. Rev., 13, 255-278. Shellie K.C., & Hosfield G.L. (1991). Genotype x Environmental effects on food quality of common bean: resource-efficient testing procedures. J. Am. Soc. Hort. Sci., 116, 732-736. Shim S.I., Jun W.L., & Kang B.H. (2003). Evaluation of Nutritional and Antinutritional Components in Korean Wild Legumes. Plant Foods Hum. Nutr., 58, 1-11. Shimoyamada M., Ikedo S., Ootsubo R., & Watanabe K. (1998). Effect of soybean saponins on chymotryptic hydrolyses of soybean proteins. J. Agric. Food Chem., 46, 4793-4797.
168
Siddhuraju P., & Becker, K. (2005). Nutritional and antinutritional composition, in vitro amino acid availability, starch digestibility and predicted glyceic index of differentially processed mucuna beans (Mucuna pruriens var. utilis): an under-utilised legume. Food Chem. 91, 275-286. Siddhuraju P., & Becker K. (2001). Species/variety differences in biochemical composition and nutritional value of Indian tribal legumes of the genus Canavalia. Nahrung/Food, 45, 224-233. Siddhuraju P., & Becker K. (2005). Nutritional and antinutritional composition, in vitro amino acid availability, starch digestibility and predicted glycemic index of differentially processed mucuna beans (Mucuna pruriens var. utilis): An under-utilised legume. Food Chem., 91, 275-286. Siddhuraju P., Becker K., & Makkar H.P.S. (2001). Chemical composition protein fractionation, essential amino acid potential and antimetabolic constituents of an unconventional legume, Gila bean (Entada phaseoloides Merill) seed kernel. J. Sci. Food Agric., 82, 192-202. Simopoulos A.P. (2002). Omega-3 fatty acids in inflammation and autoimmune diseases, J. Amer. College Nutr., 21, 495-505. Sinha R., & Kawatra A. (2003). Effect of processing on phytic acid and polyphenol contents of cowpeas (Vigna unguiculata (L) Walp). Plant Foods Hum. Nutr. 58, 1-8. Solanki I.S., Kapoor A.C., & Singh U. (1999). Nutritional parameters and yiled evaluation of newly developed genotypes of lentil (Lens culinaris Medik.). Plant Foods Hum. Nutr., 54, 79-87. Stevenson, D.G., Doorenbos, R.K., Jane, J.-L., & Inglett, G.E. (2006). Structures and functional properties of starch from seeds of three soybean (Glycine max (L.) Merr.) varieties. Starch/ Staerke, 58, 509-519. Sudari A., imi D., & Vratari M. (2006). Characterization of genotype by environment interactions in soybeen breeding programmes of southeast Europe. Plant Breed., 125, 191-194. Tacon A.G.C. (1997). Fishmeal replacers: Review of antinutrients within oilseeds and pulses A limiting factor for the aquafeed Green Revolution?, Cah. Opt. Medit., 197, 153-182. Tadesse W., & Bekele (2003). Variation and association of morphological and biochemical characters in grass pea (Lathyrus sativus L.). Euphytica, 130, 315-324. Tetchi F.A., Rolland-Sabat A., Amani N.G., & Colonna P. (2007). Molecular and physicochemical characterisation of starches from yam, cocoyam, cassava, sweet potato and ginger produced in the Ivory Coast. J. Agric. Food Chem., 87, 1906-1916. Tharanathan R.N., & Mahadevamma S., 2003, Grain legumes a boon to human nutrition. Trends Food Sci. Technol., 14, 507-518. Torres A., Frias J., Granito M., & Vidal-Valverde C. (2007). Germinated Cajanus cajan seeds as ingredients in pasta products: Chemical, biological and sensory evaluation. Food Chem., 101, 202-211. Ubedibie A.B.I., & Carlini C.R. (1998). Questions and answers to edibility problem of the Canavalia ensiformis seeds A review. Anim Feed Sci. Technol., 74, 95-106. Urbano G., Aranda P., Gmez-Villalva E., Frejnagel S., Porres J., Fras J., Vidal-Valverde C., & Lopez-Jurado M. (2003). Nutritional Evaluation of Pea (Pisum sativum L.) Protein Dietsafter Mild Hydrothermal Treatment and with and without Added Phytase. J. Agric. Food Chem., 51, 2415-2420.
169
Urbano G., Lopez-Jurado M., Aranda P., Vidal-Valverde C., & Tenorio E., Porres J. (2000). The role of phytic acid in legumes: antinutrient or benefitial function? J. Physiol. Biochem., 56, 283-294 Urbano G., Lpez-Jurado M., Frejnagel S., Gmez-Villalva E., Porres J.M., Fras J., VidalValverde C., & Aranda P. (2005). Nutritional assessment of raw and germinated pea (Pisum sativum L.) protein and carbohydrate by in vitro and in vivo techniques. Nutrition, 21, 230-239. Vasconcelos I.M., Campelo C.C., Oliveira J.T.A., Carvalho A.F.U., De Sousa D.O.B., & Maia F.M.M. (2006). Brazilian soybean Glycine max (L.) Merr. Cultivars adapted to low latitude regions: seed composition and content of bioactive proteins. Rev. Brazil. Bot., 29(4), 617-625. Vasconcelos I.M., Siebra E. A., Maia A.A.B., Moreira R.A., Neto A.F., Campelo G.J.A., & Oliveira J.T.A. (1997). Composition, Toxic and Antinutritional Factors of Newly Developed Cultivars of Brazilian Soybean (Glycine max). J.Sci. Food Agric., 75, 419426. Vavidel V., & Janardhanan K. (2002). Agrobotanical traits and chemical composition of Cassia obtusifolia L.: a lesser-known legume of the Western Ghants regions of South India. Plant Foods Hum Nutr., 57, 151-164. Vavidel V., & Janardhanan K. (2004). The nutritional and antinutritional attributes of sword bean [Canavalia gladiata (Jacq.) DC.]: an under-utilized tribal pulse from south India. Int. J. Food Sci. Techn., 39(9), 917-926. Vavidel V., & Janardhanan K. (2005). Nutritional and Antinutritional Characteristics of Seven South Indian Wild Legumes. Plant Foods Hum. Nutr., 60, 69-75. Vidal-Valverde,C., Frias, J., Estrella, I., Gorospe, M.J., Ruiz, R., & Bacon, J. (1994). Effect of processing on some antinutritional factors of lentils. J. Agric. Food Chem. 42, 22912295. Vollman J., Fritz C.N., Wagentristl H., & Ruckenbauer P. (2000). Environmental and genetic variation of soybean seed protein content under Central European growing conditions. J. Sci. Food Agric., 80, 1300-1306. Wang N., & Daun J.K. (2004). Effect of variety and crude protein content on nutrients and certain antinutrients in field peas (Pisum sativum). J. Sci. Food Agr., 84, 1021-1029. Wang N., & Daun J.K. (2006). Effect of variety and crude protein content on nutrients and anti-nutrients in lentils (Lens culinaris). Food Chem., 95, 493-502. Wesley T.L., Lamond R.E., Martin V.L., & Duncan S.R. (1998). Effects of late-season nitrogen fertilizer on irrigated soybean yield and composition. J. Prod. Agric., 11, 331336. Wiryawan I.K.G. (1997).Grain Legumes for Poultry. University of Queensland, Australia: PhD thesis. Wolf R.B., Cavins J.F., Kleiman R., & Black L.T. (1982). Effect of temperature on soybean seed constituents: oil, protein, moisture, fatty acids, amino acids and sugars. JAOCS, 59(5), 230-232. Wuletaw T. (1998). Effect of genotype x environment interaction on Neurotoxin content and grain yield of grass pea. In K. Georgis & Y. Degago (Eds.). Crop Management Options to Sustain Food Security: Proceedings of the third conference of Agronomy and crop physiology society of Ethiopia (ACPSE). Addis Ababa, 1997, ACPSE, Addis Ababa.
170
Yaklich R.W., Vinyard B., Camp M., & Douglass S. (2002). Analysis of Seed Protein and Oil from Soybean Northern and Southern Region Uniform Tests. Crop Sci., 42,1504-1515 Yaez-Farias, G.A., Moreno-Valencia, J.G., Del Refugio Falcn-Villa, Ma., & BarrnHoyos, J.M. (1997). Isolation and partial characterization of starches from dry beans (Phaseolus vulgaris) and chickpeas (Cicer arietinum), grown in Sonora, Mexico. Starch/Staerke 49(9), 341-345 Yao L.H., Jiang Y.M., Shi J., Toms-Barbern F.A., Datta N., Singanusong R., & Chen S.S. (2004). Flavonoids in Food and Their Health Benefits. Plant foods Hum. Nutr., 59, 113122. Yemane A., & Skjelvg A.O. (2003). Physicochemical Traits of Dekoko (Pisum sativum var. abyssinicum) Seeds. Plant Foods Hum. Nutr., 58, 275-283. Yoshida H., Tomiyama Y., Kita S., & Mizushina Y. (2005). Lipid classes, fatty acid composition and triacylglycerol molecular species of kidney beans (Phaseolus vulgaris L.). Eur. J. Lipid Sci. & Techn., 107, 307-315. Zhou Y., Hoover R., & Liu Q. (2004). Relationship between -amylase degradation and the structure and physicochemical properties of legume starches. Carb. Polym., 57, 299-317. Zia-Ur-Rehman, & Shah W.H. (2001). Tannin contents and protein digestibility of black grams (Vigna mungo) after soaking and cooking. Plant Foods Hum. Nutr., 56, 265-273. Zohary, D.D., & Hopf M. (2000). Domestication of plants in the old world. third edition. Oxford, UK: Clarendon Press.
Chapter 3
LOW-COST ADSORBENTS FROM AGRI-FOOD WASTES

Leandro S. Oliveira* and Adriana S. Franca
Programa de Ps-Graduao em Cincia de Alimentos/UFMG Av. Antnio Carlos, 6627 31270-901 Belo Horizonte, MG, Brasil
ABSTRACT
Agricultural and food wastes are high volume, low value materials that are highly prone to microbial spoilage which limits their exploitation. Further exploitation can also be precluded by legal restrictions and the costs of collection, drying, storage and transportation. Thus, for the most part, these materials are either used as animal feed, combustion feedstock or disposed to landfill causing major environmental issues. These materials usually contain high levels of cellulose, hemicellulose, lignin and proteins and as such can constitute renewable natural resources for a plethora of inexpensive ecofriendly and sustainable materials. Examples of such inexpensive materials are low cost adsorbents. Adsorption has been deemed one of the best techniques for the removal of organic pollutants of wastewaters and of undesirable chemical components in the agrifood industry. Because of their excellent adsorption ability, activated carbons are the most widely used sorbents and have been employed in the agri-food industry for a variety of applications such as the decolorization of sugar and vegetable oils, the removal of copper ions in the distilled alcoholic beverages industry and others. However, although activated carbon is certainly the preferred sorbent, its widespread use is restricted by its inherently high cost and, hence, the production of low cost adsorbents has been recently intensively sought. Since agricultural and food wastes are generated in large scales, thus, being largely available and rather inexpensive, these materials are considered potential precursors for the preparation of low-cost sorbents and are being thoroughly studied as such. In the last decade, a significant amount of information has been published on the potentiality of agri-food residues to be suitably modified and used as low-cost sorbents in a variety of applications. Thus, it is the aim of this essay to critically analyze the current
E-mail:leandro.oliveira@pesquisador.cnpq.br.Tel:+55-31-34096910. Fax:+55-31-34096989
172
Leandro S. Oliveira and Adriana S. Franca

situation and future applications of low-cost sorbents prepared from agri-food materials, with an emphasis on applications of interest to the food industry.
1. INTRODUCTION
The turn from the twentieth to the twenty first century has been viewed in many ways and by many prominent people as also a turning point in the history of mankind with regard to the peoples awareness of environmental problematic issues and the urgent need for technological developments (accompanied by suitable economical developments) to comply with these issues. Thus, words such as innovative technology, sustainable development, green chemistry, bioenergy, zero emissions and eco-friendly products have gained relevant status in the academic, research and political communities. However, when put together with the word economical, those words usually occupy a far out second place in priority. Extensive and interesting discussions on this topic were presented by Ruth (2006) and Ayres (2008). Biofuel and bio-based products prepared from agricultural and food wastes usually comply (at least partially) with all the buzzwords aforementioned, but, regardless of their technical feasibility and performance, they are also subject to economical, environmental, social and legislative analysis when implementation on industrial scale is sought after. It has been suggested by many people that agricultural and food wastes should be thought of as sources of plentiful of value-added products and this should be the path to take to achieve a biological-based economy. It is a commendable goal to be achieved in the future, when the petroleum-based materials and fuels are no longer controlling the global world economy. However, recent analysis of the macroeconomics of the globalized world, where the projected prices of fossil fuel for the next 30 to 50 years and the current obstacles (legal, social, environmental and economical) in establishing a bio-based economy are considered, leads to the conclusion that a petroleum-based economy will still be dominant over the most part of the 21st century (Parris, 2004). Nevertheless, the problem of properly dealing with huge amounts of waste generated in the agricultural and food sectors all over the world (certainly in the range of billion of kilograms per year) is an issue for which suitable solutions can no longer be delayed. Agricultural and food wastes are high volume, low value materials that are highly prone to microbial spoilage, limiting their exploitation. Further exploitation can also be precluded by legal restrictions and the costs of collection, drying, storage and transportation. Thus, for the most part, currently these materials are either used as animal feed (not always adequate due to difficulties in properly balancing the nutritional requirements), combustion feedstock or disposed to landfill causing major environmental issues (e.g., emission of large quantities of volatile organic compounds in the case of combustion, and contamination of groundwater in the case of landfill). These materials usually contain high levels of cellulose, hemicellulose, lignin and proteins and as such can constitute renewable natural resources for a plethora of inexpensive eco-friendly and sustainable materials. Examples of such inexpensive materials are low cost adsorbents. Adsorption has been deemed one of the best techniques for the removal of organic and inorganic pollutants of wastewaters and of undesirable chemical components in the agri-food industry. Because of their excellent adsorption ability, activated carbons are the most widely
Low-cost Adsorbents from Agri-food Wastes
173
used sorbents and have been employed in the agri-food industry for a diversity of applications such as the decolorization of sugar and vegetable oils, the removal of copper ions and undesirable organics in the distilled alcoholic beverages industry and others. However, although activated carbon is certainly the preferred sorbent, its widespread use is restricted by its inherently high cost (mostly related to the costs of the precursor material and of the energy intensive production processes) and, hence, the production of low cost adsorbents has been recently intensively sought. Since agricultural and food wastes are generated in large scales, thus, being largely available and rather inexpensive, these materials are considered potential precursors for the preparation of low-cost sorbents and are being thoroughly studied as such. In the last decade, a significant amount of information has been published on the potentiality of agri-food residues to be used as is or to be suitably modified and employed as low-cost sorbents in a variety of applications. Thus, it is the aim of this essay to critically analyze the current situation of both scientific and technological aspects of the preparation of low-cost sorbents from agri-food materials and of the potential future applications of the prepared sorbents, with emphasis on applications of interest to the food industry. The literature is pregnant with current comprehensive reviews on the subject of low-cost adsorbents (Pollard et al., 1992; Kratochvil and Volesky, 1998; Bailey et al., 1999; Brown et al., 2000; Fu and Viraraghavan, 2001; Volesky, 2001; Davis et al., 2003; Guibal, 2004; Aksu, 2005; Crini, 2006; Suhas et al., 2007; Ioannidou and Zabaniotou, 2007; Dias et al., 2007; Crini and Badot, 2008). However, these reviews are mostly focused on the application itself, rather than on the methods of preparation of the sorbents. In our point of view, the preparation method is the primary factor influencing the technology to be developed and further implemented for large-scale productions of these sorbents. Some of the cited reviews do not present discussions about any sorbent related to agricultural or food wastes (Fu and Viraraghavan, 2001; Davis et al., 2003; Aksu, 2005). Nevertheless, they discuss interesting aspects of low-cost biosorbents (and of the respective adsorption and biosorption processes they are employed) that we believe to be applicable to any sorbent of biological origin, thus, herein considered relevant to our analysis or to the further enrichment of the readers knowledge on the subject. It should be emphasized at this point that the literature pertaining preparation and application of low-cost adsorbents using agricultural and food waste materials is quite abundant and it is not the purpose of this chapter to cover the extensive information they present, but rather highlight and critically analyze the information that directly contributes to the technological aspects of producing these sorbents, i.e., most of the discussion will be focused on the preparation methods and the modifications they impart on the precursor materials.
2. AGRICULTURAL AND FOOD WASTE-DERIVED SORBENTS

From the vast literature covering the methods of preparation and application of agri-food waste-based sorbents, although never clearly stated before, it is possible to separate the types of sorbents prepared and further used into five distinct categories: (i) activated carbons; (ii) biosorbents (strictly related to its application in what is termed biosorption process); (iii) bonechar; (iv) chitin and chitosan-based sorbents; and (v) ion exchange resins. There has been
174
some interesting work on the preparation of ion exchange resins from agricultural wastes and application to the removal of metal ions from aqueous solutions (e.g., Orlando et al., 2002a,b; Wartelle and Marshall, 2005, 2006; Marshall and Wartelle, 2006; Kse, 2008). However, we should warn the reader at this point that, although the prepared sorbents were proven to be efficient and economically viable in comparison to commercial synthetic resins, in those works no detailed study was done to either exclude or, most importantly, rank the relevance of any other sorption mechanism other than ion exchange in their respective applications.
2.1. Activated Carbons

Activated carbons (AC) can be generally described as highly microporous carbons which, after carbonization and activation of the precursor material, are comprised of microcrystalline graphite layers interspersed with non-graphitic aromatic carbon structures containing heteroatoms, such as oxygen and hydrogen, and in which many carbon-carbon bounds are left incomplete, thus creating chemically active sites which are responsible for specific physical and chemical interactions with an assortment of sorbates of great relevance in adsorption processes (Rodriguez-Reinoso and Molina-Sabio, 1998; Bourke et al., 2007). In simple terms, activated carbons can be described as thermally produced solid carbons with high porosity, high internal surface areas (usually ranging from 500 up to 2000 m2 g-1) and a suitable surface chemical make up (which impart a degree of reactivity). Due to their high capacity for adsorption of a broad spectrum of sorbates (metal ions, dyes, phenol and phenolic derivatives, and others), activated carbons are quite versatile and are the most common sorbents currently being used in the chemical process industry and other sectors worldwide. As adsorbents, they are used in purification, decolorization, deodorization, dechlorination, defluoridation, separation and concentration of products in areas as diverse as food, pharmaceutical, chemical, petroleum, nuclear, and automobile industries as well as for the treatment of industrial wastewaters and flue gases, and of drinking water (Bansal and Goyal, 2005). However, as fantastic adsorbents as they might appear to be, activated carbons do present several disadvantages, with the major drawback being the cost (Savova et al., 2001). Other disadvantages are non-selectivity (for non-tailored carbons, which is the general case), inefficacy for certain types of sorbates (e.g., dispersive and vat dyes), and expensive, nonstraightforward regeneration of the saturated carbon which, in general, incur in loss of adsorption capacity (Crini, 2006). These disadvantageous aspects are the main drive for the search of more economic adsorbents and lignocellulosic wastes such as those from the agricultural and food sectors have been extensively demonstrated to be suitable candidates for the production of activated carbons as precursor materials (Ioannidou and Zabaniotou, 2007; Dias et al., 2007). Thus, an agricultural or food waste (in general, lignocellulosic materials) can be turned into an activated carbon by means of a carbonization of the biomass followed by an activation of the carbonized biomass (charcoal), which can be carried out in a single or more steps, with the activation processes being either physical or physical/chemical, at low (400 to 600oC) or high (700 to 1000oC) temperatures. The charcoal itself, the solid residue of the carbonization of vegetable or animal matter by heat in the absence of air at temperatures above 300oC (Bourke et al., 2007), can sometimes be used as a sorbent when it already presents high
175
internal surface area (well-developed accessible microporosity) and a diversity of desirable functional groups at the surface, thus requiring no further processing (activation). Physical activation of a carbonaceous material constitutes a process in which the desired physical characteristics of the final product the activated carbon are developed by a heat treatment of the precursor in a stream of gases, and it is usually carried out in a two-step process. First, the carbonaceous material is carbonized at temperatures ranging from 400 to 800oC, in an inert atmosphere (usually nitrogen), to transform it into a charcoal. Basically, during the carbonization process, the carbonaceous material will decompose by breaking of the least stable bonds within its structure (e.g., methylene and oxygen bridges between the aromatic layers). The result of breaking these bonds is the formation of radical components which, upon stabilization by hydrogen addition, leads to the production of volatile compounds (Demirba, 2001). The volatile matter is driven-off the transforming carbon and the non-carbon elements are mostly removed. The volatile matter content of the lignocellulosic precursor is the key factor that influences the chemical structure of charcoals (Mszros et al. 2007) with the mineral content possibly catalyzing some of the pyrolytic reactions during carbonization. The formation of the solid charcoal is a result of the polymerization and condensation reactions occurring between volatile and non-volatile radical components (Demirba, 2001). Charcoals are generally slightly microporous and a second heat treatment, with the aid of oxidizing gases, such as CO2, steam, air or a mixture of them, at temperatures ranging from 600 to 1000oC, is necessary for the further generation of a well-developed micropore structure. Details on the intrinsic chemical and physical changes occurring during carbonization and physical activation processes can be found in the compelling works of Rodrguez-Reinoso and Molina-Sabio (1998), Mszros et al. (2007) and Bourke et al. (2007). Carbon dioxide is the preferred gas for physical activation since it can be easily handled, it is clean and allows for a reasonable control of the activation process due to the slow rates of the reactions it promotes on the char at temperatures around 800oC (Ioannidou and Zabaniotou, 2007). In general, considering lignocellulosic precursors, activation with CO2 leads to the creation and widening of small micropores, whereas activation with steam only promotes widening of the existing micropores in the char structure (Rodrguez-Reinoso and Molina-Sabio, 1998), thus producing activated carbons with mesoto macropore structures. An advantage of activation with steam is that it is less expensive than activation with carbon dioxide. The chemical activation of charcoals is usually carried out by incorporation of one or more elements or functional groups onto the carbon structure, by means of its impregnation with an activating agent. Chemical activation is considered rather advantageous in regard to physical activation since both the carbonization and activation steps are carried out simultaneously and usually at lower temperatures than in physical activation (Ioannidou and Zabaniotou, 2007). Dehydrating (e.g., ZnCl2, CaCl2 and others) and oxidizing agents (e.g., HNO3, H2O2 and others) are the most common chemicals employed in activation processes. Chemical activation promotes chemical reactions in the carbon matrix that, in turn, promotes physical changes to the precursor material by favoring the creation (by volatilization of organic matter) and, sometimes, further enlargement of pores, thus increasing the internal surface area and the pore volumes, which are highly desirable properties. It also modifies the chemical make up of the adsorbent surface, thus, altering its functionality in regard to its affinity to specific sorbates.
176
In regard to the subject of adsorption, the porosity of carbons is usually classified into three major categories (IUPAC, 1972): (i) micropores with a width less than 2 nm; (ii) mesopores with widths between 2 and 50 nm; and (iii) macropores with widths greater than 50 nm. Although still subject of debate (Zdravkov et al., 2007), the IUPAC classification is the one being considered in our discussion of the matter. The micropores are the ones that contribute most to the high internal surface areas. However, they can only provide high adsorptive capacities for molecules of small sizes since they are usually narrow spaces (ideally envisioned as slit-shaped) between the three-dimensional network of graphitic and non-graphitic structures, with half pore widths between 3 and 10 . Bourke et al. (2007) stated that another way to account for micropores is to consider the presence of intermittent voids within condensed hexagonal planes, thus creating positions for free radicals and dangling carbon bonds to which the well-known chemisorption property of biocarbons can be attributed. Mesopores are of relevance for the adsorption of larger molecules and, together with macropores, facilitate the transport of molecules to the interior of the particle (Rodrguez-Reinoso and Molina-Sabio, 1998). Thus, depending on the target molecule to be removed from a gas or solution by adsorption, a well-structured network of interconnected meso- and micropores is highly desirable. The most common technique employed for the characterization of the porosity of activated carbons is the adsorption of gases with molecules of known sizes and properties, such as N2 and CO2 in the BET method. When a rough estimate of the porosity and internal surface area is acceptable, adsorption of other molecules (of known sizes and properties) are also used in the characterization of the carbon texture (e.g., iodine, methylene blue, rhodamine B and others). The porosity is the major property responsible for the carbon texture and consequently will dictate its mechanical properties, which are fundamental to the design and selection of the type of equipment to be employed in large-scale adsorption processes. Although physical structure was the main focus of the characterization of activated carbons for decades, since its introduction as an adsorbent in industrial scale in the early 1900s (Pollard et al., 1992), it is now widely recognized and accepted that a complete characterization of adsorbent carbons must also scrutinize their chemical structure (Rodrguez-Reinoso and Molina-Sabio, 1998). In that regard, emphasis should be placed in the determination of the types of oxygenated functional groups present which play a major role in influencing the surface characteristics and consequently the adsorption behavior of an activated carbon. The presence of oxygenated groups on the internal and external surfaces of activated carbons can be attributed to the following aspects: (i) low temperatures of carbonization and activation, that are not able to remove some of the more thermal resilient groups by volatilization; (ii) chemisorption of oxygen introduced to an outgassed carbon surface; and (iii) insertion of oxygenated groups onto the surface by chemical reaction with oxidizing gases or solutions. Oxygen groups can impart acidic or basic characters to the surface and, thus, promote different kinds of interactions between the carbon and the target sorbate in aqueous solutions. The most common oxygenated groups detected in the surfaces of activated carbons are carboxylic, phenolic, lactone, carbonyl, ether, pyrone and chromene. Thermogravimetric studies reveals that, during carbonization of a lignocellulosic material, carbolxylic groups are the most thermolabile (least refractory) oxygenated groups, decomposing to CO2 at temperatures in the range of 100-400oC; carboxylic anhydrides and lactones decompose in the range of 430-660oC; the other types of oxygenated groups (phenolic, ethers, carbonylic and quinonic) are thermally decomposed as either CO or CO2 at
177
temperatures higher than 600oC, with the most thermally stable being the pyrone structures (decompose at 900-1200oC) (Bourke et al., 2007). Some of the more refractory functionalities are believed to be products of pyrolysis reactions catalyzed by components of the biomass such as potassium, phosphorus, magnesium and sodium (Mszros et al. 2007). Thus, to control the acidic or basic nature of the activated carbon being produced, aside from the inherent properties of the precursor material, the temperature and the heating rates should be carefully controlled in the carbonization/activation process. The acidity/basicity character of activated carbons is usually quantitatively determined by common titration methods. The Point of Zero Charge (PZC), characterized by the pH in which the negative charges on the surface of the carbon are exactly counterbalanced by the positive charges, is an important parameter used in the characterization of activated carbons since it will dictate its performance when electrostatic forces are relevant to the adsorption process. The determination of the pHPZC of a carbon is of utmost relevance to adsorption applications where the target sorbate is either in a cationic or an anionic state. At pH values higher than that of the PZC, the adsorbent surface is predominantly negatively charged and the removal of cations by adsorption is greatly enhanced, favored by electrostatic attraction. On the other hand, at pH values lower than that of the PZC, the net charge of the surface is predominantly positive, thus favoring the sorption of anions. The PZC of a carbon can be determined by measurements of its zeta potential, by measurements of its convergent pH at equilibrium in solutions with varying initial pH values and varying amounts of the carbon sorbent (Oliveira et al., 2008a), or by the pH drift method described by Lopez-Ramon et al. (1999). The variation of the pH value for the PZC of activated carbons with the total content of oxygenated groups at the carbon surface was studied by the Lopez-Ramon et al. (1999). lvarez-Merino et al. (2008) demonstrated the temperature dependence of the point of zero charge of oxidized and non-oxidized activated carbons, where a decrease in the PZC was observed for an increase in temperature, for both oxidized and non-oxidized activated carbons. The number of acidic groups on the carbon surface increased with increasing the temperature. Chemical characterization of the oxygenated groups in the surface of a carbon cannot be precisely done by a single analytical technique. However, it can be reasonably done by qualitative methods, such as infrared spectroscopy, or by quantitative (more like estimative) titration methods, such as Boehms method (Boehm, 1994). Boehms titration method, although certainly not flawless (Rodrguez-Reinoso and Molina-Sabio, 1998), has been the most frequent and successfully employed method for the determination of oxygenated groups on carbonaceous surfaces in the recent literature on preparation and utilization of sorbents using agricultural and food waste materials. The most common forms of commercially available activated carbons are the powdered or granular ACs. Granular activated carbons (GACs) take up a large percentage of the carbon market for being considered more versatile than the powdered carbons (Ahmedna et al., 2000) due to factors such as better regenerability and lower pressure drops in fixed-bed adsorption columns applications. A diversity of equipments is currently available for the commercial production of activated carbons, with rotary kilns and drums, and fixed and fluidized beds being the most common. The most common precursor materials used for the commercial production of activated carbons are wood, anthracite and bituminous coal, lignite, peat, and coconut shells (Pollard et al., 1992). The commercial processes are basically carried out in two stages: (i) carbonization
178
of the precursor material at temperatures below 800oC in an inert atmosphere; and (ii) subsequent activation of the carbonized material at temperatures ranging between 800 and 1000oC in an atmosphere of air, CO2 or steam (Bansal and Goyal, 2005). Flue gases, which usually contain large volumes of CO2, are sometimes used in industry (Crittenden and Thomas, 1998). Some of the common feedstocks do not constitute renewable sources (coal, lignite and peat). The precursor materials are usually expensive and their processing into activated carbons is also expensive due mostly to the fact that it is a high energy consuming process. The activation step, with either steam or carbon dioxide, involves gasification of the charcoal by means of endothermic reactions, thus, requiring the activating gases to be delivered at high temperatures (Dai and Antal, 1999). Also, since the activated carbon is an expensive product, there is usually a need to regenerate its adsorption capacity after its saturation with a sorbate and the regeneration step ends up adding more costs to activated carbon adsorption processes. The regeneration of loaded activated carbons usually employs drastic chemical and thermal conditions that will lead to the depreciation of the adsorption capacity of the carbon, thus, limiting the number of times it can be re-used. Thus, costeffective alternative technologies and materials are being thoroughly searched and researched. Natural materials that are inexpensive and abundantly available, such as agricultural and food wastes, have recently been demonstrated to present excellent potential as alternative inexpensive precursors for activated carbon production (Ioannidou and Zabaniotou, 2007; Dias et al., 2007). Ahmedna et al. (2000) classified agricultural by-products into two groups in regard to its suitability for GAC production: (i) soft compressible materials of low density, such as sugarcane bagasse, rice straw, soybean hulls, peanut shells and rice hulls, that must be mixed with a suitable binder and compressed into briquettes or pellets to increase the density of the final product; and (ii) hard, dense and not easily compressible materials, such as pecan and walnut shells, that do not require a binder or briquette formation. GACs are usually employed for the adsorption of gases and vapors. They are also used in the form of a carbon bed as in the column adsorption treatment of water for the removal of inorganic and organic pollutants. Powdered ACs are usually employed for the purification of liquids and are easily produced from soft compressible materials (e.g., sugarcane bagasse, rice straw and rice hulls) without the need of binders and conformation into briquettes or pellets (Bansode et al., 2004). It is well established in the literature that the lignocellulosic composition of the precursors dictates charcoal yield and porosity due to the differences in thermal stability of the biomaterial major components (lignin, cellulose, hemicellulose) (Mackay and Roberts, 1982a,b; Ahmedna et al., 2000; Suhas et al., 2007). In fact, several researchers have observed that lignin is the main source of char formation when compared to cellulose and hemicellulose which are considered the more volatile fraction (Suhas et al., 2007). The predominantly mesopore and macropore structure of the activated carbons produced from grape seeds and cherry stones was attributed by Gergova et al. (1994) to the high lignin content in the raw material. Daud and Ali (2004) performed a comparative study on the pore development of activated carbons produced from palm shell and coconut shell and concluded that, at any degree of burn-off, the amount of micropores (indirectly measured by the internal surface area) created in the material with higher content of lignin (palm shell) was always higher than those created in the material with lower content of lignin and higher holocellulose content (coconut shell). However, it was also observed that the activation rate was several times higher for the material with higher holocellulose content (coconut shell) than for that with lower holocellulose content (palm shell). All these results lead to the conclusion that
179
knowledge of the precursor material composition (pertaining to its major components) is a key factor to the adequate selection of raw materials to produce activated carbon with certain pore size distribution. Aside from the composition of the precursor material, the carbonization/activation conditions used such as the heating rate, the maximum heat treatment temperature, and the hold time at the maximum temperature have a strong influence on the porous structure and adsorption properties of the resulting activated carbons (Gergova and Eser, 1996; Guerrero et al., 2008). Gergova and Eser (1996) investigated the differences in the pore structure of ACs produced from apricot stones by two different processes, a two-step physical activation and one-step pyrolysis/activation, with steam being the activating agent in both cases. Both methods produced activated carbons with a rather wide pore size distribution with well developed microporosity. In order to achieve good porosity development and high surface area, Gergova and Eser (1996) suggested that, for one-step AC production processes, relatively low temperatures and long reaction times should be used, whereas for two-step processes the recommended conditions are higher temperatures and shorter activation times. However, considering the lower activation temperatures used in one-step processes, which would save both energy and time by eliminating the carbonization step, their final recommendation is to strongly consider the one-step steam activating process for the production of activated carbons from lignocellulosic materials such as apricot stones. Guerrero et al. (2008) carried out a comparative study of the properties of rice husks and eucalyptus wood chars produced at various carbonization temperatures and heating rates under nitrogen flow. The low heating rate (10oC min-1) experiments were conducted in a fixed bed reactor with the final temperature in the range of 600 to 900oC and a soaking time of 1 h. The high heating rate experiments were conducted in a fluidized bed reactor with the final temperature in the range of 800 to 900oC. The char yields for both carbonaceous materials were enhanced by decreasing the heating rate. As the heating rate increased, the ratio of hydrogen to carbon in the chars increased. The high ash content of the rice husks (mostly silica) compared to the content of the eucalyptus wood lead to rice husk chars with lower values of CO2 surface area than those for eucalyptus chars. The surface areas of the chars of both materials reached a maximum value at temperatures between 700 and 800oC. At temperatures higher than 800oC, the specific surface areas for both rice husk and eucalyptus chars diminished significantly. This reduction in surface area at higher temperatures was attributed to thermal annealing. In regard to physical activation, nitrogen, carbon dioxide, steam and mixtures of these were the chief agents used for the preparation of activated carbons using lignocellulosic materials reported in the scientific literature (Ioannidou and Zabaniotou, 2007; Dias et al., 2007). In the majority of works published in the scientific literature, the preparation methods of activated carbons using agricultural and food wastes involved a two-step process (carbonization of the precursor followed by activation of the char). The temperatures for AC preparation in two-step processes were usually in the range of 450 to 550oC and the soaking times at the final carbonization temperature were in the range of 30 min to 2 h. In the physical activation step, temperatures were usually in the range of 700 to 900oC and the activation times at the final temperature were mostly in the range of 30 min to 6 h. In one-step carbonization/activation processes, the processing maximum temperatures were in the range of 600 to 800oC and the most commonly employed activating agent was steam. An extensive compilation of works published in the literature on agricultural residues and the respective
180
physical activation processes conditions used to prepare activated carbons using them as precursors was presented in the comprehensive review by Ioannidou and Zabaniotou (2007). Thus, in this essay, the comments will be restricted to those materials and AC preparation methods that were not thoroughly covered in their review and that are herein envisioned to be relevant to the evolution of AC production technology towards more economic/sustainable processes and materials. The reader is encouraged to read the aforementioned review for a broader insight on the subject. Ioannidou and Zabaniotou (2007) and Dias et al. (2007) compiled extensive lists of agricultural wastes that have been used as lignocellulosic precursor materials in two-step physical-activation processes for the preparation of activated carbons. The most common materials used were nutshells (e.g., walnut, pecan, hazelnut and pistachio), hulls (e.g., rice, peanut and corn), husks (e.g., rice and coffee), fruit stones (e.g., olive, cherry and apricot); seeds (e.g., grapes and rapeseed); oilseed cakes (e.g., rapeseed and olive); and others such as sugarcane bagasse and corncob. Other examples of agricultural and food wastes not listed by Ioannidou and Zabaniotou (2007) and Dias et al. (2007) using two-step processes are moringa oleifera seed husks (Warhurst et al., 1997a,b); bamboo dust and groundnut shell (Kannan and Meenakshisundaram, 2002); de-oiled soya (Gupta et al., 2005); babassu (Orbygnia speciosa) (Jaguaribe et al., 2005); chicken waste (Zhang et al., 2007); waste beer lees (Lee et al., 2007); Ceiba pentandra hulls (Rao et al., 2008); and rubber (Hevea brasiliensis) seed coat (Hameed and Daud, 2008). Preparation of activated carbons using agricultural wastes can be successfully carried out by one-step physical activation processes using either steam or a mixture of steam and carbon dioxide or steam and nitrogen as activating agents. Although this type of preparation method has been used since the early 1990s (Minkova et al., 1991; Minkova et al., 1992; Gergova et al., 1994; Warhurst et al., 1997a,b), it has gained much attention in recent years (Minkova et al., 2000; Alaya et al., 2000; Savova et al., 2001; Minkova et al., 2001; El-Hendawy et al., 2001; Girgis et al., 2002; entorun-Shalaby et al., 2006; Budinova et al., 2006; Daifullah et al., 2007; David, 2008) and has been commonly termed steam pyrolysis. One-step steam pyrolysis of lignocellulosic materials, when compared to conventional two-step carbonization/activation AC production processes, has proved to be a promising AC preparation method for it saves energy (it is usually performed at moderate temperatures, e.g., 600-700oC) and time (eliminates one processing step). It results in relatively high carbon yields, and it provides a means for the production of a diversity of liquid products and energyrich gaseous products. In this type of process, the lignocellulosic material is pyrolyzed under a stream of steam at final temperatures in the range of 600 and 700oC. Aside from being an activating agent, the action of the steam is two-fold (Alaya et al., 2000): it acts as a carrier gas, promoting a fast and effective removal of the pyrolysis gaseous products, which could eventually block some of the developed pores; and it acts as a selective gasification medium, preventing excessive gasification and, thus, controlling the porosity of the final product. In this type of process, it was observed by Savova et al. (2001) that lignocellulosic materials with greater contents of lignin developed activated carbons with macroporous structure whereas those with higher contents of cellulose yielded activated carbons with a predominantly microporous structure. The lignocellulosic precursor materials used for preparation of activated carbons by steam pyrolysis presented in the literature were grape seeds, cherry stones and almond shells (Savova et al., 2001); apricot stones (Gergova and Eser, 1996; Savova et al., 2001; entorun-Shalaby et al., 2006); barbecue charcoal, rice husks,
181
date pits, and date palm branches and leaves (Alaya et al., 2000); olive stones, bagasse and Miscanthus pellets (Minkova et al., 2000); corncobs (El-Hendawy et al., 2001); peanut hulls (Girgis et al., 2002); birch wood (Minkova et al., 2000; Budinova et al., 2006); rice straw (Daifullah et al., 2007); and rape seeds after extraction of oil (David, 2008). Chemical activation is considered to present several advantages when compared to conventional two-step physical activation process for the preparation of activated carbons (Lillo-Rdenas et al., 2003; Molina-Sabio and Rodrguez-Reinoso, 2004): (i) the carbonization/activation processes require lower energy inputs (lower temperatures, usually in the range of 450-600oC); (ii) it is carried out in a single-step process; (iii) it usually leads to higher carbon yields; (iv) high internal surface areas are easily obtained; (v) the porosity is usually well developed and the pore size distribution more easily controlled; (vi) it promotes a reduction in the mineral content; and (vii) the activating agent can be partially recovered. The alleged disadvantages of this type of activation are the corrosiveness of the process and the washing stage (Lillo-Rdenas et al., 2003). The most common chemical activation agents used in the preparation of activated carbons from lignocellulosic materials are potassium hydroxide (KOH), phosphoric acid (H3PO4) and zinc chloride (ZnCl2) (Ioannidou and Zabaniotou, 2007). Although chemical activation in the preparation of activated carbons has been used for a long time, only recently the intrinsic activating mechanisms of specific chemical agents have been thoroughly studied and elucidated and the reader is encouraged to refer to the works by Lillo-Rdenas et al. (2003), Molina-Sabio and Rodrguez-Reinoso (2004) and Nakagawa et al. (2007) for a detailed insight into these mechanisms. The basic procedure in chemical activation involves an impregnation of the precursor material with the chemical agent (either in aqueous solution or in solid state) prior to heat treatment. After a specified period of impregnation, the solution is evaporated and the impregnated material is subjected to thermal treatment (carbonization/activation). During impregnation, the activating agent penetrates the precursor material and promotes the depolymerization of the precursor constituents into smaller units. When the impregnating solution is evaporated by an increasing temperature, the concentration of the impregnating agent is increased and its reactivity with the precursor is intensified. Swelling of the precursor material is facilitated by the partial depolymerization of lignin which causes a decrease in its mechanical properties, and the decomposition of hemicellulose and cellulose into smaller units promotes mobility and migration of the cellular matter. When the impregnating solution is completely evaporated, the physically and chemically modified precursor will present a relatively weak structure and the mobile products of the chemical action during impregnation will be converted into tars and be deposited on the internal and external surfaces of the material (Nakagawa et al., 2007). KOH, ZnCl2 and H3PO4 are all dehydrating agents. However, aside from being a strong dehydrating agent, H3PO4 is also a Brnsted acid, thus promoting bond cleavage more effectively than the other agents, and, as a consequence, the physical and chemical changes caused by its action are more intense (Nakagawa et al., 2007). H3PO4 is also capable of reacting with the chains of degraded biopolymers to form phosphate esters and polyphosphates. Molina-Sabio and Rodrguez-Reinoso (2004) used olive and peach stones as precursor materials for the preparation of activated carbons using KOH, ZnCl2 and H3PO4 as activating agents in order to study the role of chemical activation in the development of carbon porosity. The main conclusion of their work was that the three chemicals are able to produce a large development of microporosity and that, upon increasing the degree of activation, KOH only produces a widening of micropore width, ZnCl2 further
182
develops small microporosity and H3PO4 leads to a more heterogeneous distribution of pore sizes. Chemical agents are assumed to function as templates in the creation of microporosity at moderate temperatures (<500oC) since they are incorporated into the interior of the precursor material, thus inhibiting the expected contraction of the material with the increasing temperature in the carbonization process. This assumption was corroborated by Molina-Sabio and Rodrguez-Reinoso (2004) when it was observed that the porosity created by ZnCl2, at impregnation ratios (g Zn/g of precursor) smaller than 0.4, was due to the spaces left by the chemical after it was washed from the prepared carbon, i.e., the measured volume of micropores and mesopores was identical to the volume of zinc chloride used for impregnation. For all activating agents, there was little weight loss of the precursor material at temperatures higher than 500oC, indicating that the basic pore structure was already formed and, thus, the activity of the reagent (strictly related to the development of porosity) was considered to be complete. Lillo-Rdenas et al. (2003) studied the effects of different atmospheres during the heat treatment of the precursor material (anthracite) using NaOH and KOH as activating agents. They concluded that nitrogen atmosphere provided the best activation results and that steam could also be used, although it was not as good as nitrogen. Lillo-Rdenas et al. (2003) also recommended that an atmosphere of CO2 should be avoided when using NaOH and KOH as activating agents for it can lead to the production of the respective sodium and potassium carbonates which preclude the development of porosity. Extensive lists of agricultural wastes that have been used as lignocellulosic precursor materials in one-step chemical-activation processes for the preparation of activated carbons were also presented by Ioannidou and Zabaniotou (2007) and Dias et al. (2007). The most common lignocellulosic materials used were nutshells (e.g., almond, pecan, hazelnut and macadamia), hulls (e.g., peanut), husks (e.g., rice), fruit stones (e.g., olive and apricot); peels (e.g., cassava); and others such as corncob. Other examples of agricultural and food wastes not listed by Ioannidou and Zabaniotou (2007) and Dias et al. (2007) using chemical activation processes are Arundo donax cane by H3PO4 activation (Vernersson et al., 2002); coffee beans husks by H3PO4 chemical activation (Baquero et al., 2003); Terminalia arjuna nut by ZnCl2 activation (Mohanty et al., 2005); coffee grounds by H3PO4 and ZnCl2 activation (Namane et al., 2005); coir pith by ZnCl2 activation (Namasivayam and Sangeetha, 2006); rice hull by H3PO4 activation (Guo and Rockstraw, 2007); waste beer lees by KOH activation (Lee et al., 2007); avocado kernel seeds by H3PO4 activation (Elizalde-Gonzlez et al., 2007); oil palm fibre by KOH activation (Tan et al., 2007); olive stones by H3PO4 and ZnCl2 activation (Nakagawa et al., 2007); rubber (H. brasiliensis) seed coat by KOH activation (Hameed and Daud, 2008); jackfruit peel waste by H3PO4 activation (Prahas et al., 2008); coffee endocarp by KOH activation (Nabais et al., 2008); sunflower oil cake by sulfuric acid activation (Karagz et al., 2008). Conventional and non-conventional AC preparation methods using lignocellulosic material-based described in the literature were conducted in a diversity of equipments such as common lab muffle (e.g., Gupta et al., 2005; Sathishkumar et al., 2007; Malik et al., 2007; Rao et al., 2008) and tube furnaces (e.g., Gergova and Eser, 1996; Savova et al., 2001), domestic microwave oven (e.g., Hirata et al., 2002), bench-scale fixed and fluidized bed reactors (e.g., Guerrero et al., 2008), and an industrial pyrolyser (e.g., Zabaniotou et al., 2008). Promising alternative (sometimes innovative) cost-effective methods of AC preparation have been proposed aplenty in the scientific literature, mostly at lab/pilot scale (e.g., Dai and
183
Antal, 1999; Guo and Lua, 2000; Savova et al., 2001; Hirata et al., 2002; Ng et al., 2003; Choy et al., 2005; Malik et al., 2007) with a few applications in industrial scale (e.g., Zabaniotou et al., 2008). In regard to the applications of the agricultural and food waste-based activated carbons in adsorption processes presented in the scientific literature, the majority of them are in the area of removal of heavy metal ions and dyes (mostly textile) from aqueous solutions (Pollard et al., 1992; Crini, 2006; Ioannidou and Zabaniotou, 2007; Dias et al., 2007). Applications to the adsorption of phenol and substituted phenols (Daifullah and Girgis, 1998; Rengaraj et al., 2002; Mohanty et al., 2005; Radhika and Palanivelu, 2006; Sathishkumar et al., 2007; Singh et al., 2008) from aqueous solutions are becoming increasingly common in the literature on agricultural and food waste-based activated carbons in recent years. Examples of uncommon applications of agri-food waste-based activated carbons are the adsorption of volatile organic compounds (bromo-dichloromethane, benzene, carbon tetrachloride, 1,1,1-trichloromethane, chloroform, and 1,1-dichloromethane) by pecan shell and almond shell-based granular activated carbons (Bansode et al., 2003); adsorption of pyridine derivatives such as picoline, -picoline, and -picolin, from aqueous solutions using Ac prepared from coconut shells (Mohan et al., 2005); use of activated carbons prepared from coffee residue for the adsorption of formaldehyde (Boonamnuayvitaya et al., 2005); removal of phenylalanine from aqueous solution by spent coffee grounds-based AC activated by H3PO4 (Latini et al., 2008). The mechanisms involved in the adsorption of metal ions and dyes are dependent on the physical and chemical properties of the activated carbon and the conditions in which the adsorption process occur (pH of the solution, temperature, sorbate initial concentration, and other factors). The most common adsorption mechanisms observed for metal ions and dyes onto activated carbons in the literature are ion exchange (favored by electrostatic attraction when the conditions are appropriate), chelation and complexation. In the case of the adsorption of hexavalent chromium from aqueous solutions, there are ongoing studies and discussions in the literature of its removal by an adsorption-coupled reduction mechanism. In these studies, it is postulated and verified that hexavalent chromium is reduced to its trivalent state before being effectively adsorbed onto the surface, with the reduction being caused by the presence of specific heteroatoms and functional groups on the sorbent surface (Valix et al., 2006; Park et al., 2007, 2008). In a study on the use of activated carbon produced from peanut shells by a two-step carbonization/activation process, using N2 and steam, respectively, for the removal of divalent metal ions, Wilson et al. (2006) demonstrated that the metal binding on the AC surface was strongly dependent on the density of negative charges on the carbon surface. Moreover, and most importantly, it was demonstrated that the internal surface area did not play a significant role in metal ion adsorption since the noncrushed carbons presented higher metal ion binding capacity. The majority of the published works in the scientific and technological literature does not address scale-up, implementation, and technical and economical analysis of processes for the large scale production of sorbents from agricultural and food wastes, and the majority of the results presented were restricted to lab scale. However, commendable work has been done by Marshall and co-workers in this aspect, and the technical and economical feasibility of producing adsorbents from agricultural wastes in large scale was several times demonstrated by their group, with special reference to the work by Ng et al. (2003), where a detailed description of a large-scale process for the production of phosphoric acid-activated pecan
184
shell granular activated carbon is presented, together with the associated economical analysis. Choy et al. (2005) presented a detailed process design and a comparative analysis of the process economics of a stand-alone bamboo carbonization plant with a plant that is integrated into another major processing facility. Also, the work by Zabaniotou et al. (2008) has addressed the production of activated carbon from olive kernels at industrial scale, achieving surface areas of the order of 1000 to 1200 m2 g-1 with a two-step process employing physical activation with H2O-CO2.
2.2. Biosorbents
A biosorption process is commonly defined as a passive physicochemical uptake of a sorbate from a solution by living or dead biomass cells without the occurrence of metabolic transformation/accumulation of the sorbate, i.e., it is strictly a function of the chemical makeup of the cell wall (Volesky, 1990). Although this definition does not impose any restrictions to the nature of the biomass, the terminology biosorption is almost exclusively used when the biomass is comprised of living or dead microorganisms, such as bacteria, fungi, yeasts and algae (Volesky, 1990; Davis et al., 2003; Aksu, 2005), sometimes subjected to mild chemical and thermal treatments. The concept of biomass herein used is that presented by Stout (1984) where it was defined as all renewable organic matter including plant material, whether grown on land or water; animal products and manure; food processing and forestry by-products; and urban wastes. In this section, we are considering only biomass from agricultural practices and agricultural and food processing industry. Forestry byproducts and animal products and manure are not included. In order to broaden the spectrum of sorbents to fall into the category of biosorbents and yet to better characterize the nature of the sorption process as biosorption, avoiding misusage of the term, we herein present the definition of biosorbent as biological matter (living or dead) which retain its original cellular macrostructure, even after mild chemical and/or thermal treatment (temperatures lower than 200oC), and is used for the removal of sorbates from a solution. In other words, no relevant changes occur regarding the structure of the biological precursor while some degree of chemical modification of the precursor surface is allowed, e.g., treatment (impregnation) of the biological matter with formaldehyde or methanol to reduce leaching of organic matter and avoid fungal growth on the surface of the sorbent during adsorption operations (Oliveira et al., 2008a); or the mild heat treatment with weak carboxylic acids to insert carboxylic groups onto the surface and enhance adsorption capacity for certain sorbates. The integrity of the cell has been demonstrated to be relevant for the binding capacity of dyes in fungal biomass (Fu and Viraraghavan, 2001) and the same would be expected for other types of biomass. Untreated biomass originating from the plant kingdom, mainly those considered to be solid residues from agricultural practices, are undoubtedly the cheapest materials available to be used as biosorbents. They constitute a general class of lignocellulosic materials that are quite abundant worldwide and their proper disposals currently represent major environmental issues. Lal (2005) estimated the total crop residue produced in the world to be ~4000106 Mg/year, where crop residue was defined as the non-edible plant parts that are left in the field after harvest, not including in this definition the remains that are generated from crop-packing plants or those that are discarded during crop processing. Also, food industry wastes are not considered in that number. Hence, an estimate for the total production of wastes/residues in
185
these sectors would be several orders of magnitude higher. In considering all forms of solid lignocellulosic residues produced from these sectors and the environmental problems caused by their improper disposal, extensive research has been done in the past years to propose suitable processes and products to mitigate the problem of disposal of this type of material. Direct use as biofuels is the current chief form of disposal worldwide. However, biomass burning can be environmentally hazardous and its impact on offsetting fossil fuel emissions turned it into the most promising major energy source through the manufacturing of biofuels such as ethanol and biodiesel. However, not all the residue produced can be or should be used for bioenergy production. Indiscriminate removal of agricultural biomass residue can lead to decline in soil quality with long-lasting adverse impacts on the environment and on the agronomic production capacity (Lal, 2005). Therefore, the residue must be used judiciously to enhance ecosystem functions, i.e., in some way the lignocellulosic material has to be returned to the soil to maintain the ecosystem balance of its major components and assure the renewability of the material sources. Thus, the use of unmodified (or slightly modified) agricultural and food residues as biosorbents is an attractive way of complying with this concept. Biosorbents, in general, require little processing. When not in an appropriate size as it is, the biological material is usually cleaned (washing with water and weak acid solutions being the most common methods), and crushed, ground or cut into small pieces to meet the requirements of offering reasonable surface areas and appropriate bulk densities when loaded into recipients or other types of equipment. High surface areas are not a strict requirement for agri-food waste-based biosorbents since their surface chemical makeups are extremely heterogeneous and their inherent porosities are usually negligible compared to those of thermally or chemically manufactured sorbents. The extreme variability in both chemical composition and physical properties of the lignocellulosic waste materials constitute an attractive characteristic when considering their use as biosorbents for specific adsorption applications (e.g., removal of metal ions, dyes, pesticides and other organic pollutants from aqueous solutions). Since surface area is deemed not relevant for this type of sorbent (usually it is of the order of a few meters per gram of material), the physical properties become relevant only as related to the biosorbent mechanical strength. On the other hand, the chemical composition of the biosorbent available surface plays a major role in its capacity, affinity and selectivity properties related to the adsorption of specific sorbates. Thus, chemical characterization of the biosorbent and of the sorbate speciation is mandatory for an accurate determination of the mechanisms taking place during biosorption. As it is in the case of adsorption, considering the diversity of chemical functional groups present in the cell walls of biological matters and the nature of the sorbates in the solution, biosorption processes can occur by any of the following mechanisms: chemisorption by complexation, coordination, chelation, and ion exchange; physical adsorption; and microprecipitation (Volesky, 2001). In the case of biosorption of heavy metals, it is now well established that the removal of metal ions from solution by a biosorbent predominantly occurs by exchange for counterions (such as calcium, potassium, magnesium and sodium) present in the biomass (Kratochvil and Volesky, 1998). Whatever is the adsorption mechanism for a specific pair biosorbent-sorbate, it has been demonstrated in the literature several times that when using a biosorbent the pH of the solution is the major parameter influencing its adsorption performance (Kratochvil and Volesky, 1998; Davis et al., 2003; Crini, 2006). The
186
initial sorbate concentration is another parameter that is often cited as of relevance to the biosorption performance. The types of biosorbents and their respective applications to a variety of sorbates published in the literature are quite numerous and a thorough review of the literature would be unfeasible for this type of essay. Therefore, a few works were randomly selected to be briefly described here and give the reader a clear view of the potential applications of agricultural and food wastes as biosorbents. Orange peels were used by Namasivayam et al. (1996) for the adsorption of dyes such as congo red, procion orange and rhodamine-B. Both congo red and procion orange are anionic in nature and their increased adsorption in an acidic medium and their increased desorption in an alkaline medium indicated that the most probable mechanism for the sorption of these dyes was ion exchange. In the case of rhodamine-B, an increase of pH from 3.0 to 11.0 did not show a marked change in the percentage desorption indicating that ion exchange might not have a significant role in the adsorption process and chemisorption was the suggested mechanism for the dye uptake. The adsorption capacity was much higher for congo red (22.4 mg g-1) than for procion orange (1.3 mg g-1) and rhodamine-B (3.22 mg g-1). Nevertheless, waste orange peel was considered to be an effective adsorbent for the removal of dyes from aqueous solution. The removal of direct red and acid brilliant blue by adsorption on to banana pith was also studied by Namasivayam et al. (1998) and it was demonstrated that an acidic pH was favorable for the adsorption of both dyes and an alkaline pH was favorable for desorption of the dyes. Incomplete desorption in alkaline medium led to the conclusion that ion exchange was not the only mode of adsorption and chemisorption might play a role in the adsorption process. Annadurai et al. (2002) used banana and orange peels as low-cost adsorbents for the adsorption of dyes from aqueous solutions. The adsorption capacities for both peels decreased in the following order: methyl orange (MO) > methylene blue (MB) > Rhodamine B (RB) > Congo red (CR) > methyl violet (MV) > amido black 10B (AB). Intraparticle diffusion of dyes within the peels particles was identified to be the adsorption rate limiting parameter. No chemical characterization of the wastes was presented in this study. The removal and recovery of malachite green from wastewater using an agricultural waste material, de-oiled soya, was studied by Mittal et al. (2005) in both batch and column systems. The de-oiled soya waste was considered successful as an adsorbent for the removal of the hazardous dye malachite green. At lower concentrations the removal of dye was almost 100%, while at higher concentrations removal was slightly lower. The adsorption was considered to take place via particle diffusion process. It was also observed that by eluting acetone through the fixed bed column, regeneration of the biosorbent could be achieved as well as a quantitative recovery of the dye. The de-oiled soya was deemed more economic than commercially available adsorbents. De-oiled soya was also successfully employed by Mittal et al. (2006) for the removal of tartrazine, a hazardous dye, in adsorption column mode. The solution pH, temperature, contact time, particle size, adsorbent dose and concentrations of the adsorbate governed the overall process of adsorption by the biosorbent. The kinetic treatment predicted that the adsorption at lower concentration, took place through film diffusion, whereas particle diffusion became active at higher concentrations. It was also demonstrated the possibility to regenerate the biosorbent and to quantitatively recover the dye with dilute NaOH solution. Aksu and Iolu (2005) used dried sugar beet pulp, an agricultural solid waste byproduct, as a biosorbent for the removal of copper(II) from aqueous solutions. The sorption
187
data indicated that the biosorption mechanism of copper(II) by dried sugar beet pulp is probably a combination of external mass transfer, intraparticle diffusion and sorption process. The obtained kinetic parameters can be used for the design of a suitable agitated batch biosorption reactor. In an attempt to reuse food waste, Tokimoto et al. (2005) investigated the possibility of using coffee grounds to remove lead ions from drinking water. The experiments demonstrated that the adsorption capacity for lead ions had a positive correlation with the protein content in coffee beans since the coffee subjected to a protein denaturing agent presented much lower adsorption capacity for these ions. Zulkali et al. (2006) applied a response surface methodology for the optimization and analysis of the batch adsorption process of lead ions using rice husks as a biosorbent. The optimum conditions for the maximum uptake of lead of 8.60 mg/g were obtained for an initial lead concentration of 50 mg/L and biomass loading of 0.2 g. The optimum temperature and pH were found to be 60oC and 5.0, respectively. Arami et al. (2006a) studied the application of Soy Meal Hull (SMH), an agricultural byproduct, for the removal of direct and acid dyes from aqueous solutions. Four textile dyes, C.I.Direct red 80 (DR80), C.I.Direct red 81 (DR81), C.I.Acid blue 92 (AB92) and C.I.Acid red 14 (AR14) were used. The presence of functional groups on the SMH surface such as hydroxyl, amine and carbonyl groups were found to be the main functional groups responsible for most of the dye adsorption. Dye desorption studies were carried out and high rates of dye desorption (98%) were obtained suggesting an efficient recovery of the adsorbate and adsorbent could be designed for such application in large scale processes. Oliveira et al. (2008a) used untreated coffee husks (CH) as sorbents for the removal of heavy metal ions from aqueous solutions as an alternative use for this coffee processing residue. The adsorption studies were conducted in batch system using divalent copper, cadmium, zinc and hexavalent chromium as sorbates. Coffee husks presented better sorption performance for low concentrations of all metal ions studied. Coffee husks maximum sorption capacity was compared to the maximum capacity of other biosorbents presented in the literature. Its adsorption capacity was higher than other untreated residues such as sugarcane bagasse, cocoa shell, banana and orange peel, and peanut hulls. The effect of the initial pH in the biosorption efficiency was verified in the pH range of 47, and it was demonstrated that the highest adsorption capacity occured at distinct pH values for each metal ion. Also, the pH of the metal ions solution was monitored before and after sorption tests, and no significant variations were observed, and this fact was attributed to a buffering action by leached potassium. The amount of leached potassium determined after sorption of Cr(VI) indicated that ion exchange may play an important role in the chromium adsorption process. The experimental data demonstrated coffee husks to be a suitable candidate for use as biosorbents in the removal of heavy metals from aqueous solutions. Untreated coffee husks were also used by Oliveira et al. (2008b) as potential biosorbents for treatment of dye contaminated waters. Methylene blue was the model dye used in batch adsorption system. The pH of the biosorption system did not present significant effects on the adsorption capacity for values above the determined pHPZC value (~4.5) being, thus, an indication that other mechanisms than ion exchange may be taking place. Rather peculiar agricultural and food wastes have also been studied as biosorbents for applications mostly in dye and metal ions removal from aqueous solutions and a few examples of these materials include: egg shell membranes, used by Arami et al. (2006a) to adsorb Direct Red 80 (DR80) and Acid Blue 25 (AB25) dyes; beer bran, used by Adachi et al.
188
(2006) to effectively adsorb several organic compounds, such as dichloromethane, chloroform, trichloroethylene, benzene, pretilachlor, and esprocarb; Sharma et al. (2006) studied the removal of cadmium from aqueous system by shelled Moringa oleifera Lam. seed powder. The adsorption properties of eggshells and eggshell membrane were studied by Tsai et al. (2006) using the dye Methylene Blue as a model sorbate. Tamarindus indica seeds were used by Agarwal et al. (2006) in the biosorption of aqueous chromium(VI). Low cost biosorbent wheat bran for the removal of cadmium from wastewater was used by Singh et al. (2006). Vijayaraghavan et al. (2006) studied the biosorption of copper(II) and cobalt(II) from aqueous solutions by crab shell particles. Biosorption of the pesticides pesticides carbaryl, atrazine and parathion in cold-pressed rapeseed (Brassica napus), moringa (Moringa oleifera) and soybean (Glycine max) was studied by Boucher et al. (2007). Pavan et al. (2008) studied the biosorption of methylene blue from aqueous solutions by yellow passion fruit waste. Although the majority of the studies conducted on the use of biosorbents for the sorption of a variety of sorbates were performed in batchwise systems, a few interesting studies were conducted in adsorption columns with the biosorbents presenting excellent performances. The adsorption of water vapor on cornmeal for ethanol dehydration was studied by Chang et al. (2006) in a fixed-bed apparatus. The analysis of mass-transfer resistance indicated that water adsorption on cornmeal was controlled by the internal mass-transfer resistance for both the low and high velocity at the end of the breakthrough curves. Han et al. (2008) employed rice husks as biosorbent for the removal of congo red (CR) from aqueous solutions in fixed bed columns. Through the experimental data it was verified that the breakthrough curves were dependent on flow rate, initial dye concentration and bed depth. It was also verified that, with the increasing of pH in the experimental condition, the adsorption capacities decreased. Thus, the removal of CR from aqueous solution was more efficient at lower initial pH value and this was attributed to the fact that, at low pH values, a significantly high electrostatic attraction exists between the positively charged surface of the adsorbent and the negatively charged CR dye. Large scale applications of agricultural and food wastes as biosorbents were not encountered in the vast literature searched. Industrial applications of algae biosorbents have been reported by Kratochvil and Volesky (1998) to be existent for metal ion removal from wastewaters, but also are scarce due mostly to a lack of understanding of the mechanism underlying the sorption process that hinders the adequate assessment of the process performance and lilmitations. Volesky (2001) stated that the technology for employing biosorption process is yet to be developed, despite the relative simplicity of biosorption processes demonstrated by a vast scientific literature on the subject. Thus, the success in its implementation on large scale relies on continued R&D efforts with a close collaboration between researchers and industrial clients since industrial effluents and conditions are not easily reproduced in lab-scale experiments.
2.3. Bone Char

The earliest applications of bone char in large scale occurred in the nineteenth century in the sugar industry where it was used for decolorization, ash removal and prevention of sugar inversion (Barrett et al., 1951). It was later employed for defluoridation of drinking water, but due to problems regarding the cost and quality of the adsorbent (it imparted bad taste to the
189
water), its application did not broaden any further. Also, the properties of the bones were considered to vary in an uncontrollable manner (Barrett et al., 1951). Although production and use of bone char in large scale has been and is currently being done in many countries, mainly for industrial sugar decolorization, the scientific literature on the preparation and use of bone char as an adsorbent is rather shy compared to the amount of literature on the other types of sorbents. Recently, scientific publications on the preparation and application of bone char as adsorbent has picked up a fast pace, mainly with the research conducted by Gordon McKay and his co-workers (Cheung et al., 2001a,b; Cheung et al., 2002; Cheung et al., 2003; Ko et al., 2003; Ko et al., 2004; Choy et al., 2004; Choy and McKay, 2005a,b). Bone char is produced from the pyrolysis of dried, crushed cattle bones, a waste of the meat industry. The bones are ground to particles of an appropriate size which are subsequently heat treated at 500700C in an airtight iron retort or in fluidized beds, under controlled conditions for periods ranging from 4 to 6 h (Arvanitoyannis and Ladas, 2008). Relatively cheap low-tech units for the production of bone charcoal were also described in the literature (Jacobsen and Dahi, 1997; Mjengera and Mkongo, 2003). Jacobsen and Dahi (1997) designed and built a kiln for the charring of bones where the walls were comprised of an inner and outer wall made of bricks with a filling of sand in between them to enable optimal isolation. The charring of the bones occurs within the chamber formed by the walls. Fire resistant cement was used to construct the inner wall to avoid cracking upon heating at the high temperatures used to char the bones (400-500oC). Temperature and oxygen concentration were determined to be the most important parameters to control the quality of the bone char. A grate was installed at the base of the kiln to enable an equally distributed inflow of fresh air. An outlet chimney at the top of the kiln regulates the inflow of fresh air to the kiln. The oxygen content of the inlet air is regulated by mixing depleted-oxygen outlet gas with fresh air. A kiln with a charring capacity of approximately 10 tons of bones per batch was constructed and put to work in Nakuru, Kenya. Mjengera and Mkongo (2003) designed and built kilns to produce bone char comprised of a cylindrical chamber with chimneys on top and fueled by wood charcoal at a ratio of 8% of charcoal/raw bones. The kiln is initially loaded with one third of the amount of charcoal at the bottom of the kiln. Upon ignition of the charcoal, the raw bones are pilled up in the kiln in a way to ensure the continuing burning of the bones from the underneath layers to the uppermost ones. Temperatures ranging from 400 to 500oC were attained with controlled air supply. Processing times varied with the kiln capacity, ranging from 6 h for a kiln capacity of 10 kg of raw cow bones up to 24 h for a kiln capacity of 150 kg. The weight loss on charring bones in this type of kiln is about 44% for a good quality bone charcoal. The produced charcoals were tested for defluoridation of waters in fluorotic areas in Tanzania. Deydier et al. (2005) performed a study on the combustion of bovine bone meal and it was demonstrated that, under the conditions used (atmosphere of air at a temperature increase rate of 3oC min-1), the thermal decomposition of the precursor material was practically complete at 550oC with a total weight loss around 80%. In an investigation on the pyrolysis products from animal bones, Purevsuren et al. (2004) chemically characterized both the bone char and the generated tar (about 5% yield), separated by atmospheric distillation. The composition of the tar was determined to be 18.6% of organic acids, 20.5% of asphaltenes and 55.9% of preasphaltenes. Chemical characterizations of bone chars reveals that they are usually composed of approximately 7090% of basic tricalcium phosphate, 9-11% of amorphous carbon, small amounts of calcium carbonate, acid insoluble ash and other minor
190
compounds (Choy et al., 2004). The calcium phosphate is in the hydroxyapatite form, and the amorphous carbon fraction is distributed throughout the hydroxyapatite structure mostly as an active thin film over about 50% of the porous hydroxyapatite surface (Choy et al., 2004), i.e., the carbon accounts for half the total surface area of the product and the calcium carbonate imparts alkaline properties to the bone charcoal (Wilson et al., 2003). Aside from sugar decolorization (Barret et al., 1951), the scientific literature has presented reports on applications of bone char for removal of heavy metals (mostly divalent copper, zinc, cadmium and mercury) from aqueous solutions (Cheung et al., 2001; Wilson et al., 2003; Ko et al., 2004; Cheung et al., 2003; Choy and McKay, 2005; Purevsuren et al., 2004; Hassan et al., 2008); removal of dyes from aqueous solutions (Walker and Weatherley, 2001; Bangash and Alam, 2006); defluoridation of water (Mjengera and Mkongo, 2003; Nahum et al., 2007; Medellin-Castillo et al., 2007); and simultaneous removal of phosphorous and chemical oxygen demand (COD) from a real secondary effluent (Xie et al., 2004). Walker and Weatherley (2001) compared the performance of a commercial granular activated carbon (total BET surface area ~1070 m2 g-1) with that of a commercial bone char (total BET surface area ~100 m2 g-1) for the removal of acid azo dyes, Tectilon 4R, Tectilon Red 2B and Tectilon Orange 3G from aqueous solution. Dye ions have a tendency to self associate (aggregation) and a measure of the degree of association is the aggregation number (N), closely related to aggregation of dimeric units. Considering a typical value for aggregation number in aqueous solution (N = 2,5), that would result in an aggregate having end on dimension 2.7 nm in the liquid phase, Walker and Weatherley (2001) calculated that only 14% of the total available surface area of the GAC would be available for adsorbates having that dimension in liquid phase. On the other hand, the calculated value for bone char resulted in 70% of its specific surface being available for adsorption of sorbates of this size. Thus, the bone char and the granular activated carbon (GAC) endedup presenting similar orders of magnitude of adsorption capacities (mmol g-1) for the three dyes studied. The adsorption of acid dyes on bone char resulted in relatively larger aggregation numbers (N =21-23) than those for GAC (N =12-19). At high aggregation numbers, the multilayer adsorption of the dyes breaks up and non-adsorbed aggregates are formed within the pores. Walker and Weatherley (2001) attributed the relative ease of desorption of acid dyes from bone char, as opposed to the irreversible adsorption of the dyes on GAC, to the multilayer break-up at high aggregation numbers. The major conclusion was that adsorption of acid dyes on bone char not only is less expensive than in commercial GACs, but also allows for the recovery of the adsorbed dyes since they can be relatively easily desorbed. Wilson et al. (2003) studied the sorption mechanisms of Cu(II) and Zn(II) onto bone char with hydroxyapatite concentrations in the range of 70 to 76% and carbon concentrations in the range of 9 to 11% (total surface area of ~100 m2 g-1). The measurements of calcium concentrations in the solution containing the metal ions suggested that ion-exchange is the most significant mechanism for the removal of Cu from the solution. There was an approximately 1:1 mol ratio of Ca:Cu measured, that would correspond to a predominant sorption mechanism by ion exchange. It was also demonstrated that, in the case of Zn adsorption, mechanisms such as chemisorption may play a more significant role than ion exchange since the Ca:Zn mol ratios were considerably lower (~0.2:1). The accurate mechanisms for zinc adsorption were not determined. Bone charcoal was considered to present a high capacity for the removal of Cu(II) and Zn(II) from aqueous solutions when
191
compared to other adsorbents. It was also concluded that not only copper is removed more efficiently than zinc but it is also removed to a greater capacity. The adsorption performance of bone chars for divalent metal ions was studied and reported by McKay and co-workers in a series of papers published in the literature (Cheung et al., 2001; Ko et al., 2004; Cheung et al., 2003; Choy and McKay, 2005). Cadmium, copper and zinc were the metal ions used and bone char adsorption capacities for the three metal ions was demonstrated to be much higher than those of most sorbents reported in the literature for these metals. Structural studies demonstrated the metal ion sorption mechanisms involved to be sorption onto calcium hydroxyapatite and ion exchange with calcium in the calcium hydroxyapatite lattice (Cheung et al., 2002). The effect of the activation temperature on bone char was studied by Bangash and Alam (2006) in adsorption studies of the dye Patent Blue VF. The carbonization temperature (600 to 1000oC) had a significant effect on the removal of the dye from aqueous solutions. The adsorption process was demonstrated to be controlled by intraparticle diffusion. The adsorption of fluoride from water solution on bone char was studied by Nahum et al. (2007). The surface area of the bone char was in the order of ~100 m2 g-1 and the pHPZC was basic. The adsorption capacity for fluoride increased with a decrease in the solution pH due to electrostatic interactions between the fluoride anions and the predominantly positively charged surface of the bone char. The adsorption of fluoride on bone char was determined to be mostly by ion exchange mechanisms. The fluoride adsorption capacity of bone char was compared to those of traditional adsorbents employed in defluoridation of water and it was 1.3 times smaller than that of polymeric resin IRA-410 and 2.8 times higher than that of activated alumina which is commonly used in such application.
2.4. Chitin and Chitosan-based Sorbents

Chitin, one of the most abundant biopolymers in nature (second only to cellulose), is a white, hard nitrogenous polysaccharide made up of acetylglucosamine units. The main sources of chitin are the exoskeletons of crustaceans (mostly crab and shrimp shells) in which it naturally functions as a structural polysaccharide; much like cellulose does in the plant kingdom. Other natural sources of chitin include fungal biomass, insect cuticle and squid pen (Guibal, 2004). It is a highly insoluble material, presents low chemical reactivity, and is considered a major source of surface pollution in coastal areas (Kumar, 2000; Guibal, 2004). Chitin can be deacetylated by alkali treatment to produce chitosan, which has different but rather interesting properties when compared to chitin. The polymer will be denominated chitosan when the degree of deacetylation (> 60%) turns it soluble in acidic solutions (Guibal, 2004). Commercially produced chitosan usually presents degrees of deacetylation between 70 and 95%, and its source is largely from the chitin of the crab and shrimp shells discarded by canning industries in countries such as USA, India, Japan, Poland, Norway and Australia (Kumar, 2000). Chitin is produced by extraction from crab and shrimp shells with an acid treatment to dissolve the calcium carbonate and subsequently treated with an alkali to dissolve the proteins. After extraction, a decolorization step is carried out to obtain a colorless product (Crini and Badot, 2008). As natural polymers, chitin and chitosan are suitable candidates for the production of functional materials for they present excellent properties such as biodegradability, biocompatibility, bioadehesivity, polyfunctionality, hydrophilicity and non-toxicity (which
192
allows applications such as artificial skin, chitin- and chitosan-based dressings, drug-delivery systems and others), and, more relevant to this essay, high-capacity adsorption for metal ions and other ionic sorbates. The presence of amine groups in the acetylglucosamine and glucosamine units impart a highly basic character (cationic nature) to chitin and chitosan (very unique characteristic when compared to other natural abundant polysaccharides which are mostly acidic), hence, allowing for outstanding chelation abilities, in particular to metal ions (Kumar, 2000; Guibal, 2004; Crini and Badot, 2008). In an acidic medium, the amine groups are easily protonated which may cause electrostatic attraction of anionic metals or dyes (Guibal, 2004). Chitosan is considered chemically more versatile than cellulose (Crini and Badot, 2008). Regarding its use as adsorbent, Crini and Badot (2008) pointed out that chistosan presents several aspects that make it a suitable biomaterial for the removal of dyes, as did Guibal (2004) for the case of adsorption of metal ions. In both cases, emphasis was placed in the cost-effectiveness of chitosan-based polymers due to their abundant availability, and the reduced volume of biosorbent used when compared to conventional sorbents with the same sorption efficiency (outstanding adsorption capacities). Also, outstanding adsorption rates, selectivity and high affinity for both metal ions and dyes were reported in the literature. Another aspect is the versatility of chitosan in its ability to be relatively inexpensively manufactured into films, membranes, fibers, gels, beads and other types of materials that allows for applicability to a wide diversity of process configurations (Crini and Badot, 2008). Regarding its use as adsorbent, chitosan has received considerable attention in the area of heavy metal removal from wastewaters due to its excellent metal-binding (chelation) capacities and selectivity when compared to commercial activated carbon. Also, its possible biodegradability after long term use has been deemed an attractive characteristic (Crini and Badot, 2008). Regarding the application of chitin and chitosan, and their respective derivatives, as adsorbents for the removal of heavy metals from aqueous solutions, the readers are encouraged to refer to the comprehensive review presented by Guibal (2004) for a more thorough discussion on the interactions of metal ions with chitosan-based adsorbents. A diversity of metal ions-chitosan-based adsorbents interaction mechanisms was discussed in the literature and there is a general agreement that the amine sites are the main reactive groups for metal ions. Guibal (2004) mentions that hydroxyl groups (mainly those in C-3 position) may also contribute to sorption. The sorption mechanism of a metal ion is strongly dependent on the pH of the solution, the composition of the solution, and the degree of deacetylation of the chitosan sorbent and its surface charge density. The pH of the solution affects both the metal speciation and the acid-base character of the chitosan surface. Chelation has been determined to be the primary mechanism in metal ion adsorption by chitosan. It was also demonstrated that chitosan has low affinity for alkaline and alkaline-earth metals, therefore being selective of transition metals over non-transition metals (Guibal, 2004). The most common applications of chitosan for the adsorption of metal ions were for divalent cations such as copper, zinc, nickel, cadmium and mercury (Kumar, 2000; Guibal, 2004). Chitosan has been determined to be able to reduce adsorbed metal with the reducing activity depending on the oxidation potential of the metal and on the structure of the polymer. Guibal (2004) reported that, in an application of chitosan for adsorption of chromium, the chromate was almost completely reduced on the sorbent. Metal-loaded chitosan sorbents have the ability to adsorb other solutes and were used in a diversity of applications such as recovery of
193
pesticides by silver-loaded chitosan and recovery of protein by immobilized metal affinity support prepared with chitosan-coated silica (Guibal, 2004). The literature on applications of chitosan and chitosan derivatives as sorbents for the removal of dyes from aqueous solutions is quite extensive and an excellent review on the subject has been recently presented by Crini and Badot (2008). To avoid repetition in the matter of adsorption of dyes by chitosan, our further discussion will be restricted to a brief description of the methods of preparation of chitosan-based sorbents in its wide variety of solid-state forms. Although the majority of practical applications of chitosan has been in its unmodified form (Crini and Badot, 2008), it presents an advantage over other natural polysaccharides in that its chemical structure allows specific modifications with little or no difficulties at all. Aside from the amino groups distributed along its backbone, chitosan has primary and secondary hydroxyl groups at the C-2, C-3 and C-6 positions that also play a role as reactive functional groups. Thus, chemical modifications of chitosan present the advantages of preventing the dissolution of the polymer in applications where adsorption is performed in acidic media, improving the mechanical resistance of the sorbent, and the adsorption capacity and selectivity can be greatly enhanced by grafting desirable functionalities to the polymer backbone (Guibal, 2004). Among the diversity of chemical modification methods and their respective chitosan-derivatives used for application in adsorption, cross-linking of the biopolymer is the most common and relevant method employed and the produced cross-linked derivatives are usually prepared in a multitude of forms such as gels, beads or particles. Gels and beads are usually prepared by covalently cross-linking the chitosan biopolymer with itself. Examples of the common agents used to prepare covalently cross-linked chitosan gels are formaldehyde, glutaraldehyde and epichlorohydrin. Cross-linking in general improves the mechanical resistance of the biopolymer and enhances its chemical stability in acidic solutions by modifying its hydrophobicity. However, cross-linking presents several drawbacks in regard to applications in adsorption. The polymer reactivity is depreciated by the decrease in the number of free and available amino groups on the chitosan backbone and the accessibility of the sorbate to the internal structure is hindered due to a loss in the flexibility of the polymer chains. Thus, a rigorous control of the degree of cross-linking is essential to guarantee the adsorption performance of the resulting chitosan sorbent. Chitosan microspheres can be obtained by an emulsion cross-linking method where controlled-size aqueous droplets are emulsified in an oil phase by rigorous stirring followed by the hardening of the droplets and their separation from the emulsion as solid particles. Chitosan microspheres usually present high degree of sphericity and specific surface area when their sizes are controlled by a spray drying method. Chitosan beads have also been prepared for applications in adsorption of dyes by ionic cross-linking reactions (ionotropic gelation) (Crini and Badot, 2004). The grafting of new functionalities such as carboxylic and carbonyl groups into the chitosan backbone has been reported to increase the sorption properties of chitosan in relation to metal ions. Carboxylic functions have been grafted onto chitosan and chitin by means of Schiff`s base reactions or reactions with chloroacetic acid in propanol. The grafting of sulfur compounds on chitosan has also been carried out for the preparation of chitosan-based resins (Guibal, 2004). A few examples of recent and rather interesting applications of unmodified and modified chitin and chitosan for adsorption processes other than of metal ions and dyes are briefly
194
described next. Copper-loaded chitosan nanoparticles were prepared by Qi et al. (2004) and evaluated for in vitro antibacterial activity. The chitosan nanoparticles were prepared by ionic gelation with tri-polyphosphate anions and the copper ions were adsorbed onto the chitosan particles by ion exchange and surface chelation. Chitin extracted from crushed crab shells were used by Dursun and Kalayci (2005) for the adsorption of phenol in aqueous solutions. The adsorption capacity of the sorbent was affected by pH, temperature and initial phenol concentration and it was demonstrated to be thermodynamically spontaneous. Ahmad et al. (2005) used unmodified chitosan in the forms of powder and flakes for the adsorption of residue oil from palm oil mill effluent. Adsorption was demonstrated to be pH independent. Chitosan in powder form had a higher capacity for residue oil compared to the flake form and this was mainly due to the differences in surface area. Another interesting application of chemically-modified chitosan in adsorption process was presented by Kamble et al. (2007) where the chitosan backbone was loaded with lanthanum (La) by reaction with LaNO36H2O. The La-loaded chitosan was successfully used for defluoridation of drinking water and its adsorption performance was excellent when compared to that of unmodified chitosan and chitin. imanolu (2007) used unmodified chitin for the adsorption of the fungicides 4,4iso-propylidene diphenol (BPA), and diphenylolpropane 4,4-dioxyaceticacid (BPAc). The maximum adsorption capacity of BPA was much higher than that of BPAc on chitin. The adsorption process was demonstrated to be spontaneous in nature, supporting an endothermic reaction. Regarding economic aspects of production of modified and unmodified forms of chitin and chitosan, it has been clearly pointed out by Crini and Badot (2008) that, although outstanding progress has been made in the areas of preparation methods and respective applications of chitin- and chistosan-based adsorbents, the economic aspects of such processes and applications were usually neglected in the reported literature. According to Kumar (2000), chitin and chitosan are currently commercially produced with an economically feasible process of their extraction from crustacean shells, especially when it includes the recovery of astaxanthin, a carotenoid that has not been synthesized so far, and which is marketed as a fish food additive in aquaculture. However, industrial production of these biopolymers is restricted due the environmental problems created by the traditional methods of extraction, in which expressive amounts of polluting bases and degradation products are discarded in the process effluents. Also, difficulties in controlling the variability in chitosan properties and quality are major factors influencing the processing costs and limiting the potential for industrial acceptance. Further requirements for an increase in the use of chitin and chitosan in large scale processes, as pointed out by Crini and Badot (2008), are the development of cheaper manufacturing processes and processes that would allow profitable recovery of proteins and high-value pigments from the by-products of chitin manufacture. A promising alternative route for the economic production of chitosan is the extraction of this polymer from fungal cell walls by fermentation processes, considered to be a more ecofriendly pathway (Crini and Badot, 2008).
195
2.5. Ion Exchange Resins

The low cost adsorbents prepared from agricultural and food wastes that do not fall in the previously described categories are discussed in this section and are generically termed ion exchange resins. Guaran, a naturally occurring hydrophilic polysaccharide derived from the seeds of the plant Cyamoposis tetragonalobus, was turned into ion exchange resins by Ahuja and Rai (1997). The polysaccharide was first subjected to a cross-linking reaction with epichlorohydrin to form an epoxyether of guaran which was then utilized for derivatization with hydroxamic acids (glycine hydroxamate, acetic acid hydroxamate and iminodiacetic acid dihydroxamate). Although several reaction steps were required for the preparation of the guaran resins, the conditions used were mild (in terms of chemical conditions) and low energy consuming (temperatures in the range of 5 to 50oC). All the prepared resins were used in adsorption tests for the removal of metal ions from aqueous solutions. All the resins presented selectivity for iron, copper, uranium and tungsten ions and low affinity for alkaline earth metals such as calcium. The resins were also capable of separating mixtures of metal ions, presenting strong retention of ions such as iron and copper and very low or no retention of ions such as cobalt and calcium in column adsorption runs. Orlando et al. (2002a) prepared weak-base anion exchange resins by introducing epoxy and amino groups into sugarcane bagasse and rice hulls after reaction with epichlorohydrin and dimethylamine in the presence of pyridine and N,N-dimethylformamide (EDM method). The resins were evaluated for their exchange capacity for nitrate. The total exchange capacity for nitrate ions of the rice husk resin was comparable with that of a commercial ion exchanger Amberlite IRA-900 and it was concluded that rice husk and sugarcane bagasse-based anion exchange resins were potential materials to treat water contaminated with nitrate. The anion exchange resins prepared from sugarcane bagasse by Orlando et al. (2002b) employing the aforementioned EDM method, aside from being inexpensive when compared to synthetic resins (such as Amberlite IRA-900), presented the highest yield (225%) and lowest preparation cost among the other agricultural residues tested. Unnithan et al. (2004) prepared an adsorbent by grafting a -NH3+Cl functional group onto biopolymers of coconut coir pith. The preparation of the adsorbent was carried out through grafting of polyacrylamide onto the lignocellulosic material using N,N-methylenebisacrylamide as a cross-linking and functionalization agent of the polymer. The amine-modified lignocellulosic sorbent performance was investigated in application to the removal of hexavalent chromium from aqueous solutions and electroplating industrial wastewater. Quantitative removal of Cr(VI) from the industry wastewater confirmed the validity of the results obtained in batchwise studies. Regeneration of the spent adsorbent was studied and it was demonstrated that it could be regenerated and reused by alkali treatment. The overall costs of production and wastewater treatment with amine-modified coconut coir pith resin were estimated to be lower than those of commercially available polymeric resins. Adsorption gels were prepared from agricultural wastes by Minamisawa et al. (2005) by means of cross-linking reactions of the pretreated biomaterials with either epichlorohydrin (in the case of Yuzu and lemon) or formaldehyde (in the case of coffee beans). The prepared gels were used for the adsorption of Pb(II), Cu(II), Cd(II) and Zn(II) ions from aqueous solutions. The Pb-laden lemon gel was further used to adsorb nitrate ions (NO3) from aqueous
196
solutions. Soybean hulls, sugarcane bagasse and corn stover were converted to anion exchange resins by Wartelle and Marshall (2005) through modification with the cross-linking reagent dimethyloldihydroxyethylene urea (DMDHEU) and the quaternary amine, choline chloride. Adsorption capacities of the prepared resins were investigated for chromium, arsenic and selenium in a simulated wastewater at pH 7. The results showed preferential adsorption of chromate ion over arsenate or selenate ion. The modified by-products demonstrated chromate ion adsorption capacity that was higher than that of a cellulose-based anion exchange resin but was lower than that of a synthetic, commercially available anion exchange resin. The evaluated product or manufacturing costs for the by-product-based resins were relatively low compared to the market costs for the commercial products, and this was mostly due to the low cost of the starting materials and of the reagents used for quaternization. Thus, it was concluded that in applications involving the removal of hexavalent chromium, lignocellulosic by-product-based resins should be considered comparable to commercial resins on the basis of high efficacy and low cost. Wartelle and Marshall (2006) prepared anion exchange resins through the quaternization of a series of 12 agricultural by-products with N-(3-chloro-2-hydroxypropyl) trimethylammonium chloride (CHMAC). The agricultural materials used were almond shells, corn cob, peanut shells, corn stover, oat hulls, cottonseed hulls, pecan shells, rice hulls, rice straw, soybean hulls, sugarcane bagasse and white oak chips. All the prepared resins were used on batch adsorption studies to compare their adsorptive properties towards phosphate anion. A further objective of their study was to identify the by-product with the highest phosphate adsorption capacity and compare it to the adsorption of phosphate anions onto a commercial, cellulose-based anion exchange resin and also its efficacy towards arsenate, chromate, and selenate (anions of environmental relevance). All the produced quaternized products presented the ability to adsorb phosphate ion from solution. Anion exchange resin prepared by the quaternization of corn stover was the adsorbent with the highest adsorption capacity for phosphorus compared to other by-products and the commercial resin. As a general result, by-products with low lignin content or low lignin:cellulose ratios appeared to lead to the production of better anion exchange resins than by-products with high lignin content or high lignin:cellulose ratios. CHMAC modified corn stover demonstrated a higher adsorption capacity for chromium than for arsenic or selenium, but, in spite of that, it generally adsorbed over 90% of chromium, arsenic, and selenium from a simulated wastewater solution. An anion exchanger resin was prepared by Kse (2008) from straw, an agricultural residue. The resin was prepared by the EDM method (Orlando et al., 2002a) in which dry ground straw was reacted with epichlorohydrin in the presence of N,N dimethylformamide and pyridine, and the product of this reaction was further reacted with a 50% dimethylamine solution to introduce amino groups into the epoxypropyl- product of the previous reaction. The prepared resin was used to investigate its performance in the removal of Remazol Black B, a commonly employed textile dye, from a hydrolysed dye solution. The resin sorption capacity was correlated to their mesopore surface area since mesopores (diameter between 20 and 500 ) were more predominant in this material. Anirudhan et al. (2008) synthesized a new adsorbent having carboxylate functional group at the chain end of biopolymers by grafting poly(hydroxyethylmethacrylate) onto coconut coir pith, a coir industry-based lignocellulosic residue, using potassium peroxydisulphate as an initiator and in the presence of N, N-methylenebisacrylamide as a cross linking agent. The synthesized resin was used for
197
the removal of divalent mercury ions from aqueous solutions and its adsorption performance was compared to that of a commercial carboxylic acid functionalized cation exchanger, Ceralite IRC-50. The coconut coir pith-based resin presented higher adsorption capacities than the commercial resin for the same adsorption conditions. The application of the synthesized resin to a real wastewater sample containing Hg(II) obtained from chlor-alkali industry showed satisfactory removal of Hg(II). Regenerability of the sorbent was verified by desorption of the adsorbed Hg with a 0.2 M HCl solution and the loss in adsorption capacity became significant only after four successive adsorption and desorption cycles.
3. POTENTIAL APPLICATIONS OF LOW-COST SORBENTS IN THE AGRICULTURAL AND FOOD SECTORS

