You are on page 1of 138

NHNG QUY TC AN TON TRONG PHNG TH NGHIM VI SINH VT

Thao tc an ton l yu cu cc k quan trng i vi th nghim vi sinh vt. Vi sinh vt c kch thc nh b m mt thng khng nhn thy c. Trong qu trnh lm th nghim, chng ta thng thao tc vi s lng rt ln v m c t bo vi sinh vt. Bn cnh nhng ging, loi vi sinh vt c ch l nhng ging, loi c kh nng gy bnh v c hi i vi sc khe con ngi. Mt khc, trong qu trnh th nghim chng ta cng phi s dng nhiu loi ha cht, trong c nhng ha cht c c tnh. Chnh v th, ngi lm th nghim trong phng th nghim vi sinh vt cn tun th cc qui tc c bn sau y: 1. Nhng qui nh chung: - Nhng ngi khng c nhim v khng c vo phng th nghim. - Khi vo phng th nghim phi mc o Blouse (ci khuy kn), ct tc gn gng. - Khng ni chuyn n o, gi gn trt t. Khng n ung, ht thuc trong phng kim nghim. - Mang khu trang, gng tay khi thao tc vi vi sinh vt v ha cht. - Trn bn th nghim ch vt dng th nghim, s ghi chp, giy ghi chp. Tt c cc vt dng c nhn, o khoc, ti xch, sch v, phi ng ni qui nh. - Trc v sau khi kt thc th nghim, phi st trng mt bn bng cc ha cht st trng cn 70% hoc dung dch dit khun khc (lysol 5%, amphyl 10%, chlorox 10%) chun b sn v lau kh bng giy v sinh. - Cn ghi ch tn chng, ngy thng th nghim, ngi l th nghim ln tt c cc hp petri, ng nghim, - Tuyt i khng canh trng hay vt phm c vi sinh vt dy ln qun o, sch v v dng c c nhn. ng thi cng phi ch bo v da v qun o khi b dnh ha cht v thuc nhum. - Cn thn khi thao tc vi n cn hoc n Bunsen. Tt ngn la khi cha c nhu cu s dng hoc ngay sau khi thc hin xong mi thao tc. Tuyt i khng dng n cn mi la n cn. - S dng qu bp cao su khi thao tc ng ht nh lng (pipette), Tuyt i khng ht bng ming. - Khng t s dng trang thit b, dng c trong phng th nghim khi cha c hng dn c th. S dng theo hng dn, ht sc thn trng, trnh lm v v h hng. - Tt c cc vt liu b nhim bn, mi trng cha hoc nhim vi sinh vt cn phi c kh trng trc khi vt b hoc s dng li. Cc dng c, bnh cha nhim vi sinh vt cn c ngm vo dung dch dit khun (nc javel) trc khi ra v ti s dng. - Kt thc th nghim phi v sinh cc thit b, dng c s dng theo ng qui trnh v sp xp vo ng ni qui nh. - Ra tay sch s trc khi ri phng th nghim. - Tt c cc trng hp tai nn phi bo co cho cn b hng dn th nghim kp thi v x l. 2. Mt s lu vi sinh vin nhm t kt qu tt trong thc hnh vi sinh vt a. Trc khi thc hnh - Cn c bi trc ni dung ton bi hnh dung c khi lng cng vic s lm. - Hiu r nguyn tc, mc ch ca cc th nghim. - c cn thn cch tin hnh th nghim b. Trong gi thc hnh: - Ghi ch cn thn nhng cn dn ca ging vin v cc thao tc v qui trnh thc hnh. - Thc hin th nghim theo ng hng dn ca ging vin. - Trong qu trnh th nghim c nhng thao tc, cng on khng r cn hi li ging vin hng dn. Trang 1

- Ghi chp cn thn cc ch quan trng ca th nghim v kt qu ca mi th nghim. c. Kt thc thc hnh: - Lm bo co thc hnh theo cc yu cu trong mc 5 ca tng bi th nghim v theo yu cu ca ging vin.

Trang 2

BI 1 THIT B, DNG C PHNG TH NGHIM VI SINH VT V CC PHNG PHP TIT TRNG VI SINH VT
1. Thit b phng th nghim vi sinh vt hc 1.1.T sy (vacuum oven): to t 60oC 200oC, dng sy kh, kh trng cc loi dng c chu c sc nng kh, ch yu l dng c thy tinh, kim loi. Ty vo i tng cn kh khun m sy ch to v thi gian khc nhau, thng sy 160oC/2 gi, hoc 180oC/30 pht.

Hnh. T sy 1.2.T m (incubator or etuve): to t 20oC 60oC, c ch n nh nhit , c s dng nui cy vi sinh vt ti nhit thch hp cho s sinh trng v pht trin ca chng. Ty vo i tng nui cy m to khc nhau vi sinh vt c th pht trin tt. V d: Coliform 30oC/24h 48h, E. coli thch hp 44oC/24h 48h. 1.3. T lnh hay t mt (freezer): dng bo qun mi trng pha ch, ging vi khun, cc ch phm sinh hc (vaccin, huyt thanh, a giy khng sinh,), ha cht, thuc th d phn hy nhit thng. 1.4. Ni hp t (Autoclave): Thit b ny cp nhit bng hi nc p sut cao (hi nc bo ha p sut cao), c s dng hp kh trng mi trng, mt s nguyn liu v dng c th nghim. Ty i tng m s dng ch nhit v p sut thch hp, thng dng 121oC/1 atm/ 15 pht. Hay 127oC/1.5 atm/30 pht vi mi trng t, 117oC/ 0.8 atm/15 pht vi mi trng cha nhiu ng, mi trng sa Th tch mi trng nui cy (ml) 25 50 100 250 500 1000 2000 4000 Thi gian hp tit trng ti thiu (pht) 20 25 28 31 35 40 48 63

Trang 3

Ch s p k ca 0,0 ni p sut (atm) To si nc (oC) 100 T si nc ( F)


o o

0,2 105 221

0,4 110 230

0,5 112 234

0,6 114 237

0,7 116 241

0,8 117 243

0,9 119 246

1,0 121 250

1,5 127 261

2,0 134 273

212

Hnh. Ni hp cao p (Autoclave) 1.5. Cn phn tch in t (analytical balance): cn trng lng t 100g 200g. chnh xc 10-4 g. Cn k thut (technical balance): chnh xc 10-2g. Dng cn ha cht, mi trng.

Hnh. Cn phn tch (A) v cn k thut (B) 1.6. T cy v khun c n cc tm (UV) (flux laminar ): C khng gian v trng c s dng thao tc vi vi sinh vt nh h thng n t ngoi v b phn thi kh v trng.

Hnh. T cy v trng

1.7. My ly tm (centrifuge): Dng tch cc cht cc pha rn-lng ra khi nhau nh Trang 4

tch sinh khi t bo ra khi mi trng nui cy, tch hng cu, enzyme,

Hnh. My ly tm 1.8. My lc (shaker): Thit b dng nui cy, nhn ging vi sinh vt bng cch lc cc bnh nui cy theo cc chiu khc nhau (lc vng v lc ngang) mt cch u n tng lng oxy ha tan trong mi trng.

Hnh. My lc 1.9. Knh hin vi (microscope): c vai tr rt quan trng nghin cu vi sinh vt. Dng nghin cu, quan st t bo vi sinh vt v c im hnh thi, sinh l nh vo kh nng phng i ca knh (s gii thiu chi tit bi s dng knh hin vi).

Hnh. Knh hin vi quang hc 1.10. My o pH (pH meter): o pH dung dch, mi trng nui cy vi sinh vt

Trang 5

Hnh. My o pH bn (A), my o pH cm tay (B) 1.11. My ct nc (single/ double water stills): dng ct nc.

Hnh. My ct nc 1.12. B n nhit (water bath): cha nc v c ci t nhit nht nh n nh nhit cho nhng th nghim cn s n nh v nhit .

Hnh. B n nhit 1.13. Ni ln men (fermenter/Bioreactor): thit b ln men nui cy vi sinh vt trong iu kin ti u ha v iu chnh c cc thng s mi trng nui cy

Trang 6

Hnh. Ni ln men 1.14. Cc thit b khc nh: my m vi sinh vt, my quang ph, sy ng kh, 2. Dng c - Dng c thy tinh: c nhiu loi vi nhiu kch c khc nhau nh bnh tam gic, ng nghim, a petri, lam knh, a thy tinh, que trang, ng ong, cc ong, bnh nh mc, yu cu phi sch, trong, trung tnh. Trc khi dng ng mi trng phi c sy kh, lm nt bng v kh trng trong t sy kh. - i vi dng c mi: cn ngm nc hoc dung dch H2SO4 long trong 24 gi. Sau mi ra li bng nc hoc x phng nhiu ln cho n khi pH trung tnh. - i vi dng c qua s dng cn cha mi trng v vi sinh vt, cn kh trng ri mi ra sch bng x phng, phi v sy kh. - i vi dng c b bm bn, cn ngm thm vi dung dch sulfocromic vi gi, sau ra li bng nc sch. - Dng c sch khi a ln nh sng khng c vt m v vt bn. - Cc dng c khc: nh n cn, gi ng nghim, que cy, kp, ko, bm tim nha, u tp, bp in, 3. Cc phng php kh trng vi sinh vt * Nguyn tc Dit trng hay kh trng l phng php nhm c ch hoc loi b, cui cng l git cht cc vi sinh vt khng mong mun. Ngi ta thng kh trng bng 2 phng php chnh: 3.1. Phng php l hc * Nhit kh. - i vi dng c cy kim loi, i khi c thy tinh, phng php thng dng l t: t trc tip trn ngn la hoc nhng cn t. - i vi dng c thy tinh c th gi giy v sy 160oC/ 1 gi. Dng c a vo sy phi chu c nhit cao v khng buc dy nha hoc thun. * Nhit m. - Phng php luc: cho vt kh trng vo nc si, nhit s thm nhanh vo mu vt lm cho protein ng kt, dn n git cht vi sinh vt. Tuy nhin, ch dit t bo sinh dng, bo t vn cn. - Phng php Pasteur: Ch dit vi khun gy bnh ( k sinh ), khng dit bo t v vi khun hoi sinh. Phng php ny khng dit hon ton mm bnh m ch chn mt vi vi sinh vt i khng mnh nht. V vy, phi bit nhit v thi gian dit trng cho tng loi vi sinh vt. - Phng php Tyndall: un cch thy nhiu ln nhit 70- 80oC, mi ln 30-60 pht v lin tip trong 3 ngy lin. - Phng php hi nc bo ha p sut cao: dng autoclave. * Dit trng bc x. - Tia t ngoi hay UV: ch st trng b mt, khng xuyn su vo mu vt. - Tia m cc: dng trong dit trng dng c gii phu, thuc, thc phm. Vt kh Trang 7

trng phi bao gi kn. * Dit trng bng sng. Sng ngn khi tc ng vi cng v thi gian thch hp c th ph v t bo vi sinh vt, lm cht cc t bo sng. * Dit trng bng cch lc. - Dng c lc thng l nhng mng xp bng s, aminate, cellulose, thng l nhng vt phm lng khng kh trng bng nhit c. - i vi kh trng khng kh th thit b kh trng l mt my lc kh c trang b mng lc hay hp ph vi khun. 3.2. Phng php ha hc. - Cht st khun ngoi da: x phng, cn, iode, phm mu (phn ln phm mu c tc dng st khun nh: xanh methylene). - Cht dit khun v ty u: phenol, formol, hp cht Clor, 4. Nhng im cn lu - Khng lm vn bng khng thm khi lm nt y cho cc dng c nh ng nghim, bnh tam gic. - Khi nt bng gn vo ui pipette, cht phi va , phi kim tra kh nng ht dung dch ca pipette sau khi nt xong. - Kch thc nt y ca ng nghim, bnh tam gic phi ph hp, tin dng. 5. Bo co thc tp - Trnh by yu cu ca vic bao gi dng c nui cy vi sinh vt? - Cng dng v cch s dng cc dng c, thit b phng th nghim vi sinh vt? - Trnh by phng php tit trng dng c v mi trng nui cy vi sinh vt?

Trang 8

BI 2 PHNG PHP PHA CH MI TRNG NUI CY VI SINH VT


1. Nguyn tc Cc cht dinh dng l nhng hp cht tham gia vo qu trnh trao i cht ni bo. Mi trng dinh dng l hn hp gm cc cht dinh dng v cc cht c nhim v duy tr th oxi ho kh, p sut thm thu ca t bo v s n nh pH ca mi trng. Yu cu ca mi trng dinh dng: c cc cht dinh dng cn thit; c pH thch hp; c nht nht nh; khng cha cc yu t c hi; hon ton v trng m bo s pht trin n nh ca vi sinh vt. Phn loi mi trng dinh dng: ngi ta da trn cc c s khc nhau phn loi mi trng - Phn loi theo ngun gc + Mi trng t nhin: dch nc chit tht, nc chit khoai ty, mu ng vt... + Mi trng nhn to: Czapeck, Hansen, EMB... + Mi trng bn t nhin: Potatoe glucose agar (PGA), gi u ng... - Phn loi theo trng thi vt l: + Mi trng lng: dng lng, khng c agar hay cc cht lm gi th khc trong thnh phn mi trng + Mi trng rn: mi 1000ml mi trng c 15-20g agar hay cc cht lm gi th + Mi trng bn lng (bn rn): mi 1000ml mi trng c 3-5g agar hay cc cht lm gi th khc. - Phn loi theo cng dng: + Mi trng phn lp + Mi trng tng sinh + Mi trng lu gi ging + Mi trng th nghim sinh ha Mi trng nui cy vi sinh vt c pha ch theo nguyn tc: - Da trn c s nhu cu v cc cht dinh dng v kh nng ng ho cc cht dinh dng ca tng loi sinh vt. - m bo s cn bng v p sut thm thu gia mi trng v t bo vi sinh vt nn cn iu chnh t l v nng cc cht trong thnh phn mi trng. - m bo cc iu kin ho l cn thit cho cc hot ng trao i cht ca vi sinh vt. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Bnh tam gic Phu thy tinh a khuy thy tinh n v tnh Ci Ci Ci Ci Ci S lng 1 5 1 1 1 Trang 9 Ghi ch

STT 6 7 8 9 10 STT 1 2 3 4 5

Tn dng c, thit b mi nhm (3 sinh vin) Cc 100ml Cc 500ml a cn nha Bnh tia Bp in Dng c dng chung My o pH Cn k thut Cn phn tch Ni hp cao p T sy

n v tnh Ci Ci Ci Ci Ci n v tnh Ci Ci Ci Ci Ci

S lng 3 1 3 1 1 S lng 1 1 1 1 1

Ghi ch

Ghi ch

2.2. Mi trng v ho cht * Mi trng nui cy vi khun: Mi trng cao tht - peptone - Cao tht: 3g - Peptone: 10g - NaCl : 5g - Agar: 20g - Thm nc ct cho 1000ml. Lc u, iu chnh pH=7,00,2 Nu si nh tan agar, phn phi mi trng vo cc dng c kh trng 121oC trong 30 pht * Mi trng nui cy nm men: Mi trng Hansen - Glucose, maltose (hoc ng knh ): 50g - Peptone:10g - K2HPO4: 3g - MgSO4.7H2O : 2 - 5g - Agar: 20g - Thm nc ct : 1000ml Lc u, iu chnh pH=6,00,2 Trang 10

Nu si nh tan agar, phn phi mi trng vo cc dng c kh trng 121oC trong 30 pht * Mi trng nui cy nm mc: Mi trng Czapek - Saccarose: 30g - NaNO3: 30g - K2HPO4:1 g - MgSO4: 0,5g - FeSO4: 0,01g - Thch (agar): 20g; - Thm nc ct : 1000ml pH = 6,00,2 kh trng 1atm / 30 pht. * Mi trng nui cy x khun: Mi trng Gauze 1 - Tinh b tan: 20g - K2HPO4: 0,5g - MgSO4.7H2O: 0,5g - KNO3: 1,0g - NaCl : 0,5g - FeSO4 : 0,1g - Agar: 20g - Nc ct : 1000 ml pH = 7,2 7,4 kh trng 1atm/30 pht * Mi trng nui cy to Mi trng Tamiya - KNO3: 5,000 - MgSO4: 2,500 - KH2PO4: 1,250 - FeSO4.7H2O: 0,003 - EDTA: 0,037 - Vi lng A5: 1 ml - Agar: 20g - Nc ct 1.000 ml Thnh phn vi lng A5 - H3BO3: 2,860 - MnCl2.4H2O: 1,810 - ZnSO4.7H2O: 0,222 - MoO3: 176,4 Trang 11