Although a wide spectrum of applications for adsorbents produced from agricultural and food wastes has been published in the literature, their utilization is mostly restricted to research labs and in which they were most often used for the adsorption of metal ions, dyes, phenol and substituted phenols. Examples of practical adsorption processes to which these types of sorbents could economically, and sometimes more efficiently, replace the currently used sorbents are: decolorization of vegetable oil by removal of -carotene, chlorophyll and other pigments during bleaching of the oil; the removal of phenylalanine and/or other amino acids from protein hydrolysates to produce dietary formulations for people bearing diseases associated with a severe disorder in the amino acid metabolism; removal of phenolic compounds involved in the browning of vinegar, thus enhancing its color; removal of metal ions (mainly copper) and other undesirable organic compounds (e.g., ethyl carbamate) in the production of alcoholic beverages (e.g., sugarcane spirits and other distilled beverages); selective removal of methyl mercaptan which causes an irritating odor in coffee aroma in order to improve the quality of soluble coffee products; removal of dark compounds from clarified fruit juices; removal of cells and cell debris from fermentation broth in the production of xanthan; recovery of phenolic compounds with high antioxidant activities from distilled grape pomace; separation and purification of ferulic acid in hydrolysates from sugarcane bagasse; purification of pigmented orange pulp wash to obtain a purified sugar concentrate; adsorption of xanthines (caffeine, theophylline) for applications in pharmaceutical industries; and reduction of COD and BOD from water used in the wet processing of coffee in producing farms, with possible recovery of sugars. Novel applications would include the use of antibacterial activated carbons (Tamai et al., 2001) for the treatment of drinking waters and for the sterilization of air in processes where a strict control of airborne pathogens is of utmost relevance.
4. CONCLUSION
The whole idea behind the production of low cost, agri-food waste-based sorbents is strictly tied to the concept of creating profitable alternative applications for the solid residues generated in the production and processing of agricultural and food materials (which currently constitutes a heavy economical burden), and also to its economical impact when costly
198
products such as commercial activated carbons and synthetic ion exchange resins can be suitably replaced by them. However, the true strictly economical motivation for the production and application of low cost sorbents is usually sugar-coated (cloaked?) with buzzwords such as sustainability, eco-friendly and others. Sustainability and economics do not necessarily go in the same direction; in fact, most of the times their paths are in rather opposite directions (Ayres, 2008), and a mid-term compromise between these two aspects should be the goal in a short-term period. However misinterpreted or misused the concept of sustainable development may be (AtKisson, 2006; Ayres, 2008), a basic idea of whatever it really is has already been widely disseminated: Sustainable development can be defined as the development in which the needs of the present generation are met without compromising the ability of future generations to meet their requirements (Lou et al., 2004). Unfortunately, the dissemination of this concept has led to misuses and abuses of the idea in every sector of economy and its misapplication has been deemed beyond repair by AtKisson (2006), who strongly suggested it must be reinvented. Hence, instead of further abusing the term in our essay, we will introduce a more easily comprehensive concept to work with, the concept of no waste or waste not. Since a waste not concept is hardly attainable with the current available knowledge and technologies, innovation is something to be intensively sought for the near future, and until then a waste less idea is something we can presently deal with. A good example of an application of this concept in regard to the production of low-cost adsorbents was presented by Savova et al. (2001), in which an integrated plant is conceptualized for the production of carbon adsorbents and energy-rich gases from biomass. Activated carbons were prepared by steam pyrolysis of biomass, such as apricot stones and others. The steam-pyrolysis resultant solid product is the targeted carbon adsorbent with alkaline character of the surface, and the inevitable steam-purged liquid products, such as tar, were mixed with furfural and further treated with sulfuric acid. The solid particles obtained thereafter were heated to 600oC at a heating rate of 10oC min-1 under nitrogen. Oxidation of the carbonized material was then carried out with air at 400oC to obtain activated carbon with acidic surface properties, i.e., polyfunctional cationites carbons. Thus, an effective utilization of the biomass was achieved, which is a partial fulfillment of the requirements for a morally acceptable use of natural resources (Ruth, 2006). Low-cost adsorbents prepared from agricultural and food wastes may be the most promising type of biomaterials that will lead to a globalized bio-based economy since their production and applicability has been several times proven to be economical and effective and their utilization, upon development of innovative technologies, would imply in getting closer to a full compliance with the waste not concept. The possible applications are limitless and it constitutes an increasingly fast-paced research area. However, to have a clear idea of the future of low cost agri-food waste-based adsorbents, one question still remains to be answered: where do we stand now in regard to technology for the production and further application of agri-food waste-based adsorbents? The technologies for the production of activated carbons from agricultural and food wastes are practically the same as those being currently used for the commercial production of either powder or granulated ACs, requiring little or no modifications at all to the equipments and processes. However, it should be clear that the suitable operational parameters and the final quality of the products will most certainly not be the same. Regarding the applications of the ACs produced from agricultural and food wastes, the final product is usually of equal or sometimes better capacities than the currently available
199
commercial carbons. Their mechanical strength was scarcely reported, but most of them were successfully tested in comparative studies with commercial carbons under the same conditions and, hence, similar or better textural properties are expected for them. A lack of a closer interaction between researchers and the potential clients (AC producers) might be the prevalent issue precluding the widespread production and application of such types of activated carbons in large scale. The preparation of biosorbents from agricultural and food waste materials requires no special technology. In the worst case scenario, these materials need to be ground, dried and cleaned, possibly involving a washing step with either just water or a dilute acidic solution. On the other hand, to our best knowledge, since no large scale application of these types of biosorbents has been reported, a rather interesting opportunity for the development of innovative technology in this area is envisioned. But until creative minds are put to that task, it is our firm belief that these types of biosorbents can be used in conventional adsorption processes, such as agitated batch systems or fixed bed columns, without significant modifications to the processes. Their adsorption performances were several times proven in the scientific literature and profitable alternative proposals for end uses of sorbate-laden biosorbents need to be thoroughly studied for its successful application in large scale processes. Metal-laden biosorbents have already been demonstrated to present specific sorption affinities for other types of sorbates and also properties such as antibacterial activity (Tamai et al, 2001). The technologies for the production of bone char are well established and have a tendency to follow the advances in technology for production of activated carbons when the production is in medium to large scale. Low tech kilns for low to medium bone char production capacities have been developed and implemented in underdeveloped areas as a source of revenue and, although they are reported to present a good performance, problems arising from hazardous emissions seem to have been overlooked. Therefore, the technology has to be improved in that aspect. Chitin and chitosan have been many times demonstrated to be excellent materials for applications in adsorption. However, the ever present limitations to its large scale production are still persistent and a long way has yet to be paved to overcome those issues. As pointed out before, the major limitations for production in large scale are the difficulties to control the variability in the properties and quality of the biopolymer, which directly affects its quality as an adsorbent, and the hazardous pollution generated by discarded bases and degradation products in the process effluents. The inherent variability in the properties of the biopolymers can be overcome by their controlled production by extraction from fungal cell walls through fermentation processes. The existent technology for the production of chitosan from chitin extracted of crustaceans shells can only be improved by the use of less harmful chemicals in the process or by the design of effective and yet economical effluent treatment technologies. To our best knowledge, the production of ion exchange resins from agricultural and food wastes in large scale has not been implemented yet, but it is our belief that it should not pose any problem in that regard, since the processes employed in the lab scale are well established, require mild chemical and thermal conditions, and some of the processes are already applied in large scale for other types of applications. On the matter of innovative technology, more thorough studies should be conducted in the fields of microwave and other types of physical waves to be applied in the large scale production and in applications of low-cost adsorbents since such processes are generally low
200
energy consuming and it is expected that large scale production plants using this technology would be more efficient, compact and versatile. Several industrial applications using microwaves to regenerate loaded activated carbons have been reported by Bathen (2003). Major advantages in using microwaves for regeneration of carbons are the cost reduction and the enhanced quality of the regenerated sorbent. In regard to applications of low cost sorbents produced from agricultural and food wastes in the agri-food sector itself, as pointed out in the previous section, there are numerous possible applications in which these sorbents could replace the adsorbents being currently used, and efficient and economical new applications are expected to appear in the near future as the research in this area progresses at a fast pace.
ACKNOWLEDGEMENTS
The authors gratefully acknowledge financial support from the following Brazilian Government Agencies: CNPq and FAPEMIG.
REFERENCES
Adachi, A., Ozaki, H., Kasuga, I. and Okano, T. (2006) Use of beer bran as an adsorbent for the removal of organic compounds from wastewater, Journal of Agricultural and Food Chemistry, 54, 6209-6211. Agarwal, G.S., Bhuptawat, H.K. and Chaudhari, S. (2006) Biosorption of aqueous chromium(VI) by Tamarindus indica seeds, Bioresource Technology, 97, 949956. Ahmad, A.L., Sumathi, S. and Hameed, B.H. (2005) Adsorption of residue oil from palm oil mill effluent using powder and flake chitosan: Equilibrium and kinetic studies, Water Research, 39, 24832494. Ahmedna, M., Marshall, W.E. and Rao, R.M. (2000) Production of granular activated carbons from select agricultural by-products and evaluation of their physical, chemical and adsorption properties. Bioresource Technology, 71, 113-123. Ahuja, M. and Rai, A.K. (1997) Adsorption studies with some chelating ion exchange resins derived from guaran, Carbohydrate Polymers, 33, 57-42. Aksu, Z. (2005) Application of biosorption for the removal of organics pollutants: a review, Process Biochemistry, 40, 997-1026. Aksu, Z. and Iolu, .A. (2005) Removal of copper(II) ions from aqueous solution by biosorption onto agricultural waste sugar beet pulp, Process Biochemistry, 40, 3031 3044. Alaya, M.N., Girgis, B.S. and Mourad, W.E. (2000) Activated carbon from some agricultural wastes under action of one-step steam pyrolysis, Journal of Porous Materials, 7, 509 517. lvarez-Merino, M.A., Fontecha-Cmara, M.A., Lpez-Ramn, M.V. and Moreno-Castilla, C. (2008) Temperature dependence of the point of zero charge of oxidized and nonoxidized activated carbons, Carbon, In Press, doi: 10.1016/j.carbon.2008.02.002.
201
Annadurai, G., Juang, R.S. and Lee, D.J. (2002) Use of cellulose-based wastes for adsorption of dyes from aqueous solutions, Journal of Hazardous Materials, B92, 263274. Anirudhan, T.S., Divya, L. and Ramachandran, M. (2008) Mercury(II) removal from aqueous solutions and wastewaters using a novel cation exchanger derived from coconut coir pith and its recovery, Journal of Hazardous Materials, In Press, doi:10.1016/j.jhazmat. 2008.01.030. Arami, M., Limaee, N.Y., Mahmoodia, N.M. and Tabrizi, N.S. (2006a) Equilibrium and kinetics studies for the adsorption of direct and acid dyes from aqueous solution by soy meal hull, Journal of Hazardous Materials, B135, 171179. Arami, M., Limaee, N.Y. and Mahmoodia, N.M. (2006b) Investigation on the adsorption capability of egg shell membrane towards model textile dyes, Chemosphere, 65, 1999 2008. Arvanitoyannis, I.S. and Ladas, D. (2008) Meat waste treatment methods and potential uses, International Journal of Food Science and Technology, 43, 543559. AtKisson, A. (2006) Sustainability is dead-long live sustainability. In: M. Keiner (Ed.), The Future of Sustainability, Netherlands: Springer. Ayres, R.U. (2008) Sustainability economics: Where do we stand?, Ecological Economics, In Press, doi:10.1016/j.ecolecon.2007.12.009. Bailey, S.E., Olin, T.J., Bricka, R.M. and Adrian, D.D. (1999) A review of potentially lowcost sorbents for heavy metals, Water Research, 33, 2469-2479. Bangash, F.K. and Alam, S. (2006) Kinetic of Patent Blue VF Adsorption from aqueous solution on activated bone charcoal, Journal of the Chinese Chemical Society, 53, 10911108. Bansal, R.C. and Goyal, M. (2005) Activated Carbon Adsorption, Boca Raton: Taylor & Francis. Bansode, R.R., Losso, J.N., Marshall, W.E., Rao, R.M. and Portier, R.J. (2003) Adsorption of volatile organic compounds by pecan shell and almond shell-based granular activated carbons, Bioresource Technology, 90, 175184. Bansode, R.R., Losso, J.N., Marshall, W.E., Rao, R.M. and Portier, R.J. (2004) Pecan shellbased granular activated carbon for treatment of chemical oxygen demand (COD) in municipal wastewater, Bioresource Technology, 94, 129135. Baquero, M.C., Giraldo, L., Moreno, J.C., Surez-Garca, F., Martnez-Alonso, A. and Tascn, J.M.D. (2003) Activated carbons by pyrolysis of coffee bean husks in presence of phosphoric acid, J. Anal. Appl. Pyrolysis, 70, 779-784. Barrett, E.P., Jonnard, A. and Messmer, J.H. (1951) Some granular carbonaceous adsorbents for sugar refining. A study of bone char replacement based on hydroxyapatite, Industrial Engineering and Chemistry, 43, 639-654. Bathen, D. (2003) Physical waves in adsorption technologyan overview, Separation and Purification Technology, 33, 163-177. Boehm, H.P. (1994) Some aspects of the surface chemistry of carbon blacks and other carbons, Carbon, 32, 759-769. Boonamnuayvitaya, V., Sae-ung, S. and Tanthapanichakoon, W. (2005) Preparation of activated carbons from coffee residue for the adsorption of formaldehyde, Separation and Purification Technology, 42, 159168. Boucher, J., Steiner, L. and Marison, I.W. (2007) Bio-sorption of atrazine in the press-cake from oilseeds, Water Research, 41, 3209 3216.
202
Bourke, J., Manley-Harris, M., Fushimi, C., Dowaki, K., Nunoura, T. and Antal, M.J., Jr. (2007) Do all carbonized charcoals have the same chemical structure? 2. A model of the chemical structure of carbonized charcoal, Ind. Eng. Chem. Res., 46, 5954-5967. Brown, P.A., Gill, S.A. and Allen, S.J. (2000) Metal removal from wastewater using peat, Water Research, 34, 3907-3916. Budinova, T., Ekinci, E., Yardim, F., Grimm, A., Bjrnbom, E., Minkova, V. and Goranova, M. (2006) Characterization and application of activated carbon produced by H3PO4 and water vapor activation, Fuel Processing Technology, 87, 899905. Chang, H., Yuan, X.G., Tian, H. and Zeng, A.W. (2006) Experiment and prediction of breakthrough curves for packed bed adsorption of water vapor on cornmeal, Chemical Engineering and Processing, 45, 747754. Cheung, C.W., Chan, C.K., Porter, J.F. and McKay, G. (2001a) Combined diffusion model for the sorption of cadmium, copper, and zinc ions onto bone char, Environ. Sci. Technol., 35, 1511-1522. Cheung, C.W., Porter, J.F. and McKay, G. (2001b) Sorption kinetic analysis for the removal of cadmium ions from effluents using bone char, Water Research, 35, 605-612. Cheung, C.W., Porter, J.F. and McKay, G. (2002) Removal of Cu(II) and Zn(II) ions by sorption onto bone char using batch agitation, Langmuir, 18, 650-656. Cheung, C.W., Ko, D.C.K., Porter, J.F. and McKay, G. (2003) Binary metal sorption on bone char mass transport model using IAST, Langmuir, 19, 4144-4153. Choy, K.K.H., Ko, D.C.K., Cheung, C.W., Porter, J.F. and McKay, G. (2004) Film and intraparticle mass transfer during the adsorption of metal ions onto bone char, Journal of Colloid and Interface Science, 271, 284295. Choy, K.K.H., Barford, J.P. and McKay, G. (2005) Production of activated carbon from bamboo scaffolding waste-process design, evaluation and sensitivity analysis, Chemical Engineering Journal, 109, 147-165. Choy, K.K.H. and McKay, G. (2005a) Sorption of cadmium, copper, and zinc ions onto bone char using Crank diffusion model, Chemosphere, 60, 1141-1150. Choy, K.K.H. and McKay, G. (2005b) Sorption of metal ions from aqueous solution using bone char, Environment International, 31, 845-854. Crini, G. (2006) Non-conventional low-cost adsorbents for dye removal: A review, Bioresource Technology, 97, 1061-1085. Crini, G. and Badot, P.M. (2008) Application of chitosan, a natural aminopolysaccharide, for dye removal from aqueous solutions by adsorption processes using batch studies: A review of recent literature, Prog. Polym. Sci., In Press, doi:10.1016/j.progpolymsci. 2007.11.001. Crittenden, B. and Thomas, W.J. (1998) Adsorption Technology and Design, London: Elsevier Science & Technology Books. Dai, X. and Antal, M.J., Jr. (1999) Synthesis of a High-Yield Activated Carbon by Air Gasification of Macadamia Nut Shell Charcoal, Ind. Eng. Chem. Res., 38, 3386-3395. Daifullah, A.A.M. and Girgis, B.S. (1998) Removal of some substituted phenols by activated carbon obtained from agricultural waste, Water Research, 32, 1169-1177. Daifullah, A.A.M., Yakout, S.M. and Elreefy, S.A. (2007) Adsorption of fluoride in aqueous solutions using KMnO4-modified activated carbon derived from steam pyrolysis of rice straw, Journal of Hazardous Materials, 147, 633643.
203
Daud, W.M.A.W. and Ali, W.S.W. (2004) Comparison on pore development of activated carbon produced from palm shell and coconut shell, Bioresource Technology, 93, 6369. David, E. (2008) Production of eco-materials from organic wastes by pyrolysis process, Journal of Alloys and Compounds, 452, 188193. Davis, T.A., Volesky, B. and Mucci, A. (2003) A review of the biochemistry of heavy metal biosorption by brown algae, Water Research, 37, 4311-4330. Demirba, A. (2001) Carbonization ranking of selected biomass for charcoal, liquid, and gaseous products, Energy Conversion and Management, 42, 1229-1238. Deydier, E., Guilet, R., Sarda, S. and Sharrock, P. (2005) Physical and chemical characterisation of crude meat and bone meal combustion residue: waste or raw material?, Journal of Hazardous Materials, B121, 141148. Dias, J.M., Alvim-Ferraz, M.C.M., Almeida, M.F., Rivera-Utrilla, J. and Snchez-Polo, M. (2007) Waste materials for activated carbon preparation and its use in aqueous-phase treatment: A review, Journal of Environmental Management, 85, 833846. Dursun, A.Y. and Kalayci, .S. (2005) Equilibrium, kinetic and thermodynamic studies on the adsorption of phenol onto chitin, Journal of Hazardous Materials, B123, 151157. El-Hendawy, A.A., Samra, S.E. and Girgis, B.S. (2001) Adsorption characteristics of activated carbons obtained from corncobs, Colloids and Surfaces A: Physicochemical and Engineering Aspects, 180, 209221. Elizalde-Gonzlez, M.P., Mattusch, J., Pelez-Cid, A.A. and Wennrich, R. (2007) Characterization of adsorbent materials prepared from avocado kernel seeds: Natural, activated and carbonized forms, J. Anal. Appl. Pyrolysis, 78, 185193. Fu, Y. and Viraraghavan, T. (2001) Fungal decolorization of dye wastewaters: a review, Bioresource Technology, 79, 251-262. Gergova, K., Petrov, N. and Eser, S. (1994) Adsorption properties and microstructure of activated carbons produced from agricultural byproducts by steam pyrolysis, Carbon, 32, 693702. Gergova, K. and Eser, S. (1996) Effects of activation method on the pore structure of activated carbons from apricot stones, Carbon, 34, 879-888. Girgis, B.S., Yunis, S.S. and Soliman, A.M. (2004) Characteristics of activated carbon from peanut hulls in relation to conditions of preparation, Materials Letters, 57, 164172. Guerrero, M., Ruiz, M.P., Millera, A., Alzueta, M.U. and Bilbao, R. (2008) Characterization of Biomass Chars Formed under Different Devolatilization Conditions: Differences between Rice Husk and Eucalyptus, Energy & Fuels, In Press, doi:10.1021/ef7005589. Guibal, E. (2004) Interactions of metal ions with chitosan-based sorbents: a review, Separation and Purification Technology, 38, 43-74. Guo, J. and Lua, A.C. (2000) Preparation of activated carbons from oil-palm-stone chars by microwave-induced carbon dioxide activation, Carbon, 38, 19851993. Guo, Y. and Rockstraw, D.A. (2007) Activated carbons prepared from rice hull by one-step phosphoric acid activation, Microporous and Mesoporous Materials, 100, 1219. Gupta, V.K., Mittal, A. and Gajbe, V. (2005) Adsorption and desorption studies of a water soluble dye, Quinoline Yellow, using waste materials, Journal of Colloid and Interface Science, 284, 8998. Hameed, B.H. and Daud, F.B.M. (2008) Adsorption studies of basic dye on activated carbon derived from agricultural waste: Hevea brasiliensis seed coat, Chemical Engineering Journal, In Press, doi:10.1016/j.cej.2007.07.089.
204
Han, R., Ding, D., Xu, Y., Zou, W., Wang, Y., Li, Y. and Zou, L. (2008) Use of rice husk for the adsorption of congo red from aqueous solution in column mode, Bioresource Technology, In Press, doi:10.1016/j.biortech.2007.06.027. Hassan, S.S.M., Awwad, N.S. and Aboterika, A.H.A. (2008) Removal of mercury(II) from wastewater using camel bone charcoal, Journal of Hazardous Materials, In Press, doi:10.1016/j.jhazmat.2007.11.003. Hirata, M., Kawasaki, N., Nakamura, T., Matsumoto, K., Kabayama, M., Tamura, T. and Tanada, S. (2002) Adsorption of dyes onto carbonaceous materials produced from coffee grounds by microwave treatment, Journal of Colloid and Interface Science, 254, 17-22. Ioannidou, O. and Zabaniotou, A. (2007) Agricultural residues as precursors for activated carbon production A review, Renewable and Sustainable Energy Reviews, 11, 19662005. IUPAC (1972) Manual of Symbols and Terminology for Physicochemical Quantities and Units, London: Butterworths. Jacobsen, P. and Dahi, E. (1997) Charcoal packed furnace for low-tech charring of bone, Proc. 2nd International workshop on Fluorosis and Defluoridation of Water, Nazreth, Ethiopia, 151-155. Jaguaribe, E.F., Medeiros, L L., Barreto, M.C.S. and Araujo, L.P. (2005) The performance of activated carbons from sugarcane bagasse, babassu, and coconut shells in removing residual chlorine, Brazilian Journal of Chemical Engineering, 22, 41-47. Kamble, S.P., Jagtap, S., Labhsetwar, N.K., Thakare, D., Godfrey, S., Devotta, S. and Rayalu, S.S. (2007) Defluoridation of drinking water using chitin, chitosan and lanthanummodified chitosan, Chemical Engineering Journal, 129, 173180. Kannan, N. and Meenakshisundaram, M. (2002) Adsorption of congo red on various activated carbons. A Comparative Study, Water, Air, and Soil Pollution, 138, 289305. Karagz, S., Tay, T., Ucar, S. and Erdem, M. (2008) Activated carbons from waste biomass by sulfuric acid activation and their use on methylene blue adsorption, Bioresource Technology, In Press, doi:10.1016/j.biortech.2007.12.019. Ko, D.C.K., Porter, J.F. and McKay, G. (2003) Mass transport model for the fixed bed sorption of metal ions on bone char, Ind. Eng. Chem. Res., 42, 3458-3469. Ko, D.C.K., Cheung, C.W., Choy, K.K.H., Porter, J.F. and McKay, G. (2004) Sorption equilibria of metal ions on bone char, Chemosphere, 54, 273-281. Kse, T.E. (2008) Agricultural residue anion exchanger for removal of dyestuff from wastewater using full factorial design, Desalination, 222, 323-330. Kratochvil, D. and Volesky, B. (1998) Advances in the Biosorption of Heavy Metals, TIBTECH, 16, 291-300. Kumar, M.N.V.R. (2000) A review of chitin and chitosan applications, Reactive and Functional Polymers, 46, 1-27. Lal, R. (2005) World crop residues production and implications of its use as a biofuel, Environment International, 31, 575 584. Latini, A.F., Franca, A.S., Oliveira, L.S. (2008) Removal of phenylalanine from aqueous solutions by sorbents prepared from spent coffee grounds activated by phosphoric acid, Proceedings of the International Conference on Chemistry Chem 05 Green and Sustentable Chemistry for Developing Countries, Cairo.
205
Lee, H.H., Hirano, Y., Murayama, N., Matsumoto, S. and Shibata, J. (2007) Adsorption properties of activated carbon prepared from waste beer lees by KOH activation and CO2 activation, Resources Processing, 54, 1924. Lillo-Rdenas, M.A., Cazorla-Amors, D. and Linares-Solano, A. (2003) Understanding chemical reactions between carbons and NaOH and KOH An insight into the chemical activation mechanism, Carbon, 41, 267275. Lopez-Ramon, M.V., Stoeckli, F., Moreno-Castilla, C. and Carrasco-Marin, F. (1999) On the characterization of acidic and basic surface sites on carbons by various techniques, Carbon, 37, 12151221. Lou, H.H., Kulkarni, M.A., Singh, A. and Hopper, J.R. (2004) Sustainability assessment of Industrial Systems, Ind. Eng. Chem. Res., 43, 4233-4242. Malik, R., Ramteke, D.S. and Wate, S.R. (2007) Adsorption of malachite green on groundnut shell waste based powdered activated carbon, Waste Management, 27, 1129-1138. Marshall, W.E. and Wartelle, L.H. (2006) Chromate (CrO42-) and copper (Cu2+) adsorption by dual-functional ion exchange resins made from agricultural by-products, Water Research, 40, 2541-2548. Mackay, D.M. and Roberts, P.V. (1982a) The dependence of char and carbon on lignocellulosic precursor composition, Carbon, 20, 87-94. Mackay, D.M. and Roberts, P.V. (1982b) The influence of pyrolysis conditions on yield and microporosity of lignocellulosic chars, Carbon, 20, 95-104. Medellin-Castillo, N.A., Leyva-Ramos, R., Ocampo-Perez, R., Cruz, R.F.G., Aragon-Pin, A., Martinez-Rosales, J.M., Guerrero-Coronado, R.M. and Fuentes-Rubio, L. (2007) Adsorption of Fluoride from Water Solution on Bone Char, Ind. Eng. Chem. Res., 46, 9205-9212. Mszros, E., Jakab, E. Vrhegyi, G., Bourke, J., Manley-Harris, M., Nunoura, T. and Antal, M.J., Jr. (2007) Do all carbonized charcoals have the same chemical structure? 1. Implications of thermogravimetry-mass spectrometry measurements, Ind. Eng. Chem. Res., 46, 5943-5953. Minamisawa, M., Minamisawa, H., Yoshida, S. and Takai, N. (2005) Characterization of adsorption gels prepared from plant biomaterials, Green Chemistry, 7, 595-601. Minkova, V., Razvigorova, M., Goranova, M., Ljutzkanov, L. and Angelova, G. (1991) Effect of water vapour on the pyrolysis of solid fuels : 1. Effect of water vapour during the pyrolysis of solid fuels on the yield and composition of the liquid products, Fuel, 70, 713-719. Minkova, V., Razvigorova, M., Gergova, K., Goranova, M., Ljutzkanov, L. and Angelova, G. (1992) Effect of water vapour on the pyrolysis of solid fuels : 2. Effect of water vapour during the pyrolysis of solid fuels on the formation of the porous structure of semicoke, Fuel, 71, 263-265. Minkova, V., Marinov, S.P., Zanzi, R., Bjrnbom, E., Budinova, T., Stefanova, M. and Lakov, L. (2000) Thermochemical treatment of biomass in a flow of steam or in a mixture of steam and carbon dioxide, Fuel Processing Technology, 62,4552. Minkova, V., Razvigorova, M., Bjrnbom, E., Zanzi, R., Budinova, T. and Petrov, N. (2001) Effect of water vapour and biomass nature on the yield and quality of the pyrolysis products from biomass, Fuel Processing Technology, 70, 5361.
206
Mittal, A., Krishnana, L. and Gupta, V.K. (2005) Removal and recovery of malachite green from wastewater using an agricultural waste material, de-oiled soya, Separation and Purification Technology, 43, 125133. Mittal, A., Mittal, J. and Kurup, L. (2006) Adsorption isotherms, kinetics and column operations for the removal of hazardous dye, Tartrazine from aqueous solutions using waste materialsBottom Ash and De-Oiled Soya, as adsorbents, Journal of Hazardous Materials, B136, 567578. Mjengera, H. and Mkongo, G. (2003) Appropriate deflouridation technology for use in flourotic areas in Tanzania, Physics and Chemistry of the Earth, 28, 10971104. Mohan, D., Singh, K.P., Sinha, S. and Gosh, D. (2005) Removal of pyridine derivatives from aqueous solution by activated carbons developed from agricultural waste materials, Carbon, 43, 16801693. Mohanty, K., Jha, M., Meikap, B.C., and Biswas, M.N. (2005) Preparation and characterization of activated carbons from Terminalia arjuna nut with zinc chloride activation for the removal of phenol from wastewater, Ind. Eng. Chem. Res., 44, 41284138. Molina-Sabio, M. and Rodrguez-Reinoso, F. (2005) Role of chemical activation in the development of carbon porosity, Colloids and Surfaces A: Physicochem. Eng. Aspects, 241, 1525. Nabais, J.M.V., Carrott, P.J.M., Carrott, M.M.L.R., Luz, V. and Ortiz, A.L. (2008) Influence of preparation conditions in the textural and chemical properties of activated carbons from a novel biomass precursor: The coffee endocarp, Bioresource Technology, In Press, doi:10.1016/j.biortech.2007.12.068. Nakagawa, Y., Molina-Sabio, M. and Rodrguez-Reinoso, F. (2007) Modification of the porous structure along the preparation of activated carbon monoliths with H3PO4 and ZnCl2, Microporous and Mesoporous Materials, 103, 2934. Namane, A., Mekarzia, A., Benrachedi, K., Belhaneche-Bensemra, N. and Hellal, A. (2005) Determination of the adsorption capacity of activated carbon made from coffee grounds by chemical activation with H3PO4 and ZnCl2, Journal of Hazardous Materials, B119, 189194. Namasivayam, C., Muniasamy, N., Gayatri, K., Rani, M. and Ranganathan, K. (1996) Removal of dyes from aqueous solutions by cellulosic waste orange peel, Bioresource Technology, 57, 37-43. Namasivayam, C., Prabha, D. and Kumutha, M. (1998) Removal of direct red and acid brilliant blue by adsorption on to banana pith, Bioresource Technology, 64, 77-79. Namasivayam, C. and Sangeetha, D. (2006) Removal of molybdate from water by adsorption onto ZnCl2 activated coir pith carbon, Bioresource Technology, 97, 11941200. Ng, C., Marshall, W.E., Rao, R.M., Bansode, R.R. and Losso, J.N. (2003) Activated carbon from pecan shell: process description and economic analysis, Industrial Crops and Products, 17, 209-217. Oliveira, W.E., Franca, A.S., Oliveira, LS. and Rocha, S.D. (2008a) Untreated coffee husks as biosorbents for the removal of heavy metals from aqueous solutions, Journal of Hazardous Materials, In Press, doi:10.1016/j.jhazmat.2007.07.085. Oliveira, L.S., Franca, A.S., Alves, T.M. and Rocha, S.D. (2008b) Evaluation of untreated coffee husks as potential biosorbents for treatment of dye contaminated waters, Journal of Hazardous Materials, In Press, doi:10.1016/j.jhazmat. 2007.11.093.
207
Orlando, U.S., Baes, A.U., Nishijima, W. and Okada, M. (2002a) A new procedure to produce lignocellulosic anion exchangers from agricultural waste materials, Bioresource Technology, 83, 195-198. Orlando, U.S., Baes, A.U., Nishijima, W. and Okada, M. (2002b) Preparation of agricultural anion exchangers and its nitrate maximum adsorption capacity, Chemosphere, 48, 10411046. Park, D., Lim, S.R., Yun, Y.S. and Park, J.M. (2007) Reliable evidences that the removal mechanism of hexavalent chromium by natural biomaterials is adsorption-coupled reduction, Chemosphere, 70, 298305. Park, D., Yun, Y.S. and Park, J.M. (2008) XAS and XPS studies on chromium-binding groups of biomaterial during Cr(VI) biosorption, Journal of Colloid and Interface Science, 317, 5461. Parris, K. (2004) Agriculture, biomass, sustainability and policy: an overview, In K. Parris and T. Poincet (Eds.), Biomass and Agriculture: Sustainability, Markets and Policies, Organisation for Economic Co-operation and Development (pp. 27-36) Paris, OECD Publications. Pollard, S.J.T., Fowler, G.D., Sollars, C.J. and Perry, R. (1992) Low-cost adsorbents for waste and wastewater treatment: a review, The Science of the Total Environment, 116, 31-52. Prahas, D., Kartika, Y., Indraswati, N. and Ismadji, S. (2008) Activated carbon from jackfruit peel waste by H3PO4 chemical activation: Pore structure and surface chemistry characterization, Chemical Engineering Journal, In Press, doi:10.1016/ j.cej.2007.08.032. Purevsuren, B., Avid, B., Narangerel, J., Gerelmaa, T. and Davaajav, YA. (2004) Investigation on the pyrolysis products from animal bone, Journal of Materials Science, 39, 737 740. Qi, L., Xu, Z., Jiang, X., Hu, C. and Zou, X. (2004) Preparation and antibacterial activity of chitosan nanoparticles, Carbohydrate Research, 339, 26932700. Radhika, M. and Palanivelu, K. (2006) Adsorptive removal of chlorophenols from aqueous solution by low cost adsorbentKinetics and isotherm analysis, Journal of Hazardous Materials, B138, 116124. Rao, M.M., Rao, G.P.C., Seshaiah, K., Choudary, N.V. and Wang, M.C. (2008) Activated carbon from Ceiba pentandra hulls, an agricultural waste, as an adsorbent in the removal of lead and zinc from aqueous solutions, Waste Management, In Press, doi:10.1016/j.wasman.2007.01.017. Rengaraj, S., Moon, S.H., Sivabalan, R., Arabindoo, B. and Murugesan, V. (2002) Agricultural solid waste for the removal of organics: adsorption of phenol from water and wastewater by palm seed coat activated carbon, Waste Management, 22, 543548. Rodriguez-Reinoso, F. and Molina-Sabio, M. (1998) Textural and chemical characterization of microporous carbons, Advances in Colloid and Interface Science, 76-77, 271-294. Ruth, M. A (2006) Quest for the economics of sustainability and the sustainability of economics, Ecological Economics, 56, 332-342. Sathishkumar, M., Binupriya, A.R., Kavitha, D. and Yun, S.E. (2007) Kinetic and isothermal studies on liquid-phase adsorption of 2,4-dichlorophenol by palm pith carbon, Bioresource Technology, 98, 866873.
208
Savova, D., Apak, E., Ekinci, E., Yardim, F., Petrova, N., Budinova, T., Razvigorova, M. and Minkova, V. (2001) Biomass conversion to carbon adsorbents and gas, Biomass and Bioenergy, 21, 133142. entorun-Shalaby, ., Uak-Astarliolu, M.G., Artok, L. and Sarici, . (2006) Preparation and characterization of activated carbons by one-step steam pyrolysis/activation from apricot stones, Microporous and Mesoporous Materials, 88, 126134.] Sharma, P., Kumari, P., Srivastava, M.M. and Srivastava, S. (2006) Removal of cadmium from aqueous system by shelled Moringa oleifera Lam. seed powder, Bioresource Technology, 97, 299305. Singh, K.K., Singh, A.K. and Hasan, S.H. (2006) Low cost bio-sorbent wheat bran for the removal of cadmium from wastewater: Kinetic and equilibrium studies, Bioresource Technology, 97, 9941001. Singh, K.P., Malik, A., Sinha, S. and Ojha, P. (2008) Liquid-phase adsorption of phenols using activated carbons derived from agricultural waste material, Journal of Hazardous Materials, 150, 626641. imanolu, T. (2007) Removal of some fungicides from aqueous solution by the biopolymer chitin, Colloids and Surfaces A: Physicochem. Eng. Aspects, 297, 3845. Stout, B.A. (1984) Energy Use and Management in Agriculture, North Scituate, MA: Breton Publishers. Suhas, Carrot, P.J.M. and Carrot, M.M.L. (2007) Lignin from natural adsorbent to activated carbon: A review, Bioresource Technology, 98, 2301-2312. Tan, I.A.W., Hameed, B.H. and Ahmad, A.L. (2007) Equilibrium and kinetic studies on basic dye adsorption by oil palm fibre activated carbon, Chemical Engineering Journal, 127, 111-119. Tamai, H., Katsu, N., Ono, K. and Yasuda, H. (2001) Antibacterial activated carbons prepared from pitch containing organometallics, Carbon, 39, 1963-1969. Tokimoto, T., Kawasaki, N., Nakamura, T., Akutagawa, J. and Tanada, S. (2005) Removal of lead ions in drinking water by coffee grounds as vegetable biomass, Journal of Colloid and Interface Science, 281, 5661. Tsai, W.T., Yang, J.M., Lai, C.W., Cheng, Y.H., Lin, C.C. and Yeh, C.W. (2006) Characterization and adsorption properties of eggshells and eggshell membrane, Bioresource Technology, 97, 488493. Unnithan, M.R., Vinod, V.P. and Anirudhan, T. S. (2004) Synthesis, characterization, and application as a chromium(VI) adsorbent of amine-modified polyacrylamide-grafted coconut coir pith, Ind. Eng. Chem. Res., 43, 2247-2255. Valix, M., Cheung, W.H. and Zhang, K. (2006) Role of heteroatoms in activated carbon for removal of hexavalent chromium from wastewaters, Journal of Hazardous Materials, B135, 395405. Vernersson, T., Bonelli, P.R., Cerrella, E.G. and Cukierman, A.L. (2002) Arundo donax cane as a precursor for activated carbons preparation by phosphoric acid activation, Bioresource Technology, 83, 95104. Vijayaraghavan, K., Palanivelu, K. and Velan, M. (2006) Biosorption of copper(II) and cobalt(II) from aqueous solutions by crab shell particles, Bioresource Technology, 97, 14111419. Volesky, B. (1990) Biosorption and biosorbents. In: B. Volesky (Ed.), Biosorption of Heavy Metals, New York: CRC Press.
209
Volesky, B. (2001) Detoxification of metal-bearing effluents: biosorption for the next century, Hydrometallurgy, 59, 203-216. Xie, W., Wang, Q., Yao, J., Ma, H., Ohsumi, Y. and Ogawa, H.I. (2004) Study on advanced treatment of secondary effluent using fixed-bed filled with bone char, Water, Air, and Soil Pollution, 159, 313324. Walker, G.M. and Weatherley, L.R. (2001) Adsorption of dyes from aqueous solutionthe effect of adsorbent pore size distribution and dye aggregation, Chemical Engineering Journal, 83, 201206. Warhurst, A.M., Fowler, G.D., McConnachie, G.L. and Pollard, S.J.T. (1997a) Pore structure and adsorption characteristics of steam pyrolysis carbons from moringa oleifera, Carbon, 35, 1039-1045. Warhurst, A.M., McConnachie, G.L. and Pollard, S.J.T. (1997b) Characterisation and applications of activated carbon produced from moringa oleifera seed husks by singlestep steam pyrolysis, Water Research, 31, 759-766. Wartelle, L.H. and Marshall, W.E. (2005) Chromate ion adsorption by agricultural byproducts modified with dimethyloldihydroxyethylene urea and choline chloride, Water Research, 39, 2869-2876. Wartelle, L.H. and Marshall, W.E. (2006) Quaternized agricultural by-products as anion exchange resins, Journal of Environmental Management, 78, 157-162. Wilson, J.A., Pulford, I.D. and Thomas, S. (2003) Sorption of Cu and Zn by bone charcoal, Environmental Geochemistry and Health, 25, 5156. Wilson, K., Yang, H., Seo, C.W. and Marshall, W.E. (2006) Select metal adsorption by activated carbon made from peanut shells, Bioresource Technology, 97, 22662270. Zabaniotou, A., Stavropoulos, G. and Skoulou, V. (2008) Activated carbon from olive kernels in a two-stage process: Industrial improvement, Bioresource Technology, 99, 320-326. Zdravkov, B.D., ermk, J.J., efara, M. and Jank, J. (2007) Pore classification in the characterization of porous materials: A perspective, Central European Journal of Chemistry, 5, 385-395. Zhang,Y., Cui, H., Ozao, R., Cao, Y., Chen, B.I.-T., Wang, C.-W. and Pan, W.-P. (2007) Characterization of Activated Carbon Prepared from Chicken Waste and Coal, Energy & Fuels, 21, 37353739. Zulkali, M.M.D., Ahmad, A.L. and Norulakmal, N.H. (2006) Oryza sativa L. husk as heavy metal adsorbent: Optimization with lead as model solution, Bioresource Technology, 97, 2125.
Chapter 4
MOLECULAR TRACEABILITY IN THE POST-GENOMIC ERA: AN APPLICATION OF DNA TECHNOLOGY TO FOOD SCIENCE Valeria Terzi*, Caterina Morcia and Primetta Faccioli
C.R.A., GPG, Genomics Research Centre, Via San Protaso 302, 29017-Fiorenzuola dArda , Italy
ABSTRACT
The recent worldwide progress of food regulation legislation is directed toward the need to guarantee satisfaction for consumers from both a safety and quality point of view. The composition in animal and plant species of a specific food is one of the key factors in determining the quality and the safety of the final product. Therefore, the traceability of ingredients is required along the whole production chain: the reliable identification of plant and animal ingredients at the level of species, but even at the level of genotypes is in fact essential for the handling, marketing and processing of raw materials and derived products. Moreover, the identification of microbial species that are mycotoxigenic or potentially dangerous for human and animal health in agricultural products, food and feed is an essential task from a safety point of view. Taking advantage of genomic research, DNA profiling techniques are now widely proposed not only for traceability and genotyping purposes, but even for the assessment of superior genotypes carrying genes related to quality traits. The recent advances in the application of genomic tools for the above- mentioned purposes are reviewed.
INTRODUCTION
The quality and safety of food and feed, fundamental needs of the agricultural sector, are now re-discovered as worldwide topic priorities. In recent years, in fact, some food-related health crises have shaken consumer confidence in the safety of food products. Quality and
*
Phone -39 0523 983758; Fax -39 0523 983750,E-mail valeria.terzi@entecra.it
212
Valeria Terzi, Caterina Morcia and Primetta Faccioli
safety of food are thus a major benchmark of the economic development and peoples living conditions of a country. Consumers more frequently look for quality seals and trust marks on food products, and expect manufacturers and retailers to provide products of high quality. Responding to the challenge, several countries worldwide have promoted specific actions and funded related research projects. The European Union has put in place a comprehensive strategy, based on the introduction of new legislation rules, on the establishment of an independent European Food Authority (efsa.eu.int/ ) and on public research financing, to restore peoples belief in the safety of their food from the farm to the fork. This is based on a combination of high standards for food, animal health and welfare, and plant health (europa.eu.int/comm/dgs/health_consumer/library/pub/pub06_en.pdf). In the USA, the USDA recently promoted a Nutrition, Food Safety, and Quality program to provide the means to ensure that the food supply is safe for consumers and that food and feed meet foreign and domestic regulatory requirements (http://www.ars.usda.gov/pandp/locations/locations.htm? modecode=02-04-00-00). For decreasing the hazards of both introduced and naturally occurring toxicants in foods and feed (including pathogenic bacteria, viruses and parasites, chemical contaminants, mycotoxins produced by fungi growing on plants, and naturally occurring toxins produced by plants), Chinas government promoted the publication of a white paper entitled The Quality and Safety of Food in China (http://www.chinadaily.com.cn/china/200708/17/content_6032557. htm). The document describes the Chinese government's efforts in enhancing the level of food quality and improving the level of food safety over the past years. CSIRO (Commonwealth Scientific and Industrial Research Organisation), the Australia's national science agency, is developing innovative agri-food and processing technologies focusing, among other things, on quality biosensors and consumer engagement (http://www.csiro.au/ org/FoodFuturesFlagship.html). It must be underlined however, that safety does not mean uniformity. Each country promotes diversity of agri-food products, based on quality: traditional foods and products from specific regions are therefore protected and revalued [Trichopoulou et al., 2007]. Moreover, there is the need to respect the consumers rights with public debates and labelling to allow an informed choice, that can reflect different lifestyles and nutrition requirements. Mandatory or voluntary labelling is therefore essential to give an indication of several food characteristics, which can range from ingredients or categories of ingredients to nutrition and health claims [for a review, see Cheftel, 2005]. In this scenario, several research actions directed toward the enhancement of food quality and safety have been promoted, ranging from the development of new breeding approaches to innovative traceability strategies and technologies for a better monitoring and evaluation of food.
MOLECULAR TOOLS FOR SPECIES TRACEABILITY

Among others, several applications of DNA technologies have been proposed for molecular traceability of the presence, in food or feed, of species, ingredients, microrganisms, animal races and conventional or genetically modified plant varieties. DNA analysis in fact
Molecular Traceability in the Post-genomic Era
213
offers advantages over protein-based approaches, including stability at high temperatures, presence in all tissue types, high level of polymorphism [Teletchea, 2005]. DNA-DNA hybridization techniques belong to the past, because of the high amounts of nucleic acid required, and have been substituted by PCR-based tests to amplify specific fragments of interest in the sample. The well-known Polymerase Chain Reaction has in fact revolutionized molecular biology during the last twenty years: the combined use of short primers complementary to regions of target sequence with opportune DNA polymerase and temperature conditions, allows the synthesis of million of copies of the fragment of interest. The amplification products can be further characterised by sequencing, digestion, hybridisation. Up to now, several PCR-based genotyping technologies exist, ranging from the identification and quantification of a specific DNA sequence to the high-throughput production of molecular markers. A great amount of research on the application of PCR for traceability and authenticity assessment of food samples is focussed on animal and plant species detection. For these purposes, PCR-sequencing, PCR-RFLP (Restriction Fragment Length Polymorphism), PCR-SSCP (Single Strand Conformational Polymorphism) are widely used techniques. A direct means to obtain information after PCR, is by amplicon sequencing, however this approach is time consuming and technically demanding. Several different primer-extension and ligation-based chemistries have been incorporated into sophisticated "allelic discrimination" assays for higher-throughput analyses. Pyrosequencing is based on single-base extension chemistry, and the detection of the added nucleotide is achieved with the help of the firefly enzyme, luciferase. This enzyme generates luminescence upon the release of the natural byproduct of DNA synthesis, pyrophosphate, when a base attaches to the primer. The dNTPs are released into the reaction mixture one-by-one in a predetermined order; whichever nucleotide causes light emission is the one added to the sequence. It is now possible to type 384 samples at once by pyrosequencing. For species identification, widely used approaches are based on the design of sequencespecific primers [SSP or allele specific primer extension (ASPE)], sequence-specific oligonucleotide probes [SSOP or allele-specific oligonucleotides (ASO)], and restriction fragment length polymorphism analysis following PCR [PCR-RFLP]. PCR-RFLP markers are obtained after amplicon digestion with a very careful choice of restriction enzymes to produce fragments of well-defined size. In PCR-SSCP analysis, the informative markers can be characterized on the basis of their electrophoretic mobility in single-stranded conformation: the amplified products are therefore denatured to a single-stranded form and electrophoresed on a non-denaturing polyacrilamide gel. All these techniques give an indication about presence or absence of the target sequence, lacking a quantitative information. Therefore, starting from end-point PCR, a quantitative technique, the real time qPCR, has been developed. The greatest amount of research on the application of PCR for traceability and authentication of food is now based on real time qPCR. This evolution of conventional PCR allows one to quantify a target sequence, following the amplification kinetics in real time, thanks to the use of fluorescent molecules or probes that highlight the progressive growth of amplicons. This technique has several advantages over conventional PCR, ranging from the elimination of all the post-PCR processing steps to the increasing of result reliability with the use of specific probes. Quantification in a sample is done on the basis of the PCR cycle threshold [Ct]: the real-time PCR data are in fact plotted as the Rn fluorescence signal versus cycle number. The software
214
of the real-time PCR instrument commonly calculates the Rn using the equation Rn = [R+n][R-n], were R+n is the fluorescence signal of the product at any given time and R-n is the fluorescence signal of the baseline emission during cycles 6-15. An arbitrary threshold is set at the midpoint of the log Rn versus the cycle number plot. The Ct value is defined as the cycle number at which the Rn crosses this threshold. The number of PCR cycles needed for a sample to reach the Ct is inversely proportional to the number of DNA target sequence present at starting time in the sample. A curve reporting the Ct values of standard samples plotted against the amount of target sequence can be used to get absolute quantification of the target sequence in unknown samples. These qPCR assays can be run in medium-throughput studies using 384-well plates and real-time PCR instruments that can complete the run in less than 40 minutes. High Resolution Melting [HRM] is an innovative post-PCR method, that is an extension of previous DNA dissociation analysis. This new approach can be used to characterize amplicons according to their dissociation behaviour as they move from double-stranded to single-stranded conformation with increasing temperature. HRM instruments, characterized by higher optical and thermal precision in comparison with classical qPCR instruments, allow one to analyze samples according to their sequence, length, GC content or strand complementarity. Even single-base changes such as SNPs [Single Nucleotide Polymorphisms] can be readily identified: dedicated instruments can analyze 384-well plates in a short time, making high-throughput analysis possible. The system is inexpensive, there are no constraints on primer design, it is closed-tube, thus reducing the contamination risk: for all these reasons HRM technology seems to be a promising tool for genotyping and application for food and feed molecular characterisation. A very interesting area of development for molecular traceability and authentication is the use of the so-called lab-on-a-chip technologies, for which a huge diversity of technological solutions has been proposed. For example, the miniaturisation of chambers both for PCR reaction and for electrophoretic separation of the amplified products has been shown to increase the speed, efficiency and functionality of the analysis. PCR reactions conducted in picoliters of volume can in fact proceed with high degree of control, thanks to the higher rate of thermal exchanges [De Mello, 2003]. Moreover, electrophoretic characterisation of the PCR products can be greatly improved using technologies that combine capillary electrophoresis into an easy-to-use chip-based format. Instruments like Agilent 2100 Bioanalyser or BioRad Experion are based on this technology for improved separation of DNA, RNA and proteins. Another family of microfluidic device-based techniques are DNA microarray: these tools are now widely used in several research fields and proposed in several different models [Venkatasubbarao, 2004]. This high-throughput technology allows the simultaneous detection of thousands of DNA sequences [Galbraith, 2006] through hybridization among the target and the probes on the chip. For gene expression studies in several organisms, high-density chips carrying millions of oligonucleotide probes are now in use, however, until now, for traceability purposes, medium and low-density microarrays have been proposed [Pic, 2007; Leimanis et al., 2006]. New diagnostic probes are constantly developed, like nanobiotransducers, that are molecular beacons bringing a fluorescein molecule in 5 end and a golden particle in 3 end. Transduction changes are associated with hybridization of the target sequence with such probes [Firrao et al., 2005]. Alternatively, PNA [Peptide Nucleic
215
Acid] probes have been developed for traceability purposes, because the duplex PNA/DNA is more stable than DNA/DNA hybrid: this fact allows one to target a sequence with higher sensibility [Germini et al., 2005]. Nanoparticle-based DNA biosensor in a dry-dipstick configuration has been proposed for visual detection of genetically modified organisms [Kalogianni et al., 2006]. In other analytical approaches, the LDR [Ligation Detection Reaction] reaction has been used to identify a sequence: the target sequence is in fact ligated to probes immobilized onto a chip and bearing specific ZipCodes [Busti et al., 2002], that allow the easy and unambiguous identification of the target sequences. An innovative development was the combination of solution-phase genotyping methods with a fluorescently coded microbead-capture step. In single-base extension chemistries, oligonucleotides with unique address tags at their 5' end and target-specific 3' ends are hybridized to PCR-amplified genomic DNA targets and then extended by DNA polymerase: a ligation reaction follows in which the common probe is biotin-labeled. The next step is hybridization to complementary tags attached to spectrally distinct microbeads and detection of the hybridization with flow cytometry-based instrument, like the Luminex analyzer. Each microbead is specific for a single variant and will emit the fluorescent signal if the variant is present. The bead-based platform performs equally well with single-base extension, primer extension, hybridization, and oligonucleotide ligation assays. With Luminex technology hundred-plex detection is possible, making this approach particularly attractive for the analysis of large number of variants [Dorak, 2006]. Up to now, the bottleneck of the majority of these technologies is the need to analyse samples that have been previously amplified via PCR. Moreover, in several applications, microarray technology gives qualitative output, indicating only the presence/absence of the target sequence and not its amount in the unknown sample. This limitation is however balanced by the opportunity to examine the sample for a very high number of characteristics.
THE BARCODE APPROACH

In 2003, Paul D. Hebert [Hebert and Gregory, 2005] demonstrated that the nucleotidic sequence of a single gene can be used to differentiate and to identify the majority of animal species. This was the starting point of the so called DNA barcoding approach, based on the fact that the polymorphisms of the nucleotidic sequence of a specific genic region can be assimilated to a bar code by which every species is identified by an highly conserved sequence or by a group of sequences. As consequence, the Consortium for the Barcode of Life [CBOL, http://barcoding.si.edu/] was created, as an international initiative devoted to developing DNA barcoding as a global standard for the identification of biological species with molecular diagnostic tools. DNA barcode sequences, to be useful, must be obtained reasonably quickly and cheaply. The "Folmer region" at the 5' end of the cytochrome c oxidase subunit 1, mitochondrial region [COI] has been selected as the standard barcode region for almost all groups of higher animals. This region is 648 nucleotide base pairs long in most groups and is flanked by regions of conserved sequences, making it relatively easy to isolate and analyze. A growing number of studies have shown that COI sequence variability is very low [generally less than 1-2%] and that the COI sequences of even closely related species differ by several percent, making it possible to identify species with high confidence.
216
For those groups in which COI is unable to resolve species-level differences, CBOL recommends the use of an additional gene region. In some groups, COI is not an effective barcode region and a different standard region must be identified. For example, this approach is not so easy to apply to species identification in plants: in the work of Barcaccia et al. [2007] it was investigated the opportunity to use standard DNA regions from the chloroplastic genome that is uniparentally inherited, nonrecombining and structurally stable. For phylogenetic purposes, the most commonly exploited locus in plants is the one relative to the rbcL gene, encoding for ribulose 1,5 bisphosphate carboxylase-oxygenase. Therefore, it was suggested to adopt an integrated approach of DNA barcoding consisting on the use of multiple genes, both nuclear, like rbcL, and chloroplastic, like atpB, ndhF and matK exons and non-coding regions such as the trnL intron and the trnL-F intergenic spacer. Noncoding regions offer the advantages to have fast rates of evolution and to be short so they can be directly amplified and sequenced. Up to now, barcoding approach finds its main application in biodiversity studies and genetic resources characterization, together with other molecular tools [Ruane and Sonnino, 2006]. However, as underlied by CBOL [Consortium for the Barcode of Life] when established, barcoding will quickly identify undesirable animal or plant material in processed foodstuffs and detect commercial products derived from regulated species.
MOLECULAR MARKERS FOR GENOTYPING

Classical approaches for genotyping are based on the use of molecular markers, that can be mapped and therefore have well-known positions onto the chromosomes of the organism or can be unmapped, with unknown location. Several classes of molecular markers have been developed, designed on expressed or intergenic regions, on nuclear, mitochondrial or chloroplast sequences. A molecular marker can be defined as a particular DNA sequence or a product thereof capable of recognizing a defined genotype in a population of individuals; so by definition a molecular marker must be polymorphic between two given genotypes. The discovery of molecular markers started in 1970 [Grodzicker et al., 1974] with RFLPs [Restriction Fragment Length Polymorphisms]; these markers made it possible to recognize differences in DNA sequences between two individuals by Southern analysis of restricted fragments. Yet, to overcome some technical constraints of RFLPs, first of all the labour intensity, many other markers have been proposed since that time, which in turn have led to the creation of second-generation molecular markers like microsatellites [SSRs, Simple Sequence Repeats], AFLPs [Amplified Fragment Length Polymorphisms], STSs [Sequence Tagged Sites], SCARs [Sequence Characterized Amplified Regions] and CAPSs [Cleaved Amplified Polymorphic Sequences]. The advantage of marker classes such RFLPs, SSRs or specific-primed PCR markers is the codominant behaviour, enabling them to detect heterozygous genotypes. On the other hand, random markers like RAPDs and AFLPs generate a high number of dominant data in a short time. The DNA polymorphisms detected can be converted into binary matrices reporting the presence/absence as 1/0 code. These are the input data from which genetic similarity/dissimilarity matrices can be obtained with the aid of available dedicated softwares. Moreover, graphical representations can be obtained after clustering analysis of the data for a better evaluation of distance among genotypes.
217
The last generation of molecular markers include SNPs, that identify single-base polymorphisms and therefore can be applied in high-throughput systems: several different technological approaches can detect SNPs, like microarray scanning, real-time PCR analysis, MALDI-TOF, single base extension approach, OLA analysis, dideoxysequencing. The different methods are characterized by different accuracy, cost and throughput [Pati et al., 2004].
DATABASES AND MOLECULAR TRACEABILITY

Nucleotide sequences databases publicly available via web are now essential even for molecular traceability. In particular, genome sequencing projects are now opening new opportunities even for traceability purposes. Several databases, developed and managed by academic or governmental entities or international consortia, are now publicly available. In Nucleic Acids Research [http://nar.oxfordjournals.org/archive/] a special issue is published each year with the aim to renew the description of biological databases that can be of relevant interest for biological research. Talking about molecular traceability useful databases collecting nucleotide sequences are Gen-Bank [http://www.ncbi.nlm.nih.gov/Genbank], EMBL [http://www.ebi.ac.uk/embl, DDBJ [http://www.ddbj.nig.ac.jp]. Usually, the traceability lab working flow starts in fact with the identification of a set of publicly available DNA sequences in selected via a functional annotation based query. On the basis of the researcher knowledge, a deeper selection of the hypothetical optimal sequences is then obtained. The chosen sequences are subsequently aligned by means of a dedicated, locally installed or web based, software. In this way, common DNA regions are underlined and a more restricted set of sequences is selected for the lab analysis. The development of a new traceability approach is therefore a multi-step workflow, involving several in silico activities devoted to sequence selection [Faccioli et al., 2007].
PLANT SPECIES TRACEABILITY

The plant species composition in food and feed can be relevant both for the quality and the safety of the product. Food allergies represent, for example, an important health problem in industrialized countries, affecting about 1% of the worlds adult population and up to 2.5% of the children population [Jackson, 2003]. Not only some animal-derived products like crustaceans, eggs, cows milk, specific fish, but even some plant species contain allergens [Poms et al., 2004]. These are typically proteins or glycoproteins with molecular weight ranging from 10 to 70 kDa. Although any protein can be potentially allergenic, the most severe adverse reactions are associated with the consumption of a small number of plants, that are however widely used as ingredients in several foods, like soybean and wheat, together with the group of tree nuts and peanuts. New directives have been diffused worldwide regarding the comprehensive labelling of allergenic food ingredients [van Hengel, 2007] and, as consequence, the analytical methods for allergen identification in food have been strenghtened. Although the determination of allergens in food is currently mainly based on immunological methods based on the use of monoclonal antibodies [Blais et al., 2003; Poms
218
et al., 2004], DNA-based technologies are emerging. In fact, commercial products often involve heat treatments which denature the food proteins, interfering with the allergen detection based on immunological assays. On the contrary, DNA remains intact even after strong temperature and pressure treatments and can therefore provide the basis of a robust assay for allergen detection. Recent advances in DNA technology have thus led to the development of several PCR and real time-PCR based analytical approaches: Table 1 reports some examples of such assays directed toward the identification and quantification of peanuts and tree nuts. Several other qPCR assays are now available for the traceability of other plant species containing allergens, like celery [Hupfer et al., 2007], buckwheat [Hirao et al., 2005] and some cereals [Table 2]. For the identification of such plant species interesting microarraybased approaches have been developed. In the work of Rossi et al. [2006] a PNA-array platform in combination with a duplex PCR has been designed and implemented for the detection of hidden allergens in foodstuffs: PNA [Peptide Nucleic Acid] probes were designed, synthesized and characterized to investigate the presence of traces of nuts, hazelnut and peanut. The rationale of the work is that the use of PNA probes is advantageous if compared to the use of DNA probes, because of higher thermal stability of PNA/DNA hybrids versus DNA/DNA. The plant species composition can be relevant not only for the safety, but even for the quality of a commercial products. For example, pasta made from durum wheat semolinas is considered superior, from a qualitative point of view, to pasta produced with bread wheat flours or with mixture of the two species. As a consequence, the quality of the pasta labelled as made in Italy is protected by directives that impose the use of durum wheat semolinas, with a maximum threshold of bread wheat contamination equal to 3%. For the discrimination of bread and durum wheats, classical analytical approaches are based on the identification, through isoelectrofocusing separation, of some protein isoforms that are species-specific. However, the high temperatures now used for pasta drying can led to the denaturation of such proteic isoforms: therefore DNA-based approaches have been developed. PCR assays, both qualitative and quantitative, have been developed to detect adulteration of pasta with bread wheat or non-wheat flours [von Buren et al., 2001; Alary et al., 2002; Terzi et al., 2003; Pasqualone et al., 2007; Kelly and Bhave, 2007]. Several other crop species are now detectable via PCR (Terzi et al., 2005): Table 3 reports the primers designed for the detection of some of them. These primers can be used even in the monitoring of GM [Genetically Modified] components in food and feed, for the identification and quantification of species as requested by directives of some countries [Engel et al., 2006].
Table 1. Examples of PCR-based assays developed for the molecular traceability of peanuts and tree nuts
Species Hazelnut Hazelnut Peanut Peanut Peanut Peanut Walnuts Technology PNA-array and duplex PCR Real time PCR with TaqMan probe PCR PNA-array and duplex PCR Real time PCR with TaqMan probe Real time PCR with TaqMan probe Real time PCR with TaqMan probe References Rossi et al., 2006 Arlorio et al., 2007 Delano and Schmidt, 2004 Rossi et al., 2006 Hird et al., 2003 Stephan and Vieths, 2004 Brezna et al., 2006
Table 2. Cereal species containing allergens for which PCR assays are available.
Cereal species Sequence primer References Bryan GJ, Dixon A, Gale MD, Wiseman G [1998] Jornal of Cereal Science 28:135-145 Bryan GJ, Dixon A, Gale MD, Wiseman G [1998] Jornal of Cereal Science 28:135-145 Arlorio M, Coisson JD, Cereti E, Travaglia F, Papasso M, Martelli A [2003] Eur Food Res Technol 216:253258 Arlorio M, Coisson JD, Cereti E, Travaglia F, Papasso M, Martelli A [2003] Eur Food Res Technol 216:253258 Sequence primer
Bread wheat Primer Forward GTCCTATATCTTGAGGCCGCAAG Primer Reverse AACCCACTGTACCTGAGTATATATC
GTCCTATATCTTGAGGCCGCAAG AACCCACTGTACCTGAGTATATATC
Bread wheat Primer Forward CTTCTGACGGGTCAGGGGCAC Primer Reverse CTGAATGCCCCTGCGGCTTAAG
CTTCTGACGGGTCAGGGGCAC CTGAATGCCCCTGCGGCTTAAG
Bread wheat Primer Forward GGGAAATGGGTAGCAAAGCAACC Primer Reverse GCGAGCCAACAGAAATGGTGC
GGGAAATGGGTAGCAAAGCAACC GCGAGCCAACAGAAATGGTGC
Bread wheat Primer Forward TCGGCTGGTACATCATCCTCCC Primer Reverse GCGAGCCAACAGAAATGGTGC
TCGGCTGGTACATCATCCTCCC
Bread wheat Primer Forward AGCACTTCTCCCGAACCTCA Primer Reverse CAGTACCTGGCCCACAAA Probe CTCACAGCCGCCCTTCCACCA
GCGAGCCAACAGAAATGGTGC Alary R, Serin A, Duviau MP, Joudrier P, Gautier MF [2002] Cereal Chemistry 79:553-558 AGCACTTCTCCCGAACCTCA CAGTACCTGGCCCACAAA CTCACAGCCGCCCTTCCACCA Terzi V, Malnati M, Barbanera M, Stanca AM, Faccioli P [2003] Jornal of Cereal Science 38:87-94
Wheats
Primer Forward CGTTGGCACCGGAGTTG Primer Reverse TCACCGCTGCATCGACAT ATTGGGTCACCGTTGTTTAGTCGATG Probe GA
CGTTGGCACCGGAGTTG TCACCGCTGCATCGACAT ATTGGGTCACCGTTGTTTAGTCGATGGA
Bread wheat Primer Forward TGGTCTCATCCCTCTGGTCAA Primer Reverse GCTGCTGAGGAATCTGTGCTA Probe TGAGGCAACAATGCTGCCAACAA
Terzi V, Malnati M, Barbanera M, Stanca AM, Faccioli P [2003] Jornal of Cereal Science 38:87-94
TGGTCTCATCCCTCTGGTCAA GCTGCTGAGGAATCTGTGCTA TGAGGCAACAATGCTGCCAACAA
Table 2. Continued
Cereal species Sequence primer References Sequence primer Allmann M, Candrian U, hofelein C, Luthy J [1993] Zeitschrift fur Lebensmittel-Untersuchung und Forschung 196:284-251 GCGGCGTGTGCCACGTACGTGGTTT GAACGGGCTGTACGTGGACACGGGA Dahinden I, von Buren, M, Luthy J [2001] Eur Food Res Technol 212:228233 Von Buren M, Stadler M, Luthy J [2001] Eur Food Res Technol 212:234-239 Von Buren M, Stadler M, Luthy J [2001] Eur Food Res Technol 212:234-239 Sandberg M, Lundberg L, Ferm M, Malmheden Yman I [2003] Eur Food Res Technol 217:344-349 DePater BS, Schilperoort RA [1992] 18:161-164
Wheats
Primer Forward GCGGCGTGTGCCACGTACGTGGTTT Primer Reverse GAACGGGCTGTACGTGGACACGGGA
Wheats
Primer Forward GGTAACTTCCAAATTTCAGAGAAAC Primer Reverse TCTCTAATTTAGAATTAGAAGGAA
GGTAACTTCCAAATTTCAGAGAAAC TCTCTAATTTAGAATTAGAAGGAA GCAGCAAGAACAACAAGAACAA CGGCGACTACGCTGGA GCAACCACAACAACAATTTTCT GATATAGTGGCAGCAGGATATG
Bread wheat Primer Forward GCAGCAAGAACAACAAGAACAA Primer Reverse CGGCGACTACGCTGGA Bread wheat Primer Forward GCAACCACAACAACAATTTTCT Primer Reverse GATATAGTGGCAGCAGGATATG
Wheats
Primer Forward CAGAAAGCGAGTGGAAAGATGAAAG Primer Reverse GCAAGGAGGACAAAGATGAGGAA
CAGAAAGCGAGTGGAAAGATGAAAG
Wheat
Primer Forward TGCCCATTGTCGGCCTTA Primer Reverse GCATTCCAACCATCTGCCC Probe
TGCCCATTGTCGGCCTTA GCATTCCAACCATCTGCCC FAM-TGCCTCGACAACACCATCGCTATCCTAMRA
Wheat
FAM-TGCCTCGACAACACCATCGCTATCC-TAMRA Ogasawara T, Sawasaki T, Morishita R, Ozawa A, madin k, Endo Y [1999] EMBO Primer Forward GGAGCGGTTGCTGTTGGA J 18:6522-6531 Primer Reverse GCCTCGGTGCATTAATAATCTTG VICCGATTGGCGGTGCCTCTACTCACGProbe TAMRA
GGAGCGGTTGCTGTTGGA GCCTCGGTGCATTAATAATCTTG VIC-CGATTGGCGGTGCCTCTACTCACGTAMRA
Wheat
Primer Forward ATTTTCCATTCACTTGGCCC Primer Reverse TGCTATCTGGCTCAGCTGC TET-ATGGTGGAAGGGCGGTTGTGAPrimer Forward TAMRA
Li Z, Hansen JL, Liu Y, Zemetra R, Berger PH [2004] Plant Molecular Biology Reporter 22:179-188 ATTTTCCATTCACTTGGCCC TGCTATCTGGCTCAGCTGC TET-ATGGTGGAAGGGCGGTTGTGA-TAMRA
Cereal species Barley
Sequence primer
References Dahinden I, Von Buren M, Luthy J [2001] Eur Food Res Technol 212:228-233 Sandberg M, Lundberg L, Ferm M, Malmheden Yman I [2003] Eur Food Res Technol 217:344-349 Taverniers I, Van Bockstaele E, De Loose M [2004] Anal Bioanal Chem 378:1198-1207
Sequence primer GGTAACTTCCAAATTTCAGAGAAAC TCTCTAATTTAGAATTAGAAGGAA
Barley
Primer Forward ATTAATTCCCAAACTGAACGACTA Primer Reverse CATGGCGAACATGTGAAC
ATTAATTCCCAAACTGAACGACTA CATGGCGAACATGTGAAC
Barley
Primer Forward AGACAAGGCGTGCAGATCG Primer Reverse GACCCTGGACGAGCACACAT FAM-CCTCAGCCGCAACAGGTGGGTCProbe TAMRA
AGACAAGGCGTGCAGATCG GACCCTGGACGAGCACACAT FAM-CCTCAGCCGCAACAGGTGGGTC-TAMRA
Oats
Primer Forward CGCTCAGTGGCTTCTAAGA Primer Reverse TTTTATTTTATTTGTCACCGCTAC
Sandberg M, Lundberg L, Ferm M, Malmheden Yman I [2003] Eur Food Res Technol 217:344-349 Koppel E, Stadler M, Luthy J, Hubner P [1998] Zeitschrift fur LebensmittelUntersuchung und -Forschung A 206:399-403 Von Buren M, Stadler M, Luthy J [2001] Eur Food Res Technol 212:234-239 Dahinden I, Von Buren M, Luthy J [2001] Eur Food Res Technol 212:228-233 Sandberg M, Lundberg L, Ferm M, Malmheden Yman I [2003] Eur Food Res Technol 217:344-349 Terzi V, Infascelli F, Tudisco R, Russo G, Stanca AM, Faccioli P [2004] Zeitschrift fur Lebensmittel-Wissenschaft und Technologie 37:239-246
CGCTCAGTGGCTTCTAAGA TTTTATTTTATTTGTCACCGCTAC
Oats
Primer Forward TGGGAAGTCCTCGTGTTGCA Primer Reverse TTTAGTGCTGGTATGATCGC
TGGGAAGTCCTCGTGTTGCA TTTAGTGCTGGTATGATCGC GCAACCACAACAACAATTTTCT GATATAGTGGCAGCAGGATATG GGTAACTTCCAAATTTCAGAGAAAC TCTCTAATTTAGAATTAGAAGGAA
Spelt
Primer Forward GCAACCACAACAACAATTTTCT Primer Reverse GATATAGTGGCAGCAGGATATG
Rye
Rye
Primer Forward TTTTTCAGAAAGCGAGTTCAATGATG Primer Reverse CGAGGACAAAGATGAGGAAGGTCT
TTTTTCAGAAAGCGAGTTCAATGATG CGAGGACAAAGATGAGGAAGGTCT
Rye
Primer Forward TAGTCACCTTCCATCATCCA Primer Reverse CATCATCACCATATCCGTAG
TAGTCACCTTCCATCATCCA CATCATCACCATATCCGTAG
Table 2. Continued
Cereal species Sequence primer References Terzi V, Infascelli F, Tudisco R, Russo G, Stanca AM, Faccioli P [2004] Zeitschrift fur Lebensmittel-Wissenschaft und Technologie 37:239-246 Terzi V, Infascelli F, Tudisco R, Russo G, Stanca AM, Faccioli P [2004] Zeitschrift fur Lebensmittel-Wissenschaft und Technologie 37:239-246 Sequence primer
Triticale
Primer Forward TAGTCACCTTCCATCATCCA Primer Reverse CATCATCACCATATCCGTAG
TAGTCACCTTCCATCATCCA CATCATCACCATATCCGTAG
Triticale
TTACATGATAATATCCTTGCAAACATA Primer Forward GG Primer Reverse TTTAGTACCCTTTCAGTGTGCTTTATTT
TTACATGATAATATCCTTGCAAACATAGG TTTAGTACCCTTTCAGTGTGCTTTATTT
Table 3. Crop species for which PCR assays have been developed. For each species are reported the primer sequences and the reference.
CROP Soybean Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Sequence primer AACCGGTAGCGTTGCCAG AGCCCATCTGCAAGCCTTT TTCGCCGCTTCCTTCAACTTCACCT ATGGGCTTGCCTTCTTTCT CCGATGTGTGGATTTGGTG TCCACCCCCATCCACATTT GGCATAGAAGGTGAAGTTGAAGGA VIC-AACCGGTAGCGTTGCCAGCTTCG-TAMRA AACCGGTAGCGTTGCCAG AGCCCATCTGCAAGCCTTT TET-TTCGCCGCTTCCTTCAACTTCACCT-TAMRA TCAACGAAAACGAGTCTGGTG Hurst CD, Knight A, Bruce IJ [1999] Molecular Breeding 5:579-586 Vodkin LO, Rhodes PR, Goldberg RB [1983] Cell 34:1023-1031 Hubner P, Waiblinger HU, Pietsch K, Brodmann P [2001] JAOAC Int 84:1855-1864 Germini A, Zanetti A, Salati C, Rossi S, Forr C, Schmid S, Marchelli R [2004] 52:3275-3280 REFERENCES Va M, Pijnenburg H, Gendre F, Brignon P [1999] J Agric Food Chem 47:5261-5266
Soybean
Soybean
Soybean
Soybean
CROP Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward
Sequence primer GGTGGAGGCATCATAGGTAAT GAAGCAACCAAACATGATCCTC ATGGATCTGATAGAATTGACGTTA CCAGCTTCGCCGCTTCCTTC GAAGGCAAGCCCATCTGCAAGCC FAM-CTTCACCTTCTATGCCCCTGACAC-TAMRA GGGTGAGGATAGGGTTCTCTG GCGATCGAGTAGTGAGAGTCG GCCCTCTACTCCACCCCCATCC GCCCATCTGCAAGCCTTTTTGTG CACTCCATCGTGGAGAGCTT GGCGTTGTTGAAGAGGAAGA FAM-TACCCCACACGAGCCATCTACGACT-TAMRA CGGTGGATGCTAAGGCTGATG AAAGGGCCAGGTTCATTATCCTC HEX-TAAGGAGCACTCGCCGCCGCATCTG-TAMRA TGCAGCAACTGTTGGCCTTAC TGTTAGGCGTCATCATCTGTGG VIC-ATCATCACTGGCATCGTCTGAAGCGG-TAMRA CGCCAGAAATCGTTTTTCAT GGTGGTGTCCTTGCTTCCTA TGGCGGACGACGACTTGT
REFERENCES
Soybean
Hurst CD, Knight A, Bruce IJ [1999] Molecular Breeding 5:579-586
Soybean
Lin HY, Wei HA, Lin FP, Shih DYC [2006] J Food Drug Anal 14:194-202
Soybean
Delano J, Schmidb AM, Wall E, Green M, Masri S [2003] J Agric Food Chem 51:5829-5834
Soybean
Pan TM, Shih TW [2003] J Food Drug Anal 11:154-158
Maize
Xu J, Pemberton GH, Almira EC, McCarty DR, Koch KE [1995] Plant Physiology 108:1293-1294
Maize
Kuribara H, Shindo Y, Matsuoka T, Takubo K, et al [2002] Journal of AOAC International 85:1077-1089
Maize
Kirihara JA, Hunsberger JP, Mohoney WC, Messing JW [1988] Mol Gen Genet 211:477-484
Maize
Germini A, Zanetti A, Salati C, Rossi S, Forr C, Schmid S, Marchelli R [2004] 52:3275-3280
Maize
Brodmann PD, Ilg EC, Berthoud H, Herrmann A [2002] J AOAC Int 85:646-653
Table 3. Continued
CROP Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Sequence primer AAAGTTTGGAGGCTGCCGT VIC-CGAGCAGACCGCCGTGTACTTCTACC-TAMRA CCTCAGTCGCACATATCTACTATACT CTAGAATGCAGCACCAACAAA GCGCTCTGTACAAGCGTGC GCAAAGTGTTGTGCTTGGACC VIC-CACGTGAGAATTTCCGTCTACTCGAGCC-TAMRA Studer E, Dahinder I, Luthy J, Hubner [1997] Mitteilungen aus Gabiete GCTTGCATTGTTCGCTCTC Lebensmitteluntersuchung und Hygiene 88:515-524 CGATGGCATGTCAACTCCATTA CCGCTGTATCACAAGGGCTGGTACC GGAGCCCGTGTAGAGCATGACGATC CCAAAGGAGGTGCCTGTTCA TTGAGGTGAGTCAGAATGTTGTTC CCAAAGGAGGTGCCTGTTCA TTGAGGTGAGTCAGAATGTTGTTC HEX-TCACCCACTCCATGCCGCCTCACA-TAMRA CGAAGTGCTACAAAGACCCC TTTCCCACGAAGCCCAAT CCAAAGGAGGTGCCTGTTCA TTGAGGTGAGTCAGAATGTTGTTC HEX-TCACCCACTCCATGCCGCCTCACA-TAMRA Yang L, Chen J, Huang C, Liu Y, Jia S, Pan L, Zhang D [2005] Plant Cell Rep published online Yang L, Chen J, Huang C, Liu Y, Jia S, Pan L, Zhang D [2005] Plant Cell Rep published online Yang LT, Chen JK, Cheng H, Jia SR, Liu YH, Pan LW, Zhang DB [2005] Plant Cell Rep 24:237-245 Yang LT, Chen JK, Cheng H, Jia SR, Liu YH, Pan LW, Zhang DB [2005] Plant Cell Rep 24:237-245 Hurst CD, Knight A, Bruce IJ [1999] Molecular Breeding 5:579-586 Hernandez M, Esteve T, Prat S, Pla M [2004] Jornal of Cereal Science 39:99-107 Matsuoka T, Kuribara H, Akiyama H, Miura H, Goda Y, Kusakabe Y, Isshiki K, Toyoda M, Hino A [2000] J Food Hyg Soc Jpn 42:24-32 REFERENCES
Maize
Maize
Maize
Maize
Cotton
Cotton
Cotton
Cotton
CROP Cotton Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe
Sequence primer CCACGAGACAGCCTATACCAAAA CTTCTTCATCATGTCAGCAAATGC
REFERENCES Xu WT, Huang KL, Wang Y, Zhang HX, Luo YB [2006] J Sci Food Agric 86:11031109
Tomato
FAM-CGTTGAAAAGCTGTTTGAGATTGATCCTGATG-TAMRA Yang L, Pan A, Jia J, Ding J, Chen J, Cheng H, Zhang C, Zhang D [2005] J Agric AGACCACGAGAACGATATTTGC Food Chem 53:183-190 TTCTTGCCTTTTCATATCCAGACA HEX-CTCTTTGCAGTCCTCCCTTGGGCT-TAMRA AGACCACGAGAACGATATTTGC TTCTTGCCTTTTCATATCCAGACA HEX-CTCTTTGCAGTCCTCCCTTGGGCT-TAMRA TTGCTGCTCAAGATGTGATGG ACGTACCACCAGAACAATCGTCT JOE-TTCAGCAATATGATCCAGTTTGTCACAAACCTTG-TAMRA GCTGAGGGAAGCGAGACTGA CAATCCTTCTTGGGCCTACCT CTCTCCATACTCTCTGCTCCTCG CGGCATCAGCAGGAGAAAG FAM-TCACAATCTTCTTCTCTGCTATGGTCACTGCT-TAMRA Hernandez M, Ferrando A, Esteve T, Pere P, Prat S, Pla M [2003] J Agric Food Protection 66:1063-1070 TGACAATTCATTCTACTCCACGAAA TGTTACAAATTGGATCTGCGTGTT JOE-TGTTCTACCAACGGTGACGAAACTTTTTCA-TAMRA CTCGAGCACCTCCGGCT AGCGTGGAAAGAGGCGAACTCCG FAM-GGATTGGATGGCATTCGG Cameron-millis V, Brandt A [1988] Plant Mol Biol 11:449-461 Ceron J, Ortiz A, Quintero R, Bravo A [1995] 61:3826-3831 Ceron J, Ortiz A, Quintero R, Bravo A [1995] 61:3826-3831 Hernandez M, Ferrando A, Esteve T, Pere P, Prat S, Pla M [2003] J Agric Food Protection 66:1063-1070 Twell D, Wing R, Yamaguchi J, McCormick [1989] Mol Gen Genet 217:240-245
Tomato
Tomato
Potato
Potato
Potato
Sunflower
Table 3. Continued
CROP Rice Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Probe Primer Forward Primer Reverse Primer Forward Primer Reverse Sequence primer TTGCGCCTGAACGGATAT CGGTTGATCTTTTCGGGATG GACGCACGGACGGCTCGGA CGCCGCGTTCCTGCT CGTTGTAGGAGATGATCGACATG VIC-CTCATCGTCGTTGGTCACCGCG-TAMRA TTAGCCTCCCGCTGCAGA AGAGTCCACAAGTGCTCCCG VIC-CGGCAGTGTGGTTGGTTTCTTCGG-TAMRA TGGCTAAAGGTACGTGAATCTG CTCTCCCCATAAGACCTTCTCC CAGTTCTTGGAGCCGCTTGAG TGACGGATGTCGAGCTTCACA FAM-ACAGACCTACAGCCGATGGAAGCCTGC-TAMRA Hernandez M, Rio A, Esteve T, Prat S, Pla M [2001] J Agric Food Chem 49:3622GGTGAGCTGTATAATCGAGCGA 3627 GGCGCAGCATCGGCT VIC-AACACCTCTTCGACATTCGTTCCATGGTCGA-TAMRA Hernandez M, Rio A, Esteve T, Prat S, Pla M [2001] J Agric Food Chem 49:3622GAGAATGAGGAGGACCAAGCTC 3627 GGCGCAGCATCGGCT GGTCGTCCTCCTAAGGCGAAAG CTTCTTCGGCGGTCGTCCAC Weng H, Yang L, Liu Z, Ding J, Pan A, Zhang D [2004] J AOAC Int Zeitler R, Pietsch K, Waiblinger HU [2002] Eur Food es Technol 214:346-351 James D, Schmidb AM, Wall E, Green M, Masri S [2003] J Agric Food Chem 51:5829-5834 Taverniers I, Windels P, vaitilingom M, Van Bockstaele E [2005] J Agric Food Chem 53:3041-3052 Watanabe H, Abe K, Hosoyama H, Arai S [1991] J Biological Chem 266:1689716902 REFERENCES Ding J, Jia J, Yang L, Zhang W, Liu W, Zhang D [2004] J Agic Food Chem 52:33723377
Rice
Rice
Canola
Rapeseed
Rapeseed
Rapeseed
Rapeseed
227
ANIMAL SPECIES TRACEABILITY

A great amount of research has been recently focused on the molecular traceability of animal species. The great majority of the assays developed for this aim is based on PCRRFLP and real time PCR. The applications are directed toward the assessment of the presence of a target animal species for the authentication of food products in defence of the consumers rights but even for food processors that do not wish to be subjected to unfair competition [Reid et al., 2006]. An increasing number of PCR based assays are now available for the traceability of fish and Mollusca species: the commercial values of the species can in fact be very different and the species identification can be complicated when the fish is reduced in filets or minced or crumbled [Mafra et al., 2008]. A comprehensive review on the PCR-based methods available for fish and fishery products authentication has been prepared by Asensio [2007].
Table 4. Some examples of PCR-based assays developed for different target
Target of the assay Technological approach References
Detection of bovine, porcine, horse, and wallaroo in food products Specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra Quantitation of cattle or ruminant species in feeds Detection of Central Nervous System tissues in meat and meat products
Real-time uniplex and duplex polymerase chain reaction [PCR] assays with a SYBR Green I postPCR melting curve analysis SNaPshot minisequencing analysis
Lopez-Andreo et al., 2006
La Neve et al., 2008
Validation of four different realtime PCR methods Real-time RT-PCR method based on a messenger [m]RNA assay that uses bovine, ovine and caprine glial fibrillary acidic protein [GFAP] encoding gene sequences as markers Real time PCR with SYBR Green
Prado et al., 2007
Schonenbrucher et al., 2007
Quantification of red deer, fallow deer, and roe deer DNAs in meat mixtures Quantitation of mule duck in binary duck/goose foie gras mixtures Authentication of ostrich meat
Fajardo et al., 2007
Real time PCR with TaqMan probe
Rodriguez et al., 2004
PCR-RFLP
Abdulmawjood and Bulte, 2002
An impressive amount of assays are now available for the traceability of mammals and bird species that are relevant from a zootechnical point of view [reviewed by Mafra et al.,
228
Valeria Terzi, Caterina Morcia, and Primetta Faccioli
2008]. Table 4 reports some examples of such PCR-based assays applied to the resolution of specific traceability problems. Besides species traceability, the breed genetic traceability is currently important because of the many typical products available that are prepared from one breed only or cannot be made with some breeds [Dalvit et al., 2007] and for which specific labels exist. For this purpose, both deterministic and probabilistic approaches have been proposed, based on the study of allelic variants for molecular markers [Ajmone-Marsan et al., 2004; Orr et al., 2006]. It is noteworthy that the developed assays can be applied not only to fresh products like meat and milk, but even to processed food like dairy products or meat preparations. Focusing on dairy products, the authenticity assessment is an important issue to defend the consumers rights. Common adulterations of dairy products include the substitution of higher value milk with cows milk. PCR based methods can now be applied to milk and cheese samples, to differentiate the biological sources of the product. Cow, buffalo, goat, sheep can therefore be tracked in raw and treated milk, milk derivatives and cheese [Lopez-Calleja et al., 2007; Loparelli et al., 2007]. As an example of molecular traceability of animal species, Figure 1 reports a real time qPCR analysis for the detection and quantification of cow [Bos taurus] and water buffalo [Bubalus bubalis] components in milk samples and dairy products. Mozzarella di Bufala Campana [stretched pasta cheese] and ricotta [whey cheese] are typical Italian products, in particularly mozzarella obtained Protected Designation of Origin [PDO] by European Community [EC] Regulation numbers 2037/1993, 107/1996, 2301/1997. This dairy product is based of pure buffalo milk [water buffalo or Bubalus bubalis], instead ricotta can be made from the milk whey of different animal species, but often it is declared as pure Buffalo. The substitutions of buffalo milk with cow milk are common frauds in Italy. Rea et al. [2001] reported that in 1998-1999 the Central Inspectorate for Repression of Frauds [Italian Ministry of Agricultural and Forestry Policy] has detected approximately 13% of cheese labelled mozzarella pure buffalo as containing undeclared non buffalo milk. Species identification in dairy products are also indispensable because it allows the detection of frauds consisting in the use of different milks instead of those reported in the label. This substitution is responsible for less commercial quality of the dairy products [Rosati and van Vleck, 2002]. Several methods have been proposed to identify the species from which the milk comes: the EC standard method usually involve the identification of gamma-casein after plasminolysis [EC Regulation number 213/2001]. This method is certainly adequate, but requires some complex steps for sample extraction and preparation and involves the use of expensive and complex equipment [HPLC]. Antibody-based analytical techniques for the differentiation of milk from different species has been reviewed by Moatsou and Anifantakis [2003] and ELISA test that works even on heat-denatured whey proteins have been developed [Beer et al., 1996]. Oligonucleotide microarray hybridisation analysis of PCR products from mitochondrial cytochrome b gene has been recently proposed for animal species identification in food samples [Peter et al., 2004] as high-throughput analytical system. Genomic DNA can be extracted from milk and cheese somatic cells, that are present in a range between 2.3x105 and 3.8x105 cells/ml [Rea et al., 2001] and therefore several DNA-based techniques have been proposed for the cow and buffalo species identification in milk and dairy products. Plath et al. [1997] used both restriction enzyme analysis of PCR products and PCR-SSCP for
229
traceability of cow and buffalo, Klotz and Einspanier [2001] developed a PCR-LCR-EIA assay to detect cow milk in ewe, goat and buffalo milk and dairy products and Branciari et al. [2000] differentiated mozzarella made from buffalo milk and from cow milk with PCRrestriction fragment length polymorphism analysis. Duplex PCR approaches have been developed by Rea et al. [2001] ad by Bottero et al. [2002] for the same purpose. All these variations on the common theme of PCR technique, show high specificity, sensibility and rapidity, and ensure qualitative detection of the two species. The primers 18/125 were designed on Bubalus bubalis 12S ribosomal RNA gene [gi|33112042|gb|AY327817.1|], assisted by Primer Express software 2.0 [Applied Biosystems, Forster City, CA-USA]. [Pepe et al., 2004]
10
1 62,2 64,4 66,6 68,8 71 73,3 75,4 77,7 79,9 82,1 84,3 86,5 88,7 90,9
100% 80% 70% 50% 0%
0,1
NTC
0,01
Figure 1. Melting plots obtained after Real time PCR analysis with primer pair named 18-125 on pure buffalo DNA sample [100%], pure cow DNA sample [0%] or mixtures of buffalo and cow DNAs [80% buffalo and 20% cow DNAs; 70% buffalo and 30% cow DNAs; 50% buffalo and 50% cow DNAs]. NTC means No Template Control. Primers 18-125 were selected for their buffalo species-specificity: only samples containing buffalo DNAs [ranging from 100% to 50%] can produce an amplification signal. In fact, sample 0% [pure cow DNA] fails to give any amplicon. On the contrary, this same sample give amplification plot when tested with cow-specific primers 14814/15092.
230
MONITORING THE PRESENCE OF PATHOGENS ALONG THE FOOD CHAIN: THE CASE OF MYCOTOXIGENIC FUNGI IN CEREALS
Several classes of foodborne pathogens can have a negative impact both on the quality and the safety of food and feed. Consequently, the development of new methods for molecular diagnosis is of great relevance in food microbiology. PCR has now became the most extensively used molecular technique for this purpose and it is expected that it will become the routine procedure within the next decade [Hoorfar and Cook, 2003], together with NASBA [Nuclei Acid Sequence-Based Amplification] approach for the determination of viable forms. The paper of Rodriguez-Lazaro et al. [2007] summarizes the trends in analytical methodology for microorganisms monitoring and reports some real-time qPCR methods that have been developed and validated for the principal foodborne pathogens, like Campylobacter, E.coli, Listeria, Salmonella, Yersinia. Focusing the attention on specific agricultural products, like the small grain cereals, that are included in the ten major vegetable foods [FAO Statistical Yearbook, http://www.fao.org/statistics/yearbook/vol_1_1/pdf/d02.pdf], an emerging risk is now represented by the contamination of grain with mycotoxins, produced by some classes of phytopathogenic fungi. The problem has a worldwide relevance, because the contribution of wheat to the dietary energy consumption with a mean of 521 Kcal/person/day [http://www.fao.org/statistics/yearbook/vol_1_1/pdf/d09.pdf]. It is well known that mycotoxins cause both acute or chronic toxic effects in human and animals. Human toxicosis induced by consumption of mycotoxin contaminated food presents haematological perturbations, like thrombocytopenia and leukopenia, that lead to coagulation problems and poor resistance to infections [Parent-Massin, 2004], anorexia, nausea, fever, headaches, and emesis. In small grain cereals, mycotoxins are mainly produced by Aspergillus, Penicillium, Alternaria and Fusarium: these fungi can colonize the plant in the field during its development, they can spread during the post-harvest, producing several classes of mycotoxins as secondary metabolites [Table 5]. DNA-based methods for Fusaria species detection have been developed for studies on epidemiology and chemical control, as well as for risk assessment, as an alternative to morphological approaches, that require taxonomical expertise and longer time [Schaad and Frederik, 2002]. Figure 2 reports an example of amplification plot obtained after real time qPCR analysis of two DNA samples extracted from Fusarium-contaminated wheat grains. Both generic assays that target all trichothecene producers [Li et al., 2005] as well as species-specific assays [Demeke et al., 2005] have been developed. Species-specific competitive PCR assays have been developed by Nicholson et al [1996; 1998], whereas generic primers designed on tri5 gene sequence, that amplify all trichothecene producers have been developed by Schnerr et al. [2001; 2002], by Doohan et al. [1999] and by Edwards et al. [2001]. DNA-Detection Test Strips were developed for the fast identification of the PCR products derived from Fusarium graminearum gaO targeted primers [Niessen and Vogel, 1997; Knoll et al., 2002]. Multiplex PCR has been developed by Waalwijk et al. [2003] to identify field strains isolated from different plant tissues. Moreover, a quantitative assay based on TaqMan technology has been applied to field samples collected in the Netherland during 2001 growing season for Fusaria species detection [Waalwijk et al., 2004]. These
231
fungi produce 8-ketotrichothecenes, including deoxynivalenol [DON], 3acetyldeoxynivalenol,15-acetyldeoxynivalenol, nivalenol [NIV], and 4-acetylnivalenol[4ANIV], as well as an estrogenic mycotoxin, zearalenone. The 8-ketotrichothecenes have different level of toxicity, therefore there is the need to characterize the chemotype. An example of such characterisation is reported in Figure 3.
Table 5. Mycotoxigenic fungi widely spread on cereals like wheat, barley and oats
Genus Aspergillus Species flavus fumigatus ochraceus carbonarius parasiticus versicolor aurantiogriseum citreonigrum citrinum expansum griseofulvum islandicum ochrosalmoneum verrucosum viridicatum Principal micotoxins Aflatoxin B1, Cyclopiazonic acid, 3-nitropropionic acid Verruculogen, Fumitremorgine Ochratoxin A, Penicillic acid, Xanthomegnin,Viomellein Ochratoxins, Aflatoxins, Sterigmatocystin Penicillic acid, Penitrem A, mycophenolic acid, Xanthomegnin, Viomellein Citreoviridin Citrinin Patulin, Penicillic acid, Citrinin, Roquefortine C Cyclopiazonic acid, Patulin, Roquefortine C, Griseofulvin Cyclochlorotine, Islanditoxin, Luteoskyrin Citreoviridin Ochratoxin A, Citrinin Penicillic acid, Viomellein, Xanthomegnin, Cyclopiazonic acid Moniliformin, Fusarins Deoxinivalenol, Zearalenone, Fusarins, Nivalenol Zearalenone, Fusarocromanone, Nivalenol Deoxinivalenol, Zearalenone, Nivalenol, Fusarins T-2 toxin, Diacetoxyscirpenol, Fusarins, Nivalenol Fumonisin, Moniliformin, Beauvericin, Fusaproliferin T-2 toxin, Diacetoxyscirpenol Moniliformin, Beauvericin, Fusaproliferin Fumonisin, Fusarins Alkaloids toxic [Ergotamine, Clavine] Tenuazonic acid, Alternariol, Altenuic acid Satratoxins, Verruculogen
Penicillium
Fusarium
avenaceum culmorum equiseti graminearum poae proliferatum sporotrichioides subglutinans verticillioides purpurea alternata atra
Claviceps Alternaria Stachybotrys
232
Figure 2. Example of amplification plots obtained on DNA samples extracted from Fusariumcontaminated wheat grains. The amplification was obtained with primer pair specific for Fusarium, as reported in Terzi et al. [2007].
Figure 3. Amplification patterns of DNAs extracted from Fusarium isolates amplified with primer pair Gztri7f1/Gztri7r1. Amplification products from DON chemotypes varied, ranging from 173 to 327 bp, depending on the number of 11-bp repeats within each sequence, whereas the products from NIV chemotypes were identical in size [161 bp] due to a lack of the repeat, as reported in the work of Lee et al. [2001].

PLANT VARIETIES TRACEABILITY
233
Molecular markers can be applied to the traceability even at genotype level: this approach can be directed to different aims. Molecular fingerprinting can in fact be applied to the identification of plant genotypes characterized by particular qualitative traits: this authentication can therefore be important for the protection of food products with recognized quality. The molecular fingerprinting can be applied not only to raw materials , but even to processed products. Examples are reported in the work of Faccioli et al. [1999] in which AFLP analysis has been applied to the identification of barley varieties in malt. Terzi et al. [2004] used SSR markers for the authentication of monovarietal pasta. A great interest is addressed to the authentication of wine and olive oil. These two matrices can pose serious problems for efficient DNA extraction, however some authors have developed strategies for the improvement of this analytical step. In the work of Faria et al [2000] the grape varietal fingerprinting was done in musts, whereas Savazzini and Martinelli [2006] and Drbek et al. [2008] proposed an improved method for extraction of amplifiable DNA from wine. For the varietal fingerprinting of olive oil, the DNA extraction method was improved by Pafundo et al. [2005] and the development of specific molecular markers was done by Busconi and Martinelli [2006] and Pafundo et al. [2007].
Figure 4. PCR products obtained after amplification with primer pair PinA-D1 F/PinAD1 R on a panel of bread wheat genotypes. The PCR products are visualized in 2% agarose gel. An amplification products of 330 bp is observed for the wild-type allele PinA-D1a, whereas the null allele [PinA-D1b] associated with hard texture gives no amplification signal.
234
Another task of the genotype traceability is directed toward the identification and quantification of Genetically Modified plant varieties. The use of Genetically Modified Plants and derived products is in fact subjected to regulatory oversight in a number of countries and analytical methods for the event-specific detection and quantification is therefore requested. Several PCR-based methods have been developed for this purpose, as reviewed by Engel et al. [2006]. As an alternative Gressel and Ehlrich [2002] proposed the use of a simple Biobarcodes, that could be introduced in a genetically modified organism and used to track it. Several questions are still open in GMO controls, ranging from the reduction of the analytical costs to the harmonization of analysis and results interpretation [Rodriguez-Lazaro et al., 2007]. A very interesting characterization of varieties from a qualitative point of view can be done with the use of functional or perfect markers. These markers are designed on genes responsible for mechanisms underlying some key quality traits and they are therefore superior in comparison to random DNA markers such as RFLPs, SSRs and AFLPs thanks to the complete linkage with trait locus alleles [Andersen and Lubbestedt, 2003]. In rice, for example, Bradbury et al. [2005] reported an ASA [Allele Specific Amplification] assay which allows discrimination between fragrant and non-fragrant rice varieties. In barley, breeding strategies can be based on the principle of pyramiding multiple desirable genes using perfect markers for agronomic relevant traits [Ye et al., 2007; Francia et al., 2005]. In wheat are now available diagnostic markers designed on the DNA sequences of various alleles encoding for proteins with a key role in the quality, such as high and low molecular weight glutenins that contribute to strength and extensibility of wheat doughs, puroindolines that affect grain texture, and variation in granule-bound starch synthase that produces starches with altered amylose content and physical properties [Gale, 2005]. Practical validation of the utility of such perfect markers for MAS [Molecular Assisted Selection] has been shown in the work of Kuchel et al. [2007]. Figure 4 shows the pattern of a dominant PCR marker obtained after PCR analysis of some wheat genotypes (Terzi, data not published). The primer pair used was developed by Tranquilli et al. [1999] on puroindoline gene sequences [Gautier et al., 1994], as perfect marker for grain texture.
CONCLUSION
FAO recently declared that Food security exists when all people, at all times, have access to sufficient, safe and nutritious food to meet their dietary needs and food preferences for an active and healthy life [Rome Declaration and World Food Summit Plan of Action]. The attention is therefore currently focused not only on sustainable agriculture, but even on sustainable nutrition: this can have great impact on future scenarios of food chains [Meyer, 2007]. DNA profiling techniques can play a role in food science with monitoring and traceability activities, contributing to the solution of problems linked not only to safety, but even to the quality of food.
235
REFERENCES
Abdulmawjood, A; Bulte, M. Identification of ostrich meat by restriction fragment length polymorphism [RFLP] analysis of cytochrome b gene. JFS: Food Chemistry and Toxicology 2002 67, 1688-1692. Ajmone-Marsan, P; Milanesi, E; Negrini, R. Breed traceability using molecular methods. Proceedings of the seventh world conference of the Brown Swiss cattle breeders 2004 101-104. Alary, R; Serin, A; Duviau, MP; Joudrier, P; Gaultier, MF. Quantification of common wheat adulteration of durum wheat pasta using real-time quantitative polymerase chain reaction (PCR). Cereal Chemistry 2002 79, 553-558. Arlorio, M; Cereti, E; Coisson, JD; Travaglia, F; Martelli, A. Detection of hazelnut (Corylus spp.) in processed foods using real-time PCR. Food Control 2007 18, 140-148. Asensio, LG. PCR-based methods for fish and fishery products authentication. Trends in Food Science and Technology 2007 18, 558-566. Andersen, JR; Lbberstedt, T. Functional markers in plants. Trends in Plant Science 2003 8[11], 554-560. Barcaccia, G; Nicol, S; Lucchin, M. Assessing distinctiveness of crop plant species and varieties through DNA barcoding. Proceedings of the 51st SIGA Congress 2007 ISBN 978-88-900622-7-8 Beer, M; Krause, I; Stapf, M; Schwarzer, C; Klostermeyer, Zeitsch H. Indirect competitive enzyme linked immunosorbent assay for the detection of native and heat denatured bovine beta-lactoglobulin in ewes' and goats' milk cheese. Zeitschrift fur LebensmittelUntersuchung und-Forschung A 1996 203, 21-26. Blais, BW; Gaudreault, M; Phillippe, LM. Multiplex enzyme immunoassay system for the simultaneous detection of multiple allergens in foods. Food Control 2003 14, 4347. Bottero, MT; Civera, T; Anastasio, A; Turi, AM; Rosati, S. Journal of Food Protection 2002 65, 362-366. Bradbury, L; Henry, R; Jin, Q; Reinke, R; Waters, DLE. A perfect marker for fragrance genotyping in rice. Molecular Breeding 2005 16[4], 279-283. Branciari, R; Nijman, IJ; Plas, ME; Di Antonio, E; Lenstra, JA. Species origin of milk in Italian mozzarella and Greek feta cheese. Journal of Food Protection 2000 63, 408411. Brezna, B; Hudecova, L; Kuchta, T. A novel real time polymerase chain reaction (PCR) method for the detection of walnuts in food. European Food Research and Technology 2006 223, 373-377. Busconi, M; Sebastiani, L; Fogher, C. Development of SCAR markers for germoplasm characterisation in olive oil tree (Olea europea L.). Molecular Breeding 2006 17, 59-68. Busti, E; Bordoni, R; Castiglioni, B; Monciardini, P; Sosio, M; Donadio, S; Consolandi, C; Rossi Bernardi, L; Battaglia, C; De Bellis, G. Bacterial discrimination by means of a universal array approach mediated by LDR [ligase detection reaction] BMC Microbiology 2002 2, 27-39. Cheftel, JC. Food and nutrition labelling in the European Union. Food Chemistry 2005 93, 531-550. Dalvit, C; De Marchi, M; Cassandro, M. Genetic traceability of livestock products: a review. Meat Science 2007 77, 437-449.
236
De Mello, AJ. DNA amplification moves on. Nature 2003 422, 28-29. Delano, J; Schmidt AM. Use of chloroplast tRNA gene [trnL] as a target for PCR identification of specific food crops including sources of potential allergens. Food Research International 2004 37, 395-402. Demeke, T; Clear, RM; Patrick, SK; Gaba, D. Species-specific PCR-based assay for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. International Journal of Food Microbiology 2005 103, 271284. Doohan, FM; Parry, DW; Nicholson P. Fusarium ear blight of wheat: the use of quantitative PCR and visual disease assessment in studies of disease control. Plant Pathology 1999 48, 209-217. Dorak, MT. Real-Time PCR. The Advanced Methods Series, Oxford: Taylor & Francis, 2006. Drbek, J; Stvek, J; Jalvkov, M; Jurek, T; Frbort, I. Quantification of DNA during winemaking by fluorimetry and Vitis vinifera L.-specific quantitative PCR. European Food Research and Technology, 2008 226, 491-497. Edwards, SG; Pirgozliev, SR; Hare, MC; Jenkinson, P. Quantification of trichotheceneproducing Fusarium species in harvested grain by competitive PCR to determine efficacies of fungicides against Fusarium head blight of winter wheat. Applied and Environmental Microbiology 2001 67, 1575-1580. Engel, KH; Moreano, F; Ehlert, A; Busch, U. Quantification of DNA from genetically modified organisms in composite and processed foods. Trends in Food Science and Technology 2006 17, 490-497. Faccioli, P; Pecchioni, N; Stanca, AM; Terzi, V. Amplified fragment length polymorphism (AFLP) markers for barley malt fingerprinting. Journal of Cereal Science 1999 29, 257260. Faccioli, P; Lombardo, R; Scarpellini, M; Magini, M; Terzi, V; Alberici, R; Laforenza, D. Toward a grid-based e-Science infrastructure supporting the plant genomic resources of the Institutes belonging to Italian Agricultural Research Council (CRA). VI Plant Gem, Tenerife 2007 p. 06.10. Fajardo, V; Gonzalez, I; Martin, I; Rojas, M; Hernandez, PE; Garcia, T; Martin, R. Real time PCR for detection abd quantification of red deer (Cervus elaphus), fallow deer (Dama dama) and roe deer (Capreolus capreolus) in meat mixtures. Meat Science 2007 doi 10.1016/jmeatsci.2007.09.013. Faria, MA; Magalhanaes, R; Ferreira, MA; Meredith, CP; Monteiro, FF. Vitis vinifera must varietal authentication using microsatellite DNA analysis (SSR). Journal of Agricultural and Food Chemistry 2000 48, 1096-1100. Firrao, G; Moretti, M; Ruiz Rosquete, M; Gobbi, E; Locci, R. Nanobiotransducer for detecting flavescence dore phytoplasma. Journal of Plant Pathology 2005 87[2], 101107. Francia, E; Tacconi, G; Crosatti, C; Barabaschi, D; Bulgarelli, D; DallAglio, E; Val, G. Marker assisted selection in crop plants. Plant Cell Tissue and Organ Culture 2005 82, 317-342. Galbraith, DW. DNA microarray analyses in higher plants. OMICS: A Journal of Integrative Biology 2006 10[4], 455-473. Gale, KR. Diagnostic DNA markers for quality traits in wheat. Journal of Cereal Science 2005 41, 181-192.
237
Gautier, MF; Aleman, ME; Guirao, A; Marion, D; Joudrier, P. Triticum aestivum puroindolines, two basic cysteine-rich seed proteins: cDNA sequence analysis and developmental gene expression. Plant Molecular Biology 1994 25, 43-57. Germini, A; Scaravelli, E; Lesignoli, F; Sforza, S; Corradini, R; Marchelli, R. Polymerase chain reaction coupled with peptide nucleic acid high-performance liquid chromatography for the sensitive detection of traces of potentially allergenic hazelnut in foodstuffs. European Food Research and Technology 2005 220, 619-624. Gressel, J; Ehrlich, G. Universal inheritable barcode for identifying organisms. Trends in Plant Science 2002 7, 542-544. Grodzicker, T; Anderson, P; Sharp, PA; Sambrook, J. Conditional lethal mutants of adenovirus 2-simian virus 40 hybrids I. Host range mutants of Ad2+ND1. Journal of Virology 1974 13[6], 1237-1244. Hebert, PDN; Gregory, TR. The promise of DNA barcoding for taxonomy. Systematic Biology 2005 54, 852-859. Hirao, T; Imai, S; Sawada, H; Shiomi, N; Hachimura, S; Kato, H. PCR methods for detecting trace amounts of buckwheat (Fagopyrum spp.) in food. Bioscience, Biotechnology and Biochemistry 2005 69[4], 724-731. Hird, H; Lloyd, J; Goodier, R; Brown, J; Reece, P. Detection of peanut using real time polymerase chain reaction. European Food Research and Technology 2003 217, 265268. Hoorfar, J; Cook, N. Critical aspects of standardization of PCR. Methods in Molecular Biology 2003 216, 5164. Hupfer, C; Waiblinger, HU; Busch, U. Development and validation of a real time PCR detection method for celery in food. European Food Research and Technology 2007 225, 329-335. Jackson WF. 2003 Food allergy. Concise monograph series. International Life Sciences Institute Europe, Belgium 2. Yunginger JW, Sweeney KG, Sturner WQ, Giannandrea. Kalogianni, DP; Koraki, T; Christoploulos, TK; Ioannou, PC. Nanoparticle-based DNA biosensor for visual detction of genetically modified organisms. Biosensor and Bioelectronics 2006 21, 1069-1076. Kelly, F; Bhave, M. Application of a DNA-based test to detect adulteration of bread wheat in pasta. Journal of Food Quality 2007 30, 237-252. Klotz, A; Einspanier, R. Development of a DNAbased screening method to detect cow milk in ewe, goat and buffalo milk and dairy products using PCR-LCREIA- technique. Milchwissenschaft Milk Science International 2001 56, 67-70. Knoll, S; Vogel, RF; Niessen, L. Identification of Fusarium graminearum in cereal samples by DNA Detection Test Strips. Letters in Applied Microbiology 2002 34: 144-148. Kuchel, H; Fox, R, Reinheimer, J; Mosionek, L; Willey, N; Bariana, H; Jefferies, S. The successful application of a marker-assisted wheat breeding strategy. Molecular Breeding, 2007 20, 295-308. La Neve, F; Civera, T; Mucci, N; Bottero, MT. Authentication of meat from game and domestic species by SNaPshot minisequencing analysis. Meat Science 2008 DOI 10.1016/j.meatsci.2007.11.027. Lee, T; Oh, DW; Kim, HS; Lee, J; Kim, YH; Yun, SH; Lee, YW. Identification of deoxynivalenol and nivalenol producing chemotypes of Gibberella zeae by using PCR. Applied and Environmental Microbiology 2001 67, 2966-2972.
238
Leimanis, S; Hernandez, M; Fernandez, S; Boyer, F; Burns, M; Bruderer, S; Glouden, T; Harris, N; Kaeppeli, O; Philipp, P; Pla, M; Puigdomenech, P; Vaitilingom, M; Bertheau, Y. A microarray-base detection system for genetically modified (GM) food ingredients. Plant Molecular Biology 2006 61, 123-139. Li, HP; Wu, AB; Zhao, CS; Scholten, O; Loffler, H; Liao, YC. Development of a generic PCR detection of deoxynivalenol- and nivalenol-chemiotypes of Fusarium graminearum. FEMS Microbiology Letters 2005 243, 505-511. Loparelli, RM; Cardazzo, B; Balzan, S; Giaccone, V; Novelli, E. Real-time TaqMan polymerase chain reaction detection and quantification of cow DNA in pure water buffalo mozzarella cheese: method validation and its application on commercial samples. Journal of Agricultural and Food Chemistry 2007 55, 3429-3434. Lopez-Andreo, M; Garrido-Pertierra, A; Puyet, A. Evaluation of post-polymerase chain reaction melting temperature analysis for meat species identification in mixed DNA samples. Journal of Agricultural and Food Chemistry 2006 54, 7973-7978. Lopez-Calleja, I; Gonzalez, I; Fajardo, V; Martin, I; Hernandez, PE; Garcia, T; Martin, R. Real time TaqMan PCR for quantitative detection of cows milk in ewes milk mixtures. International Dairy Journal 2007 17, 729-736. Mafra, I; Ferreira, IMPLVO; Beatriz, M; Oliveira, PP. Food authentication by PCR-based methods. European Food Research and Technology 2008 DOI 10.1007/s00217-0070782x. Meyer, R. Comparison of scenarios on futures of European food chains. Trends in Food Science and Technology 2007 18, 540-545. Moatsou, G; Anifantakis, E. Recent developments in antibody-based analytical methods fot the differentiation of milk from different species. International Journal of Dairy Technology 2003 56, 133-138. Nicholson, P; Lees, AK; Maurin, N; Parry, DW; Rezanoor, HN. Development of a PCR assay to identify and quantify Microdochium nivale var nivale and Microdochium nivale var majius in wheat. Physiological and Molecular Plant Pathology 1996 48, 257-271. Nicholson, P; Simpson, DR; Weston, G; Rezanoor, HN; Lees, AK; Parry, DW; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiological and Molecular Plant Pathology 1998 53, 17-37. Niessen, L; Vogel, RF. Specific identification of Fusarium graminearum by PCR with gaO targeted primers. Systematic and Applied Microbiology 1997 20, 111-123. Orr, L; Napolitano, F; Catillo, G; Moioli, B. Meat molecular traceability: how to choose the best set of microsatellites? Meat Science 2006 72, 312-317. Pafundo, S; Agrimonti, C; Maestri, E; Marmiroli, N. Applicability of SCAR marker to food genomics: olive oil traceability. Journal of Agricultural and Food Chemistry 2007 55, 6052-6059. Pafundo, S; Agrimonti, C; Marmiroli, N. Traceability of plant contribution in Olive Oil by amplified fragment length polymorphisms. Journal of Agricultural and Food Chemistry 2005 53, 6995-7002. Parent-Massin, D. Haematotoxicity of trichothecenes. Toxicology Letters 2004 153, 75-81. Pasqualone, A; Montemurro, C; Grinn-Gofron, A; Sonnante, G; Blanco, A. Detection of soft wheat in semolina and durum wheat bread by analysis of DNA microsatellites. Journal of Agricultural and Food Chemistry 2007 55, 3312-3318.
239
Pati, N; Schowinsky, V; Kokanovic, O; Magnuson, V; Ghosh, S. A comparison between SNaPshot, pyrosequencing, and biplex invader SNP genotyping methods: accuracy, cost, and throughput. Journal of Biochemical and Biophysical Methods 2004 60, 1-12. Pepe, T; Di Marco, I; Terzi, V; Faccioli, P; Morcia, C; Trotta, M; De Dominicis, R; Cortesi, ML. Identification of cow milk in "buffalo" cheese by real time PCR. 2nd International Meeting on Veterinary Morpho-functional Biotechnologies. Napoli, 1-3 July 2004 p.57 Peter, C; Brnen-Nieweler, C; Cammann, K; Brchers, T. Differentiation of animal species in food by oligonucleotide microarray hybridisation. European Food Research Technology 2004 219[3], 286-293 Pic, Y. Food Toxicants Analysis. Techniques, Strategies and Developments. 2007 Elsevier. Plath, A; Krause, I; Einspanier, R. Zeitsch Lebensmittel-Untersuchung und-Forschung 1997 205, 437-441. Poms, RE; Klein, CL; Anklam, E. Methods for allergen analysis in food: a review. Food Additives and Contaminants 2004 21, 1-31. Prado, M; Berben, G; Fumiere O; van Dujin, G; Mensinga-Kruize, J; Reaney, S; Boix, A; von Holst, C. Detection of ruminant meat and bone meals in animal feed by real-time polymerase chain reaction: result of an interlaboratory study. Journal of Agricultural and Food Chemistry 2007 55, 7495-7501. Rea, S; Chikuni, K; Branciari, R; Sangamayya, RS; Ranucci D; Avellini, P. Use of duplex polymerase chain reaction (duplex-PCR) technique to identify bovine and water buffalo milk used in making mozzarella cheese. Journal of Dairy Research 2001 68, 689-698. Reid, LM; ODonnell, CP; Downey, G. Recent technological advances for the determination of food authenticity. Trends in Food Science and Technology 2006 17, 344-353. Rodriguez, MA; Garcia, T; Gonzalez, I; Asensio, L; Hernandez, PE; Martin, R. Quantitation of mule duck in goose foie gras using TaqMan real time polymerase chain reaction. Journal of Agricultural and Food Chemistry 2004 52, 1478-1483. Rodriguez-Lazaro, D; Lombard, B; Smith, H; Rzezutka, A; DAgostino, M; Helmuth, R; Schroeter, A; Malorny, B; Miko, A; Guerra, B; Davison, J; Kobilinsky, A; Hernandez, M; Bertheau, Y; Cook, N. Trends in analytical methodology in food safety and quality: monitoring microorganisms and genetically modified organisms. Trends in Food Science and Technology 2007 18, 306-319. Rosati, A; Van Vleck, LD. Estimation of genetic parameters for milk, fat protein and mozzarella cheese production for the Italian river buffalo population. Livestock Production Science 2002 74, 185-190. Rossi, S; Scaravelli, E; Germini, A; Corradini, R; Fogher, C; Marchelli, R. A PNA-array platform for the detction of hidden allergens in foodstuffs. European Food Research and Technology 2006 223, 1-6. Ruane, J; Sonnino, A. The role of biotechnology in exploring and protecting agricultural genetic resources. FAO report 2006 http://www.fao.org/docrep/009/a0399e/ a0399e00.htm Savazzini, C; Martinelli, L. DNA analysis in wines: Development of methods for enhanched extraction and real-time polymerase chain reaction quantification. Analytica Chimica Acta 2006 563, 274-282. Schaad, NW; Frederik, RD. Real time PCR and its application for rapid plant disease diagnostics. Canadian Journal of Plant Pathology 2002 24, 250-258.
240
Schnerr, H; Niessen, L; Vogel, RF. Real time detection of the tri5 gene in Fusarium species by Lightcycler-PCR using SYBR Green I for continuous fluorescence monitoring. International Journal of Food Microbiology 2001 71, 53-61. Schnerr, H; Vogel, RF; Niessen, L. Correlation between DNA of trichothecene-producing Fusarium species and deoxynivalenol concentrations in wheat samples. Letters of Applied Microbiology 2002 35, 121-125. Schonenbrucher, H; Abdulmawjood, A; Gobel, KA; Bulte, M. Detection of central nervous system tissues in meat products: validation and standardization of a real time PCR-based detection system. Veterinary Microbiology 2007 123, 336-345. Stephan, O; Vieths, S. Development of a real time PCR and a sandwich ELISA for detection of potentially allergenic trace amounts of peanut (Arachis hypogaea) in processed foods. Journal of Agricultural and Food Chemistry 2004 52, 3754-3760. Teletchea, F; Maudet, C; Hanni, C. Food and forensic molecular identification: update and challenges. Trends in Biotechnology 2005 23, 359-366. Terzi, V; Malnati, M; Barbanera, M; Stanca, AM; Faccioli, P. Development of analytical systems based on real-time PCR for Triticum species-specific detection and quantitation of bread wheat contamination in semolina and pasta. Journal of Cereal Science 2003 38, 87-94. Terzi, V; Infascelli, F; Tudisco, R; Russo, G; Stanca, AM; Faccioli, P. Quantitative detection of Secale cereale by real-time PCR amplification. LWT 2004 37, 239-246. Terzi, V; Morcia, C; Gorrini, A; Stanca, AM; Shewry, PR; Faccioli, P. DNA-based methods for identification and quantification of small grain cereal mixtures and fingerprinting of varieties. Journal of Cereal Science 2005 41, 213-220. Terzi, V; Morcia, C; Faccioli, P; Faccini, N; Rossi, V; Cigolini, M; Corbellino, M; Scudellari, D; Delogu, G. Fusarium DNA traceability along the bread production chain. International Journal of Food Science and Technology 2007 doi10.1111/j.13652621.2006.01344.x., 42[12], 1390-1396. Tranquilli, G; Lijavetzky, D; Muzzi, G; Dubcovsky, J. Genetic and physical characterization of grain texture-related loci in diploid wheat. Molecular General Genetics 1999 262, 846850. Trichopoulou, A; Soukara, S; Vasilopoulou, E. Traditional foods: a science and social perspective. Trends in Food Science and Technology 2007 18, 420-427. Ye, G; Moody, D; Emebin, L; van Ginkel, M. Designing an optimal marker-based pedigree selection strategy for parent building in barley in the presence of repulsion linkage, using computer simulation. Australian Journal of Agricultural Research 2007 58[3], 243-251. Van Hengel, AJ. Declaration of allergens on the label of food products purchased on the European market. Trends in Food Science and Technology 2007 18, 96-100. Von Buren, M; Stadler, M; Luthy, J. Detection of wheat adulteration of spelt flour and products by PCR. European Food Research and Technology 2001 212, 234-239. Venkatasubbarao, S. Microarrays- status and prospects. Trends in Biotechnology 2004 22, 630-637. Waalwijk, C; Kastelein, P; de Vries PhM; Kernyi, Z; van der Lee, TAJ; Hesselinnk, T; Khl, J; Kema, GHJ. Major changes in Fusarium spp. In wheat in the Netherlands. European Journal of Plant Pathology 2003 109, 743-754. Waalwijk, C; van der Heide, R; de Vries, I; van der Lee, T; Schoen, C; Costrel-de Corainville, G; Hauser-Hahn, I; Kastelein, P; Khl, J; Lonnet, P; Demarquet, T; Kema,
241
GHJ. Quantitiative detection of Fusarium species in wheat using TaqMan. European Journal of Plant Pathology 2004 110, 481-494.
Chapter 5
PSYCHOPHYSICAL AND ELECTROPHYSIOLOGICAL RESPONSES TO ODOR IN FOOD SCIENCE