- NH4VO3: 229,6 - Nc ct 1.000 ml 2.3. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc 3. Tin hnh th nghim Lm mi trng thc hin vic phn lp, nhn ging, gi ging vi sinh vt, ng thi nui cy v nghin cu cc c im sinh hc ca chng. Cc bc ch to mi trng dinh dng: 3.1. Chun b dng c tt c cc dng c cn s dng trong sut qu trnh pha ch mi trng phi c chun b y . Cc dng c c ra sch, trng bng nc ct, sy kh trc khi s dng. 3.2. Cn ong ha cht pha ch mi trng Cn, ong tht chnh xc tng thnh phn mi trng v pha ch theo ng trnh t hng dn trong ti liu. Dng a cn nha hoc cc thy tinh cn ong cc loi ha cht d ht m 3.3. Phi ch to mi trng nui cy - Cc thnh phn ca mi trng c ha tan ring r trong nc ct trc khi phi trn. - Phi trn cc thnh phn theo trnh t nht nh trnh s tng tc trc tip ca cc thnh phn c th phn ng to kt ta vi nhau. Phi trn da trn nguyn tc th tch tng dn. - Sau khi phi ch cc thnh phn, cn tin hnh lc mi trng qua giy lc, bng thm nc (i vi mi trng lng) hoc vi mn (i vi mi trng c) lm trong mi trng, m bo vic quan st vi sinh vt c d dng. - i vi mi trng rn, sau khi phi trn cc thnh phn, phi tin hnh nu si mi trng lm tan hon ton agar trc khi phn phi vo dng c cha. 3.4. iu chnh pH ca mi trng - Mun iu chnh pH ca mi trng c th dng HCl 10 % hay NaCl 10 %. Ngoi ra c th dng mt s ho cht khc nh: H3PO4, H2SO4, KOH, NaHCO3, Na2CO3 ... - Mun kim tra pH ca mi trng nn dng my o pH (pH-metre). Phng php ny nhanh nhy v cho chnh xc cao. Trong phng th nghim c th dng ch th mu xanh bromotomol hay giy qu o pH. Phng php ny tin li, nhanh nhng khng cho chnh xc cao. 3.5. Phn phi mi trng vo dng c cha - Mi trng sau khi pha ch xong thng c phn phi mi trng vo ng nghim, bnh tam gic. Trnh t phn phi gm cc bc sau: + Mi trng cn c un cho ho cht lng ri qua phu thu tinh vo cc dng c. + Tay tri gi dng c cha mi trng, tay phi kp nt bng v ko ra. + Nhanh tay rt mi trng vo dng c v y nt bng li. - i vi ng nghim: Nu dng mi trng lm thch nghing th lng mi trng cn c phn phi chim 1/4 th tch ca ng nghim. Nu lm thch ng th lng mi trng cn c phn phi t 1/2 - 1/3 th tch ng nghim. - i vi bnh cu hay bnh tam gic, lng mi trng c phn phi chim 1/2 1/3 th tch ca bnh. - i vi a petri, mi trng ch c phn phi vo a sau khi hp tit trng. Th tch mi trng khong 12-15ml mi a, lp mi trng thch dy khong 2mm. - Vit nhn mi trng trn dng c cha, bao gm cc thng tin: Trang 12

+ Tn mi trng + Ngy kh trng + Ngi pha ch 3.6. Kh trng mi trng - Tu theo tnh cht v iu kin c th ca tng loi mi trng m c ch v phng php kh trng khc nhau. Mi trng thng c hp tit trng bng ni p cao p. Thi gian hp tit trng mi trng nhit 121oC ph thuc vo lng mi trng c phn phi vo dng c cha (xem bi 1). - i vi mi trng c cc thnh phn d b bin tnh nhit cao (vitamin, cht khng sinh, cht kch thch sinh trng...), cn hp tit trng mi trng trc, sau b sung cc thnh phn ny sau khi hp xong. - Mt s loi mi trng khng c hp tit trng theo quy nh ca nh sn xut (v d: mi trng Selenit cystine broth, Xylose lysin deoxycholate agar, Chromocult coliform agar...), cn chun b nc ct v trng trc, sau pha ch v s dng ngay. 3.7. Lm thch nghing, thch ng, thch vo a petri - Lm thch nghing: cn tin hnh ngay sau khi kh trng mi trng va kt thc v mi trng cha ng c. ng nghim c t nghing c nh trn gi . Phn nh nghing phi cch nt y 3-5cm. Phn y phi c mt phn thch ng 0,5-1cm. - Lm thch ng: t cc ng nghim c mi trng lm thch ng vo gi , yn cho n khi mi trng ngui v ng c. - thch vo a petri: mi trng v trng cha trong ng nghim hoc bnh tam gic c rt vo phn y ca a petri. Ton b quy trnh thch vo a petri u thc hin trong t cy v trng hoc trong phm vi v trng ca ngn la n cn. 3.8 Kim tra v trng v bo qun - Mi trng sau khi pha ch xong, c t iu kin nhit phng 24 gi. Sau thi gian ny kim tra v trng ca mi trng bng cch quan st trng thi mi trng. - Mi trng cha dng cn c bo qun ch mt, hn ch tc dng ca nh sng, nhit t 0 - 50C v khng mi trng b kh. Thi gian lu tr ti a l 15 ngy. - Trc khi s dng, kim tra v khun ca mi trng, ngi ta thng t chng vo t m 370C, trong 48 - 72h. Sau ly ra quan st, loi b cc ng c vi sinh vt pht trin v ch s dng nhng ng nghim, nhng a petri c mi trng t yu cu.

a thch

Thch ng

Canh trng

Thch nghing

Trang 13

Hnh. Mt s dng mi trng trong ng nghim v hp petri 4. Nhng im cn lu - Khi pha ch mi trng rn hoc bn rn, thnh phn agar trong mi trng c th b sung sau khi iu chnh pH ca mi trng. - i vi mi trng rn hoc bn rn, cn phi nu si lm tan agar hon ton trc khi phn phi vo dng c cha. - Khi iu chnh pH, cn dng tng lng nh cc dung dch iu chnh (dung dch NaOH, HCl) trnh vt qu pH cn. pH mi trng cn c kim tra trc v sau khi hp tit trng. - Cc thao tc phn phi mi trng vo dng c phi nhanh, gn, kho lo mi trng khng dnh ln ming dng c hoc nt bng v vic phn phi cn thc hin xong trc khi mi trng b ng c. 5. Bo cc thc tp - Trnh by khi nim mi trng v phn loi mi trng nui cy vi sinh vt? - Trnh by quy trnh pha ch mi trng nui cy vi sinh vt? - Yu cu ca mi trng trong a petri, ng nghim thch nghing v thch ng? - Gii thch to sao khng phn phi mi trng vo a petri trc khi kh trng? - a petri cha mi trng trc khi cy vi sinh vt nn t p hay nga? Ti sao?

Trang 14

BI 3 PHNG PHP NUI CY VI SINH VT


1. Nguyn tc Qu trnh nui cy vi sinh vt gm 2 khu: cy v nui. Cy l nhng thao tc chuyn vi sinh vt t mi trng ang sng sang mi trng thun li hn cho s pht trin ca chng. Nui l qu trnh m bo v duy tr nhng iu kin thun li nht cho s hot ng v pht trin ca vi sinh vt. Hai khu ny lun gn b vi nhau trong qu trnh nghin cu v ng dng vi sinh vt. * Mc ch ca vic nui cy - Pht hin s c mt ca vi sinh vt trong cc nguyn liu v vt phm cn nghin cu. - Tin hnh vic nhn ging cc vi sinh vt mt cch nhanh chng. - Bo tn cc ging vi sinh vt thun khit. - Nghin cu cc c tnh sinh hc v s pht trin ca tng loi vi sinh vt. * Nguyn tc nui cy vi sinh vt - Mi thao tc nui cy u phi thc hin trong iu kin v trng trnh tp nhim cc vi sinh vt khng mong mun t mi trng ngoi. - Mi trng v dng c nui cy u phi c kh trng trit . - Duy tr tt cc iu kin nui cy (nhit , m, nh sng, oxy...) vi sinh vt pht trin thun li. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 STT 1 2 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml Cc 500ml n cn Que cy Bnh tia Dng c dng chung T m T cy v trng n v tnh Ci Ci Ci Ci Ci Ci Ci n v tnh Ci Ci S lng 1 1 3 1 1 1 1 S lng 1 1 Ghi ch Ghi ch