John Patterson1 and Caroline Owen1,2
1
Sensory Neuroscience Laboratory, Faculty of Life & Social Sciences Swinburne University of Technology, PO Box 218 Hawthorn Vic 3122 Australia 2 Research Division, Peter McCallum Cancer Centre St. Andrews Place, East Melbourne Vic 3002 Australia
ABSTRACT
There are underlying factors which may effect the quality, quantity and the relevance of the results obtained from flavor research, particularly if it is consumer related. These are experience, language, and culture. The importance of the lexicon available to the participant is often the output filter determining how well the opinion of the experience is communicated in traditional sensory testing. This may not be a problem except when the difference between the knowledge and ability to express the participants opinions is compared with that of an expert. The expert may be the major contributor to the composition of the food or beverage being consumed by the less experienced individual. The issue extends into areas of identification, preference, or even detection. While this is well recognized, it is not one that necessarily is avoided in research with the very young, very old, or those whose first language is different from that of the researcher. There have been approaches developed still more comfortably undertaken in the laboratory which may minimize the impact of the experience and technical knowledge of the participant. In fact, these were developed specifically to be used on untrained people. It is indisputable that an odor stimulates a cascade of physiological responses in the brain, with the final outcome of the process of smelling an odor being a high-level cognitive response. One physiological recording technique which allows brain activity to be inexpensively, rapidly, and conveniently monitored is the recording of the electroencephalogram (EEG), which although not the best from a spatial perspective is very good in the time domain. The use of EEG recordings for olfactory and gustatory recordings is well established, but its application to issues of preference and threshold determination is less common. As a supplement to traditional sensory testing techniques and as a way of revealing new
244
John Patterson and Caroline Owen

information, the EEG has a great deal of potential. The information in the following chapter gives detail of the benefits and challenges of language-free sensory testing interfaced with advanced neurophysiological and chemical techniques.
INTRODUCTION
There is an underlying issue which may effect the quality, quantity and the relevance of the results obtained from flavour research, particularly if it is meant to be consumer related. In light of the much held view that flavour is recognised to be 70 - 80% olfactory, for the purpose of this chapter olfactory responses will be the main focus of flavour assessment, although it is important to often consider both modalities. In relation to the assessment of food and beverage preference, there are two disparate, but complementary, approaches to measurement: metrics obtained from opinion, and metrics obtained from physiological responses. Both these are very dependent upon the experience, culture and language capacity, of the participants. Obviously the age of the individual will impact on all of these through the variable lexicon the participant comes equipped with. This has particular relevance to the very young who lack the lexicon and experience (Hummel et al., 2007). In addition, those of increasing age - forming an increasing proportion of the population - may be forgetting their experiences, and loosing the ability to connect their extensive memories with the current task. Any sensory task relying on normal cognitive skills may be more poorly done by these extremes of age. Language issues are not limited to these cohorts, but become major issues with those whose first language is different from that of the experimenter. Metrics based on expressed opinions form the basis of traditional sensory testing in the food and beverage industries. Determining the sensory responses of a range of groups with language and lexicon limitations (such as the very young, the very old, or the culturally diverse) is traditionally overcome by training the expert panel. Thus, the expert may be the major contributor to the composition of the food or beverage being consumed by the less experienced individual. The most influential expert is the professional who is responsible for the composition of the food or beverage in the factory, winery or brewery. Of course, it is these real experts who are determining what the consumer is going to be offered, regardless of the difference in actual preferences. The risk is that there can be a bias towards a composition which is not necessarily what is preferred by the nave consumer. Unfortunately, metrics based on fundamental physiological responses are not as easily obtained and are therefore not as popular, even though they may reveal more basic, less influenced, views. They can also provide information in the absence of, or a very much reduced level of, verbal responses. It is indisputable that an odour or taste stimulates a cascade of physiological processes in the brain, with the final outcome of being high-level cognitive responses. This may require processing of the signal by regions of the brain associated with language, memory, and visual processes, along with the development of any emotional response. These higher level cognitive processes will be involved in whether we like, or dislike a flavour, whether we recall experiencing the flavour and how we articulate what we have perceived. These changes in brain activity might conveniently, at least intuitively, be separated into relatively rapid processes which lead to basic detection which have been shown to take many hundreds of milliseconds; it takes longer 0.75 s to 1.5 s to
Psychophysical and Electrophysiological Responses to Odors
245
reach the more sophisticated responses such as identification, discrimination, preference, recollection and syntax (Pause, Sojka and Ferstl, 1997). Suitable brain imaging techniques may reveal changes in brain activity in response to odours and tastants that can contribute knowledge as to which regions of the brain are being activated and at what time after the stimulus is delivered. The benefits and challenges of language-free sensory testing applying advanced neurophysiological techniques are yet to be fully realised and incorporated into routine preference testing. The following material will focus on the research into olfactory responses, firstly outlining psychophysical recording techniques commonly used, and then some examples of using these newer approaches which we believe can contribute significant information on what is driving consumer preference and choice. All of these techniques are based on common, well-established and well-documented clinical approaches and therefore are reliable in what they reveal. Their use in flavour appreciation is a relatively new under-utilised application. These approaches have started to reveal some of the workings of the brain in flavour appreciation.
PSYCHOPHYSICS OF OLFACTION
Psychophysical measurement has led to a better understanding of several general aspects of human olfaction. Quantitative psychophysical measures have served to demonstrate the degree to which olfactory function is influenced by gender, age, smoking, environmental toxins and various disease processes. For these and other reasons, olfactory testing is now routinely performed in the food, beverage and perfume industries, as well in a number of medical fields, including neurology, otorhinolaryngology, epidemiology and public health. Any discussion of the psychophysical methods used to measure human responses to odour must first consider some of the factors known to influence such measures, these being adaptation, masking, discrimination, identification, and detection threshold levels, and their effect on human responses to odorant stimuli.
Adaptation
Adaptation is a temporary phenomenon associated with a decrease in sensitivity following exposure to a constant stimulus that results in fatigue due to continued or repeated stimulation of the same receptors. Some stimuli are reputed to show very rapid adaptation, reflecting the strong tendency of those odours to absorb strongly on surfaces, including the olfactory tissue. Adaptation induced by one substance can alter sensitivity to some other substance, particularly those of similar structure. This is referred to as cross-adaptation (Cain, 1988) and is considered evidence that different odorants stimulate the same receptors. Olfactory testing must always be conducted with consideration of the effects of adaptation, which may confound test results if inadvertently initiated and not recognised during testing.
246
Masking
A further issue of concern in flavour testing is that of masking. The administration of mixtures containing different odours that do not react together chemically often results in masking, whereby the concentration of one odour surpasses that of the other odour or odours in the mixture (Schiffman, 1990). The phenomenon of masking has long been recognised as a feature of olfactory functioning. In the extreme case, masking represents obliteration of one odour by the presence of another, and can occur to varying degrees, with stimuli weaker than the masker tending to be suppressed more than stimuli stronger than the masker. What is not clear is whether the odour that is masked can still have a contributing effect on perception of the overall odour possibly contributing a background odour (below conscious threshold) which may still make an important contribution to the overall mixture.
Discrimination and Identification

Discrimination can be defined as the ability to distinguish between stimuli, whereas identification relies on the ability to recognise and possibly label a stimulus, thereby assuming prior exposure and experience of the odour and the ability to make an association between an odour and its label. Odour identification seems limited mainly by discrimination. Odour identification has also proved to be a useful way to uncover group differences in olfactory processing, with a large disparity in odour identification reported between young and elderly, and a smaller disparity between males and females. These differences may be attributable in part to differences in previous experiences or interest in odours, or to differences in the facility of retrieval from memory of labels for the odours identified.
Detection Thresholds
Although we are sensitive to many different odorants, the ability to stimulate olfaction varies from odorant to odorant over many orders of magnitude, and the perceived sensation may vary with the concentration of the stimulating substance. For example, at very low concentrations, an odour may only just be detected, referred to as the detection threshold, while at higher concentrations an odour may not only be detected but also identified, referred to as the recognition threshold. Working with odour thresholds is not a precise art, as threshold values for a given substance do not exist in the same sense that values of vapour pressure exist. Our ability to detect an odour is influenced by physiological factors and by the methods and procedures used to introduce the odour to the olfactory system in order to produce a response by the subject (Schiffman, 1990); the detectability of an odour can be influenced by the flow rate of a gaseous odorous sample further evidence of the effect of nasal air flow on odour perception. Olfactory thresholds are notable for their variability among subjects. The possible sources of the variability range from the odorant, the stimulus delivery system, and the psychophysical procedures used in different tests, to the individual physiological and psychological differences between subjects (Stevens, Cain and Burke, 1988). The detection threshold has been found to differ within individuals at different times, and between
247
individuals of different ages and with different medical conditions, backgrounds, testing conditions and odour purity.
Testing Methods
One of the most common methods used to measure detection thresholds is based on the Method of Limits that requires a choice to be made between two or more samples at each concentration step, presented either randomly or in a descending or ascending order. The odour threshold obtained using this technique may vary according to the order of presentation. An ascending series generally leads to a lower threshold, and a descending series to a higher threshold (Cain, Cometto-Muniz & de Wijk, 1992). To reduce the potential impact of such presentations, the presentation of alternating ascending and descending series is often used, as prescribed for the Sniffin Sticks test (Hummel, Sekinger, Wolf & Kobal, 1997).
Standardised Tests of Olfactory Function

The development of standardised tests is a basic requirement of sensory research, without which it is difficult to make comparisons between test populations and stimuli. Various tests have been devised in an attempt to provide a standardised test of olfaction. The University of Pennsylvania Smell Identification Test (UPSIT; Doty, Shaman & Dann, 1984b) has proved to be reliable, to correlate significantly with traditional odour detection thresholds, and to be sensitive to subject variables including age, gender and ethnic background. This test relies on the subjective response of the subjects to suprathreshold stimuli and, as stated previously, is based on odours relevant to North America. In recognition of the potential confounding effect of cultural differences, a cross-cultural smell identification test (CC-SIT) was later developed based on the UPSIT (Doty, Marcus and Lee, 1996). The Connecticut Chemosensory Clinical Research Centre (CCCRC) was designed to use identification and threshold tests to quantify olfactory functioning in patients with chemosensory complaints (Cain, Gent, Catalonotto & Goodspeed, 1983; Cain, 1989). The UPSIT and CCCRC tests have been found to yield comparable net results in screening, although they may have diagnostically useful differences that remain to be specified. A diagnosis of hyposmia/anosmia made with one test appeared to be confirmed by the other (Cain & Rabin, 1989). The Sniffin Sticks was developed for the clinical and research environments to provide a portable test kit incorporating tests of threshold, discrimination and identification ability tests (Hummel et al., 1997), and has been proved to have better test-retest reliability than the CCCRC tests for threshold, identification and recognition. Various methods have been developed to measure human psychophysiological and physiological responses to odour stimuli. Such methods include changes in heart rate, blood pressure, and skin potential levels have been used as indices for the measurement of the sedative effects of odours, by estimating the stimulating and sedative effects of different odours. Techniques to measure the activity of the odour molecules at the olfactory epithelium and brain response levels are now being used to determine and measure the actual transduction of the chemical information in the brain waves. Various methods of measuring
248
and imaging brain activity responses to odorants are now used, such as the electroencephalogram (EEG) and magnetoencephalography (MEG), computed tomography (CT; or computed axial tomography: CAT), magnetic resonance imaging (MRI), functional MRI (fMRI), and positron emission tomography (PET). These quantitative brain imaging techniques, combined with technical developments in odour delivery, increase the potential for significant advances in the understanding of olfactory processing that in turn can contribute to the understanding of factors that influence individual responses to odours and flavours.
PHYSIOLOGY OF OLFACTION
The two flavour determining senses: smell and taste are physiologically quite different. Both depend on specific detection sites for their flavour molecules, termed receptors. These are generally considered to be quite specific in what they respond to, but this may be a chemical class rather than a single molecule; in fact, the former is thought to be the most common. The difference between the two lies in their relative complexity. Taste is rather simple with at least five modalities or perceptions (sweet, sour, bitter, salt and umami). There is no clear agreement as to how many odours we can detect, but it is certainly much greater than the limits we find for taste. The differences arise from the structure and function of the two systems. Both depend on the complex molecular receptors embedded in the cell membrane to interact with the agonist molecule (that is, any normal molecule which can attach to the receptor mechanism). Both depend on the receptor, with the agonist molecule attached, being able to alter the state of the receptor cell (which has the receptor structure embedded in its membrane). This process is termed transduction. Both depend on the cell containing the receptor molecules to be able to send the information that there is an interaction to the nervous system. How these steps are actually carried out is different between the two systems. For taste, a tastant molecule, which must be to some extent water soluble, attaches to the receptor molecule on the taste cell. Not all modalities are found all over the tongue, but instead they are regionalised. To get to the taste cell the tastant must diffuse passively in the liquid (basically saliva) in the mouth. The taste cell membrane is then depolarised (a reversible change in the electrical nature of the membrane) and this is transmitted to a nerve cell which in turn sends the signal indicating the attachment to the brain and the taste processing centres where tastes probably is more reminiscent of somatosensory stimulus processing than chemosensory. The process of transduction for olfaction is more complex as is the processing of the signal indicating an attachment. Firstly, the odorant is more freely able to move as it is in the gas phase and so exposure to the surface of the olfactory epithelium is straight forward. But, the epithelium containing the olfactory receptor molecules is protected from dehydration by a layer of continually secreted mucus. Thus, the odorant molecule must diffuse into this layer and then through it to the receptors. This layer is moving, so the odorant molecule drifts along with this movement once it is in the mucous layer. It seems that the receptors are lined up so that they are in the optimum place in the system to be exposed to their group of specific odorant chemicals. Why? Different odorant molecules have different solubilities in the
249
mucus. Some diffuse very rapidly and reach the receptors quickly; some diffuse very slowly and take more time to get to the receptors. Having the receptors positioned in the best place in relation to the interaction of the inspired air, containing the volatile molecules, and the mucus, ensures that an optimum process occurs. Odorant molecules which are partitioned (spread out) in such a way in the mucus to only reach their specific receptors would require their receptors to be some distance along the direction of movement of the mucus: this is exactly the arrangement. This separation of the zones of interaction means the receptors are arranged in strips at right angles to the flow, with each strip containing receptors which are going to interact with odorants of a particular mucus solubility characteristic (Malnic, Hirono, Sato and Buck, 1999). All odorants sharing this solubility will be detected in the same region. This is the first major difference between the two systems in that the olfactory system relies on chemical separation (actually a simple chromatography process), while the gustatory system has every molecule diffusing everywhere until they are in the correct place After attachment of the odorant, there is a further difference in the olfactory system; the receptor is on the membrane of a nerve cell. In fact these olfactory receptor cells are the only known brain cells which are outside the skull. It is also believed that there is only one type of receptor manifested on each olfactory nerve cell. So, the depolarisation of the cell membrane is already part of the nervous signalling of the brain. This signal enters the olfactory bulb region of the brain (a very ancient and well conserved part of the brain). Here, processing of the signal commences in a manner not yet fully understood. What is well accepted is that the signals from similar regions of the olfactory epithelium are combined in one layer or zone (through large numbers of olfactory neurons synapsing on individual target nerve cells; Zou and Buck, 2006). Cells from this layer output a pattern which is determined by the array of olfactory cells which have been stimulated (Malnic et al., 1999). This starts to explain the idea of the holistic perception we have of complex mixtures, which research suggests may be related to novel cortical representations resulting from the combination of the component odorants in a mixture (Zou and Buck, 2006). These secondary target cells in the olfactory bulb send out their neural processes (axons) which make contact with various higher regions of the brain proper including the pyriform cortex, amygdala, thalamus and orbitofrontal cortex, where they have an effect on overall brain functioning including learning, memory and emotional responses. Clearly detection takes place at the receptor surface, integration of the complex signal starts in the olfactory bulb, and conscious awareness occurs later when the signal, or more likely signals, reach the midbrain (emotional reactions) and forebrain (cortical processing combining memory and labels). The flow of signals is not just towards the brain, but there are special neurons which descend from the brain into the layers of the olfactory bulb. These are thought to allow the adjustment of sensitivity of the input output signal relationship, by damping down responses. Before leaving the physiology there are a number of considerations concerning the removal of the stimulus. In the taste buds it is thought to be removed by flushing by saliva; in the olfactory epithelium it is also thought that the flow of mucus and diffusion act to remove the odorants from the region where the relevant receptors are located, so ending the association. This is improved by the unidirectional flow. Should too much odorant impinge on the system and saturate the mucus, this process will take some time, providing a possible explanation for fatigue or saturation of the olfactory system. Of particular relevance to this chapter is the electrical response of the brain. To date it is believed that only after adequate activation of appropriate centres of the brain can detection
250
and then awareness occur. At the highest level this can then produce a verbal response, but there are still processes occurring at levels below this conscious awareness, and also, independently of verbal responses. Methods of brain imaging might then reveal information beyond that of asking for an opinion, but how much detail about the olfactory process can be obtained, and how?
Brain Imaging Techniques

If we accept the premise that there are electrochemical processes in the brain which encompass all the intellectual and emotional consequences of detecting a flavour compound, then looking at the brains function during exposure to flavour compounds should reveal much. The brain defined as that neural tissue encased in the skull isnt easy to record from. It is very, very complex; it is shielded by bone; it processes information quickly (although abysmally slowly compared to electronic devices); it processes information in parallel (simultaneously doing many tasks); and, it is surrounded and infiltrated by electrically conducting solutions (blood and tissue fluids). The brain conservatively consists of some 1012 neurons; each neuron connects with many hundreds of other neurons near and far and there may be several forms the signal being transmitted may take (excitatory or inhibitory). An increase in the activity of an inhibitory neuron may increase or decrease a process output, so we cannot just assume that neuronal activity equates with output. So, the brain may consist of as many as 1015 possible combinations of states. In fact it is likely to be nothing like this as there isnt any evidence to suggest that a single synapse is an intellectual unit, or thought. Of course, there is no evidence that it isnt, either. Brain activity consists mostly of electrically active cells transmitting their output to other electrically active cells via the synapse. At the synapse the electrical activity of the input neuron releases a neurotransmitter, of which there are many and more are discovered regularly, which in turn causes the output neuron to change its output. Neurons of the brain usually in groups - may exhibit continuous activity, or may be silent unless stimulated. Changes wrought by the influence of the synapse may be to increase the output firing of the neuron on which the synapse is based, or, to decrease the firing rate, or, to modulate (alter the pattern) of firing. There is no evidence of actual physical movement associated with this process, only the diffusion of neurotransmitters across a tiny gap between the cells. It is thought that the output of these processes are the origins of brain waves, or patterns of electrical activity seen when we record the electroencephalogram (EEG). It must also be added that there may be relatively static influences as well as these dynamic ones. The level of excitability of the brain may be affected by neurochemicals not released in synaptic structures but broadcast in the extracellular matrix so that they influence many cells in a non-specific way. All this activity requires energy; not lots, because it is so efficient, but essential to proper function. Oxygen is also required for these metabolic processes. The brain is divided into anatomical regions, some of which have specific functions, but most of the brain is found as the cerebral cortex. This consists of six layers and is like the skin of an orange surrounding the rest of the brain. It has evolved to a point where its surface area (and therefore number of cells) is too big to fit in the skull, so it is thrown into ridges like the skin of a bloodhound. These sulci (grooves) and gyri (ridges) give the brain its outer pattern. Beneath the cortex is the mid-brain through which the rest of the nervous system
251
communicates to the cortex and through which the cortex communicates to the rest of the nervous system. Between the spinal cord and the mid-brain is the medulla oblongata; sitting on the mid-brain is the cerebellum. As the cortex surrounds the rest of the structures it is the most superficial part of the brain lying directly under the skull and therefore closest for imaging. Brain imaging has come a very long way over recent decades. Some more traditional imaging techniques are not really appropriate: such as ultrasound or X-ray. These are predominately techniques for revealing structure (although ultrasound can reveal the movement of particles such as blood cells). The simple radiographic X-ray can show structures in the brain and may be useful in determining lesions, cavities or swellings, but cannot help with dynamic processes. Ultrasound can show the nature of blood flow which does increase and decrease with activity. It is most useful for revealing abnormal blood flow caused by blockages. Neither of these basic imaging techniques can yet show the electrochemical changes occurring all the time in the brain. The brain of a person who is in a coma may be structurally normal at the level of resolution of these techniques, but is clearly not functioning normally. A development of the X-ray is the CT scan. CT stands for computed tomography and a scan done this way gives a complete cross-section of the body at the level of scanning. Simply put, an X-ray is taken across the body giving a flat image. This image has the density information of layers of the body overlying each other and so all you see is the shape of the most X-ray dense part. An X-ray of the lower arm shows long shadows of the arm bones. This may actually be taken at an angle such that one bone covers the other, or may show them separately. In the CT scan the X-ray system is rotated a small distance and another view taken. This continues until the X-ray system has rotated around the body, perhaps many times, taking many views of the body. Then the computation part analyses these images and creates a picture of the body which is complete and is no longer flat but is a cross-section with all structures defined by their depth. Special radio-opaque material may be injected into the blood to enhance the circulation as blood is very transparent to X-rays normally. So, the CT scan is a structural technique far superior to the simple X-ray but not much use for the electrochemical processes of the brain. The problem with the brain is that it normally only produces electromagnetic radiation which is the most easily detected signal. Before we look at this technique, though there are two artificial imaging systems which can do a better job than the radiographic techniques described previously. By injecting some radioactive material which concentrates in a region or during a process in that region, we can then measure the effects of the disintegration of the radioactive material. This is the basis of the PET scanner: the positron-emission tomography system. When a positron is created as a result of radioactive decay, it travels only a short distance and is destroyed when it collides with an electron which is part of the nearby structure. This destruction results, in turn, in the production of two high energy photons/gamma rays which travel in diametrically opposite directions. These are energetic enough to leave the body and if they strike a detector in their path a signal is created indicating their presence. Because two are always produced you need at least two detectors opposite each other. Because the photons travel in straight lines from the source you can back-project the line on which the source must be. If you have a second pair of detectors at some rotational angle to the first and they pick up a different pair of photons from the same location, simple triangulation tells you where in the body cross-section they were generated.
252
A source of positrons such as a region of enhanced metabolic activity will then be identifiable. Some of the radionuclides used for diagnostic PET are: 18F, 11C and 15O; these are used to label the injected compounds. PET is often combined with a high resolution structural image (by CT) so that the anatomical location of the radioactive decay can be seen. PET could reveal changes in metabolism, or uptake of metabolic substrates during flavour awareness. The need to inject radioactive substances also requires that they are eliminated from the body before a repeat observation can be made. The last technique which is of possible use for flavour research is the MRI: magnetic resonance imaging. While basically a structural technique the MRI can be functional when it is in the form of the fMRI. The big advantage of these two approaches over PET is that there is no need to inject radiopharmaceuticals. In an over-simplified description, MRI involves the measurement by use of coils of the small signals which occur when atoms relax. The normal spin of atoms produces a tiny magnetic field. The fields produced by a given material (the sum of all its atoms) is unique. Placed in a static magnetic field, the spin of the atoms has a unique frequency as their spin rotates around the external magnetic field. If you turn the field off, the imposed spin decays and the small signal (unique to the material) is detected by a coil. To get an image from this signal requires some considerable processing and the details are far beyond the content of the current document. What is produced is an image of different materials in their correct spatial relationships. Further the information can be obtained from successive slices of the body and, unlike PET, easily produce a 3-D image. In fMRI the material which is imaged is haemoglobin. There are discernible differences in the magnetic properties of oxyhaemoglobin compared with deoxyhaemoglobin. By scanning before a change caused by some neuronal oxygen-dependent metabolic process and then after the change (i.e. during the detection of a flavour), and subtracting one from the other, there is a signal which is caused by the task. This can be overlaid on the very high quality structural image from the basic MRI to provide a 3-D image with a measure of the level of change in removal of oxygen from the blood by the tissues. Any region which has not changed its oxygen requirements during the task, will, of course only show the structural information. This process is termed the BOLD method (blood oxygen level dependent contrast) and has been used to reveal the processing of neurons during tasks which require them to have their activity changed. There are some considerations inherent in each of these imaging systems which actually preclude their use in routine, or even experimental, flavour research. Characteristics which precludes the use of PET and MRI are: cost, time-scale and lack of portability. CT, X-ray and MRI have the spatial resolution (approximately 1 mm) to provide useful structural information; but, X-ray of the head is not as revealing as it can be in other parts of the body. PET and fMRI have the advantage of providing information about activity changes. That PET requires radioactive materials works strongly against it for repeated measurements. Much less limiting is fMRI, but the cost and relative slowness (temporal resolution) is an issue. Magnetic materials cannot be close to the scanner, so any flavour delivery system has to be constructed of non-magnetic materials. The person cannot move during the process or the alignment is affected. Of all of these methods, only ultrasound and X-ray instruments are reasonably priced. CT, PET and MRI are very expensive instruments to buy and locate. So, is there a convenient system of brain imaging which can provide adequate spatial and temporal resolution without the cost and inconvenience of these clinically-based scanners? Yes, at present there are two: EEG (electroencephalography) and MEG
253
(magnetoencephalography). We will quickly deal with MEG as it has a major disadvantage: it requires liquid helium to operate and this is expensive and inconvenient. Further it needs a magnetically-shielded facility which is also an expense to set up and isnt conducive to portability. While it has some possible benefits over EEG it is not really a serious contender (at least not at its current level of development) for flavour work, other than for very advanced research. So, that leaves EEG. Inexpensive to buy, inexpensive to run, simple, portable with good temporal resolution (at present probably superior to everything so far described expect MEG), EEG has more advantages than disadvantages as a means of seeing what happens in the brain during tasks. Its limitations are few, but the relatively poor spatial resolution is one. The spatial resolution can be improved by increasing the numbers of electrodes, but there is still a need to mathematically determine the possible origin sites for the signals. This process is not as good as for MRI and PET. If the desire is to reveal the activity of 1 mm cubes of cortical tissue, then EEG is not suitable; if, the average signal from larger volumes of brain are acceptable, then EEG is fine. The big benefit of EEG is that it is measuring what happens: changes in electrical currents in the brain. So, neuronal activity produces electrical currents and the EEG detects the remnants of these on the scalp using small metal or saline electrodes. Because the small electric currents are dissipating as they spread from their sources, deeper structures become more problematic. The cortex, where most of the flavour-related higher processing occurs is thin and is conveniently close to the scalp. Unlike PET, CT and MRI, the person can stand, sit, lie or actually move around when EEG is recorded (although movement does add its own problems of interference, portable EEG systems are available). The speed with which recordings can be made is quite fast (a few minutes depending on the number and type of electrodes being used). It is not as fast as ultrasound or X-ray, but far quicker to set up than CT (particularly contrast enhanced), PET or MRI. If gel-based electrodes are being used, the clean-up is a little messy; this can be avoided by using saline electrodes. In summary, there are several ways of viewing the brain. Some of these are purely for structure. Some are designed to provide activity measurements, but only indirectly of the neurons. Some can do both as with fMRI. For convenience and to follow dynamic signals, EEG is, at present, the best method.
DETERMINANTS OF RESPONSE AND OPINION

There are many factors some very hard to pinpoint which can influence the response to an odour. Before delving into some of these in more detail, one very important and obvious factor needs to be mentioned: the dangerous assumption that all participants are normosmic. Any loss of relevant olfactory capacity will clearly destroy the value of the participants responses to any more normal population. The extent of such physiological issues is not clear. It has been established that there is a decline with age and a more dramatic decline in men with age of their olfactory capacity (Doty, Shaman, Applebaum, Giberson, Siksorski, & Rosenberg, 1984a; Murphy, Morgan, Wetter, Geisler, Ellison, & Polich, 1997). What is normal, however, is, in itself, a difficult issue. It is certainly not going to be the average response. The average response to an odour is going to be determined by the range in the population.
254
Normal implies that there are no deficits or deficiencies in ability. We could class young children as normal in their olfactory response, before any environmental and age-related reductions in sensitivity occur. It probably means that there would be a normal olfactory ability for a series of age ranges with the tendency to decline from this early ideal condition. No one has published data on such information about the specific normal ranges, but data have been published about the decline in ability (Murphy et al., 1997; Nordin & Murphy, 1997). The anatomic and physiological bases of age-related changes in smell ability include involvement of the degenerative process within the olfactory epithelium, combined with greater susceptibility to olfactory adaptation, a slower rate of recovery from such adaptation, and evidence that the elderly brain shows smaller responses to odours, is less able to allocate attentional resources and slows in its olfactory cognitive processing (Murphy et al., 1997). This is supported by findings of normal aging affecting the recall of odours which requires the implementation of episodic and semantic memory strategies and processes (Nordin & Murphy, 1997). In our own work, we have had only one known case of a specific deficit in over 400 participants; this was critical as the male had no ability to detect n-butanol (anosmic) which was the substance being used as the test compound. While in these circumstances, this eliminated the persons responses from our averages, had the experiment been with a mixture rather than a single substance and the gap in his detection capacity wasnt known, his results (in an actual pool of only 20 people), would have biased them from a more normal range. In this hypothetical extension of an actual case, testing with the mixture and training the person would not have brought his responses into line with the remainder of the group. The lack of the ability to detect any qualitative odour sensation is commonly known as anosmia. The causes of such olfactory dysfunction are varied, but can be divided basically into two broad fields: organic causes and psychological causes (Takagi, 1989). Anosmias are known to occur with head injuries, substance abuse, medical treatment, therapeutic drugs, psychoses, mental dysfunction and excessive exposure to organic solvents. Anosmias may be genetically determined. How many apparently normal people have genetically determined anosmias is not clear. If the anosmia is not to a component of interest in the test odour, then the issue is moot, but, if the person has an anosmia to a specific compound of interest an issue of the relevance of that persons inclusion in the testing is raised. Likely to be more common and of greater impact is that of a reduction in sensitivity below that of normal as indicated previously which is, at least, an attribute of ageing (Doty et al., 1984a; Murphy et al. 1997). This means clearly that any determination of commercially targeting older people must use a cohort of relevantly aged individuals. Ideally, preference testing would be focussed on the age range of interest to the company; in practice this may be too expensive. There are risks of course to the efficacy of the testing if the test panel has a group of individuals who are outside the desired range in age. Further complications can arise from the source of the panellists. It is our observation that in some cases companies have used people who live close to the factory or test site. In two cases we know of, the environment of these people would not be that of an average consumer: in one case, very rural (pesticide and agro-chemical exposure); in the other, very close to petrochemical factories and sewage works (with occasional very rich odours). It would be possible, in fact easy, but not inexpensive, to determine if these participants were normal for their age, but we are aware of only limited work in that respect. While there is considerable evidence for respiratory effects on olfactory sensitivity, little attention has focussed on environmental impact on
255
olfactory sensitivity. Recent research into the effect of air pollution on olfactory function has now revealed high levels of ambient air pollution impair olfactory function, most likely linked to damage to the olfactory epithelium from air pollution (Hudson et al., 2006; Dalton et al., 2007). Volatile chemicals inhaled either through the nose (orthonasal route) or via the mouth and throat (retronasal route) arrive at the olfactory epithelium in the superior part of each nostril. Minor alterations in upper respiratory health can diminish the performance of the nose and olfactory epithelium. Some way of eliminating pool participants with such temporary issues is surely sensible, even by simply asking if anyone is suffering, but much better to independently establish the fact. Days with extremes of temperature are also to be considered carefully as very hot and dry conditions are going to change performance, as will very cold and dry conditions. Thus, the issue still persists that we are at risk if we assume normality and do not test for it. In our own work we recognised that this was going to be a major issue as we had two distinct pools of participants in one of our studies an older professional highly trained group and a younger nave group so it was necessary to ensure that they all had acceptable olfactory performance. We chose to use the Sniffin Sticks three part test (Hummel et al., 1997), which although developed for clinical use, lends itself readily to experimental use, at least in our hands. The kit allows an accurate way of comparing the olfactory ability of the participants in an experiment, but also for a comparison with a much larger pool (Kobal et al., 2000). Is the cost in time and money worth it? For an accurate determination of the quality of a participant pool, yes. The test could be carried out in detail to characterise the olfactory ability of the potential volunteers and be used to screen those with an ongoing problem. Further quick and simple point checks could be carried out with only a few of the tests to check the consistency of the particular test groups performance to eliminate acute problems. In this way the reliability of a variable performing group of humans can be assured with minimal ongoing expense. Like other tests, the Sniffin Sticks system can provide a measure of sensitivity, discrimination and recognition. What it may not do, in keeping with other similar tests is cope with any language or experience barriers. Determining threshold is the easiest and least confounded test. People can either smell something or not. It matters little if they can subsequently smell it after gaining experience, as long as this is clearly recognised as a change in their ability, not a failure of the test. As soon as someone participates in these tests they are no longer untrained, but must be seen as, at least partially trained. Discrimination is another simple test: a direct comparison between two target odours to see if they are distinguishable; such a test is not confusing or affected greatly by experience. It is in the testing of recognition that many issues arise. Although all these comparative and qualitative (although a performance number can be obtained) tests depend on verbal communication, it is in recognition that the issues become concerning. How does one communicate with a young child? If they have never been allowed to taste bubble-gum, can you use it as a valid descriptor of a test sample? The answer is obviously, no. Although the olfactory sense is one of the most well retained in memory, can an older individual who may have tasted bubble-gum 50 years ago be expected to immediately recognise it? Probably this is more than a bit unrealistic. There may be communities where the popularity of bubble-gum is high, but, equally, there are communities where it is likely to be a rarely experienced product. There is a strong risk that recognition or identification tests may
256
therefore be subject to cultural influences. This possibility has been recognised in the development of smell tests for different populations, such as the University of Pennsylvania Smell Identification Test (UPSIT) developed for a predominantly Northern America audience (Doty et al., 1984b), the cross-cultural smell identification test (CC-SIT) based on the UPSIT (Doty et al., 1996) and the Sniffin Sticks for an audience with a European background (Hummel et al., 1997). The influence of experience on the ability to perceive, discriminate and identify odours and thus play a role in preference responses was highlighted in the international smell survey conducted by the National Geographic Society, with responses from 1.4 million people from approximately 80 countries. This study revealed differences in pleasantness and intensity ratings across odorants and regions (Wysocki, Pierce and Gilbert, 1991), a finding which has been further supported by studies investigating odour responses for different cultural groups, (Ayabe-Kanamura et al., 1998; Distel et al., 1999; Kobayashi, Saito, Kobayakawa, Deguchi and Costanzo, 2006; Saito et al., 2006), and evidence for the need to develop different variations of tests for different target audiences. Recent research has demonstrated the applicability of the Sniffin Sticks for use with other cultural groups, provided descriptors in the identification test are modified for that cultural background (Shu, Yuan, Lin and Lin, 2007). Care must therefore be exercised in the selection of testing compounds or mixtures and of testing protocols, to ensure that they are within the experience range of the target audience or test pool participants. The major factors which are going to influence the ability of a person to detect an odour, and therefore a flavour based on that odour, are recognition threshold, sensitivity and identification. All other aspects of flavour perception are going to be determined by the first of these: recognition threshold: the concentration at which an odour is recognised. There are in fact two thresholds: the detection threshold (the concentration at which an odour just detected as present), and the recognition threshold. For most practical purposes the latter is the only one of relevance to the food and beverage industry. As far as is known a perfectly normal olfactory capacity does not mean that we all can detect odours at the same concentration of exposure. Variability in this aspect automatically means different perceptions. Why do we not all detect at the same minimum concentration? It has not been empirically established but the most likely reason is the normal genetic variation in the structure of our noses, the size, distribution and arrangement of our olfactory epithelium, and, the basic wiring of our olfactory brain. In various studies the range of thresholds is not great, but there are big differences between individuals. What determines threshold? Airflow bringing the odour to the olfactory epithelium is the first variable. Natures way of improving this limitation is the sniff which increases temporarily the delivery of odour molecules to the olfactory epithelium, thereby enhancing odour detection (Laing, 1983, 1986). Interestingly, research has shown it is the duration rather than the strength of the sniff that impacts on the odour detection (Sobel, Khan, Hartley, Sullivan and Gabrieli, 2000), while recent studies have reported that the sniff not only impacts on odour intensity and identity but also drive activity in the olfactory cortex, demonstrating it has an important role in olfactory perception (Mainland and Sobel, 2006; Kepecs, Uchida and Mainen, 2006). There is a relevant applied comment worth mentioning here and that is the issue of when does the flavour chemist or formulator want the odour detected, with normal breathing, or with a sniff? People do not go around sniffing every breath, so if the concentration of odorant is too low then it may be missed unless the person sniffs involuntarily at the right time. The only way to allow people to reliably detect an odour is to offer it at levels above sub-threshold
257
concentrations, that is a supra-threshold level. For any odour, this varies with individuals and their circumstances at the time of measurement. So, unless there has been some intentional determination of these individual levels, a single chosen concentration used in a test may be either sub-threshold or supra-threshold for different participants. For mixtures which are very common in flavour work the situation is compounded. If a chosen concentration is intentionally high, to ensure that all may smell it, there is a small possibility that for some, it may be so strong as to change their opinion (usually compounds become more unpleasant the more concentrated they are). If some participants in a panel are very sensitive to a component in the flavour mixture, their reactions may be contrary to those for whom it was still in the pleasant concentration range. Research has supported this, with evidence that different concentrations of an odorant can stimulate different combinations of olfactory receptors, changing the receptor code and therefore potentially impacting on the perceived odour quality (Malnic et al. 1999). So, choice of flavour component concentration is not a simple decision when a variable population is involved which must almost always be the case. Underlying this is the issue that a large number of existing flavour sources food and beverages, for example have been tested on large numbers of people, and have been successful for many years. It lies in the formulation of new flavour mixtures that the issue of threshold is critical, particularly when additives are being used to modify an existing product. The next factor of interest is that of sensitivity. Threshold determines the level at which the odour becomes recognised, but sensitivity is a measure of how much the perception changes with increasing (or decreasing) concentration. Those with a low sensitivity will require larger steps in concentration to express a change than those with a high sensitivity. It could be suggested that those with a high sensitivity may have an unpleasant reaction while those of low sensitivity may not have even noticed the changes. Fortunately, the food and beverage industry is characterised by fixed levels of flavour compounds and in those situations where they can be changed, it is usually at the discretion of the consumer (for example, by adding salt, pepper, or sugar). It is in the combination of threshold and sensitivity in affecting preference that the significance of these may be most relevant to the food and beverage flavour industry. While the Sniffin Sticks test includes a set of discrimination odours, the need to discriminate between components in food and beverage consumption is limited to the activity of the professional tasters, or, possibly, the enthusiastic amateur. The task used during testing must be ideally based on how the consumer is going to normally interact with the product; that is, the tested material should mirror the final products characteristics. Testing a volatile component which is going to be tasted as part of a liquid might give spurious results. Certainly anyone who cannot discriminate between components may have a different experience to those who can. Research has suggested that humans are only able to identify up to three odours in a mixture (Marshall, Laing, Jinks & Hutchinson, 2006), From the physiological perspective, once over 3 components in a mixture, the mixture now becomes a new undifferentiated single experience associated with a different representation to those of the separate odours in the mixture (Le Berre, Thomas-Danguin, Beno, Coureaud, Etievant, and Prescott, 2007). It has remained an unresolved issue how accurately tasters (particularly of wine) are able to seemingly go beyond these three components and still make detailed, apparently component specific, discrimination. It is not impossible that through experiences which they all have in abundance that the combined undifferentiated flavour is resolved
258
cognitively, not by the sensation. The wine judge may relate the complex mixture as recalling a previous experience based on more than three flavour characters. They are not actually discriminating the individual components, but rather the holistic experience. Further, wine judges will use repeated sniffs of the odour to assist in their discrimination of the different flavour components. This is in contrast with most discrimination techniques utilised in olfactory testing, where the participant is typically only allowed one sniff of the test odour. This brings the issue of identification of flavour. If a flavour component is above threshold, but below saturation, or the level at which hedonic character switches, then it should be easily detected. But, this will only occur if it has been previously consciously and intellectually labelled. This was observed in our own laboratory when a test odour was delivered at a concentration at, or around the expected threshold. Needless to say, some detected it, some couldnt. They were intentionally not exposed to the odour (n-butanol) before the experiments (which will be described in much more detail later). As this is a gas which is not commonly experienced we did not expect identification, but just detection of an odour. Significantly, those who were very poor at detecting the odour (no better than chance) when delivered at this initial level, commented that they had smelt the odour before when they were exposed to it during a subsequent threshold test of the same material. Their previous, apparently subliminal experience was used to recognise the presence of an odour they could now smell. It can be assumed that this process is not unique to n-butanol or the laboratory. In this lies an issue for trained sensory panels: by training the panellists, do we shift their olfactory ability to a level not equivalent to when they were not trained, and so how do they then relate to the rest of the untrained consumer population? But do we need to actually identify, that is apply a label, to enjoy food and beverage? Probably not, unless one is an enthusiast. There is one critical time when identification is an issue when we recognise something we dont like: aversion. The other related circumstance is when we require our panellists to identify a flavour. The human odour experience is naturally hedonistic; the primary response to odour is liking or disliking, with the most salient attribute of odours being pleasantness or unpleasantness (Ehrlichman & Halpern, 1988). There is evidence for the hedonic effect of some odorants, with examples of the positive effect of olfaction seen in the addition of seasonings to food, the use of perfumes and incense, and in the commercial products used for the masking of odours perceived as unpleasant. People, however, vary considerably in their responses, depending upon variables such as sensitivity to odours, age, sex, socio-ethnic background and previous odour experiences. Overall, there needs to be a physiological sensory response to a flavour before it can be detected; it must be of an adequate concentration for this to happen. If it is strong enough, but not too strong, we may have an opinion about how we consider it; too strong and we may dislike it. If we have the experience and the vocabulary, we may identify it by description or by chemical name. There must be a certain confidence in detection before we can apply a label. The higher cortical functions need to be presented with a clear option before a label can be chosen. Below this level we may emotionally react to the flavour: we like it, or dislike it, or dont care either way. It may make us happy, sad, distracted, focussed, without needing a name. These add to our next concept, that of preference.
259
EMPIRICAL USE OF NOVEL AND TRADITIONAL FLAVOUR TECHNIQUES

There is no clear replacement for the traditional flavour research techniques at this point in time. What is clear is that traditional flavour assessment techniques can benefit from combining with some of the newer approaches. In our work we have had a bias towards using electrophysiological methods as these are: simple (for us), inexpensive, and quick and revealing (usually far more data than one can easily cope with). By themselves these approaches will produce conclusions which may not be readily accepted by the majority of the industry, unless they are able to be put into context with past observations and wellestablished views. There was a need for us to link the two: for our benefit (knowing that we were getting comparable results to the literature); and providing comfort for those interested in our results, that we could get produce data that werent totally contrary to expectations. The best way of outlining these observations is to look at them in the way they actually happened and developed over time as we established evidence of the application of a combination of novel and traditional testing techniques using a range of food and beverage odours.
Electrophysiological (EEG Responses) to Odours

Our first goal was to develop methods of delivery to allow odour delivery during natural breathing that can be timed for EEG recordings. This was necessary so we could reduce the amount of data we had to analyse to that which was just before and just after the presentation of the stimulus. It is outside the scope of this work to elaborate how the Continuous Respiration Olfactometer (CRO) was developed, except to say that it functioned for over 500 recordings (for details, see Owen, Patterson and Simpson, 2002). The first observations involved sub- versus supra-threshold recordings brain activity patterns when no conscious detection of odour (Owen, Patterson and Silberstein, 2002a), using steady-state visual evoked potential (SSVEP) topography. SSVEP is a variation on normal EEG recording in that it records the changes to on-going neural processing at a specific frequency (13 Hz or around alpha rhythm). Stimulus mediated changes to this ongoing activity have been taken to imply that the neural tissue has been re-directed to process the stimulus-induced new signal. Odour-air and air only stimuli were delivered synchronous with natural respiration during the simultaneous recording of SSVEPs and subjective behavioural responses. Detection threshold levels in response to the test odour were determined using the Sniffin Sticks n-butanol threshold test. Data were analysed to determine if the SSVEP would be altered when odour was present, and whether the revealed topographic activity would differentiate levels of olfactory sensitivity as indicated by subjective odour detection response (yes and no responses) that identified supra- and subthreshold odour responders. In comparison to air, the SSVEP topography revealed cortical changes in response to odour stimulation consistent with the neurophysiological olfactory responses reported using other electrophysiological and imaging techniques. Topographic changes (that is, different regions of the cortex) were also evident for those who reported they were unable to perceive the odour, showing the presence of a subconscious physiological
260
detection response to sub-threshold odour stimulation. In addition, differences in regional SSVEP topography were shown for those who reported smelling the odour compared with those who remained unaware of the odour. These regional differences continued to be observed in response to the increased concentration of the odour: regional changes in the SSVEP topography were observed with the higher concentration of n-butanol for the participants who could smell the low concentration odour. The SSVEP topographic differences between the sub- and supra-threshold responders suggested differences in olfactory processing related to odour sensitivity, associated with differences in the nature of specific brain-related olfactory responses. These results had the benefit of not requiring analysis of the full range of frequencies in the brains processing, just that part involving the 13 Hz probe. Further it was not surprising to us that t visual signal (producing the 13 Hz probe) could be altered, or abandoned by the presence of an olfactory stimulus. Such a result confirms the high priority of this fundamental sense.
Interpreting and Understanding EEG Frequency Analysis

Throughout the following reported experiments, EEG frequency analysis was conducted in order to investigate the changes in EEG responses associated with the odour stimuli. This was done, in part, to confirm that the 13 Hz visual probe SSVEP wasnt some lucky coincidence. EEG is the recording of continuously fluctuating voltages in the brain. Rhythmic variations are continually present at the surface of the scalp from before birth to death. The fluctuations are often periodic and may take several forms: some patterns are so reliable they have been identified by Greek letters (alpha, beta etc) and may be expected to occur periodically in the normal brain. The various frequencies and distributions of specific patterns of EEG wax and wane, providing a constant record of the changing patterns of electrical activity associated with internally (breathing, hunger, fatigue etc) and externally induced responses (visual stimuli, smells, sounds, etc). Waveforms that are measured in response to a specific stimulus (in this case the air or odour stimulus) can be analysed by power spectra analysis of the evoked EEG response, timed to the stimulus onset. Power spectra analysis is designed to determine what variety of frequencies are present in a segment (collected over a time interval such as a second) of EEG data. Changes in the frequency and patterns of the EEG have traditionally been related to behaviours. For example, large rhythmic waves between 8 12 Hz are know as the alpha rhythm, which has often been related to a state of relaxation. A reduction in alpha activity can therefore be interpreted as an increase in alertness, or a shift in attention; basically a change in brain activity has occurred. The presence of brain activity associated with processing involved in breathing and "concentrating on the likelihood of a smell" are accounted for by the subtraction of the air signals from the odour signals for each recording to produce what is here referred to as a difference response. The data for each frequency have then been combined into groups or bands of frequencies which are commonly accepted in EEG studies, but have no specific value other than their general acceptance. These selected frequency bands have previously been found to reveal the majority of the frequency changes that occur during the odour/EEG experience. A positive difference response (above the x-axis) is interpreted as an increase in activation associated with the odour stimulus, a negative difference response (below the x-
261
axis) is interpreted as a decrease in activation, and the x-axis or zero-crossing indicates no change in response to odour. This analysis process was used for a series of studies that investigated the use of traditional sensory techniques (using rating scales and descriptors) in comparison with recordings of brain activity techniques to determine consumer liking responses associated with beer, wine and dairy flavours.
Expert Versus Nave Consumer Responses to Beer Odours An opportunity arose to carry out a comparison of experienced versus untrained responses to beer odours. A major international brewer was interested in the experience aspect of beer tasters, how to compare consumer and expert responses to beers, and how the knowledge may need to be passed on from generation to generation. Beer satisfaction is ultimately determined by the effects of the odour characteristics (aromas, flavours and taints) which in turn depend on the beer components. Those who like or dislike beer may not be able to articulate what it is that affects them because they lack experience of the nature of the components. In a collaborative project with a major brewing company, research was conducted to determine the correlation of brain activity responses with flavour preferences, using a combination of tastings, psychophysiological and electrophysiological (EEG) measures to assess flavour responses. Two panels were established, consisting of 22 industry tasters and 22 general consumers (untrained in flavour and sensory analysis). Olfactory profiling was undertaken for all panellists using subjective psychophysiological techniques (Sniffin Sticks test), and all participated in a traditional taste test and in brain activity recording sessions (EEG) in response to heavy and light beer odours, delivered synchronously with natural respiration (as described previously). The data collected during recordings of on-going EEG using an ElectroGeodesic Inc (EGI) 64-channel recording system were analysed to determine the relationship of the EEG responses to reported preferences for the heavy and light beer odours. Relative % power was calculated for the frequency bins of interest (1-4 Hz, 5-8 Hz, 9-12 Hz) for each odour condition. The use of relative % power was justified due to the protocol adopted, which incorporated both air and odour (light or heavy beer) stimuli randomised throughout the same time frames (each 5 minute recording period or trial). The assumption was therefore made that within each time frame the total power for each epoch would remain relatively constant. In view of the use of a no-odour control (air stimulus only), the relative % power was also calculated for the odour-air difference for both odours, based on the assumption that such a calculation would account for any common brain responses, and isolate the odour-related responses. There were clear differences between the patterns of brain electrical activity - as determined by power spectra (FFT) - when people are grouped according to odour preference. Although clearly seen, these results are compromised by the small number of subjects in some of the groups, particularly the Dislike groups. A further complication in such work is that any one individual is not going to express the same preference for two odours as another might. Consequently, the recordings from one person were used in 'different' groups depending on the odour involved. Ideally, a much larger group of participants should be used where it may be possible to ensure that the same people provide recordings which are pooled for any pattern of like and dislike of odours. But, such are the vagaries of flavour research on real people. Doing correlations would have been pertinent if the subject pool had provided
262
people who all preferred the same odours to the same extent. While not necessarily affecting the data described here, the complexity of neural processing, and individual preference variations requires consideration of the subject pool and how the data are handled. For this reason, statistical analysis must be cautiously interpreted. The use of a small subject pool is normally not preferred, but because of the variation in preference seen in the two odours when a 10 cm Likert scale is used, we were inevitably going to be examining only a small number of similar responses, even with the initial larger group. That the major changes or differences in power spectra occurred in the 4-8 and 8-12 Hz frequency bands provided more support for the previous work on the use of the SSVEP in olfactory research reported earlier (Owen et al., 2002a). Results of this beer study demonstrate that alterations in a 13 Hz probe is not unexpected if the major alterations in EEG processing occur near this frequency. Of further importance, the shift in processing in the 4-12 Hz frequency range has been considered to imply shifts of attention (Martin, 1998; Van Toller, Behan, Howells, Kendal-Reed and Richardson, 1993). It is obvious that when a participant detects an odour and then attempts to recognise it, a change in attention must occur. This is supported by the shifts in frequency distribution evident in this beer study. The difference in the expertise of the industry subjects was evident both in their rating responses and in their electrophysiological responses. It could be predicted that flavour training and experience with taste sessions would provide the experts with an advantage in their familiarity with the procedure and with the descriptors used for the rating scales. However, the difference in electrophysiological responses would not be as easily predicted as a consequence of training. The experience associated with flavour training and regular practice in taste and flavour analysis may alter the odour experience, resulting in the differences in processing in response to the odour stimuli which was evident between the nave and expert groups. Further research may contribute information to assist in determining the degree to which this training or experience is affecting the olfactory processing in the brain. From the results of this preliminary study, it can be seen that responses to beer odours are not solely dependent on a persons ability to smell. At any given time, however, the individuals responses may be altered by differences in olfactory performance at the time of measurement. Additionally, the electrophysiological findings suggest that experience, training and preference contribute greatly to the olfactory experience. When studying olfactory responses, it is difficult to isolate the factors which contribute to the olfactory experience. The sense of smell is very closely linked with memory and emotion, therefore the individual's previous experiences and associations will contribute significantly to their responses. Characterising people on the basis of other attributes will not necessarily be a predictor of someone elses responses even with the same attributes. Experience of the product, even when relatively nave, can influence how a person describes, reacts to or interprets the flavour experience. Training or the acquisition of experience of products provides yet another dimension to the influence on responses. Other means of assessing responses are required which can avoid reliance on subjective comments. These results supported the potential for the use of physiological and psychophysiological measures in monitoring flavour responses and in the physiological profiling of sensory experts and consumers.
263
Nave Consumer Responses to Dairy and Wine Odours The next step was to use our technology to further investigate the correlates of liking and preference in the EEG signals we recorded. This involved a series of studies supported by dairy and wine producer organizations in Australia. The first was to look at the odour-liking physiological indices associated with a common flavour component in a correlation of sensory and electrophysiological responses to odour (Owen and Patterson, 2002). The design of this study was based on the domination of the hedonic dimension in smell perception that is evident anecdotally and also in changes in left and right orbitofrontal cortical activation in responses to odours of different valence. EEG recordings were again used to investigate differences in cortical hemispheric activation associated with different hedonic responses to a low concentration of a single compound (damascenone: fruity, berry smell). EEG responses acquired using the same CRO delivery and EEG recording systems were analysed using traditional power spectrum techniques to determine the relationship of the brain activity to the reported odour liking responses. Differences in response to the odour were evident in comparison with air, and also between response groups. Using the same odour to evoke different hedonic responses, power spectrum analysis revealed a non-significant trend for left frontal differences in EEG associated with different liking responses to damascenone. This demonstrated quantification of the neurophysiological effects associated with odour liking. The second stage of the investigation of the correlated of liking and preference with EEG responses was a study of cross-cultural differences in responses to dairy odours. Flavour sensory qualities and consumer perceptions were compared with sensory and brain activity responses to flavour components in different populations (Patterson, Owen, Frank, Smith & Cadusch, 2004). This research explored the relationship between odour responses of nave consumers to different flavour components, by investigating the ability of sensory ratings and brain recording techniques to reveal differences in responses associated with differences in background and experience. Two groups of nave consumers were recruited: 18 Australian participants formed one group, and 28 Overseas students from a range of Asian/South-east Asian countries formed the second group. Inclusion criteria specified that all of the overseas participants were only temporary residents, with the majority exposed to Australian life, culture and tastes for less than 12 months. All participants were untrained in sensory work. Sensory ratings (liking, strength and descriptor responses) and EEG recordings were made in response to the odours of four flavour components: paracresol (4-methylphenol; described as a farm, manure, grass odour); 2-heptanone (described as a sweet, pea-like odour and a key component in blue cheese); methional (3-methylthiopropionaldehyde; described as a baked potato, savoury odour) and dimethyltrisulphide (DMTS; a stale, cabbage, sulphur odour), all assessed in comparison to a control odour of 100% ethanol. Results indicated no significant differences in rating responses between cultural groups, but did reveal significant brain electrical activity differences between cultural groups in response to para-cresol, and a similar [non-significant] trend in responses to 2-heptanone and dimethyltrisulphide. There was a reduction in frontal activation in the 5-8 Hz or theta range associated with OS subjects in comparison to Australian responses to para-cresol and heptanone. Previous research has suggested the effect of odours on theta activity may reflect changes in attention associated with the emotional reaction to the odour (Martin, 1998). The increased theta activity in the right frontal region evident in the Australian responses in comparison with the OS responses
264
may reflect a shift in attention common to different odours (particularly heptanone and paracresol) and be associated with the similar psychological or experiential responses to the odours, which is in turn are associated with differences in experience and the subsequent subjective responses to these odours of differing familiarity. These results were interpreted as demonstrating the potential for the application of EEG techniques to sensory analysis in providing physiological evidence of cultural differences in odour responsiveness that cannot always be discriminated by subjective reports, independent of language and reporting abilities. Additional studies were conducted using a range of dairy and wine odours, including headspace odours from a range of cheeses and wines in addition to further flavour components. The same protocol was used for all studies, using the CRO delivery system, the 64-channel EEG system, and the same sensory rating scales. Once the large number of observations had been recorded, a cross-study analysis was undertaken to collapse all the separate studies into one large pool using 14 different complex and simple odours. Using a total of 367 participant recordings, responses from left and right frontal and temperoparietal groups of electrodes (see Figure 1) were examined for each liking group as determined from sensory rating responses. Liking responses were determined using a 10-point Likert rating scale: Dislike = <4, Neutral= 4-6, Like=>6 (See Figure 2). The three Liking groups were formed from recordings for a total of 367 participant EEG odour sessions: Like: n=131; Neutral: n=116; Dislike: n=120. A One-Way ANOVA was conducted on the OdourControl relative % power difference responses, with Liking group (Like, Neutral, Dislike) as a between subjects factor. Viewed from above (nose at top, right and left ears indicated), the EGI electrode sites have been labelled for the sites equalling the International 10/20 system. The Left and Right frontal groups (LF and RF) are the top two groups, and the Left and Right temperoparietal groups (LTP and RTP) are at the bottom.
Fz
Cz Left ear T5 T6 Right ear
P3 Pz
P4
O1
Oz
O2
Figure 1. Illustration of brain recording electrode site locations.
265
Figure 2. Illustration of the Likert 10-point scale used to determine liking responses to odours, showing the arbitrary ranges used for like, dislike and neutral responses.
Using a One-Way ANOVA, brain activity frequency responses at anterior sites were examined for each liking response group. There were significant between-group differences in relative % power difference responses associated with Liking response in beta (13-16 Hz) activation associated with increased liking for an odour (see Figure 3). These beta responses associated with liking responses to a range of simple and complex odours were robust in both the left and right hemispheres. While beta wave bands are commonly interpreted to be associated with changes in activation or arousal, the changes in right and left hemisphere beta responses may also be a reflection of shifts in attention associated with the emotional reaction to the odour. Increases in beta activity are commonly associated with cortical arousal due to sensory stimulation. This suggests that stimulation with a pleasant odour can lead to stronger cortical activation than stimulation with a neutral or unpleasant odour, and that such activation is independent of the odour type but related to the emotional response to the odour. One of the key aims of this cross-study analysis was to investigate EEG as an objective sensory technique with the potential for use in product development and consumer analysis with small subject groups. It was important to establish if brain activity changes associated with emotional responses to odours are robust, and therefore whether the findings of small groups can be considered significant. As a result of the significant findings of this cross-study analysis, it was concluded that changes in alpha and beta activation associated with odorous stimuli can be used as an indicator of emotional responses to the odour, independent of differences in cultural background and expertise.
Figure 3. Left and right frontal OdourControl relative % power difference in the 13-16 Hz or beta range for Liking groups (Like: n=131; Neutral: n=116; Dislike: n=120) associated with the 14 simple and complex test odours. The Y-axis shows power normalised as a relative percentage.
266
Frequency analysis of the EEG has been used commonly in cognitive EEG research and in cases where the stimulus is a visual one, but its use in olfaction and taste is very limited. The advantage is that allows an interval of EEG which includes early and late responses to a stimulus to be analysed as a whole. This avoids issues of small timing variations such as caused by differences in inspired airflow, length of the nasal cavity, response time of receptors and small pathway variations in the brain. By using this technique we are stepping back from defining precisely when a response to the odour occurred, but instead analysing what changes occurred in the period when the response must occur if there is one. It also allows relatively simple definition of where on the electrode array the responses occurred and therefore (somewhat crudely) where in the brain alterations in activation took place. That there is strong evidence of a persons preference encoded in this simple way is very encouraging as it means that differences in odour response can be determined without much dependence on language or experience. In this way it should be feasible to look at cultural groups and groups of different ages and experience almost equally and without an imposed inconsistency or limitation (reliance on the language and reporting abilities of the consumers). The speed and simplicity of the approach may lend itself to product development involving these groups even at the stage of determining preference for components and for the strength of these components. By complementing subjective reporting the EEG-based approach can provide a separate and objective measure, and increased confidence for the flavour industry in its goal to develop new products or formulations for different populations of consumers over the world.
CONCLUSION
What are the outstanding issues concerning the neurological processes involved in flavour appreciation? We dont know the nature of brain processing of flavour. While the regions of the brain which are involved in olfaction and gustation are well known, what they do to modify the signals and how they are then processed to become flavour is not known. Further, the impact of all the modifiers of appreciation of flavour is not understood. There must be logically some higher processing linking together the various outputs of the various processing centres handling the flavour inputs. There are sufficient hints that these can alter the actual perception of flavour, but what the detail is, still needs elucidation. For example, is flavour processed in both hemispheres, or only the left, or only the right? How does it fit with the psychological view of left-right hemispheric dominance on behaviour? It may be that the processing of flavour is so fundamental to our survival that the cognitive components often part of the left-right hemispheric dominance are much less involved, other than to be rationalised or explained later. It is clear that differences in relative processing in the left-right hemispheres can be shown for: 1. Different odours. 2. Different appreciations for the same odour in different people. 3. Changes caused by different concentrations in an individual.
267
This processing has been shown to involve different anatomical locations of the brain and in the different frequencies of brain activity. While very informative studies can be done with an individual, the usual expectation of such research is that there must be tight statistical support to be able to draw conclusions. In brain electrical activity the number of variants of processing in a small group of normal participants smelling an odour confounds the data. For example, what the individual may recall and associate with the odour during the sensation may alter the pattern of brain activity. The more complex the stimulus, the more likely that different people will have different neural processes operating while the recording takes place. For these reasons, the comparison of the persons activity before and during the experience is more likely to be useful compared with averaging all the responses and looking for any trends. The pathways of the flavour inputs suggest that lower brain centres are integral to the processing. But, we dont know what contribution to flavour appreciation arises from these lower (midbrain) centres. Is it all cortical and high level, or is there always a significant impact of emotional involvement? Resolving this would be an important step in understanding how our appreciation of flavour may change with emotional context, mental state and autonomic system activity. Surprisingly, we dont know the precise relationship between memory, age and flavour appreciation: is there a normal change in preference as well as a change through deterioration? With a general trend in the population towards a greater percentage of older people, resolving the issue of deterioration in flavour appreciation is quite important. At the very least it should be a priority to determine if some problems of personally imposed malnutrition in the elderly may be partially because of the lack of taste, or a bad taste experience. Surely, the least one can expect is that food and beverages will remain a source of pleasure as we age? Another area which might be beneficial in our pursuit of better understanding of such a fundamental thing as flavour appreciation lies in the the way these preferences develop in time and with experience. What are the developmental aspects of flavour appreciation? What are the cultural and racial differences, if any, in this processing? What social, medical (traumatic, disease, treatment) and environmental issues alter flavour appreciation? All of these questions affect some groups within our societies. Lastly, we dont know the precise pathways which the signals follow to develop what we call flavour. How do all the inputs mingle to produce appreciation of the flavour. How could these ethically be manipulated to ensure that we get the most of this very basic aspect of our lives across all ages? No single experimental approach is likely to provide answers to these questions. Different sources of flavour in our food and beverages are going to alter the circumstances which create an output: flavour appreciation. One fact is clear. Staying with the established approaches will not easily leads to new understanding. Future research needs to be balanced with contributions from the old established techniques and the latest approaches. It may be said, with much less clarity, that it is time for those carrying out research into flavour to approach the remaining issues and uncertainties with a combined targeted and comprehensive research plan. This could lead to large increases in our knowledge of this fundamental aspect of our physiology and behaviour which may be, in reality, compromised by modern life. This leaves one last question: did our ancestors enjoy their food and drink more than we do,
268
because we are now generally forced to consume heavily modified products, produced to a price, or because of a manufacturing convenience? Perhaps we can develop new formulations, inexpensively with novel approaches, which are more likely to have definite appeal to our basic senses, rather than the current situation where a lot of products are chosen as the best of those available. If the industry continues with the traditional approaches, it is likely that our options for food and drink in the future will be only the traditional options.
ACKNOWLEDGEMENTS
The authors wish to thank Carlton & United Breweries, Australia, Diary Research & Development Corporation, Grape & Wine Research & Development Corporation and the CRC for International Food Manufacture & Packaging Science, Australia, for their financial and intellectual support of research reported in this chapter.
REFERENCES
Ayabe-Kanamura, S., Schicker, I., Laska, M., Hudson, R., Distel, H., Kobayakawa T. & Sachiko, S. (1998). Differences in perception of everyday odors: a Japanese-German cross-cultural study, Chemical Senses, 22, 31-38. Cain, W.S. (1988). Olfaction. In R.C. Atkinson, R.J. Herrnstein, G. Lindzey & R.D. Luce (Eds.), Stevens' Handbook of Experimental Psychology Volume 1: Perception and motivation. (2nd ed, 409 - 459). New York: Wiley. Cain W.S. (1989). Testing olfaction in a clinical setting. Ear, Nose and Throat Journal, 68, 316 - 328. Cain, W.S., Cometto-Muniz, J.E. & de Wijk, R.A. (1992). Techniques in the quantitative study of human olfaction. In M.J. Serby & K.L. Chobor (Eds.), Science of Olfaction (279 308). New York: Springer-Verlag. Cain W.S., Gent J., Catalonotto F.A. & Goodspeed R.B. (1983). Clinical evaluation of olfaction. American Journal of Otolaryngology, 4, 252 - 256. Cain W.S. & Rabin M.D. (1989). Comparability of two tests of olfactory functioning. Chemical Senses, 14, 479 - 485. Dalton, P., Lees, P.S.J., Gould, M., Dilks, D., Stafaniak, A., Bader, M., Ihrig, A. & Triebig, G. (2007). Evaluation of long-term occupational exposure to styrene vapor on olfactory function. Chemical Senses, 32, 739-747. Distel, H., Ayabe-Kanamura, S., Martinez-Gomez, M., Schicker, I., Kobayakawa, T., Saito, S., & Hudson, R. (1999). Perception of everyday odors - correlation between intensity, familiarity and strength of hedonic judgement, Chemical Senses, 24, 191-199. Doty, R.L., Marcus, A., Lee, W.W. (1996). Development of the 12-item Cross-Cultural Smell Identification Test (CC-SIT). Laryngoscope, 106, 353-6. Doty, R.L., Shaman, P., Applebaum, S.L., Giberson, R., Siksorski, L., & Rosenberg, L. (1984a). Smell identification ability: changes with age. Science, 226, 1441-1442.
269
Doty, R.L., Shaman, P., & Dann, M. (1984b). Development of the University of Pennslylvania smell identificiaton test: a standardized microencapsulated test of olfactory function. Physiology & Behaviour, 32, 489-502. Hudson, R., Arriola, A., Martinez-Gomez, M. & Distel, H. (2006). Effect of air pollution on olfactory function in residents of Mexico City. Chemical Senses, 31, 79-85. Hummel, T., Bensafi, M., Nikolaus, J., Knecht, M., Laing, D.G. and Schaal, B. (2007). Olfactory function in children assessed with psychophysical and electrophysiological techniques. Behavioural Brain Research,180, 133-138. Hummel, T., Sekinger, B., Wolf, S.R., Pauli, E. & Kobal, G. (1997). Sniffin Sticks: Olfactory performance assessed by the combined testing of odor identification, odor discrimination and olfactory threshold. Chem. Senses, 22, 39-52. Kepecs, A., Uchida N. & Mainen, Z.F. (2006). The sniff as a unit of olfactory processing. Chemical Senses, 31, 167-179. Kobal, G., Klimek, L., Wolfensberger, M., Gudziol, H., Temmel, A., Owen, C.M., Seeber, H., Pauli, E., Hummel, T. (2000). Multicenter investigation of 1,036 subjects using a standardized method for the assessment of olfactory function combining tests of odor identification, odor discrimination, and olfactory thresholds. European Archives of Otorhinolaryngology, 257, 20511. Kobayashi, M., Saito, S., Kobayakawa, T., Deguchi, Y, & Costanzo, R.M. (2006). Crosscultural comparison of data using the odor stick indentificaiton test for Japanese (OSITJ). Chemical Senses, 31, 335-342. Laing, D.G. (1983). Natural sniffing gives optimum odour perception for humans. Perception, 12, 99 - 117. Laing, D.G. (1986). Identification of single dissimilar odors is achieved by humans with a single sniff. Physiological Behaviour. 37, 163-70. Le Berre, E., Thomas-Danguin, T., Beno, N., Coureaud, G., Etievant, P. & Prescott, J. (2007). Perceptual processing strategy and exposure influence the perception of odor mixtures. Chemical Senses, doi:10.1093/chemse/bjm080. Mainland J, Sobel N. (2006). The sniff is part of the olfactory percept. Chemical Senses, 31, 181-96. Malnic, B., Hirono, J., Sato, T. & Buck, L.B. (1999). Combinatorial Receptor Codes for Odors. Cell, 96, March 5, 713723. Martin, G. N. (1998). Human electroencephalographic (EEG) response to olfactory stimulation: Two experiments using the aroma of food. International Journal of Psychophysiology, 30, 287-302. Murphy, C., Morgan, C.D., Wetter, S., Geisler, M.W., Ellison, D.W., & Polich, J. (1997). Age effects on central nervous system activity reflected in the olfactory event-related potential. Chemical Senses, 22, 756. Nordin, S., & Murphy, C. (1997). Odor memory in normal aging and in Alzheimers disease. Chemical Senses, 22, 761. Owen, C.M. & Patterson, J. (2002). Odour liking physiological indices: a correlation of sensory and electrophysiological responses to odour. Food Quality and Preference, 13, 307-316. Owen, C.M., Patterson, J., & Silberstein, R.B.S. (2002a). Olfactory modulation of steadystate visual evoked potential topography in comparison with differences in odour sensitivity. Journal of Psychophysiology, 16, 71-81.
270
Owen, C.M., Patterson, J. & Simpson, D.G. (2002). Development of a continuous respiration olfactometer for odorant delivery synchronous with natural respiration during recordings of brain electrical activity. IEEE Trans Biomed Eng., 49, 852-8. Pause B.M., Sojka B. & Ferstl R. (1997) Central processing of odor concentration is a temporal phenomenon as revealed by chemosensory event-related potentials (CSERP). Chemical Senses, 22, 9 - 26. Saito, S. Ayabe-Kanamura, S., Takashima, Y., Gotow, N., Naito, N., Nozawa, T., Mise, M., Deguchi, Y. & Kobayakawa T. (2006). Development of a smell identification test using a novel stick-type odor presentation kit. Chemical Senses, 31, 379-391. Shu, C.H., Yuan, B.C., Lin S.H. & Lin, C.Z. (2007). Cross-cultural application of the Sniffin Sticks odor identification test. American Journal of Rhinolaryngology, 21, 570-573. Sobel, N., Khan, R.M., Hartley, C.A., Sullivan, E.V. & Gabrieli, J.D.E. (2000). Sniffing longer rather than stronger to maintain olfactory detection threshold. Chemical Senses, 25, 1-8. Stevens, J.C., Cain, W.S., & Burke, R.J. (l988). Variability of olfactory thresholds. Chemical Senses, l3, 643-653. Takagi, S.F. (1989). Human Olfaction. Univ of Tokyo Press, Tokyo. Van Toller, S., Behan, J., Howells, P., Kendal-Reed, M & Richardson, A. (1993).A. An analysis of spontaneous human cortical EEG activity to odors. Chemcial Senses, 18, 116. Zou Z. & Buck L.B. (2006). Combinatorial Effects of Odorant Mixes in Olfactory Cortex. Science. Mar 10, 311(5766), 1477-81.
Chapter 6
FOOD BIOACTIVE PEPTIDES: RECENT TRENDS IN RESEARCH, PRODUCTION, FUNCTIONALITY, AND APPLICATIONS
Kasipathy Kailasapathy*
Probiotics and Encapsulated Functional Foods Research Unit, School of Natural Sciences, Centre for Plant Food Science, University of Western Sydney, South Penrith DC, Locked Bag 1797, NSW 1797, Australia
ABSTRACT
In the recent past, increasing attention is being focussed on physiologically active peptides from a range of plant and food sources. Proteins and peptides from planta and foods have been observed to be physiologically active (bioactive) either directly or indirectly after their hydrolysis in vivo or in vitro (eg. cheese ripening & food fermentation). For example, milk proteins exert a wide range of nutritional, functional and biological activities. Many milk proteins possess specific biological properties that make these components potential ingredients of health-promoting foods. Food-derived bioactive peptides refer to different plant or animal origins that may have regulatory functions in the human system beyond normal and adequate nutrition. This chapter includes: the introduction of bioactive peptides, structure and physicochemical properties of bioactive peptides, and it will discuss various food-derived bioactive peptides including opioid, ACE-inhibitory, mineral-binding, anti-microbial, immunomodulatory, cytomodulatory, anti-thrombotic, antioxidant, and hypocholesterolemic peptides. This chapter also includes the various sources of enzymes needed to produce bioactive peptides, and their applications. The production of bioactive peptides using enzyme hydrolysis, microbial fermentation and the fractionation and enrichment of bioactive peptides are discussed. Functionality of bioactive peptides and their physiological, biochemical and immunological effects are also discussed. The food and nutraceutical applications and potential directions of new food and therapeutic
*
Phone: + 61 2 45 701 653; Fax: + 61 2 45 701 954
272
Kasipathy Kailasapathy
products are discussed in this chapter. Finally, a future outlook on the development and utilization of bioactive peptides and their novel applications is discussed.
INTRODUCTION
Traditional fermentation involving proteolysis of food proteins has been practised for many years, for example in Japan, fermented soybean products (Shoyu and miso), in Indonesia, a partially fermented product called tempeh, while soy sauce (fermented soy bean product), is a popular food ingredient in Chinese cooking. Whether modern technology or traditional fermentations is utilised in processing these products, a common practise is to use proteolytic enzymes to hydrolyse the protein. The role of proteins as physiologically active component in the diet is being increasingly acknowledged. Many of the proteins that occur naturally in raw food materials exert their physiological action upon enzymatic hydrolysis. In recent decades, many studies have investigated the bioactivity of peptides from hydrolysing food proteins. Such peptides are inactive within the sequence of the parent protein and can be released in three ways: 1. Use of hydrolytic digestive enzymes. 2. Use of proteolytic micro organisms 3. Through the action of proteolytic enzymes derived from micro organisms or plants. For example, plant origin enzymes include papain and bromelain and of microbial origin include neutrase and alcalase. The role of lactic acid bacteria in the production of physiologically active peptide during gastrointestinal digestion and fermentation of food ingredients is well known. Food-derived bioactive peptides are short amino acid structures, ranging from 2-20 amino acids long, produced from the hydrolysis of proteins of plant or animal origin with the resultant fragments capable of exerting positive impact on body functions in a human system and may ultimately influence health beyond normal and adequate nutrition (Kitts & Weiler, 2003; Hartmann and Meisel, 2007). Bioactive peptides may influence various physiological activities associated with cardiovascular, digestive, immune and nervous systems. These activities depend, however, on their amino acid sequence. In recent decades, many studies have investigated the bioactivity of peptides derived from hydrolysing food proteins. Two possible uses of these bioactive peptides are the inhibition of angiotensin I-converting enzyme ( ACE), which can lower the blood pressure of hypotensive people and in the inhibition of microbial growth that may be used in food preservation and in medicine (peptide antibiotics). There are, however, many other beneficial health effects including anti-carcinogenic, antianaemic, anti-oxidative, opioid-like, anti-thrombotic, immunomodulatory and cholesterol lowering activity (Korhonen & Pihlanato, 2006). Hydrolysis of food proteins with different enzymes produces different peptides with different amino acid composition and sequence, with different inhibitory activities towards ACE. Many peptides of plant, animal and fish origin with relevant bioactive potential have been discovered. The original protein source of these peptides includes soy, fish, meat, milk, egg, wheat, broccoli, rice etc (Hartmann & Meisel, 2007). Currently, milk proteins are considered most important source of bioactive peptides and an increasing number of bioactive peptides have been identified in milk protein hydrolysates and fermented dairy products (Korhonen & Pihlanto, 2006). This chapter reviews the current knowledge on the bioactive peptides from food sources (both animal and plant), their production and utilisation as health promoting ingredients.
Food Bioactive Peptides: Recent Trends in Research ...
273
PRODUCTION OF BIOACTIVE PEPTIDES

The production of bioactive peptides essentially involves degradation or hydrolysis of proteins into smaller peptides. This is accomplished by: 1. enzymes, 2. fermentation with proteolytic cultures, and 3. enzymes derived from micro organisms or plants.
Release of Bioactive Peptides by Enzymatic Hydrolysis
The common way to produce bioactive peptides is using proteolytic enzymes and whole protein molecules. Pancreatic enzymes such as trypsin and pepsin have been commonly employed. Angiotensin-converting enzyme (ACE)-inhibitory peptides and caseinophosphatides (CPP), for example are commonly hydrolysed by trypsin (Fitzgerald et al., 2004). Other enzymes and combination of proteinases including alcalase, chymotrypsin, pancreatin and pepsin, as well as enzymes from bacterial and fungal sources have been utilised to generate bioactive peptides from various sources (Korhnen and Philanto, 2003b). The enzymes used in the hydrolysis of food proteins can be classified according to their origin (animal, plant or microbial), their catalytic action (endopeptidase or exopeptidase), and the nature of the catalytic site. Endopeptidases are always used in food protein hydrolysis, although a combination with exopeptidase is occasionally employed (Adler-Nissen, 1986). Examples of proteinases from plant origin are papain and bromelain (from papaya latex and pine apple stem respectively). Papain is an endoprotease with an optimum pH of 5-9 (Whitaker, 2003). The preferential specificity of papain is Lys-Arg- and Phe-X-COOH at the terminal amino acid (Adler-Nissen, 1986). Bromelain is a collective name for proteolytic enzymes found in pineapple plant (Doko et al., 1991). It is also an endopeptidase with an optimum pH range of 5-9 at temperature range of 50 600 C (Kristinsson, 2006). The preferential specificity of bromelain is Lys-Arg-Phe- and Tyr-COOH at the terminal amino acid (Adler-Nissen, 1986). Flavourzyme is a commercial name for a mixture of enzymes of fungal (Aspergillus oryzae) origin. According to Adler-Nissen (1986), Aspergillus oryzae produces a mixture of aspartic protease, metalloprotease, serine protease and carboxypeptidase with optimum pH ranges of 4-8 and shows a very broad specificity. Flavourzyme (of Novozymes) is a complex endopeptidase and exopeptidase used in the food functionality industry for extensive hydrolysis of protein and de-bittering process (http://www.novozymes.com). Enzymatic hydrolysis of proteins can be performed by either batch hydrolysis or continuous hydrolysis using membrane technology. Traditional batch method has several disadvantages, such as the relatively high cost of enzyme and their inefficiency compared with a continuous process. The enzymatic membrane reactor, which integrates enzymatic hydrolysis, product separation and catalyst recovery into a single operation for continuous production of specific peptide fragments was introduced during the 1990s. This technology has been widely applied for the total conversion of food proteins of various origins to produce hydrolysates with improved nutritional and / or functional properties (Martin Orue et al, 1999). Membrane technology using stepwise ultrafiltration in low molecular mess cut off membrane systems are useful for separating small peptides from high molecular mass residues and remaining enzymes. Ultrafiltration membrane reactors yield a consistently
274
uniform product with desired molecular mass characteristics. Turgeon and Gauthier (1990) reported a two-step ultrafiltration membrane separation process that achieved production of a mixture of polypeptides and small peptides with a molecular mass cut off of 2000 Da. Recently, ion exchange membrane chromatography has emerged as a promising technique for the enrichment of peptide fraction from protein hydrolysates. The proteins may be concentrated within a chromatographic medium and hydrolysed in situ with appropriate enzymes. The resulting active peptides are retained on the ion exchanger, while the other peptides are washed out. In the end, the fraction containing the active peptides can be eluted from the chromatographic -medium. An application of this ion-exchange separation technology is the isolation and enrichment of cationic antibacterial peptides from lactoferrin and -s2 casein as well as negatively charged phosphopeptides from -casein (Korhonen and Pahlanto, 2003a).
Formation of Bioactive Peptides by Microbial and Digestive Enzymes

Dairy cultures used in the production of fermented milk products have appreciable proteolytic activity enabling their rapid growth in milk. Bioactive peptides can, thus, be generated by starter and non starter bacteria used in the manufacture of fermented dairy products. The proteolytic capability of lactic acid bacteria such as Lactococcus lactis, L. helveticus and L. delbrueckii ssp bulgaricus, is already well characterised. Strains of L. helveticus have been identified as highly proteolytic and peptidolytic towards caseins and their derivatives, and, if used in fermentations, they can produce products with a range of bioactivities (Matar et al., 1996). In the GI tract, endogenous digestive enzymes and proteases released by micro organisms colonising the intestine may further degrade long oligopeptides, leading to a possible formation of peptide sequences with specific bioactivities. Once liberated in the intestine, such peptides may act locally or transit through the intestinal membranes into the blood circulation ending up in a target organ, with subsequent regulation of physiological conditions (Meisel. 2001) The formation of various bioactive peptides from milk proteins through microbial proteolysis has been reported in many studies. During fermentation, milk proteins, namely caseins, undergo a slight proteolytic degradation resulting in a number of potentially bioactive peptides. These peptides include hypotensive, ACE inhibitory and opioid activity (Shah, 2007). Milk proteins contain a number of ACE-inhibiting peptides encrypted within their primary structures (Donkor et al. 2005). These peptides are liberated by proteolytic action of extra cellular and intracellular enzymes of LAB proteolytic system. Most of the documented ACE- inhibiting peptides are generally short peptides with a proline residue at the carbonyl terminal end. For example, the ACE inhibiting bioactive peptide obtained by fermentation of -casein with L. helveticus NCC showed an amino acid sequence of Asn Leu His Leu Pro (Shah, 2007). Proline is known to be resistant to degradation by digestive enzymes and may pass from the small intestines into the blood circulation in the sequence of short peptide (Yamamoto et al, 2003). Several commercial products containing highly proteolytic strains of L. helveticus have been developed and marketed as possessing hypotensive activity, including Calpis and Evolus. Calpis sour milk (Calpis Co. Ltd., Tokyo, Japan) is manufactured by fermentation of milk cultures containing L. helveticus CM4
275
(CP 790) and S. cerevisiae (Shah 2007). These organisms are capable of generating a range of bioactive peptides (Nakamura et al., 1995; Vasilievic & Shah, 2007) Further, lactic and bacterial fermentation of milk followed by hydrolysis with digestive enzymes can produce a variety of immunomodulatory peptides (Rokka et al, 1997). These observations indicate that LAB may modulate the immunogenecity of milk proteins prior or after oral ingestion of the product. This modulation may be beneficial in the down regulation of hypersensitive reactions to ingested proteins with food protein allergy.
BIOACTIVE PEPTIDES DERIVED FROM FOOD PROTEINS

a. Milk-Derived Peptides
Milk protein is synthesised specifically to be consumed and subsequently digested for the provision of nutrition, however, some peptides released during the digestive process exhibit biological activities over and above their intrinsic nutritional value. Hydrolysates of milk proteins have been produced using proteolytic enzymes and fractionated in order to study in vitro bioactivities, since the 1950s. (Playnel et al; 2003). It is now established that bioactive peptides can be generated during milk fermentation with the starter cultures traditionally employed by the dairy industry. As a result, peptides with various bioactivities can be found in the end products, such as various cheese varieties and fermented milks (Korhonen and Pihlanto, 2006) These traditional dairy products may under certain conditions carry specific health effects when ingested as part of the daily diet. Yoghurt and cheese fermentation processes have also been optimised to release bioactive peptides (Korhonen and Pihlanto, 2003b). A number of peptides are formed during cheese ripening and many of them have been shown to have biological activities. Selected milk derived peptides are also known to exhibit bio-functionality, for example, the casein phosphopeptide class of peptides have been shown to exert immunostimulatory and anti-cancer properties (Meisel and Fitzgerald, 2003). The occurrence of bioactivity in the cheese peptides appear to be dependent on the ripening stages of the cheese. For example, Meisel et al (1997) observed higher ACE inhibitory activities in middle-aged Gouda cheese than in short or long-ripened cheese. It could be said that the concentration of active peptides in cheese increases with cheese maturation, however, decline when proteolysis exceeds a certain level. Thus ACE inhibitory activity was low in products having a low degree of proteolysis, such as yoghurt, fresh cheese and quark (Korhonen and Pihlanto, 2003b). The degree of proteolysis and the duration of proteolysis could influence the net concentration of bioactive peptides naturally formed in cheeses. It is possible that an equilibrium between the formation of bioactive peptides and the degradation of bioactive peptides exerted by the proteolytic systems in the cheese ripening process. Peptidases released from both starter and non starter LAB seem to contribute to the formation of bioactive peptides throughout the ripening period. Mature cheddar cheese may not contain opioid peptide due to degradation during the ripening process (Muehlenkamp& Warthesen, 1996). However, small quantities of -casomorphin-3 in Edam cheese during ripening, and no structurally longer casomorphins were not detected (Sabikhi and Mathur, 2001). These results also confirm that there is production and degradation of bioactive peptides during the continuous proteolysis of long-term cheese ripening.
276
A vast literature on the various bioactivities of milk derived peptides, including mineral binding, opioid agonist and antagonist immunostimulation, cell growth modulatory , ACE inhibitory, anti-thrombotic, anti oxidant and anti-microbial properties was recently reviewed by Korhonen and Pihlanto (2006). Much of the knowledge is based on bioactivity as demonstrated by in vitro assay protocols, however, more research is needed to understand the pharmokinetics of peptide production and efficiency in vivo in order to support functional ingredient claims involving bioactive peptides. For example, a peptide with poor ACE inhibiting activity in vitro was found to be significantly anti-hypertensive in a Spontaneously Hypertensive Rat Model, suggesting that mechanisms other than ACE- inhibition were involved and that ACE inhibition alone was not predictive for anti-hypertensive activity (Yamamoto et al., 2003). Korhonen and Pihlanto (2003a) have suggested that peptide absorption pathways are likely to be via both direct transmission from the gastro-intestinal tract to the blood circulation and also via receptor-mediated transport at the intestinal cell wall. The peptides derived from whey protein like -lactalbumin and -lactoglobulin exhibit an opioid like activity. Peptide -lactophorin, for instance, has shown to exhibit weak opioid activity by producing analgesic and sedative effect that can smooth muscles (Gerdes et al., 2001). Food-derived peptides with opioid activity were first found in the late 1970s (Zioudrou, et al., 1979) and were termed exorphins on the basis of their structural similarity to endogenous ligands (endophins and enkephalins), which interact with opioid receptors of the --or -type. The common structural motif exhibited by both endogenous and exogenous ligands is an N-terminal tyrosine residue (except -casein opioid) and the presence of another aromatic residue in the third or fourth position from the N terminus (Phe or Tyr). Furthermore, a proline residue in the second position is crucial for the three-dimensional orientation of the tyrosine and phenylalanine side chains. Opioid peptides are opioid receptor ligands with agonistic activity. They originate from different milk proteins and exhibit naloxone-inhibitable opioid activity during both receptor and bioassay studies (Mullally et al., 1997) and the majority of these exogenous opioid peptides such as -casomorphins are fragments of -casein sequence 60-70 (Meisel, 1986), and has also been found in similar position in sheep, water buffalo and human -casein (Schlimme and Meisel, 1995). Another opioid peptide, serorphin, has also been derived from whey protein (Mullally et al., 1997), while Yang et al. (2001) reported the presence of opioid peptides, namely rubiscolin-5 and rubiscolin-6, derived from plant rubisco protein. Antithrombotic peptides have also been found in milk and whey protein derivatives. Thrombosis is a formation or presence of blood clot within the blood vessel and a risk factor in cardiovascular diseases. This formation takes place when fibrinogen, a plasma protein, is converted into fibrin that fixes into platelets and aggregates them, while peptides derived from milk are presumed to have the ability to inhibit the fixation (Gerdes, et al., 2001). Peptides, called casoplatelins, derived from bovine -caseins C-terminal part (caseinoglycomacropeptide) can inhibit the aggregation of platelets and binding the fibrinogen -chain to a specific receptor site on the platelet surface. These -caseins antihrombotic peptides are from sequence 106-116, and are in various sizes (Mullally et al;, 1997). Antimicrobial peptides have also been derived from hydrolysis of milk proteins (Chan and Li-Chan, 2006). Zucht et al (1995) reported that Casosidin-I, a 39 amino acid fragment derived from acid treatment of -s2-casein, could inhibit the growth of Escherichia coli and
277
Staphylococcus carnosus. The disruption of normal membrane permeability is at least partly responsible for the antibacterial mechanism of lactoferricins (Fitzgerald & Murray, 2006). It was also found that pepsin digestion of -s2-casein released cationic fragments with potent antimicrobial inhibitory activity. Antihypertensive action of milk, milk products, and whey proteins has been studied extensively. Meisel et al (2006) reported more than 50 peptides derived from bovine milk and consisted of 2-11 amino acids. Nakamura et al (1995) reported two ACE inhibitory peptides Val-Pro-Pro and Ile-Pro-Pro from fermented sour milk. In this study unfermented milk was also a subject for ACE inhibitory assay and showed slight ACE inhibitory activity as compared to sour milk which indicates that the activity was markedly increased during fermentation with Calpis sour milk starters containing L. helveticus and Saccharomyces cereviceae. A further study indicated that a relatively small quantity of these peptides could decrease the systolic blood pressure of spontaneous hypertensive male rats (SHR) but did not change the systolic blood pressure of normotensive rats, indicating that these peptides worked only on hypertensive state (Nakamura et al., 1995b). The same peptides, Val-Pro-Pro and Ile-ProPro were also produced in a similar fashion hydrolysis of skimmed milk proteins using freecell extract of L. helveticus JCM 1004 that contained proteinase, aminopeptidase and xprolyl-dipeptidyl aminopeptidase (Pan et al., 2005). The hydrolysis process reached its peak with respect to ACE inhibitory activity of the resulting peptides at pH 6.5 -7.0 and 6-10 hrs of hydrolysis. These 2 peptides have been claimed to have higher ACE inhibitory activity than other reported bioactive peptides derived from milk products (Mullally, et al., 1997; Abubaker et al., 1998). In another work Gobbetti et al (2000) reported that peptides derived from milk fermented with Lactobacillus delbrueckii sub spp bulgaricus SS1 and L .lactis sub sp cremoris FT 4 also showed inhibitory activity towards ACE. The fermented milk gave nine bioactive peptides against ACE with IC50 values from 8.0mg/L to 11.2mg/L. The synthesized forms of these peptides showed ACE inhibitory activities but were unstable and were strengthened to resist further proteolysis. Mineral-binding peptides have been found in milk proteins. Milk caseins (CN) stabilise calcium and phosphate ions. Tryptic digestion of the casein proteins yield caseinophosphopeptides (CPP) from the N-terminus polar region, which contain clusters of phosphorylated seryl residues (Cross et al., 2005). These phosphoseryl clusters have been hypothesised to be responsible for the interaction between the caseins and calcium phosphate that leads to the formation of casein micelles. CPPs retain the ability of whole casein and phosphate ions through the formation of complexes, thus enhancing their general bioavailability. CPPs are reported to enhance calcium transport in the small intestine in murine models (Erba et al., 2002), In human, however, the ability of the CPPs to survive the passage down to the distal human ileum was confirmed when CPPs were detected in the ileostomy fluid of human volunteers given milk (Meisel, et al., 2003).
b. Fish and Seafood Derived Peptides

Most of the studies on the production of ACE inhibitors were carried out using milk proteins as raw material, however, recent reports show increasing number of studies have also been done with fish and seafood proteins. A summary of ACE inhibitory peptides derived
278
from fish and seafood protein is given in Table 1. Yokoyama et al (1992) reported the finding of nine ACE inhibitory peptides derived from thermolysin hydrolysis and boiling water extract of dried bonito. Comparative studies of these peptides to the protein sequences of chicken actin, rat myosin, creatine kinase and human fibronectin primary structures indicated that the origin of these peptides might be from bonito actin, myosin, C-terminal of creatine kinase and fibronectin. The IC50 values of these peptides ranged from 3.7 M (strongest) to 62 M (weakest). A further thermolysin digestion of two these peptides, IKPLNY and DYGLYP, yielded additional four ACE inhibitors, IKP, LNY, DYG and LYP. The IC50 values of IKP and LYP were 1.7 M and 6.6 M, respectively, which were much stronger than their parent peptides. Another smaller peptide, IW with an IC50 value of 2.0 M, was released from a further chymotrypsin digestion of IWHHT. Also in this study, some synthetic fragments and homologue had been made, LKP, LYP and VGRPRHQG and had shown stronger activity than their original peptides. In 1993, Matsui et al. reported the ACE inhibitory activity of sardine muscle hydrolysates prepared by hydrolysis with Bacillus licheniformis alkaline protease. Although this report did not go further as to identify the peptides, the IC50 values that were ranging from 0.24 to 0.26 mg protein/ml indicated the presence of strong ACE inhibitors and fractionation of these hydrolysates markedly increased their IC50 values. In another report, Okamoto et al (1995) reported ACE inhibitory activities of various fermented foods on a liquid and solid basis. This study indicated that fish sauces, from salmon, sardine and anchovy, both in liquid and dry basis had high ACE inhibiting power. Dried bonito, on the other hand, only showed strong ACE inhibition power when tested in solid form that indicated the presence of low concentration ACE inhibitory substances. In another work with dried bonito, Fujita and Yoshikawa (1999) isolated and further characterised peptide LKPNM and found that further cleavage of this peptide by ACE gave even stronger ACE inhibitor, LKP. Both LKPNM and LKP could reduce blood pressure of spontaneously hypertensive rats (SHRs) and hypertensive subjects in a dose dependant manner. A novel ACE inhibitor, FGASTRGA, had been isolated from pepsin hydrolysate of Alaska Pollack (Teragra chalcogramma) frame protein with an IC50 value of 14.7 M (Je et al., 2004). This ACE inhibitor was of a non-competitive type that can combine with an enzyme molecule to produce a dead-end complex regardless of whether a substrate molecule is bound or not. In another study, one hydrophobic peptide (MIFPGAGGPEL) with an IC50 value of 22.3 M was isolated from yellow-fin sole (Limanda aspera) frame protein chymotrypsin hydrolysate (Jung et al., 2006). This is also a non-competitive inhibitor and showed in vivo activity in SHRs three hour after administration and remained effective for up to nine hours. Protamex hydrolysate of catfish had also been found to produce ACE inhibitory activity, although the peptides were not identified (Theodre & Kristinsson, 2007). While the above studies on antihypertensive peptides are all from fish muscles proteins, recent reports have shown results from studies on antihypertensive peptides derived from other seafood, fish cartilage and skin as well as seaweed proteins (Nagai et al., 2006; Sato et al., 2002). Je et al (2005) reported the finding of ACE inhibitory activity of fermented oyster (Crassostrea gigas) sauce. Although their work did not go as far as to identify the active peptide/s, it did, however, characterised it as competitive against ACE, and had an IC50 value of 0.087 mg/ml and a molecular weight of 592.9 Da. In another work, He et al (2006) reported the finding of five ACE inhibitory peptides from Bacillus sp. SM98011 hydrolysate
279
of shrimp Acetes chinensis. The five peptides were identified as FCVLRP, IFVPAF, KPPETV, YLLF and AFL. Three of these peptides, FCVLRP, IFVPAF and KPPETV were novel peptides with ACE inhibitory activity that never been reported before. Cartilage and skin of Chum Salmon (Oncorhynchus keta) have also shown to exhibit ACE inhibitory activity. Nagai and Tashimura (2006) reported that pressure cooker extract of chum salmon cartilage and skin showed ACE inhibitory activity with IC50 values of 62.2 mg/ml for cartilage and skin and 8.87 mg/ml for skin only. Protease S Amano (from Bacillus stearothermophilus) of wakame seaweed (Undaria pinnitifida) showed in vitro and in vivo activities against ACE (Sato et al., 2002). A total of seven active dipeptides were collected and their synthetic counterparts showed IC50 values that range from 1.5 42.3 M.
Table 1. Antihypertensive peptides derived from fish and seafood proteins
Peptides IKPLNY IVGRPRHQG IWHHT ALPHA EQP LKPNM IY DYGLYP DMIPAQK IKP LYP IW LKP LKPNM LKP FGASTRGA MIFPGAGGPEL Unknown FCVLRP IFVPAF KPPETV YLLF AFL VY IY AW FY VW IW LW Protein Source Dried Bonito (Myosin) Dried Bonito Actin Dried Bonito Actin Dried Bonito Actin Dried Bonito Actin Dried Bonito Dried Bonito Dried Bonito (Fibronectin) Dried Bonito Creatine kinase Dried Bonito (Myosin) Dried Bonito (Fibronectin) Dried Bonito Actin Dried Bonito Dried Bonito Alaska Pollack Yellowfin Sole Oyster (Crassostrea gigas) Shrimp Acetes chinensis Shrimp Acetes chinensis Shrimp Acetes chinensis Shrimp Acetes chinensis Shrimp Acetes chinensis IC50* 43 52 5.1 10 12 17 3.7 62 45 1.7 6.6 2.0 1.6 2.4 0.32 14.7 22.3 0.087b 12.3 3.4 24.1 172 65.2 35.2 6.1 18.8 42.3 3.3 1.5 23.6 Preparation Thermolysin Thermolysin Thermolysin Thermolysin Thermolysin Thermolysin Thermolysin Thermolysin Boilingwater extract Thermolysin Thermolysin Chymotrypsin Synthetica Thermolysin ACE Pepsin - Chymotrypsin Fermentation Bacillus sp Protease Bacillus sp Protease Bacillus sp Protease Bacillus sp Protease Bacillus sp Protease Syntheticc Syntheticc Syntheticc Syntheticc Syntheticc Syntheticc Syntheticc
* a
Unless otherwise indicated, the concentration for IC50 values is M. Synthetic products of the corresponding peptides derived from dried bonito. b In mg/ml c Synthetic products of the corresponding peptides derived from wakame seaweed.
280
c. Plant-derived Peptides
A number of peptides derived from plant proteins have been reported to show bioactivity. These peptides have been isolated from various plants such as buckwheat, corn, chickpeas, soybean, sea weeds and vegetables such as broccoli. As the major protein resource in most developing countries soy bean is widely consumed as processed foods (tofu, natto, tempe, miso, shoyu etc.) in China and South East Asian countries. ACE inhibitory peptides derived from soy protein by the action of alcalase enzyme, showed hypotensive effect on SHR (Wu and Ding, 2001). Soybean hydrolysates and fermented soybean products have been reported to produce ACE inhibitory peptides. Kuba et al (2005) reported that acid proteinase hydrolysates of soybean proteins, -conglycinin and glycinin, contained four bioactive peptides with ACF inhibitory IC50 values of 65 to 850 M. These peptides have been identified as LAIPVNKP or Leu-Ala-Iso-Pro-Val-Asp-Lys-Pro, LPHF or Leu-Pro-His-Phe, SPYP or Ser-Pro-Tyr-Pro and WP or Try-Pro. The synthesised versions of WL and LAIPVNKP showed high ACE inhibitory activities. This research also indicates that the degree of hydrolysis and ACE inhibitory activity increased with increasing hydrolysis time. Zhang et al (2006) reported that douchi, a traditional fermented soybean product of Chinese origin, fermented by Aspergillus Egypticus for 48h, produced angiotensin-I-converting enzyme (ACE) inhibitors with the potential of lowering blood pressure. They also found that ACE inhibitors in 48h-fermented douchi qu could be fractionated into 4 major peaks by gel filtration chromatography on Sephadex G-25 column and peak 2 which showed the highest activity, had only one peptide, composed of phenylalanine, isoleucine and glycine with a ratio of 1:2:5. According to Chiang et al (2006), a 6h hydrolysis of soy protein with alcalase at 500C, pH 9.0 and E/S ratio of 0.01 would provide hydrolysate with highest AC inhibitory activity as compared to hydrolysate of flavourzyme, trypsin, chymotrypsin and pepsin. It was evident that the higher the degree of hydrolysis (DH) and ACE inhibitory activity increase as the hydrolysis time increase which showed the significance of protease hydrolysis of proteins to provide bioactive peptides. In case of flavourzyme, however, the increase in degree of hydrolysis did not guarantee the increase in ACE inhibitor activity. This might be due to inactivation of active peptide sequence by exoprotease present in flavourzyme, through the splitting of one or more amino acids from the N-terminal or C-terminal of the peptides. This is, however, in direct contrast to the finding of Suh et al (2003) which showed that flavourzyme gave higher ACE inhibitor peptidases when corn gluten was hydrolysed. These results suggest that different proteins may produce different bioactive peptides when hydrolysed with the same enzyme. When soy proteins were treated with protease D3 (a cathepsin L-like protease derived from germinating soybean cotyledons) novel ACE inhibitory peptides with less bitter taste and showing activity similar to that of bradykinin-potentiators were produced (Kodera and Nio, 2006). These results suggest that the nutraceutical functionality of hydrolysates by D3 as a less bitter food additive for hypertensive people than formerly identified and existing hydrolysates intended for this purpose. When soy milk was fermented with probiotic cultures including L. acidophilus (LAFTI L10 and La 4962), B. lactis (LAFTI B94 and longum B. 1536), L. casei (LAFTI L26 and Lc 279), L. delbrueckii ssp bulgaricus Lb 1466 and S .thermophilus St 1342, B. longum B-1536 showed higher ACE-inhibitory activity (Donkor et al., 2007). The hydrolysis of soy protein
281
was dependent on the strain and most of the probiotic strain released bioactive peptides with ACE-inhibitory activities between 17% and 43%. Donkor et al (2005) also showed that LAB produced peptides, which exhibited in vitro ACE-inhibitory activity in soy yoghurt. These results show that fermented soy milk and soy products such as yoghurts could be converted into rich functional products containing probiotics and bioactive compounds. Plant proteins such as corn gluten and wheat gluten are produced commercially. Traditionally corn gluten is used as animal feed, but in recent times, new uses for corn gluten has been actively researched. Suh et al (2003) had studied corn gluten hydrolysate of six commercial proteases viz protamax, flavourzyme, proleather FG-F, protease A, aroase AP-10 and pescalase. The results showed that flavourzyme produced hydrolysis with stronger ACEinhibitory activity of IC50 0.18mg solid. Legumin, the main protein in chickpea seeds, also produced six ACE inhibitory peptides when hydrolysed with alcalase (Yust et al., 2003). These peptides showed inhibitory activity with IC50 values ranging from 0.011mg/ml to 0.021mg/ml with a total IC50 value of 0.18 mg/ml, all these peptides contain methionine residues. Wheat gluten is a by-product during production of wheat starch. Wheat gluten includes two main components, glutenins and gliadins. The use of wheat gluten in food and non-food applications is gaining much interest. Wang et al (2007) studied hydrolysis of wheat gluten using papain, and the hydrolysate was separated based on the molecular weight of the peptides by membrane ultrafiltration. The gluten hydrolysate and its UF fractions showed strong antioxidative activities in the linoleic acid oxidation system and DPPH radical scavenging activity. Buckwheat, a staple food in Mustang district of Nepal, has been reported to reduce hypertension regardless of their traditional intake of salty tea (Kawasaki et al., 1995). Buck wheat contains an edible rich source of rutin, a flavonol glycoside compound. Li et al (2002) studied the ACE inhibitors from tartary buckwheat and reported that intact buckwheat exhibited ACE inhibitory activity having an IC50 value of 3 mg/ml and the activity of the protein fraction (IC50: 0.36 mg protein/ml) was not enhanced by pepsin treatment. However, treatment with chymotrypsin and trypsin after pepsin hydrolysis resulted in a significant increase in the ACE inhibitory activity (IC50: 0.14 mg protein/ml). The results of this study demonstrated that buckwheat protein has a latent ability to exert an in vitro antihypertensive effect after the gastrointestinal digestion process. Ma et al (2006) have isolated and identified an ACE inhibitor from buckwheat. This tripeptide ACE inhibitor has an amino acid sequence of Gly-Pro-Pro and demonstrated activity against ACE with an IC50 value of 6.25 g protein/ml. Kafirin is the storage protein (prolamin) in sorghum grains. Sorghum is an important food source for people living in the semi-arid tropical areas of Africa and Asia. Kamath et al (2007) studied hydrolysis of sorghum Kafirin using the protease chymotrypsin and reported yielding a hydrolysate rich in peptide with ACE inhibitory activity. The IC 50 values of these peptides ranged from 1.3 -24.3 g/ml. Chick pea (Cicer arietinum L.) is the third most important grain legume in the world on the basis of total grain production (FAO, 1994). Legumin is the main storage protein in chick pea and it is a globulin. When chick pea protein was hydrolysed with alcalase (commercial protease with endopeptidase activity obtained from Bacillus licheniformis), yielded a hydrolysate that inhibited the angiotensin I- converting enzyme with an IC50 value of 0.18mg/ml (Yust et al., 2003). The results of this study demonstrated that hydrolysates of
282
chick pea legumin obtained by treatment with alcalse are a good source of peptides with angiotensin-I- converting enzyme inhibitor activity. Recently broccoli (Brassica oleracea italica), a protein rich vegetable has demonstrated potential health benefits because of the high nutritive value of vitamin C and glucosinolates, having anti-carcinogenic properties (Dillard & German, 2000). Lee et al (2006) reported that ACE inhibitory peptides with high activities could be derived from proteins of broccoli. The purified ACE inhibitory peptide was identified to be a tripeptide, Tyr-Pro-Lys, having an IC50 values of 10.5 g protein/ml. Sea weed is popular traditional food stuff in Japan. Among the sea weeds, wakame (Undaria pinnatifida) is the most widely eaten brown sea weed. Sato et al (2002) reported four peptides having significant ACE inhibitory activity from the hydrolysate of wakame, and demonstrated the anti-hypertensive effect in the hydrolysates of wakame by protease S Amano. These peptides were: Val-Tyr ( IC50 = 35.2 ), Ile-Tyr(6.1 M), Phe-Tyr (42.3M) and Ile-Trp (1.5M) and they significantly decreased the blood pressure.
Generation of Peptides from Meat Proteins

During gastrointestinal proteolysis, bioactive peptides would be liberated from food proteins. Ingested proteins are degraded y various digestive enzymes, such as pepsin, trypsin, chymotrypsin, elastase and carboxypeptidase. In addition to gastrointestinal digestion, there are a number of ways in which peptides are generated from meat proteins, for example, ageing of meats, fermentation of meats and enzymatic treatments. The content of peptides in meat increases during post-mortem aging. During aging or storage, meat proteins are hydrolysed by muscles endogenous peptidases such as calpains and cathepsins (Koomaraie, 1994) and the generation of bioactive peptides occurs by aging or storage. During fermentation of meat products, primarily, proteins are degraded into peptides by endogenous enzymes such as cathepsins. Lactic acid bacteria used in the starter cultures of meat fermentation influence protein degradation by causing a decrease in pH, which results in increased activity of muscle proteases (Kato et al., 1994). Utilisation of commercial proteases is used for producing bioactive peptides from food proteins. In meat industry, proteolytic enzymes have been used for meat tenderisation. The most commonly used enzymes for meat tenderisation are the plant enzyme papain, bromelain, and ficin. In meat treated with enzymatic tenderisation, peptides having bioactivities could be generated. Arihara et al. (2001) hydrolysed porcine skeletal muscle proteins using eight proteases (thermolysin, proteinase K, pronase E, ficin, papain, trypsin, -thermolysin, papain) and found that among the various digests of porcine muscle proteins, thermolysin digest showed the most potent inhibitory activity. Two ACE inhibitory activity peptides (Met-Asn-Pro-ProLys and Ile-Thr-Thr-Asn-Pro), were purified from thermolysin digest of myosin. These peptides showed antihypertensive activity when administered orally to SHR (Nakashima et al., 2002). Fujita et al. (2000) isolated ACE inhibitory peptides ( Leu- Lys-Ala-Leu-Lys- Pro, Leu-Ala-Pro, Phe-Gln-Lys-Pro-Lys-Arg, Ile-Val-Gly-Arg-Arg-Arg-His-Gln-Gly, Phe-LysGly-Arg-Tyr-Tyr-Pro, Ile-Lys-Trp) generated from chicken muscle proteins by thermolysin treatment. Both carnosine (-alanyl-L-histidine) and anserine (N--alanyl-1-methyl-L-histidine) are endogenous antioxidative dipeptides found in skeletal muscle (Lynch and Keroy, 2000). They
283
are known to be the most abundant antioxidants in meats. These peptides have been reported to play many physiological roles, such as prevention of diseases related to oxidative stress (Hipkiss and Brownson, 2000). Arihara et al (2005) studied anti-oxidative activities of enzymatic hydrolysates of porcine skeletal muscle actomyocin using hypoxanthine-xanthine oxidase system as the source of superoxide anion. Three ani-oxidative peptides were isolated from a papain hydrolysate of pork actomycin which showed sequences of Asp-Leu-Tyr-Ala, Ser-Leu-Tyr-Ala and Val-Trp. In addition to antioxidative activity in vitro, these peptides showed physiological activity in vivo.
FUNCTIONALITY OF BIOACTIVE PEPTIDES

In recent years, food proteins have gained increasing value due to the rapidly expanding knowledge about physiologically active peptides. There is now a substantial amount of published data to demonstrate that a wide range of milk peptides can regulate specific physiological functions.
REGULATION OF THE GASTRO-INTESTINAL SYSTEM

Food-derived proteins and peptides may play important functions in the intestinal tract before hydrolysis to amino acids and subsequent absorption.
Antimicrobial Peptides
Since the identification of the first antibacterial protein family, thionins, during the early 1970s, over 700 antimicrobial proteins and peptides have been identified in plants and animals (Zasloff, 2002). The wide spread distribution of potent, broad-spectrum antimicrobial peptides in multicellular organisms suggests that they could be used to prevent attack from a range of microbes, including bacteria, fungi, viruses and protozoa. An increased expression of antimicrobial peptides in an organism could enhance its innate immunity and increase its resistance against micro-organisms and diseases in the natural environment. Antimicrobial peptides have been identified from many milk protein hydrolysates. Lactoferricins derived from bovine lactoferrin and those from s1-casein and s2-casein has been shown to exhibit antimicrobial activity against various Gram-positive and Gramnegative bacteria, eg. Escherichia, Helicobacter, Listeria, Salmonella and Staphylococcus, yeasts and fungi (Korhonen and Pihlanato, 2006). Lactoferricins seems to disrupt the normal permeability of the bacterial cell wall. These peptides may find interesting applications in the field of food safety and as pharmaceuticals. Several families of antimicrobial peptides have been identified in plants. Ranging in size from 2 to 9 KDa, all plant antimicrobials peptides are globular, compact and cysteine-rich peptides. Compared with terrestrial sources, relatively few antimicrobial peptides have been identified with a marine origin. Only a few antimicrobial peptides have been described from marine organisms. Hen egg white lysozyme is probably the most widely used preservative agent from a food source. Its been said that
284
chicken lysozyme contains peptide sequences that can induce non-catalytic bacterial death differing from enzymatic lysis of cell membrane and the antimicrobial action of lysozyme is due to structural factors (Ibrahim et al., 2001). Bacteriocins are peptides produced by bacteria that display antimicrobial properties against other bacteria. Nisin is probably the best known bacteriocin. In the membrane interaction mechanism of the antibacterial activity, the cationic peptides initially interact with the surface lipopolysaccharides, competitively displaying the divalent cations that connects and partly neutralise the lipo-polysaccharides. The result is disruption of the outer membrane (Ulvatne et al., 2001). The initial interaction of cationic antimicrobial peptides with the cytoplasmic membrane involves the insertion of the peptides parallel to the membrane surface into the interface between the phospholipid head groups and fatty acid chains of the outer monolayer of this membrane. Consequently, the membrane can be rendered permeable through the formation of transmembrane pores, causing cell lysis and leading cell death (Zasloff, 2002). In addition to disrupting cell membrane, antimicrobial peptides may also exhibit their activity against multiple potential targets such as cell division, DNA, ribonucleic acid (RNA) for protein synthesis, and autolysis activation (Cudic and Otvos, 2002). It has been shown that antimicrobial peptides could act as signalling molecules to increase the chemotaxis of neutrophils and T helper cells resulting in the recruitment of leukocytes to infection sites, hence promoting nonopsonic phagocytosis at those infection sites (Yang et al., 2001).
Peptides for Appetite Control and Prebiotic Effects

Casein macro peptides (CMP) has been reported to inhibit gastric secretions and reduce peristalsis, particularly, stomach contractions. It is also been proposed that CMP stimulates the release of cholecystokinin (CKK), the satiety hormone involved in controlling food intake and digestion in the intestines of human and animals (Yvon et al., 1994). CMP can trigger stimuli from intestinal receptors without being absorbed (Fosset et al., 2002) or it is absorbed intact and partially digested into blood circulation of adult humans after milk or yoghurt ingestion (Chabance et al., 1998). Based on the above studies, commercial products containing GMP have been launched on the market for purpose of appetite control and weight management. It is also reported that the glycosylated form of CMP may have a beneficial role in modulating the microflora, as this macro peptide is known to promote the growth of bifidobacteria due to its carbohydrate (mainly sialic acid) content (Manso & Lopez, 2004).
Regulation of the Cardiovascular System

Angiotensin-I-converting enzyme (ACE) is a key enzyme in the regulation of peripheral blood pressure and has been associated with renin-angiotensin system. Inhibition of this enzyme can exert an anti-hypertensive effect. Many food-derived peptides are known to have an inhibitory effect on ACE. A great number of ACE-inhibitory peptides have been isolated from the enzymatic digest of various milk proteins and they are currently, the most researched group of bioactive peptides. The potency of an ACE- inhibitory peptide is usually expressed
285
as IC50 value, which is equivalent to the concentration of peptide mediating a 50% inhibition of activity. To exert an antihypertensive effect after oral ingestion, active peptides must be absorbed in an intact form from the intestine and further be resistant to degradation by plasma peptidases in order to reach the target sites. It is also known that proline containing peptides are generally resistant to degradation by digestive enzymes. Masuda et al (1996) reported two ACE inhibitory tripeptides in the abdominal aorta of SHR after oral administration of sour milk containing these tripeptides. Studies, however, has shown that not all potent peptide inhibitors of ACE in vitro, may necessarily be antihypertensive in vivo. For example, Walsch et al (2004) indicated that a tryptic peptide Ala-Leu-Pro-Met-His-Ile-Arg, a known potent inhibitor of ACE activity in vitro was not adequately stable to the gastrointestinal proteinases as well as serum proteinases and peptidases to have a hypotensive effect in humans following oral ingestion. Blood pressure (BP) is controlled by a number of different biochemical pathways within the body and can be increased or decreased depending on which pathways predominate. One of the main biochemical pathway involved in BP response is renin-angiotensin system. In the renin-angiotensin system, ACE plays an important role in the regulation of blood pressure. ACE is required for converting the inactive decapeptide angiotensin I, by cleaving a dipeptide from the C-terminus, into the potent vaso-constricting octapeptide angiotensin II, resulting in increases in blood pressure and production of aldosterone. Also, ACE inactivates the antihypertensive vasodilator bradykinin, which is a nonapeptide in the Kallikrein-Kinin system. Thus inhibition of ACE results in an antihypertensive effect. High blood pressure (Hypertension) has been widely acknowledged as a major factor for coronary heart diseases. Antithrombotic peptides has amino acid sequences which inhibit the aggregation of blood platelets and the binding of the humans fibrinogen -chain to platelet surface fibrinogen receptors have been identified in CMP, which is split from -casein of the casein micelle during milk coagulation with enzyme rennet during cheese making (Fiat et al., 1993). The dodecapeptide of human fibrinogen and the undecapeptide (Met-Ala-Ile-Pro-Pro-Lys-LysAsn-Gln-Asp-Lys) of bovine -casein are both structurally and functionally similar. This casein derived undecapeptide (casoplatelin) inhibited ADP-induced platelet aggregation and combined with the fibrinogen receptor of blood platelets (Jolles et al., 1986). Consumption of fruit and vegetables and high fibre foods is said to neutralise and reduce free-radical formation and their damage in human tissues (Lindsay, 2003). This beneficial action of food is attributed to the anti-oxidant potency of various compounds (eg. vitamin C, E and polyphenolic compounds). The intake of such antioxidants (including consumption of red wine in moderate amounts) may decrease the risk of diseases, such as cardiovascular diseases and certain types of cancer (Hertog, 1996). Several studies have reported that antioxidative peptides can be released from food proteins. For example, milk casein-derived peptide has been shown to have free radical scavenging activity to inhibit enzymatic and non enzymatic lipid oxidation (Suetsuna, et al., 2000). Both carnosine and anserine are endogenous antioxidative dipeptides in skeletal muscle (Lynch and Kerry, 2000). They are known to be the most abundant antioxidant in meats. These peptides have been reported to play many physiological roles, such as prevention of diseases related to oxidative stress (Hipkiss and Brownson, 2000). Hyperlipidemia, especially hyper cholesterolemia, is one of the most important risk factors associated with heart disease, including ischemic heart disease (Martin et al., 1986).
286
Nagaoka et al (2001) identified a hypocholesterolomic peptide (Ile-Ile-Ala-Glu-Lys) from the tryptic hydrolysate of -lactoglobulin. This peptide suppressed cholesterol absorption by Caco-2 cells in vitro and elicited hypocholesterolomic activity in vivo in rats upon oral administration of the peptide preparation. It has been proposed that the degree of serumcholesterol-lowering activity depends on the degree of faecal sterid excretion. Many studies support the hypothesis that a peptide with high bile-acid-binding capacity could inhibit the reabsorption of bile acid in the ileum and decrease the blood cholesterol level (Iwami et al., 1986).
Regulation of the Immune System

Immunomodulatory peptides can enhance immune cell functions, measured as lymphocyte proliferation, natural killer (NK) cell activity, antibody synthesis and cytokine regulation (Fitzgerald and Murray, 2006). Milk protein hydrolysates and peptides derived from caseins and major whey proteins can enhance immune cell functions, measured as lymphocyte proliferation, antibody synthesis and cytokine regulation (Gill et al., 2000). Many peptides released during milk fermentation or cheese ripening with LAB, and these peptides have been found to modulate the proliferation of human lymphocytes, to downregulate the production of certain cytokines and to stimulate the phagocyte activities of macrophages. Moreover, immunomodulatory peptides might reduce allergic reactions in atopic humans and enhance mucosal immunity in the gastrointestinal tract (Korhonen and Pihlanto, 2003).This could be one way immunomodularory peptides may regulate the development of the immune system in new born infants. The demonstrated result that whey protein isolates contain immunomodulatory peptides which can be released by enzymatic digestion are being utilised in the development of infant formulas with immunomodulatory properties. Cytomodulatory peptides derived from casein fractions inhibit cancer cell growth or stimulate the activity of immunocompetent cells and neonatal intestinal cells (Meisel & Fitzgerald, 2003). Matar et al. (2003) reported that peptides released by bacterial proteolysis might have important implications in modulation of the hosts immune response and have an impact on inhibition of tumour development. Immunomodulatory peptides derived from tryptic hydrolysis of rice and soybean proteins act to stimulate superoxide anions which trigger non-specific immune defence systems (Kitts and Weiler, 2003). Cytochemical studies have demonstrated that food source bioactive peptides modulate viability (eg. proliferation, differentiation and apoptosis) of different cell types. Some milk-derived peptides, for example, have been shown to trigger apoptosis, especially in malignant cells, whereas normal cell seem to be less susceptible. Together, the cytomodulatory and immunomodulatory properties might contribute to some degree of protection of food source peptides in tumour development (Meisel and Fitzgerald, 2003).
Other Functionalities
Dental caries is initiated via the demineralisation of dental hard tissue by organic acids from the fermentation of dietary sugar by odontopathogenic bacteria in dental plaque. In most developed countries, the use of fluorides in tooth paste and drinking water has helped to
287
decrease the presence of dental caries however the disease remains a substantial health problem. The food group most recognised as exhibiting anti-caries activity is dairy products (milk, milk powders, milk concentrates, and cheese). The casein phosphopeptides (CPP) released by trypsin that sequester calcium phosphate is responsible for the anti-cariogenic activity. CPP are 10% (w/w) of caseinates and through their multiple phosphoseryl residues, sequester their own weight in amorphous calcium phosphate to form colloidal nanocomplexes. CPP also have a marked ability to stabilise calcium phosphate in solution. Many food-derived peptides have more than one functional role, eg., peptides from the sequence 60-70 of -casein show immunostimulatory opioid and ACE inhibitory activities. Other examples of the multi functionality of milk-derived peptides include the -s1-casein fraction 194-199 immuno-modulatory and ACE- inhibitory activity, the opioid peptide - and -lactorphin also exhibiting ACE-inhibitory activity and the CPPs, which possess immunomodulatory properties (Korhonen and Pihlanto, 2003).
FOOD AND OTHER APPLICATIONS

Bioactive peptides are fundamental constituents of many traditional products or ingredients marketed as Functional Foods or Nutraceuticals. In these products the bioactive peptides are either added or enriched by modification of the usual manufacturing process (eg. by changing process parameters or starter cultures used). Examples of commercially available functional foods or food ingredients carrying bioactive peptides include Calpis (Calpis Co., Japan), Evolus (Valio, Finland) claimed to be hypotensive; BioPURE-GMP (Danisco, USA) claimed to be anticariogenic, antimicrobial and antithrombotic; Cholest Block (Kyowa Hakko, Japan) claimed to be hypo-cholesterolemic; Capolac (Arla Foods, Denmark) claimed to help mineral absorption and Glutamin peptide (DMV, Netherlands) claimed to be immunomodulatory. Non-food applications include Trident (chewing gum containing food ingredient Recaldent , Cadbury Schweppes, Australia) claimed to prevent against the demineralisation of tooth enamel. Several commercial dairy products containing highly proteolytic strains of L. helveticus have been developed and marketed as possessing hypotensive activity, and this include Calpis and Evolus. Calpis sour milk is prepared by fermenting milk using mixed culture containing L. helveticus CM4 (CP 790) and S. cerevisiae. These organisms are responsible for release of a range of potent bioactive peptides (Shah, 2007). In addition a number of food protein derived hypotensive products/ ingredients are either in development or are introduced into the market. These include peptides from hydrolysis of milk casein by trypsin, extract of autologus L. casei (YIT 9018) cell lysate, sardine muscles hydrolysed by alkaline protease from Bacillus licheniformis, dried blue fish / bonito (katsuobushi) hydrolysed by thermolysin, whey protein hydrolysate (Bio Zate and sour milk fermented with L. helveticus (LBK-16H strains), all of these are reported to have BP reduction / Meisel et al., 2006). However, the growth in the use of these and related products will depend on the availability of vigorous scientific data demonstrating their efficiency and food safety for human consumption. Many antimicrobial peptides that demonstrated strong in vitro antimicrobial activity, the in vivo effectiveness of antimicrobial peptides as preservative in food systems is often low because of the interaction with minerals, proteins, and other substances that are naturally
288
present in foods. Hence new techniques to maximise the potential of antimicrobial peptides are needed in the application to food systems. For example, incorporation of nisin into the edible packagings was reported to be an effective way to inhibit the growth of meat-spoiling organisms and pathogens on meat surfaces (Padget et al., 1998). The ameliorative action of soybean protein and soy peptides on cholesterol metabolism has been widely reported. Soybean phospholipids when combined with soy peptides have shown to provide a significant cholesterol-lowering effect (Sugano et al., 1990) Recently probiotic meat products containing human intestinal lactic acid bacteria are marketed (Arihara, 2004). A commercial product known as Breadon is a new range of meat spread fermented with probiotic bacteria L. rhamnosus FERM P- 15120 (Sameshima et al., 1998). Meat proteins are partially hydrolysed by proteins prior to fermentation, this product contains relatively high levels of peptides. Incorporation of bioactive peptides as ingredients or preservatives needs evaluation whether sensory properties of the product are altered. Most of the peptide ingredients or products incorporated with peptides do not seem to affect the organoleptic or sensory properties. For example, Nattress and Baker (2003) evaluated the effects of antimicrobial treatments on the sensory properties of fresh pork loins and reported that the pork loins stored in vacuum was not affected by antimicrobial peptide treatment. However, the antimicrobial peptide treatment did have an impact on off-odour intensity and odour acceptability when the loin chops were transferred to an aerobic retail display case. This defect in sensory attributes could, however, depend on the population of lactic acid bacteria and Enterobacteriacea during transfer from an anoxic environment to an aerobic one to evaluate the total impact of the organoleptic properties of products treated with antimicrobial peptides. Food-derived bioactive peptides also have enormous potential as ingredients of pharmaceuticals, for example, blood pressure controlling capsules contain oligopeptides extracted from bonito (katsuobushi). Digestive enzymes such as Vasotensin 120 T marketed by Metagenics, USA converts inactive peptides to bioactive forms.
FUTURE TRENDS AND ISSUES

While research will continue to uncover new bioactive peptides derived from proteins and to evaluate their structure, functions, efficacy and health benefits, there will also be a growing commercial interest in developing and marketing bioactive peptides incorporated functional foods and nutraceuticals. There is an increasing tendency, where, the interphase between food and medical drugs is narrowing, particularly in the context of the new generation functional foods, nutra-and pharmaceuticals. Consumers are increasingly treating food as drugs for curative action on certain life style diseases. This dinner or drugs concept is also growing in many industrialised world as people are embracing a busy life style and a significant population is aging. In future the trend may be that both food and pharmaceutical industries will work together to develop novel functional food or drugs and this will further narrow the interphase between food and medicine. Numerous products are already on the market or under development by food companies, exploiting the potential of food-derived bioactive peptides. The commercial development is likely to continue alongside with the increasing knowledge about the structure, functionality,
289
safety, and efficacy of the peptides. The optimal exploitation of bioactive peptides for human health poses a challenge in science and technology, while at the same time, offering potential for commercially successful applications. In future, a number of bioactive peptides from plant, animal and microbial source will be incorporated in the form of ingredients in functional and novel foods, dietary supplements and pharma-and nutraceuticals with specific or designed therapeutic benefits. Many such dietary formulations and ingredients are being developed tailor made world wide commercially. In the future bioactive peptides will offer an excellent basis for the novel concept of personalised nutrition, and the growing market for nutrition. The systematic isolation, characterisation and evaluation of biological efficiency and synthesis of peptides have an important role in finding new bioactive structures and for elucidating structural information on the active conformations. Many scientific, technological and regulatory issues must, however be resolved before these substances can be optimally assessed and marketed for use. These include development of novel technologies such as ion exchange chromatographic and membrane separation techniques, to enrich active peptide fractions from the hydrolysates of various proteins. Innovative microbial fermentation technology will provide a natural technology application for the production of bioactive peptides from animal, fish or plant proteins. The potential of this approach is already well demonstrated by the presence of bioactive peptides in fermented dairy products. Production of bioactive peptides from protein-rich raw materials may be scaled up to industrial level using controlled fermentation in bioreactors with known LAB. In the future, commercial production of peptides with specific sequences is likely to employ recombined enzyme technology and selected strains or alternatively makes use of peptidases isolated from suitable micro-organisms. It is important to study the technological properties of active peptide and to develop model foods that contain these peptides and retain their activity for a guaranteed period. Structure-activity studies using chemometric methods are effective and useful for identifying bioactive substances. The application of computational chemistry will result in the creation of structure and sequence data bases that will enable bioactive fragments to be related to the protein chains (Dziuba and Iwaniak, 2006). A number of products are already marketed by food or pharmaceutical companies, exploiting the potential of food-derived bioactive peptides. An important requirement for the production of functional foods containing bioactive peptides is to enhance their bioavailability from dairy products or to create novel foods through the addition/ fortification of isolated or enriched fractions of bioactive peptides. The production of bioactive peptides during food processing, for example, by the use of specific bacterial enzymes or genetically transformed micro-organisms for over production of enzymes will be further research trends. In addition, genetically modified proteins will be designed to carry multiple copies of bioactive sequences (Prak et al., 2006). The trend will also be to evaluate the possible involvement of cytomodulatory peptides in tumour development. Peptides due to their lower molecular weight can be more reactive than whole proteins, and hence these peptides present in the food matrix may react with other food components. The interaction of peptides with carbohydrates and lipids, as well as the effect of processing conditions on peptide activity and bioavailability, should be studied well in the future. When assessing peptides that could provide beneficial effects, one must also take into account the possible adverse effects that may be exerted by peptides or their by-products that
290
are present in the food products. In this respect, the possible formation of toxic, allergenic or cariogenic substances warrants intensive research. As more and more peptide-based products are developed, more human clinical trails should be conducted to obtain consistent evidence for the health claims. In this context, screening methods should be developed for the measurement of long term effects in order to ascertain effects of food components that are claimed to promote good health. For example, although many antimicrobial peptides exhibit effects against microbes under in vitro conditions, only a few have demonstrated promising protective effects to the host under in vivo environments (Chan and Chan, 2006). Innovative strategies are therefore needed to identify new peptides and design antimicrobial peptides with enhanced stability in the host in order to maximise their potential in agriculture, in food systems and in medical applications. Relevant indicators or biomarkers that can predict potential benefits relating to a target function in the body needs to be identified. These biomarkers, however, must be representative of the effect brought about by the bioactive food components. To study further the impact of proteins and peptides on the expression of genes and hence optimise the nutritional and health effects, advanced molecular studies need to be conducted to assess the mechanisms by which peptides exert their activities. Proteomics and associated technologies will assume greater importance in future. The majority of the known bioactive peptides are not absorbed from the gastrointestinal tract into the blood circulation and their effect is, therefore, probably mediated directly in the gut lumen or through receptors on the intestinal cell wall. In this respect, the target function of the concerned peptide is of utmost priority (Korhonen and Pihlanto, 2006). Targets may range from cardiovascular diseases, cancer, diabetes, osteoporosis, stress and obesity as well as interactions between these lifestyle diseases. Generation of bioactive peptides in meat products is a possible direction for introducing physiological function, especially suitable for fermented meat products. An attractive approach for developing functional meat products is to develop bioactive probiotic meat products. New range of meat products fermented with strong proteolytic bacteria (eg. L. rhamnosus FERMP-15120, Sameshima et al., 1995), could release high levels of peptides. Although further studies of the relationship between ingestion of such products and human health are required, combination of probiotics and peptides would have a great possibility to develop a new generation of bioactive and functional meat products. In all the future developments of functional foods, nutraceuticals and pharmaceuticals, incorporating bioactive peptides, legislation will play an important role. For example in many countries food legislation always slower to achieve compared to the rate of commercial development of these products. Japan, however, is quick to adopt a legal system in relation to allowable health claims on functional foods through the introduction of the FOSHU (Foods for Specific Health Use) licensing system in 1991. In the future, food authorities in the industrialised countries should be more proactive and develop and implement appropriate standards and legislations that will help the timely evidence-based commercialisation of the new generation of functional foods.
291
REFERENCES
Abubaker, A., Saito, T., Kitazawa, H., Kawai, Y. & Itoh, T. (1998). Structural analysis of new ani-hypertensive peptides derived from cheese whey protein by proteinase K digestion. J. Dairy Sci., 81, 3131-3138. Adler-Nissen, J. (1986) Enzymatic Hydrolysis of Food Proteins, Elsevier Applied Sci., Pub., London. Arihara, K. (2004). Functional foods. In: Encyclopaedia of meat sciences. Eds. W.K. Jensen, C. Devine, and M. Dikeman, 492-499, Oxford, UK. Elsevier. Arihara, K., Nakashima, T., Mukai, S., Ishikawa, & Itoh, M. (2001). Peptide inhibitors for angiostensin I-converting enzyme from enzymatic hydrolysates of porcine skeletal muscle proteins. Meat Science, 67, 434-437. Arihara, K., Tomita, K., Ishikawa, S., Itoh, M., Akimoto, M. & Sameshima, T. (2005). Antifatigue peptides derived from meat proteins. Japanese Patent (submitted). Chabance, B., Marteau, P., Rambaud, J.C., Migliore-Samour, D., Boynard, M., Perrotin P et al., (1998). Casein peptide release and passage to the blood in humans during digestion of milk or yoghurt. Biochimie, 80, 155-165. Chan, J.C.K . & Li-Chan, E.C.Y. (2006). Antimicrobial peptides. In: Nutraceutical Proteins and Peptides in Health and Disease. Y. Mine and F. Shahidi, Eds. Taylor & Francis Group, New York. Chiang, W.D., Tsou, M.J., Tsai, Z.Y. & Tsai, T.C. (2006). Angiotensin I-converting enzyme inhibitor derived from soy protein hydrolysate and produced by using membrane reactor. Food Chemistry, 98, 725-732. Cross, K.J., Hug, N.L., Palamara, J.E., Perich, J.W. & Reynolds, E.C. (2005). Physicochemical characterisation of casein phosphopeptide-amorphous calcium phosphates nano-complexes. J. Biol. Chem., 280, 15362-15369. Cudic, M. & Otvos L.J. (2002). Intracellular targets of antibacterial peptides. Curr. Drug Targets., 3, 101-106. Dillard, C.J., & German, J.B. (2000). Phytochemicals: nutraceuticals and human health. J. sci. Food Agric. 80, 1744-1756. Doko, M.B., Bassani, V., Casadebaig, J., Cavailles, L. & Jacob. M. (1991). Preparation of proteolytic enzyme extracts from Ananas Cosmos L., Merr. fruit juice using semipermeable membrane, ammonium sulfate extraction, centrifugation and freezedrying processes. Int. J. Pharmaceutics, 76(3), 199-206. Donkor, O.N., Henriksson, A., Vasiljevic, T., & Shah, N.P. (2005). Probiotic strains as starter cultures improve angiostensin-converting enzyme inhibitory activity in soy yoghurt. J. Food Sci., 70, 375-381. Donkor, O.N., Henriksson, A., Vasiljevic., Shah, N.P (2007). -galactosidase and proteolytic activities of selected probiotic and dairy cultures in fermented soy milk. Food Chemistry, 104, 10-20. Dziuba, J. & Iwaniak, A (2006). Database of protein and bioactive peptide sequences. In: Nutraceutical Protein and Peptides in Health and Disease. Eds. Mine, V. and Shahidi, F. Taylor & Francis, 543-563.
292
Erba, D., Ciappellano, S. & Tetolin, G. (2002). Effect of the ratio of casein phosphopeptides to calcium (w/w) on passive calcium transport in the distal small intestine of rats. Nutrition, 18, 743-746. FAO (1994). FAO Yearbook Production. Rome. Italy, FAO. Fiat, A-M., Migliore-Samour, D., Jolles, P., Drouet. L.,Collier, C., & Caen, J. (1993). Biologically active peptides from milk proteins with emphasis on two examples concerning antithrombotic and immunomoduatory activities. J. Dairy Sci., 301-310. Fitzgerald, R.J., Murray, B.A., & Walsh, D.J. (2004). Hypotensive peptides from milk proteins. Journal of Nutrition, 134, 980S-988S. Fitzgerald, R.J. & Murray, B.A. (2006). Bioactive peptides and lactic fermentations. Int. J. Dairy Technol., 59, 118-125. Fosset, S., Fromentin, G., Gietzen, D.W., Dubarry, M, Huneau, J.F., Antoine, J.M. et al., (2002). Peptide fragments released from Phe-caseinomacropeptides in vivo in the rat. Peptides, 23, 1773-1781. Fujita, H & Yoshikawa, M. (1999). LKPNM: a prodrug type ACE-inhibitory peptide derived from fish protein. Immunopharmacology, 44(1-2), 123 -127. Fujita, H., Yokoyama, K. & Yoshikawa, M. (2000). Classification and antihypertensive activity of angiotensin I-converting enzyme inhibiting activity peptides derived from food proteins. J. Food Sci., 65, 564-569. Gerdes, S.K., Harper, W.J. & Miller, G. (2001). Bioactive components and cardiovascular health. Applications Monograph US Dairy Export Council. Gill, H.S., Doull, F., Rutherfurd, K.J. & Cross M.L. (2000). Immunoregulatory peptides in bovine milk. Br. J. Nutr. 84 (Suppl. 1), S111-S117. Gobbetti, M., Ferranti, P., Smacchi, E., Goffredi, F and Addeo, F. (2000). Production of Angiostensin I-converting enzyme inhibitory peptides in fermented milks started by Lactobacillus delbrueckii subsp bulgaricus SS1 and Lactobacillus lactic ssp cremoris FT4. App. Environ Microbiol. 66, 3898-3904. Hartmann, R. & Meisel, H. (2007). Food-derived peptides with biological activity: from research to food applications. Curr. Opinion in Biotechnology, 18, 163-169. He, H-L., Chen, X-L., Sun, C-Y., Zhang, YZ. & Zhou, B-C. (2006). Analysis of novel angiotensin I-converting enzyme inhibitory peptides from protease hydrolysed marine shrimp (Acetes chinensis). J. Peptide Sci., 12(11), 726-733. Hertog, M.G.L. (1996). Epidemiological evidence on potential health properties of flavonoids. Proc. Nutr. Soc., 55, 385-387. Hipkiss, A.R. & Brownson, C.A. (2000). A possible new role for the anti-aging peptide carnoine. Cell. Mol. Life Sci., 57, 747-753. Ibrahim, H.R., Matsusaki, T. & Aoki, T. (2001). Genetic evidence that antibacterial activity of lysozyme is independent of its catalytic function. FEBS Lett., 506, 27-32. Iwami, K., Sakakibara, F., & Ibuki, F. (1986). Involvement of post-digestion hydrophobic peptides in plasma cholesterol-lowering effect of dietary plant proteins. Agric. Biol. Chem., 50, 1217-1222. Je, J-Y., Park, P-J., Kwon, J.Y. & Kim, S-K. (2004). A novel angiotensin I-converting enzyme inhibitory activity peptide from Alaska Pollack (Therageic chaleogramma) frame protein hydrolysate, J. Agric. Food Chem., 52, 7842-7845.
293
Je, J-Y., Park, J-Y., Jung, W-K., Park, P-J & Kim, S-K. (2005). Isolation of angiotensin Iconverting enzyme (ACE) inhibitor from fermented oyster sauce, Crassostrea gigas. Food Chemistry, 90(4), 809-814. Jolles, P., Levy-Toledano, S., Fiat, A.M., Soria, C., Gillessen, D., Thomaids, A., Dunn, F.W. & Caen, J.B. (1986). Analogy between fibrinogen and casein. Eur. J. Biochem. 158, 379389. Jung, W.K., Mendis, E., Je, J.Y., Park, P.J., Son, B.W., Kim, H.C., Choi, Y.K., & Kim, S.K. (2006). Angiotensin I-converting enzyme inhibitory peptide from yellow fin sole 9Limanda aspera) frame protein and its antihypertensive effect in spontaneously hypertensive rats. Food Chemistry, 94(1), 26-32. Kamath, V., Niketh, S., Chandrasehekar, A. & Ranjini, P.S. (2007). Chymotrpytic hydrolysate of -kafirin, the storage protein of sorghum (Sorghum bicolor) exhibited angiotensin converting enzyme inhibitor activity. Food Chemistry, 100, 306-311. Kato, T.T., Matsuda, T., Tahara, M., Sugimoto, Y., Sato & Nakamura, R. (1994). Effects of meat conditioning and lactic fermentation on pork muscle protein degradation. Biosci., Biotech., Biochem.,58, 408-410. Kawasaki, T., Itoh, K. Ogaki, T., Yoshimizu, Y., Ghimire, P.K., Regmi, P., Acharya, G.P. (1995). A study on the genesis of hypertension in mountain people habitually taking Tibetan tea and buckwheat in Nepal. J. Health Sci. (In Japanese) 17, 121-130. Kitts, D.D., & Weiler, K. (2003). Bioactive proteins and peptides from food sources. Applications of bioprocesses used in isolation and recovery. Current Pharmaceutical Design, 9, 1309-1323. Kodera, T. & Nio, N. (2006). Identification of an Angiotensin I-converting enzyme inhibiting peptide from protein hydrolysates by a soybean protease and antihypertensive effects of hydrolysates in spontaneously hypertensive model rats. J. Food Sci., 71, C164-C173. Koohmaraie, M. (1994). Muscle proteinases and meat aging. Meat Science., 36, 93-104. Korhonen, H. & Pihlanto, A. (2003 a). Food-derived bioactive peptides opportunities for designing future foods. Current Phamaceutical Design., 9, 1297-1308. Korhonen, H. & Pihlanto, A. (2003b). Bioactive peptides; new challenges and opportunities for the dairy industry. The Aust. J. Dairy Technol., 58(2), 129-134. Korhonen, H. & Pihlanto, A. (2006). Review: Bioactive peptides: Production and functionality. Int. Dairy J., 16, 945-960. Kristinsson, H.G. (2006). The production, properties and utilization of fish protein hydrolysates. In: Food Biotechnology, K. Shetty, G. Paliyath, A. Pometto, and R.E. Levin, Eds. Taylor & Francis Group, LLC., NY. Kuba, M., Tanna, C., Tawata, S., and Yasudo, M. (2005). Production of angiotensin Iconverting enzyme inhibitory peptides from soybean protein with Monascus purpureus acid proteinases. Process Biochemistry, 40, 2192-2196. Lee, J-E., Bae, I.Y., Lee, H.G. & Yang, C-B. (2006). Tyr-Pro-Lys, an angiotensin Iconvreting enzyme inhibitory peptide derived from broccoli (Brassica oleraceae italica), Food Chemistry, 99, 143-148. Li, C-H., Matsui, T., Matsumoto, K., Yamasaki, R., Kawasaki, T. (2002). Latent production of Angiotensin I-converting enzyme inhibitors from buckwheat protein. J. Peptide Sci., 8, 267-274. Lindsay, D.G. (2000). Maximising the functional benefits of plant foods. In: Functional foods: Eds. G.R. Gibson and C.M. Williams. 183-208. Boca Raton, FL: CRC Press.
294
Lynch, P.B. & Kerry, J. P. (2000). Utilizing diet to incorporate bioactive compounds and improve the nutritional quality of muscle foods In: Antioxidants in muscle foods. Eds. E. Decka, C., Faust,an, and C.J. Lopez-Bote, 455-480, New York: Wiley. Ma, M-S., B, I.Y., Lee, H.G., & Yang, C-B. (2006). Purification and identification of Angiotensin I-converting enzyme inhibitory peptide from buckwheat (Fagopyrum esculentum moench). Food Chemistry, 96, 36-42. Manso, M.A. & Lopez-Fandino, R. (2004). Kappa-casein macro peptides from cheese whey: Physicochemical, biological, nutritional, and technological features for possible uses. Food Reviews Int., 20 329-355. Martin, M.J. Hully, S.B., Browner, W.S., Kuller, L.H., & Wentworth, D. (1986). Serum cholesterol, blood pressure, and mortality: implications from a cohort of 361,662 men. Lancet, 2, 933-936. Martin-Orue, C., Henry, G. & Bouhallab, S. (1999). Tryptic hydrolysis of kappa-caseinomacro peptide: Control of the enzymatic reaction in a continuous membrane reactor. Enzyme Microbiology and Technology, 24, 173-180. Matar. C., Amoit, J., Savoie, L., & Goulet, J. (1996). The effect of milk fermentation by Lactobacillus helveticus on the release of peptides during invitro digestion. J. Dairy Sci., 79, 971-979. Matar, C., LeBlanc, J.G., Martin, L., Perdigon, G. (2003). Biologically active peptides released in fermented milk: Role and functions. In: E.R. Farnworth (Ed.). Handbook of Fermented Functional Foods. Functional Foods and Nutraceuticals Series., pp. 177-201. Florida, USA, CRC Press. Masuda, O., Nakamura, Y. & Takano, T. (1996). Antihypertensive peptides are present in aorta after oral administration of sour milk containing these peptides to spontaneously hypertensive rats. J. Nutr., 126, 3063-3068. Matsui, T., Matsufuji, H., Seki., Osajima, K., Nakashima, M and Osajima, Y. (1993). Inhibition of Angiotensin I-converting enzyme by Bacillus licheniformis alkaline protease derived from sardine muscle. Bioscience, Biotechnology and Biochemistry, 57(6), 922-925. Meisel, H. (1986). Chemical characterisation and opioid activity of an exorphin isolated from in vivo digests of casein. FEBS Letters, 196(2): 223-227 Meisel, H. (2001). Bioactive peptide from milk proteins: A perspective for consumers and producers. Aust. J. Dairy Technology, 56, 83-92. Meisel, H. & Fitzgerald, R.J. (2003). Bio-functional peptides from milk proteins : Mineral binding and cytomodulatory effects. Current Pharmaceutical Design, 9, 1289-1295. Meisel, H., Goepfert, A. & Gunther, S. (1997). ACE-inhibitory milk products. Milchwissenschaft, 52, 307-311. Meisel, H., Bernard, H., Fairweather-Trait, S., Fitzgerald, R.J., Hartmann, R., Lane, C.N., McDonagh, D., Teucher, D., & Wal, J.M. (2003). Detection of caseinomorphosphopeptides in the distal ileostomy fluid of human subjects. Br. J. nutr., 89, 351-358. Meisel, H., Walsh, D.J., Murray, B. and Fitzgerald, R.J. (2006). ACE inhibitory activity peptides. In: Nutraceutical Proteins and Peptides in Health and Diseases. Y. Mine and F. Shahidi, Eds. Taylor & Francis Group, New York.
295
Muehlenkamp, M.R. & Warthesen, J.I. (1996). Beta-casomorphins: Analysis in cheese and susceptibility to proteolytic enzymes from Lactococcus lactis ssp cremoris. J. Dairy Sci., 79, 20-26. Mullally, M.M., Meisel, H., & Fitzgerald, R.J.(1997). Identification of a novel angiotensin Iconverting enzyme inhibitory activity peptide corresponding to a tryptic fragment bovine (beta)-lactoglobulin. FEBS Letters, 402(2-3), 99-101. Nagai, T & Nagashima, T. (2006). Antioxidative activities and angiotensin I-converting enzyme inhibition of extracts prepared from chum salmon (Oncorhynchus Keta) cartilage and skin. Int. J. Food Properties, 9, 813-822. Nagaoka, S., Futamura, K., Miwa, T., Awano, K. Yamudi, Y., Kanamura, T. Kojima, & Kuwata, T. (2001). Identification of novel hypocholesterolomic peptides derived from bovine milk -lactoglobulin. Biophy. Res. Common., 281, 11-17. Nakamura, Y., Yamamoto, N., Sakai, K., Okubo, A., Yamazaki, S., & Takano, T. (1995a). Purification and characterisation of angiotensin I-converting enzyme inhibitors from sour milk. J. Dairy Sci., 78, 777-783. Nakamura, Y., Yamamoto, N., Sakai, K., & Takano, T. (1995b). Antihypertensive effect of sour milk and peptides isolated from it that are inhibitors to angiotensin I-converting enzyme. J. Dairy Sci., 78, 1253-1257. Nakashima, Y.K., Arihara, A., Sasaki, S., Ishikawa, S., & Itoh, M (2002). Antihypertensive activities of peptides derived from porcine skeletal myosin in spontaneously hypertensive rats. J. Food Sci., 67, 434-437. Nattress, F.M., & Baker, L.P. (2003). Effects of treatment with lysozyme and nicin on the microflora and sensory properties of commercial pork. Int. J. Food Microbiol., 85, 259267. Okamoto, A. et al. (1995). Angiotensin I-converting enzyme inhibitory activity of various fermented foods. Bioscience Biotechnology and Biochemistry, 59, 1147-1149. Padgett, T., Han, I.Y., & Dawson, P.L. (1998). Incorporation of food-grade antimicrobial compounds into biodegradable packaging films. J. Food Protection., 61, 1330-1335. Pan, D., Luo, Y. & Tanokura, M. (2005). Antihypertensive peptide from skimmed milk hydrolysate designed by cell- free extract of Lactobacillus helveticus JCM 1004. Food Chemistry, 91, 123-129. Playne, M.J., Bennet, L.E., & Smithers, G.W. (2003). Functional dairy foods and ingredients. The Australian J Dairy Technol., 58(3), 242-264. Prak, K., Maruyama, Y., Maruyama, N., Utsumi, S (2006). Design of genetically modified soybean proglycin A1a B1b with multiple copies of bioactive peptide sequences. Peptides, 27, 1179-1186. Rokka, T., Syvaoja, E.L. Tuominen, J. & Kohonen, H. (1997). Release of bioactive peptides by enzymatic proteolysis of Lactobacillus GG fermented UHT-milk. Milchwissenschaft, 52, 675-678. Sabikhi, L., Mathur, B.N. (2001). Qualitative and quantitative analyisis of -casomprphins in Edam cheese. Milchwissenschaft, 56, 198-200. Sameshima, T., Magome, C., Takeshita, K. Arihara, K., Itoh, M. & Kondo, Y. (1998). Effect of intestinal Lactobacillus starter cultures on the behaviour of Staphylococcus aureus in fermented sausage. Int. J. Food Microbiol., 41, 1-7. Sato, M., Hosokawa, T., Yamaguchi, T., Nakano, T., Muramoto, K., Kahara, T., Funayama, K., Kobayashi, A. & Nakano, T. (2002). Angiotensin I-converting enzyme inhibitory
296
peptides derived for wakame (Undaria pinnatifida) and their anti-hypertensive effect in spontaneously hypertensive rats. J Agric Food Chem., 50, 6245-6252. Schlimme, E., and Meisel, H. (1995). Bioactive peptides derived from milk proteins: Structural, physiological and analytical aspects. Food / Nahrung, 39(1), 1-20. Shah, N.P. (2007). Review: Functional cultures and health benefits. International Dairy J., 17, 1262-1277. Sugano, M., Goto, S., Yamada, Y., Yoshida, K., Hashimoto, Y., Matsuo, T., Kimoto, M. (1990).Cholesterol-lowering activity of various undigested fractions of soybean protein in rats. J. Nutr., 120, 977-985. Suh, H.J., Whang, J.H., Kim,Y.S., Bae, S.H. & Noh, D.O. (2203). Preparation of angiotensin I-converting enzyme inhibitor from corn gluten. Process Biotechnology, 38, 1239-1244. Suetsuna, K., & Nakano, T. (2000). Identification of antihypertensive peptide from peptic digest of wakame (Undaria pinnatifida). J. Nutr. Biochem. 11, 450-454. Theodore, A.E.T. & Kristinsson, H.G. (2007). Angiotensin converting enzyme inhibition of fish protein hydrolysates prepared from alkaline aided channel catfish protein isolate. J. Sci. Food Agric., 87, 2353-2357. Turgeon, S.L. & Gauthier, S.F. (1990). Whey peptide fractions obtained with a 2-step ultrafiltration process: Production and Characterisation. J. Food Sci., 55, 106-110. Ulvatne, H., Haukland, ., Olsvik, L. & Vorland, L (2001). Lactoferrin B causes depolarisation of the cytoplasmic membrane of Escherichia coli ATCC 26922 and fusion of negatively charged liposomes. FEBS Lett., 492, 62-65. Vasiljevic, T., Shah, N.P. (2007). Fermented milk health benefits beyond probiotic effect. In: Hui, Y.H. (Ed)., Nutraceutical and functional foods, Wiley, New York (In Press), Walsh, D.J., Bernard, H., Murray, B.A, Mac Donald, J., Pentzein, A.K., Wright, G.A., et al., (2004). In vitro generation and stability of the lactokinin -lactoglobulin fragment (142148). J. Dairy Sci., 87, 3845-3857. Wang, J-S., Zhano, M-M., Zhao, Q-Z., & Jiang, Y-M. (2007). Antioxidant properties of papain hydrolysates of wheat gluten in different oxidation systems. Food Chemistry, 101, 1658-1663. Whitaker, J.R. (2003). Protelytic Enzymes. In: Handbook of Food Enzymology, J.R. Whitaker, A.G.J. Voragen and D.W.S. Wong, Eds., Marcel Dekker, Inc., New York. Wu, J. & Ding, X. (2001). Hypotensive and physiological effect of angiotensin converting enzyme inhibitory peptides derived from soy protein on spontaneously hypertensive rats. J. Agric. Food Chem., 49, 501-506. Yamamoto, N., Ejiri, M. & Mizuno, S. (2003). Biogenic peptides and their potential use. Curr. Pharmaceutical Design, 9, 1345-1355 Yang, D., Chertov, O., & Oppenheim, J.J. (2001). Participation of mammalian defensins and cathelicidins in antimicrobial immunity: receptors and activities of human defensins and cathelicidin (LL-37). J. Leukocyte Biol., 69, 691-697. Yokoyama, K., Chiba, H. & Yoshikawa, M. (1992). Peptide inhibitors for Angiotensin Iconverting enzyme from thermolysin digest of dried bonito. Bioscience, biotechnology and biochemistry, 56 (10), 1541-1545. Yust, M.M., Pedroche, J., Giron-Calle, J., Alaiz, M., Millan, F., & Vioque, J. (2003). Production of ACE inhibitory peptides by digestion of chick pea legumin with alcalase . Food Chemistry, 81, 363-369.
297
Yvon, M., Beucher, S., Guilloteau, P., Le Huerou-Luron, I. & Corring, T (1994). Effect of caseinomacropeptide (CMP) on digestion regulation. Reproduction, Nutrition & Development, 34, 527-537. Zhang, J.H., Tatsumi, E., Ding, C., & Li, L. (2006). Angiotensin I- converting enzyme inhibitory peptides in douche, a Chinese traditional fermented soybean product. Food Chemistry, 98, 551-557. Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature, 415, 389-395. Zioudrou, C., Streaty, R.A., Klee, W.A. (1979). Opioid peptides derived from food proteinsexorphins J. Biol. Chem., 254, 2446-2449. Zucht, H.D., Raida, M., Ademann, K., Magert, H.J. & Forssmann, W.G. (1995). Casoicidin I: a casein (alpha) S2 derived peptide exhibits antibacterial activity. FEBS Letters, 372 (23), 185-188.
Chapter 7
RECENT TRENDS IN THE PROBIOTIC AND PREBIOTIC FUNCTIONAL FOOD PRODUCT DEVELOPMENT
Kasipathy Kailasapathy*
Probiotics and Encapsulated Functional Foods Research Unit, School of Natural Sciences, University of Western Sydney, South Penrith DC, Locked Bag 1797, NSW 1797, Australia
ABSTRACT
In the recent past functional food product development in the world food market has significantly increased. It is estimated that the functional food market world wide will reach several hundred billion dollars in the near future. Functional foods provide health benefits to humans in addition to the nutritional benefits. Of all the recent functional food products, probiotics and prebiotics incorporated food products have assumed a significant market share worldwide particularly in Europe, Asia (Japan), Australia and recently in the US. Probiotics includes beneficial bacteria that enhance gut-health by their selective action on harmful microorganism in the gut in contrast to the action of antibiotics. Continued ingestion of probiotic bacteria has been shown to improve gut-health, prevent certain modern-day life style diseases, and show immuno-stimulatory activity. Prebiotics are essentially complex carbohydrates that are resistant to human digestive enzymes and pass to colonic regions undigested and provide nutrients for the colonic commensal bacteria. Thus the probiotic approach and the prebiotic approach through development of functional foods are fundamentally different, though both contribute to overall enhancement of gut health. Recently, a combination of both approaches, ie a synbiotic (probiotic and prebiotic) approach has been promoted and a number of synbiotic products are being developed for functional food markets. This chapter will focus on the science of probiotics and prebiotics, gastrointestinal microbiota, applications in probiotic and prebiotic foods including some examples. The science aspect of the probiotics includes introducing probiotics, their health benefits,
*
Phone: + 61 2 45 701 653; Fax: + 61 2 45 701 954; Email: k.kailasapathy@uws.edu.au
300
commercial probiotic strains and their efficacy, challenges in incorporating probiotics into foods, and factors affecting viability and survival of the probiotic bacteria and techniques such as microencapsulation to improve their viability in products and in the gut. The science aspect of prebiotics includes introducing concept of prebiotics, how it is different to probiotic approach, type of prebiotics utilized commercially, and healthrelated benefits and claims. The chapter also discuss the synbiotic approach and future issues in the development of functional foods.
INTRODUCTION
Modern consumers are increasingly interested in their personal health, and expect the food they consume to be safe, healthy or even capable of preventing illnesses. In many parts of the world, ageing population, stress-induced busy life styles, and self-medication approach to prevention of health-related problems rather than curing them are factors that are increasingly contributing to narrow the interphase between food and drugs. Foods are no longer considered by modern consumers solely in terms of taste and immediate nutritional needs, but also in terms of their ability to provide specific benefits above and beyond their basic nutritional values. Functional food or beverage imparts a physiological benefit that enhances overall health helps to prevent or treat a disease/condition, or improve physiological or mental performance via an added functional ingredient, processing modification or biotechnology (Shah, 2001). A food can be regarded as functional if it is satisfactorily demonstrated to affect beneficially one or more target functions in the body, beyond adequate nutritional effects, in a way which is relevant to either the state of well-being and health or the reduction of the risk of a disease. A food can be made functional by increasing the concentration, adding or improving the bioavailability of a particular component. Functional food science will serve to establish claims based either on enhanced function or disease risk reduction (Roberfroid, 2002). Functional foods targeted towards gut health currently provide the largest segment of functional food market in Europe, Japan and Australia (Heasman and Mellentin, 2001). The significant market drivers for growth of functional foods includes: increased consumer health awareness; increased popularity of healthy foods; ageing population demographics; stressinduced life styles; search for food-based drug substitutes; self medication approach promoted by busy life style; organics and natural remedies; side effects of drugs and rapidly developing health conscious markets. The functional food research and development, in recent years, has increased towards the development of dietary supplementation that may influence gut microbial composition and activities. The rationale behind this derives from the growing evidence that human colon contains pathogenic, non-pathogenic and possibly health-promoting species. The amount of microbia cells harboured by every human is approximately 1014, and is estimated to be ten to twenty times greater than the amount of the mammalian cells of the host (Savage, 1977; Suau et al., 1999). This microbiota functions in such a manner that the colon is the most metabolically active organ in the body and possibly having a very significant nutritional role. Dietary supplementation is a feasible route by which the large gut microbiota composition
Recent Trends in the Probiotic and Prebiotic Functional Food ...
301
and activities can be modulated. The health benefits attributed to intestinal microbes provide the rationale for using defined components of a healthy microbiota as therapeutic agents. Probiotics are live microbial food supplement that have been in use in recent years and are available incorporated into many food products, primarily fermented dairy foods. The positive health effects attributed to lactic acid bacteria and foods fermented with these bacteria have been long recognised. Bacteria which produce lactic acid, that are perceived to exert beneficial properties such as improved lactose digestion and resistance to pathogens are common probiotics. Prebiotics are non-digestible food components (eg. oligosaccharides) that are resistant to human digestive enzymes and pass to colonic regions undigested, undergo selective fermentation, and provide nutrients for the colonic commercial bacteria. Fructose oligosaccharides are able to modify the gut flora composition in favour of bifidobacteria. Prebiotics do not suffer survivability difficulties that may arise with probiotics. Thus the probiotic approach and the prebiotic approach in the development of functional foods are fundamentally different, though both contribute to overall gut health. Other strategies may exploit both probiotic and prebiotic technologies (as synbiotics). This chapter discuss the science and technology of probiotics, commercial probiotic strains, and prebiotic substances sold, their efficacy, challenges in incorporating probiotics and prebiotics into foods, viability issues, techniques to improve viability, physiological benefits, packaging considerations, product examples and commercial successes and failures. This chapter also discuss the efficiency and evaluation of prebiotics and the differences between probiotic and prebiotic approaches to maintain gut health.
GASTROINTESTINAL TRACT AND GUT MICROBIOTA

The gastrointestinal (GI) tract of humans consists of a diverse microbiota with between 300-500 bacterial species. Bacteriologically, there are large differences between the numbers and composition of the bacterial flora of the stomach, small intestine and colon. The vast majority (> 95%) of cells in the human body are present as bacteria in the colon, lower populations being detected elsewhere in the gastrointestinal tract. The human large intestinal microflora is acquired at birth, initially, facultative anaerobic strain such as Escherichia coli. Thereafter differences in the commensal species composition develop that are largely influenced by the type of diet. The faecal flora of breast-fed infants is dominated by population of bifidobacteria. It is reported that certain bifidogenic factors are present in human breast milk. In contrast, formula-fed infants have a more complex microbiota, with bifidobacteria, bacteroides, clostridia, and streptococci all being prevalent. After weaning, a pattern that resembles the adult flora becomes established. The microbiota of the GI tract of an adult consists of 99 % of obligate anaerobes, gastric secretions and rapid mobility in the upper small intestine restricts the microbiota to approximately 103 organisms per ml of luminal fluids at this site and between 1011-1012 organisms per g or ml of colon contents (Xu and Gordon, 2003; Backhead et al., 2005). The bacterial composition of the microbiota in different regions of the GI-tract differs due to the anatomical properties of the sites and other conditions such as pH, oxygen availability and transit time of the food contents. Bacterial species belonging to the genera Bacteroides,
302
Bifidobacterium, Fusobacterium, Butyrivibrio, Clostridium, Eubacterium, Enterobacter, Peptococcus and Lactobacillus are common members of the resident microbiota of the GItract (Benno and Mitsuoka, 1986). Bifidobacteria and lactobacilli represents 90% of the bacterial population, whereas less than 0.01% consists of diversified bacterial population which may include potential pathogens (Tournut, 1993). The microbiota alters throughout the GI-tract, and also changes as a person ages. The pH, presence of residual bile salts and the availability of oxygen are the predominant factors determining which species of bacteria reside in the different regions of the GI-tract (Hoier, 1992; Goldin, 1996). The stomach with a pH of 2.3 and substantial level of gastric juices, is inhabited by a few, hardy Gram positive bacteria and some yeasts. Further down the GI-tract as bile salt levels decrease and pH increases, more bacterial species are present in higher numbers. The small intestine is a zone of transition, with Gram negative bacteria and anaerobes becoming predominant (Richardson, 1996). The number of aerobic bacteria decreases towards the colon, where 95% of the bacterial population are strict anaerobes. The ileo-caecal sphincter acts as a doorway to the enormous bacterial concentrations found in the colon (Goldin, 1996). In the small intestine, the limiting factors for the intestinal microbiota are the presence of gastric juices and contents movement, whereas in the large intestine, the limiting factors are microbiologically produced anti-microbial substances and competition for food (Richardson, 1996). As the intestinal contents pass through the colon, nutrients are depleted by microbial activity until very little remains in the distal or descending colon (Cummings and MacFarlane, 1991). There is a more neutral pH and less metabolite production in the descending colon (Gibson and Roberfroid, 1995). Although bacteria are distributed throughout the GI-tract, the major concentration of microbes and metabolic activity are to be found in the large intestine. The major precursors for colonic bacterial growth are dietary carbohydrates that have escaped digestion in the upper gastrointestinal tract. Predominant substrates available for the colonic fermentation are starches that can be degraded by bacterial enzymes, as wells as dietary fibre. Other carbohydrate sources available for fermentation in lower concentrations include oligosaccharids and a variety of sugars and un-absorbable sugar alcohols. In addition, proteins and amino acids can be effective as growth substrates for colonic bacteria, while bacterial secretions, lysed end products, sloughed-off epithelial cells, and mucins may also form substrates. While the products of gut proteolysis (eg. phenolic compounds and ammonia) may be generally thought of as toxic toward host health, those of carbohydrate digestion, such as short-chain fatty acids, may be considered benign and in some cases can contribute positively (Macfarlane and Cummings, 1991). The colonic bacteria produce butyric acid which is reported to have a protective role in colonic cancer. Microbial colonisation of the intestines begins immediately after birth (Benno and Mitsuoka, 1986). The microbes derived from the mother have a strong stimulatory effect for both the normal development of the microbiota and the maturation of the gut-associated lymphoid tissue. These effects are less apparent in caesarean-born infants (Gronlund et al. 1999). Initial colonisation is by Enterobacteriaceae and streptococci. These species are followed by those of Bacteroides, Bifidobacterium and Clostridium, with Bifidobacterium spp. becoming predominant approximately one week after birth. As children are weaned from breast milk, the numbers of bifidobacteria decrease while those of Bacteroides, Eubacterium and Peptococcus increase. Diet can have a major effect on the gut microbial activities. Breastfed infants have a natural predominance of bifidobacteria, and also specific strains of these.
303
Children fed with infant formula have lower levels of bifidobacteria and a microbiota that is more complex and similar to that of adults (Ishibashi and Shimamura, 1993). In the elderly, the number of bifidobacteria decrease, whereas the number of clostridia and lactobacilli increase (Mitsuoka, 1996). The intestinal bacteria live in symbiotic or antagonistic relationships with their host. The indigenous bacteria may be grouped either as potentially pathogenic or as health-promoting (Salminen et al., 1998). Strains with beneficial properties include, among others, bifidobacteria and lactobacilli, which are also among the predominant culturable microbes in healthy infants (He et al., 2001). Normalisation of the indigenous microbiota by specific strains of the healthy gut microbiota forms the basis of probiotic therapy (Salminen et al., 1998). The targets for probiotic interventions include clinical conditions with impaired mucosal barrier functions, particularly manifested by infections and inflammatory diseases (Saarela et al., 2002). For obvious health reasons, there is significant interest in increasing the number and activities of beneficial microbes (probiotics) in the large gut, preferably at the expense of more harmful spp thus improving the health potential of the hind gut. The means of achieving this is through dietary supplementation, emphasising the significance of the human large intestine in the functional food concept.
PREBIOTIC FUNCTIONAL FOODS

A prebiotic is defined as a non-digestible food ingredient that affects the host by selectively targeting the growth and/or activity of one or a limited number of bacteria in the colon, and thus has the potential to improve host health (Gibson and Roberfroid, 1995). For food ingredients to be classified as prebiotics, they must: 1. Neither digested nor absorbed in the stomach or small intestine; 2. Act as a selective food source for one or a limited number of potentially beneficial commercial bacteria in the large intestine; 3. Change the colonic microbiota ecosystem towards a healthier composition and 4. Induce luminal or systemic changes that improve health of the host. Through the process of fermentation, colonic bacteria are able to produce a wide range of compounds which have varying potential effects on gut physiology, as well as other systemic influences. Better resistance to pathogens, reduction in blood lipids, anti-tumour properties, improved nutrition absorption, hormonal regulation and immune stimulation may all be possible through gut microflora manipulation. One approach advocates the oral intake of live micro-organisms (probiotics). However, survival after ingestion is difficult to guarantee and to prove and is very strain dependent. The prebiotic approach dictates that non-digestible food components are specifically fermented in the colon by indigenous bacteria thought to be of beneficial value (eg. bifidobacteria, lactobacilli) so that these selectively increase in numbers.
Types of Prebiotics
The principal substrates for bacterial growth in the colon are dietary carbohydrates that have escaped digestion in the upper gastrointestinal tract. These include starch, non-starch polysaccharides, unabsorbed sugars, non-digestible oligosaccharides, and sugar alcohols.
304
Whilst any food ingredients that enters the large intestine is a prebiotic candidate, it is selectivity of the fermentation in the complex mixed bacterial gut environment that is critical and required for a prebiotic effect. There are a number of substances that are loosely termed prebiotics. Many of these however, fail to meet the criteria outlined above. Slippery elm, psyllium husks, guar gum and pectin could best be considered as colonic foods rather than prebiotics as they appear to lack the selectivity of fermentation that is required of probiotics. Other substances, such as poly dextrose and larch arabinogalactans have been shown to increase the growth of beneficial bacteria in human trials. Certain carbohydrates, oligo- and poly-saccharides, occur naturally and meet the criteria of prebiotics (Gibson and Roberfroid, 1995).
Fructo-Oligosaccharides
The carbohydrate group that has received the most attention and research is the oligosaccharides. Fructo-oligosaccharides (FOS) have been extensively studied. A number of foods such as chicory, garlic, onion, artichoke and asparagus contain relatively high concentrations of FOS (Gibson and Roberfroid, 1995). Fructo-oligosaccharides represent one of the major classes of bifidogenic oligo-saccharides in terms of their production volume (Crittenden and Playne, 1996). Fructo-oligosaccharides are beta-D-fructans with varying degrees of polymerisation (DP). This can vary from 2 to 60 (eg. beta (2-1) fructans, inulin) or 2 to 20 (oligofructose). The synthesis of inulin in plant cells starts by the transfer of a fructosyl moiety between two sucrose molecules. The beta-2-1 glucosidic bond, including the first glucose-fructose linkage, is not hydrolysed to a significant extent by human digestive enzymes. Thus these carbohydrates present in the natural food can enter the colon relatively undamaged, where they are subjected to fermentation by indigenous commensal bacteria. A number of studies have reported the effects of FOS on human gut bacteria. In general, feeding of FOS increases bifidobacteria and lactobacilli, increases short-chain fatty acid concentrations and decreases clostridia, fusobacteria and bacteroides and pH (Fuller and Gibson, 1997; Gibson et al., 1996). The intake doses of FOS which have produced a bifidogenic effect in human studies ranged from 4 to 15 g/day (Gibson et al., 1996; Roberfroid, 1996). The use of oligofructose as a replacement for sucrose in the diet caused a marked increase in bifidobacteria, while bacteroides, fusobacteria, and clostridia all decreased (Gibson and Collins, 1999). Bacteroides was the numerically predominant genus on sucrose, while on oligofructose bifidobacteria became predominant.
Galacto-Oligosaccharides, Lactulose, Lactitol and Lactosucrose

The establishment of a bifidobacteria-dominant microflora in the intestines of breast-fed infants has been attributed to the presence of galactose containing oligosaccharides in human milk (Coppa et al., 2006). Thus the incorporation of galacto-oligosaccharides as a prebiotic food or supplement has increasingly attracted commercial interest and several companies are involved in their production. Galacto-oligosaccharides (GOGS), lactitol, lactosucrose and lactulose are all produced from lactose, and all have been shown to be good candidate prebiotics (eg exhibit bifidogenic effects). Galacto-oligosaccharides are formed by the
305
reaction of enzyme beta-galactosidase on the substrate lactose in a transgalactolysation reaction. This biosynthetic reaction occurs simultaneously with the hydrolytic degradation of lactose. They are produced commercially from refined lactose derived from whey in a batch reactor, using the galactosyl-transferrase activity of beta-galactosidase which dominates at high lactose concentrations (400g/L). After reaction, the product mix is decolorised and demineralised, filtered and concentrated to produce either a syrup or a powder.
Lactulose
Lactulose which is manufactured in pharmaceutical industry is an example of an earlycandidate prebiotic that was used to enhance the population of commensal lactobacilli in the intestines of bottle-fed infants (MacGillivray et al., 1959). This disaccharide is able to target the colon, is well fermented therein, and thus widely used in pharmaceutical applications. Nagendra et al. (1995) showed that lactulose promoted the development of a microbiota rich in bifidobacteria in a controlled study of an infant milk powder formula, and it has found commercial application in this area, as well as its use in the relief of chronic constipation. Lsactulose is produced by alkaline isomerisation of lactose at 100C (Mizota et al., 1987).
Lactosucrose
Lactosucrose is a trisaccharide (beta-D-galactopyranosyl-(1-4)- alpha-D-glucopyranosyl beta-D- fructofuranoside) is another bifidogenic oligosaccharide that has been reported to increase faecal bifidobacteria in long-term human clinical trials (Ohkusa et al., 1995). Lactosucrose is manufactured from a mixture of lactose and sucrose using the transfructosylation activity of enzyme beta-fructofuranosidase(Crittenden and Playne, 1996).
Lactitol
Lactitol is the sugar alcohol of lactose and is commercially manufactured by catalytic hydrogenation. Lactitol also shows bifidogenic effects (Mesters and Brokx, 2000). It is reported to reduce activity of procarcinogenic enzymes and aromatic compounds in colon. Lactitol is chemically derived from lactose by catalytic hydrogenation at high temperature and pressure
HEALTH RELATED ASPECTS AND CLAIMS

Protection against Cancer
Many common diseases of the human large bowel arise in the distal colon, particularly colon carcinogenesis. Many researchers believe that the colonic microflora has an important role to play in the development of bowel cancer.
306
Prebiotics may protect against development of colon cancer through the selective modulation of microflora (increase of bifidobacteria and decrease of bacteroides, clostridia and fusobacteria and/ or Gram positive cocci) as well as production of protective metabolites. The colonising cells of bifidobacteria produce lactic acid, thereby lowering of the pH, and create a bactericidal environment for putative enteropathogens, thus developing a favourable micro environment in the gut. This may also involve the modulation of specific bacterial enzymes such as beta-glucoronidase. Prebiotics also increase the production of short chain fatty acids in the colon, butyrate is a common fermentation product that may inhibit the genotoxic activity of nitrosamines and of hydrogen peroxide in human cells and possibly induce a more differentiated phenotype including colorectal tumor cells (Reddy, 1998; 1999). Prebiotic substances may also modify colonic metabolism away from protein and lipid metabolism, thus it is possible to shift the bacterial metabolism in the colon towards less harmful end products. For example, there could be a metabolic shift away from proteolytic fermentation by clostridia or bacteroides to a saccharolytic one.
Effect on Pathogens
Prebiotics demonstrates the ability to improve resistance to pathogens by increasing bifidobacteria and lactobacilli which in turn produce acids that lowers the luminal pH to levels below those at which pathogens can effectively compete. Many of the lactobacilli and bifidobacterial spp are able to excrete natural antibiotics, which could exert a broad spectrum of bacterial activity. For the bifidobacteria, some spp are capable of exerting antimicrobial effects on various Gram-positive and Gram-negative intestinal pathogens (Mackey and Gibson, 1997).
Improved Mineral Uptake (Calcium)

The stimulation of mineral absorption by prebiotics has been shown, particularly an increase in calcium and magnesium at the level of large intestine has been reported. An increase (about 65%) in calcium absorption was observed by Brommage et al (1993) with 5% oligofructose or other non-digestible carbohydrates. Ingestion of oligofructose also decreased or prevented the loss of bone mass, calcium and phosphorous from the bones of gastrectomized anemic rats (Ohta et al., 1998). The improved absorption of the minerals induced by prebiotics could be associated with reduction in pH of the ileal, caecal and colonic contents due to the fermentation of prebiotics such as inulin resulting in significant production of short chain fatty acids. This is likely to increase calcium solubility and overall levels in the gut. Increased bacterial breakdown of phytates (that bind divalent cations such as calcium and magnesium) could also release the bound minerals. Human clinical trails also have confirmed that the consumption of prebiotics such as chicory inulin or oligofructose results in increased calcium absorption (Coudray et al., 1997).
307
Lowering of Serum Lipids (and Cholesterol)

A large number of animal studies provide convincing evidence of the beneficial effects of prebiotics such as inulin and oligofructose on blood lipid levels. There is a marked reduction of serum triglycerides which occurs via reduction of fatty acid synthesis in the liver. It has been reported (Roberfroid et al., 1997; Delzenne et al., 1999) that the decreased de novo lipogenesis in the liver is the result of a co-ordinated reduction of the activity of all lipogenic enzymes as a result of consistent intake of oligofructose. Thus oligofructose could modulate inulin concentration possibly via effects on the secretion of gut hormones. Hence oligofructose also decreases serum inulin and glucose.
Immunological Effects
There is increasing awareness that immune functions and health are responsive to the bacteria resident in the GI tract. Changes in the populations of GIT bacteria caused by diet, antibiotics or other means can alter enteric and systemic immune responses. For example, a decrease in cell concentration of bifidobacteria in the colon, especially during ageing, could be an important cause of decreased immunity. Lactic acid bacteria are thought to stimulate both non-specific host defence mechanisms and certain types of cell involved in the specific immune response. The result is often an increased phagocytic activity and/or elevated immunological molecules such as secretory IgA, which may affect pathogens such as salmonella and rotavirus. As prebiotics achieve a similar outcome to lactic acid bacteria (ie improved composition of the gut microflora), similar effects may occur through their ingestion.
Prevention of Infectious Diseases

Prebiotics can act in a number of ways to help prevent pathogen colonisation and translocation: 1. selective stimulation of gut lactic acid bacteria that allow them to effectively compete for luminal nutrients and exclude pathogens competitively in the intestines; 2. the metabolic end products of increased lactic acid fermentation of prebiotics provide additional nutrient source for intestinal mucosal cells; 3. Organic acids and antibacterial proteins (bacteriocins) secreted by lactic acid bacteria could effectively inhibit pathogen proliferation in the GIT, and 4. possibly cell-cell communication between commensal bacteria and the GALT, prebiotics demonstrates modulating properties on the immune system of the host. It has been reported that the introduction of inulin and oligofructose enhances the luminal cell concentrations of bifidobacteria at the expense of pathogenic bacteria. When oligofructose is added to pure cultures of B. infantis and two potential pathogens (E. coli and Clostridium perfringens), a rapid decline in pathogen numbers occur compared with a glucose control (Wang and Gibson, 1993). A number of other studies have confirmed the prebiotic effect of inulin and oligofructose inhibiting pathogen growth and subsequent colonisation.
308
FUNCTIONAL FOOD APPLICATIONS OF PREBIOTICS

Oligosaccharides are used in beverages, for example in soybean oligosaccharide drinks in Japan (Suntory Ltd., Japan). Increasingly oligosaccharides are being incorporated into probiotic yoghurts and yoghurt drinks to produce synbiotic products. The effect of prebiotics on the characteristics of dairy products has been reported. Ipsen et al (2001) reported a gradual coarsening of the acid-induced milk protein net work, increased syneresis, increased permeability and a tendency for a lower shear stress with increasing amount of inulin in yoghurt manufacture. However, Dello et al (2004) found that the yoghurt containing inulin had a stable colour and water activity and did not undergo syneresis during storage, similar to that for the other fibre-containing yoghurts. Bozanic et al (2001, 2002) found that the firmness of fermented goat and cow milks and yoghurts improved upon the addition of inulin. Recently Aryana and McGrew (2007) reported that the chain length of inulin polymer affected some characteristics of fat-free yoghurts incorporated with probiotic bacteria, L. casei. They found that the flavours scores of yoghurts made with inulin of short chain length were significantly higher than for yoghurt incorporated with longer chain lengths inulin. However, the yoghurts with longer chain lengths demonstrated better body and texture compared to the control and yoghurts made with short chained inulin. Seydin et al (2005) found that yoghurt containing inulin had a good flavour and a smooth texture. Organoleptic scores for set and fermented milk containing inulin and B. bifidum were greater than the control (Ibrahim et al., 2004). The viability of lactic acid bacteria in fermented milk was enhanced by inulin (Sadek et al., 2004). Recently, a petit-suisse cheese supplemented with both inulin and oligofructose combined seems to be most promising in that simultaneous achievement of high fructan contents and good viable counts of L. acidophilus and B. animalis subsp lactis and sensory acceptance (Cardarelli et al., 2008). Niness (1999) reported that inulin has been successfully used to replace fat in baked goods, table spreads, fillings, dressings and frozen desserts. Oligosaccharides are also widely used in confectionery including desserts, jellies, ice creams, bakery products including biscuits, breads and pastries, spreads such as jams and marmalades and infant milk formulas. It has been long thought that the gut flora of the breast-fed infants is dominated by bifidobacteria and that this is not the case for formula-fed infants. As prebiotics exploit the use of non-viable dietary components to improve gut health, the range of foods into which they can be added is much wider than that for probiotics, where culture viability needs to be maintained. Potential application for probiotics as food ingredients to improve gastrointestinal health of the consumer includes beverages, health drinks, sauces, cereal bars, biscuits, snack bars, soups, salad dressings etc. Some non-food application has also been proposed for oligosaccharides including duh delivery, cosmetics and mouth washes.
PROBIOTIC FUNCTIONAL FOODS

Metchnikoff (1908) in his fasciating treatise The Prolongation of Life propounded that the longevity of Bulgarians was in part due to their consumption of large quantities of fermented milks containing lactobacilli. This observation has led to burgeoning activity on
309
the elucidation of the role of lactic acid cultures and cultured milk products in alleviation of human gastrointestinal disorders. Recent advances in our knowledge of the biosynthetic activities of lactic acid bacteria and their antagonistic action against pathogenic, toxigenic and putrefactive organisms have added a new dimension to the development of probiotic fermented milks and dairy products as functional foods. The emergence of antibiotic-resistant bacteria and natural ways of suppressing the growth of pathogens has contributed to the concept of probiotics. The word probiotic derived from the Greek Language means for life (Fuller, 1989). Probiotic bacteria not only compete and suppress unhealthy fermentation in human intestine, but also produce a number of beneficial health effects of their own. Recently, probiotics have been defined as live micro-organisms which when administered in adequate amounts confer a health benefit on the host (Reid et al., 2003). The current understanding is that probiotic products should contain live microorganisms to impart health status of the host by exerting beneficial effects on the gastrointestinal system of human. Tissier (1906) originally proposed the concept of beneficial bacteria. He advocated the administration of Bifidobacterium to infants with diarrhoea, based on the concept that the beneficial bifidobacteria will replace the bad bacteria responsible for causing the intestinal disturbance. Metchnikoff (1908) recommended the consumption of yoghurt containing Lactobacillus spp. The consumed bacteria were to replace toxin producing bacteria present in the intestines. He suggested that the long life of Bulgarian peasants resulted from the consumption of fermented milk products. Probiotics are live microbial feed supplements that have been used for many years in the animal feed industry. However, probiotics are now widely used in the manufacturing of fermented dairy products. Probiotic bacteria have been increasingly incorporated into fermented dairy products, including yoghurts, soft-semi hard cheeses, ice creams, and frozen fermented dairy desserts (Anal and Singh, 2007). Many different organisms are used as probiotics, however, Lactobacillus acidophilus, L. casei, Bifidobacterium bifidum, B. longum, B. breve, L. rhamnosus, L. paracasei, B. latis, L. johnsonii La 1, L. reuterii, L. plantarum, L. fermentum and Saccharomyces cereviseae boulardii are frequently used as probiotics in products for human consumption (Playne, 1994). Generally Lactobacillus and Bifidobacterium strains are used in the development of probiotic products intended for human consumption due to the belief that these bacteria are members of the intestinal microbiota and are also considered as generally safe (Berg, 1998; Klein et al., 1998). A probiotic must have good technological properties so that it can be manufactured and incorporated into food products without loosing viability and functionality or creating unpleasant flavours or textures in the product. Selection criteria for probiotic bacteria include survival in acidic gastric juices, and alkaline bile secretions and in the presence of hydrolytic and proteolytic digestive enzymes during their transit through the gut. Additionally, probiotic bacteria must be capable of colonising the GI tract they must be safe and have the potential to maintain their efficiency during the shelf life of the product. Other requirements include the growth and survival of the organism under the conditions required for its commercial manufacture. The organism must grow well in simple media to high cell concentrations, and survive centrifugation, freeze-drying and freezing. The probiotic culture must also withstand incorporation into a range of food matrices, and be able to survive the shelf life of the food product. Careful screening of probiotic bacteria for their technological suitability can also allow the selection of strains with the best manufacturing and food technology characteristics.
310
However, even the most robust probiotic strains are carefully limited in the range of food applications to which they can be applied. In addition bacteria with exceptional functional health properties are often ruled out due to technological limitations. The viability of probiotics has been both a marketing and technological challenge for many food processing industries. The standard for any food sold with health claims derived from the addition of probiotics is that it must contain per g at least 106 107 cfu of viable probiotic bacteria (FAO/WHO, 2001). Viability during the shelf life of the product and survival in the GI-tract to populate the human gut are two important issues in health benefit provision by probiotics. Additionally, factors related to the technological and sensory aspects of probiotic food production are of importance since only by satisfying the demands of consumers can the food industry succeed in promoting the consumption of functional probiotic products in the future. In certain cases, non-viable probiotic bacteria may also have beneficial effects on health (Ouwehand and Salminen, 1998). Despite the recognition of the possible physiological benefits of non-viable probiotics, viability of the bacteria is nevertheless considered one of the most important characteristics of probiotics, and the term viable is included in most definitions of probiotic bacteria.
Beneficial Effects of Probiotics

A number of health benefits of probiotic bacteria are reported, including enhancement of immunity against intestinal infections, immune enhancement, prevention of diarrhoeal diseases, prevention of colon cancer, prevention of hypercholesterolemia, improvement in lactose utilisation, prevention of upper gastrointestinal tract diseases and stabilisation of the gut mucosal barrier (Kailasapathy and Chin, 2000). Probiotic microbes have been linked with a range of beneficial effects on host healt, some are well documented, and others need further assessment. There is an increasing number of proposed health benefits targeted outside the gastrointestinal tract. An important reason for the increasing proposed health benefits of the probiotic bacteria is the increasing awareness of the role of the gut microbiota in the pathogenesis of a number of clinical conditions, which has provided rationale for the attempts to treat or prevent these conditions by modulating the gut microbiota. Additionally, the crucial role of the gut microbiota in the development and the modulation of host immune functions have become evident. Hence, administration of probiotics may provide a means for directing the host immune responses both locally and distantly. The use of probiotic cultures stimulates the growth of preferred microorgansisms, crowds out potentially harmful bacteria and reinforces the bodys natural defence mechanisms (Gismondo et al., 1999; Dunne, 2001). The probiotic effect may also operate in a variety of ways to achieve resistance to such a wide range of infectious agents. The mechanisms of antipathogenic effects may also be through decreasing the luminal pH by the production of organic acids (acetate, lactate, or propionic acids), rendering vital nutrients unavailable to pathogens, changing the redox potential of intestinal environment, producing bacteriocins, competing with pathogens for the receptor sites on the intestinal wall (competitive exclusion), producing hydrogen peroxide, antimicrobial or other inhibitory substances (Hughes and Hoover, 1991; Gilliland and Speck, 1977; Kailasapathy and Chin, 2000). The activities of probiotics may include cell-mediated immune responses, including activation of the reticulo-
311
endothelial system, augmentation of cytokine pathways and stimulation of pro-inflammatory pathways such as interleukin regulation (Gill et al., 2001; Paturi, 2007). Currently, the best-documented health effects are the treatment and preparation of rotavirus diarrhoea, and the improvement of lactose digestion in yoghurt. The efficiency of the management of antibiotic-associated diarrhoea has recently been confirmed in several meta-analyses. The prevention of urinary tract infections is also well documented. However, other promising therapeutic applications requiring further clinical evidence include prevention of eczema, prevention of relapse of ulcerative colitis, treatment of pouchitis, blood pressure-lowering effects, prevention of necrotising enterocolitis, treatment of bacterial vaginosis, and prevention of Clostridium difficile- associated diarrhoea. Treatment of allergies, adjuvant effects on antibiotic therapies against H. pylori, treatment of constipation, treatment of irritable bowel syndrome, and treatment of short bowel syndrome also appears promising. It is widely accepted that the health benefits of probiotic bacteria are straindependent and strain-specific and that the documented health effects of one strain are not applicable to others.
Viability Issues of Probiotic Bacteria

Viability of probiotics is often considered a requirement for the beneficial health effects, and it is by definition, a requirement for microbes to be considered a probiotic. Based on current reports, viable probiotics appear to be superior in mediating a number of health benefits. The viability of probiotic cultures in functional foods is therefore a critical issue of their functionality. The viability and metabolic activity of probiotic bacteria are important considerations because the bacteria must survive in the food or nutraceutical during its shelf life and during transit through the acidic conditions of the stomach, and must resist any degradation by hydrolytic enzymes and bile salts in the small intestine. It is essential that products sold with any health claims meet the recommended criterion of minimum of 106 107 cfu/g viable probiotic bacteria (FAO/WHO, 2001).
Applications of Probiotic Cultures in Functional Foods

The wide range of claimed health benefits of probiotics has stimulated the rapid expansion of the market of probiotic products world wide. Because of these perceived health benefits, probiotic bacteria has been increasingly included in fermented dairy products, including yoghurts, soft hard and hard cheeses, dairy spreads, margarine, ice cream, frozen fermented dairy desserts and fermented milks. Probiotic foods can be made in two ways: 1. fermentation of raw ingredients by probiotics, with or without starter cultures, and 2. addition of suitable concentrations of probiotics to the finished product. Probiotic fermentation of raw ingredients allows the bacteria to multiply and impart distinctive flavours and organoleptic changes to the food. The probiotic strains selected for each different food system will affect the qualities of the final product, depending on the type and amount of acids and other metabolites that are produced. Hetero- and homo-fermentative lactobacilli will impart different flavours during fermentation. Homo-fermenters produce an acid-sour from lactic acid and hetero-fermenters yield an
312
acid-sharp from the production of acetic acid. When probiotic bacteria are added to the final product just before packaging (eg in some acidophilus milk) bacterial survival rather than growth is the important factor. Bacteria must be added at a suitable concentration to remain > 106 cfu/g food for the shelf life of the product. Unplanned bacterial growth during this time may produce undesirable changes such as post-acidification during storage, resulting in a less acceptable produce. Whether probiotics are used in the manufacture of the food product or are added post production, the most important factor is the ability of the produce to convey the desired health benefits. Strain selection, food composition, including the use of prebiotics and food parameters such as pH, will determine the successful survival of the bacterial spp. Product taste, appearance, composition and marketing will determine the success of the produce in the market place. In addition to their application in dairy products, probiotic bacteria are now being applied to more new food products including fermented cereals, infant formulas, beverages and some therapeutic foods. Over 70 products all over the world including sour cream, butter milk, yoghurt, powdered milk and frozen desserts contain Bifidobacterium and lactobacillus (Shah, 2001). In the recent past a number of new products incorporating probiotics have been researched. These include probiotic orange juice (Luckow and Delahunty, 2004), oat-based cereal bar incorporating Bifidobacterium lactis Bb-12 (Ouwehand et al., 2004), dry fermented sausages incorporating probiotic bacteria (lactobacillus strains) (Pennacchia et al., 2004) and a non-fermented frozen vegetarian dessert containing B. lactis, L. rhamnosus, L. paracasei ssp paracasei (Heenan et al., 2004).Other possible development includes novel applications of probiotic bacteria in food service industry.
Factors Affecting the Survival of Probiotic Bacteria

Analysis of probiotic products in many different countries has confirmed that probiotic strains exhibit poor survival in foods such as yoghurts and fermented milks, with cell numbers being much lower than the recommended levels at the expiry date (Kailasapathy and Rybka, 1997; Shah, 2000; Laurens-Hattingh and Viljoen, 2000). Probiotic preparations such as tablets, powders etc., may contain lower viable counts. A number of factors such as acid, alkali, hydrogen peroxide produced by yoghurt bacteria, the concentration of lactic acid and acetic acids, interaction of the probiotic species with the yoghurt starters, buffering capacity, whey proteins, sugars, incubation temperature and fermentation time, and the fat content of the yoghurt can affect the survival of probiotic bacteria in dairy fermented foods (Shah, 2000; Vinderola et al., 2002). Processing of probiotic foods involve heat treatment (pasteurisation), pumping, homogenising, ultrafiltration and stirring (incorporation of air), freezing (frozen dairy products), addition of ingredients which can be antimicrobial (eg salt), drying (powdered milk products), packaging (oxygen entry into product during storage), unfavourable storage conditions (eg post-acidification in yoghurt), heat shock (in cold-chain manufacture and storage), and the possible development of anti-microbial compounds secreted by the starter cultures during fermentation.
313
Immobilisation and Encapsulation Technologies for Probiotics

Incorporating probiotic bacteria into functional food presents challenges, particularly with respect to the stability of probiotic bacterial cells during processing and storage and the need to prevent undesirable interactions with the carrier food matrix. Recently microencapsulation (ME) is emerging as a technology to provide protection to the probiotic bacteria during food processing and storage as well during the transit in the gastrointestinal system. ME is an inclusion technique for confining a bioactive substance into a polymeric matrix coated by one or more semi-permeable polymers by virtue of which the suspected compound become stable and protected than its isolated or free form. Encapsulation of food bio-actives can provide the final product with better technological and nutritional properties and, in addition, controlled release of encapsulated compounds under specific conditions. Microencapsulation of probiotics presents two challenges: the size of the bacterial cell (typically 1-5 m in diameter), and the cell must be kept alive and little or no stress imposed on the bacterial cells during ME process and during encapsulated shelf life. There are several methods of ME. However, technologies applied to probiotics are generally limited to gelling, spray-drying; spray-cooling, extrusion and emulsions (Kailasapathy, 2002; Anal and Singh, 2007; Champagne and Fustier, 2007).
Application of Microencapsulation of Probiotic Bacteria in Fermented Foods

Microencapsulation offers the necessary protection to enhance the survival of probiotics in food and nutraceuticals. It has been reported that ME using calcium-induced alginate starch polymers (Godward and Kailasapathy, 2003; Sultana et al., 2000), in potassium-induced kappa-carrageenan polymers (Adhikari et al., 2000; 2003) and in whey protein polymers (Picot and Lacroix, 2004) have increased the survival and viability of probiotic bacteria in yoghurts during storage. Compared to yoghurt, cheese (particularly in cheddar cheese) has a markedly higher pH and hence provides a more stable medium to support the survival of acidsensitive probiotic bacteria (Stantin et al., 1998). However, compared to yoghurt, cheddar cheese has a longer ripening, storage and shelf life during which the pH decreases, making the cheese acidic in nature during ripening. The combination of long maturation periods and acidic conditions could make it difficult for probiotic bacteria to survive during the 6-12 month ripening period. Darukaradhya (2005) reported that ME helps to improve the survival of probiotic bacteria in long-ripened cheeses such as cheddar cheese. A number of studies have reported that probiotics entrapped in alginate or carrageenan beads have greater viability following freezing in dairy desserts (Kebery et al., 1998; Sheu et al., 1993; Godward and Kailasapathy, 2003; Shah and Ravula, 2000). The addition of cryoprotectants such as glycerol along with microencapsulation seems to improve the viability of probiotic bacteria during freezing of dairy desserts. The milk fat in ice cream formulations may also act as an encapsulant material for protection of probiotic bacteria during the homogenisation and freezing of the ice cream mix. In powdered milk products, the addition of a thermoprotectant such as trehalose (Conrad et al,, 2000) in addition to ME may improve viability during drying and storage. Freezedrying of microencapsulated hydro-gel beads seems to be more stable during incubation at
314
room temperature (Kailasapathy and Sureeta, 2004; Capela et al., 2006). In a traditional African fermented maize product, microencapsulation in gellan/ xanthan beads was found to improve the stability of bifidobacteria during storage (McMaster et al., 2005). Microencapsulation improved the survival of L. rhamnosus subjected to freezing in a cranberry juice concentrate and during storage of the frozen product (Reid et al., 2006).
FUTURE TRENDS AND ISSUES