2.2. Mi trng, ha cht - Mi trng nui cy vi sinh vt: c chun b bi 2, bao gm cc loi + Mi trng cao tht pepton: nui cy vi khun + Mi trng Hansen: nui cy nm men + Mi trng Czapeck: nui cy nm mc - Cn 96o Trang 15

2.3. Chng ging vi sinh vt - Nm mc: Aspergillus niger, Aspergillus oryzea - Nm men: Saccharomyces cerevisiae, Saccharomyces vini - Vi khun: Escherichia coli, Bacillus subtilis 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. Cy truyn vi sinh vt trn mi trng lng Cy truyn l phng php ly vi sinh vt t ng nghim ny sang mt ng nghim khc. Trc khi cy, tin hnh dn nhn ghi: tn loi vi sinh vt, ngy cy vo thnh ng nghim bn di nt ng nghim. a. Cy truyn bng pipet Pasteur - Kh trng pipet pasteur qua ngn la n cn - Tay tri cm ng ging gc, dng ngn tay t phi m nt bng ca ng ging, h v xoay ming ng ging qua ngn la n cn st khun. - Cho pipet pasteur vo ng ging lng ly dch vi khun (dch dng ln trong pipet t t theo lc mao dn), nhanh chng t ngn tay tr phi ln u pipet, rt pipet ra khi ng, y nt bng li ri t ng ging vo gi. - Cm ng mi trng mi bng tay tri, m nt bng ngn tay t phi, kh khun ming ng, cho pipet vo ti khi u pipet chm vo mi trng v chy ra vi git dch cha vi khun. Rt pipet ra, kh trng ming ng, y nt. - t pipet vo bnh ng thuc st khun. b. Cy truyn bng que cy vng - Tay tri cm hai ng nghim: 1 ng ging; 1 ng mi trng. - Tay phi cm que cy v kh trng trn ngn la n cn cho n khi nng dy cy. - Dng ngn t v ngn p t kp nt ng nghim vo lng bn tay xoay nh, ko nt ng nghim ra. - H nng kh trng khng kh ming 2 ng nghim. - i khi que cy va ngui, kho lo a que cy tip xc vi khun lc trong ng ging. - Rt que cy ra, khng que cy chm vo thnh ng nghim v a vo ng mi trng. Khi u que cy chm vo mi trng th lc kh que cy cho vi khun tan trong mi trng. - Kh trng li phn khng kh ni ming 2 ng nghim ri y nt li - Kh trng li que cy sau khi s dng xong. * Ch - Nu ng ging l canh trng lng c vi sinh vt th dng pipet ht canh trng thay que cy. - Thao tc kh trng ng ht bt u thc hin u nh ca ng ht sau khi tho giy bao gi. - S dng xong cm ng ht vo dung dch sunfocromic kh trng.

Trang 16

Hnh. Thao tc cy truyn vi sinh vt trn mi trng lng 3.2. Phng php cy truyn trn mi trng thch a. Cy truyn trn ng nghim thch nghing Phng php ny dng cy truyn cc vi sinh vt hiu kh. Gm cc thao tc nh sau: - Dn nhn ghi: tn loi vi sinh vt, ngy cy vo thnh ng nghim. - S dng que cy u trn thc hin cc thao tc cy - Tay tri cm hai ng nghim: 1 ng ging; 1 ng mi trng. - Tay phi cm que cy v kh trng trn ngn la n cn cho n khi nng dy cy. - Dng ngn t v ngn p t kp nt y ng nghim vo lng bn tay xoay nh, ko nt y ra. - H nng kh trng khng kh ming 2 ng nghim. - i khi que cy va ngui, kho lo a que cy tip xc vi khun lc trong ng ging. - Rt que cy ra, khng que cy chm vo thnh ng nghim v a vo ng mi trng thc hin thao to cy: - Ha ging u que cy vo git nc y ng nghim. - Nh nhng lt que cy trn mt thch theo cc kiu: + Hnh ch chi. + Hnh vng xon. + Hnh vch ngang song song. - Kh trng li phn khng kh ni ming 2 ng nghim ri y nt bng. - Kh trng li que cy sau khi s dng xong Trang 17

* i vi nm mc hoc cc vi sinh vt a bo sinh bo t khc, khi cy trn ng nghim thch nghing, dng que cy mc v trng ly bo t t ng ging. Cy truyn bo t sang ng nghim mi trng mi theo 2 cch: - Cy im: cch cm ngp u que cy thnh 3 im cch u nhau trn b mt thch - Cy g: a que cy c mang bo t vo ng nghim mi trng, g nh lng que cy vo thnh ng nghim i din vi mt thch ri bo t xung.

Hnh. Cy truyn trn ng nghim thch nghing b. Cy trn ng nghim thch ng - Phng php ny dng cy cc vi sinh vt k kh. - S dng que cy u nhn. - Sau khi ly ging vi sinh vt, dng que cy ny m su vo phn khi thch hnh tr. - m st y ng nghim v m thnh 3 ng: 1 ng chnh gia, 2 ng st thnh ng ty yu cu. - ng cy phi thng, nh nhng khng gy nt, v mi trng.

Trang 18

Hnh. Phng php cy trn thch ng c. Cy truyn trn thch a - Dng que cy u trn, hoc que tri thy tinh. - Dng que cy u trn ly vi sinh vt bng tay phi theo ng quy cch hng dn trn. - Tay tri cm hp petri kh h nh trn ngn la n cn. Sau cch n cn chng 1 - 2cm, kh m m nghing mt bn hp (phn h la), sao cho va cho que cy vo. - Nh nhng, nhanh chng lt que cy trn mt thch theo mt trong cc kiu sau: + Theo hnh zig zac trn ton b mt thch + Theo nhng ng song song + Theo hnh zig zac 3 hoc 4 gc. - Khi dng que tri, ht sn mt lng khong 0,1 dch vi sinh vt nh ln trn b mt thch a. Kh trng que tri thy tinh bng cch nhng vo cn v t trn ngn la. Lm ngui que tri v tri u git dung dch vi sinh vt ln khp b mt mi trng thch a.

(d)

Hnh. Cc kiu cy truyn bng que cy trn thch a

Trang 19

Hnh. Cy truyn bng que tri trn thch a 3.3. Cc iu kin nui cy ca vi sinh vt - Nhit : Ph thuc vo tng loi vi sinh vt. Duy tr s n nh ca nhit bng t vi sinh vt. - m: duy tr m, trong qu trnh nui cn m bo lng nc khi lm mi trng. Trong iu kin cn thit c th phun nc v khun vo phng nui hoc nc bc hi trong t m. - Oxy: i vi vi sinh vt hiu kh, cung cp thng xuyn v y oxy. Lp mi trng nui cy c dy va phi. Cc bnh cha mi trng c lc thng xuyn trong qu trnh nui cung cp thm oxy cho vi sinh vt. Nu nui cy trong mi trng c khi lng ln phi tin hnh sc kh thng xuyn hay nh k. i vi vi sinh vt k kh: hn ch s tip xc vi oxy bng cch ln b mt mi trng parafin, du vaselin hoc cy trch su vo mi trng c, nui cy trong bnh ht chn khng, nui trong ng nghim c bit, sau khi rt ht khng kh v hn kn li, un si mi trng trong mt thi gian loi ht O2 . ngui 450C. Dng pipet cy vi sinh vt vo y ng nghm. Lm ngui nhanh ri vaselin ln b mt hn ch s tip xc vi oxy. 3.4. Quan st vi sinh vt sau khi nui cy Sau khi nui thi gian v nhit thch hp cho mi loi vi sinh vt ta thy: - Trong mi trng lng: Vi khun pht trin s lm c mi trng - Trong mi trng c thch nghing: Nm men, vi khun pht trin s to nn vt ni trn mt thch trong hay trng c. Nm mc s to nn nhng si mnh t vt cy. - Trong mi trng thch ng: Cc vi khun k kh pht trin y ca ct mi trng.. 4. Nhng im cn lu - Mi trng thch phi c b mt kh, phng. Nu ng mi trng cn ng nc cn dng ng mi cy vo gi ng nghim, trnh nc lm hoen vt cy. - Khi tin hnh cy truyn trnh chm u que cy dng ly vi khun vo bt c vt g. - Nu dch vi khun cy truyn ri xung mt bn cn lau ngay bng panh kp bng thm cn hoc nc st trng. - Khi cy truyn vi khun, dng tay tri cm hai ng nghim; ng c vi sinh vt xa v ng mi trng gn ngi thao tc. Trc v sau khi cy truyn xong phi h que cy trn ngn la n cn v trng que cy. 5. Bo co thc tp - Trnh by phng php cy truyn vi khun, nm men, nm mc? - Nu cc iu kin nui nm men v vi khun sau khi gieo cy? - a petri sau khi cy vi sinh vt nn t p hay nga mt thch? Gii thch? - Khi cy truyn vi sinh vt trn ng thch nghing, gii thch ti sao phi ria que cy ngc t y ng nghim ln pha trn?

Trang 20

BI 4 PHNG PHP QUAN ST VI SINH VT BNG KNH HIN VI QUANG HC


1. Nguyn tc 1.1. Gii thiu v cc loi knh hin vi a. Knh hin vi nn en nh sng thng chiu t di ln, qua ra ca t quang nn en, chiu ht vo xung quanh tiu bn, nhng tia sng ny b tiu bn lm khc x ri a vo vt knh. Tiu bn c soi sng rc trn nn en, ging nh trong phng ti c mt tia sng mnh chiu vo, gip thy r tng ht bi trong khng kh b tia sng chiu vo. Chc nng: quan st hnh thi v c tnh ca mt s vi khun m knh hin vi thng kh quan st. b. Knh hin vi i pha nh sng thng b i pha v bin dao ng bi cu trc c bit ca t quang knh, vt knh v th knh. Chc nng: dng quan st r nt cc cu trc nh nh tin mao, cc lp mng. c. Knh hin vi hunh quang Chm tia t ngoi chiu vo tiu bn nhum mu bng cc cht hunh quang. Trong t bo, cc cu trc khc nhau s pht quang vi mu sc khc nhau. Chc nng: quan st v phn bit c cc cu trc khc nhau trong t bo vi sinh vt. d. Knh hin vi in t Chm tia in t bc sng rt ngn, nng sut phn li rt ln nn phn gii cao, gip phn bit 2 im rt gn nhau. Chc nng: dng quan st virus, cu trc phn t ca t bo. e. Knh hin vi quang hc Dng nh sng c bc sng t 500nm 560 nm trong chm nh sng thng to nng sut phn ly ln gip phn bit 2 im cch nhau khong 0.2 m tr ln. H thng phng to ca knh hin vi quang hc gm hai b phn: Vt knh (quay v pha vt quan st) v th knh (quay v pha mt nhn). Mi b phn ny l mt h thng thu knh hi t phc tp, mu vt cn quan st AB c t trc vt knh mt khong cch ln hn tiu c ca vt knh mt cht. nh tht o ngc AB ca vt s thu c bn kia vt knh, nm trong khong tiu c ca th knh. Th knh hot ng nh mt knh lp. Qua th knh, ngi ta s thy nh o AB c phng to ln ca nh tht AB.

Hnh. Nguyn tc quang hc ca knh hin vi Chc nng ca knh hin vi quang hc dng quan st t bo vi sinh vt, k sinh trng, t bo ng vt, thc vt. 1.2. Cu to v nguyn tc hot ng ca knh hin vi quang hc Knh hin vi quang hc c cu to gm 2 phn: - H thng c hc: gi knh gm chn knh, thn knh, tr v xoay th knh, gn Trang 21

v xoay vt knh, bn knh, thanh trt di chuyn tiu bn, c di chuyn thanh trt, kp gi tiu bn, c di chuyn t quang knh, c iu chnh s th cp, c iu chnh th cp (vi cp). - H thng quang hc gm: th knh, vt knh, t quang knh, mn chn sng, ngun chiu sng (n in chiu sng v/ hoc knh chiu sng). Ngoi ra, knh dng ngun chiu sng l n in th c thm b phn cung cp in nh phch cm, dy in, cu ch, mch in (trong chn knh) v nt iu chnh cng chiu sng.

Th knh ng knh Thn knh T quang vt knh c chnh tinh c chnh th Vt knh

Bn mang mu vt T quang n knh

Hnh. Cu to knh hin vi quang hc * Nguyn tc hot ng ca knh hin vi quang hc - Vt knh l h thng quang hc phc tp gm mt s thu knh, trc tip phng i mu vt. Cc thu knh sp xp theo th t, thu knh nh ngoi cng hng vo tiu bn c phng i ln nht. phng i ca knh ph thuc tiu c, tc bn knh cong ca thu knh. Thu knh cng cong, tiu c cng ngn th kh nng phng i cng ln. C 2 loi vt knh: + Vt knh kh phng i nh nh x4, x10, x15, x40,. + Vt knh du c phng i ln nh x90, x100. - Th knh cng c cu to phc tp, gm 2 thu knh, mt hng v mt ngi xem, mt hng v vt knh. Th knh phng i mt ln na nh do vt knh thu vo, lm nh to ln, xem r hn. phng i ca knh = phng i ca vt knh x phng i ca th knh. V d: phng i ca vt knh: x100 , phng i ca th knh: x10 Nh vy: phng i ca knh: 100 x 10 = 1.000 ln. Nng sut phn ly ca knh quan trng hn phng i, v l tiu chun chnh chn knh hin vi. Nng sut phn ly ( phn gii) ca knh hin vi l i lng cho bit kh nng phn bit hai im ca vt quan st nm st nhau. Nu khong cch gia 2 im nm cng st nhau m vn c th phn bit c th nng sut phn ly ca knh cng cao. Khong cch ny ph thuc chiu di sng nh sng s dng v s lng tia sng i vo vt knh, c biu hin bng cng thc:

Trang 22

Trong : : di bc sng pht ra t mu vt. n: Ch s chit quang ca mi trng gia mu vt v vt knh. : Na gc m ca vt knh. 2nsin: Tr s m ca vt knh. - Qua , ta thy mun c phn ly cao phi dng nh sng c bc sng tht ngn, hoc dng vt knh c tr s m ln. Nu dng vt knh c tr s m 0,65 v soi vi nh sng trng (c bc sng trung bnh = 0,55 m) th khong cch nh nht c th nhn thy r c l:

Bng. Thng s ca vt knh v th knh

K hiu ghi trn vt knh

phng i ca vt knh

m (A)

Khong cch t vt knh n tiu bn (mm)

ng knh vi trng khi quan st bng th knh x10 (mm)

Vt knh kh 8 x 0,20 10 x 0,25 40 x 0,65 Vt knh du 90 x 1,25 100 x 1,25 90 100 1,25 1,25 0,15 0,12 0,15 8 10 40 0,20 0,25 0,65 8,91 6,80 0,60 0,35 1,75

Chit sut nh sng ca khng kh nh hn thy tinh, nn tia sng khi i qua tiu bn thy tinh s b khc x mt phn. Phn pha ngoi ca tia sng do b khc x nn khng i vo c vt knh. Vt knh c phng i ln th ng knh ca thu knh cng nh, lng tia sng i vo c vt knh rt t, nn khng thy r nh. hn ch nhc im ny ta dng du soi c chit sut nh sng gn bng thy tinh, thy tinh v du soi c xem nh mt mi trng ng nht. nh sng i qua khng b khc x, nn tp trung y vo vt knh, gip xem r nh.

phng i m Khong cch lm vic

Hnh. Tng quan gia phng i ca vt knh vi khong cch lm vic t vt knh n tiu bn vi sinh vt

Trang 23

nh sng khng b khc x Thu knh ca vt knh du

nh sng b khc x nu kkng c du soi knh Tiu bn

Du soi knh

n t quang

Con ngi diaphragm Ngun sng

Hnh. Nguyn l ca vt knh du 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 9 10 STT 1 2 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml n cn Que cy Bnh tia Lame (phin knh) Lamelle (l knh) Phin knh lm Knh hin vi Dng c dng chung Ni hp cao p T cy v trng n v tnh Ci Ci Ci Ci Ci Ci Tm Tm Tm Ci n v tnh Ci Ci S lng 1 1 3 1 1 1 5 5 1 1 S lng 1 1 Ghi ch Ghi ch

2.2. Ha cht - Cn 96o - Dch x phng long - Dung dch Xylen 2.3. Chng ging vi sinh vt dng quan st - Nm mc: Aspergillus niger, Aspergillus oryzea - Nm men: Saccharomyces cerevisiae, Saccharomyces vini Trang 24