Numerous human feeding studies have shown that the human gut microbiota can modulated with probiotics, prebiotics and synbiotics to increase the numbers and activity of bifidobacteria and lactobacilli. All three microbiota management tools have also shown some positive health outcomes against specific disease conditions. As clinical evidence of the beneficial effects of probiotics and prebiotics accumulates, the food, nutraceutical and pharmaceutical industries will formulate new and innovative probiotic-based therapeutic products. New synbiotic products, containing both probiotic bacteria and prebiotic carbohydrates will be developed. Though yoghurts containing inulin and bifidobacteria are available, the development of synbiotic products is still in its infancy. There is still only limited evidence of enhanced health efficiency due to synbiotics, over that of the probiotic alone or the prebiotic alone. In addition, specific strains of probiotics are not yet being selected for their ability to act synergistically with a specific prebiotic carbohydrate. Thus future developments will include fermented functional foods where matching of probiotic bacterial strains with specific prebiotic carbohydrates will assume greater importance. Future prospects to exploit the potential health-promoting properties of new functional foods will continue to expand as we gain a greater understanding of the probiotic microorganisms concerned and how they, or their biogenic metabolites, can directly interact in a positive way with the human host. Advanced genomic-based studies on probiotic microorganisms will undoubtedly lead to a greater understanding of probiotic-human interactions and ultimately to greater knowledge of the mechanisms underlying the probiotic effects. Advanced genetic engineering tools to manipulate probiotic lactobacilli and bifidobacteria will be fundamental in designing food-grade bacteria that over-produce biogenic compounds during fermentation; examples include the overproduction of nutrients such as folate and riboflavin by genetically modified lactic acid bacteria and overproduction of conjugated linoleic acid (CLA), a family of positional and geometric isomers of linoleic acid that are associated with several health benefits including anti-carcinogenic and anti-inflammatory activities (Belury, 2002). Thus in the future, the application of functional genomics approaches to probiotic bacteria will certainly accelerate the development of probiotic-based functional food products. Culture companies will invest large sums of money to develop better efficacious probiotic strains that can provide significantly enhanced benefits and withstand rigours of processing and storage. Future research will include the interactive effect of two or more probiotic strains in a food product on the health outcome of consuming the food. Both synergistic and antagonistic effects between genera of probiotic bacteria will be investigated. It is likely that synergies may be most significant at the strain level, rather than at the species
315
level. Antagonistic effects between probiotic microbial spp may also occur, particularly between strains from the same genus and spp, due primarily to direct competitive effect for nutrients. New innovative ways of administering, delivering and controlled releasing of probiotics will be developed in the near future. Future developments in microencapsulation of probiotic bacteria will include the use of prebiotic oligosaccaharides as encapsulation materials. Adding fructo-oligosaccharides or isomalto-oligosaccharides into alginate beads has helped improve the stability of bifidobacteria during storage in unfermented milk as well as in simulated gastric solutions (Chen et al.,, 2005). It can be expected that prebiotics which enable to formation of glassy structures would be particularly useful because of their potential to stabilise biological structures through hydrogen bonding (Ubbink amd Kruger, 2006). Prebiotics could also be used to microencapsulate probiotics in spray-drying processes (Crittenden et al., 2006). Using fats for both their coating and prebiotic properties has also been proposed (Naidu and Baksh, 2004). While most emphasis in research has been carried out on non-digestible carbohydrate as prebiotics, it is clear from early reports that bifidogenic effects were observed for a number of nitrogenous compounds including casein peptides and pantotheine (Playne et al., 2003). Lactoferrin, a globular glycoprotein in milk is also known to effect the growth of bifidobacteria, possibly through an iron metabolism. It is known that ammonia and amines in colon have important effects of disease development, eg. colonic cancers. Future field of research on the prebioic effect of proteins will include investigations on the mechanisms by which nitrogenous compounds including proteins, affect gut microflora and host health will be different from those of non-digestible carbohydrates. Yoghurts and fermented milks have spear-headed the development of synbiotic functional foods. The tendency is for other fermented products such as cheese, dairy vegetable blended spreads, frozen desserts, cereal and meat products to follow. Designer synbiotic products delivering specific health benefits will be the next phase of development. This will also include food, pharmaceutical and nutraceutical products. Synbiotic technology also has a huge potential in the development of new and innovative products in food service and catering industries. The advantage provided to food manufacturers by the physicochemical properties of oligosaccharides, combined with the health benefits of probiotic bacteria and prebiotic substances should ensure that synbiotic functional food market will continue to expand.
REFERENCES
Adhikari, K., Mustapha, A., Grun, I.V. & Fernando, L. (2000). Viability of microencapsulated bifidobacteria in set yoghurt during refrigerated storage. J. Dairy Sci., 83, 1946-1951. Adhikari, K., Mustapha, A. & Grub, I.U. (2003). Survival and metaboic activity of micro encapsulated Bifidobaterium longum in stirred yoghurt. J. Food Sci., 68, 275-280. Anal, A, K. & Singh, H. (2007). Recent advances in microencapsulation of probiotics for industrial application and targeted delivery. Trends in Food Science and Tecchnology, 18, 240-251.
316
Aryana, K.J. & McGrew, P. (2007). Quality attributes of yoghurt with Lactobacillus casei and various prebiotics. LWT Food Science and Technol., 40, 1808-1814. Backhead, F., Ley, R.E., Sonnenburg, J.L., Peterson, D.A. & Gordon, J.I. (2005). Host bacterial metabolism in the human intestine. Science, 307, 1915-1920. Benno, Y & Mitsuoka, T. (1986). Development of intestinal microflora in human and animals. Bifidobacteria Microflora, 5, 13-25. Belury, M.A. (2002). Dietary conjugated linoleic acid in health: physiological effects and mechanisms of action. Annu Rev Nutr., 22, 505-531. Berg, R.D. (1998). Probiotics, prebiotics or conbiotics? Trends in Microbiology, 6, 89-92. Bozanic, R., Rogelj, I. & Tratnik, L.J. (2001). Fermented acidophilus goats milk supplemented with inulin: comparison with cows milk. Milchwissenschaft, 56(11), 618622. Bozanic, R., Rogelj, I. & Tratnik, L.J. (2002). Fermentation and storage of probiotic yoghurt from goat milk. Mijekarstvo, 52(2), 93-111. Brommage, R., Binacua, C., Antille, S. & Carrie, A.L. (1993). Intestinal calcium absorption in rats is stimulated by dietary lactulose and other resistant sugars. J. Nutr., 123, 21862194. Capela, P., Hay, T.K.C., & Shah, N.P. (2006). Effect of cryoprotectants, prebiotics and microencapsulation on survival of probiotic organisms in yoghurt and freeze-dried yoghurts. Food Research International, 39, 203-211. Cardarelli, H.R., Buriti, F.C.A., Castro, I.A. & Saad, S.M.I. (2008). Inulin and oligofructose improve sensory quality and increase the probiotic viable count in potentially synbiotic petit-suisse cheese. LWT Food Sci. & Technol., (In Press). Champagne, C.P. & Fustier, P. (2007). Microencapsulation for the improved deliverey of bioactive into foods. Curr. Opinion in Biotechnol., 18, 184-190. Chen, K.N., Chen, M.J., Liu, C.W., & Chiu, H.Y. (2005). Optimisation of incorporated prebiotics as coating materials for probiotic microencapsulation. J. Food Sci., 70, M260M266. Conrad, P.B., Miller, D.P., Cielenski, P.R. & Pablo, J.J. (2000). Stabilisation and preservation of Lactobacillus acidophilus in saccharide matrices. Cryobiology, 41, 17-24. Coppa, G.V., Zampini, L., Galeazzi, T & Gabrielle, O. (2006). Prebiotics in human milk: a review. Digestive and Liver Disease, 38(Suppl.2): S291-S294. Coudray, C., Bellanger, J., Castiglia-Dela-Vaud, C., Vermorel, M and Rayssignuier, Y. (1997). Effect of soluble or partly soluble dietary fibres supplementation or absorption and balance of calcium, magnesium iron and zinc in healthy young man. Eur. J. Clin. Nutr. 51(6), 375-380. Crittenden, R.G., & Playne, M.J. (1996). Production, properties and applications of foodgrade oligosaccharides. Trends in Food Sci. & Technol., 7, 353-361. Crittenden, R., Weerakkody, R., Sanguansri, L & Augustin, M.A. (2006). Synbiotic microcapsules that enhance microbial viability during non-refrigerated storage and gastrointestinal tract. App. Environ, Microbiol., 72, 2280-2282. Cummings, J.H., & Macfarlane, G.T. (1991). The colon and consequences of bacterial fermentation in the human colon. J. App. Bacteriol., 70, 443-459. Darukaradhya, J (2005). Enumeration and survival studies of free and encapsulated Lactobacillus acidophilus and Bifidobacterium lactis in cheddar cheese. Master Hons. Thesis. University of Western Sydney, NSW, Australia.
317
Dello Staffolo, M., Bertola, N., Martino, M. & Bevilacqua, A. (2004). Influence of dietary fiber addition on sensory and rheological properties of yoghurt. Int. Dairy J. 14(3), 263268. Delzenne, N.M. & Kok, N.N. (1999). Biochemical basis of oligofructose-induced hypolipidemia in animal model. J. Nutr., 129(suppl.): 1467S-1470S. Dunne, C., OMahony, L., Murphy, L., Thornton, G., Morrissey, D., OHalloran, S., Feeney, M., Flynn, S., Fitzgerald, G. & Daly, C. (2001). In vitro selection criteria for probiotic bacteria of human origin: Correlation with in vivo findings. Am J Clin. Nutr., 73 (2 Suppl.): 386S-392S. FAO/WHO. (2001). Evaluation of health and nutritional properties of powdered milk and live lactic acid bacteria. Cordoba, Argentina: Food and Agric, Organisation of the United Nations and World Health Organisation Expert Consultation Report, pp. 1-34. Fuller, R. (1989). Probiotics in man and animals. J. Appl. Bacterol., 66, 365-78. Fuller, R. & Gibson G.R. (1997). Modification of the intestinal microflora using probiotics and prebiotics. Gastroenterology, 32, Suppl. 222, 28-31. Gibon, G.R. & Roberfroid, M.B. (1995). Dietary modulation of the human colonic microbiota: Introducing the concept of prebiotics. J. Nutrition, 125, 1401-1412. Gibson, G.R., Williams, A., Reading, S. & Collins, M.D. (1996). Fermentation of nondigestible oligosaccharides by human colonic bacteria. Proc. of Nutr. Soc., 55, 899-912. Gibson, G.R. & Collins, M.D. (1999). Concept of balanced colonic microbiota, prebiotics and synbiotics. In: Eds. A. Hanson and R.H. Yolken, Probiotics, other Nutritional Factors and Intestinal Microflora. Nestle Nutrition Workshop Series, Vol. 42, Nestec Ltd., Vevey/ Lippincott-Raven Pub. Philadelphia. Gill, H.S., Rutherfurd, K.J., Cross, M.L. & Gopal, P.K. (2001). Enhancement of immunity in the elderly by dietary supplementation with the probiotic Bifidobacterium lactis HN019. American J Clinical Nutr., 74, 833-839. Gilliland, S.E., & Speck, M.L. (1977). Antagonistic action of Lactobacillus acidophilus towards intestinal and food-borne pathogens in associative cultures. J. Food Prot., 40(12), 820-823 Gismondo, M.R., Drago, J. & Lombardi, A. (1999). Review of probiotics available to modify gastrointestinalflora. Int. J. of Antimicrobial Agents., 12, 287-292. Godward, G & Kailasapathy, K. (2003). Viability and survival of free, encapsulated and coencapsulated probiotic bacteria in yoghurt. Milchwissenschaft, 58, 396-399. Goldin, B.R. (1996), The metabolic activity of the intestinal microflora and its role in colon cancer. Nutr. Today Supp., 31, 24S-27S. Gronlund, M.M., Lehtonen, O.P., Eerola, E. & Kero, P. (1999). Faecal microflora in healthy infants born by different methods of delivery: permanent changes in intestinal flora after caesarean delivery. J. Pediatric Gastroenterology and Nutrition., 28, 19-25. He, F., Ouwehand, A., Isolauri, E., Hosoda, M., Benno, Y., Salminen, S. (2001). Differences in composition and mucosal adhesion of bifidobacteria isolated from healthy adults and healthy seniors. Curr. Microbiol., 43, 351-354. Heenan, C.N., Adams, M.C., Hosken, R.W. & Fleet, G.H. (2004). Survival and sensory acceptability of probiotic microragnisms in a non-fermented frozen vegetarian dessert. Lebensm-Wiss.u-Technologie, 37, 461-466. Heasman, M & Mellentin, J. (2001). The Functional Foods Revolution- Healthy People, Healthy Profits? Earthscan Pub. Sterling, VA.
318
Hoier, E. (1992). Use of probiotic starter cultures in dairy products. Food Australia, 44, 418420. Hughes, D.B. & Hoover, D.G. (1991). Bifidobacteria: Their potential for use in American dairy products. Food Technology, 45, 74-83. Ibrahim, G.A., Mehanna, N.S., El-Rab, D.A.G., Abd El-Salam, M.H., Kholif, A.M., Abdou, S.M. & El-Shibiny, S. (2004). Preparation and properties of set fermented milk containing inulin and different probiotics. In: 9th Egyptian Conference for Dairy Science and Technology, Cairo, Egypt, Oct. 9-11, 2004. (pp. 117-132), Cairo, Egypt: Egyptian Society of Dairy Science. Ipsen, R., Otte, J., Lozahic, G., & Qvist, K.B. (2001). Microstructure and viscosity of yoghurt with inulin added as a fat replacer. Annual Transactions of the Nordic Rheology Society, 2000-2001 (8/9), 59-62. Ishibashi, N & Shimamura, S. (1993). Bifidobacteria: Research and Development in Japan. Food Technology, Europe, 47, 126-135. Kailasapathy, K. (2002). Microencapsulation of probiotic bacteria : Technology and potential applications. Curr. Issues in Int. Microbiol., 3, 39-48. Kailasapathy, K & Chin, J.C. (2000). Survival and therapeutic potential of probiotic organisms with reference to Lactobacillus acidophilus and Bifidobacterium spp. Immunology and Cell Biology, 78, 80-88. Kailasapathy, K & Rybka, S. (1997). Lactobacillus acidophilus and Bifidobacterium spp : their therapeutic potential and survival in yoghurt. Aust. J. Dairy Technol., 52, 28-35. Kailasapathy, K & Sureeta, B.S. (2004). Effect of storage on shelf life and viability of freezedried and microencapsulated Lactobacillus acidophilus and Bifidobacterium infantis cultures. Aust. J. Dairy Technol., 59, 204-208. Kebary, K.M.K., Hussein, S.A. & Badawi, R.M. (1998). Imroving viability of bifidobacteria and the effect of frozen ice milk. Egyptian J. Dairy Science, 26, 319-337. Klein, G., Pack, A., Bonaparte, C. & Reuter, G. (1998). Taxonomy and physiology of probiotic lactic acid bacteria. Int. J. of Food Microbiology, 41, 103-125. Lourens-Hattingh, A & Viljoen, B.C. (2001). Review: Yoghurt as a probiotic carrier in food. Int. Dairy J., 11, 1-17. Luckow, T. & Delahunty, C. (2004). Consumer acceptance of orange juice containing functional ingredients. Food Research International, 37, 805-814. Macfarlene, G.T. & Cummings, J.H. (1991). The colonic flora, fermentation and large bowel digestive function, In: Phillips, S.F., Pemberton, J.H., Shorter, R.G. Eds. The large intestine: physiology, pathophysiology and disease, New York: Raven Press, pp. 51-92. MacGillivray, P.C., Finlay, H.V.L., Binns, T.B. (1959). Use of lactulose to create a preponderance of lactobacilli in the intestine of bottle-fed infants. Scott. Med. J., 4, 182189. Mackey, B.M. & Gibson, G.R. (1997). Escherichi coli 0157 from farm to fork and beyond. Society of General Microbiology Quarterly, 24, 55-57. McMaster, L.D., Kokott, S.A., Reid, S.J. & Abratt, V.R. (2005). Use of traditional African fermented beverages as delivery vehicles for Bifidobacterium lactis DSM 10140. Int. J. Food Microbiol., 102, 231-237. Mesters, P & Brokx, S. (2000). Lactitol: a functional prebiotic. In: Functional Foods 2000. Conference Proceedings (Eds. F.Angus and C. Miller). Leatherhead Pub. Surrey, UK., pp. 173-189.
319
Metchnikoff, E. The Prolongation of Life, 1st Edition, New York; SP Putmans Sons, 1908. Mitsuoka, T (1996). Intestinal flora and human health. Asia Pacific J Clin. Nutr. 5, 2-9. Mizota, T., Tamura, Y., Tomita, M & Okonogi, S. (1987). Lactulose as a sugar with physiological significance, Bull. Int. Dairy Fed. 212, 69-76. Nagendra, R., Viswanathan, S., Kumar, S.A., Murthy, B.K. & Rao, S.V. (1995). Effect of feeding of milk formula containing lactulose to infants on faecal bifidobacteria flora. Nutr. Res., 15, 15-24. Naidu, S.A., & Baksh, b. (2004). Prebiotic and preservative uses of oil-emulsified probiotic encapsulations. International Patent WO 2004/028460/A2. Niness, K.R. (1999). Inulin and oligofructose: What are they? Journal of Nutrition, 129, 1402S-1406S Ohkusa, T., Ozaki, Y., Sato, C., Mikuni, K & Ikeda, H. (1995). Long term ingestion of lactosucrose increases Bifidobacterium sp in human faecal flora. Digestion, 56, 415-420. Ohta, A., Ohtsuki, M., Hosono, A., Adachi, T., Hara, H. & Sakata, T. (1998). Dietary fructooligosaccharides prevent osteopenia after gastrectomy in rats. J.Nutr., 128, 106-110. Ouwehand, A.C., & Salminen, S.J. (1998). The health effects of cultured milk products with viable and non-viable bacteria. Int. Dairy J. 8, 749-758. Ouwehand, A.C., Kurvinen, T., Rissanen, P. (2004). Use of a probiotic Bifidobacterum in a dry food matrix, an in vivo study. Int. J. Food Microbiol., 95, 103-106. Paturi, G. (2007). Probiotic characteristics of Lactobacillus acidophilus and Lactobacillus paracasei and their effects on immune response and gene expression in mice. PhD Thesis, University of Western Sydney, Australia. Pennacchia, C., Ercolini, D., Blaiotta, G., Pepe, O., Mauriello, G and Villani, F. (2004). Selection of Lactobacillus strains from fermented sausages for their potential use as probiotics. Meat Science, 67, 309-317. Picot, A. & Lacroix, C. (2004). Encapsulation of bifidobacteria in whey protein based microcapsules and survival in simulated gastrointestinal conditions and in yoghurt. Int. Dairy J., 14, 505-515. Playne, M.J. (1994). Probiotic foods. Food Australia 46, 362-366. Playne, M.J., Bennet, L.E., & Smithers, G.W. (2003). Functional dairy foods and ingredients. The Australian J. Dairy Technology, 58(3), 242-264. Reddy, B.S. (1998). Prevention of colon cancer by pre and probiotics: evidence from laboratory studies. British J Nutr., 80, Supp. 2., S219-S223. Reddy, B.S. (1999). Possible mechanisms by which pro and prebiotics influence colon carcinogenesis and tumour growth. J. of Nutrition., 129 (7S), 1478S-1482S. Reid, G., Sanders, M.E., Gaskins, H.R., Gibson, G.R., Mercenier, A., Rastall, R., Roberfroid, M., Rowland, I., Cherbut, C., Klaenhammer, T.R. (2003). New scientific paradigms for probiotics and prebiotics. J. Clinical Gastroenterology, 37, 105-118. Reid, A.A., Champagne, C.P., Gardner, N. Fustier, P & Vuillemard, J.C. (2006). Survival in food systems of Lactobacillus rhamnosus R011 microencapsulated in whey protein gel particles. J. Food Science, (In Press). Richardson, D. (1996). Probiotics and product innovation. Nutr. and Food Sci., 4, 27-33. Roberfroid, M.B. (1996). Functional effects of food components and the gastrointestinal system: chicory fructooligosaccharides. Nutrition Reviews, 54, S38-S42.
320
Roberfroid, M.B., Kok, N. & Delzenne, N. (1997). Chicory Fructans: are they effective in modulating lipid metabolism? Proc. of the NDO Workshop, December 1997, LUW, Wageningen, The Netherlands. Roberfroid, M. (2002). Functional food concept and its application to prebiotics. Digest Liver Dis., 34(suppl. 2), S105-10. Saarela, M., Lahteemaki, L., Crittenden, R., Salminen, S. & Mattila-Sandholm, T. (2002). Gut bacteria and health-foods-the European perspective. Int. J. of Food Microbiol., 78, 99-117. Sadek, Z.I., El-Shafei, K & Murad, H.A. (2004). Utilisation of xanthan gum and inulin as prebiotics for lactic acid bacteria. In: 9th Egyptian Conference for Dairy Science and Technology, Cairo, Egypt, Oct. 9-11, 2004, 9 (Research Papers 1) pp. 269-283). Salminen, S., Bouley, C., Boutron-Ruault, M.C., Cummings, J.H., Franck, A., Gibson, G.R., Isolauri, E., Moreau, M.C., Roberfroid, M. & Rowland, I. (1998). Functional food science and gastrointestinal physiology and function. Br. J. Nutr., 80, 141-171 (suppl.) Savage, D.C. (1997). Microbial ecology of the gastrointestinal tract. Ann. Rev. Microbiol., 31, 107-133. Seydin, Z.B.G., Sarikus, G., & Okur, O.D. (2005). Effect of inulin and dairy-lo as fat replacers on the quality of set type yoghurt. Milchwissenschaft, 60(1), 51-55. Shah, N.P. (2000). Probiotic bacteria: Selective enumeration and survival in dairy foods. J. Dairy Sci., 83, 894-907. Shah, N.P.(2001). Functional foods from probiotics and prebiotics. Food Technology, 55, 4653. Shah, N.P.& Ravula, R.R. (2000). Microencapsulation of probiotic bacteria and their survival in frozen fermented desserts. Aust. J. Dairy Technology, 55, 139-144. Sheu, T.Y., Marshall. R.T., & Heyman, A. (1993). Improving survival of culture bacteria in frozen desserts by microentrapment. J. Dairy Sci., 76, 1902-1907. Stanton, C., Gardiner C., Lynch, P.B. Collins, J.K., Fitzgerald, G.F. & Ross, R.P. (1998). Probiotc cheese. Int. Dairy J., 8, 491-496. Suau, A., Bonnet, R., Sutren, M., Godon, J.J., Gibson, G.R., Collins, M.D. & Dore, J. (1999). Direct analysis of genes encoding 16s rRNA from complex communities reveals many novel molecular species within the human gut. App. Environ. Microbiol., 65, 4799-4807. Sultana, K., Godward, G., Reynolds, N., Arumugaswamy, R., Peiris, P. & Kailasapathy, K. (2000). Encapsulation of probiotic bacteria with alginate-starch and evaluation of survival in simulated gastro-intestinal conditions in yoghurt. Int. Food Microbiol., 62, 4755. Tissier, H. (1906). Traitment des infections intestinales pah la methode de transformation de la flora bacterienne de lintestin. Complex Rendus des Seances Societe de Biologie, 60, 359-361. Tournut, J. (1993). The digestive flora of the pig and its variations. Recucil de Medicine Veterinaire, 169, 645-652. Ubbink, J & Kruger, J. (2006). Physical approaches for the delivery of active ingredients in foods. Trends in Food Sci. and Technol., 17, 244-254. Vinderola, C.G., Costa, G.A., Regenhardt, S. & Reinheimer, J.A. (2002). Influence of compounds associated with fermented dairy products on the growth of lactic acid starter and probiotic bacteria. Int. Dairy J., 12, 579-589.
321
Wang, X & Gibson, G. (1993). Effects of the in vitro fermentation of oligofructose and inulin by bacteria growing in the human large intestine. J. App. Bacteriology., 75, 373-380. Xu, J & Gordon, J.I. (2003). Inaugural article: Honour thy symbionts. Proc. of the Nat. Academy of Sci., USA., 100, 10452-10459.
Chapter 8
DIFFUSIVE AND CHEMICAL EXCHANGE MODEL: PRACTICAL HITS TO INVESTIGATE WATER DYNAMICS IN FOODS
Elvino Brosio*, Monica Belotti and Raffaella Gianferri
Department of Chemistry, University of Rome La Sapienza, Italy
ABSTRACT
In the present paper it is reported a full description of the model of the magnetic site exchange, as well as of the relations that, in the different limit conditions, allow the analysis and the physical interpretation of the relaxation curves as measured for water protons in food systems. It will be hereafter demonstrated that a correct measurement and analysis of both the longitudinal and transversal relaxation curves are likely to provide information on the morphology, size and distribution of the diffusive domains, and also on the physical-chemical parameters of the exchange processes involved.
INTRODUCTION
Water is the most abundant component present in foods and its interaction with other components proteins, polysaccharides, lipids plays a major role in defining the physical, chemical, and structural characteristics of the system. The understanding of the water motion state and the elucidation of the nature and power of water interactions involved within food systems is of fundamental relevance for the characterization, traceability, processing, and preservation of food. The NMR dynamic parameters, longitudinal and transversal relaxation times, T1 and T2, respectively, are very sensitive to the motion state of molecules, and their correct
324
Elvino Brosio, Monica Beliotti and Raffaella Gianferri
measurement and analysis significantly contribute to the understanding of the system under study. Beside being characterized by the possibility of being multi-exponential, proton relaxation curves measured for water in heterogeneous food systems, i.e., some kinds of food, are characterized by time constants considerably lower than those of pure water at the same temperature; typically, they vary from few milliseconds to some hundreds of milliseconds, that is to say one or two orders of magnitude lower than pure water relaxation times. Moreover, in some cases, relaxation rates present a characteristic dispersion pattern the longitudinal ones as a function of frequency as such, and the transversal ones also as a function of the time interval between two following 180 pulses in the Carr Parcell Meiboom Gill (CPMG) sequence [1]. All these characteristics are ascribable to a reduction in the rotational and translational correlation times of water molecules, very likely due both to the interactions with the surfaces of the compartments present in heterogeneous systems, and to diffusive exchange phenomena. This means that those models normally employed for the interpretation of relaxation data, based on either the isotropic or anisotropic rotation, are not suitable and therefore, the translational correlation function is also to be taken into account. However, translational motions generate no simple models of the correlation function, thereby making it impossible to rigorously describe those effects. In addition, in macromolecular heterogeneous systems, exchangeable protons may be present, which have intrinsic relaxation times far shorter than water molecules protons which they can exchange chemically with. When so, the mixing of protons due to the chemical exchange modulates, and sometimes even totally dominates the relaxation process of water protons. The magnetic site exchange model has been progressively developed due to a sound number of valuable contributions [2, 3, 4, 5], paying attention in particular both on porous systems, such as stony materials or zeolites, in which solvent molecules are not involved in direct chemical interaction with the material containing them [6, 7, 8, 9, 10]; and on heterogeneous systems capable of chemically interact with the solvent, as for instance macromolecular food matrixes, these being rich in protons that can exchange with those of the water molecules [1, 11, 12, 13, 14, 15].
MAGNETIC SITE EXCHANGE MODEL

Foods can be considered spatially heterogeneous systems having in their inside cavities or pores of different size, which can discriminate on a temporal scale the molecular motions of fluids, like water, naturally present inside them. NMR longitudinal and transversal relaxation times are physical-chemical parameters especially suitable for the study and characterization of heterogeneous systems in that they are sensible to the morphological characteristics of molecules, as well as to the dynamic phenomena the molecules are subject to. The experimental evidence generally found with NMR measurements of proton relaxation in heterogeneous systems is as follows:
To whom correspondence should be addressed: Department of Chemistry (V. Cagliolti Building), University of Rome La Sapienza. Box 34 Roma 62 P.le Aldo Moro, 5 00185 Roma Italy. Telephone: #39 06 49913307, fax: #39 06 490324, e-mail: elvino.brosio@uniroma1.it
Diffusive and Chemical Exchange Model

325
an increase in the relaxation rates of protons in water molecules with respect to those measured for pure water at the same temperature; the possibility for relaxation curves of being multi-exponential; a trend in relaxation times at varying temperatures different from the typical one of a relaxation dominated by the dipolar term, as evidenced for pure water; a characteristic dispersion trend of relaxation rates. In particular, the transversal relaxation rate at the varying time interval, cp, between two successive pulses at 180 in the Carr-Purcell-Meiboom-Gill (CPMG) sequence may show a typical sigmoid diffusive trend [1, 5].
All these characteristics can be well interpreted using the model of the magnetic site diffusive and chemical exchange. To be precise, by the term site we intend a local structure characterized by physical or chemical conditions different from those of another site. Moreover, by this term we mean to indicate that the Brownian motions that are responsible for NMR relaxation also cause a nucleus exchange among different sites [16]. The mathematical development of the model is based on the solution of Blochs equations as modified to explicitly include the effects of the exchange processes [2]. Their analytical solution is made possible by introducing different contour conditions, according to the system under study [3, 4], and obtaining the explicit expressions of the relaxation times observed. So, let us proceed step by step. Although the chemical exchange contribution should not be overlooked in foods where the observable 1H NMR is represented mainly by protons of water and fats in polysaccharide and/or protein matrices, our discussion will start with considering water-soaked heterogeneous systems without exchangeable protons. By that, we will be able to gradually deepen the study of our model and draw attention to the diverse implications case by case. In porous systems, water molecules are adsorbed, through weak physical interactions, on the solid matrix being preferentially surface oriented, thereby causing a distribution of correlation times of water molecules, such as to sensibly affect both longitudinal and transversal relaxation times [6, 17, 18]. Porous systems lead possibly to consider an -thick layer of water molecules physically adsorbed on the porous matrix. Because of their interactions with the cavity walls, these adsorbed molecules shall be characterized by relaxation times, being indicated with Ti,s, where subscript i = 1 or 2 are the longitudinal or transversal time constants, respectively. These relaxation times are considerably lower than those of the water inside the pore, that water not being affected by interaction with the wall. This bulk water is characterized by relaxation times, indicated with Ti,w, of the same order of magnitude as the relaxation times of pure water. Obviously, superficially adsorbed water molecules and those of bulk water can be interchangeable, with the latter capable of diffusing up to reach the material interface and exchange with the water molecules interacting with the porous surface [8, 12,19, 20]. The relaxation rates observed to be indicated with Ti,obs suffer the effect of the exchanging process between adsorbed water molecules and the bulk ones, as well as of the nature and morphology of the porous material. In particular, the balance among the different factors the observed relaxation rate depends on is determined by the surface relaxivity, indicated as s,i. The concept of surface relaxivity needs a thorough analysis. It may be defined as the relaxation force as determined by the wall and it depends on the chemical
1
326
physical nature of the adsorbing material, on thickening of the layer of the adsorbed water molecules, and on the difference between the relaxation rates of the adsorbed water molecules and the bulk ones [10]. Moreover, relaxivity as well shows a dispersion as a function of frequency, thus evidencing its not (exclusively) dipolar nature. The effect of surface relaxation can be also expressed by the relative or reduced relaxivity, ~s [11]
~ = a s s D
(1)
where a represents the characteristic pore size (e.g., the radius, in the case of a spherical geometry); and D, the coefficient of self-diffusion of bulk water molecules. The relative relaxivity is a dimensionless quantity, independent of the surface size, that measures the relaxation rate as determined by the surface in relation to the translational velocity toward the wall. The wall effect on the relaxation rates observed depends on the velocity, expressed to coefficient D, at which bulk water molecules are able to reach the interface with the porous matrix. More in detail, when the velocity they diffuse at toward the pore surface is higher than
D the surface relaxation rate, i.e., when ~s <<1 or s,i << regime of fast diffusive a
exchange or surface-limited regime , the observed relaxation rate is determined by interaction with the wall and it can be expressed the approximate equation [11]
1 Ti,obs
1 Ti,w
1 s,i a
(2)
In that case, within the spatial heterogeneity, diffusion mediates all, and the observed relaxation rate is linearly proportional to the surface relaxation force. On the contrary, when the surface relaxation rate at which bulk water molecules diffuse toward the surface is lower
D regime of slow diffusive than the surface relaxation rate, i.e., when ~s >>1 or s,i >> a
exchange or diffusion limited regime , relaxation rate is limitedly affected by the surface presence, and is determined by the value of self-diffusion coefficient D. The equation describing the observed relaxation rate is [11]
1 Ti,obs
1 Ti,w
2D 4 a2
(3)
Taking into account bulk relaxation and defining the dimensionless quantity
1 a2 ~ [11], that measures the relative bulk relaxation rate , at the bulk diffusion, R= Ti,w D
Diffusive and Chemical Exchange Model the condition of the fast diffusive exchange is expressed R <<1, or
327
1 D << 2 , whereas Ti,w a ~ the condition of slow diffusive or diffusion-limited exchange is expressed as R >>1, or 1 D >> 2 , respectively. Those conditions allow speculating on pure water, as follows: Ti,w a
considering a 25C temperature, at which intrinsic transversal relaxation time and the molecular self-diffusive coefficient of bulk water are T2,w 2 s and D 2.3 10-9 m2 s-1, respectively, for a surface-limited relaxation, the limit size of heterogeneity is << 70 m [11]. This means that water may be affected by the surface relaxation, whatever the surface force s, only if it is located in a spatial region much lower than 70 m (as it is the case of cell systems rich in very close membranes, as for instance, mitochondria or endoplasmatic reticulum). Such a speculation is fundamental since the surface relaxivity cannot be determined previously: Although this can be get out of through independent measures (e.g., stony materials), it is not so for foods or vegetable systems for which it is only possible to hypothesize the size of their surface relaxivity [11, 21]. Equations (2) and (3) quantitatively describe the values of the experimentally observed relaxation rates and allow the interpretation of whether the relaxation curves are possibly multi-exponential. This because the diffusive exchange in heterogeneous systems involves the casual jump among different volume elements along the spatial dimension. When the
~ diffusive exchange is fast i.e., ~s or R <<1 , so much that each magnetization density
~ contrary, when the diffusive exchange is slow i.e., ~s o R >>1 , the magnetization
vector associated to the water molecules samples all spatial regions in a very short time with respect to resonance frequency differences and/or intrinsic relaxation time differences, independently of the number of the diverse volume elements in the diffusive space Therefore, magnetization will be mediated on the entire volume and no heterogeneity is visible, that is to say, the relaxation curve will result to be mono-exponential. In that case, multi-exponential relaxation curves may be recorded only if the system can count on different kinds of compartments (a distribution) or different kinds of surfaces (different ~s values) [12]. On the
density vectors do not sample all the regions in a short time with respect to the frequency differences of resonances and/or intrinsic relaxation time. In that case, each volume element is associated with a magnetization vector that differs as for phase and amplitude from the neighboring ones. Thereby, a multi-exponential relaxation takes place, characterized generally speaking, by an infinite number of decaying times even in a single-compartment system [12, 14]. To note that in the limited-diffusion regime, relaxation is caused by the heterogeneity dimensions, and equation (3) allows quantification of the maximum diffusive distance, amax, that causes a mono-exponential relaxation curve. As a matter of fact, when dimensions are higher than amax, heterogeneity becomes so much large that it can no more be mediated by diffusion and the relaxation curve results to be multi-exponential. The discussion becomes more complex when pores connected with one another are considered. In a biological system this condition occurs in the presence of semi-permeable membranes. In the case of interconnection in the fast diffusive exchange regime, the relaxation observed is not limited by the surface relaxivity, but by the interconnection (or
328
permeability) [11]. Therefore, in the presence of two or more compartments separated by semi-permeable membranes, account should not be taken of the surface relaxivity, but of
2a permeability , or more in synthesis, of the relative permeability defined as ~s = s D [11]. So, the fast diffusion regime can be expressed by condition ~s <<1, and the relaxation
velocity observed is determined by permeability. In these instances, the discussion is also made about a membrane-limited regime and relaxation curves result to be bi-exponential. The condition of diffusion-limited relaxation is to be expressed by ~s >>1 and characterized by mono-exponential relaxation curves; in real cellular systems, however, cases of the kind are unknown [11]. Within a porous material, water molecules, beside being affected by the surface and by interconnections, if any, suffer as well the effect of the geometric restriction of motions. The smaller the size of pores and the weaker the interactions between the adsorbed water molecules and the wall, the more important the restriction effects become on the relaxation velocity observed. Let us now deal with foods in general as heterogeneous systems where water molecules interact with a macromolecular reticulum capable of exchanging protons with them. These systems were studied into deeper details by Belton and Hills [1, 11, 12, 13] in their working out of the diffusive and chemical exchange model. In porous systems, by the expression magnetic site exchange we have simply meant to indicate the diffusion-caused exchange among different sites, like bulk water interface with the surface and/or different pores. However, in heterogeneous systems of a macromolecular nature, beside the diffusive exchange between bulk water and interface of the macromolecular reticulum (where water molecules may be dynamically oriented), and between different physical domains (proper compartments), account should be also taken of the chemical exchange of nuclei among different sites. For instance, in foods a very important, if not determinant role is played by the chemical exchange between water protons and the exchangeable protons present on macromolecules, like those of groups OH, SH, NH, COOH, and so on, that are characterized by much shorter relaxation times than those of pure water [11]. In spatially heterogeneous systems, the effect of the chemical exchange on transversal and longitudinal magnetization should be dealt with, as it is with homogeneous systems, through generalization of Blochs equations, by addition of the chemical exchange terms and by the solution of the coupled differential equations as resulting from particular heterogeneity and morphologies. Unfortunately, this analytical approach is rather complex for a number of real morphologies and pulse sequences, in so much so that only a numerical solution becomes possible [14]. In particular, through this approach, Carver and Richards [5] have obtained an explicit expression, modified by Hills et al. [1], by which the relaxation time observed, T2,obs, is dependent on the time interval, cp, between the 180 pulses in the CPMG sequence. Carver and Richards equation expresses the observed relaxation rate in terms of relaxation rate in the two sites (the macromolecule exchangeable protons T2,b - and bulk T2, w ), exchange rate (kb) and chemical shift difference between the two sites (). The analysis of the diffusive curve by the modified Carter and Richards equation needs numerical methods and its complexity does not explain clearly the importance of the various terms [15]. To this
1 1
329
respect, Swift and Connicks equation [3] appears to be clearer and thence, more useful to our discussion. Their equation is deduced by diluted systems, that is where the fraction of protons on one site (in general, the fraction of protons of bulk water, Pw) is much higher than the one on the other site (the fraction of the macromolecule exchangeable protons, Pb = 1 Pw ), and in the limit of a cp , much longer than the average half life time on a site (cp>> k b )
1
1 T2, obs
1 T2, w
T 1 2 + T 1 k + ()2 Pb 2, b 2, b b + kb 2 Pw T2,1 + k b + ()2 b
( ) (
(4)
Further more, some limits for Swift and Connicks equation can be derived to better demonstrate the effects of the different parameters on the relaxation rate. In the limit of a fast chemical exchange with respect to either the relaxation time of the exchangeable protons or the inverse of the chemical shift difference (kb>>() e T2, b ), equation (4) becomes
1
1 T2, obs
1 T2, w
+ Pb
P () 1 + b T2, b kb
(5)
In the further hypothesis of measures made of low statistical magnetic fields (kb>>>()), equation (5) can be still simplified
1 T2,obs
1 T2,w
+ Pb
1 T2,b
(6)
to describe one limit case where no or very little diffusion is observed. The second limit case (that can be considered) is that of a small difference of chemical shift and of a slow chemical exchange with respect to the relaxation time of the exchangeable protons ( T2, b >>() e kb); in that case equation (4) becomes
1
1 T2, obs
1 T2, w
+ Pb k b
(7)
and relaxation is dominated by the exchange term, since it is the rate at which the nuclei experiment the very fast relaxation of the macromolecule site that determines the relaxation rate, though not being affected by T2b. Here, too, no diffusion is observed. Therefore, the absence of diffusion does not involve the absence of an exchange process, but only the existence of a limit condition [15]. Finally, in the limit case of a very short vcp with respect to the average half life (time) on a site (cp>> k b ), or of experiments at a low static magnetic field, the terms () can be
1
330
neglected. Also, again in the hypothesis of a diluted system (Pw>>Pb), the expression of the observed relaxation rate becomes
1 T2, obs
1 T2, w
T2, b + k 1 b
Pb
(8)
This expression is analogous to equation (5), describing the relaxation rate in the kb>>() and T2, b . At very short cp values, there is no enough time to make the chemical exchange occur, and consequently, it can not contribute to de-phasing, and the relaxation time shows no dispersion. Equation (8) has the advantage of describing the rate of proton relaxation in macromolecular heterogeneous systems under measurement conditions typical of CPMG experiments on food systems (high water content-diluted systems and very short sequence inter-pulse so as to mostly favour sampling of the decaying curve of the transversal magnetization). Also, all the parameters therein can be measured although in an approximate way. T2,w is the intrinsic relaxation time of the bulk water molecules in the system. At a first approximation, it can be estimated to be equal to the transversal relaxation time of pure water, but it may be determined by measures as a function of temperature or of the system composition [14, 22]. kb is the kinetic constant of a pseudo-first order of the proton exchange process and corresponds to the flex abscissa of the dispersion curve [5]. Should not a T2 diffusion be present as a function of cp, kb can be evaluated by data reported in the literature [23, 24]. T2b is the intrinsic relaxation time of the macromolecule exchangeable protons and can be assimilated to that of non exchangeable protons of the polymer itself, that can be measured through FID or CPMG experiments with a very short cp. To make equation (8) even more accessible, it is possible to re-write it as follows:
1
1 T2, obs
1 T2, w
f Pb, max
T2, b + k 1 b
(9)
where Pb,max is the theoretic fraction of the macromolecule exchangeable protons, that can be calculated by stoichiometry based on the chemical composition of the samples; and f is a parameter representing the percent of the macromolecule exchangeable protons which are accessible to the water molecules for the chemical exchange [25, 26, 27, 28]. As gave prominence our discussion, while in porous systems T1 and T2 can be discussed indifferently, in macromolecular heterogeneous systems, T2 is almost exclusively considered. The reason for this is first of all that a critical first step in the data interpretation of water relaxation times in heterogeneous system is the estimate of some parameters such as the kinetic constant kb , which is made possible by the analysis of T2 dispersion curve as a function of vcp in CPMG sequence. Furthermore, it can not be overlooked some experimental aspects in relaxation times measurement: while T2 can be carefully determined relatively easily and quickly by CPMG sequence, an accurate T1 determination can be challenging in heterogeneous systems, where, generally, T1 >> T2. Since, the longitudinal magnetization
331
recovery curve measurement by inversion recovery sequence requires a suitable series of recovery delays and long repetition time ( 5 T1), to ensure full longitudinal relaxation, often a low number of experimental points were measured for the T1 determination, and it was not possible always, by deconvolution of the curve, to calculate the same number of T1 components as those obtained by T2 measurements. Hence, care needs to be taken when comparing T1 and T2 of different components in heterogeneous systems, but the correspondence of the T1 values with T2 values can be likely enough in data interpretation, because the T1 /T2 ratio is a potentially useful information [29]. In fact, for water in heterogeneous systems, the T1/T2 ratio value provides evidence for anisotropy of molecular motions. Isotropic motion, with only one correlation time (c), is characterised by a value of T1/T2 between 1 and 1.6; for any deviations from isotropic motion, or for a distribution of c, T1/T2 ratio increases [30, 31]. To conclude (our discussion), it is important to emphasize that, despite the enormous potentialities of the magnetic site diffusive and chemical exchange model, this is not always easy to apply. Actually, if chemical and physical parameters kb and Pb can be obtained, other orders of magnitude like s,i are difficult to obtain by the experimenter; thence, the presence at times of rough approximations that are likely to limit, at least partially, the possible application of such a model. Anyway some interesting application of the diffusive and chemical exchange model to water dynamics study in food systems have been reported in the literature [24, 27, 28, 29, 32]. In the following some significative examples.
FOODS CHARACTERIZATION BY DIFFUSIVE AND CHEMICAL EXCHANGE MODEL: SOME EXAMPLES OF RELAXATION DATA ANALYSIS
In this Section, we report some examples of diffusive and chemical exchange model application to NMR relaxation data of food systems. In heterogeneous food systems different NMR relaxation times can be obtained for the more abundant components, i.e. water and lipids, as well as for the presence of different structural elements such as cellular organelles, proteinic structure or fat globules. Furthermore, as described above, water relaxation is affected by a food network structure as a result of water-macromolecules interactions. Therefore, not only translation and rotation of water molecules affect relaxation, but also diffusive and chemical exchange processes between water molecules and biopolymers strongly contribute to T2 and T1 values. The discussed systematic approach to proton NMR relaxation, based on the understanding of the effects of the diffusive and chemical exchange, can provide valuable information about water dynamic state and morphology of food sample, thus allowing for a thorough insight into the system physical structure and for NMR dynamic parameters to be related to the quality or evolution of samples.
332
1. Mozzarella di Bufala Campana Cheese

As a first example, we report herewith the low-resolution NMR results obtained from samples of the Mozzarella di Bufala Campana cheese, one of the most highly valued traditional Italian cheese, which has obtained the protected designation of origin (PDO) trademark from the European Community. Mozzarella cheese has got a well-organized microstructure that results from the stretching process, as shown by microscopic studies [33]. A network of parallel-oriented protein strands creates large open channels that are occupied by water and fat droplets. In our laboratory, transverse relaxation times were measured by CPMG pulse sequence at a low magnetic field. As expected, the Mozzarella di Bufala Campana cheese relaxation curves show a multi-exponential behaviour because of the presence of different components, i.e. water and lipids, as well as of different structural elements in the sample. The analysis of the transverse magnetization decay curve of Mozzarella cheese provides evidence to the presence of four components, characterised by different T2 values and amplitudes. The obtained results are reported in Table 1. As explained in detail in a previous paper [29], the following assignments to the four components were made:
serum water (T2,sw = 951 36 ms). The slow relaxation component was ascribed to water molecules remote from the casein network whose motion is unaffected by the presence of the protein. This is the water accumulated in the large open channels formed by protein fibres, with essentially the same properties as water in a solution, i.e. characterised by an isotropic motion. fat (T2,fat = 160 15 ms). The component whose transverse relaxation value is of the order of hundred milliseconds was assigned to protons of the lipid phase of Mozzarella cheese, on the basis of the lipid content in the water plus the fat phase of Mozzarella samples [29]. entrapped water (T2,ew = 47 3 ms). The component in the relaxation curve whose relaxation time value is of the order of few tens milliseconds can be ascribed to water molecules inside the meshes of the gel network made by casein molecules. This water can interact with the protein structure by diffusion from the bulk to the biopolymer interface, and its T2 value is controlled by a diffusive exchange. junction zone water (T2,jw = 7.3 0.4 ms). The fast relaxation component was attributed to water molecules trapped within casein junction zones. This water can be seen as an integral part of the protein structure, trapped within the casein matrix in an interstitial form. Its transverse relaxation time is essentially dominated by a fast chemical exchange with protein exchangeable protons (OH, COOH, NH, SH), which have a shorter T2 than water.
The observation in casein like-gel network of two relaxation components, junction zone water and entrapped water, is consistent with a regime of a slow diffusive exchange between water molecules in junction domains and inside gel meshes. This condition is defined by equation [11, 15]
333
Table 1. Proton transverse relaxation times and signal percentages of the four components of Mozzarella di Bufala Campana (by Caseificio Fratelli Francia) samples, at 8C
Component serum water fat entrapped water junctions zones water T2 (ms) 951 36 160 15 47 3 7.3 0.3 % 28 6 20 3 37 1 15 4
Data are the average of twelve samples, four from each of the three loaves of Mozzarella di Bufala Campana, and errors represent the standard deviations.
D 1 1 < 2 T2, jw T2,ew a
(10)
where a is the characteristic dimension of a spatial heterogeneity, D is the water self-diffusion coefficient and T2,jw, and T2,ew are the intrinsic relaxation times of water molecules in junction zones and inside meshes of casein network, respectively. Assuming that water diffusion in this compartment is the same as that for bulk water, and knowing D value for water to be at 8C, 1.4 10-9 m2 s-1 [34], by equation (10) water molecules diffusive domains in the casein like-gel network have been reckoned to have sizes larger than 4 m. Furthermore, since the ratio
D a
2
is nothing but the diffusive exchange rate constant, kdiff, a value of kdiff 116 s-1 for
diffusion of water molecules can be derived. The measured entrapped water relaxation is essentially controlled by a diffusive exchange from the bulk to the biopolymer interface, which acts as a relaxation surface sink, and surface relaxation will become significant. If relaxation on the surface is fast compared with diffusion to the surface diffusion limited relaxation regime the observed water transverse relaxation rate is independent of the effective surface relaxation strength and given by the equation (3) [12], where T2,obs and T2,w are the entrapped water and water protons intrinsic relaxation times. Assuming that T2,w = (2.50 0.01 s), as measured by an independent experiment [24], and water diffusion is in the order of that for bulk water, the equation (3) gives a maximum diffusive distance [12] a = 26 m. The latter is such in that has been calculated assuming that the compartment is bounded by extremely active surface relaxation sinks. The range of spatial heterogeneity for the entrapped water compartment size calculated by equations (10) and (3), 4 m < a < 26 m, is consistent with the mean value of <a> = 20 m derived by Einstein equation [35]
a = 6Dt
where the time t is equal to T2,ew.
(11)
334
Let us consider the T2 value of water molecules in junction zones of the casein network, T2,jw, which is dominated by the fast chemical exchange of water protons with exchangeable protons of casein molecules according to the equation (9), where Pb and T2,b are the casein exchangeable protons molar fraction and transverse relaxation time, respectively; kb is the pseudo-first order rate constant of chemical exchange between water and biopolymer. As reported in literature [15], T2,b is in the order of few tens of microseconds ( 50 s) and it can be neglected compared to kb-1 (3000 s-1) [15], Pb is given by the number of exchangeable protons in casein and can be estimated as about 0,02 [26], then from the measured T2,jw, a roughly value of kb 104 s-1 can be derived. The obtained values of diffusive and chemical exchange rate constants, kdiff 116 s-1 and kb 104 s-1, are in the same magnitude order as the values derived by Hills et al. [15] in a casein micelles suspension (~ 80%w/w). In their study about the dependence of the water proton transverse relaxation rate on the CPMG sequence pulse spacing (cp) at 100 MHz, the authors found a CPMG double dispersion curve with two mid-points, at 1/cp 1-2 102 s-1 and 3-6 103 s-1, respectively. From these values an estimate for diffusive and chemical exchange rate constants was obtained, the points of inflexion in the CPMG dispersion curve occurring when the pulse rate, 1/cp, equalled the diffusive and chemical exchange rates, respectively.
2. Rice StarchWater Samples

NMR relaxometry has been applied to probe the water distribution change in rice starch water systems during swelling and gelatinisation process. In particular, proton relaxation curves of rice flour starch (Baldo Japonica variety)water samples were measured and analysed to give information on dynamics of water molecules as well as on size and dispersion of diffusive domains. At the macromolecular level, starch granules present an organisation leading to a spherulite-like structure, with a radial cohesiveness due to the chain axis of the macromolecules and a tangential one induced by intermolecular bonds. These are responsible for the formation of crystalline regions by aggregation of a great number of chains. These crystallites are separated by amorphous regions. Inside a native starch granule, water molecules are distributed between crystalline and amorphous regions. [36] In our laboratory, water saturated suspensions of starch have been studied by lowresolution NMR. The samples have been prepared by addition of excess of distilled cold water to rice flour, so to reach the definite 1 : 3 starch to water ratio, the latter chosen on the basis of the DSC study. The starch system gelatinisation transition was at ca. 59C, as observed by DSC curves [28]. Proton transverse relaxation curves were measured by CPMG pulse sequence, at 20 and 64C. The measured transverse magnetization decay curves show a complex multi-exponential behaviour, dependent on measure temperature. The obtained results are reported in Table 2.
335
Table 2. Proton transverse relaxation times and signal percentages of different components in 1:3 starch (by Baldo Japonica variety)water samples, at 20 and 64C
T (C) component A B C D 20 T2 (ms) 1056 + 2 85 + 1 32 + 1 3,1 + 0,1 % 35 + 1 33 + 1 17 + 1 15 + 1 T2 (ms) 69 + 1 29 + 1 3,2 + 0,1 64 % 62 + 1 32 + 1 6+1
At 20C the transverse magnetization relaxation decay can be analysed by a quadriexponential curve, while at 64C, best fit for relaxation data gave a tri-exponential behaviour. This highlights a substantial change of waterstarch system with starch gelatinisation process. The micro structural complexity of starch does not make the assignment of NMR signals to sub-granular components so obvious. In starch-water systems relaxation is affected by the interior structure as a result of water-macromolecules interactions. Therefore, not only translation and rotation of water molecules affect relaxation, but also a diffusive and chemical exchange process between water molecules and carbohydrate, or other solutes, strongly contributes to T2 and T1 values. With reference to the data at 20C, the following assignments to the four components were made:
T2,A = 1056 2 ms. The slowly relaxing component is associated to extra-granular bulk water molecules, whose motion is no way affected by the presence of starch granules. These water molecules have essentially the same dynamic properties as water in a solution, i.e. characterized by an isotropic motion, as supported by T1/T2 ratio value near to unity (see Table 3). This assignment is furthermore well confirmed by the fact that this component vanishes by lowering the water content of samples down to a water saturation capacity of starch ca. 45% (data not shown). T2,B = 85 1 ms and T2,C = 32 1 ms. The intermediate relaxing components can be ascribed to nonexchangeable hydrogens of more mobile sub-granular starch components amylose and amylopectin CH protons [37] as well as to water protons interacting by diffusion with structured amylose and amylopectin in the starch amorphous regions. These water molecules are likely to interact with the polysaccharide structure by diffusion from the bulk to the biopolymer interface acting as a relaxation sink, while T2 values are controlled by diffusive exchange. The observation of two different T2 values may be consistent with the difference in the mobility of amylose and amylopectin chains, even if the relative percentages of these two components do not correspond to the amyloseamylopectin content measured in these samples (17% and 83%, respectively). Hence the two T2 values are more likely explained by a polydispersion in the radius (and geometry) of diffusive domains [38] following starch swelling. T2,D = 3.1 0.1 ms. The fast relaxation component can be associated to water molecules, trapped within amylopectin or amylose helices in the crystalline phase of starch. This transverse relaxation time is essentially dominated by a fast chemical exchange with amylopectin or amylose exchangeable OH protons, which have a T2 of the order of magnitude of tens microseconds [37].
336

Table 3. Proton longitudinal relaxation times and signal percentages of different components in 1:3 starch starch (by Baldo Japonica variety)water samples, at 20 and 64C
T (C) component A B
20 T1 (ms) 1076 + 48 147 + 9 % 53 + 1 47 + 1 T1 (ms) 512 + 11
64 %
As regards the relaxation rate of water interacting through a fast chemical exchange process with exchangeable OH protons of starch, the measured T2,d value is given by the equation (9), where T2,w is the water protons intrinsic relaxation time of water protons likely to be given by the measured T2,A value of bulk water external to starch domains and T2,obs is the fast relaxation component T2,D. Pb value can be calculated taking into account the sample composition and relative concentration of amylose and amylopectine starch fractions that have been measured by an independent experiment [28]. According to the measured values and considering the number of exchangeable hydrogens per monomeric unit for amylopectin ( 8 485 ) and amylose ( 3 162 ), the Pb = 0.0493 0.0004 is derived. A kb value can be obtained by exploiting the dispersion curve of the transverse relaxation time T2,D (obtained on the inter-pulse spacing cp value change in a CPMG sequence at 20C). From the mid-point abscissa of T2, D vs cp curve, a kb value of (11.546 0.1) 103 s-1 is obtained. [28]. Finally, we assumed for T2,b the value as measured by Tang et al. [37]. The authors found in the FID from the native potato starch dispersion in D2O, a main relaxation time Gaussian component at ca. 20 s, corresponding to hydrogens of rigid amylopectin and amylose in the semicrystalline lamella. Based on this finding, an f value of 0.69 0.02 has been derived. That means that, due to the helices structure of amylopectin and amylose crystalline phase, only about 69% exchangeable starch protons are actually accessible to water molecules. In fact, it is realistic to speculate that some of starch exchangeable hydrogens are not available to chemical exchange with water protons because directly used in the crystalline lattice formation. As far as the measured entrapped water in the different sub-granular starch domains, whose relaxation rate is essentially controlled by a diffusive exchange from the bulk to biopolymer interface, if relaxation on the surface is fast compared with diffusion to surface diffusion limited relaxation regime the observed water transverse relaxation rate is independent of the effective surface relaxation strength and it is given by the equation (3), where a is the radius of water filled compartment bound by surfaces relaxation sink 2a apart. On a smaller scale, a may describe the distance of the outside faces of super junction zones in the interstitial spaces of gels [12]. Assuming that water diffusion is in the order of that for bulk water, 2.023 10-9 m2 s-1, the equation (3) gives a maximum diffusive distance, a, of 21 m and 13 m for water molecules, whose T2,obs are T2,B = 85 ms and T2,C = 32 ms, respectively. These values of the diffusive domain size are consistent with the results of Ohtsuka et al. [39] who, by fitting echo attenuation data in diffusion measurements, according to the Meerwall Fergusons model, found pores dimensions in starch gels in the range 10-20 m, and with dispersion of spatial heterogeneity, 5-20 m, reported for a variety of starch1
337
based systems through SEM measurements [40] and diffusion data [41, 42]. That supports the hypothesis that the measured T2 values of T2,B = 85 ms and T2,C = 32 ms may be associated to water molecules in compartments of different sizes. So far the analysis of proton transverse magnetization decay curves has enabled having a more detailed insight into water dynamics and microscopic distribution of waterstarch samples. As shown by the T2 relaxation data reported in Table 2, by heating starch suspensions at 64C, substantial change was observed. The percentage of extra granular water disappeared. At the same time, water populations associated to water molecules interacting with amorphous regions inside starch granules were observed to increase. The percentages of B and C components (ca. 32% and 15%, respectively, at 20C) increased by 62% and 32%, respectively, at the temperature of 64C. Finally, it is further to be evidenced that the population of water molecules associated to the starch crystalline region, whose T2,D value is determined by a chemical exchange process with double helices OH protons, decreases from 15% to 6%. The change with temperature of the different water molecules starch populations, deducted by our interpretation of the relaxation data, is in agreement with the hypothetic mechanism of starch gelatinisation in water [43, 44], that presumed a first stage of uptake of water by the amorphous background region of the starch granules, followed by their subsequent rapid expansion. This swelling exerts a strong destabilizing effect on the crystallites contained within the crystalline lamellae. Eventually, these crystallites are disrupted and the crystallinity is progressively lost. To complete our study, proton longitudinal magnetization recovery curves were measured by IR pulse sequence, for the same water starch suspensions, at 20 and 64C. The obtained results are summarized in Table 3. The analysis of longitudinal magnetization decay curves measured for the same waterstarch samples gave two components before gelatinisation (at 20C), and only one component for the gel state (at 64C). Because of the lower number of experimental points measured by IR sequence, with respect to those sampled by CPMG sequence, the exponentials curve deconvolution is less accurate, thus it was not possible to estimate the same number of T2 components for longitudinal relaxation. Furthermore, being T1 in heterogeneous systems higher than T2, the exchange processes play a different role in determining the multiexponentiality of the recovery curve and resolution with respect to T1, which is generally lower than that of T2. For this reason, even if different T2 values are generally measured for water in heterogeneous systems, T1 curves are singleexponential [38]. The data reported in Table 3, however, provide evidence that in the swelling process we distinguish between an external water associated to T1,A values, typical of free water, whose dominant relaxation mechanism is the dipolar one, and an internal water whose T1,B is determined by interaction with starch components. After gelatinisation only one T1 value, associated to water in gel state is measured. Our results seem to give a more detailed description of water distribution in starch granules with respect to the one reported in the literature involving differing amounts of weakly and strongly bound water [36, 40]. Indeed, our description is based on the assumption that the different components in the relaxation curve are to be related to granule structure and not to the so-called bound water. That in agreement with the interpretation of Tang et al. [45], even if some differences have been found: an improved resolution of the transverse relaxation
338
decay curve, probably due a better choice of the measuring parameters in CPMG sequence, i.e., a cp inter-pulse spacing of 40 s (instead of 150 s), allowed the quadri-exponential deconvolution of rice starchwater samples transverse relaxation curve. Finally, some difference with the interpretation reported in the literature [45] has to be pointed out: we think the components characterized by T2 of the order of magnitude of tens milliseconds are to be associated to the water molecules inside starch granules, even if for water concentrations lower than starch saturation capacity, a T2 value of 50 ms may be also due to interstitial water molecules diffusing between the outside faces in super-junction zones of starchwater gel.
CONCLUSION
The potential of NMR relaxometry to investigate food water interaction has been exploited. By the analysis of proton relaxation curves different water population in food systems can be observed and that gave the possibility of a deeper insight about water dynamics and distribution in foods. Relaxation data interpreted by diffusive and chemical exchange model allowed not only for the explanation of the relaxation curves being multiexponential, but also of the quantitative rationalization of relaxation time absolute values. By that, additional information was obtained concerning the dimension of water diffusive domains, the kinetics constant of diffusive exchange and/or of water-macromolecule protons chemical exchange, and the fraction of macromolecular protons accessible to exchange with water. Over the years, many theories have been brought about to rationalize the relaxation data obtained for heterogeneous systems, but it was only in the 90s a theory was put forward by which the experimental evidence could be explained. This theory is known as the model of the chemical and diffusive exchange and allows the characterization from a chemical and physical standpoint of the system under study without resorting to the concept of bound water, a concept which, over the course of many years, the interpretation of the relaxation data has been based on. Through this model it is possible to obtain information concerning the constants of pseudo-first order of chemical exchange processes and also as regards the size and geometry of the diffusive domains. As against the former ones, the above theory has basically introduced in Blochs equation some terms relative to the diffusion of bulk water molecules toward the matrix of the system under study and to the chemical exchange phenomenon that may occur among exchangeable protons of the system with water protons. The one process prevailing over the other leads brings forth mathematical equations capable of rationalizing the decay curves of transverse magnetization as recorded for heterogeneous systems. Although being extremely effective, the diffusive and chemical exchange model is not always easy to apply in that it calls for the knowledge of terms that are difficult to be obtained experimentally: so, those difficulties have induced to the employment of expressions that are equivalent to those obtained in the chemical and diffusive exchange model, but more easily accessible at the level of the experimental parameters.
339
REFERENCES
[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] Hills, B. P.; Takacs, S. F.; Belton, P. S. Mol.. Phys. 1989, 67 (4), 903-918. McConnell, H. M. J. Chem. Phys. 1958, 28 (3), 430-431. Swift, T. J.; Connick, R. E. J. Chem. Phys. 1962, 37 (2), 307-320. Luz, Z.; Meiboom, S. J. Chem. Phys. 1964, 40 (9), 2686-2692. Carver, J. P.; Richards, R. R. J. Magn. Reson. 1972, 6 (1), 89-105. Zimmerman, J. R.; Brittin, W. E. J. Phys. Chem. 1957, 61 (10), 1328-1333. DOrazio, F.; Tarczon, J. C.; Halperin, W. P.; Eguchi, K.; Mizusaki, T. J. Appl. Phys. 1989, 65 (2), 742-751. DOrazio, F.; Bhattacharja, S.; Halperin, W. P.; Eguchi, K.; Mizusaki, T. Phys. Rev. B 1990, 42 (16), 9810-9818. Korb, J. P.; Delville, A.; Shu Xu; Demeulenaere, G.; Costa, P.; Jonas, J. J. Chem. Phys. 1994, 101 (8), 7074-7081. Korb, J. P.; Godefroy, S.; Fleury, M. Magn. Reson. Imag. 2003, 21 (3-4), 193-199. Belton, P. S.; Hills, B. P. Mol. Phys. 1987, 61 (4), 999-1018. Belton, P. S.; Hills, B. P.; Raimbaud, E. R. Mol. Phys. 1988, 63 (5), 825-842. Hills, B. P.; Wright, K. M.; Belton, P. S. Mol. Phys. 1989, 67 (1), 193-208. Hills, B. P.; Wright, K. M.; Belton, P. S. Mol. Phys. 1989, 67 (6), 1309-1326. Hills, B. P.; Takacs, S. F.; Belton, P. S. Food Chem. 1990, 37 (2), 95-111. Woessner, D. E. Concept Magn. Reson. 1996, 8 (6), 397-421. Zimmerman, J. R.; Lasater, J. A. J. Phys. Chem. 1958, 62 (10), 1157-1163. Woessner, D. E. J. Chem. Phys. 1963, 39 (11), 2783-2787. Liu, G.; Li, Y.; Jonas, J. J. Chem. Phys. 1991, 95 (9), 6892-6901. Korb, J. P.; Shu Xu; Jonas, J. J. Chem. Phys. 1993, 98 (3), 2411-2422. Brownstein, K. R.; Tarr, C. E. Phys. Rev. A 1979, 19 (6), 2446-2453. Watanabe, T.; Murase, N.; Staemmler, M.; Gersonde, K. Magn. Reson. Med. 1992, 27 (1), 118-134. Brosio, E.; Barbieri, R.; Gianferri, R. In Recent Research Developments in Polymer Science; Pandalai, S. G. Ed.; Transworld Research Network: Kerala, India, 2002, pp 177-196. Gianferri, R.; DAiuto, V.; Curini, R.; Delfini, M.; Brosio, E. Food Chem. 2007, 105 (2), 720-726. Hills, B. P.; Cano, C.; Belton, P. S. Macromol. 1991, 24 (10), 2944-2950. Gottwald, A.; Creamer, L. K.; Hubbard, P. L.; Callaghan, P. T. J. Chem. Phys. 2005, 122 (3), 034506-1-10. Raffo, A.; Gianferri, R.; Barbieri, R.; Brosio, E. Food Chem. 2005, 89 (1), 149-158. Ritota, M.; Gianferri, R.; Bucci, R.; Brosio, E. Food Chem. 2007, accepted DOI: 10.1016/j.foodchem.2008.01.048. Gianferri, R.; Maioli, M.; Delfini, M.; Brosio, E. 2007 Int. Dairy J. 17 (2), 167-176. Brosio, E.; DUbaldo, A.; Carnevale, E.; Giusti, A. M. Cell. and Mol. Biol. 1993, 39 (2), 199-204. Belton, P.S. Int. J. Biol. Macromol. 1997, 21 (1-2), 81-88. Brosio, E; Barbieri, R. Rev. Anal. Chem. 1996, 15, 273-291. McMahon, D. J.; Fife, R. L.; Oberg, C. J. J. Dairy Sci. 1999, 82 (7), 1361-1369.
[24] [25] [26] [27] [28] [29] [30] [31] [32] [33]
340
[34] Holtz, M.; Heil, S. R.; Sacco, A. Phys. Chem. Chem. Phys. 2000, 2, 4740-4742. [35] Einstein, A. Investigation on the theory of the Brownian movement. Translated by A. D. Cowper; Dover Publications: Mineola, NY, 1956, pp. 35-44. [36] Le Boltan, D.; Rugraff, Y.; Martin, C.; Colonna, P. Carbohydr. Res. 1998, 308, 29-36. [37] Tang, H. R.; Brun, A.; Hills, B. P. Carbohydr. Polymers 2001, 46, 7-18. [38] Hills, B. P.; Godward, J.; Manning, C. E.; Biechlin, J. L.; Wright, K. M. Magn. Reson. Imag. 1998, 16 (5/6), 557-564. [39] Ohtsuka, A.; Watanabe, T.; Suzuki, T. Carbohydr. Polymers 1994, 25, 95-100. [40] Charles, A. L.; Kao, H.; Huang, T. Carbohydr. Res. 2003, 338, 2403-2048. [41] Hills, B. P. Magnetic Resonance Imaging in Food Science. Wiley: New York, NY, 1998, pp. 205-241. [42] Meerwall, E.; Ferguson, R. D. J. Chem. Phys. 1981, 74, 6956-6959. [43] Donovan, J. W. Biopolymers 1979, 18, 263-275. [44] Jenkins, P. J.; Donald, A. M. Carbohydr. Res. 1998, 308, 133-147. [45] Tang, H. R.; Godward, J.; Hills, B. P. Carbohydr. Polymers 2000, 43, 375-387.
Chapter 9
EFFECT OF SOME REACTIONAL PARAMETERS IN AN ENZYME ASSISTED PROCESS FOR HYDROLYSING WHEY PROTEINS
Raquel Linhares Carreira, Eliza Augusta Rolim Biasutti, Wendel de Oliveira Afonso, Viviane Dias Medeiros Silva and Marialice Pinto Coelho Silvestre*
UFMG / Faculdade de Farmcia / Depto. de Alimentos Av. Antnio Carlos 6627 - 31270-901 Belo Horizonte, MG, Brazil
ABSTRACT
Whey proteins were hydrolyzed by an enzymatic process using two proteases and the influence of some reactional parameters, such as enzyme type, E:S ratio and reaction time was evaluated. Aiming the analysis of peptide profiles, the protein hydrolysates were fractionated by size-exclusion-HPLC and the rapid Correct Fraction Area method was used for quantifying peptides and free aminoacids. The peptide profiles obtained by the two enzymes were similar giving rise to average amounts of 21.42%, 39.70%, 10.73% of large, oligo and di-/tripeptides, respectively, as well as 39.34% of free aminoacids. For subtilisin, the best result was obtained for an E:S of 2:100 and 15h of hydrolysis, while for pancreatin this same result was observed for an E:S of 2:100 with a reaction time of either 10h and 15h as well as for an E:S of 4:100 after 15h of hydrolyisis.
INTRODUCTION
The improvement of protein utilization may be attained by hydrolysis, since the enzyme assisted process may be controlled giving rise to large quantities of oligopeptides. These
*
Corresponding author. Dr. Marialice Pinto Coelho Silvestre. Food Science, PhD. Phone: + 55 - 31- 3499-6919 or 6928 - Fax: 3499-6988 or 6730. Email: malice@farmacia.ufmg.br
342
Raquel Linhares Carreira, Eliza Augusta Rolim Biasutti et al.
peptides, especially di- and tripeptides, are more quickly and completely absorbed than intact protein and free aminoacids (Grimble & Silk, 1989; Ziegler et al., 1990; Minami et al, 1992; Keohane et al., 1985; Boza et al., 1995; Synowiecki et al., 1996). In this way, enzymatic protein hydrolysates containing short-chain peptides are highly desired for specific formulations. They show important advantages with respect to elemental diets, in which the protein component consist exclusively of a mixture of free aminoacids (Mannheim and Cheryan, 1992). In fact, studies of absorption mechanisms revealed that in the case of small peptides the competition for the transport system is lower than that observed for free amino acids (Grimble et al., 1986; Frenhani and Burini, 1999;Clemente, 2000). Enzymatic treatment shows several advantages over the chemical one, like the possibility of controlling the degree of hydrolysis, the milder conditions used, the lower cost, the lower salt content in the final product and the minimum formation of by-products (Cheftel et al., 1989; Mannheim and Cheryan, 1992; Pearce, 1995). Moreover, the removal of the enzymes from the reaction system is, generally, not needed and if so it is easier than for other catalysers, since they are used in low concentrations (Reed, 1975). Another advantage of the use of enzymes is associated with the formation of oligopeptides that are nutritionally beneficial and required in dietary supplements (Anantharaman and Finot, 1993; Siemensma et al., 1993). Several proteolytic enzymes have been used for preparing protein hydrolysates with dietary applications (Boza, et al, 1995; Neto, & Galeazzi, 1998; Clemente, 2000; Morato, et al, 2000; Lopes, 2005; Carreira, 2004, Soares, 2006). After having tested some enzymes for this purpose, we decided to use a subtilisin and a pancreatin in this work for the first time. The enzymatic hydrolysis of proteins may be affected by some factors and, consequently, the final nutritional quality of hydrolysates are the same. Among these factors we can find the type and the association of enzymes; the enzyme:substrate ratio; the pH, the length and temperature of the reaction; the presence of ions and the thermal treatment fo the susbrate (Adler Nissen, 1981; Chobert et al,1988a,b). Among several protein sources that may be used for preparing protein hydrolysates, isolated casein, the main milk protein, is the choice in most cases (Lopez-Bajonero , 1991; Outinem et al, 1996). However, in underdeveloped countries, this protein needs to be imported which represents an important increase in production costs. Thus, the use of alternative sources must be investigated, such as whey, whose proteins are ready assimilated by the organism, showing a high protein efficiency ratio (Nicolau, 2005). Also, the use of whey may contribute to reduce the environment pollution. Our interest in protein hydrolysates is associated with the preparation of dietetic supplements for several purposes. In this way, we have been testing different protein sources, enzymes and hydrolytic conditions in order to have an appropriate peptide profile from the nutritional point of view, i.e., a high oligopeptide content (Morato et al., 2000; Morais et al., 2002; Carreira et al., 2001; 2004). Also, for many years we have been examining several analytical methods of protein hydrolysates (Silvestre et al., 1993a,b; 1994a,b;1997). For characterizing the peptide profiles of protein hydrolysates, we developed a technique which consists in first fractionation of peptides lower than 1000 Da according to their chain size, followed by a quantification of these peptides by a rapid method based on the estimation of the corrected fraction area, after the removal the influence of aromatic amino acids (Silvestre et al., 1994a; b).
Effect of Some Reactional Parameters in an Enzyme Assisted Process ...
343
In this work, a subtilisin and a pancreatin were used for hydrolyzing whey proteins and the effect of some parameters on the peptide profile was studied.
MATERIAL AND METHODS

Material
A pancreatin (Corolase PP, from porcine pancreas, Activity = 18,9 U/mL, where one unit of activity is defined as the amount of enzyme that liberates 1 g of tyrosine in one min at 37C) was kindly furnished by AB Enzymes (Barueri, SP, Brasil). A subtilisin (Protemax N200, from B. subtillis, Activity = 12,4 U/mL, where one unit of activity is defined as the amount of enzyme that liberates 1 g of tyrosine in one min at 37C) was kindly furnished by Prozyn (So Paulo, SP, Brazil). Whey (Kerrylac 700, demineralized), in a powder form, was kindly furnished by Kerry of Brazil Ltda. (Trs Coraes, Minas Gerais, Brazil). The HPLC system consisted of one pump (HP 1100 Series), an UV-VIS detector, coupled to a computer (HPchemstation HP1100, Germany). A poly (2-hydroxyethylaspartamide)-silica (PHEA) column, 250 x 9.4 mm, 5m, 200 pore size (PolylC, Columbia, MD), was used for HPLC. For HPLC, water was purified by passage through a water purification system (AriesVaponics, Rockland, EUA). All solvents used for the HPLC were carefully degassed by sonication for 10 min before use. The freeze dryer was from Labconco (77500 model, Kansas City,MI, USA), and the stirrer from Fisatom (So Paulo, SP, Brazil).
Methods
Determination of the Chemical Composition of Whey The contents of moisture, protein, lipid, minerals were determined according to the Association of Official Agricultural Chemists methods (Aoac, 1995). The carbohydrates were calculated by difference. The conversion factor of nitrogen to protein was 6.38 (Nielsen, 1998). Preparation of Whey Hydrolysates Twelve hydrolysates were prepared, 06 with subtilisin and 06 with pancreatin. The pH of 15% (w/v) whey solutions was adjusted to 7.0 with a 3 mol/L Na2CO3 solution. The solutions were heated in an oil-bath at 55C, under continuous stirring, and the enzyme was added in such a concentration to attain the desired enzyme:substrate ratios. The hydrolytic reactions were stopped by heating at 85C for 20 min. The hydrolysates were freeze-dried and indentified by different names (Table 1).
344
Table 1. Hydrolytic conditions employed for preparing whey protein hydrolysates

Hydrolysates b S1 b S2 b S3 b S4 b S5 b S6 c P1 c P2 c P3 c P4 c P5 c P6
a b
E:S 1:100 2:100 4:100 1:100 2:100 4:100 1:100 2:100 4:100 1:100 2:100 4:100
Reaction Time (h) 10 10 10 15 15 15 10 10 10 15 15 15
E:S = enzyme:substrate ratio. S = hydrolysates prepared with subtilisin. c P = hydrolysates prepared with pancreatin.
Characterization of Peptide Profiles of Whey Hydrolysates This characterization was performed in two stages: fractionation of the peptides, according to their size, followed by their quantification. The fractionation of whey hydrolysates was carried out by Size-Exclusion HPLC (SE-HPLC) on a PHEA column, according to the method developed by our group (Silvestre and others 1994a,b), using 0.05 mol L-1 formic acid as the mobile phase at a flow rate of 0.5 mL min-1. Twenty microliters of 0.4 % hydrolysate solutions were injected on the column. Peptides were detected at three wavelengths: 230, 280 and 300nm. The fractions were separated according to the elution time: F1, from 13.2 to 18.2 min (large peptides with more than 7 amino acid residues); F2, from 18.2 to 21.7 min (medium peptides, with 4 to 7 amino acid residues); F3, from 21.7 to 22.7 min (di- and tripeptides); and F4, from 22.7 to 32 min (free amino acids). The rapid method of Correct Fraction Area (CFA) developed by our group (Silvestre and others 1994a,b) was used for quantifying peptides and free amino acids in SE-HPLC fractions of whey hydrolysates. The samples were fractionated and the CFA values calculated with aid of a standard curve, prepared by using whey as the substrate. Briefly, five whey standard hydrolysates (two using trypsin and three using pancreatin) were prepared and then fractionated in four fractions by SE-HPLC, as described above. The four fractions were collected and submitted to an amino acid analysis. The calculation of CFA was performed using the formulas described by Silvestre (1994b). A standard curve was drawn correlating the CFA with the amino acid contents of the fractions. In order to find the amino acid contents of the whey hydrolysates prepared by using the subtilisin and the pancreatin described bellow, their CFA were taken to this curve.

Table 2. Chemical composition of whey
Nutrients Moisture Protein Lipids Total ash Total sugars Values founda 2.63 13.54 0.75 5.11 77.97 SILVA et al. (2005)b 3.51 11.82 0.85 8.72 67.47 USDA (2006)c 3.19 12.93 1.07 8.35 74.46
345
All the values are in g/100g. a Values found in the present work. b Values found in whey from Prolcteos Indstria e Comrcio Ltda (Contagem, MG, Brazil). c Values from USDA National Nutrient Database for Standard Reference, Release 19, 2006.
Statistical Analysis All experiments were replicated three times and all measurements were carried out in triplicate. Differences between means of areas were evaluated by analysis of variance (ANOVA) and Duncan test (Pimentel-Gomes, 2000). Differences were considered to be significant at p<0.05 throughout this study. The least square method was used to fit the standard curve and the adequacy of the linear model (y = ax + b) was tested at p<0.05. The factorial analysis was used to evaluate peptide and free amino acid contents of chromatographic fractions. The analysis of variance was performed for each condition, in order to investigate the presence of significant effects among treatments (p<0.05), and in these cases the Duncan test was applied to establish the differences among the means (Pimentel-Gomes, 2000).
Figure 1. Chormatographic pattern of a whey hydrolysate (S1) at 230nm. F1: large peptides (> 7 aminoacid residues); F2: medium peptides (4 to 7 aminoacid residues); F3: di- and tripeptides; F4: free amino acids. Y = tyrosine peak, W = tryptophan peak. Hydrolysate S1: substrate concentration = 10%, E:S = 1%.
346
RESULTS AND DISCUSSION

Chemical Composition of Whey
The results of the analysis of some components of whey are shown in Table 2. In general, the values found here are close to those of the literature, although several factors such as the animal, the feed, the climatic conditions may interfere in the milk and therefore whey composition (Embrapa, 2006). Moreover, the analytical method used may also influence the results. The ash content found here is lower than those of the literature because the whey used here was a demineralized one.
Chromatographic Patterns of Whey Hydrolysates

The whey hydrolysates were resolved in four fractions, as can be seen in a typical chromatographic pattern shown in Figure 1. The SE-HPLC technique used here showed to be efficient in fractionating whey hydrolysates, especially peptides of molecular mass lower than 1,000 Da. These results were previously reported by our group using different protein sources such as fluid whey (De Marco et al., 2005; Silva et al., 2007; Delvivo et al., 2006), casein (Morato et al., 2000; Carreira et al., 2004; Morais et al., 2005; Barbosa et al., 2004) and milk (Lopes et al., 2005; Soares et al., 2006) and rice (Bizzoto et al., 2006)..In these works using whey, the enzymes were different from those used here and were immobilized in two supports. The fractionation of protein hydrolysates based on peptide chain length has been described by several authors. However, most of the described techniques concerns the separation of peptides of high molecular mass (> 1,000 Da). The main reported methods are sodium dodecyl sulfate-polyacrylamide gel electrophoresis, SDS-PAGE (Schimidt and Poll, 1991; Gallagher et al., 1994; Perea et al., 1993); size-exclusion chormatography, SEC (Amiot and Brisson, 1980; Vallejo-Cordoba et al., 1986; Deeslie and Cheryan, 1988; Adachi et al., 1991; Zhang et al., 1992; Parrado et al., 1993); capillar HPLC (Davis and Lee, 1992); ligand exchange-HPLC, LE-HPLC (Ford et al., 1986; Armstead and Ling, 1991; Aubry et al., 1992) and SE-HPLC (Chobert et al., 1988a; Lemieux and Amiot, 1989; Lemieux and Amiot, 1990; Visser et al., 1992). These techniques showed some inconvenience, like hydrophobic and electrostatic interactions between solute molecules and the matrix (Kopaciewicz and Regnier, 1982; Golovchenko et al., 1992), and the inefficiency in separating small peptides (Veurneil et al., 1990; Lemieux et al., 1991). The use of SEC and LE-HPLC showed to be able to separate only peptides from amino acids. The SE-HPLC and capillar HPLC failed to separate peptides based on their chain length and several molecular weight overlaps have been reported (Lemieux and Amiot, 1989; Lemieux and Amiot, 1990; Davis and Lee, 1992).
PEPTIDE AND AMINOACID CONTENTS OF HYDROLYSATES

The amount of peptides and free aminoacids of the hydrolysates is shown in Table 3. The statements of some authors were considered for evaluating the peptide profiles of whey
347
hydrolysates. Thus, according to Frenhani and Burini (1999), the first stage of the hydrolytic process of proteins in their metabolic pathway, produces oligopeptides containing 2 to 6 aminoacid residues and free aminoacids. Then, these peptides are broken to di- and tripeptides. Finally, the proteins are absorbed in the form of di- and tripeptides as well as of free aminoacids, where the absorption of the formers is quicker. Gonzlez-Tello et al. (1994) also reported the advantage of the di-and tripetides over the free aminoacids, concerning the velocity of absorption. Among the hydrolysates prepared with subtilisin, S5 (E:S = 2%, Time = 15h) showed the best peptide profile, because it contains the lowest large peptide content (22,91%) and the highest amount of oligopeptides (41,77%), especially di- and tripeptides (10,77%), as well as of free aminoacids (35,29%). Concerning the use of pancreatin, no important difference was observed among the peptide profiles of three hydrolysates. Thus, P2, P5 and P6 contains the highest amount of oligopeptides (37.82%, in average), especially di- and tripeptides (10.69%, in average). Moreover, their free aminoacid contents were high (42.58%, in average) and those of large peptides were low (19.58%, in average). Although P3 and P4 showed the lowest large peptide content (15.15%, in average), their amount of free aminoacids was extremely high (54,98%, in average) which may be an inconvenient, since it can make the hydrolysate hyperosmotic and be responsible for causing intestinal secretion and consequently diarrhea (Gonzlez-Tello et al., 1994). Also, the level of oligopeptides of P4 was the lowest one (27,47%).
Table 3. Peptide and free aminoacid contents of chromatographic fractions of whey hydrolysates
Hydrolysates F1 (> 7 AA residues) 58.66 b/1 52.63 c/1 51.97c,d/1 49.74c,d/1 22.91 f/3 77.36 a/1 25.66 e/2 21.83 f/3 15.01 i/3 15.29 i/3 19.10f,g/3 17.82 h/3 F2 (4 - 7 AA residues) 17.60 e/2 16.80 e/3 17.40 e/3 16.97 e/3 31.00 a/2 11.96 f/2 25.08b,c/2 27.01b,c/2 22.62 d/2 21.80 d/2 26.71b,c/2 27.62 b/2 F3 (2-3 AA residues) 5.49 c,d/3 6.27 c,d/4 6.12 c,d/4 6.45 c/4 10.77a,b/4 2.77 e/4 5.11 d/3 11.34 a/4 9.61 b/4 5.67 c,d/4 10.34 a,b/4 10.44 a,b/4 F4 (Free AA) 18.23 h/2 24.29 g/2 24.48 g/2 26.83 f/2 35.29 e/1 7.90 i/3 44.13 c/1 39.80 d/1 52.74 b/1 57.21 a/1 43.84 c/1 44.10 c/1 F2 + F3 (2 - 7 AA residues) 23.09f 23.07f 23.52f 23.47f 41.77a 14.73g 30.19d 38.35b 32.23c 27.47e 37.05b 38.06b
S1 S2 S3 S4 S5 S6 P1 P2 P3 P4 P5 P6
The values are in % of nnmols of the four fractions and represent the means of triple repetition. Different numbers are significantly different (p<0.05) for different fractions of the same hydrolysate. Different letters are significantly different (p<0.05) for the same fraction of different hydrolysates. AA = aminoacid. S = hydrolysates prepared with subtilisin. P = hydrolysates prepared with pancreatin.
348
No report concerning the action of subtilisin on the peptide profile of whey hydrolysates was found in the literature. Our group evaluated this effect for casein hydrolysates, using a subtilisin (Carlsberg, Sigma, from B. Licheniformis) different from that used here and obtained much higher di- and tripeptide (36%) and lower large peptide contents (14%). However, the substrate concentration used in this study was 120 times lower (0.125% of casein) than that one used here (15% of whey), which would increase the costs associated to the drying stage, a serious inconvenient for scaling-up the process. Regarding the use of pancreatin for hydrolysing whey, no report from other authors was found in the literature. However, we studied before the effect of a pancreatin, purchased from a different company (Sigma Chemical, St. Louis, MO, EUA), on the peptide profile of whey hydrolysates, using different hydrolytic conditions. In this study (Silva et al., 2007), the pancreatin was immobilized on activated carbon, and the hydrolysis was performed at a lower temperature (300C) and E:S ratio (0.01%) than those used here. The peptide profile obtained was inferior from those of the present work for P2, P5 and P6 concerning the much higher large peptide (58%) and the much lower free amino acid contents (2%). In respect to the oligopeptides, no important difference between the two works was shown (40%, in this last study), but the amount of di- and tripeptides was higher (15%, in this last study).
COMPARISON BETWEEN DIFFERENT ENZYMATIC TREATMENTS

No report was found in the literature concerning the effect of hydrolytic parameters in the action of a subtilisin on whey. Therefore, the results of this work were compared with those obtained for this enzyme using casein as substrate. For pancreatin, some works in the literature were made with whey, but using different reaction conditions from those used here.
Effect of Enzyme Type

Comparing the best results obtained by the use of the two enzymes (S5 and the average values of P2, P5 and P6), it can be inferred that the action of subtilisin and pancreatin on whey, in the reaction conditions employed here, produced similar peptide profiles, giving rise to 22,91% and 19.58% of large peptides, 41,77% and 37.82% of oligopeptides, 10,77% and 10.69% of di and tripeptides, 35,29% and 42.58% of free aminoacids, respectively. The slight advantage of pancreatin over subtilisin is related to its lower production of large peptides and higher of free aminoacids. Also, the number of hydrolysates that presented the best peptide profiles was higher for pancretin than for subtilisin (3 and 1, respectively).
Effect of E:S Ratio

For assessing the influence of the E:S ratio of the subtilisin action on whey, the following comparisons must be made: 1. reaction time of 10h = S1 with S2 with S3 (E:S = 1, 2 and 4:100; 2. reaction time of 15h = S4 with S5 with S6 (E:S = 1, 2 and 4:100). The data in Table 3 show that, for a reaction time of 10h, no significant difference was observed between the
349
peptide profiles obtained with E:S of 2 and 4:100 and a slight advantage of these two conditions over 1:100 is related to lower large peptide and higher free aminoacid contents. In the case of a longer reaction time (15h), the E:S of 2:100 produced the best peptide profile, as described above for S5. Contrarily, in a previous study of our group, the use of a E:S ratio of 4:100 was more advantageous than 2:100, for the peptide profile of casein hydrolysates prepared by using another subtilisin for 5h (Carlsberg, from Sigma Co.), leading to a lower large peptide (30% to 14%) and higher olipeptide contents (44% to 82%) (Morato et al., 2000). No data from other authors was found in the literature, concerning the effect of E:S in the action of a subtilisin on the peptide profiles of whey hydrolysates In the case of pancreatin, the effect of E:S ratio in the whey hydrolysis may be estimated by comparing the following conditions: 1. reaction time of 10h = P1 with P2 with P3 (E:S = 1, 2 and 4:100); 2. reaction time of 15h = P4 with P5 with P6 (E:S = 1, 2 and 4:100). It can be seen in Table 3 that using 10h reaction an E:S of 2:100 was the more advantageous, mainly due to its higher oligopeptide content, especially that of di- and tripeptides. For a longer reaction time (15h), the E:S of 2 and 4:100 produced similar peptide profiles which were superior than that obtained with an E:S of 1:100, especially concerning their higher oligopeptide and di- and tripeptide contents. The only studies concerning the effect of E:S in the action of a pancreatin on whey hydrolysis, we found in the literature were those developed in our laboratory. In these works, the peptide profiles were analysed only after the treatment of whey hydrolysates by activated carbon (AC) for removing phenylalanine. Thus, using a different pancreatin (Carlsberg, from Sigma Co.) immobilized on AC and a substrate concentration of 10%, It was shown by SILVA et al. (2005) that the use of a E:S of 0.01:100 produced a better peptide profile than 1:100, notably concerning the oligopeptide content (8 and 40%, respectively). In the second study, using this same enzyme in batch, and a more diluted substrate solution (1%), Delvivo et al., 2006 reported that the E:S (0.01:100 and 1:100) showed no effect on the peptide profiles of whey hydrolysates.
Effect of Reaction Time

The evaluation of the effect of reaction time in the action of subtilisin on whey hydrolysis, can be done by comparing the following hydrolysates: S1 with S4 (E:S = 1:100), S2 with S5 (E:S = 2:100, S3 with S6 (E:S =4 :100). The data in Table three show that a longer reaction time (15h) was more favorable in two of the three cases (E:S = 1:100 and 2:100), giving rise to a better peptide profile. Thus, S4 showed smaller large peptide and higher free aminoacid contents than S1, while S5 besides these same advantages in relation to S2, showed higher amount of oligopeptides, especially di- and tripeptides. Concerning the action of pancreatin, the effect of reaction time must be estimated by comparing the following hydrolysates: P1 with P4 (E:S = 1:100), P2 with P5 (E:S = 2:100, P3 with P6 (E:S =4 :100). Similarly to subtilisin, in the action of pancreatin, the time of 15h showed to be more advantageous in two of the three cases, although the values of E:S were not exactly the same (E:S = 2:100 and 4:100) and the benefit of 15h over 10h was not so evident. Thus, in one case (P2 with P5), the peptide profiles obtained at 15h and 10h were very similar and the only advantage of 15h was associated with its higher free amino acid content. In case of P3 and P6, the values favor slightly 10h, except for those of oligopeptides
350
which were higher for 15h than for 10h. Finally, we considered 10h superior to 15h when comparing P1 with P4, just because the free aminoacid content obtained at 15h was extremely high. No reports were found in the literature concerning the effect of the reaction time on the peptide profile of whey hydrolysates.
CONCLUSION
Subtilisin as well as pancreatin were similarly able to hydrolyze whey and produce an appropriate peptide profile, having reached an average oligopeptide content of 39.70%. The E:S and the reaction length influenced the distribution of peptides and free aminoacids of the hydrolysates, in a such way that the best results for subtilisin was obtained for an E:S of 2:100 and 15h of hydrolysis, while for pancreatin two of the three values tested for E:S (2:100 and 4:100) and for hydrolysis time (10h and 15h) produced the more suitable peptide profile.
ACKNOWLEDGEMENTS
The authors thank CNPq, CAPES and FAPEMIG for their financial support.
REFERENCES
Adachi, S; Kimura, Y; Murakami, K; Matsuno, R; Yokogoshi, H. Separation of peptide groups with definite characteristics from enzymatic protein hydrolysate. Agricultural and Biological Chemistry, 1991, 55, 925-932. Amiot, J; Brisson, G. J.Continuous automatic nitrogen determination for gel chromatography of protein enzymatic hydrolysates. Journal of Chromatography, 1980, 193, 496-499. Anantharaman K; Finot P.A Nutritional aspects of food proteins in relation to technology. Food reviews international, 1993, 9, 629-655. Armstead, I. P; Ling, J. R. Chromatographic separation of mixed peptides from amino acids in biological digests with volatile buffers. Journal of Chromatography, 1991, 586, 259263. Aubry, A. F; Caude, M; Rosset, R. Separation and identification of dipeptides in an hydrolyzed brain extract. Chromatographia,1992, 33, 533-538. Barbosa, C. M. S; Morais, H. A; Delvivo, F. M; Mansur, H. S; Oliveira, M. C;Silvestre, M. P. C. Papain hydrolysates of casein: molecular weight profile and encapsulation in lipospheres. Journal of Science and Food Agriculture, 2004, 84 (14), 1891-1900. Bizzotto, C. S; Capobiango, M; Biasutti, E. A. R; Silva, V. D. M; Junqueira, R. G; Silvestre, M. P. C. Hidrolisados proticos de arroz com baixo teor de fenilalanina, obtidos pela ao da corolase pp e uso do carvo ativado. Revista Cincia e Agrotecnologia, 2006, 30, (2), 308-316.
351
Boza, J. J; Martnez-Augustin, O; Gil, A. Nutritional and antigenic characterization of an enzymatic whey protein hydrolysate. Journal of Agriculture and Food Chemistry, 1995, 43, 872-875. Carreira R. L; Morais, H. A; Barbosa, C. M. S; Motta, S; Silvestre, M. P. C. Otimizao da hidrlise da casena para elevar o teor de pequenos peptdeos: associao da pepsina, tripsina e subtilisina , Brazilian Journal of Food Technology, 2001, 4 (5), 103-108. Carreira, R. L; De Marco, L. M; Dias, D. R; Morais, H. A; Ornellas, C. B. D; Silvestre, M. P. C. Analysis of peptide profiles of casein hydrolysates prepared with pepsin, trypsin and subtilisin. Acta Farmaceutica Bonaerense, 2004, 23, 17-25. Cheftel J. C ; Cuq J. L ; Loriente, D. Protins alimentaires: biochimie, proprits fonctionnelles, valeur nutritionnelle, modifications chimiques. Paris: Tec & Doc Lavoisier, 1989 Chobert, J-M; Sitohy, M. Z; Whitaker, J. R. .Solubility and emulsifying properties of caseins modified enzymatically by Staphylococcus aureus V8 protease. Journal of Agriculture and Food Chemistry, 1988, 36, 220-224. Clemente, A. Enzimatic protein hydrolysates in human nutrition. Trends in Food Science and Technology, 2000, 11, 102-109. Davis, M.T; Lee, T. D. Analysis of peptide mixtures by capillary high performance liquid chromatography: a practical guide to small-scale separations. Protein Science, 1992, 1, 935-944. Deeslie, W.D; Cheryan, M. Functional properties of soy protein hydrolysates from a continuos ultrafiltration reactor. Journal of Agriculture and Food Chemistry, 1988, 36, 26-31. Delvivo, F. M; Vieira, C. R; Biasutti, E. A. R; Afonso, W. O; Silvestre, M.P.C. Evaluating the effect of adsorption medium, hydrolytic parameters and ultrafiltration on the phenylalanine removal from pancreatic whey hydrolysates. American Journal of Food Technology, 2006, 1 (2), 94-104. De Marco, L.M; Delvivo, F.M; Silva, V.D.M; coelho, J.V; Silvestre, M.P.C. Uso do carvo ativado para remoo de fenilalanina de hidrolisados proticos, obtidos pela ao da papana imobilizada. Braz. J. Food Technol, 2005, 8 (3), 210-219. EMBRAPA (Empresa Brasileira de Pesquisa Agropecuria), 2006, (Accessed 20 september 2006), Agncia de informao - Agronegcio do leite. Available from::<http://www. agencia.cnptia.embrapa.br/agencia8/AG01/arvore/ AG01_ 128_21720039243.html>. Ford, C; Grimble, G. K; Halliday, D; Silk, D. B. A. Gas chromatography-mass spectrometry analysis of dipeptides in nutritionally significant partial enzymic hydrolysates of ovalbumin and casein. Biochemical Society Transactions, 1986, 14, 1291-1293. Frenhani, P. B; Burini, R. C. Mecanismos de absoro de aminocidos e oligopeptdios. Controle e implicaes na dietoterapia humana. Arquivos de Gastroenterologia, 1999, 36 (4), 227-236. Gallagher J; Kanekanian A.D; Evans E.P. Hydrolysis of casein: a comparative study of two proteases and their peptide maps. International Journal of Food Science and Technology 1994, 29: 279-285. Golovchenko, N; Kataeva, I. A; Akimenko, V. K. Analysis of pH-dependent protein interactions with gel filtration medium. Journal of Chromatography, 1992, 591 (4), 121128.
352
Grimble G.K; Keohane P.P; Higgins B.E; Kaminski Junior M.V; Silk D.B.A. Effect of peptide chain length on amino acid and nitrogen absorption from two lactoalbumin hydrolysates in the normal human jejunum. Clinical Science, 1986, 71, 65-69. Grimble G.K; Silk, D.B.A. Peptides in human nutrition. Nutritional Research Review, 1989, 2, 87-108. Keohane P.P; Grimble G.K; Brown B; Spiller R.C. Influence of protein composition and hydrolysis method on intestinal absorption of protein in man. Gut 1985, 26, 907-913. Kopaciewicz, W; Regnier, F. E. Nonideal size-exclusion chromatography of proteins: effects of pH at low ionic strength. Analytical Biochemistry, 1982, 126, 8-16. Lemieux, L; Amiot, J. Application of reversed-phase high-performance liquid chromatography to separation of peptides from phosphorylated and dephosphorylated casein hydrolysates. Journal of Chromatography, 1989, 73, 189-206. Lemieux, L; Amiot, J. Efficiency of five chromatographic systems for separation of casein digest. Journal of. Liquid Chromatography, 1990, 13 (20), 4023-4035. Lemieux, L; Piot, J. M; Guillochon, D; Amiot, J. Study of the efficiency of a mobile phase used in size-exclusion HPLC for the separation of peptides from a casein hydrolysate according to their hydrodynamic volume. Journal of Chromatography, 1991, 32, 499504. Lopez-Bajonero LJ; Lara-Calderon P; Galvez-Mariscal A; Velasquez-Arellano A; LopezMunguia A. Enzymatic production of a low-phenylalanine product from skim milk powder and caseinate. J Food Sci, 1991, 56, 938-942. Lopes, D. C. F; Delvivo, F. M; Silvestre, M. P. C. Hydrolysates of skim milk powder: peptide profiles for dietetic purposes. British Food Journal, 2005, 107 (1), 42-53. Mannheim A; Cheryan, M. Enzyme-modified proteins from corn gluten meal: preparation and functional properties. Journal of the American Oil Chemists' Society, 1992, 69, 11631169. Minami H; Morse E.L; Adibi S.A. Characteristics and mechanism of glutamine-dipeptide absorption in human intestine. Gastroenterology, 1992, 103, 3-11. Morais, H. A; Barbosa, C.M.S; Lopes, D.C.F; Oliveira, M.C; SILVESTRE, M.P.C. Caracterizao do perfil peptdico e de aminocidos de hidrolisados de casena atravs. Arquivos Latino Americano de Nutricin ,2002, 52,77-83 Morato, A. F; Carreira, R. L; Junqueira, R. G; Silvestre, M. P. C. Optimization of casein hydrolysis for obtaining high contentes of small peptides: use of subtilisin and trypsin. Journal Food Composition and Analysis, 2000, 13, 843-857 Netto, F.M; Galeazzi, M.A.M. Production and characterization of enzymatic hydrolysate from soy protein isolate. Lebensmittel-Wissenschaft und-Technologie, 1998, 31, 624-631. Nicolau ES, Squilassi KMBS, Cotta MC, Mesquita AJ, Mira G. Whey: importance and nutritional characteristics. 2005 (Accessed October 08th 2005), (Available from: http://www.umc.br/pesquisa/nucleos_pesquisa/biotecnologia/pesquisadores/e_esposito.ht ml.. Nielsen, S.S. Food Analysis. Gaithersburg: Aspen Publisher, 1998. Outinen MT, Tossavainen O, Harju M, Linko P. Method for removing phenylalanine from proteinaceous compositions, a product so obtained and use thereof. Valio Oy, Helsink, Finland, Patents US 5547687, A23J3/34B4; A23J3/34C; A23L1/015E2; A61K38/01B; A61K38/01D6. 12/09/1994; 20/08/1996.
353
Parrado, J; Millan, F; Hernandez-Pinzn, G; Bautista, J; Machado, A. Characterization of enzymatic sunflower protein hydrolysates. Journal of Agriculture and Food Chemistry, 1993, 41, 1821-1825. Pearce R.J. Food functionality success or failure for dairy based ingredients. Australian Journal Dairy Technology, 1993, 50,15-23. Perea A; Ugalde U; Rodriguez I; Serra J.L. Preparation and characterization of whey protein hydrolysates: applications in industrial whey bioconversion processes. Enzyme and Microbial Technology, 1993, 15, 418-423. Pimentel-Gomes, F. Curso de estatstica experimental. Piracicaba: Nobel, 2000. Reed G. Enzymes in food processing. New York: Academic Press, 1975. Schmidt, D. G; Poll, J. K. Enzymatic hydrolysis of whey proteins. Hydrolysis of lactoalbumin and -lactoglobulin in buffer solutions by proteolytic enzymes. Netherlands Milk and Dairy Journal, 1991, 45 (4), 225-240. Siemensma A.D; Weijer W.J; Bak, H.J. The importance of peptide lengths in hypoallergenic infant formulae. Trends in Food Science & Technology, 1993, 4: 16-21. Silva, V.D.M; De Marco, L.M; Afonso, W.O; Lopes, D.C.F; Janurio, J.N; Aguiar, M.J.B; Starling, A.L.P; Silvestre, M.P.C. Preparation of low-phenylalanine whey hydrolysates, using papain and pancreatin immobilized on activated carbon and alumina. American Journal of Food Technology, 2007, 2 (5), 327-341. Silvestre, M.P.C; Dauphin, A; Hamon, M. Cuprimetric assay of casein hydrolysates. Journal of A.O.A.C. Int., 1993 a, 76, (6), 295-1299. Silvestre, M.P.C; Dauphin, A; Hamon, M. Application of UV absorbance and secondderivative spectrophometry for analysing casein hydrolysates. Analytica Chimica Acta, 1993 b, 282, 603-612. Silvestre M.P.C; Hamon M; Yvon M. Analysis of protein hydrolysates. 1. Use of poly (2hydroxyethyl-aspartamide)-silica column in size-exclusion chromatography for the fracionation of casein hydrolysates. Journal of Agricultural and Food Chemistry, 1994 a, 42, 2778-2782. Silvestre M.P.C; Hamon M; Yvon M. Analyses of protein hydrolysates. 2. Characterization of casein hydrolysates by a rapid peptide quantification method. Journal of Agricultural and Food Chemistry, 1994 b, 42,2783-2789. Soares, D. L. R; Biasutti, E. A. R; Capobiango, M; Vieira, C. R; Silva, V. D. M; Janurio, J. N; Aguiar, M. J. B; Silvestre, M. P. C. Preparation of enzymatic skim milk hydrolysates with low phenylalanine content. Acta Farmaceutica Bonaerense, 2006, 25, 325-332. Synowiecki J; Jagielka R; Shahidi F. Preparation of hydrolysates from bovine red blood cells and their debittering following plastein reaction. Food Chemistry, 1996, 57, 435-439. Vallejo-Cordoba, B; Nakai, S; Powrie, W. D; Beveridge, T. Protein hydrolysates for reducing water activity in meat products. Journal of Food Science, 1986, 51, 1156-1161. Verneil, B; Bressolier, P. H; Julien, R. Quantification of amino acids, and di- and tripeptides in nutritional interest protein hydrolysates by ligand exchange chromatography in combination with Edman degradation. 4th Symposium on purification technologies, 1990, 253-258. Visser, S; Slagen, C. J; Robben, A. J. P. M. Determination of molecular mass distributions of whey protein hydrolysates by high-performance size-exclusion chromatography. Journal of Chromatography, 1992, 599, 205-209.
354
Zhang, Y; Dorjpalam, B; Ho, C. T. Contribution of peptides to volatile formation in the Maillard reaction of casein hydrolysate with glucose. Journal of Agriculture and Food Chemistry, 1992, 40, 2467-2471. Ziegler F; Olivier J.M; Cynober L; Masini J.P; Coudray-Lucas C; Levy E; Giboudeau J. Efficiency of enteral nitrogen support in surgical patients: small peptides v no-degraded proteins. Gut, 1990, 31, 1277-1283.
Chapter 10
TECHNO-FUNCTIONAL PROPERTIES FROM HYDROLYZED WHEAT GLUTEN FRACTIONS

S. R. Drago1,*, R. J. Gonzlez1 and M. C. An2,*
1
CONICET, Inst. de Tecnologa de Alimentos -FIQ- Univ. Nacional del Litoral, 1 de Mayo 3250, Santa Fe, Argentina 2 CONICET, CIDCA, calle 47 y 116, La Plata, Argentina
ABSTRACT
Many protein sources that are found in the market are obtained as by-products and there is a great interest in using them as protein ingredients with adequate functionality for food formulation. Structure modification permits one to add value and to diversify their uses. The diversification of wheat gluten applications depends on the improvement of its solubility in a wider pH range. One of the alternatives that allow protein modification in these products is the enzymic hydrolysis. The objective of this work was to evaluate foaming properties of protein fractions obtained by extracting, at 3 pH, different hydrolyzed gluten samples. Two commercial enzymes (acid -Ac- and alkaline Al- proteases) were used to reach 3 different hydrolysis degrees (DH). Extracts pHs (4, 6.5 and 9) were diluted to a protein concentration of 4 g/l. RP-HPLC, free amino groups content, sulphydryl and disulfur content, average peptide chain length were used to characterize each extract. Foam was produced by sparging nitrogen at a known rate through a dilute protein solution. The maximal volume of liquid incorporated into the foam (Vmax) and the rate of liquid incorporation into the foam (Ri) were determined and used as indicators of foaming capacity. The times for half-drainage of the liquid that was incorporated into the foam at the end of the bubbling period (t1/2) and the rate of liquid drainage from the foam were also measured. Regarding Ri, all pH 4 extracts from hydrolyzed samples showed higher Ri than an un-hydrolyzed sample. Extracts from Al hydrolyzed extracts showed higher Ri than those from Ac. In the case of Al extracts, an inverse relation between DH and Ri was observed, but practically no influence of DH on Ri, was observed in the case of Ac extracts. For pH 6.5 extracts, the relation between DH and Ri were in opposite directions, depending on the enzyme, for Ac, Ri decreased with
356
S. R. Drago, R. J. Gonzlez and M. C. An

DH, while for Al, Ri increased with DH. At this pH, it was observed that the extracts which foamed more quickly, were those with the highest times for half-drainage of the liquid (t1/2). Some foam parameters correlated between themselves, depending on the extracts. Foaming capacity and stability depend on pH, DH and enzyme and it was possible to correlate parameters with composition evaluated by RP-HPLC
INTRODUCTION
Many protein sources that are found in the market are obtained as by-products and there is a great interest in using them as protein ingredients with adequate functionality for food formulation. Wheat gluten is a by-product of the wheat starch process, which is available in large amounts and at relatively low cost. Because it is insoluble in water at near-neutral pH and is viscoelastic when hydrated, gluten is mainly used to enhance the strength of flours for breadmaking and for textured food (Popineau et al. 2002; Babiker et al. 1996). Enzymic hydrolysis is one of the alternatives that allow protein modification by means of structural transformations, which could provide other properties to it (techno-functional or biofunctional properties). Foaming capacity is a techno-functional property that allows protein ingredients to be used to improve texture, consistency and appearance of foods (Kokini and Aken, 2006). The behavior of proteins at the air/water interface has been described by many authors (Mac Ritchie, 1978; Graham and Phillips, 1979a,b,c; Kinsella, 1981; Kinsella and Phillips, 1989; Damodaran, 1994). The ability of proteins to act as surfactants and stabilize foams and emulsions depends upon their ability to adsorb at interfaces, greatly reduce the interfacial tension, and form a cohesive film. Since all proteins are amphiphilic, they show a tendency to adsorb at interfaces (Tsaliki et al., 2004). However, the foam ability differs widely among proteins. These differences arise primarily from differences in conformation and in the physicochemical properties of the protein surfaces that interacts with the dispersed and continuous phases in the foam (Damodaran, 1994). The foaming capacity of a protein depends on many events. For surface adsorption, proteins must follow successive steps: a) diffusion from the bulk solution to the interface, (which kinetic depends essentially on the size of the hydrated molecule) overcoming the electrostatic barrier to the adsorption process (the higher the charge of the molecule, the higher the energy required); b) adsorption (which depends mainly on the proportion of non polar residues, on their repartition along the chain and on the flexibility of the macromolecule; c) the conformational rearrangements for surface coverage and loop and tail formation are easier when molecules are flexible; d) film formation at the interface whose thickness and resistance depend on the tertiary structure of the protein and on the proteinprotein interactions (Le Meste et al., 1990). Also, protein surface properties are related to the presence of components with adequate surface hydrophobicity (Nakai, 1983). Moreover, it is known that the pH solution affects foam properties, modifying the protein net charge and the formation and properties (thickness and viscoelaticity) of the protein film (German and Phillips, 1994). It has been observed that the mild protein hydrolysis increase foaming and emulsifiying properties but impair the stability (Linares et al., 2000).
Techo-Functional Properties from Hydrolyzed Wheat Gluten-Fractions
357
Ultra-filtration has been used to fractionate protein hydrolysates in order to select fractions with good foaming properties (Popineau et al., 2002). Another alternative would be the fractionation by extraction at different pH. The aim of the present work was to evaluate foaming properties of peptide fractions, obtained by extracting at 3 pH different hydrolyzed gluten samples with different degree of hydrolysis and from two proteolytic enzymes, and to correlate these properties with their structural characteristics.
MATERIAL AND METHODS

Commercial vital gluten provided by Molinos SEMINO S.A. (Carcara - Santa Fe) was used. Gluten composition was the following: moisture: 5.95% (AACC 44-15A method)10, protein (N x 5.7): 77.20 % d.b. (Kjeldahl AACC 46-11 method), starch: 13.15 % d.b. (Ewers polarimetric method), ether extract 0.71 % d.b. (AACC 30-25 method) and ash: 0.834 % d.b. (ICC N 104- IRAM N 15851 Standard technique). In order to disperse vital gluten in water and secure a uniform suspension, a moderate thermal treatment was carried out (Drago et al, 2008). The thermal-treated gluten (TTG) sample was used in all experiments as a substrate. The acid and alkaline enzymes used in the experiment were provided by GENENCOR S.A. (Arroyito-Crdoba). The acid enzyme (Ac) was a fungal protease derived from Aspergillus oryzae (31.000 HU/g), which is a mixture of endo/exopeptidases whose characteristics are the following: effective pH: 3.5 9, optimum pH: 4.3 5, temperature range: 30 50 oC. The alkaline enzyme (Al) was an endoprotease derived from Bacillus Licheniformis, which effective pH rangr was 7- 10, optimum pH: 9.5, temperature range: 25-70 C, optimum: 60C.
Preparation of Hydrolysates
Hydrolysates were prepared in a 5 l batch reactor with agitation, using a thermostatized bath. Protein concentration was 8% (W/W) and 3N HCl or NaOH were added in order to reach and maintain a constant pH. After enzyme inactivation, the hydrolysates were frozen at -20 C and lyophilized. Reaction parameters used for acid protease were: temperature: 55C, pH: 4.25, Enzyme/Substrate ratio (E/S): 5%. Enzyme inactivation was carried out at 70C for 15 min. Reaction parameters used for alkaline protease were temperature: 60C, pH: 9.5, E/S ratio: 0.095%. Enzyme inactivation was carried out at 80-85C for 10 min. Hydrolysates were obtained at three different trichloroacetic acid index (TCAI) for both acid and alkaline enzyme hydrolysates: 14, 22 and 32%, named Ac14, Ac22, Ac32 for acidase enzymic hydrolysates and Al14, Al22, Al32 for alkaline enzyme hydrolysates.
Hydrolysis Reaction Progress

The hydrolysis progress was followed by means of the trichloroacetic acid index (TCAI), using TCA 20% and diluting the sample in a 1:1 ratio. N was measured by the Semimicro-
358
Kjeldahl method. The TCAI, which was used as an indirect measurement of degree of hydrolysis (DH), was calculated as follows: TCAI = [N soluble in TCA (hydrolyzate) N soluble in TCA (blank) x 100] / total aminic N
Preparation of Fractions at Different pH

In order to obtain the hydrolysates fractions at different pH (4, 6.5 and 9), a 2% (W/W, dry basis) solution of the different hydrolysates was prepared (Drago and Gonzlez, 2001). The pH was achieved by adding 0.8N HCl or 0.8N NaOH. The samples were stirred for 1 hour at room temperature, and then centrifuged during 15 min at 8000xg at room temperature. The supernatant (the extract at each pH) was frozen and protein content determined by semimicro-Kjeldahl method. The solubility was calculated as Nsupernatant (g) x 100/N total (g)
Characterization of Soluble Fractions at Different pH of Thermally Treated Gluten (TTG) and Hydrolysates
Reverse Phase HPLC (RP-HPLC) of the Extracts The extracts were diluted to a protein concentration (Nx5.7) of 2.5 mg/ml, and a Sephasil Peptide C8 column of 12 m ST 4.6/250 (Pharmacia Biotech) was used, together with an auto injector Waters 717 Plus Autosampler Millipore, a Waters 600 E pump (Multisolvent Delivery System- Millipore), and a diode array detector (Waters 996-Millipore). Peptides were separated and eluted at 1.1 ml/min, at 60C, by using the following buffers: Buffer A: Acetonitrile-water 2:98, with 650 l/l of trifluoroacetic acid (TFA); Buffer B: Acetonitrilewater 65:35 with 650 l/l of TFA, and detected at 210 nm. Since elution profiles of RP-HPLC can be grouped in categories according to the increasing hydrophobicity of the eluted peptides (Linares et a.l, 2001), chromatogram analysis was carried out by integrating peak areas in three sections of each chromatogram:
a. Components of low molecular weight and low hydrophobicity: 0-20 min of elution range (LH) b. Components of medium molecular weight and medium hydrophobicity: 20-40 min of elution range (MH) c. Components of high molecular weight and high hydrophobicity: 40-60 min of elution range (HH) Results were expressed as a percentage of each section with respect to the total area.
359
Determination of Free Amine Group Content The o-phthaldialdehyde (OPA) technique (Nielsen et al., 2001) was used for this purpose. Free amine group content was used to calculate the number of peptide bonds cleaved during hydrolysis. Estimation of Peptide Chain Length (PCL) PCL can be estimated as was decrypted by Adler Nissen (1986) by means of the following expression:
PCL (soluble fraction) = 100 x %S / (h/ htot )%. Where: htot, is the total number of peptide bonds in the protein substrate (8.3 mEq/g protein) h, is the number of peptide bonds cleaved during hydrolysis. %S: fraction of soluble proteins.
Determination of Thiol Groups and Disulphide Bonds

Thiol groups (SH) and disulphide bonds (SS) in hydrolyzed gluten fractions were determined colorimetrically with 5.5-dithiobis (2-nitrobenzoic acid) (DTNB) by means of a Anderson y Wetlaufer (1975) method, modified by Graveland et al. (1985). For the determination of thiol groups, samples were dissolved in 1 ml of the following stock solution: 6.0 M urea, 0.05M SDS, 0.1 M sodium phosphate buffer pH 7.0, and 1 mM EDTA. A 0.1 ml aliquot of 0.01 M DTNB, dissolved in the same stock solution, was then added, and after 5 min the absorbance was measured at 412 nm . Disulphide bonds were estimated after alkaline cleavage. A 1 ml sample of the hydrolysate fraction, in the same solution used for thiol determination, was mixed with 1 ml 6.0 M NaOH and stirred for 30 min at 50C. The reaction mixture was neutralized by adding 2.0 M H3PO4 (1.0 ml), mixed thoroughly and the chromophore was developed by adding 0.01 M DTNB solution (0.1 ml). Bovine serum albumen was used as standard (Kella and Kinsella, 1985). Disulphide bonds were estimated using the following: SS = (SH total - SH free) (mol)
Foaming Properties
Foaming properties of fractions obtained at pH 4, 6.5 and 9, from gluten hydrolyzed with acid or alkaline enzymes and from TTG were evaluated. All determinations were performed four times. N2 gas was sparged during 1 min at a flow rate of 40 ml/s, through 6 ml of 4 g/l of protein sample, contained into a 3x30 cm glass column. During the test, the conductivity was recorded along the bubbling time and during 10 min after stop the sparging. Volume of liquid in the foam was estimated according to Popineau et a.l, (2002). Conductivity measurements
360
as a function of time (Ct) and with reference to the conductivity of test solution (Ci) were used to calculate the volume of liquid in the foam (VL): VL (ml) : V0 [1- (Ct /Ci)] Where: V0: is the volume of sample solution (6 ml) introduced into the sparging chamber The maximal volume of liquid incorporated to the foam (Vmax, ml), the liquid volume in the foam 10 min after the end of the bubbling (Vf, mL), and the rate of liquid incorporation to the foam (Ri, ml/min) were determined. Ri is related to the surface behavior of the protein at the initial step of foam formation (Wagner et al., 1996). Foam stability was estimated from the time for half-drainage of the liquid that was incorporated into the foam at the end of the bubbling period (t1/2, min). The initial rate of liquid drainage was also measured. The decay portion of the curve: volume of liquid incorporated to the foam (ml) vs time (min), was fitted with a single exponential decay. y = y0 + A e k.t Where, y: is the liquid into the foam (ml). A and k: were equation parameters. The first derivative of (1) respect to the time, at t=0 is the initial rate of liquid drainage: dy/dt = -A . k = V0dren Figure 1 shows an example of the record of the formation and the instability of the foam. (1)
Statistical Analysis
Software Statgraphics Plus 3.0 was used for statistical analysis. LSD (Least significant difference) test was used to determine statistical differences among samples (p<0.05).