- Vi khun: Escherichia coli, Bacillus subtilis 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. Lm tiu bn vi sinh vt sng a. Lm tiu bn git p - Dng que cy hoc ng ht chuyn ging vi sinh vt t ng nghim nui cy ln tm phin knh. Nu vi sinh vt c nui trn mi trn thch, khi lm tiu bn, nh sn mt git nc mui sinh l ln phin knh, sau ha sinh khi vi sinh vt vo git nc mui ny. - t l knh ln git canh trng tht nh nhng trnh khng to thnh bt kh gia hai tm kinh. Mun vy mt mp l knh tip xc vi phin knh ri t t h l knh xung. - a tiu bn ln quan st trn knh hin vi vt knh x10 ri x40. - Ch : + Nu git dch nhiu qu, trn ra phn ngoi tip xc ca phin knh v l knh ta dng giy thm bt nc i. + Nu cn quan st tiu bn lu th dng vazlin bi quanh mp l knh git dch khi b kh. b. Lm tiu bn git treo Loi tiu bn ny dng theo di s sinh sn, s hnh thnh bo t, kh nng di ng v phn ng ca t bo vi sinh vt vi cc loi kch thch. - Dng phin knh c bit c phn lm hnh trn gia. - Bi vazlin quanh phn lm ca phin knh. - Cho 1 git canh trng ln gia l knh - Thn trng xoay ngc l knh cho git canh trng xung pha di ri dt ln phn lm ca phin knh. - Ch khng git canh trng lan rng hay chm vo phn y ca phn lm trn phin knh. - t tiu bn ln quan st trn knh hin vi vt knh x10 ri x40. u im ca loi tiu bn ny so vi tiu bn git p l gip ta quan st t bo vi sinh vt sng d dng hn v lu hn.

Hnh. Tiu bn git p v tiu bn git treo 3.2. S dng knh hin vi quan st tiu bn vi sinh vt sng Trc khi s dng phi kim tra tt c cc b phn ca knh, dng khn mm lau cc b phn ca knh (Ch : ch lau bn ngoi, khng tho ri cc b phn ca knh), knh ngay ngn va vi tm ngi, sau tin hnh tun t cc bc tip theo soi tiu bn. * Bc 1: Chun b knh. Trang 25

Cm in, bt cng tc knh, iu khin nm chnh nh sng knh c c nh sng thch hp. Xoay vt knh nh nht (vt knh 10x) v trc knh nh trn. * Bc 2: t tiu bn vo mm knh. - Trc khi t tiu bn vo mm knh, phi chn mt phi, mt tri ca tiu bn. Mt phi ca tiu bn thng c dn lamen, dn nhn (nu c lamen v nhn) hoc lm gim bt la ca gng khi nghing soi ra nh sng (nu khng c lamen, khng c nhn). - mt phi ca tiu bn ln trn, tay phi m kp tiu bn, tay tri cm pha u nhn tiu bn, t tiu bn vo mm knh v tay phi th kp gi tiu bn ra. Tiu bn c gi cht vo xe y, trn mm knh. - Dng c xe y iu chnh sao cho mu vt nm ng vo trc knh (gia l mm knh) Ch : C th dng im sng ca hp t quang lm im chun khi iu chnh mu vt v im trc knh, nu mu vt nh qu. * Bc 3: Quan st. Nguyn tc bt buc khi quan st l phi quan st c vt knh c phng i nh, ri mi chuyn sang quan st vt knh c phng i ln hn k n. Xem tiu bn vt knh X10 - H t quang knh xung di (tc tng khong cch t quang vi tiu bn, th trng m i). - Xoay vt knh x10 vo khp ca vt knh (hng vt knh vo t quang). Mt nhn vo bn t tiu bn (khng nhn vo th knh), hai tay xoay c iu chnh s cp a dn vt knh hng n tiu bn (khng c chm vo tiu bn). - t mt hng vo th knh, hai tay xoay chm c iu chnh s cp hng ra xa tiu bn n khi mt thy r dn tiu bn mu vt th dng li. Hai tay nm c vi cp iu chnh cho nh r nht. - Mt vn hng vo th knh, iu chnh mt ln na khong cch ca t quang knh vi tiu bn v mng chn sng sao cho nh r nht. Xem tiu bn vt knh X40 - Nng t quang knh ln va phi (th trng sng hn). - Xoay vt knh X40 vo khp ca vt knh (hng vt knh vo t quang). - t mt hng vo th knh, c th nhn thy ngay hnh thi ca mu vt (i khi khng r lm). Hai tay nm c vi cp iu chnh cho nh r nht. - Mt vn hng vo th knh, iu chnh mt ln na khong cch ca t quang knh vi tiu bn v mng chn sng sao cho nh r nht. * Quan st vi sinh vt - Xem chi tit hnh dng, mu sc ca nm mc: khun ty, vch ngn khun ty, cung bo t, th bng, th bnh, ti bo t, cch sp xp ca bo t,... Xem tng th hnh dng ca nm mc vt knh x10, v hnh. - T bo nm men: Xem vt knh x40 quan st hnh dng t bo: t bo ng ring l hay kt dnh to si gi - si tht, trng thi ny chi. V hnh mt th trng knh hin vi vt knh X40, c cc t bo nm men. - Xem trng thi ca t bo vi khun: di ng hay ng yn, kiu di ng ca t bo, hnh dng ca t bo. 3.3. Bo qun knh hin vi - Sau khi s dng xong, xoay tt c cc vt knh ra trc, m kp tiu bn, ly tiu bn ra tr v ch c, h mm knh, h hp t quang. Dng hai tay b knh ct vo t chng m (t bo qun knh hin vi). - Phi gi gn knh lun lun sch s, khng bi bn v ha cht dnh vo. Lun lun gi knh ni kh ro, mt m cc b phn quang hc khng b mc. - Khi lau knh, khi s dng knh, khng c tho ri cc b phn ca knh. Khng c dng tay xoa trn mt cc thu knh, m nn dng mt bt lng nh sch chi bi cc mt knh hoc dng Trang 26

bng mm, sch lau. - Nu s dng vt knh x100 th phi dng dung dch ph hp thm vo giy chuyn dng lau sch du cede u vt knh x100. - Trnh mi s va chm mnh vo knh, khng nh , nh ri knh. Nu di chuyn knh ra khi phng th nghim, nht thit phi a knh vo hp ca n c chn lt cn thn. - Nu pht hin c 1 h hng no , nht thit khng c t tho ra sa cha m phi bo vi cn b hng dn bit x l. 4. Nhng im cn lu - Sau khi s dng xong phi v sinh cn thn knh hin vi theo mc 3.3 trc khi giao tr. - Trong qu trnh s dng, nu khng quan st thi phi tt n ca knh trnh gy nng v chy n. - Khng c tho ri cc b phn ca knh hin vi. - Cc tiu bn vi sinh vt sng sau khi quan st xong phi kh trng trc khi ra. - Khng c nhng cc vt knh x4, x10, x40 vo trong git du khi quan st. 5. Bo co thc tp - Trnh by cu to v nguyn tc hot ng ca knh hin vi? - V hnh cc tiu bn vi sinh vt quan st? Ch thch hnh v?

Trang 27

BI 5 PHNG PHP NHUM MU VI SINH VT


1. Nguyn tc Nhum mu l qu trnh lm cho t bo hoc cc thnh phn ca t bo vi sinh vt c mu di tc dng ca cc loi thuc nhum. Nhum mu vi sinh vt nhm mc ch: - Gip d dng ha vic quan st hnh dng t bo, cc thnh phn cu trc ca t bo vi sinh vt trn knh hin vi. - Gip phn bit cc chng vi sinh vt vi nhau do vic n mu khc nhau i vi cc loi thuc nhum to iu kin cho vic phn loi, nh dang vi sinh vt (nhum mu Gram). Ty theo tng loi vi sinh vt, tu theo tng cu trc t bo mun nhum, ta c nhiu phng php nhum mu khc nhau. Mi phng php nhum cng c nguyn tc nhum khc nhau. i vi cc phng php nhum mu khng c nh vi sinh vt, thng s dng cc loi thuc nhum khng hoc t c i vi vi sinh vt v c pha long m bo cho vi sinh vt vn sng v hot ng sau khi nhum i vi cc phng php nhum mu vi sinh vt c c nh, thng s dng thuc nhum c kh nng thm thu qua mng t bo v kt hp vi thnh phn khc nhau ca t bo thnh nhng hp cht mu c trng bn vng. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 STT Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml n cn Que cy Bnh tia Lame (phin knh) Lamelle (l knh) Phin knh lm Chu thy tinh Que thy tinh hnh ch U Knh hin vi Phin knh L knh Dng c dng chung n v tnh Ci Ci Ci Ci Ci Ci Tm Tm Tm Ci Ci Ci Tm Tm n v tnh S lng 1 1 3 1 1 1 5 5 1 1 1 1 5 5 S lng Ghi ch Trang 28 Ghi ch

1 2 3

Ni hp cao p T cy v trng Bp in

Ci Ci Ci

1 1 3

2.2. Ha cht - Cn 96o - Dch x phng long - Dung dch Xylen - Thuc nhum Fuchsin Zeihl long v m c - Thuc nhum Safranin O - Thuc nhum Crystal violet (tm kt tinh) - Dung dch lugol - Dung dch Xanh methylen - Du soi knh (du Bch hng du cede) * Dung dch tm kt tinh (crystal violet - C25H30N3Cl.9H2O = 570,11): 2g tm kt tinh ho tan trong 20 ml ethanol 95%; 0,8 g ammon oxalat ho tan trong 80 ml nc ct. Trn hai dch ni trn li vi nhau, gi 48 gi ri lc. Bo qun trong l ti, s dng trong vi thng. * Dung dch lugol: Ho tan 1g Iod trong 3-5 ml nc ct, thm 2g KI (Kali iodide), khuy cho tan ht, thm nc ct cho 300 ml. Bo qun trong l ti. * Dung dch ty mu: Ethanol 96% hoc trn hn hp 70 ml ethanol 96% vi 30 ml aceton hoc trn 100ml ethanol 96% vi 4ml I2 10%. * Dung dch nhum b sung: Chun b sn dung dch Safranin O (C20H19N4Cl = 350,80) 2,5%, trc khi dng pha vi nc ct theo t l 1:5 (vol/vol) c dung dch 0,5%. Hoc chun b sn dung dch Fuchsin Ziehl: fuchsin kim (C19H18N3Cl = 323,82) 1g, phenol 5g, ethanol 90% 10 ml, nc ct 200 ml (ha tan fuchsin vi ethanol; ha tan phenol vi nc ct sau trn li). * Dung dch xanh methylen: ho 1g xanh methylen vo 10ml ethanol 96%. B sung nc ct 100ml. * Dung dch lc malachite 50%: ho 5g lc malachite vo 100ml nc ct. * Thuc nhum Nishikawa Kangen - Dung dch A: ho tan 5g acid tanic vo 100ml nc ct, va khuy va b sung thm theo th t 1,5g FeCl3, 2ml Formalin, 1ml NaOH4%. Gi trong chai mu c 6 gi. - Dung dch B: ha tan 2g AgNO3 vo 100ml nc ct. Ly ra 10ml cho vo 1 cc, hm tng git NH4OH, lc u cho n khi dung dch tr nn trong sut th dng li (khong 5-6 git). dung dch ny vo phn cn li ca dung dch B, lc u. Gi trong chai mu. * Dung dch Carbon Fuchsin: - Dung dch Fuchsin kim bo ho trong nc ct (10%): 10 ml - Dung dch acid carbolic 5% trong nc ct: 100 ml Trn u 2 dung dch vi nhau 2.3. Chng ging vi sinh vt dng quan st - Nm mc: Aspergillus niger, Aspergillus oryzea - Nm men: Saccharomyces cerevisiae, Saccharomyces vini - Vi khun: Escherichia coli, Bacillus subtilis 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc - Giy lau knh 3. Tin hnh th nghim Trang 29

3.1. Lm tiu bn nhum mu vi sinh vt khng c nh - Nh 1 git thuc nhum xanh methylen 0,001% ln phin knh. - Nh 1 git canh trng vi sinh vt hoc ha mt t sinh khi vi sinh vt vo git thuc nhum. - y l knh ln git dch. - Quan st tiu bn vt knh (x 10) ri (x 40) 3.2. Lm tiu bn nhum mu vi sinh vt c nh C hai cch nhum chnh: - Nhum n : Ch dng 1 loi thuc nhum trn 1 tiu bn. - Nhum kp : Dng ng thi 2 hay nhiu loi thuc nhum trn 1 tiu bn (nhum Gram, nhum bo t, nhum Ziehl Neelsen...) Quy trnh nhum c thc hin nh sau a. To vt bi v c nh vi sinh vt - Lau nh tiu bn sch bng giy mm, h qua n cn. - Dng bt ch m hoc bt lng ghi tn mu, v v vng trn ng knh 15mm, mt di lame knh nh du vt khun pha trn lame. - t nng que cy (trc v sau khi thao tc), m nt bng, h nhanh ming ng nghim. * Trng hp 1: mu nui cy trong canh dinh dng, a u que cy vo ming ng nghim (vn gi gn ngn la), nhng vo dung dch canh cy, ly 1 vng que cy. Ly que cy ra, h nhanh ming ng nghim v nt bng, y nt bng li. Pht canh khun trn vng que cy vo mt trn lam, gia vng trn, dn u ra xung quanh. * Trng hp 2: mu nui cy trong thch dinh dng, nh git dung dch NaCl 9 ln gia vng trn (mt trn lam). Thao tc ging trng hp 1, nhng dng cnh vng trn ca u que cy t nh ln khun lc vi khun, ri t vo git NaCl 9 trn lam, dn mng v u. - C nh mu: Mc ch git cht vi khun, lm cho vi khun bm cht vo lame v Que cy Que cy lm vt bi bt mu tt hn v cc t thng cht bt mu tt hn cc t bo sng. C nh mu bo vng 1 t hoc h nhanh trn ngn la n cn vk pht bng cch kh t nhin
trin 1 git nc 1-2 vng cy vi khun

Vi sinh vt t mi trng thch

Dn tri hn hp nc vi khun

Dn tri git huyn ph vi khun

Vi sinh vt t mi trng lng

Lm kh trong khng kh

Trang 30
C nh bng nhit

Hnh. To vt bi v c nh vi sinh vt b. Nhum n - t tiu bn vi sinh vt c nh ln que thu tinh hnh ch U (t nm ngang ming mt chu thu tinh). - Nh vo vt bi vi git Fuchsin Ziehl, yn t 1 - 2 pht. - Ra vt bi bng cch nghing phin knh, dng bnh xt cho dng nc chy nh qua vt bi n khi nc chy ra khng cn mu na - Dng giy thm kh tiu bn hoc h nh tiu bn trn n cn - Quan st tiu bn vt knh (x 40) ri chuyn sang vt knh (x100) dng du soi.
Gi ch U Bocan hoc ni thch hp

Bnh ng thuc nhum

Bnh ng nc

Lm kh

Hnh. Quy trnh nhum n c. Phng php nhum Gram Nhum Gram l mt phng php thc nghim nhm phn bit cc loi vi khun thnh 2 nhm Gram dng (Gram positive) v Gram m (Gram negative) da trn cc c tnh ho l ca thnh t bo. Phng php ny c t tn theo ngi pht minh ra n, nh khoa hc ngi an Mch Hans Christian Gram (1853 -1938). ng pht trin k thut ny vo nm 1884, v sau c Hucker v nhiu ngi khc ci tin. Quy trnh nhum Gram nh sau: - t tiu bn vi sinh vt c nh ln que thu tinh hnh ch U (t nm ngang ming mt chu thu tinh). t ln b mt vt bi mt tm giy thm. - Nhum bng dung dch tm kt tinh trong 30 giy n 1 pht, ra nc. Trang 31

- Cn mu tm kt tinh ln t bo i sinh vt bng cch thm dung dch lugol v gi trong 1 pht, ra nc. - Nh dch ty mu, gi khong 30 giy (cho n khi va thy mt mu), ra nc. - Nhum b sung mu bng dung dch safranin O hoc fuchsin Ziehl trong 1 pht, ra nc, lm kh. Ln nhum ny c hai nhm vi khun u bt gi thuc nhum, nhng vi khun Gram dng khng b thay i mu nhiu, trong khi vi khun Gram m tr nn vng (nhum safranin O) hay ta (Fuchsin Ziehl). - Quan st tiu bn vt knh du x90 hay x100. Nu nhum ng vi khun Gram dng bt mu xanh en hay tm, Gram m bt mu vng (nhum safranin) hay ta (fuchsin). * Xem tiu bn vt knh x90, x100 - Nng t quang knh ln st tiu bn, m cng sng ti a (th trng sng nht). - Xoay vt knh x100 vo khp ca tr vt knh (hng vt knh vo t quang). - Nh mt git du soi vo gia tiu bn. - Mt nhn vo bn t tiu bn (khng nhn vo th knh), hai tay xoay c iu chnh s cp a dn vt knh hng n tiu bn va chm vo tiu bn th dng li. - t mt hng vo th knh, hai tay xoay chm c iu chnh s cp hng ra xa tiu bn n khi mt thy r dn tiu bn mu vt th dng li. - Mt vn hng vo th knh, iu chnh mt ln na khong cch ca t quang knh vi tiu bn v chnh mng chn sng sao cho nh r nht.