Thermal Treated Gluten (TTG) Hydrolysis
Figure 2 shows that TCA solubility increase with time for both enzymes. From 20% TCAI, higher rate is observed for Al and 32% TCAI is reached faster. This level was the maximum hydrolysis limit for both enzymes, and it was selected in order to avoid impairing surface properties by an excessive hydrolysis.

4,0 3,5 3,0 2,5
361
Vmax V1/2 Ri VE v0 t1/2

0 2 4 6 8 10 12 14
VL (ml)
2,0 1,5 1,0 0,5 0,0 -0,5
Vfinal
Tiempo (min)
Figure 1. Foam formation and unstabilization. Ri: rate of liquid incorporation to the foam; Vmax: maximal volume of liquid incorporated to the foam; V1/2: foam volume at t1/2; t1/2: time for the halfdrainage of the liquid, Vfinal: final volume 10 min after bubbling stops.
Solubility and Reverse Phase HPLC (RP-HPLC) of the Extracts

Figure 3 shows the protein solubility corresponding to thermally treated gluten and the six hydrolysates. Hydrolysate solubility depended on pH, DH, and the physicochemical characteristic of peptides and consequently depended on the site of peptide cleavage, which change with the enzyme used (Chobert et al., 1996).
50 TCAI% 40 30 20 10 0 0 2 4 Time (h) 6 8 Al Ac
Figure 2. Hydrolysis curve. Ac: acid protease. Substrate concentration: [S]= 8%, pH=4.25, T=55C, E/S= 5%; Al: Alkaline protease: [S]= 8%, pH=9.5, T=60C, E/S= 0.095%.
362
90 80 70 60 50 40 30 20 10 0 H,g I,h
a,b B,d f d
a,b e
a b,c a B D F G E E,F E C A pH 4 pH 6,5 pH 9
Solubility (%)
TTG
Ac14
Ac22
Ac32
Al14
Al22
Al32
Figure 3. Solubility percentage of thermal treated gluten (TTG) and for Ac (acid protease) and Al (Alkaline protease) hydrolyzates. Different letters means significant differences among samples (p<0.05).
Table 1. Integrated areas of RP-HPLC chromatograms (percentage of total area)

Sample TTG Al 14 pH LH 0-20 min 8,71 11,18 8,73 13,26 11,70 11,43 10,59 9,87 10,27 11,76 12,33 MH 20-40 min 25,11 32,58 57,43 55,84 56,54 57,98 62,17 60,16 64,56 60.14 60,89 HH 40-60 min 66,14 56,36 32,29 30,83 31,93 30,52 26,79 31,05 26,13 28,08 26,76
Al 22
Al 32
4 9 4 6.5 9 4 6.5 9 4 6.5 9 4 6.5 9 4 6.5 9 4 6.5 9
Ac 14
Ac 22
Ac 32
11,15 14,28 12,38 12,55 14,25 12,44 13,60 19,43 13,40
42,24 52,35 46,21 47,69 52,71 50,05 58,13 42,91 53,92
46,54 33,29 41,33 40,13 32,97 38,18 29,67 37,19 33,51
HH: high hydrophobic and high molecular weight components; MH: medium hydrophobic and medium molecular weight components; LH: low hydrophobic and low molecular weight components.
363
Table 1 shows the reverse phase HPLC (RP-HPLC) of the extracts. The percentage of each section (LH, MH and HH) is the ratio of the corresponding integrated areas with respect to the total area of chromatogram. For small peptides (<15 residues), the hydrophobicity of the amino acid side chains in the peptides determine the elution time from a reversed phase column. However, for larger peptides, the peptide length also influences retention time (van der Ven, 2001). Although hydrolysis increased gluten solubility, as it is generally found with protein hydrolysis (Linares et al., 2000), at the same TCAI the behavior of hydrolysates was different according to the enzyme used. At pH 4, Ac hydrolysate had higher solubility than that of TTG, but subsequent hydrolysis did not cause further increase. This could be attributed to the fact that the enzyme cleaved the available HH soluble components at acid pH. Table 1 shows that at pH 4 as TCAI increase MH components of Ac extracts increase as a consequence of the decrease of HH components. In the case of Al hydrolysates it is observed that they had lower solubility than those of TTG and reach equal value at TCAI 32%. This could be related with the fact that hydrolysis was carried out at alkaline pH, where gluten has low solubility (aproximately 25%), and the enzyme first cleaved the available soluble polypeptides and then hydrolyzed more hydrophocic and insoluble polipeptides. As it is shown in Table 1, acid extract of TTG have more content of HH components than pH 9 extract. Besides that new peptides obtained by hydrolysis had also lower solubility at pH 4 than the non hydrolysed protein probably due to aggregation fenomena during alkaline hydrolysis. At pH 6.5 (isoelectric point region) and 9, solubility from hydrolysates was higher than that of TTG and also, for both enzyme hydrolysates, higher solubility is obtained as TCAI increases. For Ac, at pH 6.5 (at the isoelectric point region) hydrolysate solubility was always significantly lower than that corresponding to other pH. Extracts at this pH have higher LH component content than the other pH extracts. The 14 and 22 TCAI extracts are poorer in high hydrophobic components because of they are insoluble at the pI. This could be explained taking into account the way the Ac enzyme cleaves the protein molecules, producing big size polypeptides, whose solubility is more pH dependable, together with small soluble peptides. For Al hydrolysates, pH affect solubility in a lesser extension than Ac hydrolysates. However, for the same TCAI, Al hydrolysates had always lower solubility than that of Ac hydrolysates and it was observed that as DH increase MH component content increase and HH decrease. At pH 9, for Ac extracts, as TCAI increases, content of MH component increases but that of HH decreases, while for Al extracts no clear effects were observed.
Extract Free Amino Group Content

Figure 4 shows the amount of free amino group per 100 g of soluble protein for TTG and the three different hydrolysates extracts of both enzymes. In general, as protein is hydrolyzed amino group content increases and a mixture of peptides having different molecular weight is obtained. For Ac14 and Ac22 extracts at pH 6.5 (near isoelectric point), components having low molecular weight predominate because of the solubility of high molecular weight components is very low (as a consequence of their reduced charge).
364
70 mmol/ 100 g protein 60 50 40 30 20 10 0

a g e c b d f g
h C
F F D,E DD
B B
pH 4 pH 6.5 pH 9
TTG Ac14 Ac22 Ac32 Al14 Al22 Al32
Figure 4. Free amino groups/100g of protein for thermal treated gluten (TTG) and for Ac (acid protease) and Al (Alkaline protease) hydrolyzates. Different letters means significant differences among samples (p<0.05).
For Ac32 extracts, there are more components of low molecular weight and the impact of pH is less important. This is also observed with PCL (Figure 4). For Al extracts, the behaviour is different. It is observed that the proportion of amine group with respect to protein is similar for the extracts of the same TCAI hydrolysate.
Average Peptide Chain Length

Figure 5 shows the average peptide chain length of the soluble fraction vs. TCAI at each pH for hydrolysates of both enzymes (Al and Ac).
40 35 pH 4 30 PCL 25 20 15 10 10 15 20 25 TCAI (%) 30 35 40 pH 6,5 pH 9 pH 4 Ac pH 6,5 Ac pH 9 Ac
Figure 5. Relationship between medium peptide chain length (PCL) and TCAI %, for extracts obtained with Ac and Al enzymes. Different letters implies significant differences among samples (p<0.05).
365
Taking into account that TTG PCL is 162, 62 and 131 at pH 4, 6.5 and 9, respectively, at 14% TCAI an important decrease in the size of polypeptides of soluble fractions is observed. For Ac14 and Ac22, PCL is significantly affected by the pH but for Al hydrolyzates, PCL is practically the same for the same TCAI, independent of the pH. For TCAI 14 hydrolysates of both enzymes, at pH 4 higher size components were extracted in comparison with other pH extracts. As it was observed with free amino group content, the extract at pH 6.5 corresponding to Ac and for the same TCAI, has the peptides with the smallest sizes. For the hydrolysates with 32%TCAI, protein extractability was not much affected by pH, and their extracts have peptides of about 14 amino acid residues. At the first steps of the hydrolysis (TCAI 14 and 22%), Ac protease cleaved proteins giving high MW components (with different solubility at different pH, Figure 3), and low MW components. On the other hand, Al protease gave peptides of similar MW, and because of this, PCL of 22% has almost the same value than at 32% TCAI. The way the enzyme acts can be seen with the PCL measured at the pH corresponding to the isoelectric point (near pH 6.5) or pH 9, where the solubility of the gluten thermally treated is low. PCL shows a rapid decrease with the progress of the enzymatic reaction during the first 30 min. This increase is then slower, which shows that soluble peptides are degraded during hydrolysis until they reach a certain length. After that, the enzyme would not act on them but on the substrates of higher MW, which increases solubility.
Thiol Groups and Disulphide Bonds Content

Figures 6 and 7 show thiol groups (SH) and disulphide bonds content (SS) respectively, of the extracts at different pH from the hydrolyzates obtained using both enzymes and TTG. In general, the SS content of TTG is higher than those of the hydrolyzate extracts and Ac extracts present higher values than Al extract ones. Al Extracts at pH 9 and 6.5 have higher SH content than Ac, while pH 4 Ac extracts have higher SH content than Al extract (except at 32% TCAI). Soluble fractions from GTT are rich in SS. The values obtained are similar at those shown by Kasarda (Beveridge et al, 1974). Ac hydrolysates obtained at pH 4.25, have a lower SS content than that of TTG, but is still high. However, when Al is utilized, solubilized fractions have low content of SS but are rich in SH. This could be explained taking into account that at pH 9.5 the rupture and reduction of intermolecular SS take place. The pK of SH group is about 8, and at pH higher than 8 interchange of thiol groups reactions could occur (Mutilangi et al., 1996). It is evident that these enzymes cleaved molecules in different way producing peptides having different composition and capacity to interact with other peptides. In this way, Al soluble fractions are poor in SS peptides because of SS rich peptides interact and precipitate, which is in accordance with the lower solubility of Al hydrolystes.
366
S-S (umol/ g protein)
120 100 80 60 40 20 0 TTG Ac14 Ac22 Ac32 Al14 Al22 Al32 pH 4 pH 6.5 pH 9
Figure 6. SS content in fractions obtained from: TTG (thermal treated gluten); Ac (acid protease) and Al (alkaline protease) hydrolyzates with different TCAI % (14, 22 and 32).
SH (umol/ g protein)
20 15 10 5
nd nd
pH 4 pH 6.5 pH 9
0 TTG Ac14 Ac22 Ac32 Al14 Al22 Al32
Figure 7. SH content in fractions obtained from: TTG (thermal treated gluten); Ac (acid protease) and Al (alkaline protease) hydrolyzates with different TCAI % (14, 22 and 32). nd: not detected.
Relationship Among Integrated Areas of RP-HPLC Chromatograms (HH, MH, LH) and PCL from Extracts
Some correlations between PCL and the integrated areas of RP-HPLC chromatograms were found. At both, pH 4 and 9, PCL is inversely related with the area of MH component (r: 0.771 and 0.7585, respectively), while it is directly related with the area of HH ones (r: 0.8347 and 0.798, respectively). These results suggest that when smaller components are produced (lower PCL), a reduction of product hydrophobicity takes place.
367
Evaluation of Foaming Capacity and Stability

Except for pH 6.5 TTG extract, which did not reach the desired protein concentration, foaming properties were evaluated for all extracts using 4 mg protein/ml dispersions. Foaming capacity was evaluated using two different parameters related with this property: the rate of liquid incorporation to the foam (Ri, ml/min), which is related to the surface behaviour of the protein at the initial step of foam formation (Wagner et a.l, 1996) and the maximal volume of liquid incorporated to the foam (Vmax, ml).
Analysis of the Rate of Liquid Incorporation to the Foam (Ri)

Figure 8 shows Ri for the different extracts. Because the hydrophilic/hydrophobic balance depend on the pH and the extract composition, the analysis is made for each pH separately.
a. Analysis of pH 4 Extracts At pH 4 all hydrolysate extracts showed higher Ri than TTG extracts. Gluten is a protein which has a high content of hydrophobic amino acids (37.5% ). When DH increases, an increase of hydrophilicity is achieved due to free amino and carboxilic groups produced by proteolysis and so the hydrophilic/hydrophobic peptide balance changes. Also small peptide molecules (produced by hydrolysis) probably adsorb more easily than aggregates, because of their smaller size, and the higher availability of their residues. Higher Ri values were obtained for Al extracts than Ac extracts. Moreover, while Al extract showed a Ri decrease as TCAI% increases, practically no change was observed for Ac ones. These results suggest that a mild hydrolysis improves surface activity.
35 30
k,l c,d a e,f
l i,j f,g
Ri (ml/min)
25 20 15 10 5 0
l j,k h,i,j g e,f d,e e,f,g b,c
h,i b b,c
h a pH 4 pH 6.5 pH 9
TTG
Ac14
Ac22
Ac32
Al14
Al22
Al32
Figure 8. Rate of liquid incorporation to the foam (Ri) for different protein extract s (protein concentration: 4 mg/ml). Al (alkaline protease) and Ac (acid protease) for different TCAI %(14, 22 and 32).
368
When correlations between integrated areas of RP-HPLC chromatograms (HH, MH, LH) and Ri are analyzed, it is observed that MH content directly correlates with Ri at pH 4 (Figure 9) and that HH content inversely correlates with Ri (Figure 10). This means that the presence of components with high hydrophobicity impairs foaming capacity and that Ac extracts contains more HH than Al extract. We can say that the higher foam rate at pH 4 is related to peptides having medium molecular weight and medium hydrophobicity.
pH 4
y = 2,5857x - 13,098 R2 = 0,7141 Ac Al
(MH) 210 nm
80 60 40 20 0 10 15 20 25 30 35 TTG
Ri (ml/min)
Figure 9. Relationship between rate of liquid incorporation to the foam (Ri) corresponding to extracts at pH 4 and MH (integrated areas of RP-HPLC chromatograms corresponding to medium hydrofobic and medium molecular weight components). Ac: acid protease. Al: alkaline protease.
pH4
80
TTG Ac
y = -2,669x + 104,37 R2 = 0,7064

Al
(HH) 210 nm
60 40 20 0 10 15 20
25
30
35
Ri (ml/min)
Figure 10. Relationship between rate of liquid incorporation to the foam (Ri) of extracts at pH 4 and HH (integrated areas of RP-HPLC chromatograms corresponding to high hydrophobic and high molecular weight components). Ac: acid protease. Al: alkaline protease.
369
b. Analysis at pH 6.5 Ac extracts at pH 6.5 showed higher Ri than at pH 4, and the contrary was for Al extracts. Moreover, DH affected Ri values in a different way, depending on the enzyme. For Ac extracts Ri decreases as DH increases, while for Al extracts Ri tends to increase. At this pH no correlation between RI and integrated areas of RP-HPLC chromatograms was observed. c. Analysis at pH 9 At pH 9, Ac extracts have higher Ri than TTG extracts but Ri decreases with the degree of hydrolysis. For Al extract the hydrolysis produced a decrease in Ri and only the sample with low TCAI had Ri higher than TTG. For correlating integrated areas of RP-HPLC chromatograms with Ri, TTG extracts were discarded. At this pH, a different behavior than pH 4 is observed. Ri increases with the presence of high hydrophoficity and high molecular weight components (HH) (Figure 11) and also as MH components decrease (Figure 12). However, it is important to point out that at pH 9 it is possible to extract peptides richer in SH and more flexible structures than at pH 4, and consequently it is possible to expect a high RI with a more hydrophobic- high molecular weight peptide. Then, for a protein or peptide with good foaming capacity, measured as Ri, an adequate size, a ratio of hydrophilic/hydrophobic components and flexibility, are needed. In this way, TTG extracts with high MW, low flexibility and low hydrophilic/hydrophobic components ratio, showed lower Ri than hydrolyzed gluten extract with lower MW, higher flexibility and higher hydrophilic/hydrophobic components ratio, which make the adsorption at the interface easier.
y = 1,1384x + 7,356 R2 = 0,9116 pH 9
* TTG
Al Ac
(HH) 210 nm
50 40 30 20 10 0 0 10 20
30
40
Ri (ml/min)
Figure 11. Relationship between rate of liquid incorporation to the foam (Ri) of extracts at pH 9 and HH (integrated areas of RP-HPLC chromatograms corresponding to high hydrophobic and high molecular weight components). Ac: acid protease. Al: alkaline protease.
370
pH 9
y = -1,2448x + 83,537 R2 = 0,8977

Ac
70 60
Al
MH 210 nm
50 40 30 20 10 0 0 10 20 30 40
* TTG
Ri (ml/min)
Figure 12. Relationship between rate of liquid incorporation to the foam (Ri) of extracts at pH 9 and MH (integrated areas of RP-HPLC chromatograms corresponding to medium hydrophobic and medium molecular weight components). Ac: acid protease. Al: alkaline protease.
6 j,k 5 d,e,f a,b,c a 4 h,i a,b i,j h,i b,c, e,f, d,e g
l g,h,i d,e c,d
k,l
i,j,k f,g,h c,d,e b,c, d,e,f d,e
Vmax (ml)
pH 4
3
pH 6.5 pH 9
TTG
Ac14
Ac22
Ac32
Al14
Al22
Al32
Figure 13. Maximal volume of liquid incorporated to the foam (Vmax.), for different hydrolyzate extracts (protein concentration 4 mg/ml) and TCAI % (14, 22 and 32). Ac: acid protease. Al: alkaline protease.
371
Analysis of Maximum Volume of Liquid Incorporated to the Foam (Vmax)

The Vmax of different extracts is shown in Figure 13. As it was observed, it is difficult to find a clear tendency between Vmax and TCAI% or pH. The only correlation observed was between MH/HH and Vmax at pH 4 (Figure 14). At pH 4, higher MH components and lower HH, the peptides incorporated more liquid to the foam. This implies that a hydrolyzed structure is more capable of foaming than the raw protein.
Analysis of Foam Stability

Foam stability was measured through half-drainage of the liquid and the initial rate of liquid drainage.
Analysis of Half-drainage of the Liquid (t1/2)

In general, foams made with Ac extracts were more stable than those of Al extracts (Figure 15), and the pH affect stability in a different way according pH, DH% and the enzyme utilized.
pH4
3 2,5 2 1,5 1 0,5 0 3 4 5
(MH/HH) 210 nm
y = 0,8718x - 2,109 R2 = 0,7241
Vmax (ml)
Figure 14. Relationship between maximal volume of liquid incorporated to the foam (Vmax.) of extracts at pH 4 and MH/HH (ratio of integrated areas of RP-HPLC chromatograms corresponding to medium hydrophobic and medium molecular weight components and high hydrophobic and high molecular weight components). Ac: acid protease. Al: alkaline protease.
372
2,5
i f,g
h i
i f,g e,f g e d g e d
t 1/2 (min)
1,5
pH 4 pH 6.5 pH 9
cc a,b b b c a
0,5
TTG
Ac14
Ac22
Ac32
Al14
Al22
Al32
Figure 15. Time for the half-drainage of the liquid (t1/2) corresponding to the different hydrolyzate extracts (protein concentration: 4 mg/ml) and TCAI % (14, 22 and 32). Ac: acid protease. Al: alkaline protease.
For Ac extracts, higher TCAI lower foam stability for the different pH extracts. This behavior is similar at that observed by Linares et al. (2000) from enzymic hydrolysates of wheat gluten in acid medium. Many authors have observed that hydrolysis increase foam capacity but decrease stability (Popineau et al., 2002; Linares et a.l, 2000, Bombara et al.,, 1994, Mannheim and Cheryan, 1992). Protein partial cleavage and unfolding caused by hydrolysis, favour the rapid unfolding, rearrangements and the formation of a film in the water/air interface, but the film is not enough viscoelastic and thick to be stable (Schwencke, 1997).
a. Analysis of pH 4 Extracts The better stability of Ac14 pH 4 extract with respect to TTG means that the components of the extract are more flexible and have better H/H balance than TTG. Also, the higher stability of Ac14 pH 9 foams imply that at this pH it is possible to extract components with an adequate H/H balance, capable to interact among them, because at pH 4, Ac14 extracts have components more hydrophobic and bigger than pH 9. For Ac22, foam stability is similar for the different pH extracts but for Ac32 extracts, foams are more stable at pH 4 than pH 9 or 6.5. With acid extraction it is possible to obtain higher content of MH components (58.13 vs. 42.91 and 53.92) than at the other pH. For Al extracts, foam stability was always better at pH 4 than at any other pH. Foams made with Al extracts were more unstable than with TTG extracts, except for Al 14 at pH 4. At pH 4, a direct correlation between PCL and t1/2 (r2: 0.8504) was observed. At high PCL value, higher was the time of foam stability. At this pH, Ac 14 and Ac 22 have lower Ri than Al extracts, but have better stability. This could mean that pH 4 extracts are composed
373
for a big peptide, which rearranged at the interface more slowly but then foams are more stable because they are formed by more structured components.
b. Analysis of pH 6.5 Extracts For Ac extracts, foam stability decreases as DH increases, and foams made with hydrolysates from both enzymes have equal or lower t1/2 than at another pH. However, Cheftel et al, (1989) have observed that foam stability is good when it is made with protein solutions at the pH near the isoelectric point (pI), like globin (pH 5-6), gluten (pH 6.5-7.5) and whey proteins (pH4 -5). This could be explained by the fact that extensive protein-protein interactions at pI, increase the thickness and strength of adsorbed protein at interface air/water, leading to strengthened films entrapping and stabilizing more air in the foam (Phillips et al., 1991; Kim y Kinsella, 1985). Also, surface tension has a minimum value near isoelectric point, owing to the minimum occupied area by a protein molecule. The highest surface viscosity and rigidity is observed near gluten pI, conducing to higher foam stability (Mita et al., 1977, 1978). However, these facts could be modified as a consequence of the effect made by the protein cleavage. In this regard, Popineau et a., (2002), observed that pH affects foaming capacity from ultrafiltrated hydrolysed wheat gluten having DH: 2.6% and medium molecular weight, 17 kDa. Permeates, rich in hydrophilic and neutral peptides, showed foaming capacity at pH 6.5 but not stabilization ability and at pH 4 foaming capacity was negligible. But the retentate contains peptides which are both hydrophobic and positively charged, which showed better foaming capacity and foam stability at pH 4 than 6.5. In the case of Al extracts, foam stability improved with the increase of DH. It could be related to the enrichment with fractions not soluble at low TCAI.
pH 9 (HH) 210 nm
60 40 20 0 0 0,5 1
y = 12,713x + 23,553 R2 = 0,7154
1,5
2,5
t 1/2 (min)
Figure 16. Relationship between time for the half-drainage of the liquid (t1/2) corresponding to extracts at pH 9 and HH (integrated areas of RP-HPLC chromatograms corresponding to high hydrophobic and high molecular weight components).
374
pH 9 (MH) 210 nm
80 60 40 20 0 0 0,5 1
y = -13,007x + 65,253 R2 = 0,7365
1,5
2,5
t 1/2 (min)
Figure 17. Relationship between time for the half-drainage of the liquid (t1/2) corresponding to extracts at pH 9 and MH (integrated areas of RP-HPLC chromatograms corresponding to medium hydrophobic and medium molecular weight components). Ac: acid protease. Al: alkaline protease.
c. Analysis of pH 9 Extracts For Ac extracts foam stability decreases as DH increases, but foams made with Al extracts, not only are less stable, but also the effect of DH is not clear, being foam made with Al 22 is more stable. Regarding relationships among t1/2 and the integrated areas of RP-HPLC chromatograms, foam stability was higher at higher HH content (Figure 16) and was lower when MH content increases (Figure 17). Then at pH 9, better capacity to form and stabilize foam is related to the presence of flexible HH components, being important for flexibility, size and H/H balance.
Analysis of the Initial rate of Liquid Drainage (V0dren)

Once bubbling stopped, the liquid incorporated to foam start the drainage, depending on the foam stability, and a diminution of foam volume is observed along the time. The values of V0dren are shown in Figure 18, where negative sign was not considered, and the higher value of V0dren is related to a worse stability. Foams made with TTG and Ac extracts have the same V0dren at pH 4 and 9 and the drainage was independent of DH. At pH 6.5, V0dren was higher than at any other pH and increases with DH. Also, foams made with Al extracts have more drained liquid at pH 6.5. Near pI, enhanced hydrophobic interactions between two adsorbed protein layers caused by charges suppression make the lamellae between bubbles more thin and increasing V0dren. The behavior of Al extracts is different because V0dren was higher for foams made with pH 6.5 and 9 extracts from Al 14 and decreases with the degree of hydrolysis. But at pH 4 Al 14 has the lower V0dren.
375
6 5
i h h f d e d d pH 4 pH 6.5 pH 9
Vo drain (ml/min)
4 3 2 1 0
g e c a,b a a,b a,b b a,b
a,b a,b
TTG
Ac14
Ac22
Ac32
Al14
Al22
Al32
Figure 18. Initial rate of liquid drainage (V0drain) corresponding to TTG (thermal treated gluten) and the different hydrolyzate extracts (protein concentration: 4 mg/ml); TCAI %: 14, 22 and 32. Ac: acid protease. Al: alkaline protease.
The enhanced stability related to the drainage of liquid at pH 9 for higher DH, could be due to interactions among peptides forming film mediated by SH/SS interchanges supported by alkaline pH (Roy et a.l, 1999). As it was observed in Figure 6, thiol groups content at pH 9 increases with DH. Damodaran (1994) observed a retardation of liquid drainage in the presence of higher concentrations of DTT (dithiotreitol), in foams made with bovine albumin, related to cleavage of increased number of disulfide bonds, and consequently, an increase in the hydrodynamic size of the protein, which might facilitate formation of a cohesive viscoelastic film. Also, German and Philips (1994) observed that disulfide bonds reduce the intrinsic flexibility of a native protein and SH/SS interchange is very important in manipulating functional properties. In the case of soy protein, disulphide bonds not only limit molecular flexibility but also restrict foaming. Molecular alterations induced by reducing inter-subunit disulfide bonds greatly improved film formation, foaming and foam stability. Then, at pH 9, lack of structure cause by hydrolysis is compensated by the nature of extracts components related to their capacity of SS/SH interchange and the hydrodynamic size of peptides with higher thiol content. No correlation was observed among V0dren and integrated areas of RP-HPLC chromatograms.
Relationship among Indexes (RI, t1/2, Vmax y V0dren)

For foams made with extracts at pH 6.5 and 9, a direct correlation between Ri and t was observed (r: 0.7102 and 0.7534, respectively). This would imply that extracts containing fast arriving peptides which also interact themselves, would form the most stable foam. In the case of extracts at pH 4, no correlation was observed between these two indexes. This could
376
be explained by the fact that at pH 4 the Ac extracts contain large molecules which form foams having low Ri but high t. Furthermore at pH 6.5, an inverse correlation between V0drain and Ri was observed (Figure 19), meaning that extracts which formed foams at higher rate, had less liquid drainage and had the highest t. This was not observed at pH 9 since this tendency was only observed for Al and not for Ac extracts. It was also observed at pH 6.5 (Figure 20) a direct correlation between Vmax and t1/2 meaning that those foams with more liquid incorporated during bubbling would be the most stable. Regarding pH 4 extracts, it was observed that V0dren directly correlated with Vmax (r: 0.8237), then being foams with more liquid incorporated which have the higher rate of liquid initial drainage. This is in accordance with the other results, since foams with higher Vmax were those made with Al extracts which are more unstable (less t1/2) than those formed with Ac extracts. Also at pH 6.5, the two indexes of foaming capacity are directly correlated, showing that foams with high Ri have high Vmax (Figure 21)
y = -2,5668x + 32,762 R2 = 0,6753
pH 6.5 Ri (ml/min)
40 30 20 10 0 0 1 2 3 4
V0 drain (ml/min)
Figure 19. Relationship between initial rate of liquid drainage (V0drain) and the rate of incorporation of liquid to foam (Ri) corresponding to extracts at pH 6.5.
pH 6.5
2
Ac
y = 1,311x - 4,9779 R2 = 0,7927
t 1/2 (min)
1,5 1 0,5 0 0 2 4 6
Al
Vmax (ml)
Figure 20. Relationship between time for the half-drainage of the liquid (t1/2) and the maximal volume of liquid incorporated to the foam (Vmax) corresponding to extracts at pH 6.5.
377
pH 6.5 Vmax (ml)

40 30 20 10 0 4 4,2 4,4 4,6 Al
y = 10,529x - 22,424 R2 = 0,9359 Ac
4,8
5,2
Ri (ml/min)
Figure 21. Relationship between rate of incorporation of liquid to foam (Ri) and maximal volume of liquid incorporated into the foam (Vmax) corresponding to extracts at pH 6.5.
On the other hand, the stability indexes (half life times and initial rate of drainage) correlated at pH 4 (r: 0.6517) and 6.5 (r: 0.815) but not at pH 9 (Figure 22). V0dren inversely correlated with t1/2, meaning that, foam with higher half life time, lesser liquid will drain. In order to find other correlations among the different indexes, results corresponding for each enzyme, were analyzed separately. For Ac extracts a direct correlation between LH area (0-20 min) and V0dren was observed (r: 0.6692), which would imply that the presence of peptides of low molecular weight and low hydrophobicity would contribute to the foam liquid drainage and to foam instability. Adler-Nissen and Olsen (1979) probed that small peptides and free amino acids impair stability of foams made with protein hydrolisates. Also, Berot et a., (2001) observed that hydrophilic peptides from hydrolyzed wheat gluten reduced with cystein did not stabilize foams, although more hydrophobic peptides have better foam properties. For the three pH Al extracts (Figure 23), a direct correlation between Ri and t1/2, was observed (discarding TTG extracts which have low Ri but good stability, due to the presence of proteins of high MW) and also an inverse correlation between V0drain and t1/2 (r: 0.9013).
CONCLUSION
Foaming properties (foaming capacity and stability) depend on pH, DH and the enzyme used to produce the hydrolysates. Both parameters of foaming capacity (Ri and Vmax) revealed that at pH 4, components of medium MW and hydrophobicity are related with better foaming capacity, indicated for a high rate of incorporation of liquid into the foam and higher volume of liquid. Acid extracts of hydrolysates have better properties than gluten without hydrolysis.
378

y pH 6,5 = -0,3815x + 2,0745 R2 = 0,815
t 1/2 (min)
1,5 1 0,5 0 0 1 2 3 4 5 6 y pH 4= -0,3515x + 1,7784 R2 = 0,6517 pH 4 pH 6,5
Vo drain (ml/min)
Figure 22. Relationship between initial rate of liquid drainage (V0drain) and time for the half-drainage of the liquid (t1/2) corresponding to extracts at pH 6.5 and 4.
At pH 9, both foaming capacity and stability are related to the presence of high hydrophobic peptides. Although at pH 4 a bigger molecule gives more stability, at pH 9 the smaller size molecules produced by hydrolysis, could be compensated by SS/SH interchanges, and by a bigger hydrodynamic size due to the peptides with free SH. Moreover, this could be reaffirmed by the fact that foam made with Al 14 at pH 4 has less V0dren, but at pH 6.5 and 9 V0dren decreases with DH, which is related with the enhanced content of thiol groups as TCAI increases in the Al extracts.
y(Ri) = 9,6932x + 15,814 R = 0,8445 35 30 25 20 15 10 5 0 0 0,5 1 t 1/2 (min) 1,5 2 y (Vodrain) = -2,6933x + 5,0895 R = 0,9013
2 2
Alkaline enzyme
Vodrain Ri
Figure 23. Relationship between the rate of incorporation of liquid to the foam (Ri) and the time for the half-drainage of the liquid (t1/2) and the initial rate of liquid drainage (V0drain) and time for the halfdrainage of the liquid (t1/2)corresponding to Alkaline protease hydrolysate extracts.
379
Some parameters correlated themselves, depending on the considered extracts. At pH near of pI (pH 6.5) a direct correlation between Ri and t and an inverse correlation between Ri and V0drain exists. The extracts with higher Ri were the more stable (measured by the two stability parameters). Vital gluten has good functional properties but the low solubility limits its use as a food ingredient. Mild hydrolysis gives the possibility of increasing its use by increasing solubility and functionality, but the final properties of hydrolysates depend on DH, enzyme and pH of functional property evaluation and the assay or parameter used. Both, charge and peptide composition depend on pH extraction and the hydrophilic/hydrophobic balance. Fractionating by pH gives peptide extracts with good foaming properties, like Ac extract at pH 9 or Al extract at pH 4 from hydrolysates of low DH (TCAI 14%).
ACKNOWLEDGEMENT
Partially support by Proy. CAID + D 2005-005-25.
REFERENCES
AACC (1983) Approved Methods of the American Association of Cereal Chemists. 8th Edition. Adler-Nissen, J. (1986) Enzymic Hydrolysis of Food Proteins. Elsevier Applied Science Publishers, London. Adler-Nissen, J. and Olsen H.S. (1979) The influence of peptide chain length on taste and functional properties of enzymatically modified soy protein. ACS Symposium Series. 92, 125-146. Anderson, W.L. and Wetlaufer, D.B. (1975) A new method for disulfide analysis of peptides. Anal. Biochem. 67, 493- 502. Babiker, E.F.; Fujisawa, N.; Matsudomi, N.; and Kato, A. (1196) Improvement in the functional properties of gluten by protease digestion or acid hydrolysis followed by microbial transglutaminase treatment. J Agric. Food Chem. 44, 3746-3750. Beveridge, T.; Toma, S.J.; and Nakai, S. (1974) Determination of SH- and SS-groups in some food proteins using Ellmans reagent. J. Food Sci. 39, 49-51. Berot, S.; Popineau, Y.; Compoint, J.P.; Blassel, C.; Chaufer, B. (2001) Ultrafiltration to fractionate wheat polypeptides. J. Chromatography B. 753, 29-35. Bombara, N.; Pilosof, A.M.R.; and An, M.C. (1994). Mathematical model for formation rate and collapse of foams from enzyme modified wheat flours. J. Food Sci. 59 (3), 626628 y.681. Cheftel, J.C., Cuq, J.L., Lorient, D. (1989). Propiedades funcionales de las protenas. In: Protenas Alimentarias. Ed. Acribia S.A. Zaragoza, Espaa. Chap. 4, pp. 49-105. Chobert, J.M.; Briand, L.; Gueguen, J.; Popineau, Y.; Larr, C.; and Haertl T. (1996) Recent advances in enzymatic modifications of food proteins for improving their functional properties. Nahrung. 40 (4), 177-182.
380
Damodaran, S. (1994) Structure-Function Relationship of Food Proteins. In: Protein Functionality in Food Systems. Ed. Hettiarachchy, N.S. Ziegler G.R. IFT Basic Symposium Series 9, Chicago, Illinois. Chap. 1, pp. 1-37. Drago, S.R. and Gonzlez, R.J. Foaming properties of enzymatically hydrolysed wheat gluten. Innovative Food Science & Emerging Technologies 1: 269-273 (2001). Drago, S.; Gonzlez, R.J. and An, M.C. (2008) Application of surface response methodology to optimize hydrolysis of wheat gluten and characterization of selected hydrolysate fractions. In press. J. Sci. Food Agricult.00-00. German, J.B. and Phillips, L. (1994) Protein Interactions in Foams: Protein-Gas Phase Interactions. In Protein Functionality in Food Systems. Hettiarachchy, N.S. Ziegler G.R. (Ed). IFT Basic Symposium Series 9, chap 6, pp. 181-208. Graham, D.E. and Philips, M.C. (1979a) Proteins at liquid interfaces: I-Kinetics of adsorption and surface denaturation. J.Colloid Interface Sci. 70, 403-414. Graham, D.E. and Philips, M.C. (1979b) Proteins at liquid interfaces: II-Adsorption isotherms. J. Colloid Interface Sci. 70, 415-426. Graham, D.E. and Philips, M.C. (1979c) Proteins at liquid interfaces: II I-Molecular structures of adsorbed films. J. Colloid Interface Sci. 70, 427-439. Graveland, A.; Bosveld, P.; Lichtendonk, W.J.; Marseille, J.P.; Moonen, J.H.E.; and Scheepstra, A. (1985) A model for the molecular structure of the glutenins from wheat flour. J Cereal Sci. 3, 1-16. Kella, N.K.D. and Kinsella, J.E. (1985) A method for the controlled cleavage of disulfide bonds in proteins in the absence of denaturants. J Bioch. Biophysical Methods. 11, 251263. Kim, S.H. and Kinsella, J.E. (1985) Surface activity of food proteins: relationships between surface pressure development, viscoelasticity of interfacial films and foam stability of bovine serum albumin. J. Food Sci. 50, 1526-1530 Kokini, J. and van Aken, G. (2006) Discussion session on food emulsions and foams. Food Hydrocolloids. 20, 438-445. Kinsella, J.E. (1981) Relationships between structure and functional properties of food proteins. In: Food Proteins. Ed. Fox, P.F. y Condon J.J.Applied Sci. Publishers. London 3, 51-243. Kinsella, J.E. and Phillips, L.J. (1989) Structure function relationships in food proteins: Film and foaming behavior. In: Food Proteins: Structure and Functional Relationships, J.E. Kinsella and W. Soucie (Ed). Am. Oil. Chem. Soc., Champaign, I.L. pp. 52-77. Le Meste, M.; Colas, B.; Simatos, D.; Closs, B.; Courthaudon, J.L.; and Lorient, D. (1990) Contribution of protein flexibility to the foaming properties of casein. J Food Sci. 55 (5): 1445-1447. Linares, E.; Larr, C.; Lemestre, M.; and Popineau, Y. (2000) Emulsifying and foaming properties of gluten hydrolysates with an increasing degree of hydrolysis: role of soluble and insoluble fractions. Cereal Chem. 77 (4): 414-420. Linares E, Larr C, Popineau Y Freeze or spray-dried gluten hydrolysates. 1. Biochemical and emulsifying properties as a function of drying process. J Food Engineering. 48: 127135 (2001). Mac Ritchie, F. (1978) Proteins at Interfaces. Adv. Prot. Chem.32, 283. Mannheim, A. and Cheryan, M. (1992) Enzyme modified proteins from corn gluten meal: preparation and functional properties. JAOCS 69 (2), 1163-1169.
381
Mita, T.; Ishida, E.; and Matsumoto, I.I. (1978). Physicochemical studies on wheat protein foams. J. Colloid Interface Sci. 64 (1), 143-153. Mita, T.; Nikai, K.; Hiraoka, T.; Matsuo, S.; and Matsumoto, H. (1977) Physicochemical Studies on Wheat Protein Foams. J. Colloid Interface Sci. 59 (1), 172-178. Mutilangi, W.A.M.; Panyam, D.; and Kilara, A. (1996) Functional properties of hydrolysates from proteolysis of heat-denatured whey protein isolate. J. Food Sci. 61 (2), 270-303 Nakai, S. (1983) Structure-function relationships of food proteins with an emphasis on the importance of protein hydrophobicity. J Agric. Food Chem. 31, 676-683. Nielsen, P.M.; Petersen, D.; Dambmann, C. (2001) Improved method for determining food protein degree of hydrolysis. J Food Sci. 66, 642-646 Phillips, L.G.; Yang, S.T.; and Kinsella J.E. (1991) Neutral salt effects on stability of whey protein isolated foams. J Food Sci. 56 (2), 588-589. Popineau, Y.; Huchet, B.; Larr, C.; and Brot, S. (2002) Foaming and emulsifying properties of fractions of gluten peptides obtained by limited enzymic hydrolysis and ultrafiltration. J. Cereal Sci. 35, 327-335. Roy, S.; Weller, C.L.; Gennadios, A.; Zeece, M.G.; and Testin, R.F. (1999) Physical and molecular properties of wheat gluten films cast from heated film-forming solutions. J. Food Sci. 64 (1), 57-60. Schwencke, D.D. (1997) Enzyme and chemical modification of proteins. In: Food proteins and their applications. Ed. Damodaran S y Paraf A. Marcel Dekker, New York, 393-423. Tsaliki, E.; Pegiadou, S.; and Doxastakis, G. (2004) Evaluation of the emulsifying properties of cottonseed protein isolates. Food Hydrocolloids. 18, 631-637. van der Ven, C.; Gruppen, H.; de Bont, D.B.A.; and Voragen, A.G.J. (2001) Reversed phase and size exclusion chromatography of milk protein hydrolysates: Relation between elution from reversed phase column and apparent molecular weight distribution. Inter. Dairy J. 11, 83-92. Wagner, J.R.; Sorgentini, D.A.; and An, M.C. (1996) Thermal and electrophoretic behavior, hydrophobicity and some functional properties of acid-treated soy isolates. J Agric. Food Chem. 44, 1881.
Chapter 11
FORTIFICATION OF MEXICAN BREAD WITH SOURCES NEWS OF PROTEINS AND SOLUBLE FIBER
N. Guemes Vera1,*, G. Dvila-Ortiz2, J. Martnez-Herrera3, A. Bernardino-Nicanor4, S. Soto-Simental1, J. F. Hernndez Chvez1 and Alfonso Totosaus-Sanchez1
Instituto de Ciencias Agropecuarias-Centro de Investigaciones en Ciencia y Tecnologa de los Alimentos-Universidad Autnoma del Estado de Hidalgo. Av. Universidad km 1. Rancho Universitario, C.P. 43600. Tulancingo, Hidalgo, Mxico 2 Departamento de Graduados e Investigacin en Alimentos de la ENCB-IPN, 06470 Mxico,D.F. Mxico. 3 CEPROBI-IPN. Centro de Desarrollo de Productos Bioticos-IPN. Carr. Yautepec-Jojutla km 8.5. col san isidro, Yautepec, Morelos, Mexico 4 Instituto Tecnolgico de Apan, Mxico
1
ABSTRACT
At the present, foodstuffs are fortified with essential nutrition elements in order to fight micronutrient (vitamin and mineral) deficiencies. These are due to an increasing need in some countries, and it helps to fulfill the nutritional requirements of the underprivileged groups. The nutrient that is required to add must be present in levels in which it is not excessive or insignificant. Enrichment of wheat flour with legume ingredients rich in proteins has been given much attention in the last three decades. This practice improves the amino acid balance and increases the protein content of baked products from the blended flours. Lupin, Jatropha curcas, Guava seed and whey proteins, flours have an excellent potential for improving the nutritional value of wheat bread. The Lupin flour has high-lysine, low methionine content complements that of wheat flour proteins, which are poor in lysine and relatively higher in the sulphur-containing amino acids. In lupins, the main limiting amino
*
E-mail:njgv2002 yahoo.com.mx
384
N. Guemes Vera, G. Dvila-Ortiz, J. Martnez-Herrera et al.
acids are methionine and cystine followed by valine and tryptophan. Its known Lupin lack of sulphur-containing amino acids and valine seems to be adequate in L. albus. Previous papers have been reported an increase in the use of Lupinus flour in the elaboration of cereal-based products. The yellow color that this legume showed to the final product has been considered of at value in mixed products and pasta. Everyday, new discovers of Lupin find it contributes to the texture, flavor, and often to the color of baked products. The addition flours of 5% Jatropha curcas, Guava seed and fiber soluble to wholesome wheat flours results in bread with a small increase of weight, a larger water absorption and a greater shelf life. Sensory analysis revels a good the acceptability of products added with whey proteins up to 10%. Based on the previous facts, it can be considered that Lupinus, Jatropha curcas, Guava seed, whey proteins and fiber soluble posses a high potential for its use in baked products.
Key words: Bread, Lupinus, Jatropha, Guava seed, Whey proteins, Fiber soluble
INTRODUCTION
The situation of hunger that has in Mexico is serious, because half of this countrys habitants has lived in the poverty. In accordance with the FAO (2008), at world level there are 800 million people that suffer of hunger. While here more than 20 million Mexicans they are in alimentary shortage. An alternative that could diminish this problem is the fortification of products of human consumption, which consists on adding nutritious to the foods that commonly ingest to maintain or to improve the quantity and nutritional quality in the human diet (Weinstein, 2007). The products are fortified with essential elements in the nutrition are to counteract micronutrients deficiencies (iron, zinc, vitamins). In this case, a new fortification alternative is at the present time the addition of proteins, a clear example of this it is the addition of flour of Lupinus, Jatropha curcas, whey proteins, guava seed and fiber soluble in the elaboration of baking products, elevating this way since the content of these nutrients these, Nutritionally, these proteins significantly improves the amino acid balance, mainly by increasing lysine content, and is a good fibre source. Addition of small quantities of L. mutabilis flour in replacement of cereal flour tends to improve baked product textural properties, flavour and often colour.
DIET AND NUTRITIONAL STATUS OF MEXICAN POPULATION

The traditional diet among a large segment of the Mexican population in rural and marginal-urban areas is deficient in several key micronutrients. The National Nutrition Survey, conducted by the National Institute of Public Health of Mxico, estimated that iron and zinc deficiencies affect approximately 52% and 33%, respectively, of children under five years of age (Rivera, J. A; and Amor J.S.; 2003). Iron, zinc, and folic acid deficiencies were
Fortification of Mexican Bread with Sources ...
385
estimated to affect 36%, 20%, and 10%, respectively, of children between five and eleven years of age. Additionally, 41% and 39% of women ages 12-49 had iron and zinc deficiencies, respectively. Commenting on the results of this survey, government scientists at the Institute concluded that severe growth retardation and micronutrient deficiencies are serious public health issues in Mxico, particularly in rural areas, in the south, and in Indigenous populations (Rivera, J. A; and Amor J.S.; 2003).
IMPACT OF CEREAL FORTIFICATION ON PUBLIC HEALTH

In the last century, the scientific community has made significant progress towards improving the general health. At the forefront of this progress has been the significant reduction in diseases and physiological defects and dysfunctions related to micronutrient deficiencies. Food fortification programs have been key elements in this fight against, micronutrient malnutrition, with flours, breads, and other cereal products serving as the primary vehicles for micronutrient enrichment. The potential benefits of cereal product enrichment were clearly demonstrated the United States by the dramatic decline in pellagra deaths (Quick, et al; 1982). Even in recent years, the impact of cereal fortification has been seen in the 20-50% decline in spinal birth defects in the United States and other countries resulting from folic acid fortification of cereal products beginning in the 1990s (Honein, et al; 2001). At the present time, foodstuffs are fortified with essential nutrition elements in order to fight micronutrient (vitamin and mineral) deficiencies. This is due to an increasing need in some countries, and it helps to fulfil the nutritional requirements of the underprivileged groups. The nutrient that is required to add must be present in levels in which it is not excessive or insignificant (Anonimo, 2001; Bahnassey and Khank 1986; Johnson, 2000; Porter and Skarra, 1999; Ranum and Trood, 1995; Ranum, 2000, 2001). Enrichment of wheat flour with legume ingredients rich in protein and lysine such as legume flour, legume protein concentrates, and legume protein isolates, has been given much attention in the last three decades (Dervas et al 1999). This practice improves the amino acid balance and increases the protein content of baked products from the blended flours. The fortified blended foods are a mixture of: a) cereals such as maize, sorghum, wheat, or a combination thereof, providing carbohydrates and protein; b) chickpeas or soybeans, as an additional source of protein; c) oilseeds (groundnuts, hulled sunflower seeds, sesame), soybean, or stabilized vegetable oils, as an additional source of energy; d) vitamin/mineral supplements, e) sugar, if required (up to 10%), to replace an equivalent amount of cereal (Bayram, M; 2007).
LUPIN PROTEINS
Lupin flours have an excellent potential for improving the nutritional value of wheat bread. Their high-lysine, low methionine content complements that of wheat flour proteins, which are poor in lysine and relatively higher in the sulphur-containing amino acids (Wulf et al, 1989). In Lupins, the main limiting amino acids are methionine and cystine followed by
386
valine and then tryptophan. Since Lupins are legumes, the lack of sulphur-containing amino acids is not surprising. Valine seems to be adequate in L. albus. Previous papers have reported an increase in the use of Lupinus flour in the elaboration of cereal-based products. The yellow colour that this legume confers to the final product has been considered of value in mixed products and pasta. Everyday, new people discover Lupinus and find that it contributes to the texture, flavour, and often to the colour of baked products. (Dervas et al, 1999). The addition of 4% white Lupinus flour to wholesome wheat flours results in bread with a small increase of weight, a larger water absorption and a greater shelf life (Dervas et al, 1999). The acceptability of products added with Lupinus flour up to 10% has been very satisfactory. Lupinus flour has even been incorporated as high as 50% in bisquets, achieving good results. Based on the previous facts, it can be considered that Lupinus posses a high potential for its use in baked products. The benefits of this legume in baked goods can be brought to poorer populations in Mexico by adding L. mutabilis flour, and/or derivatives such as protein concentrate or protein isolate, to wheat flour used in a wide variety of commonly consumed, low-cost cereal-based foods such as leavened white loaf bread, bun bread and sweet bread. In an effort to increase the use of L. mutabilis in cereal-based foods in Mexico, Guemes and et all; 2008; evaluate the decrease or elimination of non nutritional compounds present in L. mutabilis derivatives, colour quality attributes and acceptability of Mexican-style loaf, white bolillo-type bread and sweet bread prepared with wheat flour enriched with different levels of L. mutabilis flour, protein concentrate or protein isolate (Guemes and et all; 2008). Physicochemical and nutritional analyses were in agreement with previous reports. The obtained Lupinus concentrate and isolate presented less tannins (0.23) and oligosaccharides (3.6) concentrations than the original seeds (0.58). Amino acid composition was determined in wheat flour (WF), L. mutabilis defatted flour (LF), L. mutabilis protein concentrate (LPC), L. mutabilis protein isolate (LPI). With the obtained values, it was possible to calculate the levels of fortification in which lysine content could be increased significantly in WF-LF blends comprising WF fortified with various levels of LF (5,10,15 y 20%), LPC (2.5, 5, 7.5 y 10) , and LPI (0.5, 1, 2, 3, 4). The additional use of citric acid (1%) reduced the yellow color presented in L. mutabilis derivatives for elaboration of white bread. The texture of white bread fortified with L. mutabilis flour and isolate determined after 24h of their elaboration showed less hardness than bread without fortification. The behavior related with bread volume was to increase with the addition of L. mutabilis derivatives in the concentrations of 5% for LF, 2,5% for LPC and 0,5, 1 and 2% of LPI (Guemes and et all; 2008). More than 150 types of pasta products are produced and consumed. These include long goods (spaghetti, linguini, fettucine, etc.) short cut products such as elbows, shells and noodles, and such specialty shapes as bowties, rigatoni, lasagne, etc. (Winston, 1971) . The best pasta is produced from semolina. The pasta manufactures prefer semolina that has a fine and uniform particle size rather than a coarseground semolina. With fine granulation and narrow size distribution, less trouble is encountered in mixing the semolina and water to form a uniform sough for subsequent extrusion forming. If semolina is not uniform in paticle size, the finer particles will tend to absorption water faster than the larger particles, resulting in undesirable white specks in the pasta (Donnelly, B.J. 1991). The fortification with L. mutabilis derivatives durum wheat semolina spaghetti showed that was prepared from durum wheat semolina, fortified with 0, 5, 10, 15 and 20% of lupine flour (LF), 3, 5, 8 and 10% of lupine protein concentrate (LPC) and 0.5, 1, 2, 3 and 4% of lupine protein isolate (LPI) to increase protein. Later the rheological
387
analyses (TPA and adhesiveness) were performed by using a TA.XT2i texture analyzer (Stable MicroSystems Ltd., Surrey, UK) in a compression mode. Supplementing semolina with LF, LPC and LPI caused a decrease in hardness and cohesivity of the dough except for blends containing 15 and 20% of LF, in the case of adhesivity, the fortification increase this property. For the extensibility and adhesivity force diminish between 1520% of LF and 8 10% of LPC. Firmness scores of the fortified spaghetti increased with the level of fortification. Sensorial analysis showed that spaghetti supplemented with 3% of LPI was acceptable. A beany taste and hardness was reported for this spaghetti with respect to the commercial (Santos; 2006). The cookies consumption is associated mainly with urban food habits. However, these products are frequently purchased by the rural population because they can be stored for extended periods of time. Mexican and Central American bakeries and /or cookie plants produce a variety of sugar cookies: plain, enriched with various ingredients and flavored. They are commonly prepared using soft wheat flour or the low protein flour steams from hard wheat milling (Pea; 1998). For the fortified cookies with derivatives of Lupinus was prepared with Wheat Flour (WF) fortified with various levels of Lupin Flour (LF) (8, 12 and 20%), Lupin Protein Concentrate (LPC) (10, 20 and 30%) and Lupin Protein Isolate (LPI) (5, 10 y 15%). The chemical composition of the flour was 6.5% protein for WF and 39.4 % protein for LF, 66 % protein for LPC and 89.1% for LPI. The cookie fortified with 12% of LF and 20% of LPC had 8.4 y 9.7% protein respectively as compared to 6.4% in the regular product, which agreed with other results reported in the literature. The addition of 12 and 20 % produced a decrease in the firmness and consistency, and an increase in the cohesiveness of the dough. Generally speaking, higher amounts of precipitate (30%) did not significantly affect the firmness, consistency or cohesiveness of the dough. The adhesiveness increased particularly in samples prepared with 20 and 15% of LF and LPI respectively. The presence of Lupin derivatives produced a excellent firmness and consistency of the cookies and an increase in its cohesiveness, which favours the production of a high-quality product (Lpez; 2007; Guemes; 2007).
JATROPHA CURCAS L. PROTEINS

The Jatropha curcas L. is a plant that belongs to the family Euphorbiaceae. Its origin is Mexico and Central America. In Mexico, it is found extensively in different regions as Sonora, Sinaloa, San Luis Potosi, Guadalajara, Michoacn, Guerrero, Oaxaca, Chiapas, Tabasco, Yucatn, Quintana Roo, Veracruz, Tamaulipas, Puebla, Hidalgo and Morelos. Some common names for Jatropha curcas in Mexico are pion, pioncillo and Achsti. It occurs between altitudes from the 0 to 1600 msnm in several agroclimatic conditions. The Jatropha plants occurring in various climatic regions and sometimes even from the same climatic zones show morphological differences, particularly with regard to the shape and size of the seeds and their protein and lipid content. In some regions can be found fruits in different months from the year (July, August, September, October, November, December and January) with two or three times of flowering. In Puebla, Hidalgo and Veracruz, the J. curcas seeds of the non-toxic variety are consumed by humans in the toasted form. It is also used in the preparation of dishes called
388
pipin or pupulpth where it is made into a paste with seeds of pumpkin and sesame. In some regions of Mexico people are aware that certain plants of J. curcas are toxic while others are nontoxic. Recently, J. curcas has attracted the interest of various Governments, public and international developmental agencies and commercial firms in the tropics and subtropics due to its easy adaptability to semi arid marginal sites, the possibility of use of its oil as a diesel fuel substitute ad its applicability in erosion control. There are very few scientific reports about the nutritional composition and antinutritional factors of the J. curcas seeds in Mexico in spite of its widespread distribution and variability there. The seeds of J. curcas of Mexico containing 25-30% protein and 55-64% oil, 80% of unsaturated fatty acids are mainly oleic (40%) and linoleic acid (38%), after oil extraction, the protein is increased to 60% in the press cake (Makkar et al., 1999; Martinez, et. al., 2006), which also shows a profile of sulfur amino acids mainly higher than reported by FAO/WHO (1990), and have an digestibility in vitro above 80%, which increased after heat treatment (Martinez et. al., 2006), for this reason, J. curcas flour can be used in the production of bread, in order to fortify wheat flour, and that due to their nutritional and organoleptic gives it a special flavour and pleasant to the product. This is the first report of using J. curcas flour for baking purposes and the possibilities are endless, although some presents non-nutritional compounds such as trypsin inhibitors and lectins, they are partially or completely inactivated at safe levels due to the cooking temperature of the flour. Likewise, the presence of phytates and saponins, confer a possibility as nutraceutical compounds in the flour. Cruz and et all; 2007 evaluate the effects of added Jatropha curcas L. flour into wheat flour to prepare fortificated dough on protein content and dough rheology. Total protein content according AOAC (1995); dough extensibility, adhesiveness and texture profile analysis test were conducted using a texture analyzer (TA-HDi). Wheat- J. curcas mixture dough making were prepared with wheat flours (WF) fortifying with various levels (Jc: 5.0, 10.0, 15.0 and 20.0%). The protein content for J. curcas was 63.3%, the extensographs showed that, increasing the J. curcas flour percentage from 0% to 20%, the dough were less extensible as indicated by higher ratios of R50/Ex, while the area under the curve (i.e. the energy required to break the strength of dough) increased substantially by adding up to 5% Jatropha flour. This indicates that the dough of the blends are still strong and elastic. However, when the amount of Jatropha flour was increased up to 100%, the dough became very weak and the resistance. The adhesiveness decreased particularly in samples prepared with 20 and 100% of Jatropha flour. The presence proteins produced a decrease in the firmness and consistency of the dough and an increase its cohesiveness, which favours the production of a high-quality product (Cruz and et all; 2007). The best fortification was of 5% with Jatropha flour for the elaboration of bread.
FIBER SOLUBLE
The fiber exists of natural form in a lot of foods. The physicochemical and biological properties are related with the physiological actions in small and large intestines have a great importance in the human health. These characteristics include solubility in water, viscosity effects, volume, absorption, and its relation with other compounds. These properties can take
389
to several physiological actions like as reduction of cholesterol and diminish glucose in blood, maintaining gastrointestinal health, and improve positively the bioavalibility of calcium and immunization. The white bread is the generic name given in Mexico to popular white bread, made with a relatively lean formula and low level of yeast, using the straight dough procedure. Hard wheat flour (100%), fresh yeast (2%), salt (1-2%) and water (aprox. 60%) are mixed and the resulting dough fermented for short periods of time (20-30min) in two to three stage: after mixing, after dividing and punching, and after dough shaping. In general, regardless of size and shape, the bread is light with an open and nonuninform crumb. The breads flavor and texture are the best when very fresh. Therefore, it is purchased daily, mainly in retail bakeries. The most popular varieties of pan blanco are bolillo and teleras (Pea; 1998). Baos; 2007 evaluate rheological characteristics of dough added with soluble fiber, as well as physicochemical characterization of bread (pan blanco). In the rheological evaluation of doughs added with soluble fiber, it indicated that it formulates optimal for the bread elaboration. The hardness and the fracturability of breads added with 5% of soluble fiber were lower control, there no was the same for the adhesiveness, elasticity and cohesivity. Miga bread quality of control has open and nonhomogenous alveoli, bread made with 5% of soluble fiber has a structure closed and homogenous, also have a greater volume compare to control. Thus this treatment has a greater weigth, maybe its due to soluble fiber added and this phenomen increase water holding capacity. Proximal analysis of formulates with soluble fiber indicates protein content was 7.2%, dietary fiber 1.78%, fat 19.68% and soluble carbohydrates 40.28. Sensorial analysis reports a good acceptance of the product formulated with 5% of soluble fiber (Baos; 2007).
GUAVA SEED
(Bernardino-Nicanor, Ortz, Martnez, & Dvila-Ortz, 2001; Liadakis, Constantine, Vassiliki, & Christos, 1995; Ravindran & Sivakanesan, 1996), have shown that these products are an alternative source of oil and protein for human and animal feeding. Examples of such products are tomato seeds (Liadakis et al., 1995) and sesame seeds (Adawy, 1997). Guava fruit, usually consumed in Mexico, belongs to a dicotyledoneous family. The pulp (88 g/100 g of fruit weight) is used for juice production, but seeds (12 g/100 g of fruit weight) are discarded. The in vitro digestibility of storage proteins of guava seeds is higher than that of the soybean isolate (94.8 g/100 g vs. 89.9 g/100 g). Except for lysine content, the essential amino acid profile is above that recommended in the FAO/WHO (1985) pattern for adults (Bernardino-Nicanor et al., 2001). Seed storage proteins were initially classified according to their solubility properties into albumins (water soluble), globulins (saline soluble), prolamins (alcohol soluble), and glutelins (residue) (Osborne, 1924). Based on more recent and extensive molecular and biochemical analysis of storage proteins and their genes, these proteins have been classified into two major groups, globulins and prolamins (Shewry & Casey, 1999, Chaps. 2, 6, 13, 22, 23, and 24). According to this classification, the guava seed proteins could be considered globulins, like most of dicotyledonous storage proteins. The fortification of wheat flour with guava seed flour showed that the best blends were with 5 and 10% of the addition. In the rheological
390
evaluation of doughs added with guava seed, it indicated formulates optimal for the bread elaboration. The hardness and the fracturability of breads added with 5% of guava seed were lower control, there no was the same for the adhesiveness, elasticity and cohesivity.
WHEY PROTEINS
Mexico has serious nutritional problems, due low income of the population. In spite of that Mexican people consuming a variety of traditional breads, but there are disposal of animal protein like whey proteins considered an environmental problem. Thus, this research will be contribute diminish that nutritional problems. There is not information about the effects of whey heat-precipitated in dough of this kind of traditional bread. The sweet breads are very popular in Mexico. They are generally made with yeast-leavened doughs, rich in shortening and sugar. Among the sweet breads, the most popular type is known as bizcocho, a medium-dense, soft and spongy sweet bread derived from the French bissotte. There are many varieties of bizcocho, some of which are characteristic of specific geographic regions. The formula for bizcocho is in practice the same for all varieties. The difference among types is based mainly on the shape and decoration given to the product. Popular bizcocho varieties include: mosca, a raisin-topped loaf; concha, bread with a layer of paste resembling a shell (Pea; 1998). Guemes; 2006 evaluate characterize the dough texture and adhesiveness of sweet bread named conchas fortified with heat-precipitated whey proteins. A proximal analysis was developed. After that dough was prepared with wheat flour (WF) fortified with various levels of whey proteins (10, 15, 20, 25 and 30%). Later the rheological analyses (TPA and adhesiveness) were performed by using a TA.XT2i texture analyzer (Stable MicroSystems Ltd, Surrey, UK) in a compression mode. The chemical composition of the flour was 9.0% protein for WF and 20% protein for whey heat-precipitated. The bakery product fortified with 15% of precipitate had 23% protein as compared to 17% in the regular product, which agreed with other results reported in the literature. The addition of 10 % whey protein precipitate produced a decrease in the firmness and consistency, and an increase in the cohesiveness of the dough. Generally speaking, higher amounts of precipitate (30%) did not significantly affect the firmness, consistency or cohesiveness of the dough. The adhesiveness increased particularly in samples prepared with 25 and 30% of whey protein precipitate. The presence of whey proteins produced a decrease in the firmness and consistency of the dough and an increase in its cohesiveness, which favours the production of a high-quality product.
REFERENCES
Adawy T. 1997. Effect of sesame seed protein supplementation on the nutritional, physical, chemical and sensory properties of wheat flour bread, Food Chemistry 59, pp. 714. Annimo. 2001. Enriquecimiento de Cereales. nfasis Alimentos, Tecnologa y Empaque Mxico no. 3. Abril-mayo pg:12-19. Bahnassey and Khank. 1986. Fortification of Spaghetti with Edible Legumes. II Rheological, Processing, and Quality Evaluation Studies. Cereal Chemistry. 63(3): 216-219.
391
Baos E. B. 2007. Caracterizacin Reolgica de Masas de Harinas de Trigo Adicionadas con Fibra Soluble. Instituto de Ciencias Agropecuarias. Universidad Autnoma del estado de Hidalgo. Tesis Licenciatura. Bayram, M; 2007. Application of Bulgur Technology to Food Aid Programs. Cereal Foods World. Vol.52 No.5 Pag:249-256. Bernardino-Nicanor A., Ortz M., Martnez A. and G. Dvila-Ortz. 2001. Guava seed protein isolate: Functional and nutritional characterization, Journal of Food Biochemistry 25, pp. 7689. Cruz-Villegas R., Martnez-Herrera J., Soto-Simental S., Perez-Soto E., Hernndez-Soto A., Reyes-Santamaria M., Hernndez-Chvez J.F. and N. Guemes-Vera. 2007. Jatropha curcas L. Flour Addition to Wheat flour Doughs and Their Effects Rheological Properties. AACC International Annual Meeting. Cereal Foods World Supplement. 52:4:A39. Dervas G., Doxastakis G., Hadjisarva-Zinoviadi, Triantafilakos N. Lupin. 1999. Flour Addition to Wheat Flour Doughs and Effect on Rheological Properties. Food Chemistry. 66(19):67-73. Donnelly, B.J. 1991, Raw Materials and Processing, in Handbook of Cereal Science and Technology, K. Lorenz and K.Kulp ed. Marcel Dekker Inc. NY, NY, p. 683-740. FAO/WHO. 1985. Application of risk analysis to food standards issues. Report FAO/WHO expert consultation, Geneva, Switzerland. FAO/WHO 1990. Protein quality evaluation. In Report of a joint FAO/WHO expert consultation (p. 23). Rome, Italy: Food and Agriculture Organization of the United Nations. Gemes- Vera N; Pea-Bautista R.J.;Jimnez-Martnez C; Dvila-Ortiz G. 2008. Effective detoxification and decoloration of Lupinus mutabilis seed derivatives and effect of these derivatives on bread quality and acceptance. J Sci Food Agric 88:000000. Honein, M.A., Paulozzi, L.J. Mathews, T.J., Erickson, J.D., and Wong, L. Y. C. 2001. Impact of folic acid fortification of the US food supply on the occurrence of neural tube defects. J. American Med. Assoc. 285:2981. Johnson Q. 2000. Flour fortification. World Grain.nov.pag.26-33. Liadakis G., Constantine T., Vassiliki O. and D. Christos, 1995. Protein isolation of tomato seed meal; extraction optimization, Journal of Food Science 60 (), pp. 477482. Lpez Lpez H. 2007. Elaboracin de Galletas de Trigo Fortificada con Harina, Aislado y Concentrado de Lupinus mutabilis. Instituto de Ciencias Agropecuarias. Universidad Autnoma del estado de Hidalgo. Tesis Licenciatura. Lpez-Lpez H., Soto-Simental S., Reyes-Santamaria M., Prez-Soto E., Hernndez-Fuentes A., Hernndez-Chvez J.F., Dvila-Ortz G., Totossaus-Snchez A. and N. Guemes-Vera. 2007. AACC International Annual Meeting. Cereal Foods World Supplement. 52:4:A51. Makkar H.P.S.; Becker K., Schmook B. 1998. Edible provenances of J. curcas from Quintana Roo state of Mxico and effect of roasting on antinutrient and toxic factors in seeds. Plant Food for Human Nutr. 52, 31-36. Martnez H.J. Siddhuraju P., Francis G., Dvila O.G., Becker K. 2006. Chemical composition, toxic/antimetabolic constituents, and effects of different treatments on their levels in four provenances of Jatropha curcas L. from Mexico. Food Chem. 96, 80-89 Osborne T.B. 1924. The vegetable proteins (2nd ed), Longmans, Green, New York.
392
Pea B. R.J; 1998. Wheat End Uses Around the World Edited by Hamed Faridi and Jon M. Faubion. American Association of Cereal Chemists. St. Paul, Minenesota, USA p 43-64. Porter M.A. and Skarra L.L. 1999. Redducing Costs Through the Inclusion of Soy Flour in Breads. Cereal Foods World. 44:9:632-637. Quick, J.A., and Murphy, 1982. E. W. Fortification of Foods: A Review. USDA Agriculture Hand-book No. 598. USDA, Washington, DC. Ranum P. and Trood V.S.I. 1995. Effects of Enrichment on International Trade. Cereal Foods World 40:2:77-79. Ranum P. 2001. Elemental Iron Powders in Food Fortification. Cereal Foods World. 46:3:137-138. Ranum P. 2000. Fortification of High-Extraction Wheat Flours. Cereal Foods World. 45:6:267. Ravindran V. and R. Sivakanesan. 1996. The nutritive value of mango seed kernels, Journal of the Science and Food Agriculture 71 , pp. 245250. Rivera, J. A; and Amor J.S. 2003.Conclusions from the Mexican national nutrition survey 1999: Translating results into nutrition policy Salud Pub. Mxico 45(4):S656-S657. Santos L.V. 2006. Evaluacin de las Caractersticas Qumicas, Reolgicas y Sensoriales de Tallarines Fortificados con Derivados de Lupinus mutabilis. Instituto de Ciencias Agropecuarias. Universidad Autnoma del estado de Hidalgo. Tesis Licenciatura. Shewry R. and R. Casey, 1999. Seed proteins, Klower Academic. Winston, J.1971, Macaroni, Noodles, Pasta Products, in Publishing Corporation, New York. Wolf W. 1993. Sulfhydryl content of glycinin: effect of reducing agent, Journal of Agricultural and Food Chemistry 41, pp. 168176.
Chapter 12
AN OVERVIEW AND PROSPECT ON BANANA PROCESSING TECHNOLOGIES IN CHINA

Wen Jun Zhang1*, Xi Yan Zhang2* and Yong Kai Xia2
1
School of Life Sciences, Sun Yat-sen (Zhongshan) University, Guangzhou 510275, China 2 Lcheng Banana Institute of Hainan, Haikou 570216, China
ABSTRACT
Banana is mainly served as a fresh fruit in China. However, it is easily degenerated, decayed, and thus not storage- and transportation-tolerable because it is a fruit with the respiration- jumping property. Postharvest loss of banana is always serious and thus results in a situation of high-yield without high-income. Postharvest loss of banana in China reached as high as 50% in recent years. China should largely expand its postharvest processing industry of banana in order to reduce the loss from decay, and to increase economic benefits. There have been a large number of banana processing technologies and products in the past twenty years, however, because of the backward technologies, deficiency of processing machinery, as well as huge investment cost and other factors, banana processing was rarely put into large-scale industrialization and processed banana products seldom marketed in China. There were currently many raw banana products but less high-end products. With the rapid development of the banana production in China, the postharvest loss problem will become more serious. It is urgent to conduct comprehensive and in-depth studies on banana processing technologies and to develop new products. In this study, the technologies, technical flows, products, and the problems emerged in banana processing industry of China were reviewed, summarized, and analyzed. Banana processing potentialities were estimated and projected. Development strategies of banana processing industry were proposed for the future studies and applications.
Correspondence: zhwj@mail.sysu.edu.cn (WenJun Zhang); zxyan1981@163.com (XiYan Zhang)
394
Wen Jun Zhang, Xi Yan Zhang, and Yong Kai Xia

The results showed that current technologies for banana processing include oven baking dehydration, microwave dehydration, far-infrared dehydration, low-pressure vacuum dehydration, freezing sublimation dehydration, and vacuum freeze drying dehydration technologies. Vacuum freeze drying dehydration is recognized worldwide as the best technology for producing high-quality dehydrated food products. Vacuum frozen and dried food products need not refrigeration and need be packaged and sealed only. They can be stored and preserved at room temperature for a long time. Common banana processing products in China include banana chips, banana sauce, banana powder, banana juice, banana prolyl, banana wine, as well as various other non-flesh banana products. The difficulties for banana processing are mainly banana browning and flavor changing, separation of banana juice from solid matter, peeling, and so on. Non-flesh banana processing is much helpful to comprehensive utilization, resource conservation, income increase, and environmental pollutants reduction. It is an integral component in banana processing industry. We suggested coordinating banana processing industry and fresh banana industry, facilitating researches on banana processing technologies, strengthening the development of banana processing machinery, improving market investigation of banana products, and establishing the production-maketing chains for banana production in the future.
Keywords: China; Banana; Processing; Technologies; Review
1. INTRODUCTION
Banana (Masa parasdisiac) is a fresh fruit with the largest marketing proportion in the world. Global cultivation area of banana is only seconded to grape and citrus. Banana was originated in southeast area of Asia, including Southeast Asia, Malaysia, and China. Wild banana has been found to be distributed in Chinas provinces such as Yunnan, Guangdong, Hainan, Fujian, and southeast Tibet (Yang et al., 2007). Banana has been cultivated for more than 2,000 years in China. It has been recorded in the books, Zhuangs and Nine Songs, written during Warring States Period (Xiao et al., 2000). Banana is a high nutritional fruit. About 60% of banana flesh is eatable. In 100 g of banana fruit, there are 486 J heat energy, 62 g water, 1.2 g protein, 0.6 g fat, 19.5 g carbohydrates (13 g sugar, 0.9 g cellulose), 472 mg potassium, 0.8 mg iron, 10 mg calcium, 35 mg phosphorus, 0.25 mg carotenoids, 0.02 mg Vitamin B1, 20 mg Vitamin C, and trace Vitamin B2, other group B vitamins, sodium, copper, zinc, magnesium, and other mineral elements (Yang, 2002; Xu et al., 2005; Wang et al., 2006). The protein content in banana flesh is 12 times of pear and 4 times of apple; the fat content is 6 times of pear, and phosphorus content is 6 times of pear and 3 times of apple. Contents of Vitamin A and iron are 5 times of apple, and contents of vitamins and minerals are 2 times of apple. Banana is a potassium-rich food-its potassium content is the highest in all of fruits. Magnesium content in Banana is also high and has been proved to produce anti-cancer effects. Potassium can improve the strength and endurance of human muscle. Two bananas are enough to generate the energy for maintaining 1.5 hours of extensive excise, and thus favored by athletes. Banana has a low sodium content, which can help reduce blood pressure. Potassium may inhibit sodium in human body. Feeding banana will prevent hypertension and
An Overview and Prospect on Banana Processing Technologies in China
395
other cardiovascular diseases. Research showed that eating two bananas per day can effectively reduce blood pressure by 10%. Banana is iron-rich and thus helps hemoglobin production of human body and improves anemia status. Abundant pectin in banana can help digestion and improve gastrointestinal function. Group B vitamins of banana help comfort the nervous system. Banana contains tryptophan, and human body will transform tryptophan into serotonin in the blood. Serotonin enables people to relax and improves feeling, which has the effect to pacify nervous system and is also effective to insomnia or emotional tension. From the viewpoint of Chinese medicine, banana is a sweet and cold medicine, which will help unblock urinating, alleviate swelling, stimulate blood circulation, alleviate hypertension and hemorrhoid pain (Xiao et al., 2000). According to the records of ancient Chinese medicine book Ben Cao Gang Mu, banana could also alleviate leprosy. The medical book, Ming Yi Bie Lu, thought that banana may alleviate swelling pain and body heat. Banana can increase the number of white cells in blood and produce the substance TNF that attacks abnormal cells. Chinese Academy of Medical Sciences found that the extracted matter from banana was effective to suppress three tumor-induced substances, carcinogens aflatoxin B1, 4-nitroquinoline-N oxide, and styrene-acrylic pyrene (a). Recent studies demonstrated that the acidified human body is sensitive to various diseases and aging. Fruits and vegetables are alkaline foods, among them banana is the typical alkaline food for its high metal content. It has thus the effects to enhance human immunity, reduce disease occurrence, retard aging, and extend longevity. The banana production worldwide is growing rapidly in the past years. According to a projection (Zhang et al., to be published), the worlds total banana production will increase at the annual rate of 1.12 million 81,000 tons, and its production would reach 100 million tons by 2035, an increase of 47 12% compared to 2006 basis. Chinas banana production is expected to grow at an annual rate of 120,000 22,000 tons, and may reach 8.5 million 2.3 million tons by 2035. Chinas cultivation area of banana is expected to grow at an annual rate of 6100 1000 ha. By 2035, it would reach 420,000 100,000 ha. Banana is a typical respiration-jumping fruit. It is easily degenerated and decayed, and thus not storage- and transportation-tolerable. Postharvest loss is always serious and thus results in the high-yield without high-income (Feng, 2006). Postharvest loss of banana in China reached as high as 50% in recent years, much higher than the average postharvest fruits loss of 25% in China and 5% in developed countries (Zhao and Yang, 2005). It is necessary to greatly develop postharvest banana processing in order to reduce the loss from decay and increase income. Banana may be processed as the dried food and produced as the nutritionand flavor-preserved, light-weighted, small-sized, storage- and transportation-convenient products, thereby promoting the healthy development of banana processing industry (Zhao and Yang, 2005; Feng, 2006). Considering fruits production as a whole, both the marketing of fresh fruits and fruits processing industry are indispensable. However, as a fruits producing country, Chinas total volume for fruits processing is presently less than 10%, and a big gap exists as compared to 35% of processing volume in developed countries. At the same time, Chinas fruit processing technologies are still lagging behind (Li, 2001), among them banana processing technology is particularly backward as compared to developed countries. At the international level, some banana processing powers, such as Honduras, Mexico, Brazil, Jamaica, Australia, and South Africa, produce mainly banana magma which is used to produce infant food and to manufacture ice cream, sweet vegetable soup, pudding, milk drinks, fruit cocktails, baking foods, sweets, and solid banana foods (Huang, 1999; Zhao and
396
Yang, 2005). Philippines produces mainly banana chip and it exports 20,000 tons of banana chip annually. Meanwhile, there are various dried banana products such as banana splices, banana blocks, etc., which are mainly raw materials for food production, such as bread products, dairy products, baby food, fruit salad, etc. Banana magma is the composition material for fruit pi, milk-soaked cereal chip, and many other processed products (Wang and Du, 2001). In Taiwan, in addition to fresh banana, banana is dried through vacuum drying and then grinded into powder for marketing (Wang et al., 1995). Packaged banana powder can be stored at room temperature for one year and would preserve color and flavor, and thus favored by consumers in Japan, North America, and Western Europe. In China, banana is mainly served as a fresh fruit. There are a lot of researches on banana processing technologies and products, however, banana processing is rarely put into largescale industrialization because of backward technologies, deficient processing machinery, as well as huge investment cost, and other factors. The banana products that put into markets remained at a lower level. From the end of the last century, the situation started to be gradually improved. Various engineering projects for processing banana products, in particular banana powder, have been established in China, and product quality problems have begun to receive great attentions. For example, the quality of banana chip produced in Guangdong Province has reached the international level and the marketing volume in the domestic market is gradually increasing. Overall, however, there are many primary raw material products but high-end products remain relatively fewer. With the rapid development of banana production in China, the postharvest loss problem will become more and more significant. To conduct comprehensive and in-depth studies on banana processing technologies and new products has become an urgent task. Based on the above background, the present study aimed to make an overview and prospect on banana processing technologies and products in China, to estimate and project Chinas banana processing potentials, and to propose the development strategies of banana processing industry in order to further provide the basis for future researches and applications.
2. ESTIMATION AND PROJECTION TO BANANA PROCESSING POTENTIALS OF CHINA

Based on 50% of postharvest loss of banana in China, the estimated loss from 2000 to 2005 (tons), and the forecast of postharvest loss(tons) with unchanged trends in production and loss, were calculated and listed in Table 1. Based on the average processing proportion of all fruits, i.e., 10% in China, the estimated maximum processing volume (tons) from 2000 to 2005, the forecast of available processing volume (tons) based on the level of developed countries (35%), and the forecast of theoretical maximum available processing volume (tons), were calculated and listed in Table 2.

Table 1. Estimated and forecast postharvest banana loss in China
2000 Estimated Postharvest Loss (tons) Year Forecast Postharvest Loss (tons) 2001 2002 2003 2004 2005
397
2,569,954 2,738,537 2,891,909 3,063,170 3,122,950 3,195,000 2008 2011 2014 2017 2020 2023
2,527,000 2,719,000 2,911,000 3,101,000 3,294,500 3,486,500 1,041,000 1,050,500 1,061,500 1,073,500 1,085,500 1,099,500
Table 2. Estimated and forecast processing potentials of banana in China

Years 2000 2001 547,707 2011 2002 578,382 2014 2003 612,634 2017 2004 624,590 2020 2005 639,000 2023
Estimated Maximum 513,991 Processing Volume (tons) Years 2008 Forecast of Available Processing Volume Based on Developed Countriess Level (tons) Years
1,768,900 1,903,300 2,037,700 2,170,700 2,306,150 2,440,550 728,700 735,350 743,050 751,450 759,850 769,650
2008
2011
2014
2017
2020
2023
Forecast of Theoretical 2,527,000 2,719,000 2,911,000 3,101,000 3,294,500 3,486,500 1,041,000 1,050,500 1,061,500 1,073,500 1,085,500 1,099,500 Maximum Available Processing Volume (tons)
3. PROCESSING TECHNOLOGIES AND PRODUCTS OF BANANA IN CHINA

3.1. Banana Processing Technologies
There are various technologies for banana processing. Most of them require the raw banana material to be dehydrated. Here we list the major technologies, technical specifications, and technical flows used in China.
3.1.1. Oven Baking Dehydration Banana is dehydrated and dried by heat energy in thermal baking room. It is characterized by less investment and simple operation skill. However, both consistency and quality stability of banana products are poor because baking time is long and heating is uneven (Zhu, 2000). 3.1.2. Microwave Dehydration The microwave dehydration technology is characterized by fast warming, uniform heating, high thermal efficiency, and better product quality, but the microwave drying
398
machinery costs higher, and strict monitoring techniques and power supply conditions are needed in the processing (Zhu, 2000; Yang et al., 2007).
3.1.3. Far-infrared Dehydration This technology uses far-infrared components to generate far-infrared radiation which will be absorbed by raw banana material and is directly transformed into thermal energy to dry and dehydrate the banana material. It is a simple technology with such advantages as energy saving and fast drying. The drying time is only about half of the near-infrared technique, and 1/10 of hot air drying method. Far-infrared dehydration exhibits a higher processing efficiency and a better product quality and has been widely used in the banana processing industry of China (Zhu, 2000). 3.1.4. Low-pressure Vacuum Dehydration Low-pressure vacuum dehydration uses vacuum drier to boil water under the lower air pressure and thus dehydrates the solid or liquid banana material. The processed products by this technology will preserve the color and flavor of raw banana material and will retain all properties of raw material after re-hydration (Zhu, 2000). 3.1.5. Freezing Sublimation Dehydration The frozen banana material is sublimated to remove water in raw material. The ice crystals inside raw material is directly sublimated and becomes steam. The basic conditions for this technique are temperature<0 and absolute pressure<627 Pa. The oxidation and degradation of thermo-sensitive material can be prevented because the whole process is in low-temperature and frozen state. Moreover, due to the direct sublimation of ice crystals to steam, the wall and membrane of banana cells will not be damaged, cell liquid may not be lost, enzyme driven chemical reactions are weak, and the product exhibits porous structure. As a result, the banana product will have a good rehabilitation quality and the inherent properties of raw material may be maximally preserved. The technology has become more and more matured. It is particularly applicable to the raw material of banana. The disadvantage is the higher processing cost. Its cost is about 2 to 5 times the other techniques and its investment for machinery is 18 to 20 times the baking room (Zhu, 2000). 3.1.6. Vacuum Freeze Drying Dehydration Vacuum freeze drying dehydration is not substantially different from freezing sublimation technology. The major processing steps include pretreatment, quick-freezing, sublimation drying, and packaging. The sublimating drying is the core of this technique, in which the frozen banana material is heated by radiation, then steam cooler collects sublimated steam, and dries the material in frozen state (Kong, 2001). The major advantages of vacuum freeze drying dehydrated products include that the original structure of solid material will be preserved; nutritional value, color, and flavor will not be changed; the processed material is cavernous and has the better re-hydration quality, and it could be stored in dark environments for five years at vacuum state or in nitrogen-filled containers. Because it is dried under low temperature, nutritional ingredients and non-volatile liquid substances can be preserved and thus has a better flavor (Liu and Feng, 2002).
399
Vacuum freeze drying dehydration is recognized worldwide as the best technique for the production of high-quality dehydrated food (Yang et al., 2007). It has been applied to various fruits. The food processed by vacuum freeze drying dehydration need only be sealed and packaged without refrigeration. It can be stored and transported at room temperature without degradation for a long time. The price of the vacuum freeze drying dehydrated food is usually 4 to 6 times of hot air dried food. Production of this food is growing at an annual rate of 30% and is becoming the stable international trading food. In the United States, about 50% of factories are using vacuum freeze drying dehydration technique to produce coffee and tea. The vacuum freeze drying dehydrated foods account for 50% of dehydrated foods in Japan. About 40% of snack foods in the United States are vacuum freeze drying dehydrated foods. Started from 1992, a number of production lines of vacuum freeze drying dehydration have been established in Shanghai, Shandong, Zhejiang, Guangdong, Fujian, Beijing, and other provinces and cities in China (Kong, 2001). The dehydrated foods produced using various techniques must be sealed and packaged with sealing material. For certain products, hygroscopic agents, e.g., CaO, silica gel, etc., should be filled into packaged bags. If conditions are permissible, the banana material can be packaged and stored with filled nitrogen (Zhu, 2000). The storage temperature should be maintained at a stable level, and the air should be kept to be drier and fresher. There are also various processing techniques for non-flesh materials of banana. Here we will not discuss these techniques because they are not the mainstream industry for banana processing and their technical specifications are still not uniform in China.
3.2. Banana Products and Technical Flows

Some representative processed products and technical flows for processing banana are discussed below.
3.2.1. Banana Crisp Chip Fruit and vegetable crisp chips, including banana crisp chip, are the worldwide popular and high-grade foods. Banana crisp chip is characterized by its natural color, natural ingredients, crisp texture. It is a natural, high-nutritional, low-calorie, and low-fat food. It is highly favored, as a green food, by consumers in those countries with matured markets, such as Europe and America. It is served as the western food, snack food, nutritional food, and healthy food in Europe, America, and other developed countries and regions. The consumption for banana crisp chip is continuously increasing (Zhu, 2000). The main technique for production of banana crisp chip is vacuum drying technique. Vacuum drying, vacuum freeze drying dehydration, and refrigeration techniques are all combined in the production flow of banana crisp chip. The function and performance of lowtemperature vacuum frying machine is the key to the production. Currently, the basic feature of the worlds most advanced low-temperature vacuum fryer is the integration of such functions as vacuum frying, vacuum oil removing, and vacuum oil filtering, and production is controlled by computer or manually controlled (Zhu, 2000). The following technical flow is widely used in the production of banana crisp chip (Wen, 2002): raw material selection cleaning peeling and fiber-removing banana slices
400
making ingredients preparationmilk soaking oven baking frying rating and packaging .
3.2.2. Banana Chip Banana chip is aromatic with better flavor, which has gradually become a popular snack food. The BFC in Philippines is a leading producer of banana chip in the world. About 95% of the companys banana chip is exported to the United States, China, Japan, and Europe. Its processing method is: make banana slices and put them into pan for frying; immersed fried banana chip into selected syrup in accordance with their different flaovors; frying banana chip again and chilling the chip. To prevent adhesion of fried banana chip, the chip should be rapidly chilled. In addition, we must ensure the better quality of cooking oil, and avoid frying for too long time. The following technical flow can also be adopted to produce banana chip (Wen, 2002): raw material selection cleaning peeling slices making sulfur smoking baking softening packaging storage. 3.2.3. Banana Powder Banana powder is also called plant milk. It can be stored for one year at room temperature and the color and flavor can be preserved. Banana powder is mainly served as additives and ingredients of various food products, but can also be soaked with boiling water for drinking. At present, banana powder is the major banana processing product in China (Yang et al., 2007; Zhao et al., 2007). The processing flow for banana powder is: pretreatment, syrup making, color fixing, enzymes eliminating, mixing, and drying. An available technical flow is: raw material treatment color fixing drying smashing packaging storage. 3.2.4. Banana Sauce Banana sauce is mainly made of fresh banana, supplemented by sugar, citric acid, potassium sorbate, and other additives. It is prepared through the steps such as color fixing, syrup making, vacuum concentration, and sterilization (Xiao et al., 2000). It must be noted that the banana sauce contains much more pectin and its oxidase activity is higher, thus the jam is easily oxidized, discolored, and distasted, which will affect the quality of banana sauce. It should be continuously stirred in the concentration process in order to prevent caramel effect due to a higher local temperature. Finally, the storage temperature for banana sauce should not be too high, a temperature around 20 is reasonable (Xiao, 2000). About 70% to 80% ripeness of raw banana is the best to produce jam. If color fixer is not added, the banana can be scalded and boiled to control browning. Adding yellowish gum solution will be more conducive to improve the quality and the appearance of jam (Xu, 2005). Banana sauce can be produced following these steps (Wen, 2002): raw material selection cleaning peeling blanching syrup making mixing preheating canning sterilizing chilling wiping cans, storage, testing, and packaging. 3.2.5. Banana Juice Banana contains various enzymes and higher content of sugar. It has a moderate acidity and unique flavor. However, the solid matter of banana is not easily clarified in making juice
401
and thus it is hard to produce drink from banana. It is suggested for fixing and strengthening color by using bread juice, and fermenting by using yeast and lactic acid in order to brew banana cool beverages (Huang et al., 1999b; Chen et al., 2007). The following is a technical flow to produce banana juice (Chen et al., 2007) raw material selection peeling slices making mixing with enzyme solution containing 0.5% citric acid, syrup making (100 ml of banana flesh plus 50 ml enzyme solution) heating to hydrolysis syrup making centrifugaling (4000 r/min, 10min) measuring light transmittance and juice yield flavor mixing sterilizing (80 , 10 min) chilling finished product testing.
3.2.6. Banana Wine A processing method for producing banana wine is: banana raw material is soaked with 50% water, then make syrup, treat syrup with pectinase enzyme solution, add sugar to acidify the material, and then ferment and brew the material (Huang et al., 1999a). The following technical flow may be used (Wen, 2002): raw material selection cleaning peeling syrup making mixing fermenting product mixing filtering bottling, capping, sterilizing, chilling. 3.2.7. Banana Prolyl Banana prolyl is a preserved candied fruit product. The ripen banana is needed to produce banana prolyl. On the other hand, too ripened banana tissue is too soft to be cooked. Therefore, the key technology is the use of color fixing and tissue hardening measures, combining the rational use of sugaring. The technical flow is (Yi, 2005): raw material treatment color fixing tissue hardening sugaring drying packaging. 3.2.8. Canned Sweet Banana A technical flow for producing canned sweet banana is (Wen, 2002): raw material selection precooking, chilling peeling, fibre removing color fixing canning chilling can cleaning packaging. 3.2.9. Banana Ice Cream See Wang (2006). 3.2.10. Banana Fermented Yogurt A technical flow for the production of banana fermented yogurt is as the following (Wang, 2006): preparation of banana juice milk processing mixing, heating, sterilizing chilling canned, fermenting finished product.
3.3. Products and Technologies for Non-flesh Processing of Banana

Non-flesh banana refers to the whole plant part excepting for banana flesh. Non-flesh processing is helpful to comprehensive utilization of whole plant, resource conservation, income increase, and environmental pollution reduction. It is an inseparable component for banana processing industry.
402
3.3.1. Banana Psedu-stem and Leaves Psedu-stem and flower buds of banana, which contain a large amount of nutrients, can be dried or directly used as the feed of pigs. Pseudo-stem and leaves contain a higher content of potassium, which can be cut and applied in the farmland to not only increase soil organic matter and loose soil, but also increase potassium content in the soil. The alkali content in pseudo-stem ash is higher and thus can be use to manufacture caustic soda (China fruits-Banana Network). Pseudo-stem and leaves contain rich cellulose and are used to extract the fiber for producing rope, fabrics and paper (Zhang et al., 2006). According to a research from Guangdong Institute of Paper Manufacturing, the pseudo-stem of banana contains 12.37% lignin and 33.00% cellulose; pseudo-stem materials are suggested for producing lining paper of cement bags. Researchers in Malaysia found that the paper made from pseudo-stem do not contain acidic substances and thus is extremely durable. Toughness of the paper exceeds 3,000 times of the normal paper. It is fireproof, oil-absorbing, and waterproof, and thus can be used as the high-intensity packaging material, fireproof building material, waterproof material, and anti-polluting and oil-absorbing material (Xinhua Network, 2007). 3.3.2. Banana Peel Banana peel accounts for 30 to 40% of the fruit weight. Banana peel is nutrient-rich. In 100 g banana peel, there is 83 to 86 g water, 5.2 to 5.9 g reduced sugar, 0.15 to 0.58 g sucrose, 1.51 to 2.31 g starch, 0.45 to 0.60 g crude fiber, 1.6 to 2.14 g protein, 1.15 g ash, 0.2 to 0.3 g tannin, as well as various vitamins and beneficial trace elements (Zhao and Yang, 2005). Banana peel can be used to produce high-quality feed. It can also be used to extract pectin (Zheng and Zhang, 1998), and to extract polysaccharides, flavor substance, and starch, etc. 3.3.3. Banana Sap Banana sap, as a fixative agent of dyes, can be used for dyeing cloth. The dyed cloth is brown and is hard to fade. Banana sap can also be used to make ink. In addition, the pseudostem sap can be extracted to manufacture food preservatives. 3.3.4. Whole Plants Some banana varieties, such as the Indian red banana and South American lobster banana, are used as ornamental plants.
4. PROBLEMS AND CAUSES IN BANANA PROCESSING INDUSTRY

Despite various banana products have been produced in China, most of the current processing technologies are hard to preserve the original color and flavor of banana. The technical difficulties and causes in banana processing include (Liu and Feng, 2002; Zhao and Yang, 2005; Bai, 2006; Yang et al., 2007):
403
(1) Banana contains polyphenols, sugar, amino acids, and other substances. The browning occurred easily in the course of processing, which results in a deep color of banana product and thus affect product quality. (2) The flavor of product is always occurred. How to maximally preserve the flavor is a key question for determining the quality of product. (3) Banana contains 1.1 to 1.2 % pectin and 2% to 4% starch. Solid matter and juice are hard to be separated in the processing of banana, and sticking to container wall and filter cloth occurred easily. (4) Raw banana material is not easily dried, heating costs in a long time, and processing cost is high. (5) Peeling technologies and machinery are deficient in banana processing industry. Combined techniques and machinery for comprehensive utilization are also deficient. As mentioned above, various processing technologies have their own shortcomings. For examples, a large amount of sugar precipitation in the drying process of low-temperature freezing dehydration; a significant decline in the contents of Vitamin C and tannin. Moreover, The sour taste of acid substances and puckery taste of tannin can not be easily removed due to the loss of sugar (Liu and Feng, 2002). The main problems in the banana processing industry include the lower level of processing techniques, backward machinery, small production scales, lower efficiency in comprehensive utilization, high energy consumption, fewer products, poor product quality, and so on (Zhao and Yang, 2005).
5. DEVELOPMENT STRATEGIES FOR BANANA PROCESSING INDUSTRY IN CHINA

5.1. Coordinating Fresh Banana Marketing and Banana Processing Industry
Banana processing industry is mainly directed to banana losses of postharvest. However, it should also take into account the processing of low-quality banana. In any case, fresh banana is the most natural green fruit. Therefore, the focus of the banana industry is fresh fruit production and marketing, which refers mainly to the improvement of the quality of fresh banana and the production and marketing of fresh banana. First, we should study and apply various advanced technologies, improve the production-marketing chains of fresh banana, and reduce postharvest loss of fresh banana. Through these measures the postharvest loss would be reduced to not higher than the average fruits loss of 50% in China and 5% loss in developed countries, from 50% postharvest loss in present China. On the other hand, China should greatly develop the banana processing industry and increase the processing volume of banana to the level of developed countries, i.e., 35%. However, banana processing industry would compete with fresh banana marketing if the former exceeds the demand. Therefore the banana processing industry should be coordinately developed with the development of fresh banana production.
404
5.2. Facilitating Researches on Banana Processing Technologies

The traditional processing techniques have been widely studied in the researches of banana processing industry in China. Fewer researches on special processing techniques based on bananas properties are conducted in China. Designs on processing products are still unreasonable. China should vigorously promote the technological innovation in banana processing, and achieve breakthroughs in separation of solid matter and juice, peeling treatment, banana browning and flavor changing. In addition, since the significant differences in processing characteristics for different banana varieties, differences between banana varieties should be studied according to various processing requirements in order to provide the basis for the banana processing (Zhao and Yang, 2005; Teng et al., 2007). Apart from the studies on banana flesh processing, it is necessary to further facilitate the researches on properties, uses, processing technologies and machinery of non-flesh parts of banana plant in order to make the best use of resources, increase economic benefits for planting banana, and reduce environmental pollution. It is expected that paper manufacturing based on banana plant should become a very promising industry in the future (Zhang et al., 2006).
5.3. Strengthening Researches and Developments of Processing Machinery

It is necessary to conduct studies on industrialization of banana processing and inputoutput analysis. Both technological feasibility and machinery availability must be paid enough attention. The research institutes and enterprises of processing machinery should jointly work to develop various processing machinery, in particular, the machinery that can comprehensively process banana. Different sizes and types of processing machinery should be developed to suit different users.
5.4. Stressing Market Researches on Processing Products of Banana

The production and marketing of banana processing products require for appropriate consumer markets. It is necessary to conduct real-time market investigations on different countries and regions, to understand product typespecies, such as prices and marketing, process, and marketing scale, etc., in order to provide the basis for the decision-making of banana production and processing.
5.5. Establishing Production-marketing Chain of Banana Products

Unified technologies, unified purchasing, unified brand and packaging, and unified distribution and marketing, should be followed (Yan, 2006). The establishment of unified production-marketing chains will be useful to the standardization of products and the scaling of production-marketing, thus can enhance the ability to resist risks and maintain steady expansion of the market.
405
In recent years China begin to pay great attention to the development of agricultural processing industries. In the The Eleventh Five-Year Plan period, the state will increase its investment to agriculture and countryside to 50% from 30% in The Tenth Five-Year Plan period, among which the processing technologies and comprehensive utilization of agricultural products is an important area. With the sustainable advancements of new countryside construction in China, the researches on banana processing technologies and products are expected expanding in the future.
ACKNOWLEDGMENTS
This study was granted by the 948 project (2006-G32), Ministry of Agriculture, China.
REFERENCES . Bai WD, Zhao WH, Feng GP, Yang GM. 2006. The clearness banana juices processing investigation. Food and Machinery, 22(4): 112-137. Chen ZL, Yang CP, Liang YN, Mo HY, Li M. 2007. A study on processing technology of clarified banana juice. Guangxi Journal of Light Industry, 1: 9-10, 44. China Fruits Network. The history and present situation of banana. http://www. efruit.com.cn/xjw/, 2006. Feng Q. 2006. A study on manual drying of banana. Guangdong Agricultural Sciences, 7:6465. He RF, Liu FJ. 2003. A approach on sustainable development strategies of Guangdong banana. Friends of Fruit Farmers, 11: 8-9. Huang XD. 1999. Processing and development of banana products. Shanxi Food Industry, 2:30-32. Huang FX, Zhang J, Huang YB. 1999a. A study on banana wine. Fujian Science & Technology of Tropical Crops, 24 (2):17-23. Huang FX, Ying RX, Yan ZX, Xuan H. 1999b. The development of banana cool drink. Jiangsu Food and Fermentation, 2:7-10. Kong FZ. 2001. The vacuum freezing dehydration foods that have a broad marketing prospects. Rural Welfare Science and Technology in China, 9-10: 50-52. Liu Y, Feng B. 2002. A drying technology for banana. Hunan Agricultural Sciences, 3:63-64. Niu GC, Meng XJ, Zhou LP. 2003. Current situations and development prospects of fruit and vegetable processing in China. Grain and Oil Processing and Food Machinery, 2: 61-65. Teng JW, Wu SC, Wei BY. 2007. Influence on banana flour processing from different varieties. Food Science and Technology, 2: 88-90. Wang JL, Guan ZX, Zhang XY. 1995. A study on processing and utilization of banana resources. Resource Sciences, 1: 57-62. Wang SL, Du WD. 2001. A prospect on worldwide demand of processed products of tropical fruits. China Fruits and Vegetables, 1:40-42. Wang SY, Wang Z. 2002. A study on producing clarified banana juice using enzymatic technique. Food Science and Technology, 7: 44-46.
406
Wang W. 2006. Researches and developments of banana processing products. Food and Drugs, 8(6): 62-64. Wen ZH. 2002. The processing technologies for some banana food products. Yunnan Agricultural Science and Technology, 4: 47-48. Xiao Y, Cao YP, Xue WX, Lan SY. 2000. The development of a banana sauce with lowsugar content. Science and Technology of Food Industry, 21(2) :56-57. Xinhua Network. Use of banana trunk to produce high-grade paper in Malaysia. http://news.sina.com.cn/w/2007-02-23/ 164312357490.shtml, 2007. Xu YS, Fu SQ, Fu GS. 2005. Study on the technology of banana jam. Journal of Qiongzhou University, 12(5): 34-37. Yan XH. 2006. Local conditions should be taken into consideration in development of fresh preserving industry of agricultural products. Technologies for Medium and Small Enterprises, 2:20.. Yang GF. 2002. Manual of Soft Drinks Industry. Beijing: China Light Industry Publishing House, 105. Yang GM, Wang J, Cheng YF, Chen RR, Li YZ. 2007. Banana powder: functions current status and new technology on processing. Journal of Food Science and Biotechnology, 26(5): 121-126. Yi M. Processing preserved banana. http://www.n318.com/nykj/JGBX/200511/26412.html, 2005. Zhang J, Deng GR, Zhou JN. 2006. Development and utilization of fibre of tropical crops in the Philippines. China Tropical Agriculture, 6: 24-25. Zhao GJ, Yang GM. 2005. The situation and developing countermeasures of processing banana. Food and Machinery, 21 (2): 81-82. Zhao LY; Deng FM, Xiao D. 2007. Study on the processing technology of banana and peanut butter. China Food Additives, 5: 128-134, 139. Zheng Q, Zhang WQ. 1998. A study on extraction of pectin from banana peel. Guangxi Light Industry, 4: 21-26. Zhu DM. 2000. Fruits and vegetables processing technologies suitable for tropical and southern subtropical regions. Tropical Agricultural Engineering, 3: 4-7.
Chapter 13
ORGANIC FRESH VEGETABLES: GREEN TECHNOLOGIES

M. R. Moreiraa,b, A. G. Ponceb,* and S. I. Rouraa,b
b
Universidad Nacional de Mar del Plata, Argentina Consejo Nacional de Investigaciones Cientficas y Tcnicas, Argentina
ABSTRACT
The exploration of green technologies for food preservation receives increasing attention due to consumer awareness of natural food products and a growing concern of microbial resistance towards conventional preservatives. Cut vegetable tissues trigger chemical reactions and release nutrients that support the growth of the microflora present on raw produce. Wounding lettuce leaves induce the synthesis of specific enzymes and the accumulation of specific phenolic compounds associated with tissue browning. Many spices and herbs exert antimicrobial activity due to their essential oil fractions, also some native microflora naturally present on fresh produce surfaces are capable of producing antimicrobial compounds playing an important role maintaining fresh vegetable quality and safety. Moreover, natural antimicrobials and antioxidants like oleoresins imbedded in edible films can be gradually released on the food surface, therefore, requiring smaller amounts of them to achieve the target shelf life. The use of edible films in food preservation has increased since they offer several advantages over synthetic materials. Other innovative methods to control natural microflora and browning reactions on vegetables include mild heat shock treatments. They lack the offensive chemical residue doing this technique, an attractive alternative of preservation. The use of essential oils to preserve organic vegetables was investigated through in vitro and in vivo experiments. Some oils presented antimicrobial and antioxidant
*
Corresponding autor. Grupo de Investigacin en Ingeniera en Alimentos, Facultad de Ingeniera, Universidad Nacional de Mar del Plata (UNMDP)- Argentina. Juan B. Justo 4302, CP: 7600. Mar del Plata. Provincia de Buenos Aires. Argentina. Tel.: +54 (0223) 481 6600; Fax: +54 (0223) 481 0046. E-mail: agponce@mdp.edu.ar
408
M.R. Moreira, A.G. Ponce and S.I. Roura

activities indicating their potential to become technologically useful products as sanitizing agents. Clove and tea tree essential oils were highly inhibitory to E. coli; while olive and rosemary oleoresins presented antimicrobial effects against L. monocytogenes and against native microflora of squash. Chitosan film enriched with rosemary and olive improved the antioxidant protection of the minimally processed squash offering a great advantage in the prevention of browning reactions. The potential use of lactic acid bacteria occurring naturally in organic vegetables was investigated. E. faecium, L. lactis, E. hirae and E. canis showed novel antagonistic effects against Gram-negative bacteria with a potential role as food biopreservatives. Heat shock treatments prevented browning of minimally processed lettuce. The impact of wounding was reduced by the application of heat shock treatments at 50 C, without changes in the sensory attributes. This work presented evidence for the potential application of mild heat shocks as a novel preservation technology for minimally processed vegetables compatible with organic and low input farming systems.
INTRODUCTION
Consumers demand fruits and vegetables that are convenient to prepare yet maintain a fresh-like quality and contain only natural ingredients. Fresh fruits and vegetables are living tissues subject to continuous changes after harvest. Although some changes are desirable, most, from a consumers standpoint, are not [1]. The factors that shorten the shelf life of vegetable products are enzymatic browning, microbial spoilage, white surfaces discoloration, and senescent caused by continued respiration and ethylene production [2]. To prolong the shelf life of fresh fruits and vegetables, the microbial population growth must be controlled and several postharvest operations, such as washing and the removal of damaged tissues are used. However, this processing affects the metabolism of the plant tissues adversely, and the shelf life of the vegetables or fruits may be shortened. Enzymatic browning, in fruits and vegetables tissues, can cause undesirable quality changes during handling, processing, and storage [3]. Leafy vegetable are products which are difficult to process because of their high mechanical and physiological fragility. A wide array of processing and storage methods have been developed to combat these deterioration factors. Most of them make use of synthetic additives and antioxidants. However, consumers tend to be suspicious with chemical additives, and thus the search for natural and socially more acceptable technologies have been intensified [1]. Biopreservatives are a wide range of natural products from plants, animals and microorganisms that can be useful in extending foods shelf life. The applying biopreservatives effects are reduce or eliminate survival pathogenic bacteria, and increase overall food products quality. Biological compounds have a number of antimicrobial properties, behaving as antioxidants, breaking down cellular membranes, and disrupting biosynthetic microorganisms pathways [4].Improving the knowledge of how these biopreservatives work and affect microorganisms survival can lead to new technologies to maintain foods quality and to prevent pathogen contamination by natural means. Since the post harvest management of organic vegetables precludes the use of genetically manipulated microorganisms, the study of the native strains from vegetables is interesting in
Organic Fresh Vegetables: Green Technologies
409
order to evaluate the technological feasibility of its use in emergent technologies. Lactic acid bacteria (LAB) have long been used as starter cultures for foods due to their contribution to flavor and aroma development and spoilage retardation [5].The ecological adaptation of added lactic acid bacteria (LAB) is an important factor for their effectiveness as biocontrol cultures, and their isolation from the same vegetables on which they will be further used as inhibitory agents could be interesting. The preservative effect is not only due to acidic conditions that these bacteria create in foods, but also their capacity for producing and excreting inhibitory substances. These processes include hydrogen peroxide, ethanol, diacetyl, carbon dioxide, bacteriocin or antibiotic-like substances [6]. Bacteriocins are defined as ribosomally synthesized antimicrobials peptides or proteins produced by LAB with antagonistic activity against species genetically closely related [7]. Some of them are inhibitory towards food spoilage and food-borne pathogenic bacteria [8]. The continuous consumer interest in high quality and food safety, combined with environmental concern has induced to the development and study of new edible coatings that avoid the use of synthetic materials. The edible coatings, formed from Generally Recognized as Safe (GRAS) materials, have the potential to reduce weight loss, respiration rate and improve food appearance and integrity. Edible films may consist of four basic materials: lipids, resins, polysaccharides and proteins. Plasticizers such as glycerol as well as crosslinking agents, antimicrobials, antioxidants and texture agents can be added to customize the film for specific uses. In addition, the edible coatings allow the incorporation of food additives with antimicrobial effect that might help reducing microbial spoilage during postharvest. The antimicrobials imbedded in the films can be gradually released on the food surface, therefore, requiring smaller amounts to achieve the target shelf life [9, 10]. Along these lines, Botsoglou et al. (2002) [11] indicated that the essential oils included in edible films could reduce water vapor permeability. Spice oleoresins (natural plant extracts) constitute the true essence of spices in their most concentrated form, containing volatile as well as non-volatile components. Besides, they are the preferred and most convenient substitutes for raw spices in the food processing industry. Oleoresins differ from essential spice oils as they have all the flavouring ingredients of a particular spice. They are free from bacteria and may be standardized to a desired degree of flavour strength. When edible films were enriched with essential oils, the drying temperatures usually employed to form the edible coating were high enough to volatilize a high percentage of the aromatic components. The advantage of substituting essential oils for their corresponding food grade oleoresins could lie in the introduction of other non-volatile components, positively affecting food quality. Other innovative methods to control natural microflora and browning reactions on vegetables include mild heat shock treatments. Generally, mild heat shock treatments are applied together with chlorinated water. Chlorine is the primary sanitizing agent used for washing fruits and vegetable; however, it has a negative impact on the environment and occasionally, it may cause the product to have an objectionable aftertaste. The ease with which a heat shock can be administered to lettuce and the lack of an offensive chemical residue make this technique an attractive alternative to preserve fresh cut lettuce [12]. LoaizaVelarde and others (1997) [13] reported that dipping lettuce in water at 45 to 55 C extends the shelf life and visual quality of minimally processed lettuce by inhibiting the activity of phenylalanine-ammonialyase (PAL), the enzyme that initiates biosynthesis of phenolic
410
compounds that lead to visible discoloration along the cut edge of the lettuce leaf [14]. Delaquis and others (1999) [15] reported that treated lettuce with water at 47 C for 3 min delayed the growth of spoilage microflora by several days during storage at 4 C. Li and others (2002) [16] suggested that heat (50 C) treatment may have delayed browning and reduced initial populations of some microorganisms naturally occurring on iceberg lettuce, but may have enhanced microbial growth during subsequent storage. Several reports analyzed mild heat shocks to control tissue browning [12, 17, 18 and 19]. However, reports on the effects of heat shocks on the microbiological and sensory properties of lettuce are scarce. Moreover, little information is available on the effects of mild heat treatments on ascorbic acid retention in lettuces leaves.
ESSENTIAL OILS TO CONTROL NATIVE MICROFLORA ON FRESH VEGETABLE

We studied the in vitro effects of essential oils on organic Swiss chard native microflora using different methods [20]. The agar diffusion method provided a rapid semi-quantitative tool to evaluate microfloras sensitivity to different essential oils. The optical density method was a rapid and easy-to-achieve procedure to determine MIC (Minimum Inhibitory Concentration) and MBC (Minimum Bactericidal Concentration) from essential oils producing similar results than the more laborious and time-demanding microdilution agar plate method. The results indicated that eucalyptus (Eucalyptus globulus), tea tree (Melaleuca alternifolia), anise (Pimpinella anisum) and clove (Syzygium aromaticum) presented antimicrobial activity that clearly indicated that these oils have the potential of becoming technologically useful products as sanitizing agents. MBC values for these oils were in the range of 0.09-1.50 mL/100 mL (Table 1). Higher concentrations of melissa (Melissa officinalis), rosemary (Rosmarinus officinalis), mint (Mentha piperita), oregano (Origanum vulgare) and lemon (Citrus limonum) were needed to achieve bactericidal effects. On the other hand, rosa moschata (Rosa moschata) and pine (Pinus silvestrys) did not present any significant antimicrobial activity toward chard native microflora. These in vitro results demonstrated that some oils showed promising activity as natural preservatives in controlling fresh vegetables native microflora.
Table 1. Minimal inbigitory concentration values of different essential oils
411
To evaluate the antimicrobial activity of botanical biopreservatives numerous in vitro studies have been done. However, the organic system complexity may introduce factors that through in vitro studies may not been analyzed. So, it is very important to evaluate their effects on actual crops. We investigated leafy vegetables shelf life treated with natural botanical biopreservatives [21]. Essential oils as natural sanitizing agents (eucalyptus, tea tree, clove, melissa, rosemary and lemon) were sprayed on Swiss chard leaves. Samples were stored at 0, 5 C, and 97-98% of relative humidity. Microbial populations, peroxidase activity and sensory attributes were monitored during storage. Essential oils used were not warranted when chard leaves were kept around 0 C since their probable effect would be masked by the temperature effect. At 0 C most microorganisms reproduction was slow enough so that essential oils did not make any difference during the shelf life of the product. At higher temperatures (5 C), representative of commercial handling conditions for this type of products, eucalyptus, tea tree and clove were effective to control the different microbial group populations. If essential oils are to be used as natural sanitizing compounds in vegetables, they should not introduce deleterious effects on product sensory attributes, mainly on the aroma. During the sensory evaluation of chard leaves sprayed with different essential oils off odors were detected in oil-treated samples right after spraying. However, on day 1 and thereafter, the panelists did not find differences in odor or in other sensory indexes among different samples. Throughout storage time, no evidence of softening or rot was found on any of the samples (Table 2). At 5 C, eucalyptus, tea tree, and clove could be used to control growth of different microbial groups although they would not extend the shelf life from a sensory point of view.
Table 2. Sensory evaluation of chard leaves treated with sprays of different essential oils and leaves without treatmenta
A sample with score less than 5 in any of the sensory attributes was considered unacceptable.
412
ESSENTIAL OILS TO REDUCE FOODBORNE PATHOGEN

Escherichia coli O157:H7 was first recognized as a pathogen in 1982 and is considered the hemorrhagic colitis and hemolytic uraemic syndrome main cause. E. coli infections are disseminated by foods, water and person to person contact [22]. Skandamis et al., (2001) [23] reported that oregano essential oils and EDTA inhibited E. coli growth by inducing morphological changes at close to minimum bactericidal concentration (MBC). Elgayyar et al., (2001) [24] showed antimicrobial activity of some essential oils from plants against selected pathogenic and saprophytic microorganisms. Technological application of essential oils, as natural sanitizing agents, to reduce food pathogens in the post-harvest processing of foods, in particular those produced by organic methods, require establish the optimal conditions, such as: pathogen sensitivity, optimal concentrations and the time of contact between the oils and the pathogen. Moreira et al., (2005) [25] evaluated the antimicrobial activity parameters: MIC, MBC and optimal contact time of some essential oils as eucalyptus, tea tree, rosemary, mint, rosa moschata, clove, lemon, oregano pine and sweet basil (Ocimum basilicum), on the survival and growth of different E. coli O157:H7 strains. E.coli susceptibility to the essential oils was determined by the agar diffusion method, showed that clove produced 50-60 mm diameter inhibition halos turning it, into the oil with the highest inhibitory effects. E. coli susceptibility to tea tree, eucalyptus, pine, rosemary and mint was also appreciable, with 16 to 30 mm diameter inhibition zones. On the other hand, E. coli showed low susceptibility to oregano, sweet basil, lemon and rosa moschata, with 9 to 14 mm diameter inhibition halos. Correspondingly, essential oil with the lowest MIC and MBC (Minimum Inhibitory and Bactericidal Concentration, respectively) was clove (0.25 mL/100 mL and 0.3 mL/100 mL, respectively) demonstrating that clove exerted a significant bactericidal and bacteriostatic action. MIC and MBC obtained from oregano, sweet basil, mint, lemon, pine and rosa moschata were higher than 1.7 mL/100 mL (Table 3). Also, others in vitro studies have demonstrated antibacterial activity of essential oils against Listeria monocytogenes, Salmonella typhimurium, Escherichia coli O157:H7, Shigella dysenteria, Bacillus cereus and Staphylococcus aureus [24, 26, 27, 28, 29, 30]. Table 3. Values of MIC and MBC for different oils on E. coli (ATCC 25158), obtained by the agar dilution method
Essential oils Melaleuca alternifolia Rosmarinus officinalis Syzygium aromaticum Eucalyptus globules Origanum vulgare Ocimum basilicum Mentha piperita Citrus limonum Rosa moschata Pinus silvestres MIC (mL/100 mL) 0.5 0.6 0.25 0.4 1.8 1.9 2.0 2.5 >3.0 >3.0 MBC (mL/100 mL) 0.6 0.7 0.3 0.5 2.0 2.0 2.2 2.8 >3.0 >3.0
Each assay was performed by duplicated.
413
7 6,5 6 5,5 5 4,5 4 3,5 3 2,5 2 10 30

time (min)
-10
Counts (log CFU/ml)
50
70
Figure 1. Essential oils effect on E. coli survival, in BHI broth at 20C. Control E. coli , Tea tree , Clove , Rosemary .
To reach an adequate shelf-life, food products not only require a reduced initial microbial load, but also its control or inhibition during the production steps. To obtain the highest sanitizing agent performance is very important to optimize the contact time between pathogen and essential oils. The essential oils inhibitory effect on E. coli survival during 20 h period of time at 20C was analyzed. Three essential oils were chosen according to their inhibitory activity, clove (high inhibitory effect), tea tree (medium inhibitory effect) and rosemary (low inhibitory effect). The essential oils concentration used was the MIC. Clove, tea tree and rosemary effects on E. coli growth during the first hour contact were presented in Figure 1. Longer contact times (up to 20 h) results between oils and pathogen were explained in the text but the data were not shown in Figure 1. Initial counts for control sample were 3 x 106 CFU/ mL. At zero time, clove application produced 1 log reduction compared with control sample. At 15 min of application E. coli counts were reduced 3.5 log respect to control. Longer contact times (> 15 min< 20 h) did not show higher reductions in microbial counts but exerted a bacteriostatic effect. For tea tree and rosemary the initial counts ranged from 2.0-2.8 x 106 CFU/ mL and these values were maintained during the first 30 min of incubation. After 45 min, 1 log reduction was obtained with tea tree, while with rosemary 60 min of contact was necessary to obtain the same log reduction. Longer contact times (> 15 min < 20 h) with tea tree and rosemary oils did not exert a bacteriostatic effect and they did not control E. coli growth. We can conclude that the optimal contact time between essential oil and pathogen were near 15 min for clove, 45 min for tea tree and 60 min for rosemary. These results were in agreement with E. coli sensitivity to each essential oils. Clove had exerted its maximum bactericidal activity at 15 min of contact, its first contact with the pathogen produce a significant reduction (p< 0.05) in microbial counts and its bacteriostatic action was active up to 20 h of incubation. This work suggests the potential essential oils used as possible food antimicrobial preservatives, in particular those produced by organic methods, providing
414
alternative technologies to conventional antimicrobial additives in foods. Nevertheless, this work has been conducted in culture media; consequently little is understood about their effectiveness in the food substrates. However, the information about essential oils effect in actual food systems is still insufficient. Higher concentrations are needed to achieve the same effects in foods systems [31, 32]. The greater nutrients availability in foods compared to laboratory media may allow bacteria to faster repair of damaged cells [33]. The effectiveness of essential oils application in actual food systems is the result of multiple factor associations such as food composition or storage temperatures [21, 30, 33, 34, 35, 36]. The presence of surfactants and organic substances that could interact with active sites of antimicrobial substances also plays an important role [26]. In addition, the mode that essential oils were applied on foods is fundamental on antibacterial and antioxidant activity [37]. When foods are kept at proper refrigeration temperatures, the microbial populations growth were arrested. However, in some food handling operations such as food-catering services and self-serve restaurants, food items may be accidentally exposed to abusive temperatures. Therefore, biopreservatives that would be capable of controlling food borne pathogens when foods are exposed to abusive temperatures could make an important contribution to such operations. We evaluated the clove and tea tree effectiveness to control Escherichia coli O157: H7 on actual food systems (blanched spinach and minced cooked beef) exposed to abusive refrigeration (8-10 C) and environment (20-22 C) temperatures. Clove and tea tree resulted to be effective enough to restrict E. coli and native microbial populations and their antimicrobial action was dependent to oil applied concentration, food matrix composition and storage abusive temperature [38]. In this way, the antimicrobial actions were more effective at concentrations higher than MIC and over blanched spinach respect to minced cooked beef (Figure 2). This food substrate was high in water and low in fat content, respect to minced cooked meat (high fat and protein content products). Higher antibacterial effects were observed at environmental abusive temperatures (20 22 C) than at refrigerated abusive temperatures (810 C), probably due to higher diffusion rates of oils active principles, allowing a best contact between microorganisms and oils.
Essentials Oils as Reducing Agents of Peroxidase Activity in Vegetables

Enzymatic browning in fruit and vegetable tissues can cause undesirable quality changes during handling, processing and storage. This reaction mostly results from polyphenol oxidase and peroxidase enzymes [39]. Both enzymes catalyze more than one reaction and act on a number of substrates, not only causing food browning but also leading to discoloration, off flavors and nutritional damage [3]. Peroxidase can bind to hydrogen peroxide and produce an activated complex that can react with a wide range of donor molecules [40]. We evaluated the effectiveness of natural essential oils from eucalyptus, tea tree, melisa, rosemary, clove and lemon to reduce peroxidase activity of leafy vegetable extracts [40]. These essential oils were applied at MIC, 2MIC and 4MIC. Crude vegetable extracts of Swiss chard, spinach, lettuce, butter lettuce and cabbage were the peroxidase activity enzyme source. Essential oils effectiveness as antioxidants varied with the enzyme sources. At MIC, all tested oils (with eucalyptus exception) had high antioxidant properties, being clove more effective than other oils.

9 8 CFU/g log 7 6 5 4 3
0
415
(A)
9 8 CFU/g log 7 6 5 4 3
(B)
10
10
15 20 15 20 time(hours)
25
25
30
30
10
15 time (hours)
20
25
30
9 8 CFU/log 7 6 5 4 3 0 5 10
(C)
9 8 CFU/g log log rtos. 7 6 5 4

10 9 8 7 6 5 4 0 5
E fecto de clavo s/ Rtos PCA (8C) (D)
CONTROL 1m ic 2m ic 3m ic
10 15 20 25 30
15 time (hours)
20
25
30
tiempo (horas) 10 15 20 time (hours)
25
30
Figure 2. Total microflora and E. coli survival in blanched spinach treated with clove essential oil during 27 h of storage at two abusive temperatures. A) E. coli counts at 20-22C, B) Total microbial counts at 20-22C, C) E.coli counts at 8-10C and D) Total microbial counts at 8-10C. Control samples (), MIC ( ), 2MIC ( ), 3MIC (X). Each point represents the mean of duplicate on three separate experimental runs.
Table 3. Inhibition halos observed with edible coatings enriched with natural oleoresins on squash native microflora and Listeria monocytogenes
Inhibition halos (mm) Squash native microflora Listeria monocytogenes
Chitosan film + Olive 1% Chitosan film + Rosemary 1% Chitosan film + Capsicum 1% CMC film + Rosemary 1%
8.85 1.50 8.65 0.70 10.00 0.28 8.75 1.92
<8 15.00 0.60 <8 9.50 0.50
The sensitivity to the different antimicrobial agents was classified by the diameter of the inhibition halos as follow: not sensitive to diameters less than 8 mm; sensitive to diameters 9-14 mm ; very sensitive to diameters 15-19 mm and extremely sensitive to diameters larger than 20 mm. Each assay was performed by duplicate in two separate experimental runs. * CMC= Carboximethyl cellulose.
416
Table 4. Effects of antioxidant agents (edible coatings and oleoresins) on percent relative peroxidase and polyphenoloxidase activities of crude vegetable extracts
Peroxidase activity (AU/g) Butternut Butter Squash lettuce 3819.19 + 1400 + 103.2 600.71 4522.12 + 728.52 + 58.32 85.32 (0) (48) 3724.42 + 1326.21+ 15.23 61.78 (2) (5) 3762.84 + 1287.97 + 63.55 25.00 (2) (8) 36.85 + 9.54 66.01 + 16.64 (100) (100) 3530.64 + 602.38 + 57.86 69.76 (8) (57) 262.92 + 58.67 + 4.07 28.72 (93) (100) 1727.76 + 82.90 + 448.78 19.92 (55) (100) 600.96 + 160.63 + 61.86 21.89 (85) (89) 1765.32 + 19.10 + 7.12 51.95 (54) (100) 2629.20 + 72.30 + 166.38 12.80 (31) (100) 3079.92 + 49.50 + 18.92 253.84 (20) (100) Polyphenoloxidase activity (AU/g) Romaine lettuce 2125.80 + 50.34 743.75 + 65.12 (65) 2295.63 + 48.96 (0) 1763.75 + 35.98 (17) 54.05 + 5,62
(100) 702.27 + 67.49 (67) 292.61+ 28.12 (86) 526.70 + 50.62 (75) 1180.20 + 113.43 (44) 1102.20 + 105.93 (48) 165.81 + 15.93 (92) 702.27 + 67.49 (67)
Crude extracts Chitosan
Casein
CMC
Rosemary
Olive
Onion
Capsicum
Cranberry
Garlic
Oreganum
Oreganum + Carvacrol (5%)
Butternut Squash 665.68 + 156.32 1941.80 + 124.51 (0) 711.55 + 98.54 (0) 352.45 + 104.25 (47) 346.47 + 81.35 (48) 553.06 + 134.25 (17) 598.06 + 162.53 (10) 534.24 + 114.20 (20) 539.60 + 109.45 (19) 524.53 + 135.00 (21) 564.65 + 148.98 (15) 568.09 + 104.52 (15)
Butter lettuce 1480.97 + 43.21 784,40 + 58.52 (47) 769.60 + 41.57 (48) 1879.60 + 23.54 (0) 38.12 + 14.60 (100) 410.24 + 27.01 (73) 888.12 + 4.41 (40) 855.00 + 217.43 (42) 610.00 + 134.35 (59) 1223.12 + 103.41 (17) 1555.00 + 523.25 (0) 1736.25 + 51.26 (0)
Romaine lettuce 3614.45 + 128.56 3614.45 + 102.23 (0) 3397.16 + 90.33 (6) 3324.88 + 75.56 (8) 3326.09 + 143.98 (8) 3402.20 + 251.43 (6) 3443.28 + 198.60 (5) 2984.08 + 858.91 (18) 3408.85 + 151.92 (6) 3617.52 + 85.39 (0) 3550.68 + 195.00 (2) 3276.49 + 67.77 10)
Number in bracket: percentage of activity reduction. Each antioxidant solution was tested for each extract in duplicate on three independent lots.
417
During vegetables storage, the feasibility of essential oils, as antioxidant was established [21]. Peroxidase activity was evaluated during 14 days of storage at 5 C. The essential oils of eucalyptus, tea tree, lemon, rosemary and clove inhibited peroxidase activity on chard leaves. In the case of eucalyptus oils, even though did not present inhibitory properties on in vitro determinations, did inhibit the peroxidase activity when applied on vegetable leaves. Although some essential oils reduced peroxidase activity on vegetable leaves did not contribute to extend chard leaves shelf life since another phenomena contributed to vegetable degradations as a whole. Perhaps, essential oils role as arresting peroxidase activity can make differences in products shelf life with higher browning rates such as lettuce, or cabbage.
Antimicrobial and Antioxidant Activities of Edible Coatings Enriched with Natural Plant Extracts
The use of edible films and coatings in food protection and preservation has recently increased since they offer several advantages over synthetic materials, such as being biodegradable and environmentally friendly [42]. Currently, studies dealing with edible films with antimicrobial properties are an interesting research area, increasing during last years. These films could prolong the shelf life and foods safety by preventing pathogenic and spoilage microorganisms growth as a result of their lag-phase extension and/or their growth rate reduction [10]. Edible film ability to retard moisture, oxygen, aromas and solute transport may be improved by including additives such as antioxidants, antimicrobials, colorants, flavors, fortifying nutrients and spices in film formulation [43]. Ponce et al. (2007) [44] analyzed the antimicrobial activity of chitosan, casein and carboxymethylcellulose films, alone as well as enriched with oleoresins, on the native microflora of butternut squash and on Listeria monocytogenes. Also, we studied the antioxidant and antimicrobial properties of these coatings and their effectiveness in in vivo studies, applied to butternut slices. Film-forming solutions did not show significant antimicrobial properties. The oleoresins with meaningful antimicrobial activity against both squash native microflora and L. monocytogenes were olive and rosemary. In general, film-solutions containing 1% of different oleoresins showed limited antimicrobial effects against these indicator microorganisms. In vitro antioxidant property was measured on different crude vegetable extracts (Table 4). The enzyme source proved to affect (POD) and p (PPO) susceptibility to the film-forming solutions. When the film-forming solutions were enriched with oleoresins, the latter lost, or retained their potential to reduce POD and polyphenoloxidase (PPO) activities. In vivo experiments were focused on the treatments offering potential antibacterial and antioxidant benefits. The use of chitosan coatings enriched with rosemary and olive oleoresins applied to butternut squash did not produce a significant antimicrobial effect, however antioxidant effects were observed during the first day, exerting POD inhibition up to 5 days of storage. Both oleoresins and chitosan enriched with them exerted significant antioxidant activities over PPO through out 5 days of storage. The use of chitosan enriched with rosemary and olive did not introduce deleterious effects on the sensorial acceptability of squash. Chitosan enriched with rosemary and olive improved the antioxidant protection of the minimally processed squash offering a great advantage in the prevention of browning
418
reactions which typically result in fruits and vegetables quality loss. If edible coatings enriched with oleoresins are to be used as naturally biopreservatives in minimally processed vegetables, they should not introduce deleterious effects on the sensory attributes of the products. Results from the overall visual quality (OVQ) of fresh control samples, dry control samples (uncoated control) and samples coated with edible films enriched with rosemary and olive resulted from on raw and cooked squash slices indicated that the edible coatings were imperceptible and the oleoresins, at the concentration used (1%), did not produce residual aroma. The panelist found no differences in OVQ among the different samples through the storage time. The use of edible coatings enriched with rosemary and olive did not introduce deleterious effects on the sensorial acceptability of minimally processed squash.
LAB AS NATURAL BIOPRESERVATIVES

LAB cultures isolated from the same type of products in which they will be subsequently used as biocontrol agents may have the greatest success chance in controlling pathogens [45]. Ponce et al. (2007) [46] presents the isolation and characterization of new strains of lactic acid bacteria (LAB) from organic vegetables. Forty five strains of LAB isolated from vegetables were investigated by its antimicrobial activity against taxonomically related microorganisms. Genetic identification of selected LAB was performed by means of PCR method. These strains were Enterococcus faecium, Lactococcus lactis, Enterococcus hirae and Enterococcus canis. Bacteriocin-like substances were active against Gram-positive and Gram-negative foodborne pathogens, Listeria monocytogenes and Escherichia coli, respectively. Few works have reported similar facts, Lactococcus lactis and Pediococcus acidilactici isolated from alfalfa sprouts showed competitive inhibition against E. coli O157:H7 [47]. Taking into account the antagonistic activity inhibition exerted by protease enzyme treatments and the fact that the antimicrobial activities of strains were not affected by catalase, we presumed that antibacterial activities could be mainly due to proteinaceous compounds (Table 5). In all four strains the bacteriocin activity was stable after extend refrigerated storage and freezing-thawing cycles. This fact suggests that bacteriocin produced by the four LAB strains may find application as biopreservatives in minimally processed vegetables. Additionally, the extracellular extracts of all four strains exhibited stable antimicrobial activity even after 15 days of storage at 5 C. The data reported in this study also support the idea that the antimicrobial activity against L. monocytogenes and E. coli were no caused by the bacterial acidification of the medium and also they were not related to the production of hydrogen peroxide. Such observations strongly suggest that the antimicrobial activities against indicators microorganisms used in this study, exhibited by E. hirae, L. lactis, E. faecium and E. canis would be based on the biosynthesis and secretion of bacteriocins. Bacteriocin-like compounds produced by the four LAB strains isolated from organic vegetables resulted to resist freezing and thawing cycles, also retained high antimicrobial activity after extended low storage. The results presented suggest that these bacteriocins may be interesting to apply in minimally processed vegetables which will be storage at refrigerated or freezing temperatures. E. faecium, L. lactis, E. hirae and E. canis isolated from organic vegetables showed novel antagonistic effects against Gram-negative
419
bacteria (E. coli and A. xylosoxidans) with a potential role as food biopreservatives. It is well known that the enterococci are able to produce bacteriocins, some of which have a broad spectrum of activity. This has led to consideration of the enterococci as potential candidates with probiotic and antimicrobial properties that could be used for preventing the development of Listeria in food stuffs. However, before any definitive consideration of these strains for use in a starter culture, they should be carefully evaluated for the presence of all known virulence factors in order to determine what potential risks might be involved in their use.
Table 5. Effect of proteinases on cell-free supernatants of E. faecium, L. lactis, E. hirae and E. canis. Residual activity was determined by agar diffusion assay
* Inhibition halos (mm) by the agar well diffusion assay. ** Control samples consisting of freshly prepared cell-free supematants without treatment. - No inhibition zone.
420
ASCORBIC ACID RETENTION, MICROBIAL GROWTH AND SENSORY ACCEPTABILITY OF LETTUCE LEAVES SUBJECTED TO MILD HEAT SHOCKS
Cut tissues trigger chemical reactions and release nutrients that support the growth of the microflora present on raw produce. Wounding lettuce leaves induces the synthesis of specific enzymes and the accumulation of specific phenolic compounds associated with tissue browning [48]. Heat shock treatments prevented browning of minimally processed lettuce [18]. We determined the effect of unchlorinated water heat shocks (2 min at 30 C, 40 C, and 50 C) on fresh lettuce leaves [49, 50]. The effects, after the treatments and during the subsequent refrigerated storage, were assessed on ascorbic acid retention, microbial count, and sensorial acceptability. Ascorbic acid is heat and oxygen labile and is therefore a sensitive indicator of vitamin losses in vegetables due to processing [51]. Initial AA content of fresh whole lettuce leaves dipped in water baths for 2 min at 20 C was 0.210 0.029 (g kg-1 of fresh weight. Because of cutting lettuce leaves into 1 cm wide stripes, the AA were reduced to a final value of 0.180 0.026 (g kg-1 of fresh weight). Compared to control, samples exposed to 30, 40 and 50 C lost 19 %, 20 % and 30 % of AA, respectively. The evolution of AA contents, represented as the ln of the ratio of AA contents over the initial contents against storage time, is presented in Figure 3.
0 0 -0,5
ln AAx/AAo
20
40
60
80
100
120 20 C 30 C 40 C 50 C
-1 -1,5 -2 -2,5
Storage time (h)
Figure 3. Ascorbic acid degradation (ln AAx/AAo) in fresh cut-lettuce dipped in water at 20, 30, 40 and 50 C. Dotted lines correspond to tendency lines obtained during the first 24 h of storage with a slope average of 0.03475. Full lines correspond to tendency lines obtained during the period 24-96 h of storage, with a slope average of 0.0109. Each assay was performed by triplicate of 3 lots on 3 separate experimental runs.
421
12 Microbial counts (Log CFU/g) 11 10 9 8 7 6 0 20 40 60 Time (hours) 80 100 120
20 C 30 C 40 C 50 C
Figure 4. Evolution of mesophilic bacteria (log colony forming units, CFU/g) in fresh cut lettuce dipped in water at different temperatures during 4 days of storage. Each assays was performed by duplicate of 2 lots on 3 separate experimental runs.
There was a rapid decrease in the first 24 h of refrigerated storage. Thereafter, the AA degraded at a lower rate. No significant differences were found among the slopes of the tendency lines for the different bath temperatures, neither during the first 24 h of storage nor thereafter. However, the slopes of the tendency lines before and after the first 24 h of storage were significantly different. Figure 4 presents the evolution of total microbial counts in fresh cut-lettuce dipped in water at 20, 30, 40 and 50 C during 4 days of storage. Microbial counts in control samples were 6.90 0.39 (log colony forming units [CFU]. g-1). Samples subjected to mild heat treatments at 30, 40 and 50 C did not present reductions in the microbial populations respect to control samples. During refrigerated storage, samples treated at different heat shock temperatures presented a same pattern for microbial populations evolution. There was a sharp increase in the number of CFU. g-1 during the first day. During day 2 and 3, the microbial populations stabilized around 8.2 log CFU. g-1. Finally, between days 3 and 4 of storage, another increase in microbial counts was found. The largest increases in microbial populations corresponded to samples that had been exposed to the highest bath temperatures, that is 50 C. Damaged tissue would not only provide a portal for the entry of microorganisms but would also facilitate their access to nutrients for their metabolism. Furthermore, microorganism can establish inside broken cells or cells adjacent to broken tissue and although fresh-cuts are washed with sanitizing agents, microorganisms can survive when they are located within cells or areas not penetrated by the washing treatment. The application of the thermal shocks did not cause any noticeable changes in the sensory evaluations at the beginning of the storage period. The scores attributed to cut-lettuce color presented similar evolutions in all samples, independent of the temperature at which they had been exposed. Samples treated at 20 and 30 C obtained higher scores in texture appearance than those treated at 40 and 50 C. Nevertheless, after 4 d of storage, this particular index did
422
not reach rejection levels. On the other hand, samples treated at 50 C received significantly higher scores in midrib and edge browning throughout the 4 d of storage, corresponding to excellent quality. Since browning has an important impact on the overall visual quality (OVQ) of this product, samples treated at 50 C were the only ones to receive scores of OVQ above 3 at day 4 of storage. When wounded, the phenylalanine ammonia lyase enzyme (PAL), the first commited step in the synthesis of phenylpropanoid compounds, is synthesized de novo. Figure 5 represents the (PAL) activity in midrib tissue of fresh cut-lettuce. No significant increase in PAL activity was observed in the first 12 h of storage in both samples, so only PAL values obtained at storage times higher than 13 h were presented. Heat shock treatments at 50 C significantly decrease the rate of PAL activity in the first day of storage, being 4 times lower than in control samples. Control of the wound response is the key to provide processed products of good quality [52]. Apparently, the impact of wounding was reduced by the application of heat shock treatments at 50 C, reducing wound-induced metabolic activity. Loaiza-Velarde et al. (1997) [18] reported that treatments at 45 C for 90 s disrupt the wound-induced increase in PAL activity, delays the accumulation of phenolic compounds and diminishes tissue browning. This work presented evidence for the potential application of mild heat shocks as a novel preservation technology for minimally processed vegetables compatible with organic and low input farming systems.
9 8 7 PALx/PALo 6 5 4 3 2 1 0 13 15 17 19 21 Storage time (h) 23 25 27 y = 0,548x - 5,9257 R 2 = 0,8892
y = 0,1237x + 0,1089 R2 = 0,9456
Figure 5. Phenylalanine ammonia lyase (PAL) activity in midrib tissue of fresh cut-lettuce treated at 50 C () compared with control cut-lettuce (20 C) () during the first hours of storage.
CONCLUSION
Due the rapid growth of the organic food industry and the increasing popularity of organic fruits and vegetables, the analysis of different preservation technologies is an issue of significant importance. Scientifically, the most urgent problem is that there is still little
423
understanding of the effectiveness of the use of natural preservatives in conjunction with other common components of organic food system. This lack of understanding encompasses whether microorganisms die, survive, adapt or grow at the dynamic of vegetables. In fact, our results emphasize the importance of thorough sanitation measures, particularly during the packaging phase, and indicate a need for careful evaluation of postharvest handling.
REFERENCES
[1] [2] [3] [4] [5] [6] Kader,AA. (1992). Postharvest technology of horticultural crops, Division of Agriculture and Natural Resources. (pp.15) University of California. Reyes, V. (1996). Improved preservation systems for minimally processed vegetables, Food Australia 48(2),8790. Vamos-Vigyazo, L. (1981). Polyphenol oxidase and peroxidasa in fruits and vegetables, Critical Review Food Science Nutrition, 15, 49-54. Cherry, J. P. (1999). Improving the safety of fresh produce with antimicrobials, Food Technology, (53), 54-59. Gilliland, S. (1986). Bacterial Starter Cultures for Foods. Boca Raton, Florida:CRCPress. De Vuyst, L., & Vandamme, E. (1994). Antimicrobial potential of lactic acid bacteria. In Bacteriocins of Lactic Acid Bacteria ed. De Vuyst, L. and Vandamme (pp. 91-142). London: Blackie Academic and Professional. De Vuyst, L., Callewaert, R., & Crabbe, K. (1996). Primary metabolite kinetics of bacteriocin biosynthesis by Lactobacillus amylovorus and evidence for stimulation of bacteriocin under unfavorable growth conditions, Food Microbiology, 142, 817-827 Zamfir, M., Callewaert, R., Cornea, P., Savu, L., Vatafu, I., & De Vuyst, L. (1999). Purification and characterization of bacteriocin produced by Lactobacillus acidophilus IBB 801. Journal of Applied Microbiology, 87, 923-931. Min, S., Krochta, J. (2005). Inhibition of Penicillium commune by edible whey protein films incorporating lactoferrin, lacto-ferrin hydrolysate, and lactoperoxidase systems. Journal of Food Science, 70(2), 87-94 Quintavalla, S., Vicini, L. (2002). Antimicrobial Food Packaging in meat industry. Meat Science, 62, 373-380. Botsoglou, N., Christaki, E., Fletouris, D., Florou-Paneri, P., Spais, A. (2002). The effect of dietary oregano essential oils on lipid oxidation in raw and cooked chicken during refrigerated storage. Meat Science, 62, 259-265. Saltveit, ME. (2000). Wound induced changes in phenolic metabolism and tissue browning are altered by heat shock. Postharvest Biology and Technology, 1(1),6169. Loaiza-Velarde, JG, Toms-Barber, FA & Saltveit, ME. (1997). Effect of intensity and duration of heat shock treatments on wound-induced phenolic metabolism in iceberg lettuce. Journal American Society of Horticulturae Science, 122, 7377. Lpez-Glvez, G., Saltveit, ME. & Cantwell, MI. (1996). Woundinduced phenylalanine ammonia lyase activity: factors affecting its induction and correlation with the quality of minimally processed lettuce. Postharvest Biology and Technology, 8,179190.
[7]
[8]
[9]
[10] [11]
[12] [13]
[14]
424 [15]
M.R. Moreira, A.G. Ponce and S.I. Roura Delaquis, PJ, Stewart, S, Toivonen, PMA & Moyls AL. (1999). Effect of warm chlorinated water on the microbial flora of shredded iceberg lettuce. Food Research International, 32, 714. Li, Y, Brackett, RE, Chen, J & Beuchat, LR. (2002). Mild heat treatments of lettuce enhances growth of L. monocytogenes during subsequent storage at 5 or 15C. Journal of Applied Microbiology, 92(2),269275. Saltveit, ME. (1998). Heat shock and fresh cut lettuce. Perishables Handling Quality, 95, 56. Loaiza-Velarde, JG & Saltveit, ME. (2001). Heat shock applied either before or after wounding reduces browning of lettuce leaf tissue. Journal American Society of Horticulturae Science, 126, 227234. Murata, M, Tanaka, E, Minoura, E & Homma, S. (2004). Quality of cut lettuce treated by heat shock: prevention of enzymatic browning, repression of phenylalanine ammonia-lyase activity and improvement on sensory evaluation during storage. Bioscience Biotechnology and Biochemistry, 68,501507. Ponce, AG., Fritz, R., Del Valle, CE. & Roura, SI. (2003). Antimicrobial activity of essential oils on native microbial population of organic Swiss chard. LebensmittelWissenschaft und-Technology, 36, 679.-684. Ponce, AG., Fritz, R., Del Valle, CE. & Roura, SI. (2004). Shelf life of leafy vegetables treated with natural essential oils. Journal of Food Science, 69:2, FM 550556. Singh, N., Singh, RK., Bhunia, AK. & Stroshine, RL. (2002). Efficacy of chlorine dioxide, ozone and thyme essential oil or a sequential washing in killing Escherichia coli O157:H7 on lettuce and baby carrots. Lebensmittel-Wissenschaft &Technology, (35), 720-729. Skandamis, P., Koutsoumanis, K., Fasseas, K. & Nychas, GJ. (2001). Inhibition of oregano essential oil and EDTA on Escherichia coli O157:H7. Italian Journal Food Science, (13), 65-75. Elgayyar, M., Draughon, FA., Golden, DA. & Mount, JR. (2001). Antimicrobial activity of essential oils from plants against selected pathogenic and saprophytic microorganisms. Journal of Food Protection, 64 (7), 1019-1024. Moreira, MR, Ponce, AG, del Valle, CE & Roura, SI. (2005). Inhibitory parameters of essential oils to reduce a foodborne pathogen. Lebensmittel-Wissenschaft undTechnology, 38(5), 565-570. Hammer, K., Carson, C. & Riley, T. (1999). Influence of organic matter, cations and surfactants on the antimicrobials activity of Melaleuca alternifolia (tea tree) oil in vitro. Journal of Applied Microbiology, 86, 446-452. Friedman, M., Henika, PR. & Mandrell, RE. (2002). Bactericidal activities of plant essential oils and some of their isolated constituents against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes and Salmonella enterica. Journal of Food Protection, 65(10), 1545-1560. Draughon, A. (2004). Use of Botanicals as Biopreservatives in Foods. Food Technology, 58(2), 20-28. Dadalioglu, I. & Evrendilek G. (2004). Chemical composition antibacterial effects of essential oils of Turkisse oregano, Bay laurel, Spanish lavender on common food borne pathogens. Journal of Agricultural and Food Chemistry, 52, 8255-8260.
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28] [29]
Organic Fresh Vegetables: Green Technologies [30]
425
[31] [32]
[33]
[34] [35]
[36]
[37] [38]
[39]
[40] [41]
[42]
[43] [44]
[45]
[46]
Burt, SA. (2004). Essential oils: their antibacterial properties and potential applications in foods- a Review. International Journal of Food Microbiology, 94, 223-253. Shelef, LA. (1983). Antimicrobial effects of spices. Journal of Food Safety, 6, 29-44 Smid, E. and Gorris G. 1999. Natural antimicrobials for food preservation. In Handbook of food preservation (pp. 285). Shafiurr Rahman M. (ed.): Marcel Dekker: Inc., New York. Gill, A., Delaquis, P., Russo, P. & Holley, R. (2002). Evaluation of antilisterial action of cilantro oil on vacuum packed ham. International Journal of Food Microbiology, 73, 83-92. Smith-Palmer, A., Stewart, J. & Fyfe, L. (2001). The potential application of plant essential oils as natural preservatives in cheese. Food Microbiology, 18(4), 463-470. Canillac, N. & Mourey, A. (2004). Effects of several environmental factors on the anti-Listeria monocytogenes activity of an essential oil of Picea excelsa. International Journal of Food Microbiology, 92(1), 95-103. Tsegaye, M., Ephraim, E. & Ashenafi, M. (2004). Behaviour of E. coli O157:H7 during the fermentation of Datta and Awaze, traditional Ethipian fermented condiments, and during products storage at ambient and refrigeration temperatures. Food Microbiology, 21(6), 743-751. Pandit, VA. & Shelef, LA. (1994). Sensitivity of Listeria monocytogenes to rosemary (Rosmarinus officinalis ). Food Microbiology, 11, 57-63. Moreira, MR., Ponce, AG., del Valle, CE & Roura, SI. (2007). Effects of clove and tea tree oils on Escherichia coli 0157:H7 in blanched spinach and mince cooked beef. Journal of Food Processing & Preservation 31: 379-391 Nicoli, M. C., Elizalde, B. E., Piotti, A. and Lerici, C. R. 1991. Effect of sugars and Maillard reactions products on polyphenol oxidase and peroxidasa activity in food. Journal of Biochemistry (15): 169-184. Reed, G. 1975. Enzymes in Food Processing. New York: Academic Press, 243p. Ponce A. G., del Valle, C. E. and Roura S. I 2004b. Natural essential oils as reducing agents of peroxidasa activity in leafy vegetables. Lebensmittel-Wissenschaft undTechnology 37:199-204. Pranoto, Y., Rakshit, S., Salokhe, V., 2005. Enhancing antimicrobial activity of chitosan films by incorporating garlic oil, potassium sorbate and nisin. LWT. 38, 859865. Tharanathan, R., 2003. Biodegradable films and composite coatings: past, present and future. Trends Food Sci. Technol. 14, 71-78. Ponce, A., Roura, S., del Valle, C. and Moreira, M. Antimicrobial and antioxidant activities of edible coatings enriched with natural plant extracts: in vitro and in vivo studies. Postharvest Biology and Technology (In revision, March 2007). Vescovo, M., Torriani,S., Orsi C., Macchiarolo, F., & Scolari, G. (1996). Application of antimicrobial-producing lactic acid bacteria to control pathogens in ready-to use vegetables. Journal of Applied Bacteriology, 7 81, 113-119. Ponce, A., Moreira, M., del Valle, C. and Roura, S. Preliminary characterization of bacteriocin-like substances from lactic acid bacteria isolated from organic leafy vegetables. Lebensmittel- Wissenschaft and Technology, Food Science and Technology (In press, 2007).
426 [47]
M.R. Moreira, A.G. Ponce and S.I. Roura Wilderdyke, M., Smith, D., & Brashears, M. (2004). Isolation, Identification and Selection of Lactic Acid Bacteria from Alfalfa Sprouts for Competitive Inhibition of Foodborne pathogens. Journal of Food Protection, 67(5), 947-951. Toms-Barbern, FA. & Espin, JC. (2001). Phenolic compounds and related enzymes as determinants of quality in fruits and vegetables. Journal of Food Science Agriculture, 81, 853-876. Moreira, M., Ponce, A., del Valle C. & Roura, S. I. (2006). Ascorbic Acid Retention, Microbial Growth and Sensorial Acceptability in Lettuce Leaves Subjected to Mild Heat Shocks. Journal of Food Science 71(2), S188-192. Moreira, M., Ponce, A. del Valle, C., Pereyra, L. & Roura, S. (2007). Mild heat shock to extend the shelf life of minimally processed lettuce. Journal of Applied Horticulture (In press). Logomarsino, JV. & Gao, J. (1991). Ascorbic acid retention of broccoli held on a refrigeration salad bar. Journal of Food Quality 14, 513519. Watada, AE., Ko, NP. & Minott, DA. (1996). Factors affecting quality of fresh-cut horticultural products. Postharvest Biology and Technology, 9, 115-125.
[48]
[49]
[50]
[51] [52]
Chapter 14
THE USE OF FISH POWDERS AND GRUEL AS GROWTH SUBSTRATE FOR THE PRODUCTION OF ALKALINE SERINE PROTEASES BY BACILLUS LICHENIFORMIS NH1
Nedra El Hadj-Ali*, Noomen Hmidet, Nabil Souissi, Alya Sellami-Kamoun and Moncef Nasri
Laboratoire de Gnie Enzymatique et de Microbiologie, Ecole Nationale dIngnieurs de Sfax B.P. "W" 3038 Sfax, Tunisia
ABSTRACT
The present study is concerned with the selection of new economical media based on agricultural and marine-processing by-products for the production of alkaline proteases by Bacillus licheniformis NH1. Powders from different fish species were prepared then tested as growth media at a concentration of 10 g/l for protease production by NH1 strain. Powder prepared from whole Sardinelle was found to be the best substrate for the production of the alkaline protease. The NH1 strain exhibited a slightly greater protease production (2927 U/ml) in medium containing only whole Sardinelle powder than that obtained in control medium (2800 U/ml). Proteases were produced even when strain NH1 was cultivated in medium containing only powder prepared from combined heads and viscera Sardinelle (CHVSP), about 2117 U/ml. Protease production was also carried out in media containing gruel, a by-product of semolina factories, as carbon source. Maximum activity (2517 U/ml) was achieved when the strain was grown in medium containing (g/l): gruel 10, casein peptone 2, K2HPO4 0.5 and KH2PO4 0.5. Moreover, protease production was considerably enhanced when the strain was grown in medium containing both gruel and CHVSP as
*
Corresponding author: Tel.: +216-74-274-088; Fax: +216-74-275-595. E-mail address: elhadjali_nedra@yahoo.fr
428
Nedra El Hadj-Ali, Noomen Hmidet, Nabil Souissi et al.

carbon and nitrogen sources, respectively (4771 U/ml). The study shows that gruel and powders from fishery by-products could be utilized as bacterial substrates for the production of alkaline protease by B. licheniformis NH1.
Keywords: Fish powder; Gruel; Heads and viscera. Protease; Bacillus licheniformis.
INTRODUCTION
The expansion of biotechnology has created an increasing demand for new and low cost microbial growth substrate. In most instances, the growth medium accounts for approximately 40% of the production cost of industrial enzymes (Joo and Chang 2005). Considering this fact, the use of cost-effective growth substrate for the production of alkaline proteases can significantly reduce the cost of protease production. Proteases are the most important industrial enzymes accounting for approximately 50% of the total industrial enzyme market (Rao et al. 1998). They have diverse applications in a wide variety of industries, such as in detergent, food, pharmaceutical, leather, silk and for recovery of silver from used X-ray films (Kumar and Takagi 1999; Gupta et al. 2002). Of these, alkaline proteases are particularly important because they are both stable and active at high pH solutions and in the presence of surfactants and oxidizing agents (Gupta et al. 1999; Gupta et al., 2002). Their major application is in detergent industry, because the pH of laundry detergents is generally in the range of 9.0-12.0. Alkaline proteases are used as cleaning additives in detergents to facilitate the release of proteins. Proteases in detergent industries account for approximately 30% of the total world enzyme production (Kalisz 1988). They are produced by a wide range of microorganisms including bacteria, moulds, yeasts and also mammalian tissues. Most of the commercial alkaline proteases were isolated from Bacillus species (Maurer 2004). Several studies have been undertaken to define culturing and nutritional conditions for obtaining higher yields of proteases. Extracellular production of proteases by microorganisms is greatly influenced by physical factors such as pH, temperature and incubation time, and by the composition of the medium (Johnvesly and Naik 2001; Puri et al. 2002). Indeed, carbon and nitrogen sources were considered determinant factors (Frankena et al. 1986; Giesecke et al. 1991). Several studies have reported that proteins and peptides are necessary for effective protease production, while glucose repressed protease formation (Drucker 1972; Ferrero et al. 1996; Fukushima et al. 1989). However, some works reported better protease synthesis in the presence of glucose as carbon source (Gessesse and Gashe 1997; Mehrotra et al. 1999). Other medium compounds, such as metal ions and phosphorus source may also affect the amount of enzyme formation. Ghorbel-Frikha et al. (2005) reported the production of a calciumdependent metalloprotease by Bacillus cereus BG1. The enzyme was detected only when the strain was cultivated in the presence of calcium. Protease production from Bacillus species using various agricultural residues (such as soybean meal, rice bran and wheat flour) was widely described in literature. Naidu and Devi (2005) reported the production of thermostable alkaline protease by Bacillus sp. K30 utilizing rice bran. Joo and Chang (2005) showed that maximum protease synthesis by alkalophilic Bacillus sp. I-312 was obtained when the bacterium was grown in a medium containing wheat
The Use of Fish Powders and Gruel as Growth Substrate ...
429
flower and soybean meal as carbon and nitrogen sources, respectively. Soybean meal was also used as a nitrogen source for protease production by Bacillus sp. L21 in low cost producing media (Tari et al. 2006). In a previous search for alkaline protease-producing strains, which have potential industrial applications, B. licheniformis NH1 strain, producing an alkaline protease, was isolated from an activated sludge reactor treating fishery wastewaters (El Hadj-Ali et al. 2007). The crude extracellular protease produced by the isolate had optimal activity at 6570C and pH 10.0-11.0. The enzyme showed excellent stability and compatibility with many detergents tested. The strain exhibited higher productivity of alkaline protease in medium containing casein as carbon source (2800 U/ml). It showed higher growth but lower protease on starch. However, glucose repressed protease formation. The ability of NH1 strain to grow and produce alkaline proteases on casein as a substrate led us to look for the formulation of media based on cheap substrates. In Tunisia, semolina factories and fishery industries produce large quantities of byproducts. Gruel, a by-product of semolina factories, constitutes a good source of starch at present utilized as a food material. Several reports showed also that gruel might be used as carbon source for metabolite production (Zouari et al. 2002). During fish processing, large quantities of waste, including heads and viscera, are generated and discarded. They can represent about 30% of the original raw material. These wastes, which represent an environmental problem to the fishing industry, constitute an important source of protein. Traditionally, these materials have been converted to powdered fish flour used as animal feed (Strom and Eggum, 1981). Since they are rich in proteins, fishes constitute a potential source of industrial peptones for a wide range of applications, especially as nitrogen and/or carbon source for microbiological use. However, few works have been reported concerning the use of non-hydrolysed fish proteins for the growth and the production of metabolites by microorganisms (Ellouz et al. 2001). The aim of this study was to examine the possible utilization of both fish powders and gruel as bacterial growth substrates for alkaline protease production by B. licheniformis NH1.
MATERIALS AND METHODS

Materials
Whole fish powders were prepared from different species of fish: Sardinelle (Sardinella aurita); Tub gurnard (Trigla lucerna); Common Pandora (Pagellus erythrinus); Red mullet (Mullus barbatus) and Salema (Sarpa salpa). Fish species were purchased from the local market at Sfax city Tunisia. Casein sodium salt from bovine milk was purchased from Sigma Chemical Co. (St Louis, MO, USA). Casein peptone and yeast extract were from Bio-Rad (France). Trichloroacetic acid was from Carlo Erba Reactifs. Other chemicals and reagents used were of analytical grade.
430
Bacterial Strain
The microorganism used in this study was isolated from an activated sludge reactor treating fishery wastewaters. It was identified as B. licheniformis NH1 (El Hadj-Ali et al. 2007).
CULTIVATION AND MEDIA

Inocula were routinely grown in Luria-Bertani (LB) broth medium composed of (g/l): peptone 10; yeast extract 5; NaCl 5 (Miller 1972). The previously optimized M1 medium used for protease production was composed of (g/l): casein 5, yeast extract 2, K2HPO4 0.5, KH2PO4 0.5, and KCl 1.5, pH 8.0 (El Hadj-Ali et al. 2007). The fish medium used for protease production was composed with only fish powder (10 g/l). The initial M2 gruel medium was composed of (g/l): gruel 10, yeast extract 2, K2HPO4 0.5 and KH2PO4 0.5, pH 8.0. Media were autoclaved at 120 C for 20 min. Gruel contains: 50-60% starch, 8-12% proteins, 1.5% cellulose and 5% carbohydrates. Cultivations were conducted in 25 ml of medium in 250 ml conical flasks maintained at 37 C. Incubation was carried out with agitation at 200 rpm for 24 h. The cultures were centrifuged and the supernatants were used for estimation of proteolytic activity.
CELL GROWTH DETERMINATION

The growth of the microorganism was estimated by the determination of colony forming units (CFU/ml). All experiments were carried out in duplicate and repeated at least twice.
Preparation of Fish Powders

To obtain fish-meat powders, heads and viscera were first eliminated. The raw material was then heated till boiling. The bones were removed and the cooked meat was pressed to remove water and fat. The resulting pressed product was minced in a meat grinder, and then dried at 80 C for 24-48 h. The dried fish preparation was minced again to obtain a fine powder, and then stored in glass bottles at room temperature. In order to obtain whole fish or combined heads and viscera fish powders, raw materials were cooked, pressed, minced and then dried.
Chemical Composition
Dry weight of fish powders was determined after heating samples at 105 C to constant weight, and ash content was determined after heating dried samples at 600 C for 2 h. Total nitrogen content was determined using the Kjeldahl method. Crude protein was estimated by
431
multiplying total nitrogen content by the factor 6.25. Crude fat was determined gravimetrically after Soxhlet extraction of dried samples with diethyl ether.
Assay of Proteolytic Activity

Protease activity was measured by the method of Kembhavi et al. (1993) using casein as a substrate. A 0.5 ml aliquot of the culture supernatant, suitably diluted, was mixed with 0.5 ml 100 mM glycine-NaOH (pH 10.0) containing 1% (w/v) casein, and incubated for 15 min at 70 C. The reaction was stopped by addition of 0.5 ml trichloroacetic acid (20%, w/v). The mixture was allowed to stand at room temperature for 15 min and then centrifuged at 10,000g for 15 min to remove the precipitate. The acid soluble material was estimated spectrophotometrically at 280 nm. A standard curve was generated using solutions of 0-50 mg/l tyrosine. One unit of protease activity was defined as the amount of enzyme required to liberate 1 g of tyrosine per min under the experimental conditions used. Protease activities represent the means of at least two determinations carried out in duplicate. The difference between values did not exceed 5%.

Preparation of Fish Substrates
Fish powders were prepared from different species of fish and used as growth media for protease production by NH1 strain. Moreover, fish powders were prepared from meat Sardinelle (MSP) and combined heads and viscera Sardinelle (CHVSP). The main chemical composition of fish powders is given in Table 1. These data show fish powders to be rich in both organic and inorganic materials. Notably, fish powders contain the essential substances required in microbial media, such as sources of carbon, nitrogen and minerals. As shown in Table 1, all whole fish powders contained high protein content (between 52.8 and 64.4%, byweight). MSP contained high protein content (76.2%) but lower ash and a relatively high lipid content. CHVSP contained more lipids and less protein content than whole and meat Sardinelle powders and due to higher bone content there are more minerals.
Protease Production by B. Licheniformis NH1 Strain Grown on Different Fish Powders

In order to test if fish preparations promote biomass and enzyme synthesis, protease production by B. licheniformis NH1 was assayed in media containing only whole fish substrates at a concentration of 10 g/l, and compared with the control medium (M1) containing casein and yeast extract as sources of carbon and nitrogen, respectively. As shown in Table 2, all the whole fish substrates tested enhanced growth and protease production by
Table 1. Chemical composition of fish powders (g/100 g product)

Water WSP Tub gurnard Common pandora Red mullet Salema MSP CHVSP 5.6 5.4 5.9 5.4 6.4 1.2 1.3 Proteins N x 6.25 62.4 63.6 52.8 59.8 64.4 76.2 48.6 Ash 10.6 17.9 19.5 10.8 19.4 4.5 20.9 Lipids 19.3 12.4 20.3 21.2 9 15.8 26.9 Cl 0.174 0.083 0.084 0.102 0.091 nd nd SO4 2.65 6.87 0.662 nd 1.23 nd nd Na 0.427 0.484 0.472 0.427 0.402 nd nd K 0.362 0.452 0.458 0.362 0.278 nd nd Mg 0.135 0.176 0.193 0.144 0.193 nd nd Ca 1.805 3.883 5.146 1.975 3.905 nd nd
WSP: Whole Sardinelle powder; MSP: Meat Sardinelle powder; CHVSP: Combined heads and viscera Sardinelle powder. nd: not determined.
433
NH1 strain, indicating that it was not necessary to add ingredients (such as salts and yeast extract) to fish medium. Maximum activity was obtained with whole sardinelle powder (WSP) (2927 U/ml) and it was slightly higher to that obtained in control medium M1 (2800 U/ml) (El Hadj-Ali et al. 2007). However, lower biomass and protease activity were obtained with whole Red mullet and whole Salema powders (1700 U/ml).
Table 2. Effect of different whole fish powders on growth and protease production by B. licheniformis NH1
Protease activity (U/ml) Control (M1) Sardinelle Tub gurnard Common pandora Red mullet Salema 2800 2927 2487 2418 1756 1647 Biomass (x 106 cells/ml) 80 225 580 520 105 145
Cultivations were performed for 24 h at 37 C in media containing only whole fish powder at a concentration of 10 g/l. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates). M1 medium consisting of (g/l): casein 5, yeast extract 2, K2HPO4 0.5, KH2PO4 0.5 and KCl 1.5.
Meat sardinelle powder (MSP) and combined heads and viscera sardinelle powder (CHVSP) were also tested for protease production by B. licheniformis NH1 in media containing only fish substrates at a concentration of 10 g/l and compared to that obtained with WSP (Table 3). The highest level of protease production was achieved by using WSP (3000 U/ml), although this substrate contains less protein (62.4%) than MSP (76.2%). An important protease activity (2117 U/ml) was produced with CHVSP, although this substrate contains less protein than the other preparations (48.6%). This result may be explained by the existence in CHVSP of bioactive substances that induced protease synthesis. With Pseudomonas aeruginosa MN7, maximum protease activity was obtained also with whole Sardinelle preparation (Triki-Ellouz et al. 2003). However the highest level of protease production by B. subtilis was obtained when the strain was cultivated in CHVSP (Ellouz et al. 2001).
Table 3. Effect of different Sardinelle preparations on growth and protease production by B. licheniformis NH1
WSP 3000 22 MSP 1713 8 CHVSP 2117 154
Protease activity (U/ml) Biomass (x 107 cells /ml)
Cultivations were performed for 24 h at 37 C in media containing only Sardinelle powder at a concentration of 10 g/l. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
434
Since whole Sardinelle preparation was the best substrate for protease synthesis by NH1 strain, the effects of its various concentrations on enzyme production was studied. As shown in Table 4, the highest protease production (3000-3300 U/ml) was achieved between 7.5 and 20 g/l. However, maximum protease yield was obtained with 7.5 g/l of WSP.
Table 4. Effect of WSP concentrations on growth and protease production by B. licheniformis NH1
WSP (g/l) 7.5 10 2967 3018
Protease activity (U/ml) Biomass (x 106 cells /ml) Yield (103 U/g substrate)
2 633 8 316.5
5 1891 34 378.2
15 3331 420 222
20 3382 900 169.1
180 395.6
230 301.8
Cultivations were performed for 24 h at 37 C in media containing different concentration of whole Sardinelle powder. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
Protease Production by B. Licheniformis NH1 Strain Grown on Gruel Based Medium

Since gruel is an inexpensive and readily available substrate, it was to be a possible candidate for the cost-effective production of extracellular proteases. So the capacity of protease production by NH1 strain was studied in medium M2 containing different concentrations of gruel as carbon substrate. As shown in Table 5, protease activity increased with increasing gruel substrate and reached a value of about 2000 U/ml with 10 g/l. Beyond 10 g/l, the level of protease activity did not vary significantly. The yield, estimated as protease produced per g of substrate used, reached a maximum value of about 200.4 x 103 U/g substrate, at 10 g/l of gruel.
Table 5. Effect of gruel concentration on growth and protease production by NH1 strain
Gruel (g/l) 10 2004
Protease activity (U/ml) Biomass (x 107 cells /ml) Yield (10 U/g substrate)
3
2 585 37 292.7
5 995 42 199
15 2142 170 142.8
20 2230 193 111.5
55 200.4
Cultivations were performed for 24 h at 37 C in media consisting of (g/l): yeast extract 2, K2HPO4 0.5, KH2PO4 0.5 and different concentrations of gruel. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
The effect of different organic (casein peptone and yeast extract) and inorganic (ammonium sulphate) nitrogen sources on protease synthesis in M2 medium containing gruel at 10 g/l, K2HPO4 0.5 g/l and KH2PO4 0.5 g/l was also investigated. As shown in Table 6, the best nitrogen source for protease production was casein peptone (2520 U/ml) followed by
435
yeast extract (2003 U/ml). However, enzyme production was significantly low with ammonium sulphate as nitrogen source.
Table 6. Effect of different nitrogen sources (2 g/l) on protease and biomass production by B. licheniformis NH1
Nitrogen Source Yeast extract Ammonium sulphate
Casein peptone Protease activity (U/ml) Biomass (x 107 cells /ml) 2520 122
2003 53
291 22
Cultivations were performed for 24 h at 37 C in media consisting of (g/l): gruel 10, nitrogen source 2, K2HPO4 0.5 and KH2PO4 0.5. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
Conflicting results regarding the effects of organic and inorganic nitrogen sources on alkaline protease production by Bacillus sp. have been reported in the literature. Do Nascimento and Martins (2004) reported maximum enzyme activity by thermophilic Bacillus sp. SMIA-2 with ammonium nitrate as inorganic nitrogen source, and found that protease production was repressed by organic nitrogen sources, while other works reported a higher protease production with organic nitrogen source (Feng et al. 2001; Patel et al. 2005). Based on these observations, casein peptone was selected and its various concentrations were tested for the production of protease. As shown in Table 7, the enrichment of growth medium with casein peptone enhanced significantly both bacterial growth and protease production. Maximum activity was achieved at a concentration of 2 g/l (2517 U/ml); further additions of casein peptone decreased biomass and protease synthesis. Protease synthesis was significantly low in the absence of casein peptone (600 U/ml).
Table 7. Effect of casein peptone concentration on growth and protease production by B. licheniformis NH1
Casein Peptone (g/l) 1 2 2116 2517 53 122
Protease activity (U/ml) Biomass (x 107 cells /ml)
0 600 32
0.5 2033 50
5 1764 33
Cultivations were performed for 24 h at 37C in media consisting of (g/l): gruel 10, K2HPO4 0.5, KH2PO4 0.5 and different concentrations of casein peptone. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
Protease Production in Medium Containing both Fish Powder and Gruel

The ability of NH1 strain to grow and produce alkaline protease in media containing fish powders or gruel, led us to study the formulation of a new medium based on these substrates. Protease synthesis was investigated in M2 medium containing gruel (10 g/l) as carbon source and different concentrations of CHVSP as nitrogen source. As shown in Table 8, protease production was significantly low with CHVSP up to 2 g/l. Maximum activity was observed
436
with 10 g/l, about 4771 U/ml, which was about 8-fold over the medium without or containing 2 g/l CHVSP. Beyond 10 g/l of CHVSP, protease activity decreased while biomass increased.
Table 8. Effect of CHVSP concentration on growth and protease production by B. licheniformis NH1
CHVSP (g/l) 7 10
0 Protease activity (U/ml) Biomass (cells/ml) 600 285 106
2 600 250 106
15 4124 85 109
20 3738 126 109
2094 240 107
3258 257 108
4771 48 109
Cultivations were performed for 24 h at 37 C in media consisting of (g/l): gruel 10, K2HPO4 0.5, KH2PO4 0.5 and different concentrations of CHVSP. Values are means of three independent experiments. Standard deviations 2.5% (based on three replicates).
CONCLUSION
In this study, the production of alkaline protease by B. licheniformis NH1 grown in economical medium was investigated. Protease production was first tested in media containing only fish powders, prepared in our laboratory, at a concentration of 10 g/l. The results obtained clearly indicated that fish preparations alone promote biomass and protease synthesis, and does not need to be enriched by the addition of nitrogen source, phosphate and salts. The proteolytic activity varied with fish powders used. This was probably due to differences in fish powders composition. The NH1 strain produced maximum protease in WSP (2927 U/ml), followed by whole Tub gurnard (2487 U/ml) and Common pandora (2418 U/ml). Moreover, the strain was found to grow well and produce higher protease activity with CHVSP, although this powder contains low protein content. The enhancement of protease activity in media containing only CHVSP may be due to the presence in fish powders of bioactive substances acting as protease inducers. Protease production was also investigated in media containing gruel, an inexpensive and readily available by-product, as carbon source. Although, gruel contains protein (8-12%) supplementing it with organic nitrogen source lead to an increase in protease activity. Among various nitrogen sources studied, the NH1 strain produced maximum protease with casein peptone (2520 U/ml) followed by yeast extract (2003 U/ml). Ammonium sulphate was found to inhibit growth and protease synthesis. In order to reduce the cost of protease production, cultures were conducted in media contained gruel and fish powders as sources of carbon and nitrogen, respectively. By comparison with the results obtained with commercial substrates (2800 U/ml), the production of the alkaline protease was enhanced significantly (4771 U/ml) by the combination of gruel and fish powders. According to optimization experiments, the optimum protease medium formulated contained (g/l): gruel 10, CHVSP 10, K2HPO4 0.5 and KH2PO4 0.5. From this study, it can be concluded that gruel and fish powders are excellent sources of carbon and nitrogen, respectively, for growth and alkaline protease synthesis by B. licheniformis NH1.
437
The use of these cheaper and readily available sources of both carbon and nitrogen sources instead of commercial substrates are the key attraction for the cost-effective production of an extracellular proteases. Additional experiments should be conducted to elucidate the behavior of the strain with each fish powder studied and to identify bioactive substances or inducers present in fish powder.
ACKNOWLEDGEMENTS
This work was financed by Ministre de la Recherche Scientifique, de la Technologie et du Dveloppement des Comptences, Tunisie.
REFERENCES
Do Nascimento, W.C.A. and Martins, M.L.L. (2004). Production and properties of an extracellular protease from thermophilic Bacillus sp. Brazilian Journal of Microbiology, 35, 91-96. Drucker, H. (1972). Regulation of exocellular proteases in Neurospora crassa: induction and repression of enzyme synthesis. Journal of Bacteriology, 110, 1041-1049. El Hadj-Ali, N., Agrebi, R., Ghorbel-Frikha, B., Sellami-Kamoun, A., Kanoun, S. and Nasri, M. (2007). Biochemical and molecular characterization of a detergent stable alkaline serine-protease from a newly isolated Bacillus licheniformis NH1. Enzyme and Microbial Technology, 40, 515-523. Ellouz, Y., Bayoudh, A., Kammoun, S., Gharsallah, N. and Nasri, M. (2001). Production of protease by Bacillus subtilis grown on Sardinelle heads and viscera flour. Bioresource Technology, 80, 49-51. Feng, Y.Y., Yang, W.B., Ong, S.L., Hu, J.Y. and Ng, W.J. (2001). Fermentation of starch for enhanced alkaline protease production by constructing an alkalophilic Bacillus pumilus strain. Applied Microbiology and Biotechnology, 57, 153-160. Ferrero, M.A., Castro, G.R., Abate, C.M., Baigori, M.D. and Sineriz, F. (1996). Thermostable alkaline proteases of Bacillus licheniformis MIR 29: isolation, production and characterization. Applied Microbiology and Biotechnology, 45, 327-332. Frankena, J., Koningstein, G.M., Van Verseveld, H.W. and Stouthamer, A.H. (1986). Effect of different limitations in chemostat cultures on growth and production of exocellular protease by Bacillus licheniformis. Applied Microbiology and Biotechnology, 24, 106112. Fukushima, Y., Itho, H., Fukase, T. and Motai, H. (1989). Continuous protease production in a carbon-limited chemostat culture by salt tolerant Aspergillus oryzae. Applied Microbiology and Biotechnology, 30, 604-608. Gessesse, A. and Gashe, B.A. (1997). Production of alkaline protease by an alkalophilic bacteria isolated from an alkaline soda lake. Biotechnology Letters, 19, 479-81. Giesecke, U.E., Bierbaum, G., Rudde, H., Spohn, U. and Wandrey, C. (1991). Production of alkaline protease with Bacillus licheniformis in a controlled fed-batch process. Applied Microbiology and Biotechnology, 35, 720-724.
438
Ghorbel-Frikha, B., Sellami-Kamoun, A., Fakhfakh, N., Haddar, A., Manni, L. and Nasri, M. (2005). Production and purification of a calcium-dependent protease from Bacillus cereus BG1. Journal of Industrial Microbiology and Biotechnology, 32, 186-194. Gupta, R., Gupta, K., Saxena, R.K. and Khan, S. (1999). Bleach-stable, alkaline protease from Bacillus sp. Biotechnology Letters, 21, 135-8. Gupta, R., Beg, Q.K. and Lorenz, P. (2002). Bacterial alkaline proteases: molecular approaches and industrial applications. Applied Microbiology and Biotechnology, 59, 1532. Johnvesly, B. and Naik, G.R. (2001). Studies on production of thermostable alkaline protease from thermophilic and alkaliphilic Bacillus sp. JB-99 in a chemically defined medium. Process Biochemistry, 37, 139-144. Joo, H.S. and Chang, C.S. (2005). Production of protease from a new alkalophilic Bacillus sp. I-312 grown on soybean meal: optimization and some properties. Process Biochemistry, 40, 1263-1270. Kalisz, H.M. (1988). Microbial proteinases. Advances in Biochemical Engineeering/ Biotechnology, 36, 1-65. Kembhavi, A.A., Kulkarni, A. and Pant, A. (1993). Salt-tolerant and thermostable alkaline protease from Bacillus subtilis NCIM No.64. Applied Biochemistry and Biotechnology, 38, 83-92. Kumar, C.G. and Takagi, H. (1999). Microbial alkaline proteases: from a bioindustrial viewpoint. Biotechnology Advances, 17, 561-94. Maurer, K.H. (2004) Detergent proteases. Current Opinion in Biotechnology, 15, 330-334. Mehrotra, S., Pandey, P.K., Gaur, R. and Darmwal, N.S. (1999). The production of alkaline protease by a Bacillus species isolate. Bioresource Technology, 67, 201-203. Miller, J.H. (1972). Experiments in molecular genetics; pp. 431-435. Cold spring Harbor Laboratory, Cold Spring Harbor, N.Y. Naidu, K.S.B. and Devi, K.L. (2005) Optimization of thermostable alkaline protease production from species of Bacillus using rice bran. African Journal of Biotechnology, 4, 724-726. Patel, R., Dodia, M. and Singh, S.P. (2005). Extracellular alkaline protease from a newly isolated haloalkaliphilic Bacillus sp.: production and optimization. Process Biochemistry, 40, 3569-3575. Puri, S., Beg, Q.K. and Gupta, R. (2002). Optimization of alkaline protease production from Bacillus sp. by response surface methodology. Current Microbiology, 44, 286-290. Rao, M.B., Tanksale, A.M., Ghatge, M.S. and Deshpande, V.V. (1998). Molecular and biotechnological aspects of microbial proteases. Microbiology and Molecular Biology Reviews, 62, 597-635. Strom, T. and Eggum, B.O. (1981). Nutritional value viscera silage. Journal of the Science of Food and Agriculture, 32, 115-120. Tari, C., Genckal, H. and Tokatli, F. (2006). Optimization of a growth medium using a statistical approach for the production of an alkaline protease from a newly isolated Bacillus sp. L21. Process Biochemistry, 41, 659-665. Triki-Ellouz, Y., Ghorbel, B., Souissi, N., Kammoun, S. and Nasri, M. (2003). Biosynthesis of protease by Pseudomonas aeruginosa MN7 grown on fish substrate. World Journal of Microbiology and Biotechnology, 19, 41-45.
439
Zouari, N., Ben Sik Ali, S. and Jaoua, S. (2002). Production of delta-endotoxins by Bacillus thuringiensis strains exhibiting various insecticidal activities towards lepidoptera and diptera in gruel and fish meal media. Enzyme and Microbial Technology, 31, 411-418.
Chapter 15
COFFEE OIL, CAFESTOL, AND KAHWEOL: EXTRACTION USING SUPERCRITICAL CARBON DIOXIDE
Jlio M. A. Arajo, Dlcio Sandi and Jane S. R. Coimbra
Department of Food Technlogy, Federal University of Viosa, Viosa, MG, Brasil
ABSTRACT
Green and roasted coffee oil was extracted using supercritical CO2 at four temperatures (333, 343, 353, 363 K) and four SC-CO2 densities ranging from 680 to 880 kg.m-3 for each temperature. Del Valle-Aguilera and Chrastil mathematical models were applied to predict oil concentration. The former led to elevated deviations between the predicted concentration values and those observed experimentally. The latter model provides better results, with better fitting being observed. In the second part of the experiment, commercial green and roasted coffee beans were used to maximize oil extraction and conditions were studied to obtain the highest and lowest diterpene levels on green and roasted coffee oil, respectively. Oil content levels and diterpene oil concentration obtained by SC-CO2 was compared to the results with the extraction with Soxhlet apparatus, using hexane as solvent. In general, an inverse correlation was observed between the amount of extracted oil and diterpene concentration levels.
The food and pharmaceutical industries have rapidly taken advantage of the possibilities of using carbon dioxide as a nontoxic, environmentally-safe, cheap, and selective extraction solvent (Brunner, 1994; McHugh & Krukonis, 1994). Compared to liquid solvents, carbon dioxide has the advantage of displaying adjustable selectivity or solvent power that can be set to values ranging from gas to liquid-like. Carbon dioxide has a lower critical temperature (304.3 K) and moderate critical pressure (73.8 bar), thus being an ideal solvent for compounds that may suffer thermal degradation (Palmer & Ting, 1995).
442
Julio M.A. Araujo, Delcio Sandi and Jane S.R. Coimbra
Figure 1. Chemical structure of cafestol and kahweol.
Coffee is a commonly consumed beverage with potential health benefits. Coffee has over a thousand chemicals, many formed during the roasting process. From physiological point of view, the potential bioactives are caffeine, the diterpenes cafestol and kahweol found in the oil, and polyphenols, most notably chlorogenic acid. Coffee oil contains pentacyclic diterpenes (cafestol and kahweol), as typical lipid constituents which have not been detected in any other foods, are present in the unsaponifiable lipid fraction of raw coffee (Kolling-Speer et al., 1999), mainly esterified to fatty acids at the C-17 position (Figure 1) and hardly present in free form. Representatives are 16-O-methylcafestol, cafestol, and kahweol. Total diterpene content ranges from 1.3 to 1.9 % (w/w) in C. arbica and 0.2-1.5 % (w/w) in C. robusta beans (Ratnayake et al., 1993). Oil content in a green coffee bean ranges from 10 15 % (w/w) and, is utilized for industrial purpose with elevated market price. Many uses have been patented for cafestol and kahweol. Coffee bean oil, which contains both compounds, has been used by cosmetic industry because of the emollient property provided by its fatty acids and its capacity to block sunlight harmful to human skin (Grollier & Plessis, 1988; Pelle, 1999; Alvarez, & Rodriguez, 2000). Roasted coffee oil has also been widely used as a flavor source in food and cosmetics. Moreover, a reduction in the diterpene levels of roasted coffee oil significantly increases its stability and sensorial profile. The cholesterol-raising effect in humans has been linked with these diterpenes. Their content in a coffee drink is influenced by the brewing method (Gross et al., 1971; Urget, & Katan, 1996). Brewing releases oil dropelet containing diterpenes from ground coffee beans. They are retained by a paper filter, which explain why filter paper-filtered coffee shows no effect on serum cholesterol. With espresso and mocha coffee, and with French press, lipids readily pass the metal filter and hypercholesterolemic diterpenes may thus be removed less efficiently from the brew. Other brews such Scandinavian boiled coffee and Turkish-style, are decanted directly from the boiling state into cup without applying a filter at all (Urget et al., 1995; Urget, & Katan, 1996). Additionally, anticarcinogenic and antiinflamatry properties conferred by the high concentration of the diterpenes cafestol and kahweol, exclusively present in coffee oil, have made its use potentially interesting in the pharmaceutical and food industry (Cavin et al., 2002; Lam et al., 1982; Miller at al. 1994; Scharf et al., 2001). Coffe oil oil has a high unsaponifiable content (about 12%) as compared to that normally found in other plant oil, and the major fatty acids are palmitic and linoleic. Cafestol and kahweol represent the major part of the unsaponifiable lipid fraction in coffee beans. They are mainly present as fatty acid esters, but small amounts of free alcohols also occur. Robusta are
Coffee Oil, Cafestol, and Kahweol: Extraction Using Supercritical C02
443
almost devoid of kahweol but contain a third diterpene 16-O-methylcafestol, which is absent in Arabic beans. Various methods of measurement of the solubility dependence on pressure and temperature have been reported in the literature (Sovov et al, 2001; Chrastil, 1982; Del Valle & Aguilera, 1988). Oil solubility were measured both by static and dynamic methods, both by contacting CO2 with liquid oil directly and by contacting it with ground vegetable materials. In this work, is also presented the feasibility of applying carbon dioxide under supercritical conditions to maximize oil extraction to obtain the highest and lowest diterpenes levels on green and roasted oil, respectively. The extraction of green and roasted coffee oil using supercritical carbon dioxide was performed in our laboratory and presented yield similar to those obtained by hexane extraction and, considerable higher than those obtained by mechanical pressing. Del Valle-Aguilera (1988) and Chrastil (1982) mathematical models were applied on the experimental data to predict oil solubility. Studies on prediction of coffee oil concentration in SC-CO2 have not been published so far. Chrastil has developed an empirical model for predicting solubility of several compounds in SC-CO2 (Eq. 1), such as fatty acids, triglycerides, water and cholesterol, based on the assumption that the concentration of a solute in the SC-CO2 is closely related to its density and extraction temperature: C = d K exp (a / T + b) (1)
where C (kg.m-3) is the solute solubility, d (kg.m-3) is the density of the pure CO2, T (K) is the absolute temperature and k, a and b are the model constants. Later, del Valle and Aguilera (1988) developed a comprehensive equation based on the Chrastil model (1982), to determine vegetable oil solubility (Eq. 2), based on the solubility data obtained from soybean oil, sunflower seed oil and cotton and corn oils (Stahl et al., 1980; Friedrich, 1984), validated for temperatures ranging from 293 K to 353 K, pressures from 150 atm to 888 atm and solubilities up to 100 kg.m-3. C = d 10.724 exp (-18708 / T + 40.361 + 2186840 / T 2 ) 2.7 (2)
In this equation, d is the oil density (kg.dm-3), the C and T are expressed as in the Chrastil equation. The objective of this work was to predict the concentration of green and roasted coffee oils in the SC-CO2 and compare them to those experimentally obtained by this technique, applying the models developed by Chrastil and del Valle and Aguilera for solubility calculation. Operational temperature, carbon dioxide density, moisture content, granulometry and CO2 flow rate were optimized for coffee oil extraction. A method using high performance liquid chromatography (HPLC) with detection at 220 nm has been used for diterpene identification.
444
MATERIALS AND METHODS

Sample Preparation
Commercial green and roasted coffee beans (Coffea arabica) containing 9.98% and 2.40% humidity, respectively, were used for oil extraction by Soxhlet and supercritical extraction. The coffee beans were ground in a bench coffee grinder and sieved to obtain particles with diameters ranging from 0.297 to 0.35 mm. The oil was extracted by two different procedures: Soxhlet and supercritical fluid extraction
Gas Chromatographic Analysis

A Hewlett Packard 5890 gas chromatograph equipped with a fused silica capillary column (25 m x 0.32 mm i.d.; 0.20 m thickness, CP-Wax J & W Inc.) and a flame ionization detector was used to analyze fatty acids and a split ratio of 100:1 was used. Oil extracted from coffee beans was esterified according to Hartman & Lago (1973) and the results are shown in Table 1.
High Performance Liquid Chromatography (HPLC)

For HPLC analysis of diterpenes, the oil was saponified, according to Gross et al. (1977); Kolling-Speer et al. (1999) and analyzed on reverse-phase column HP-C18 (200 mm x 4.6 mm i.d.; particle size 5 m) at ambient temperature. The mobile phase was a mixture of solvent methanol/water 85:15 using a flow rate of 0.7 mL.min-1 and detection wavelength set to 220 nm. Chromatograms are shown in Figure 2.
Table 1. Fatty acid composition of coffee oil (FAME analysis)
Fatty acid C14:0 C16:0 C16:1 C18:0 C18:19 C18:111 C18:2 C18:3 C20:0 C20:1 C22:0 C24:0 * Area percent. Green coffee* 0.12 0.01 32.44 0.30 < 0.1 9.06 0.07 9.18 0.05 0.37 0.03 43.50 0.31 1.40 0.15 2.65 0.05 0.33 0.03 0.82 0.02 0.13 0.01 Hexane Roasted coffee* 0.10 0.01 33.04 0.50 < 0.1 7.14 0.50 8.78 0.21 0.41 0.01 45.98 0.96 1.76 0.30 2.00 0.05 0.21 0.03 0.43 0.08 0.15 0.02
CO2-SC Green coffee* 0.21 0.03 34.43 0.97 0.15 0.02 8.73 0.22 8.67 0.19 0.49 0.07 43.27 0.41 1.22 0.13 2.94 0.60 0.24 0.01 0.30 0.05 < 0.1
Roasted coffee* 0.13 0.06 34.41 0.75 0.14 0.07 7.68 0.66 9.01 0.13 0.50 0.05 43.81 0.39 1.41 0.06 2.38 0.19 0.20 0.02 0.33 0.05 < 0.1

Green coffee
445
Roasted coffee
Minutes
Figure 2. Chromatograms of the unsaponified oil extracted by SFE.
446

Table 2. Densities and temperatures used in the extraction experiment
Temperature (K) 333 810 840 880 343 770 810 840 353 740 770 810 363 710 740 770
CO2-density (kg.m-3) 770 275 314 380 740 280 327 371 710 294 327 379 680 316 337 373
Pressure (bar) 235
253
268
280
Supercritical Fluid Extraction

The green and roasted coffee oils were obtained using a supercritical extraction instrument HP7680A equipped with an ODS collector. The oil was eluted from the collector with hexane and collected in 2 mL glass vials. The amount of oil extracted was gravimetrically determined after hexane evaporation with nitrogen at 50 0C Two hundred milligrams of green (Coffea Arabica) beans (10 % humidity and 11.4 % oil) or roasted coffee beans (2.4 % humidity and 15.5 % oil), with reduced diameter (0.297 mm to 0.35 mm) was utilized for CO2-SC. The extractions were conducted in a 4 x 4 factorial experiment, with three replications, according to Table 2. Supercritical carbon dioxide flow was maintained constant at 1.5 mL.min-1 and the static and dynamic extraction times were 5 min and 20 min, respectively. During extraction, the restrictor temperature was maintained at 343 K, the collector temperature at 308 K, and to remove oil from the collector, both temperatures were maintained at 331 K.
Mathematical Modeling
Despite the possible solubility variation due to the different composition of vegetable oils, del Valle & Aguilera developed a general equation for predicting the solubility of oils in compressed CO2. They modified the model of Chrastil, who relates the solubility of various solutes in CO2 to the density and temperature of the solvent (Sovov et al., 2001). The oil concentration in CO2 was calculated by using the ratio between the amount of oil and the CO2 mass consumed during the process. The constants a, b, and k of the Chrastil
447
model (Eq. 1) was obtained by linear regression (Sigma Plot 2001 Program, 7.0 version) following its linearization:
y = 0 + 1 / T + 2 ln d y = 0 + 1 X 11 + 2 X 12
where y = ln C; 0 = b; 1 = a; 2 = k; X11 = 1 / T; X12 = ln d.
(3) (4)
RESULTS AND DISCUSION

The difference between the experimental oil concentration (Cexp) and the predicted values (Sdel Valle-Aguilera and CChrastil) was expressed as percentage deviation (Eq. 5). Agreement of each model with experimental data was provided by the mean percentage deviation (Eq. 6) and the root mean square percentage deviation (Eq. 7)
(%) = (ccalc cexp ) / cexp
(5)
1 k MD(%) = 100 (S calc ,i S exp i ) / S exp i k i =1

1 k 2 RMSD(%) = 100 ( S calc ,i S exp i ) / S exp i ) k i =1
Where k is the number of the experimental data.
(6)
0,5
(7)
Table 3. Variance analysis of fitted regression for coffee oil concentration, according to the Chrastil model
Green and roasted coffee oil GL SQ QM F 2 4.8891 2.4446 85.3936 29 0.8302 0.0286 31 5.7193 0.1845 t for H0: Estimated Standard parameter = 0 Parameter Deviation -44.0125 3.3400 -13.1773 -3702.4886 456.7057 -8.10696 8.0736 0.6219 12.9818
Regression Residue Total Variable Intercept 1/T Ln d
P <0.0001
Prob. > |t| 0.0001 0.0001 0.0001
448
Table 4. Concentration values obtained experimentally (Cexp) and calculated according to the Chrastil Model
T P (K) (bar) Green coffee oil 235 275 333 314 380 253 280 343 327 371 268 294 353 327 379 280 363 306 337 373
d (kg.m-3) 770 810 840 880 740 770 810 840 710 740 770 810 680 710 740 770
Cexp (kg.m-3) 0.21 0.01 0.35 0.03 0.42 0.03 0.55 0.01 0.21 0.00 0.28 0.02 0.41 0.02 0.50 0.04 0.20 0.00 0.25 0.01 0.40 0.03 0.52 0.04 0.17 0.00 0.25 0.01 0.36 0.00 0.51 0.02 MD (%) RMSD (%) 0.25 0.02 0.43 0.03 0.50 0.03 0.72 0.09 0.24 0.03 0.37 0.02 0.55 0.03 0.76 0.02 0.24 0.01 0.39 0.02 0.57 0.06 0.77 0.03 0.24 0.01 0.35 0.02 0.54 0.03 0.65 0.03 MD (%) RMSD (%)
CChrastil (kg.m-3) 0.21 0.31 0.41 0.59 0.21 0.28 0.41 0.54 0.20 0.27 0.37 0.54 0.18 0.25 0.35 0.47
(%) -1.9 11.8 2.9 -6.1 2.4 -0.5 -1.6 -8.6 -0.2 -6.0 9.1 -3.0 -7.4 -0.6 3.6 8.6 0.16 0,40 -1.3 11.0 -3.7 -7.0 -6.4 3.5 -0.1 1.0 -7.0 8.5 12.7 -2.1 -3.9 -0.5 6.7 -8.2 0.19 0.44
Roasted coffee oil 235 275 333 314 380 253 280 327 343 371 268 294 353 327 379 280 30 363 337 373
770 810 840 880 740 770 810 840 710 740 770 810 680 710 740 770
0.25 0.38 0.52 0.78 0.26 0.36 0.55 0.76 0.25 0.36 0.51 0.78 0.24 0.35 0.50 0.71
449
The concentration results obtained experimentally were first compared to the solubility values determined according to the del Valle & Aguilera equation. The predictions were poor, presenting a very high deviation (order of 1000 %). The values predicted by the model are much higher than the experimental concentration values, and some reasons can explain this behavior. The del Valle & Aguilera model was derived using experimental data of solubility of pure oil, rather than the raw material, thus eliminating matrix interference. These experimental data were determined in the extraction of soybean, sunflower, cotton and corn oils, whose compositions are different from that of coffee oils, especially due to the amount of unsaponifiable fraction. As coffee oil has unsaponifiable compound contents much higher than those normally found in plant oils, coffee oil solubility in SC-CO2 may differ from that commonly observed (Al Kanhal, 1997; Lpez-Fontal & Castano-Castriln, 1999).. Since the variation found between observed and predicted values by using the del Valle & Aguilera equation was very high, the Chrastil equation was used to predict the oil concentration. It was used firstly the data bank containing results of both types of oil. The values of the constants were determined and the regression fitted by minimizing the RMSD values (Eq. 8). Table 3 shows the variance analysis of the fitted model.
C = d 8.0736 e ( 3702.49 / T 44.0125) 0.169 (R2 = 0.855)
(8)
Table 5. Variance analysis of the fitted regression and constants obtained for coffee oil concentration, according to the Chrastil model.
Green coffee oil
Regression Residue Total Variable Intercept 1/T Ln d Roasted coffee oil Regression Residue Total Variable Intercept 1/T Ln d
GL 2 13 15
SQ 2.2353 0.0530 2.2883 Estimated Standard Parameter Deviation -42.6617 1.7823 -3217.1866 243.7068 7.6386 0.3319 SQ 2.6863 0.0629 2.7492 Estimated Standard Parameter Deviation -45.3632 1.9419 -4187.7907 265.5365 8.50862 0.3616
QM F 1.1177 274.2214 0.0041 0.1526 t for H0: parameter = 0 -23.9364 -13.2011 23.0170 QM F 1.3431 277.5876 0.0048 0.1833 t for H0: parameter = 0 -23.3597 -15.7711 23.5308
Prob. > F 0.0001
Prob. > |t| 0.0001 0.0001 0.0001 Prob. > F 0.0001
GL 2 13 15
Prob. > |t| 0.0001 0.0001 0.0001
450
However, it can be observed, in Table 4, that the experimental concentration values (Cexp) for roasted coffee oil concentration in SC-CO2 is higher than that found for the green coffee oil. This fact and the low R2 value observed for the Eq. 8 lead to the adjust of the Chrastil model using the data set of green and roasted coffee oil separately. Two regression models were thus adjusted, one for the green coffee oil (Eq. 9) and the other for the roasted coffee oil (Eq. 10).
C = d 7.63863 e ( 3217.19 / T 42.6617 ) 0.0638 (R2 = 0.977)
(9) (10)
C = d 8.50865 e ( 4187.79 / T 45.3632) 0.0696 (R2 = 0.977)
Table 5 shows the variance analysis of the fitted models. Based on the higher values of determination coefficient and F parameter found for regressions 9 and 10, as compared to regression 8 and on their respective lower standard deviations it was verified a better prediction of the oil concentration for the Chrastil model fitting using the data of green coffee and roasted coffee oil separately. All equation constant values are also significant (0.1 % by the t test). Besides the evaluation of determination coefficient, the standard deviations and the significance of the equation constants, a Durbin-Watson statistical test was applied. Regression procedures found an association between independent and dependent variables that, when plotted on a Cartesian coordinated system, produce a straight, plane or curved line. This, also commonly known as curve fitting, assumes that the residuals are independent of each other with the Durbin-Watson test (Bethea et al., 1985) being used to check this assumption. So, the Durbin-Watson statistic (DW) is a measure of correlation between the residuals. If they are not correlated, the DW will be 2. The more this value differs from 2, the greater the likelihood that the residuals are correlated. The Durbin Watson value for the both green coffee and roasted coffee oils data was 0.3756 and for the adjust using the individually green coffee oil data and the roasted coffee oil data was 1.9769 and 2.0193, respectively. This showed that fitting the model using the data for each type of oil separately was much more efficient. Table 4 presents the observed concentration values (Cexp) and those predicted by the Chrastil model, as well as the variation between them. The mean percentage deviations were 0.16 and 0.19 for the green and roasted coffee oils, respectively, showing a good agreement between data, even though a few deviation values were greater than 10%. Figure 3 shows the fitting of the oil concentration values, generated by the Chrastil model, and the experimental data. One can observe that from a same isotherm, as density increases, the inclination of the isotherm is more pronounced for the roasted coffee oil. It means that oil concentration in the CO2 becomes higher for roasted coffee oil than for the green coffee oil with the density increase, what also explains the better fitting of the model, separately.
451
Figure 3. Concentration of green (a) and roasted (b) coffee oils in the SC-CO2 (dots = experimental data; lines = fitted according to Eq. 9 - green coffee oil and Eq. 10 - roasted coffee oil).
Fatty acid profile was similar in both oil extraction methods (Table 1). In addition, fatty acid composition was not modified by the different density and temperature combinations used in the SC-CO2.
Table 6. Mean value of the amount of diterpenes from green and roasted coffee extracted for each extraction method
Extraction CO2-SC (C bar-1) Roasted Green coffee 70/253 70/327 90/373
201.7 1.82 251.6 2.32 453.3 230 2.11 261.1 2.57 491.1 182.8 1.87 230.9 2.22 413.7
method
Soxhlet
Green
Diterpenes (mg100 g-1) 383.9 328.5 Cafestol Kahweol Total

2.3 476.2 6.4 860.1 3.9 397.8 6.6 726.3
Roasted coffee 70/371 80/379

94.4 0.67 114.70.8 7 209.1
90/379
122.2 113.3 0.51 0.87 165.71.5 139.8 0.92 5 287.9 253.1
452
The extracted oil analyzed by HPLC containing cafestol and kahweol are shown in figure 2. These diterpenes were separated and quantitated by reverse phase HPLC column, and the analyte concentrations were estimated by standard curve method and the results are tabulated in Table 6.
Direct SFE from Coffee Beans

This study attempted to directly extract oil from green coffee beans containing high diterpene levels and from roasted coffee beans with low diterpene levels using SC-CO2. Efforts including changing the operating temperature and pressure were applied to improve the process (Sandi, 2003). The extraction yields from different methods: SFE and Soxhlet are shown in Table 6.
SFE Extraction of Green Coffee Beans The initial development of the conditions for analytical SFE of diterpene in a green coffee bean was performed in pressure range of 235-380 bar and temperatures between 333 and 363 K. The oil content and diterpene were compared to the results obtained with the extraction with Soxhlet apparatus (Table 6). The solubility of fat in supercritical carbon dioxide increases with density and temperature (Sthal, Schutz, & Mangold, 1980). In a natural matrix, the distribution of the solutes in the solid substrate and the interactions among them, have a high influence on the course of the extraction. Thus, fat extraction in a fat matrix should preferably be performed at the highest possible temperature and density. As coffee oil has a high unsaponifiable content as compared to that normally found in other plant oils (Al Kanhal, 1997; Lopez-Fontal, & Castano-Castrilon, 1999), coffee oil solubility in SC-CO2 might differ from that commonly observed. The most efficient extraction (Figure 4) was obtained with temperature of 363 K / 373 bar / 0.77 g.mL-1. These conditions completely promoted oil extraction within 20 min., using 28.6 g of CO2 but the concentration of diterpenes was low (Arajo & Sandi, 2007). In general, an inverse correlation was observed between the amount of extracted oil and the diterpene concentration levels (Table 6). A strong interaction between temperature and density (pressure) was observed. The predominant effect of the temperature in the amount of oil extracted is due to an increase in the extract steam pressure in detriment of fluid density and a higher kinetics of desorption of the oil from the sample matrix. As the temperature increases, desorption is faster and more solute is available for extraction. Table 6 shows that the highest concentration of diterpenes was achieved at 343 K / 197 bar / 0.81 g.mL-1 with cafestol and kahweol values being 230 and 261.1 mg.100 g-1 respectively, i.e., 43 % lower when compared to oil obtained with hexane extraction. Increasing density significantly decreases diterpenes yield in oil for all isotherms (Figure 4).
453
Figure 4. Oil content and diterpene (cafestol and kahweol) in green coffee beans extracted by SFE.
454
Figure 5. Oil content and diterpene (cafestol and kahweol) in roasted coffee beans extracted by SFE.
455
SFE Extraction of Roasted Coffee Beans The initial development of the conditions for analytical SFE of diterpene in roasted coffee oil to obtain the lowest diterpene levels was performed in pressure range of 235-380 bar and temperatures between 333 and 363 K. Dynamic extraction time (20 min), granulometry (0.297 to 0.35 mm), extraction sample weight (200 mg), CO2 flow (2.0 mL.min-1), and 5 min static extraction were kept constant, and the experimental design was the same as described above. The amount of cafestol and kahweol can be significantly reduced by roasting the green coffee (Table 6), which was 14.4 % and 16.5 % less for cafestol and kahweol respectively. Figure 5 shows that roasted coffee oil was completely extracted in 20 min at 343 K / 371 bar / 0.84 g.mL-1 using 36.8 g of CO2. This condition was the most efficient in significantly reducing the oil diterpene concentrations, with the values 94.4 and 114.7 mg.100g-1 being obtained for cafestol and kahweol, respectively (Table 6). These values represent 28.8 % of the total of diterpenes compared to levels obtained in oil extraction using hexane. One can observe (Figure 5) that from a same isotherm, as density increase, the inclination of the isotherm is more pronounced for the roasted coffee oil. It means that oil concentration in the CO2 becomes higher for roasted coffee oil than for the green coffee oil, and significantly decreases diterpenes yield in oil for all isotherms.
CONCLUSIONS
Two models were tested for the prediction of coffee oil concentration in the SC-CO2. The del Valle & Aguilera and Chrastil models were fitted using three different data set containing concentration value of green coffee oil, roasted coffee oil and both green and roasted coffee oil. The latter model provided better predictions when compared to the former, for the three data set, however agreement with experiment was better for the adjust of Chrastil model using the individually data set for which errors of prediction, expressed as mean deviation, were less than 0.2 %. Probably due to their different matrices, oil concentration prediction must be conducted separately, even for equal extraction conditions. SFE is a very useful method for extracting valuable oil from green coffee beans with high levels of diterpenes for cosmetics, and healthy coffee oil with low levels of diterpenes from roasted coffee beans for food industry.
REFFERENCES
Arajo, J. M. A.; Sandi, D. (2007). Extraction of coffee diterpenes and coffee oil using supercritical carbon dioxide. Food Chemistry, 101, 1087-1094. AL Kanhal, M. A. (1997). Lipid analysis of Coffea arabica beans and their possible hypercholesterolemic effects. International Journal of Food Science and Nutrition, 48,135-139. Alvarez, A. M. R., Rodriguez M. L. G. (2000). Lipids in Pharmaceutical and cosmetic preparations. Grassas Y aceites, 51, 74-79. A & E Connock (1999). Coffee oil. Internal document. Hampshire, England, 9 p.
456
Bak, A. A. A., Grobee, D. E. (1989). The effect on serum cholesterol levels of coffee brewed by filtering or boiling. New England Jounal of Medicine, 321, 1432-1437. Bertholet, R. (1988). Preparation of a mixture of cafestol and kahweol. US patent no 4,748,258. US Patent & Trademaker Office. Bethea, R.M.; Duran, D.S. and Boullion, T.L. Statistical Methods for Engineers and Scientists. 2nd Ed. Marcel Dekker, Inc., New York, 1985, 698 p. Brunner, G. (1994). Gas Extraction: An Introduction to Fundamentals of Supercritical Fluids and the Application to Separation Processes; Topic in Physical Chemistry; Baumgurtel, H.; Franck, E. U. (Eds.), New York. Springer. Cavin, C., Holzhaeuser, D., Scharf, G., Constable, A., Hubber, W.W. (2002). Cafestol and kahweol, two coffee specific diterpenes with anticarcinogenic activity. Food and Chemical Toxicology, 40, 1155-1158. Chrastil, J. (1982). Solubility of solids and liquids in supercritical gases, J. Phys. Chem. 86, 3016. Del Valle, J. M., Aguilera J. M. (1988). An improved equation for predicting the solubility of vegetable oils in supercritical CO2. Ind. Eng. Chem. Res. 27, 1551. Friedrich, J. P. (1984). Supercritical CO2 extraction of lipids from lipid-containing materials, US patent no 4,446,923. US Patent & Trademaker Office. Gopalakrishnan, N. (1990). Carbon dioxide extraction of coffee beans. Indian Coffee, 54, 710. Grollier J. F., Plessis, S. (1988). Use of coffee bean oil as a sun filter. US patent no 4,793,990. US Patent & Trademaker Office. Gross, G., Jaccaud, E., Huggett, A. C. (1997). Analysis of the 267 content of the diterpenes cafestol and kahweol in coffee brews. Food and Chemical Toxicololgy, 35, 547-550 Hartman, L., Lago, R. C. (1973). A. Rapid preparation of fatty acid methyl esters from lipids. Laboratory Practice, 22, 475-477. Heckers, H., Gobel, U., Kleppel, U. (1994). End of the coffee mystery: Diterpene alcohols raise serum low-density lipoprotein cholesterol and triglyceride levels. Journal of International of Medicine, 235, 192-194. Kolling-Speer, I., Strohschneider, S., Speer, K. (1999). Determination of free diterpenes in green coffee and roasted coffees. Journal High Resolution of Chromatography, 22, 4345. Lam, L. K. T., Sparnins, V. L., Wattenberg, L. W. (1982). Isolation and identification of kahweol palmitate and cafestol palmitate as active constituents of green coffee beans that enhance glutathione S-transferases activity in the mouse. Cancer Research, 42, 1193. Lpez-Fontal, E. M., Castao-Castriln, J. J. (1999). Extraccin de aceite a partir de subproductos de la trilla de caf pergamino. Cenicaf, 50, 66. Lercker, G., Caboni, M. F., Bertacco, G. & Turchetto, E. (1996a). La frazione lipidica del caf:Influenze della torrefazione e della decaffeinizzazione. Industrie Alimentari, 35, 1186-1193. McHugh, M. A. & Krukonis, V. J. (1994). Supercritical fluid extraction. Principle and practice (2nd ed.). Stoneham, MA: Butterworth-Heinemann. Mensink, R. P., Lebbink, W. 291 J., Lobbezoo, I. E., Katan, M. B. (1995). Diterpene composition of oils from Arabica and Robusta coffee beans and their effects on serum lipids in man. Journal International of Medicine, 237, 543-546.
457
Miller, E. G.; Gonzles-Sanders, A. P.; Couvillon, A. M.; Wright, J. M. & Sunahara, G. I. (1994). Inhibition of oral carcinogenesis by green coffee beans and limonoid glucoside. American Chemical Society, ACS Symposium Series 546, p.220 229. Palmer, M. V., Ting, S. S. T. (1995). Applications for Supercritical Fluid Technology in Food Processing. Food Chemistry, 52, 345-348. Pelle, E. (1999). Topical composition and method for enhancing lipid barrier synthesis. United States Patent no 5,855,897. US Patent & Trademaker Office. Ratnayake, W. M. N., Hollywood, R., Ogrady, E., Stravic, B. (1993). Lipid content and composition of coffee brews prepared by different methods. Food and Chemical Toxicology, 31, 263-266. Roos, B., Caslake, M. J., Stalenhoef, A. F. H. (2001). The coffee diterpene cafestol increases plasma triacylglicerol by increasing the production rate of large VLDL apolipoprotein B in the healthy normolipidemic subjects. American Journal of Clinical Nutrition, 73, 4548. Roselius, W., Vitzthum, O., Hubert, P. (1982). Method of extracting coffee oil containing aroma constituents from roasted coffee. United State Patent no 4,328,225, US Patent & Trademaker Office. Sandi, D. Extrao do leo e diterpenos do caf com CO2 supercrtico. D.S. Dissertao, Universidade Federal de Viosa, Viosa-MG, 2003. Sarrazin, C., Le Quere, J-L., Gretsh, C., Liardon, R. (2000). Representativeness of coffee aroma extracts: a comparison of diferent methods. Food Chemistry, 70, 99-102. Scharf, G., Prustomersky, S., Huber W. W. (2001). Elevation of glutathione levels by coffee components and its potential mechanisms. Advances in Experimental Medicine and Biology, 500, 535. Sthal. E., Schutz, E., Mangold, H. K. (1980). Extraction of seed oils with liquid and supercritical CO2. Journal Agricultural and Food Chemistry, 28, 1153-1156. Sovov, H., Zarevcka, M., Vacek, M. (2001). Solubility of two vegetable oils in supercritical CO2. Journal of Supercritical Fluids 20, 15-28. Terpstra, A. H. M., Katan, M. B., Beynen, A. C. (2000). The hypercholesterolemic effect of cafestol in coffee oil in gerbils and rats. Journal of Nutrition Biochemistry, 11, 311-314. Urget, R., Katan, M. B. (1996). The cholesterol-raising factor from coffee beans. Journal Real Society of Medicine, 89, 618-621. Urget, R.; Van Der Weg, & Katan, M. B. (1995). Levels of the cholesterol-elevating diterpenes cafestol and kahweol in various coffee brews. J. Agric. Food Chemistry, 43, 2167-2172.
INDEX
A
absorption spectra, 13, 43, 63 access, 234, 421 accessibility, 193 accounting, 428 accuracy, 10, 63, 217, 239 ACE-inhibitor, x, 271, 280, 281, 284, 287, 292, 294 acetic acid, 195, 312 acetone, 18, 186 acetonitrile, 12, 16, 17, 18 achievement, 308 acidic, 19, 43, 67, 125, 176, 177, 186, 191, 192, 193, 198, 199, 205, 227, 309, 311, 313, 402, 409 acidification, 312, 418 acidity, 177, 400 activated carbon, viii, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 190, 192, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 348, 349, 353 activation, 174, 175, 176, 178, 179, 180, 181, 182, 183, 184, 191, 202, 203, 204, 205, 206, 207, 208, 249, 260, 263, 265, 266, 284, 310 active site, 174, 414 acylation, 10, 22, 34, 60, 61 adaptability, 388 adaptation, 129, 245, 254, 409 additives, 257, 400, 408, 414, 417, 428 adenovirus, 237 adhesion, 317, 400 adjustment, 249 administration, 246, 278, 285, 286, 294, 309, 310 adsorption, viii, 171, 172, 173, 174, 176, 177, 178, 179, 183, 184, 185, 186, 187, 188, 190, 191, 192, 193, 195, 196, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 351, 356, 369, 380 adult population, 217 adults, 2, 106, 303, 317, 389 aerobic bacteria, 302 Africa, 74, 106, 114, 116, 117, 281 agar, 236, 410, 412, 419 age, 244, 245, 247, 253, 254, 258, 267, 268, 384 ageing population, 300 agent, 133, 175, 179, 180, 181, 187, 195, 196, 283, 392, 402, 409, 413 aggregates, 190, 276, 367 aggregation, 190, 209, 276, 285, 334, 363 aging, 254, 282, 288, 292, 293, 300, 307, 395 agonist, 133, 248, 276 agricultural sector, 211 agriculture, 234, 290, 405 air pollution, 255, 269 Alaska, 278, 279, 292 albumin, 129, 375 alcohol(s), 302, 303, 305, 389, 442, 456 aldosterone, 285 alertness, 260 alfalfa, 47, 418 algae, 184, 188, 203 alkaline, xi, xiii, 19, 34, 37, 54, 56, 133, 186, 190, 192, 195, 198, 278, 287, 294, 296, 305, 309, 355, 357, 359, 363, 366, 367, 368, 369, 370, 371, 372, 374, 375, 395, 427, 428, 429, 435, 436, 437, 438 alkaline earth metals, 195 alkaline hydrolysis, 19, 34, 37, 54, 56, 363 alkaloids, 22, 64, 66, 106, 130, 134 allele, 213, 233 allergens, 130, 217, 219, 235, 236, 239, 240 allergic reaction, 286 allergy, 237, 275 aloe, 39, 59 alpha activity, 260 alternative(s), xi, xii, 156, 178, 182, 187, 194, 197, 199, 230, 234, 342, 355, 356, 357, 384, 389, 407, 409, 414 alters, 302 aluminum, 24
460
Index
antinutritional, viii, 105, 109, 129, 132, 133, 134, 135, 153, 154, 155, 156, 157, 158, 160, 161, 164, 165, 167, 168, 169, 388 antioxidant(s), x, xii, xiii, 42, 80, 132, 158, 197, 271, 283, 285, 407, 408, 409, 414, 416, 417, 425 antioxidative activity, 283 anti-thrombotic, x, 271, 272, 276 antithyroid agents, 133 anxiety, 84 aorta, 285, 294 apoptosis, 286 appetite, 284 aqueous solutions, 174, 176, 183, 185, 186, 187, 188, 190, 191, 192, 193, 194, 195, 197, 201, 202, 204, 206, 207, 208 arabinoside, 15, 41, 65, 72, 85 Argentina, 112, 128, 159, 317, 355, 407 arginine, 109, 133 aromatic compounds, 305 arousal, 265 arsenic, 196 ascorbic acid, 410, 420 ash, viii, 105, 127, 154, 155, 162, 179, 188, 189, 345, 346, 357, 402, 430, 431 Asia, x, 70, 72, 95, 106, 281, 299, 319, 394 Asian countries, 64, 79, 263 assessment, ix, 2, 157, 165, 169, 188, 205, 211, 213, 227, 228, 236, 244, 259, 269, 310 assessment techniques, 259 assignment, 25, 26, 30, 335 Athens, 105 athletes, 394 atmospheric pressure, 10 atoms, 252 attachment, 10, 248, 249 attacks, 395 attention, ix, xi, xii, 63, 107, 180, 192, 230, 234, 254, 260, 262, 263, 265, 271, 304, 324, 325, 383, 385, 404, 405, 407 Australia, x, 169, 191, 212, 243, 263, 268, 271, 287, 299, 300, 316, 318, 319, 395, 423 authentication, 213, 214, 227, 233, 235, 236, 238 authenticity, 69, 213, 228, 239 autoimmune diseases, 168 autolysis, 284 availability, 10, 129, 133, 158, 168, 192, 287, 301, 367, 404, 414 averaging, 267 aversion, 258 awareness, xii, 172, 250, 252, 300, 307, 310, 407 axons, 249 azo dye, 190
alveoli, 389 ambient air, 255 ambiguity, 11 American Indian, 28 amines, 50, 59, 315 amino acid, viii, xi, 19, 66, 67, 105, 106, 108, 109, 120, 127, 128, 129, 132, 133, 134, 158, 160, 168, 169, 197, 272, 273, 274, 276, 277, 280, 281, 283, 285, 302, 342, 344, 345, 346, 348, 349, 350, 352, 353, 363, 365, 367, 377, 383, 384, 385, 388, 389, 403 amino acid side chains, 363 amino acids, xi, 19, 108, 109, 120, 127, 128, 129, 132, 134, 160, 169, 197, 272, 277, 280, 283, 302, 342, 344, 345, 346, 350, 353, 367, 377, 383, 385, 388, 403 ammonia, 302, 315, 422, 423, 424 ammonium, 16, 291, 434, 435 ammonium sulphate, 434 amphiphilic compounds, 133 amplitude, 327 amygdala, 249 amylase, 130, 131, 132, 154, 170 analgesic, 276 analytical techniques, 228 anemia, 395 angiotensin, 273, 284, 291, 293, 294, 295, 296, 297 angiotensin converting enzyme, 293, 296 angiotensin II, 285 animal health, ix, 211, 212 animals, 133, 215, 230, 283, 284, 316, 317, 408 anion, 195, 196, 204, 207, 209, 283 anisotropy, 331 annealing, 179 annotation, 217 annual rate, 395, 399 anorexia, 230 ANOVA, 264, 265, 345 anthocyanin, 13, 42, 43, 47 antibacterial, 194, 197, 199, 207, 274, 277, 283, 284, 291, 292, 297, 307, 412, 414, 417, 418, 424, 425 antibacterial properties, 425 antibiotic(s), x, 272, 299, 306, 307, 309, 311, 409 antibody, 238, 286 anti-cancer, 132, 275, 394 anti-inflammatory, 109, 134, 314 antimicrobial protein, 283 antimicrobials, xii, 283, 407, 409, 417, 423, 424, 425 antinutrients, viii, 105, 107, 127, 130, 133, 142, 144, 146, 149, 150, 151, 152, 153, 154, 156, 157, 160, 161, 165, 168, 169
Index B
B vitamins, 394, 395 B. licheniformis, xiii, 428, 429, 430, 431, 433, 434, 435, 436 Bacillus, xiii, 278, 279, 281, 287, 294, 357, 412, 427, 428, 435, 437, 438, 439 Bacillus subtilis, 437, 438 bacteria, x, xiii, 167, 184, 212, 274, 282, 283, 286, 288, 290, 299, 300, 301, 302, 303, 304, 307, 308, 309, 310, 311, 312, 313, 314, 315, 317, 318, 319, 320, 321, 408, 409, 414, 419, 421, 428, 437 bacterial cells, 313 bacterial fermentation, 275, 316 bacterial strains, 314 bacteriocins, 307, 310, 418 bacteriostatic, 412, 413 bacterium, 428 bananas, 394 barley, 231, 233, 234, 236, 240 barriers, 255 base pair, 215 basicity, 177 baths, 420 beef, 414, 425 beer, 48, 180, 182, 187, 200, 205, 261, 262 behavior, 176, 356, 360, 363, 369, 372, 374, 380, 381, 386, 437, 449 Beijing, 399, 406 Belgium, 237 beneficial effect, 126, 132, 133, 289, 307, 309, 310, 314 benefits, ix, x, xii, 48, 64, 244, 245, 253, 282, 288, 290, 293, 296, 299, 300, 301, 310, 311, 312, 314, 315, 385, 386, 393, 404, 417, 442 benign, 302 benzene, 183, 188 beta wave, 265 beverages, viii, 52, 53, 64, 171, 173, 197, 257, 267, 308, 312, 318, 401 bias, 244, 259 bile, 126, 163, 286, 302, 309, 311 bile acids, 163 binding, x, 163, 183, 184, 192, 207, 271, 276, 277, 285, 286, 294 bioactive compounds, 281, 294 bioassay, 160, 276 bioavailability, 109, 133, 153, 161, 165, 166, 277, 289, 300 biochemistry, 203, 296 biocompatibility, 191 biocontrol, 409, 418 bioconversion, 353
461
biodegradability, 191, 192 biodegradable, 295, 417 biodiesel, 185 biodiversity, 216 biofuel(s), 185, 204 biological activity, 53, 292 biological systems, 133 biomarkers, 290 biomass, 174, 177, 184, 185, 187, 191, 198, 203, 204, 205, 206, 207, 208, 431, 433, 435, 436 biomaterials, 195, 198, 205, 207 biopolymer, 193, 199, 208, 332, 333, 334, 335, 336 biopolymers, 181, 191, 194, 195, 196, 199, 331, 340 biosensors, 212 biosorption, 173, 184, 185, 187, 188, 200, 203, 207, 209 biosynthesis, 48, 409, 418, 423 biotechnology, 239, 296, 300, 428 biotin, 215 biotypes, viii, 105 birth, 260, 301, 302, 385 black tea, 47, 64 bleaching, 197 blends, 386, 388, 389 blocks, 396 blood, 42, 43, 57, 247, 250, 251, 252, 272, 274, 276, 277, 278, 280, 282, 284, 285, 286, 288, 290, 291, 294, 303, 307, 311, 389, 394 blood clot, 276 blood flow, 251 blood pressure, 42, 247, 272, 277, 278, 280, 282, 285, 288, 294, 311, 394 body temperature, 134 bonding, 315 bonds, 6, 48, 175, 176, 334, 359, 365, 375, 380 bone mass, 306 Botswana, 110, 157 bounds, 174 bowel, 158, 305, 311, 318 bradykinin, 280, 285 brain, ix, 106, 164, 243, 244, 245, 247, 248, 249, 250, 251, 252, 253, 254, 256, 259, 260, 261, 262, 263, 264, 265, 266, 267, 270, 350 brain activity, ix, 243, 244, 248, 259, 260, 261, 263, 265, 267 brain functioning, 249 brain imaging techniques, 245, 248 Brazil, 52, 53, 106, 110, 112, 113, 115, 116, 169, 341, 343, 345, 395 Breads, 392 breakdown, 306 breast, 302 breast milk, 301, 302
462
Index
carnosine, 282, 285 carotene, 197 carotenoids, 394 carrier, 180, 313, 318 cartilage, 278, 279, 295 casein, xiii, 228, 274, 275, 276, 277, 283, 284, 285, 286, 287, 291, 292, 293, 294, 297, 315, 332, 333, 334, 342, 346, 348, 349, 350, 351, 352, 353, 354, 380, 416, 417, 427, 429, 430, 431, 433, 434, 435, 436 cast, 381 catalase, 418 catalyst, 273 catalytic hydrogenation, 305 catfish, 278, 296 cation, 197, 201 cattle, 189, 227, 235 cDNA, 237 cell, 18, 59, 109, 126, 134, 155, 184, 185, 194, 197, 199, 248, 249, 276, 277, 283, 284, 286, 287, 290, 295, 307, 309, 310, 312, 313, 327, 398, 419 cell death, 284 cell division, 284 cell growth, 276, 286 cell membranes, 134 cellulose, viii, 109, 155, 171, 172, 178, 180, 181, 191, 192, 196, 201, 394, 402, 415, 430 cement, 189, 402 Central America, 77, 387 Central Europe, 128, 169, 209 central nervous system, 240, 269 cereals, 109, 164, 218, 230, 231, 238, 312, 385 cerebellum, 251 cerebral cortex, 250 certainty, 23 channels, 332 charge density, 192 charring, 189, 204 chelating agents, 132 chemical composition, 18, 161, 165, 166, 169, 185, 330, 387, 390, 431 chemical interaction, 174, 324 chemical properties, 165, 183, 206 chemical reactions, xii, 175, 205, 398, 407, 420 chemical reactivity, 191 chemical stability, 193 chemisorption, 176, 185, 186, 190 chemoprevention, 48 chemotaxis, 284 Chicago, 380 chicken, 180, 278, 282, 284, 423 children, 217, 254, 269, 302, 384 chimneys, 189
breathing, 256, 259, 260 breeding, 63, 126, 127, 135, 159, 168, 212, 234, 237 Brownian motion, 325 buffer, 353, 359 bun, 386 burn, 178 burning, 185, 189 by-products, xi, xiii, 178, 184, 194, 196, 200, 205, 209, 289, 342, 355, 356, 427, 428, 429
C
cabbage, 24, 42, 80, 81, 83, 263, 414, 417 cadmium, 187, 188, 190, 192, 202, 208 caffeine, 66, 67, 197, 442 calcium, 159, 160, 161, 166, 185, 189, 190, 191, 195, 277, 287, 291, 292, 306, 313, 316, 389, 394, 428, 438 calcium carbonate, 189, 191 calibration, 60, 61 California, 423 calorie, 399 Canada, 113, 116, 162, 163 cancer, 42, 48, 80, 132, 285, 286, 290, 302, 305 cancer cells, 42 candidates, 174, 191, 419 capacity, 367 capillary, 13, 214, 351, 444 capsule, 70 carbohydrate, viii, 105, 125, 127, 132, 154, 161, 169, 284, 302, 304, 314, 315, 335 carbohydrates, viii, 105, 109, 125, 126, 127, 157, 160, 161, 163, 289, 302, 303, 304, 306, 314, 315, 343, 385, 389, 394, 430 carbon, viii, xiii, 3, 4, 171, 173, 174, 175, 176, 177, 178, 179, 180, 181, 183, 184, 189, 190, 198, 200, 201, 203, 205, 206, 207, 208, 209, 409, 427, 428, 429, 431, 434, 435, 436, 437, 441, 443, 446, 456 carbon dioxide (CO2), xiii, 175, 176, 178, 179, 180, 182, 184, 203, 205, 409, 441, 443, 444, 446, 449, 450, 451, 452, 455, 456, 457 carbon tetrachloride, 183 carbonization, 174, 175, 176, 177, 179, 180, 181, 183, 184, 191 carbonyl groups, 187, 193 carboxylic acids, 184 carboxylic groups, 184 carboximethyl cellulose.(CMC), 415, 416, 417 carcinogenesis, 457 carcinogens, 395 cardiac arrest, 133 cardiovascular disease, 80, 132, 276, 285, 290, 395 Caribbean, 106
Index
China, xii, 53, 64, 66, 67, 69, 70, 79, 98, 106, 112, 212, 280, 393, 394, 395, 396, 397, 398, 399, 400, 402, 403, 404, 405, 406 Chinese, 17, 34, 35, 36, 37, 47, 48, 57, 58, 61, 64, 70, 79, 80, 82, 98, 201, 212, 272, 280, 297, 395 Chinese medicine, 395 chitin, 173, 191, 192, 193, 194, 199, 203, 204, 208 chitosan, xiii, 173, 191, 192, 193, 194, 199, 200, 202, 203, 204, 207, 408, 415, 416, 417, 425 chitosan nanoparticles, 194, 207 chloride, 24, 154, 181, 182, 196, 206, 209 chlorine, 204, 424 chloroform, 183, 188 chlorophenols, 207 chlorophyll, 19, 197 chloroplast, 216, 236 cholecystokinin, 284 cholesterol, 126, 134, 272, 286, 288, 292, 294, 389, 442, 443, 456, 457 Chrastil, xiii, 441, 443, 446, 447, 448, 449, 450, 455, 456 chromatograms, 13, 16, 17, 21, 28, 54, 55, 64, 70, 75, 83, 87, 362, 366, 368, 369, 370, 371, 373, 374, 375 chromatographic profiles, viii, 2, 21, 22, 76 chromatography, 10, 19, 44, 249, 274, 280, 350, 351, 353, 381 chromium, 183, 187, 188, 192, 195, 196, 200, 207, 208 chromosomes, 216 chymotrypsin, 130, 131, 132, 133, 154, 273, 278, 280, 281, 282 circulation, 251, 274, 276, 284, 290, 395 classes, 74, 170, 216, 230, 304 classification, 157, 161, 176, 209, 389 cleaning, 399, 400, 401, 428 cleavage, 16, 30, 40, 44, 45, 181, 278, 359, 361, 372, 373, 375, 380 cleavages, 40 clients, 188, 199 clinical approach, 245 clinical trials, 305 clustering, 216 clusters, 277 coagulation, 230, 285 coal, 177 coatings, 409, 415, 416, 417, 425 cobalt, 188, 195, 208 cocoa, 187 coconut, 177, 178, 183, 195, 196, 201, 203, 204, 208 coding, 216 codominant, 216
463
coffee, xiii, 51, 52, 53, 54, 180, 182, 183, 187, 195, 197, 201, 204, 206, 208, 399, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457 cognitive process, 244, 254 cognitive processing, 254 cohesiveness, 334, 387, 388, 390 cohort, 254, 294 colitis, 412 collaboration, 188 collagen, 134 collector temperature, 446 colon, 126, 300, 301, 302, 303, 304, 305, 306, 307, 310, 315, 316, 317, 319 colon cancer, 306, 310, 317, 319 colon carcinogenesis, 305, 319 colonisation, 302, 307 coma, 251 combustion, viii, 171, 172, 189, 203 communication, 255, 307 community, vii, 1 compatibility, 429 competition, 227, 302, 342 compilation, 16, 179 complement, 109 complementarity, 214 complex carbohydrates, x, 74, 299 complexity, 248, 262, 328, 335, 411 compliance, 198 complications, 254 components, viii, ix, 10, 11, 16, 18, 19, 20, 22, 29, 48, 57, 59, 60, 64, 67, 74, 75, 77, 78, 80, 81, 82, 83, 84, 85, 88, 91, 109, 134, 157, 164, 171, 172, 175, 177, 178, 185, 218, 228, 257, 261, 263, 264, 266, 271, 281, 289, 290, 292, 301, 303, 308, 319, 323, 331, 332, 333, 335, 336, 337, 346, 356, 362, 363, 364, 365, 366, 368, 369, 370, 371, 372, 373, 374, 375, 377, 398, 409, 423, 457 composition, viii, ix, xi, 2, 18, 63, 105, 107, 108, 109, 110, 119, 121, 126, 127, 128, 129, 154, 155, 156, 157, 158, 159, 160, 162, 163, 164, 165, 166, 168, 169, 170, 178, 179, 185, 189, 192, 205, 211, 217, 218, 243, 244, 272, 300, 301, 303, 307, 312, 317, 330, 336, 345, 346, 352, 356, 357, 365, 367, 379, 386, 388, 391, 396, 414, 424, 428, 432, 436, 444, 446, 451, 456, 457 compounds, vii, xii, 1, 2, 7, 10, 11, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 29, 37, 38, 39, 41, 42, 43, 47, 48, 51, 52, 57, 59, 60, 61, 62, 63, 64, 66, 67, 70, 72, 73, 74, 80, 81, 88, 126, 129, 132, 133, 135, 156, 160, 163, 175, 190, 193, 197, 250, 252, 256, 257, 285, 295, 302, 303, 312, 313, 314, 315,
464
Index
cosmetics, 308, 442, 455 Costa Rica, 52, 53 costs, viii, 171, 172, 173, 178, 194, 195, 196, 234, 348, 398, 403 costs of production, 195 cotton, 443, 449 cotyledon, 111, 155, 160 coumarins, 2, 59 coverage, 356 covering, 107, 173 COX-2 inhibitors, 69 cranberry, 19, 20, 74, 314, 416 creatine, 278 crop production, 107 crop residues, 166, 204 crops, 74, 106, 126, 157, 166, 236, 406, 411, 423 cross-cultural differences, 263 cross-linking reaction, 193, 195 crystalline, 63, 334, 335, 336, 337 crystalline lamellae, 337 crystallinity, 337 crystallites, 334, 337 crystals, 398 CT scan, 251 cultivars, viii, 56, 64, 74, 84, 105, 108, 112, 113, 115, 116, 127, 129, 158, 160, 162, 163, 164, 165, 166 cultivation, 106, 127, 128, 165, 394, 395 cultural differences, 247, 264 cultural influence, 256 culture, viii, ix, 105, 243, 244, 263, 287, 308, 309, 320, 414, 419, 431, 437 culture conditions, viii, 105 culture media, 414 curing, 300 cuticle, 191 cyanide, 133 cycles, 19, 197, 214, 418 cystine, xii, 384, 385 cytochrome, 215, 228, 235 cytokines, 286 cytometry, 215 cytomodulatory, x, 271, 286, 289, 294
320, 386, 388, 407, 408, 410, 411, 418, 420, 422, 426, 428, 441, 442, 443 computation, 251 computed tomography, 248, 251 concentrates, 251, 287, 385 concentration, xi, xiii, 16, 19, 20, 21, 23, 48, 51, 62, 82, 84, 87, 127, 128, 134, 135, 158, 162, 174, 181, 183, 186, 187, 188, 189, 194, 246, 247, 256, 257, 258, 260, 263, 270, 275, 278, 279, 285, 300, 302, 307, 312, 336, 343, 345, 348, 349, 355, 357, 358, 361, 367, 370, 372, 375, 400, 410, 412, 413, 414, 418, 427, 431, 433, 434, 435, 436, 441, 442, 443, 446, 447, 449, 450, 452, 455 condensation, 175 conditioning, 293 conductivity, 359 confidence, 16, 211, 215, 258, 266 configuration, 43, 48, 215 conscious awareness, 249, 250 conservation, 394, 401 constipation, 305, 311 constraints, 214, 216 construction, 405 consumer markets, 404 consumers, viii, 211, 212, 227, 228, 261, 262, 263, 266, 294, 300, 310, 396, 399, 408 consumption, 2, 42, 48, 67, 106, 107, 126, 133, 134, 217, 230, 257, 285, 287, 306, 308, 309, 310, 384, 387, 399 contact time, 186, 412, 413 contaminants, 212 contamination, 172, 214, 218, 230, 240, 408 control, xii, xiii, 132, 155, 166, 175, 177, 189, 193, 197, 199, 214, 230, 236, 261, 263, 284, 307, 308, 388, 389, 390, 400, 407, 409, 411, 413, 414, 418, 420, 421, 422, 425, 427, 431, 433 conversion, 208, 273, 343 cooking, viii, 105, 154, 155, 156, 157, 158, 160, 161, 162, 164, 165, 166, 167, 170, 272, 388, 400 cooling, 20, 313 copper, viii, 171, 173, 186, 187, 188, 190, 191, 192, 194, 195, 197, 200, 202, 205, 208, 394 corn, 59, 180, 196, 280, 281, 296, 352, 380, 443, 449 coronary heart disease, 285 Correct Fraction Area method, xi, 341 correction factors, 62, 63 correlation(s), xiii, 127, 261, 263, 268, 269, 324, 325, 331, 366, 368, 369, 371, 372, 375, 377, 379, 423, 441, 450, 452 correlation function, 324 cortex, 249, 250, 253, 256, 259 cortical functions, 258 cortical processing, 249
D
Daidzein, 4 dairy, 228, 237, 261, 263, 264, 272, 274, 275, 287, 289, 291, 293, 295, 301, 308, 309, 311, 312, 313, 315, 318, 319, 320, 353, 396 dairy products, 228, 237, 272, 274, 275, 287, 289, 308, 309, 311, 312, 318, 320, 396 damping, 249
Index
data set, 450, 455 database, 2, 23, 48, 61, 89, 289 death(s), 260, 284, 385 decay, xii, 251, 332, 334, 335, 337, 338, 360, 393, 395 decolorization, viii, 171, 173, 174, 188, 190, 191, 197, 203 decomposition, 181 deconvolution, 331, 337, 338 decortication, 157 deduction, 30 defects, 385, 391 deficiency, xii, 109, 164, 393 deficits, 254 definition, 184, 216, 266, 311 degradation, 153, 170, 194, 199, 273, 274, 275, 282, 285, 293, 305, 311, 353, 398, 399, 420 dehydrate, 398 dehydration, 188, 248, 394, 397, 398, 399, 403, 405 Del Valle-Aguilera, xiii, 441, 443 delivery, 192, 246, 248, 252, 256, 259, 263, 264, 270, 308, 315, 317, 318, 320 demand, 190, 201, 403, 405, 408, 428 demographics, 300 denaturation, 155, 218, 380 Denmark, 287 density, 125, 178, 183, 214, 251, 327, 443, 446, 450, 451, 452, 455 dental caries, 287 dental plaque, 286 Department of Agriculture, 89 dependent variable, 450 depolymerization, 181 depreciation, 178 derivatives, 2, 10, 12, 13, 16, 19, 22, 42, 50, 51, 53, 54, 56, 57, 59, 70, 74, 75, 76, 77, 78, 79, 80, 81, 82, 84, 86, 134, 174, 183, 192, 193, 206, 228, 274, 276, 386, 387, 391 descending colon, 302 desire, 253 desorption, 186, 187, 190, 197, 203, 452 destruction, 251 detection, vii, ix, 1, 10, 11, 16, 19, 20, 21, 34, 37, 42, 51, 58, 61, 62, 86, 87, 213, 214, 218, 228, 229, 230, 234, 235, 236, 237, 238, 240, 241, 243, 244, 245, 246, 247, 248, 249, 252, 254, 256, 258, 259, 270, 443, 444 detergents, 428, 429 detoxification, 48, 133, 209, 391 developed countries, 74, 286, 395, 396, 399, 403 developing countries, 106, 280 deviation, 37, 447, 449, 450, 455 diabetes, 42, 132, 290
465
diagnostic markers, 234 diarrhea, 132, 134, 347 diesel fuel, 388 diet, 106, 154, 272, 275, 294, 301, 304, 307, 384 dietary fiber, viii, 74, 105, 126, 317, 389 dietary supplementation, 300, 303, 317 differential equations, 328 differentiation, 127, 228, 238, 286 diffusion, 186, 187, 191, 202, 249, 250, 326, 327, 328, 329, 330, 332, 333, 335, 336, 338, 356, 410, 412, 414, 419 diffusion process, 186 diffusion rates, 414 digestibility, 109, 127, 132, 133, 153, 155, 156, 157, 158, 159, 160, 161, 162, 164, 166, 168, 170, 388, 389 digestion, 130, 213, 272, 277, 278, 281, 282, 284, 286, 291, 292, 294, 296, 297, 301, 302, 303, 311, 379, 395 digestive enzymes, x, 132, 272, 274, 275, 282, 285, 299, 301, 304, 309 dihydroxyphenylalanine, 130, 131, 134 dimer, 15 dimethylformamide, 195, 196 dipeptides, 279, 282, 285, 350, 351 diphenylolpropane, 194 diploid, 240 directives, 217, 218 discrimination, 213, 218, 234, 235, 245, 246, 247, 255, 257, 269 disorder, 197 dispersion, 324, 325, 326, 330, 334, 336 dissociation, 10, 214 distillation, 189 distribution, x, 17, 47, 51, 179, 181, 182, 209, 256, 283, 323, 325, 327, 331, 334, 337, 338, 350, 386, 388, 404, 452 diterpene oil, xiii, 441 diterpenoids, 86, 87 diuretic, 53 diversification, xi, 355 diversity, 173, 175, 177, 180, 182, 185, 192, 193, 212, 214 DNA, ix, 211, 212, 214, 215, 216, 217, 218, 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240, 284 DNA polymerase, 213, 215 dominance, 266 drainage, xi, 355, 360, 361, 371, 372, 373, 374, 375, 376, 377, 378 dressings, 192, 308 drinking water, 174, 187, 188, 194, 197, 204, 208, 286
466
Index
emotion, 262 emotional reactions, 249 emotional responses, 249, 265 employment, 338 emulsifying, 351, 380, 381 emulsions, 313, 356, 380 encapsulation, 315, 350 encoding, 216, 227, 234, 320 endothermic, 178, 194 endotoxins, 439 endurance, 394 energy, 155, 158, 165, 173, 178, 179, 180, 181, 185, 195, 198, 200, 230, 250, 251, 356, 385, 388, 394, 397, 398, 403 energy consumption, 230, 403 engagement, 212 England, 455 enkephalins, 276 enlargement, 175 enterocolitis, 311 environment, 128, 129, 135, 158, 162, 164, 165, 168, 169, 185, 254, 288, 304, 306, 310, 342, 409, 414 environmental change, 128, 129 environmental factors, viii, 105, 127, 163, 425 environmental impact, 254 environmental issues, viii, 171, 172, 184, 267 enzyme, x, xi, 47, 132, 158, 213, 235, 271, 272, 273, 278, 280, 281, 282, 284, 285, 289, 291, 292, 293, 294, 295, 296, 297, 305, 341, 342, 343, 344, 348, 349, 355, 357, 361, 363, 365, 369, 371, 377, 379, 398, 401, 409, 414, 417, 418, 422, 428, 429, 431, 434, 435, 437 enzyme immunoassay, 235 enzyme inhibitors, 293, 295 enzymes, x, xi, xii, 17, 18, 64, 271, 272, 273, 274, 282, 288, 289, 302, 305, 306, 307, 311, 341, 342, 346, 348, 355, 357, 359, 360, 363, 364, 365, 373, 400, 407, 414, 420, 426, 428 EPA, 109 epidemiology, 230, 245 epithelial cells, 302 epithelium, 248, 255, 256 epoxy, 195 equilibrium, 177, 208, 275 equipment, 176, 185, 228 erosion, 388 Escherichia coli (E. coli), xiii, 230, 276, 296, 301, 307, 408, 412, 413, 414, 415, 418, 424, 425 essential oils, xiii, 407, 409, 410, 411, 412, 413, 414, 417, 423, 424, 425 ester(s), 41, 66, 71, 75, 79, 181, 442, 456 estimating, 247 ethanol, 18, 185, 188, 263, 409
drought, 128, 159 drugs, 134, 254, 288, 300 dry matter, 107, 118, 120, 133, 134 drying, viii, 13, 17, 154, 158, 171, 172, 193, 218, 291, 309, 312, 313, 315, 348, 380, 394, 396, 398, 399, 400, 401, 403, 405, 409 drying time, 398 duration, 154, 256, 275, 423 dyeing, 402 dyes, 174, 183, 184, 185, 186, 187, 190, 192, 193, 197, 201, 204, 206, 209, 402
E
E. canis, xiii, 408, 418, 419 E. faecium, xiii, 408, 418, 419 E. hirae, xiii, 408, 418, 419 ears, 264 earth, 192 East Asia, 280 eating, 395 eco-friendly, viii, 171, 172, 194, 198 ecology, 320 economic development, 212 economics, 184, 198, 201, 207 ecosystem, 185, 303 eczema, 311 EEG, ix, 243, 248, 250, 252, 253, 259, 260, 261, 262, 263, 264, 265, 266, 269, 270 EEG activity, 270 effluent(s), 188, 190, 194, 199, 200, 202, 209 egg(s), 187, 201, 217, 272, 283 Egypt, 110, 113, 116, 318, 320 Egyptian, 318, 320 Einstein, 333, 340 elaboration, xii, 384, 386, 388, 389, 390 elasticity, 389, 390 elastin, 130, 131, 134 elbows, 386 elderly, 246, 254, 267, 303, 317 electric current, 253 electrodes, 253, 264 electroencephalogram, ix, 243, 248, 250 electroencephalography, 252 electromagnetic, 251 electron, 251 electrophoresis, 214, 346 electroplating, 195 electrospray ionization (ESI), vii, 1, 10, 11, 13, 20 electrostatic force, 177 electrostatic interactions, 191, 346 ELISA, 228, 240 emission, 172, 213, 214, 251
Index
ethers, 47, 176 ethnic background, 247, 258 ethylene, 408 eucalyptus, 179, 410, 411, 412, 414, 417 Europe, x, 106, 129, 168, 237, 299, 300, 318, 399, 400 European Community, 228, 332 European Union, 212, 235 evaporation, 446 event-related potential, 269, 270 evidence, xiii, 106, 127, 132, 135, 245, 246, 250, 254, 256, 257, 258, 259, 264, 266, 290, 292, 300, 307, 311, 314, 319, 324, 331, 332, 337, 338, 408, 411, 422, 423 evoked potential, 259, 269 evolution, 180, 213, 216, 331, 420, 421 exchange rate(s), 328, 333, 334 excitability, 250 exclusion, xi, 310, 341, 346, 352, 381 excretion, 286 exons, 216 experimental condition, 188, 431 experimental design, 455 expertise, 230, 262, 265 exploitation, viii, 171, 172, 289 exports, 396 exposure, 245, 246, 248, 250, 254, 256, 268, 269 extracellular matrix, 250 extraction, vii, xiii, 1, 10, 11, 18, 19, 21, 47, 61, 69, 84, 166, 181, 191, 194, 199, 228, 233, 239, 291, 357, 372, 379, 388, 391, 406, 431, 441, 443, 444, 446, 449, 451, 452, 455, 456 extraction process, 69 extrusion, viii, 105, 154, 155, 156, 157, 164, 313, 386
467
F
failure, 255, 353 family, 10, 48, 59, 80, 84, 164, 214, 314, 387, 389 FAO, 107, 120, 161, 230, 234, 239, 281, 292, 310, 311, 317, 384, 388, 389, 391 farm(s), 197, 212, 263, 318 farmland, 402 fat, 126, 127, 128, 129, 154, 155, 161, 239, 308, 312, 313, 318, 320, 331, 332, 333, 389, 394, 399, 414, 430, 431, 452 fat reduction, 128 fatigue, 245, 249, 260, 291 fatty acids, 109, 121, 129, 168, 169, 302, 306, 388, 442, 443, 444 feedback, 132 females, 246
fermentation, viii, ix, x, 105, 154, 156, 158, 160, 166, 167, 194, 197, 199, 271, 272, 273, 274, 275, 277, 282, 286, 288, 289, 293, 294, 301, 302, 303, 304, 306, 307, 309, 311, 312, 314, 318, 321, 425 fermentation broth, 197 fermentation technology, 289 ferrous ion, 135 fertilization, 22, 129 fever, 48, 230 fiber content, 155 fibers, 192 fibrin, 276 fibrinogen, 276, 285, 293 film, xiii, 186, 190, 356, 372, 375, 381, 408, 409, 415, 417 film formation, 356, 375 films, xii, 192, 295, 373, 380, 381, 407, 409, 417, 418, 425, 428 filtration, 280, 351, 357 financial support, 200, 350 financing, 212 Finland, 287, 352 firms, 388 fish, xiii, 158, 161, 194, 217, 227, 235, 272, 277, 278, 279, 287, 289, 292, 293, 296, 427, 429, 430, 431, 432, 433, 435, 436, 437, 438, 439 fishing, 429 fixation, 276 flame, 444 flatulence, 130, 131, 134, 159 flavonoids, vii, 1, 2, 7, 10, 11, 13, 16, 17, 18, 21, 22, 23, 24, 26, 29, 33, 37, 42, 43, 44, 47, 48, 50, 53, 59, 60, 62, 63, 64, 66, 67, 69, 70, 73, 74, 77, 78, 80, 81, 82, 83, 84, 86, 90, 101, 132, 292 flavor, ix, xii, 48, 53, 243, 384, 389, 394, 395, 396, 398, 400, 401, 402, 403, 404, 409, 442 flex, 330 flexibility, 193, 356, 369, 374, 375, 380 flora, 301, 308, 318, 319, 320, 424 fluctuations, 128, 260 flue gas, 174 fluid, 18, 277, 294, 346, 444, 452, 456 fluid extract, 18, 444, 456 fluidized bed, 177, 179, 182, 189 fluorescence, 213, 240 fluoride, 205 foaming, xi, 355, 356, 357, 367, 368, 369, 371, 373, 375, 376, 377, 378, 379, 380 foams, 356, 371, 372, 373, 374, 375, 376, 377, 379, 380, 381 focusing, 212 folate, 314 folic acid, 384, 385, 391
468
Index
generation, 175, 198, 216, 217, 261, 282, 288, 290, 296 genes, ix, 211, 216, 234, 290, 320, 389 genetic factors, 108 genetically modified organisms, 215, 236, 237, 239 genetics, 438 Geneva, 391 Genistein, 4 genome, 216, 217 genome sequencing, 217 genomics, 238, 314 genotype, 117, 128, 129, 133, 135, 168, 169, 216, 233, 234 Germany, 343 germination, 127, 153, 160, 161, 167 ginger, 168 Ginkgo biloba, 17, 28, 30, 36, 67, 68, 69, 70 glass, 20, 359, 430, 446 glial, 227 glucose, 23, 30, 34, 109, 304, 307, 354, 389, 428, 429 glucoside, 15, 17, 20, 23, 24, 25, 26, 27, 29, 30, 33, 34, 35, 37, 38, 39, 40, 41, 42, 44, 46, 49, 52, 55, 58, 59, 60, 61, 62, 65, 66, 68, 71, 72, 73, 74, 75, 76, 78, 79, 80, 81, 82, 83, 85, 457 glutamate, 133 glutamine, 352 glutathione, 456, 457 glycerol, 313, 409 glycine, 195, 280, 431 Glycitin, 4 glycoprotein(s), 217, 315 glycoside, 21, 22, 23, 28, 30, 31, 34, 37, 38, 41, 44, 46, 59, 60, 62, 67, 83, 87, 281 glycosides, 2, 9, 19, 20, 21, 23, 24, 26, 27, 28, 29, 34, 36, 37, 38, 39, 40, 41, 42, 44, 46, 47, 48, 58, 59, 61, 62, 63, 64, 65, 67, 68, 69, 72, 74, 75, 80, 81, 82, 83, 84, 133 glycosylation, 10, 24, 30, 41, 42, 60 goat milk, 316 government, vii, 212, 385 grains, 17, 19, 42, 109, 156, 230, 232, 281 gram-negative, xiii, 283, 306, 408, 418 granules, 338 graphite, 174 grass, 24, 108, 113, 125, 163, 168, 169, 263 Greece, 105, 110, 116 Green Revolution, 168 green tea, 41, 47, 64, 66, 67, 69 groundwater, 172 groups, xi, 2, 3, 10, 13, 16, 23, 25, 26, 34, 37, 38, 41, 44, 48, 51, 53, 55, 60, 62, 64, 65, 66, 75, 82, 128, 130, 175, 176, 177, 178, 183, 185, 187, 192, 193,
food additives, 409 food industry, viii, 171, 172, 173, 184, 310, 442, 455 food intake, 284 food processing industry, 184, 409 food production, 310, 396 food products, x, 19, 53, 106, 211, 212, 227, 233, 240, 290, 299, 301, 309, 312, 314, 394, 400, 406, 408, 413 food safety, 212, 239, 283, 287, 409 forebrain, 249 forgetting, 244 formaldehyde, 183, 184, 193, 195, 201 fossil, 172, 185 fragility, 408 fragmentation, 10, 13, 16, 31, 40, 41, 44, 45, 50, 62 France, 429 free radicals, 176 freezing, 17, 309, 312, 313, 314, 394, 398, 403, 405, 418 frequency distribution, 262 fructose, 304 fruits, viii, 2, 17, 19, 23, 24, 28, 39, 43, 48, 50, 59, 73, 84, 387, 394, 395, 396, 399, 402, 403, 405, 408, 409, 418, 422, 423, 426 fuel, 172, 185 fulfillment, 198 functional MRI (fMRI), 248, 252, 253 functionalization, 195 fungi, 184, 212, 230, 231, 283 fungus, 158 furan, 33 fusion, 296 futures, 238
G
gamma rays, 251 gas phase, 248 gases, 175, 176, 178, 198, 456 gasification, 178, 180 gastrectomy, 319 gastrointestinal tract, 80, 283, 286, 290, 301, 302, 303, 310, 316, 320 Gaussian, 336 gel, 195, 213, 233, 253, 280, 313, 319, 332, 333, 337, 338, 346, 350, 351, 399 gelation, 193, 194 gender, 245, 247 gene, 214, 215, 227, 228, 229, 230, 234, 235, 236, 237, 240, 319 gene expression, 214, 237, 319 generalization, 328
Index
195, 196, 207, 215, 244, 250, 256, 260, 261, 262, 263, 264, 265, 266, 267, 284, 328, 350, 355, 359, 364, 365, 367, 375, 378, 379, 383, 385, 389, 411 growth, xii, xiii, 106, 128, 132, 133, 184, 213, 272, 274, 276, 284, 287, 288, 300, 302, 303, 307, 309, 310, 312, 315, 320, 385, 407, 410, 411, 412, 413, 414, 417, 420, 422, 423, 424, 427, 428, 429, 430, 431, 433, 434, 435, 436, 437, 438 growth rate, 132, 417 gruel, xiii, 427, 429, 430, 434, 435, 436, 439 Guangdong, 394, 396, 399, 402, 405 Guangzhou, 393 Guava seed, xii, 384 gut, x, 290, 299, 300, 301, 302, 303, 304, 306, 307, 308, 309, 310, 314, 315, 320
469
H
H. pylori, 311 haemoglobin, 252 halos, 412, 415, 419 hands, 255 hardness, 386, 389, 390 harmonization, 234 harvesting, 88 hazards, 212 head injuries, 254 health, vii, ix, x, 1, 2, 42, 43, 47, 48, 60, 64, 69, 109, 126, 132, 162, 211, 212, 217, 255, 271, 272, 275, 282, 287, 288, 289, 290, 291, 292, 296, 299, 300, 301, 302, 303, 307, 308, 309, 310, 311, 312, 314, 315, 316, 317, 319, 320, 385, 388, 442 health effects, 64, 272, 275, 290, 301, 309, 311, 319 health status, 309 heart disease, 285 heart rate, 247 heat, xii, xiii, 153, 154, 155, 165, 174, 175, 179, 181, 184, 189, 218, 228, 235, 312, 381, 388, 390, 394, 395, 397, 407, 408, 409, 420, 421, 422, 423, 424, 426 heating, 11, 18, 34, 64, 155, 177, 179, 189, 198, 337, 343, 397, 401, 403, 430 heating rate, 177, 179, 198 heavy metals, 185, 187, 190, 192, 201, 206 height, 67 helium, 253 hemagglutinins, 162 hemicellulose, viii, 125, 155, 171, 172, 178, 181 hemoglobin, 395 herbal medicine, 48 herbs, xii, 17, 23, 24, 51, 58, 59, 407 heterogeneity, 326, 327, 328, 333, 336
heterogeneous systems, 324, 325, 327, 328, 330, 331, 337, 338 hexane, xiii, 441, 443, 446, 452, 455 high fat, 414 high performance liquid chromatography (HPLC), xi, 12, 19, 20, 25, 61, 228, 237, 341, 343, 344, 346, 352, 356, 358, 361, 363, 443, 444, 452 histidine, 282 homopolymers, 109 Honduras, 395 hormone, 284 horticulture, 426 host, 18, 286, 290, 300, 302, 303, 307, 309, 310, 314, 315 human interactions, 314 human milk, 304, 316 human subjects, 294 humidity, 411, 444, 446 hybrid, 215 hybridization, 213, 214 hydrogen, 133, 174, 175, 179, 306, 310, 312, 315, 409, 414, 418 hydrogen cyanide, 133 hydrogen peroxide, 306, 310, 312, 409, 414, 418 hydrogenation, 305 hydrolysates, 197, 273, 278, 280, 281, 282, 283, 289, 291, 293, 296, 342, 343, 344, 346, 347, 348, 349, 350, 351, 352, 353, 357, 358, 361, 363, 364, 365, 372, 373, 377, 379, 380, 381 hydrolysis, ix, x, xi, 11, 19, 34, 38, 39, 41, 43, 44, 47, 65, 82, 127, 133, 271, 272, 273, 275, 276, 277, 278, 280, 281, 283, 286, 287, 294, 341, 342, 348, 349, 350, 352, 353, 355, 356, 357, 359, 360, 363, 365, 367, 369, 372, 374, 375, 377, 378, 379, 380, 381, 401 hydrophilic, 195, 367, 369, 373, 377, 379 hydrophilicity, 191, 367 hydrophobic, 19, 278, 292, 346, 362, 363, 367, 368, 369, 370, 371, 372, 373, 374, 377, 378, 379 hydrophobic interactions, 374 hydrophobicity, 193, 356, 358, 363, 366, 368, 377, 381 hydrothermal, 168 hydroxide, 181 hydroxyapatite, 190, 191, 201 hydroxyl, 25, 39, 40, 41, 44, 51, 187, 192, 193 hydroxyl groups, 25, 41, 44, 192, 193 hydroxypropyl, 196 hypercholesterolemia, 310 hypertension, 132, 281, 293, 394 hypertrophy, 132 hypocholesterolemic, x, 271 hypotensive, 272, 274, 280, 285, 287
470
hypothesis, 277, 286, 329, 330, 337
Index
industry, vii, viii, xii, 67, 171, 173, 174, 178, 189, 195, 196, 256, 257, 259, 261, 262, 266, 268, 273, 275, 282, 293, 305, 309, 312, 393, 394, 395, 396, 398, 399, 401, 403, 404, 406, 422, 423, 428, 429, 442 inefficiency, 273, 346 infancy, 314 infants, 106, 286, 301, 302, 303, 304, 305, 308, 309, 317, 318, 319 infection, 284 infinite, 327 inflammation, 168 inflammatory disease, 303 infrared spectroscopy, 177 infrastructure, 236 ingest, 384 ingestion, x, 2, 60, 275, 284, 285, 290, 299, 303, 307, 319 inhibition, 132, 134, 272, 276, 278, 285, 286, 295, 296, 412, 413, 415, 417, 418, 419 inhibitor, 131, 134, 135, 136, 153, 154, 155, 158, 160, 278, 280, 281, 282, 285, 291, 293, 296 inhibitors, viii, 105, 130, 131, 132, 133, 134, 135, 153, 154, 155, 156, 157, 162, 165, 277, 278, 280, 281, 285, 291, 295, 296, 388 inhibitory effect, 284, 412, 413 injuries, 42 innate immunity, 283 innovation, 198, 319, 404 inoculation, 156 inositol, 132 insertion, 176, 284 insight, 180, 181, 205, 331, 337, 338 insomnia, 395 instability, 360, 377 instruments, 10, 214, 252 integration, 249, 399 integrity, 184, 409 intensity, 21, 135, 216, 256, 268, 288, 402, 423 interaction, 128, 158, 159, 162, 169, 192, 199, 248, 249, 277, 284, 287, 289, 312, 323, 325, 326, 337, 338 interactions, 129, 164, 168, 176, 192, 290, 313, 323, 324, 325, 328, 331, 335, 351, 375, 452 interface, 284, 325, 326, 328, 332, 333, 335, 336, 356, 369, 372, 373 interfacial tension, 356 interference, 253, 449 interphase, 288, 300 interpretation, x, 234, 323, 324, 327, 330, 331, 337, 338 interval, 260, 266, 324, 325, 328 intestinal flora, 317
I
identification, vii, ix, 2, 10, 11, 16, 17, 20, 21, 22, 23, 24, 28, 29, 34, 36, 41, 42, 43, 44, 46, 48, 51, 60, 77, 211, 213, 215, 217, 218, 227, 228, 230, 233, 234, 236, 238, 240, 243, 245, 246, 247, 255, 256, 258, 268, 269, 270, 283, 294, 350, 418, 443, 456 identity, 41, 256 ileostomy, 277, 294 ileum, 277, 286 images, 251 imaging, 248, 250, 251, 252, 259 imaging systems, 251, 252 imaging techniques, 251, 259 immune function, 307, 310 immune response, 286, 307, 310, 319 immune system, 286, 307 immunity, 286, 296, 307, 310, 317, 395 immunization, 389 immunocompetent cells, 286 immunological, x, 217, 271, 307 immunomodulatory, x, 271, 272, 275, 286, 287 immunostimulatory, 58, 275, 287 implementation, 172, 183, 188, 254 impregnation, 175, 181, 184 in situ, 274 in vitro, ix, xiii, 155, 157, 158, 160, 161, 166, 168, 169, 194, 271, 275, 276, 279, 281, 283, 285, 286, 287, 290, 321, 388, 389, 407, 410, 411, 412, 417, 424, 425 in vivo, ix, xiii, 157, 169, 271, 276, 278, 279, 283, 285, 286, 287, 290, 292, 294, 317, 319, 407, 417, 425 incidence, 132 inclusion, 254, 313 income, xii, 390, 393, 394, 395, 401 incubation time, 428 India, 64, 106, 107, 110, 111, 112, 113, 115, 117, 118, 157, 163, 166, 167, 169, 191, 339 indication, 129, 187, 212, 213 indicators, xi, 290, 355, 418 indices, 247, 263, 269 indigenous, 74, 303, 304 indirect measure, 358 Indonesia, 52, 53, 272 induction, 423, 437 industrial application, 200, 315, 429, 438 industrial production, 194 industrialized countries, 217
Index
intestinal tract, 276, 283 intestine, 274, 285, 302, 309, 316, 318, 352 inulin, 304, 306, 307, 308, 314, 316, 318, 320, 321 inversion, 188, 331 inversion recovery, 331 investment, xii, 393, 396, 397, 398, 405 iodine, 176 ion adsorption, 183, 192, 196, 209 ionization, vii, 1, 10, 13, 14, 16, 51, 87, 444 ions, viii, 15, 16, 28, 34, 36, 38, 41, 44, 55, 57, 72, 82, 133, 171, 173, 183, 187, 190, 191, 192, 194, 195, 197, 200, 202, 208, 277, 342 IR, 10, 337 iron, 74, 133, 160, 161, 189, 195, 315, 316, 384, 394, 395 irradiation, viii, 105, 155 irritable bowel syndrome, 311 isoflavones, 4, 5, 47 isoflavonoids, 47 isolation, 189, 274, 289, 293, 391, 409, 418, 437 isoleucine, 108, 280 isomers, 8, 10, 16, 23, 24, 28, 29, 31, 33, 34, 41, 44, 46, 48, 51, 54, 55, 60, 314 Isorhamnetin, 3, 73 isothermal, 207 isotherms, 206, 380, 452, 455 Israel, 17 Italy, 161, 211, 218, 228, 292, 323, 324, 391 Ivory Coast, 168
471
L
L. albus, xii, 384, 386 L. lactis, xiii, 408, 418, 419 labour, 216 lactic acid, xiii, 272, 274, 288, 301, 306, 307, 308, 309, 311, 312, 314, 317, 318, 320, 401, 408, 409, 418, 423, 425 lactic acid bacteria (LAB), xiii, 272, 274, 275, 281, 286, 288, 289, 301, 307, 308, 309, 314, 317, 318, 320, 408, 409, 418, 423, 425 Lactobacillus, 277, 292, 294, 295, 302, 309, 312, 316, 317, 318, 319, 423 lactoferrin, 274, 283, 423 lactones, 67, 176 lactose, 23, 301, 304, 305, 310, 311 lamella, 336 lamellae, 374 land, 184 language, ix, 243, 244, 255, 264, 266 lanthanum, 194, 204 large intestine, 302, 303, 304, 306, 318, 321, 388 latex, 273 Latin America, 106 lattice formation, 336 laundry, 428 leaching, 154, 184 lead, 28, 36, 46, 133, 178, 179, 182, 185, 187, 196, 198, 207, 208, 209, 230, 244, 265, 267, 314, 325, 408, 410, 436, 450 learning, 249 lectin, 132, 136 left hemisphere, 265 legislation, viii, 211, 212, 290 legume, xi, xii, 47, 106, 107, 108, 109, 125, 126, 127, 129, 132, 134, 142, 144, 146, 148, 149, 150, 151, 152, 153, 154, 155, 156, 158, 160, 161, 162, 167, 168, 169, 170, 281, 383, 384, 385, 386 legumes, viii, 74, 105, 106, 107, 108, 109, 110, 119, 121, 122, 125, 126, 127, 128, 129, 130, 132, 133, 134, 136, 141, 142, 144, 146, 149, 150, 152, 153, 154, 155, 156, 158, 159, 160, 161, 162, 163, 164, 165, 167, 168, 169, 386, 390 leprosy, 395 lesions, 133, 251 leucine, 108 leukocyte(s), 284, 296 leukopenia, 230 life cycle, 129 life style, x, 42, 288, 299, 300 ligand(s), 276, 346, 353 light transmittance, 401 lignans, 2, 59
J
Jamaica, 395 Japan, x, 115, 191, 272, 274, 282, 287, 290, 299, 300, 308, 318, 396, 399, 400 Jatropha curcas, xi, xii, 383, 384, 387, 388, 391 jejunum, 352 judges, 258
K
Kenya, 52, 53, 189 kernel, 118, 168, 182, 203 kidney, 57, 74, 75, 76, 125, 155, 157, 163, 170 killing, 424 kinase, 278, 279 kinetic parameters, 187 kinetic studies, 200, 208 kinetics, 201, 206, 213, 338, 423, 452 Korea, 70, 112
472
Index
macromolecules, 328, 331, 334, 335 macrophages, 286 macropores, 176 magnesium, 126, 166, 177, 185, 306, 316, 394 magnetic field, 252, 329, 332 magnetic properties, 252 magnetic resonance imaging (MRI), 248, 252, 253 magnetization, 327, 328, 330, 332, 334, 335, 337, 338 magnetoencephalography (MEG), 248, 252, 253 Maillard reaction, 354, 425 maize, 59, 314, 385 Malaysia, 394, 402, 406 males, 246 malignant cells, 286 malnutrition, 267, 385 mammalian cells, 300 mammalian tissues, 428 management, 166, 311, 314, 408 mangroves, 129 manipulation, 303 manufacturing, 185, 194, 196, 268, 287, 309, 404 manure, 184, 263 market, x, xi, 63, 64, 69, 70, 72, 74, 79, 84, 177, 196, 240, 284, 287, 288, 289, 299, 300, 311, 312, 315, 355, 356, 394, 396, 404, 428, 429, 442 market share, x, 299 marketing, ix, 211, 288, 310, 312, 394, 395, 396, 403, 404, 405 markets, x, 53, 58, 299, 300, 396, 399 Maryland, 17, 67 masking, 245, 246, 258 mass spectrometry, 205, 351 matrix, 11, 175, 289, 313, 319, 325, 326, 332, 338, 346, 414, 449, 452 maturation, 22, 24, 69, 125, 275, 302, 313 maximum sorption, 187 meals, 239 measurement, x, 125, 161, 244, 245, 247, 252, 257, 262, 290, 323, 324, 330, 443 measures, 245, 261, 262, 326, 329, 330, 401, 403, 423 meat, 107, 189, 203, 227, 228, 235, 236, 237, 238, 239, 240, 272, 282, 288, 290, 291, 293, 315, 353, 414, 423, 430, 431 mechanical properties, 176, 181 mechanical treatments, 153 media, xiii, 154, 193, 309, 414, 427, 429, 431, 433, 434, 435, 436, 439 medication, 300 medicine, 64, 134, 272, 288, 395 Mediterranean, 106, 157, 158, 162 medulla, 251
lignin, viii, 163, 171, 172, 178, 180, 181, 196, 402 likelihood, 260, 450 limitation, 20, 37, 215, 256, 266 linear model, 345 linkage, 26, 28, 29, 34, 40, 62, 234, 240, 304 lipase, 132 lipid metabolism, 306, 320 lipid oxidation, 285, 423 lipid(s), 170, 289, 303, 323, 331, 332, 409, 431, 442, 455, 456, 457 lipopolysaccharides, 284 liposomes, 296 liquid chromatography, vii, 1, 351, 443 liquid interfaces, 380 liquid phase, 190 liquids, 178, 456 Listeria monocytogenes (L. monocytogenes), xiii, 408, 412, 415, 417, 418, 424, 425 literature, vii, viii, 1, 11, 16, 18, 23, 28, 105, 107, 108, 133, 136, 154, 156, 173, 177, 178, 179, 180, 182, 183, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 197, 199, 202, 259, 276, 330, 331, 334, 337, 346, 348, 349, 350, 387, 390, 428, 435, 443 liver, 42, 307 livestock, 158, 235, 239 living conditions, 212 localization, 126 location, 22, 128, 129, 135, 216, 251 locus, 216, 234 London, 202, 204, 291, 379, 380, 423 longevity, 308, 395 love, 413 low cost, 188, 208 low temperatures, 176, 179 low-density lipoprotein, 456 luciferase, 213 lumen, 290 luminescence, 213 Lupin, xi, xii, 159, 166, 383, 384, 385, 387, 391 Lupinus, xii, 106, 107, 108, 109, 114, 119, 130, 134, 135, 137, 159, 161, 166, 167, 384, 386, 387, 391, 392 lying, 251 lymphocytes, 286 lymphoid tissue, 302 lysine, xi, 108, 109, 132, 383, 384, 385, 386, 389 lysis, 284 lysozyme, 283, 292, 295
M
machinery, xii, 393, 394, 396, 398, 403, 404 macroeconomics, 172
Index
medulla oblongata, 251 melons, 24 melting, 227, 238 melting temperature, 238 membrane permeability, 277 membranes, 187, 192, 274, 327, 408 memory, 244, 246, 249, 255, 262, 267, 269 men, 253, 294 mental state, 267 mercury, 190, 192, 197, 204 mercury, 201 metabolism, 28, 132, 197, 252, 288, 306, 315, 316, 408, 421, 423 metabolites, vii, 1, 2, 134, 230, 306, 311, 314, 429 metal content, 395 metal ions, 174, 183, 185, 187, 190, 191, 192, 193, 195, 197, 202, 203, 204, 428 metals, 132, 191, 192 methanol, 16, 18, 20, 21, 48, 52, 67, 84, 184, 444 methionine, xi, 109, 132, 281, 383, 385 methyl group, 25 methylation, 24, 25, 60 methylene, 175, 176, 186, 188, 204 Mexico, 114, 115, 116, 167, 170, 269, 383, 384, 386, 387, 388, 389, 390, 391, 395 mice, 319 micelles, 277, 334 microarray(s), 214, 215, 217, 218, 228, 236, 238, 239, 240 microarray technology, 215 microbial, 274, 302, 320, 353, 411, 420, 421, 426, 437, 438, 439 microbiota, 301 microencapsulation, x, 300, 313, 314, 315, 316 microflora, xii, xiii, 284, 295, 301, 303, 304, 305, 306, 307, 315, 316, 317, 407, 408, 409, 410, 415, 417, 420 micronutrients, 126, 384 microorganism(s), x, 184, 230, 239, 299, 408, 410, 411, 412, 414, 417, 418, 421, 423, 424, 428, 429, 430 microsatellites, 216, 238 microspheres, 193 microstructure, 203, 332 microwave, viii, 18, 105, 154, 156, 162, 163, 164, 182, 199, 203, 204, 394, 397 microwave heating, 154, 162 microwaves, 200 midbrain, 249, 267 Middle East, 106 migration, 181 milk, ix, 217, 228, 235, 237, 238, 239, 271, 272, 274, 275, 276, 277, 280, 281, 283, 284, 285, 286, 287,
473
291, 292, 294, 295, 296, 305, 308, 309, 312, 313, 315, 316, 317, 318, 319, 342, 346, 352, 353, 381, 395, 400, 401, 429 milligrams, 446 minerals, 74, 161, 287, 306, 343, 394, 431 minority, 106 mitochondria, 327 mixing, 189, 324, 386, 389, 400, 401 mobility, 181, 213, 301, 335 models, xiii, 214, 277, 324, 441, 443, 450, 455 moisture, 63, 169, 343, 357, 417, 443 moisture content, 63, 443 mold, 156 molecular biology, 213 molecular mass, 273, 346, 353 molecular structure, 163, 166, 380 molecular weight, 2, 20, 42, 59, 61, 62, 82, 109, 160, 217, 234, 278, 281, 289, 346, 350, 358, 362, 363, 364, 368, 369, 370, 371, 373, 374, 377, 381 molecular weight distribution, 381 molecules, 18, 55, 132, 176, 213, 247, 248, 256, 273, 284, 304, 307, 323, 324, 325, 326, 327, 328, 330, 331, 332, 333, 334, 335, 336, 337, 338, 346, 356, 363, 365, 367, 376, 378, 414 money, 255, 314 monoclonal antibodies, 217 monograph, 237 monolayer, 284 monomers, 48, 60, 62, 63 monosaccharide(s), 26, 30, 60, 161 morphology, x, 323, 325, 331 mortality, 294 motion, 323, 331, 332, 335 motivation, 198, 268 movement, 248, 250, 251, 253, 302, 340 mucus, 248, 249 multicellular organisms, 283, 297 multiples, 2 muscles, 278, 282, 287 myosin, 278, 282, 295
N
NaCl, 430 nanoparticles, 194 nasal cavity, 266 National Institutes of Health, 89 natural environment, 283 natural food, xii, 304, 407 natural polymers, 191 natural resources, viii, 171, 172, 198 nausea, 132, 230 Nd, 136
474
Index O
obesity, 132, 290 obligate, 301 observations, 259, 264, 275, 418, 435 oil, viii, xii, xiii, 105, 108, 127, 128, 129, 159, 166, 167, 169, 181, 182, 193, 194, 197, 200, 203, 208, 233, 319, 343, 388, 389, 399, 400, 402, 407, 411, 412, 413, 414, 415, 424, 425, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 455, 456, 457 oils, xiii, 407, 409, 410, 411, 412, 413, 414, 417, 425, 443, 446, 449, 450, 451, 452, 456, 457 oilseed, 108, 180 older people, 254, 267 oleoresins, xii, xiii, 407, 408, 409, 415, 416, 417 olfaction, 245, 246, 247, 248, 258, 266, 268 olfactory epithelium, 247, 248, 249, 254, 255, 256 olfactory nerve, 249 oligofructose, 304, 306, 307, 308, 316, 317, 319, 321 oligomers, 48 oligonucleotide ligation assays, 215 oligosaccharide(s), 109, 125, 156, 158, 161, 164, 165, 166, 304, 305, 308 olive oil, 233, 235, 238 opioid, 276, 297 optical density, 410 optimization, vii, 2, 187, 391, 436, 438 orange juice, 312, 318 orbitofrontal cortex, 249 organ, 274, 300 organelles, 331 organic compounds, 172, 183, 188, 197, 200, 201 organic food, 422 organic matter, 175, 184, 402, 424 organic solvents, 254 organism, 216, 234, 283, 309, 342 organizations, 263 organoleptic, 288, 311, 388 orientation, 276 osteoporosis, 290 overproduction, 314 oxalate, 141, 153 oxidation, 47, 64, 192, 281, 296, 398 oxidation products, 47, 64 oxidative stress, 283, 285 oxygen, 174, 175, 176, 189, 190, 201, 250, 252, 301, 312, 417, 420 oyster, 278, 293 ozone, 424
nebulizer, 13 Nepal, 163, 281, 293 nerve, 133, 248, 249 nerve cells, 133, 249 nervous system, 248, 250, 272, 395 Netherlands, 100, 201, 240, 287, 320, 353 network, 176, 331, 332, 333, 334 neural tissue, 250, 259 neurological disease, 42 neurons, 249, 250, 252, 253 neurotoxicity, 164 neurotransmitter, 250 neurotransmitters, 250 neutrophils, 284 New England, 456 New York, 90, 96, 208, 268, 291, 294, 296, 318, 319, 340, 353, 381, 391, 392, 425, 456 nickel, 192 Nigeria, 106, 110, 111, 113, 114, 115, 116, 117, 118, 129, 156, 161 nitrate, 195, 207, 435 nitrogen, xi, xiii, 127, 129, 134, 169, 175, 179, 180, 182, 198, 343, 350, 352, 354, 355, 398, 399, 428, 429, 430, 431, 434, 435, 436, 437, 446 nitrosamines, 306 NMR, 10, 22, 32, 34, 44, 54, 323, 324, 325, 331, 332, 334, 335, 338 non-magnetic, 252 normal aging, 254, 269 normal development, 302 North Africa, 106 North America, 106, 247, 396 Norway, 191 nuclei, 328, 329 nucleic acid, 213, 237 nucleotide sequence, 217 nucleus, 325 nutraceutical, x, 160, 271, 280, 311, 314, 315, 388 nutrients, viii, x, xii, 105, 107, 132, 142, 144, 146, 149, 150, 151, 152, 153, 154, 156, 161, 162, 169, 299, 301, 302, 307, 310, 314, 315, 384, 402, 407, 414, 417, 420, 421 nutrition, ix, xi, 106, 107, 161, 162, 163, 168, 212, 234, 235, 271, 272, 275, 289, 303, 351, 352, 383, 384, 385, 392, 395 nutritional, viii, ix, x, xi, 105, 108, 109, 125, 126, 130, 132, 155, 156, 158, 159, 160, 162, 163, 164, 165, 167, 168, 169, 172, 271, 273, 275, 290, 294, 299, 300, 313, 317, 342, 352, 353, 383, 384, 385, 386, 388, 390, 391, 394, 398, 399, 414, 428 nuts, 2, 17, 18, 19, 217, 218
Index P
Pacific, 22, 319 packaging, 295, 301, 312, 398, 400, 401, 402, 404, 423 pain, 395 Pakistan, 110, 113, 116, 117 palm oil, 194, 200 pancreas, 343 Papain, 273, 350 paralysis, 133 parameter, 177, 185, 186, 330, 379, 447, 449, 450 parasites, 212 parents, 167 Paris, 165, 207, 351 Parkinson disease, 134 particles, 186, 188, 189, 193, 194, 198, 208, 251, 319, 386, 444 passive, 184, 292 pasta, xii, 168, 218, 228, 233, 235, 237, 240, 384, 386 pathogenesis, 310 pathogenic, 212, 300, 303, 307, 309, 310, 408, 409, 412, 417, 424 pathogens, 197, 230, 288, 301, 302, 303, 306, 307, 309, 310, 317, 412, 414, 418, 424, 425, 426 pathophysiology, 318 pathways, 28, 267, 276, 285, 311, 408 peat, 177, 202 pedigree, 240 Pediococcus, 418 pellagra, 385 pepsin, 132, 273, 277, 278, 280, 281, 282, 351 peptide, 214, 218, 276, 291, 292, 293, 296, 344, 346, 347, 358, 359, 364 peptide chain, xi, 346, 352, 355, 364, 379 peptide nucleic acid (PNA), 214, 218, 239 peptides, ix, xi, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 315, 341, 342, 344, 345, 346, 347, 348, 350, 352, 354, 358, 361, 363, 365, 368, 369, 371, 373, 375, 377, 378, 379, 381, 409, 428 perception(s), 246, 248, 249, 256, 257, 263, 266, 268, 269 performance, 172, 177, 185, 187, 188, 190, 191, 193, 194, 195, 196, 199, 204, 255, 262, 269, 300, 351, 353, 399, 413, 443 peripheral blood, 284 peristalsis, 284 permeability, 283, 308, 328, 409 permeable membrane, 328 permit, 11, 21, 63
475
peroxide, 129 personal, 300 pesticides, 185, 188, 193, 254 petrochemical, 254 pH, xi, 20, 43, 125, 154, 177, 183, 185, 186, 187, 188, 191, 192, 194, 196, 273, 277, 280, 282, 301, 302, 304, 306, 310, 312, 313, 342, 343, 351, 352, 355, 356, 357, 358, 359, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 428, 429, 430, 431 phagocyte, 286 phagocytosis, 284 pharmaceuticals, 283, 288, 290 pharmokinetics, 276 phenol, 174, 183, 194, 197, 203, 206, 207 phenolics, vii, 1, 2, 10, 11, 13, 17, 18, 19, 63, 67, 72, 81, 82, 84, 135, 136, 137, 138, 139, 140, 153 phenotype, 306 phenylalanine, 109, 183, 197, 204, 276, 280, 349, 351, 352, 353, 409, 422, 423, 424 Philippines, 106, 396, 400, 406 phosphate(s), 132, 133, 165, 181, 189, 196, 277, 287, 291, 359, 436 phospholipids, 288 phosphorous, 190, 306 phosphorus, 129, 135, 160, 162, 166, 177, 196, 394, 428 photons, 251 physical interaction, 325 physical properties, 157, 185, 234 physicochemical, ix, 163, 166, 168, 170, 184, 271, 356, 361, 388, 389 physicochemical properties, ix, 163, 166, 170, 271, 315, 356 physiological factors, 246 physiology, 157, 169, 249, 267, 303, 318, 320 phytates, 130, 132, 153, 160, 306, 388 phytochemicals, 2 phytosterols, 136, 137, 138, 139, 140 pigments, 42, 47, 194, 197 pigs, 402 Pisum sativum, 79, 80, 107, 108, 116, 131, 139, 141, 157, 160, 164, 165, 166, 168, 169, 170 pitch, 208 pith, 182, 186, 195, 196, 201, 206, 207, 208 plant sterols, 159 plants, ix, 2, 10, 16, 18, 22, 25, 41, 42, 43, 47, 48, 50, 51, 53, 54, 59, 74, 80, 88, 98, 125, 161, 170, 184, 200, 212, 216, 217, 235, 236, 272, 273, 280, 283, 387, 388, 402, 408, 412, 424 plasma, 276, 285, 292, 457 platelet aggregation, 285 platelets, 276, 285
476
Index
pressure, viii, 13, 18, 105, 147, 148, 154, 162, 163, 167, 177, 218, 246, 279, 284, 285, 305, 380, 394, 395, 398, 441, 443, 452, 455 prevention, xiii, 188, 283, 285, 300, 310, 311, 408, 417, 424 prices, 172, 404 priming, 163 probe, 215, 218, 227, 260, 262, 334 probiotic(s), x, 271, 280, 288, 290, 291, 296, 299, 301, 303, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 419 producers, 199, 230, 294 production, viii, ix, x, xii, xiii, 44, 64, 106, 107, 128, 132, 156, 171, 173, 174, 175, 177, 178, 179, 180, 182, 183, 185, 189, 191, 194, 196, 197, 198, 199, 204, 211, 213, 239, 240, 251, 271, 272, 273, 274, 275, 276, 277, 281, 285, 286, 289, 293, 302, 304, 306, 310, 312, 342, 348, 352, 387, 388, 389, 390, 393, 394, 395, 396, 399, 401, 403, 404, 408, 413, 418, 427, 428, 429, 430, 431, 433, 434, 435, 436, 437, 438, 457 production costs, 342 production technology, 180 productivity, 429 program, 212 pro-inflammatory, 311 proliferation, 42, 286, 307 promote, 176, 284, 290, 404, 431, 436 protease inhibitors, 130, 132, 153, 155 proteases, x, xi, xiii, 130, 131, 274, 281, 282, 341, 351, 355, 427, 428, 429, 434, 437, 438 protective role, 302 protein family, 283 protein films, 423 protein hydrolysates, xi, 197, 272, 274, 283, 286, 293, 296, 341, 342, 344, 346, 351, 353, 357, 381 protein sequence, 278 protein structure, 332 protein synthesis, 128, 133, 284 proteinase, 277, 280, 282, 291 protein-protein interactions, 356, 373 proteolysis, 109, 272, 274, 275, 277, 282, 286, 295, 302, 367, 381 proteolytic enzyme, 272, 273, 275, 282, 291, 295, 342, 353, 357 protocol(s), 256, 261, 264, 276 protons, x, 323, 324, 325, 328, 329, 330, 332, 333, 334, 335, 336, 337, 338 protozoa, 283 Pseudomonas aeruginosa, 433, 438 psychoses, 254 public health, 245, 385
pleasure, 267 Poland, 191 polarity, 60 pollutants, viii, 171, 172, 178, 185, 200, 394 pollution, 191, 199, 255, 342, 401, 404 polyacrylamide, 195, 208, 346 polyamide, 84 polymer, 12, 47, 191, 192, 193, 194, 195, 308, 330 polymer chains, 193 polymerase chain reaction (PCR), 213, 214, 215, 216, 217, 218, 219, 222, 227, 228, 229, 230, 233, 234, 235, 236, 237, 238, 239, 240, 418 polymerization, 175 polymers, 2, 48, 192, 313 polymorphism(s), 213, 215, 216, 217, 236, 238 polypeptide(s), 134, 274, 363, 365, 379 polyphenols, 90, 126, 132, 145, 151, 153, 403, 442 polyphosphates, 181 polysaccharide, 125, 159, 191, 195, 325, 335 polyunsaturated fatty acids, 109 pools, 255 poor, xi, 106, 107, 129, 230, 253, 258, 276, 312, 365, 383, 385, 397, 403, 449 population, 126, 216, 217, 239, 244, 253, 257, 258, 267, 288, 301, 302, 305, 337, 338, 384, 390, 408, 424 population growth, 408 pork, 283, 288, 293, 295 porosity, 174, 176, 178, 179, 180, 181, 206 porous materials, 209 portability, 252, 253 positive correlation, 187 positron, 248, 251 positron emission tomography(PET), 248, 251, 252, 253 positrons, 252 postharvest, xii, 393, 395, 396, 397, 403, 408, 409, 423, 425, 426 potassium, 126, 177, 181, 182, 185, 187, 196, 313, 394, 400, 402, 425 potassium hydroxide (KOH), 181, 182, 205 potato(s), 42, 43, 168, 263, 336 poultry, 158 poverty, 384 power, 155, 260, 261, 262, 263, 264, 265, 278, 323, 398, 441 precipitation, 129, 403 prediction, 202, 443, 450, 455 preference, ix, 243, 244, 245, 254, 256, 257, 258, 261, 262, 263, 266, 267 preservative, 283, 287, 319, 409
Index
pulse, 74, 134, 169, 328, 330, 332, 334, 336, 337, 338 pulses, 106, 107, 157, 168, 324, 325, 328 pure water, 238, 324, 325, 327, 328, 330 purification, 84, 174, 178, 197, 343, 353, 438 pyrene, 395 pyrolysis, 177, 179, 180, 189, 198, 200, 201, 202, 203, 205, 207, 208, 209 pyrolysis reaction, 177 pyrophosphate, 213
477
Q
quality loss, 418 quantitative technique, 213 Quercetin, 3, 27, 33 query, 217
R
racial differences, 267 radiation, 154, 155, 160, 251, 398 radical formation, 285 radio, 251 radionuclides, 252 radiopharmaceuticals, 252 radius, 326, 335, 336 rainfall, 127, 128 rape, 181 rating scale, 261, 262, 264 ratings, 256, 263 raw materials, ix, 69, 179, 211, 233, 289, 396, 430 reaction time, xi, 179, 341, 348, 349, 350 reactive groups, 192 reactivity, 174, 181, 193 reagents, 24, 196, 429 real time, 13, 213, 218, 227, 228, 230, 235, 237, 239, 240 reality, 267 recall, 244, 254, 267 recalling, 258 receptor sites, 310 receptors, 245, 248, 249, 257, 266, 276, 284, 285, 290, 296 recognition, 22, 88, 246, 247, 255, 256, 310 recollection, 245 recovery, 186, 187, 190, 192, 194, 197, 201, 206, 254, 273, 293, 331, 337, 428 red blood cells, 353 reduction, 42, 109, 126, 127, 128, 133, 135, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 162, 179, 181, 183, 197, 200,
207, 234, 254, 260, 263, 287, 300, 303, 306, 307, 324, 365, 366, 385, 389, 394, 401, 413, 416, 417, 442 refining, 201 reflection, 265 refractory, 176 refrigeration, 394, 399, 414, 425, 426 regenerate, 178, 186, 200 regeneration, 174, 178, 186, 200 regional, 260 regression, 447, 449, 450 regulation(s), vii, viii, 211, 274, 275, 284, 285, 286, 297, 303, 311 regulatory oversight, 234 regulatory requirements, 212 rehabilitation, 398 rejection, 422 relationship(s), 2, 25, 60, 61, 249, 252, 261, 263, 267, 290, 303, 374, 380, 381 relaxation, x, 260, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338 relaxation process, 324 relaxation rate, 324, 325, 326, 327, 328, 329, 330, 333, 334, 336 relaxation times, 323, 324, 325, 328, 330, 331, 332, 333, 335, 336 relevance, ix, 174, 176, 177, 186, 196, 197, 230, 243, 244, 249, 254, 256, 323 reliability, 213, 255 renin, 284, 285 repair, 198, 414 repression, 424, 437 reproduction, 411 reserves, 165 residuals, 450 residues, viii, 40, 125, 171, 173, 179, 184, 187, 195, 197, 204, 273, 277, 281, 287, 344, 345, 347, 356, 363, 365, 367, 428 resins, 173, 193, 195, 196, 198, 199, 200, 205, 209, 409 resistance, xii, 39, 188, 193, 230, 283, 301, 303, 306, 310, 356, 388, 407 resolution, 228, 251, 252, 332, 334, 337 resources, 216, 236, 239, 254, 404, 405 respiration, xii, 133, 259, 261, 270, 393, 395, 408, 409 respiratory, 254, 255 response time, 266 responsiveness, 264 restaurants, 414 restriction enzyme, 213, 228 restriction fragment length polymorphis, 213, 229, 235
478
Index
saponin(s), 130, 131, 133, 134, 141, 153, 157, 162, 164, 167, 388 satisfaction, 211, 261 saturation, 178, 249, 258, 335, 338 scaling, 348, 404 science, x, 212, 234, 240, 289, 299, 300, 301, 320 scientific community, 385 scores, 308, 387, 421 sea level, 67 seafood, 277, 278, 279 search, 174, 300, 408, 429 seasonings, 258 secretion, 307, 347, 418 security, 234 sedative, 247, 276 selecting, 60, 62 selectivity, 174, 185, 192, 193, 195, 304, 441 selenium, 196 semantic memory, 254 semi-permeable membrane, 327 sensation, 246, 254, 258, 267 sensitivity, 10, 165, 202, 245, 249, 254, 255, 256, 257, 258, 259, 269, 410, 412, 413, 415 separation, vii, 1, 10, 11, 16, 17, 21, 25, 43, 48, 51, 174, 193, 197, 214, 218, 249, 273, 289, 346, 350, 352, 394, 404 sequencing, 213 series, viii, 61, 105, 109, 125, 191, 196, 237, 247, 254, 261, 263, 331 serine, 273, 437 serotonin, 106, 395 serum, 285, 286, 307, 332, 333, 359, 380, 442, 456 serum albumin, 380 sewage, 254 sex, 258 shape, 251, 387, 389, 390 shaping, 389 sharing, 249 shear, 155, 308 sheep, 228, 276 shelf life, xii, 309, 310, 311, 312, 313, 318, 384, 386, 407, 408, 409, 411, 417, 426 Shigella, 412 shock, xii, xiii, 312, 407, 408, 409, 420, 421, 422, 423, 424, 426 shortage, 384 shrimp, 191, 279, 292 shrubs, 64 shy, 189 sialic acid, 284 side effects, 300 sign, 374 signalling, 249, 284
retail, 288, 389 retardation, 375, 385, 409 retention, 10, 11, 16, 23, 24, 26, 27, 28, 29, 30, 31, 34, 41, 46, 51, 56, 60, 67, 88, 129, 195, 363, 410, 420, 426 reticulum, 327, 328 revenue, 199 reverse phase HPLC (RP-HPLC ), xi, 355, 358, 361, 362, 363, 366, 368, 369, 370, 371, 373, 374, 375 rheological properties, 317 rheology, 388 rhythm, 106, 259, 260 riboflavin, 314 ribonucleic acid, 284 ribosomal RNA, 229 rice, 42, 58, 108, 163, 178, 179, 180, 182, 187, 188, 195, 196, 202, 203, 204, 234, 235, 272, 286, 334, 338, 346, 428, 438 rice husk, 179, 180, 187, 188, 195, 204 right hemisphere, 265, 266 rigidity, 373 rings, 47 risk, 109, 214, 230, 244, 255, 276, 285, 300, 391 risk assessment, 230 risk factors, 285 RNA, 214, 227, 284 robustness, 62 Rome, 22, 161, 234, 292, 323, 324, 391 room temperature, 17, 18, 19, 20, 155, 314, 358, 394, 396, 399, 400, 430, 431 rotavirus, 307, 311 Royal Society, 159 rubber, 180, 182 rural areas, 385 rural population, 387 Rutin, 23
S
safety, viii, xii, 158, 211, 212, 217, 218, 230, 234, 289, 407, 417, 423 salinity, 135, 154 saliva, 248, 249 salmon, 278, 279, 295 salmonella, 230, 283, 307, 412, 424 salt(s), 126, 132, 248, 257, 302, 311, 312, 342, 381, 389, 429, 433, 436, 437 sample, vii, xi, 1, 19, 21, 35, 43, 61, 62, 67, 70, 73, 84, 85, 86, 88, 121, 140, 197, 213, 215, 228, 229, 246, 255, 327, 331, 332, 336, 355, 357, 359, 360, 369, 411, 413, 452, 455 sampling, 330 sanitation, 423
Index
signals, 61, 249, 252, 253, 260, 263, 266, 267, 335 silica, 179, 193, 343, 353, 399, 444 silk, 428 silver, 158, 193, 428 similarity, 216, 276 simulation, 240 sites, 10, 34, 62, 192, 205, 248, 253, 264, 265, 284, 285, 301, 325, 328, 388 size-exclusion chromatography, 352, 353 skeletal muscle, 282, 285, 291 skeleton, 24, 25, 26, 41, 44 skills, 244 skin, 13, 22, 48, 71, 72, 134, 192, 247, 250, 278, 279, 295, 442 sludge, 429, 430 small intestine, 274, 277, 292, 301, 302, 303, 311 smoking, 245, 400 smooth muscle, 276 society, 169 sodium, 24, 154, 177, 182, 185, 346, 359, 394, 429 software, 13, 213, 217, 229 soil, viii, 22, 67, 105, 128, 129, 135, 163, 185, 402 solid matrix, 325 solid phase, 19, 84 solid state, 181 solid waste, 186, 207 solubility, xi, 108, 125, 129, 160, 162, 249, 306, 355, 358, 360, 361, 363, 365, 379, 388, 389, 443, 446, 449, 452, 456 solvent(s), xiii, 10, 14, 18, 19, 20, 21, 22, 29, 35, 46, 52, 55, 56, 57, 58, 61, 63, 65, 66, 68, 69, 71, 72, 73, 77, 78, 79, 81, 85, 86, 324, 343, 441, 444, 446 solvent molecules, 324 somatic cell, 228 somatosensory, 248 Sorghum, 281, 293 sorption, 174, 177, 184, 186, 187, 188, 190, 191, 192, 193, 196, 199, 201, 202, 204 sorption process, 184, 187, 188 sounds, 260 South Africa, 395 South America, 74, 106, 402 Southeast Asia, 394 Soxhlet apparatus, xiii, 441, 452 soybean, 19, 47, 106, 107, 108, 112, 124, 125, 126, 127, 128, 129, 133, 135, 153, 156, 157, 160, 162, 163, 164, 165, 166, 167, 168, 169, 178, 188, 196, 217, 272, 280, 286, 288, 293, 295, 296, 297, 308, 385, 389, 428, 438, 443, 449 soybeans, 47, 74, 108, 125, 128, 129, 135, 154, 155, 161, 385 Spain, 114, 116 spastic, 133
479
specialization, vii speciation, 185, 192 species, viii, xiii, 42, 47, 58, 69, 80, 84, 105, 106, 108, 109, 125, 126, 133, 134, 142, 143, 144, 146, 149, 150, 151, 152, 154, 155, 156, 158, 170, 211, 212, 213, 215, 217, 218, 219, 220, 221, 222, 227, 228, 229, 230, 235, 236, 237, 238, 239, 240, 241, 300, 301, 302, 312, 314, 320, 409, 427, 428, 429, 431, 438 specific adsorption, 185 specific surface, 179, 190, 193 specificity, 229, 273 spectra analysis, 260 spectrum, 31, 33, 40, 44, 50, 51, 59, 174, 184, 197, 263, 283, 306, 419 speculation, 327 speed, 214, 253, 266 spherulite, 334 sphincter, 302 spices, xii, 2, 17, 23, 24, 51, 407, 409, 417, 425 spin, 252 spinal cord, 133, 251 sprouting, 127 Sri Lanka, 111 St. Louis, 348 stability, xi, 43, 62, 213, 290, 296, 313, 314, 315, 356, 360, 371, 372, 373, 374, 375, 377, 378, 379, 380, 381, 397, 429, 442 stabilization, 175, 373 stages, 177, 275, 344 standard deviation, 37, 61, 333, 450 standardization, 237, 240, 404 standards, vii, 1, 2, 10, 11, 21, 23, 24, 27, 29, 41, 47, 51, 57, 60, 61, 62, 63, 67, 75, 212, 290, 391 Staphylococcus, 277, 283, 295, 351, 412 starch, viii, 105, 109, 125, 126, 127, 128, 132, 149, 150, 154, 155, 157, 158, 159, 161, 162, 164, 168, 234, 281, 303, 313, 320, 334, 335, 336, 337, 356, 357, 402, 403, 429, 430, 437 starch granules, 334, 335, 337 starch polysaccharides, viii, 105, 109, 149, 150, 155, 303 statistical analysis, 262, 360 statistics, 230 sterols, 158 stimulant, 53 stimulus, 245, 246, 248, 249, 259, 260, 261, 266, 267 stock, 61, 359 stoichiometry, 330 stomach, 284, 301, 302, 303, 311 storage, viii, xii, 17, 22, 43, 63, 108, 166, 171, 172, 281, 282, 293, 308, 312, 313, 314, 315, 316, 318,
480
Index
survival, x, 129, 266, 300, 303, 309, 310, 312, 313, 314, 316, 317, 318, 319, 320, 408, 412, 413, 415 susceptibility, 164, 254, 295, 412, 417 suspensions, 334, 337 sustainability, 198, 201, 207 sustainable development, 172, 198, 405 sweets, 395 swelling, 334, 335, 337, 395 swelling process, 337 Switzerland, 391 symbiotic, 303 symptoms, 133 synapse, 250 synbiotic, x, 299, 300, 308, 314, 315, 316 syndrome, 311, 412 synthesis, xii, 128, 134, 213, 286, 289, 304, 307, 328, 407, 420, 422, 428, 431, 433, 434, 435, 436, 437, 457 Syria, 116 systemic change, 303 systemic immune response, 307 systems, x, xiii, 155, 186, 188, 192, 199, 217, 240, 248, 249, 253, 263, 273, 275, 286, 287, 290, 296, 319, 323, 324, 325, 327, 328, 330, 331, 334, 335, 337, 338, 352, 408, 414, 422, 423 systolic blood pressure, 277
389, 393, 395, 399, 400, 408, 410, 411, 414, 415, 417, 418, 420, 421, 422, 423, 424, 425 strain, xiii, 162, 281, 301, 303, 311, 314, 427, 428, 429, 431, 433, 434, 435, 436, 437 strategies, xii, 41, 159, 212, 233, 234, 254, 290, 301, 393, 396, 405 strength, 30, 185, 199, 234, 256, 263, 266, 268, 333, 336, 352, 356, 373, 388, 394, 409 streptococci, 301, 302 stress, 127, 128, 135, 165, 290, 300, 308, 313 stretching, 332 strong interaction, 452 structural characteristics, vii, 2, 323, 357 structural transformations, 356 students, 263 styrene, 268, 395 subgroups, 10, 11, 22, 23, 43, 47, 62 sub-Saharan Africa, 106 substance abuse, 254 substitutes, 300, 409 substitution, 24, 62, 228 substrates, xiii, 126, 252, 302, 303, 365, 414, 428, 429, 431, 433, 435, 436, 437 subtraction, 260 sucrose, viii, 105, 164, 304, 305, 402 Sudan, 106 suffering, 255 sugar, viii, 17, 28, 30, 31, 33, 39, 58, 59, 60, 77, 79, 80, 128, 133, 171, 173, 186, 188, 190, 197, 198, 200, 201, 257, 286, 302, 303, 305, 319, 385, 387, 390, 394, 400, 401, 402, 403, 406 sugar beet, 59, 186, 200 sugar industry, 188 sugarcane, 178, 180, 187, 195, 196, 197, 204 sulfate, 39, 42, 71, 72, 291, 346 sulfur, 108, 109, 132, 193, 388, 400 sulfuric acid, 182, 198, 204 sulphur, xi, 108, 109, 127, 129, 263, 383, 385 summer, 24 supercritical, xiii, 441, 443, 444, 446, 452, 455, 456, 457 supercritical carbon dioxide, 443, 452, 455 superoxide, 283, 286 suppliers, 63 supply, 67, 189, 212, 391, 398 suppression, 42, 133, 374 surface area, 174, 175, 176, 178, 179, 181, 183, 184, 185, 190, 191, 194, 196, 250 surface chemistry, 201, 207 surface properties, 198, 356, 360 surface tension, 373 surfactants, 356, 414, 424, 428 survivability, 301
T
Taiwan, 396 tannins, viii, 2, 48, 53, 105, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 153, 154, 155, 156, 160, 164, 165, 386 Tanzania, 189, 206 tar, 189, 198 targets, 215, 284, 291, 303 taxonomy, 237 tea, 39, 64, 98, 413 technological developments, 172 technology, xiii, 10, 172, 173, 188, 198, 199, 201, 206, 214, 218, 230, 263, 272, 273, 289, 301, 309, 313, 315, 350, 394, 395, 397, 398, 401, 405, 406, 408, 422, 423 temperature, xiii, 12, 13, 16, 18, 19, 20, 127, 128, 129, 135, 154, 159, 169, 177, 179, 181, 183, 186, 187, 189, 191, 194, 213, 214, 218, 255, 273, 305, 312, 314, 324, 325, 327, 330, 334, 337, 342, 348, 357, 358, 388, 398, 399, 400, 403, 411, 414, 421, 428, 441, 443, 444, 446, 451, 452 temperature dependence, 177 tension, 395 terpenes, 68 test-retest reliability, 247
Index
Thailand, 43 thalamus, 249 theory, 338, 340 therapeutic agents, 301 therapeutic benefits, 289 therapy, 303 thermal decomposition, 189 thermal degradation, 441 thermal energy, 398 thermal stability, 178, 218 thermal treatment, 181, 184, 342, 357 thermodynamic, 203 thermogravimetry, 205 threonine, 108, 109 threshold, ix, 213, 218, 243, 245, 246, 247, 255, 256, 257, 258, 259, 269, 270 threshold level, 245, 257, 259 thresholds, 246, 247, 256, 269, 270 thrombin, 131 thrombocytopenia, 230 time frame, 261 timing, 266 tincture, 85 tissue, xii, 213, 245, 250, 253, 286, 401, 407, 410, 420, 421, 422, 423, 424 Tocopherol, 167 tofu, 280 Tokyo, 270, 274 total product, 184 toxic effect, 133, 134, 230 toxic products, 133 toxicity, 132, 134, 191, 231 toxin, 135, 231, 309 TPA, 387, 390 trace elements, 402 trading, 399 training, 244, 254, 258, 262 traits, ix, 129, 158, 163, 169, 211, 233, 234, 236 transduction, 247, 248 transformation, 184, 320 transglutaminase, 379 transition, 192, 302, 334 transition metal, 192 translation, 331, 335 translocation, 307 transmission, 276 transport, 176, 202, 204, 276, 277, 292, 342, 417 transportation, viii, xii, 171, 172, 393, 395 trees, 22, 64, 66, 67, 70, 73 trend, 263, 267, 288, 289, 325 trial, 261 triangulation, 251 trichloroacetic acid, 357, 431
481
trichloroethylene, 188 trifluoroacetic acid, 16, 358 triglyceride(s), 307, 443, 456 trimer, 15, 66 trust, 212 trypsin, viii, 105, 130, 131, 132, 134, 135, 136, 153, 154, 155, 156, 157, 158, 160, 162, 273, 280, 281, 282, 287, 344, 351, 352, 388 tryptophan, xii, 106, 108, 109, 345, 384, 386, 395 tumor, 306, 395 tumor cells, 306 tumour growth, 319 tungsten, 195 turnover, 126 tyrosine, 109, 276, 343, 345, 431
U
UK, 165, 170, 291, 318, 387, 390 ulcerative colitis, 311 ultrasound, 162, 251, 252, 253 un-hydrolyzed, xi, 355 uniform, 156, 274, 357, 386, 397, 399 United Nations, 161, 317, 391 United States, 385, 399, 400, 457 University of Pennsylvania Smell Identification Test (UPSIT), 247, 256 uranium, 195 urban areas, 384 urea, 196, 209, 359 urinary tract infection, 311 USDA, 1, 2, 23, 48, 61, 89, 212, 345, 392 users, 404 UV, 10, 11, 13, 14, 15, 16, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 34, 36, 37, 38, 41, 42, 43, 44, 46, 47, 48, 49, 51, 55, 56, 57, 59, 61, 62, 63, 66, 86, 87, 88, 343, 353 UV absorption, 24, 30, 37, 44, 51, 62 UV absorption spectra, 30, 51 UV spectrum, 42, 44, 48, 49, 59
V
vacuum, 19, 288, 394, 396, 398, 399, 400, 405, 425 valence, 263 validation, 234, 237, 238, 240 validity, 195 valine, xii, 108, 384, 386 values, xiii, 20, 23, 37, 38, 118, 143, 151, 165, 177, 179, 187, 188, 214, 227, 246, 277, 278, 279, 280, 281, 282, 300, 327, 330, 331, 332, 334, 335, 336, 337, 338, 344, 345, 346, 347, 348, 349, 350, 365,
482
Index
water diffusion, 333, 336 water vapor, 188, 202, 409 wavelengths, 13, 344 weakness, viii, 105 web, 217 weight loss, 182, 189, 409 weight management, 284 weight ratio, 61 welfare, 212 well-being, 300 wells, 302 West Indies, 106 Western countries, 126 Western Europe, 396 wheat, xi, xii, 163, 188, 208, 217, 218, 219, 220, 230, 231, 232, 233, 234, 235, 236, 237, 238, 240, 241, 272, 281, 296, 355, 356, 372, 373, 377, 379, 380, 381, 383, 384, 385, 386, 387, 388, 389, 390, 428 white oak, 196 wild-type allele, 233 wine, 19, 83, 84, 233, 257, 261, 263, 264, 285, 394, 401, 405 winter, 39, 236 women, 385 wood, 177, 179, 181, 189 workers, 183, 189, 191 workflow, 217 World Health Organisation (WHO), 120, 161, 310, 311, 317, 388, 389, 391
367, 369, 374, 386, 410, 413, 422, 431, 441, 447, 448, 449, 450, 452, 455 vapor, 268 variability, 125, 129, 135, 185, 194, 199, 215, 246, 388 variable(s), 132, 244, 247, 255, 256, 257, 258 variance, 345, 449, 450 variation, 127, 169, 177, 234, 256, 259, 262, 446, 449, 450 varieties, viii, 21, 22, 29, 42, 43, 56, 57, 64, 70, 74, 78, 79, 80, 84, 101, 105, 108, 109, 110, 113, 114, 117, 133, 143, 155, 161, 165, 166, 168, 212, 233, 234, 235, 240, 275, 389, 390, 402, 404, 405 vasodilator, 285 vector, 327 vegetable oil, viii, 171, 173, 197, 385, 443, 446, 456, 457 vegetables, viii, xii, xiii, 2, 17, 23, 24, 28, 36, 38, 42, 50, 57, 58, 80, 81, 82, 83, 280, 285, 395, 406, 407, 408, 409, 410, 411, 417, 418, 420, 422, 423, 424, 425, 426 vehicles, 318, 385 velocity, 188, 326, 328, 347 velvet, 109, 134, 135 Venezuela, 110 versatility, 192 virus(es), 212, 237, 283 viscera, xiii, 427, 428, 429, 430, 431, 432, 433, 437, 438 viscosity, 318, 373, 388 visual stimuli, 260 vitamin A, 130 vitamin B1, 132 vitamin B12, 132 vitamin C, 282, 285, 394, 403 vitamin D, 130 vitamin E, 130, 131 vitamins, 74, 384, 394, 402 vocabulary, 258 volatilization, 175, 176 vomiting, 132
X
xanthones, 2, 59
Y
Y-axis, 265 yeast, 389, 390, 401, 429, 430, 431, 433, 434, 436 yield, xii, 34, 126, 129, 161, 162, 165, 166, 167, 169, 178, 189, 195, 205, 247, 273, 277, 311, 393, 395, 401, 434, 443, 452, 455 yin, 64
W
warrants, 290 Washington, 392 waste treatment, 201 wastewater, 186, 188, 195, 196, 197, 200, 201, 202, 204, 206, 207, 208 wastewater treatment, 195, 207 wastewaters, viii, 171, 172, 174, 188, 192, 201, 203, 208, 429, 430 water absorption, xii, 129, 384, 386
Z
zeolites, 324 zeta potential, 177 zinc, 135, 164, 181, 182, 187, 190, 191, 192, 202, 206, 207, 316, 384, 394

Food Science and Technology - New Research

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Food Science and Technology - New Research

Uploaded by

Copyright:

Available Formats

FOOD SCIENCE AND TECHNOLOGY: NEW RESEARCH

FOOD SCIENCE AND TECHNOLOGY: NEW RESEARCH

Nova Science Publishers, Inc.

Copyright 2008 by Nova Science Publishers, Inc.

Published by Nova Science Publishers, Inc.

Lorenzo V. Greco and Marco N. Bruno

Lorenzo V. Greco and Marco N. Bruno

Lorenzo V. Greco and Marco N. Bruno

ISBN 978-1-60456-715-1 2008 Nova Science Publishers, Inc.

Long-Ze Lin and James M. Harnly

Table 1. Flavonoid functional groups*

5 OH OH OH OH OCH3 OCH3 OCH3

4 OH OH OCH3 OH OCH3 OCH3 OCH3 OH OH OH OH OH OH OH OH OH OH OCH3 OH OCH3

OCH3 OCH3 OCH3

OH OH OH OH OCH3 OCH3 OCH3 OH OH OH OH OH OH OH OH OH OH OH OH OH

OH OH OCH3 OCH3 OCH3 OCH3 OCH3 OH OH OH OH OH OCH3 OH OH

6 272 272 286 288 274

2' 3' 4' B 5' 6'

Hydroxybenzoic acids (C6-C1)

Figure 1. (Continues on next page.)

Anthocyanidins (R=OH for the common ones) Anthocyanins (R=Ogly) (C6-C3-C6)

Proanthocyanidins (4-8, or 4-6 C-C bonds, or additional C2-O-C7 bond) (C6-C3-C6)

R1 R Flavan-3-ols (Catechins) (R or R1=OH)

Stilbenes (e.g. resveratrol) (C6-C2-C6)

FIGURE 1. STRUCTURAL SKELETONS OF THE FLAVONOIDS AND OTHER PHENOLIC COMPOUNDS.

O HO OR O Malic acid (R=H) (MW=134)

OH O Tartaric acids (MW=150) in 3 forms: 2R, 3R or 2S,3S or 2R, 3S (meso-)

OH Shikimic acid, MW=174 COOH CH2 COOH

Malonic acid, MW=104

Isovaleric acid, MW=102

D-glucaric acid and its isomers, MW=210

Tiglic acid, MW=100

Xylose, other pentose MW=150

Glucose, other hexose, MW=180

OH Glucuronic acid, other oxyhexoses, MW=194

Ellagic acid, MW=302

Rosmarinic acid (MW=360)

Long-Ze Lin and James M. Harnly

LC-MS Profiling and Quantification of Food Phenolic Components ...

Long-Ze Lin and James M. Harnly

Figure 3. Standardized phenolic profiling method.

LC-MS Profiling and Quantification of Food Phenolic Components ...

0 250 300 350 400 450 500 550 600 nm

0 220 240 260 280 300 300 340 360 380 nm

Long-Ze Lin and James M. Harnly

5 10 15 DAD1 D, Sig=520,16 Ref=700,100 (LIN\ETEST-2\ETEST136.D) m AU 6 4 2 0

* References [2,43]. ** As a shoulder in the range indicated in ( ).

Anthocyanins 1 6.01 2 7.99

Caffoeylquinc acids 3 11.10

Glycosylated dihydrochalcones 18 33.04 569/567

Identified with standard. b: not positively identified.

Long-Ze Lin and James M. Harnly

LC-MS Profiling and Quantification of Food Phenolic Components ...

2.3. Sample Preparation

Long-Ze Lin and James M. Harnly

LC-MS Profiling and Quantification of Food Phenolic Components ...

2.4. Additional Preparation Methods

Long-Ze Lin and James M. Harnly

2.5. Detection limits

LC-MS Profiling and Quantification of Food Phenolic Components ...

3. PHENOLIC PROFILES AND COMPOUND IDENTIFICATION

Long-Ze Lin and James M. Harnly

F uji apple skin