Tm k tinh; 30 giy

Ra nc; 5 giy

Hnh . S bin i mu ca vi khun Gram dng, Gram m khi nhum Gram


B sung dung dch lugol; 30 giy Ra nc; 5 giy

Ty mu; 15- 30 giy

Ra nc; 5 giy

Nhum safranin; 60-80 giy

Ra nc; 5 giy

Trang 32
Lm kh bng giy mm

Hnh. Quy trnh nhum Gram d. Phng php nhum Ziehl Neelsen (Nhum khng acid - Dng phn bit vi khun lao Mycobacterium tuberculosis vi cc vi khun khc) Do t bo vi khun khng acid c lp v sp bao bc nn khi nhum c phc hp mu carbolfuchsin, phc hp ny s khng b ty mu bi dung dch ty mu mnh (acid, alcool acid). Tuy nhin phc hp mu ny c th thm xuyn qua lp v sp ca vi khun, c hai cch: (1) un nng pht nhum vi dung dch mu carbolfuchin, nh m carbolfuchsin thm qua lp v sp ca vi khun nhum mu vi khun; y l phng php nhum nng Ziehl - Neelsen. (2) Phng php th hai l phng php nhum lnh cn gi l phng php Kinyoun, trong phng php ny ngi ta dng dung dch carbolfuchsin m c, nh vy khi ph dung dch mu m c ny ln pht nhum vi thi gian lu, carbolfuchsin vn c th thm qua lp v sp nhum mu vi khun. Quy trnh nhum nh sau: - t tiu bn pht knh v c nh mu ln thanh thy tinh ch U, t trn chu nhm trn bp in. - t ming giy lc ln vng pht knh. - Nh dung dch Fuschin m c thm t ht giy lc, un nng lin tc t 5 7 pht (ch khng c lm si thuc nhum). - Trong khi un phi nh b sung thuc nhum lin tc giy lc lun thm t. - Ra nc, thm kh. - Ty cn acid n khi khng cn mu hng ca Fuschin m c (khong 30 giy). Nh Fucshin lm t giy lc, Lm lnh v ra vi nc; 30s Ra nc. un nng 5-7 pht (khng - Nhum b sung bng xanh methylen trong thi gian 2 pht. si) - Ra nc, thm kh. - Quan st bng vt knh du x90 hay x100 - Vi khun lao (vi khun khng acid) bt mu hng cnh sen ca Fuschin, vi khun khc bt mu xanh methylen.
Ty mu bng hn hp acid alcolh n mt mu hng; 10-30s Ra vi nc; 5s

Nhum b sung methyl blue; 2 pht

Ra vi nc; 30s

Trang 33
Lm kh vi giy mm

Hnh. Quy trnh nhum Ziehl Neelsen e. Nhum bo t Mt s vi khun nh Bacillus hay Clostridium c kh nng to thnh bo t. Bo t c th tn ti trong mi trng thiu cht dinh dng, chu c nhit v mt s cc ha cht m th sinh dng khng th. Bo t rt kh nhum bi a s cc thuc nhum do mng bo t dy, chc, kh bt mu v cha nhiu lipid. V th, cn thit phi c nhng phng php nhum c bit i vi bo t. Tuy nhin, i vi bt k phng php no th t bo trc ht c x l bng nhit hay/v acid t bo cht bo t d bt mu. Sau , nhum c t bo cht ca bo t v t bo vi thuc nhum c tnh hot nhum mnh ri ty mu ca t bo cht i v nhum n vi mt thuc nhum phn bit khc. Khi , t bo cht s mang mt mu, v bo t s mang mu khc. i khi bo t c nhn thy bn trong t bo. Hnh thi ca bo t cn gip nhn din vi khun. Hnh dng v kch thc bo t ph thuc vo v tr ca n trong t bo v kch thc b ngang ca t bo mang n. Bo t thng nm trong t bo sinh dng ba v tr khc nhau: nu nm tm t bo th c gi l bo t kiu Bacillus, nu nm lch tm kiu Clostridium v nu nm cc t bo th gi l bo t kiu Plectidium. mt s ging vi khun khc, cc bo t c th tn ti t do bi v cc t bo xung quanh n tan r. C th dng 1 trong 3 hn hp thuc nhum sau nhum bo t: - Lc malachite v thuc nhum safranin. - Fuschin, HCl 0.5%, H2SO4 1%, v xanh methylene (Loeffler). - Xanh methylene v trung tnh. Quy trnh nhum nh sau: * Vi thuc nhum lc malachite v thuc nhum safranin - Chn b vt bi trn phin knh sch v h nng nh. - Thm 1 t nc vo chu nhm v un si. - t gi nhum ln chu nhm ri t phin knh ln n. - t nh mu giy thm (nh hn phn knh mt cht) ln trn phin knh.Mu giy ny s gip gi thuc nhum li trn phin knh. - Ph phin knh vi thuc nhum lc malachite v h hi nc trong vng 5 pht. - Tip tc thm thuc nhum trnh tnh trng thuc nhum b kh trn phin knh. - Kh mu vi nc trong 30 giy bng cch cho nc chy ln phin knh. Cc t bo sinh dng s b mt mu, cn bo t s gi mu li. - Nhum li vi safranin trong 30 giy ri ra li vi nc trong 30 giy na. Thm kh cn thn. Quan st di knh hin vi vi vt knh u (x100). Bo t s c mu xanh cn t bo sinh dng s c mu hng. Ghi li kt qu. Trang 34

* Vi thuc nhum Fuschin, HCl 0,5, H2SO4 1% v xanh methylene - Lm vt bi trn mt phin knh sch v kh t nhin. - Nh vi git HCl 0.5% ln vt bi, h nng trn ngn la n cn cho bc hi trong 2 pht ri ra vi nc. - Nhum vt bi vi thuc nhum Fuschin, qua ming giy lc, h nng cho n khi bc hi trong vng 5 pht. - Ra vt bi bng nc - Ty mu bng dung dch H2SO4 1% trong 2 pht. - Ra vt bi bng nc. - Nhum vt bi bng xanh methylene trong 5 15 pht. - Ra li vi nc v kh t nhin. - Quan st di knh hin vi vi vt knh du (x100). Bo t s c mu xanh cn t bo sinh dng s c mu xanh. Ghi li kt qu. * Vi thuc nhum Xanh methylene v trung tnh - Lm vt bi trn mt phin knh sch. - C nh tiu bn trn ngn la n cn. - Nhum xanh methylene trong 1 pht c h nng t bn di - Ra vt bi bng nc cho n khi ht mu. - Nhum vi trung tnh 0.5% trong 1 pht. - Ra li bng nc, kh. - Quan st di knh hin vi vi vt knh du (x100).Bo t s c mu xanh cn t bo sinh dng s c mu . Ghi li kt qu.

Nh malachite green lm t giy lc v un si 5 pht

Ra vi nc 30s

B sung safranin 60-90s

Ra vi nc 30s

Lm kh vi giy mm

Hnh. Quy trnh nhum bo t f. Phng php nhum tim mao Tin mao l c quan di ng ca vi khun. Tim mao c kch thc rt mng, chiu rng khong 0,01-0,05 m, chiu di thay i ty loi. Mt s loi c mt tin mao (n mao), mt s loi mi u c mt si (song mao), mt s c mt chm mt u hoc mi u (chm mao) v mt s khc c tin mao mc khp xung quanh t bo (chu mao) Trang 35

V tin mao rt mnh nn phi nhum bng phng php c bit vi nguyn tc l tng ng knh ca tin mao bng cch trm hin ha cht v thuc nhum trn tin mao. Thao tc phi rt nh nhng, thn trng. Thng s dng hn hp thuc nhum Nishizawa Kangen. Quy trnh nhum nh sau: - Chun b ging vi khun nui trn mi trng thch 16-18 gi. - Chun b vt bi vi sinh vt trn lame knh. - vt bi kh t nhin trong khng kh, khng c t. - Nhum bng dung dch A trong 15 pht. - Ra lame knh lm sch thuc nhum: t nghing lame knh vo mt c nc y. Nghing cc nc v pha tm knh vng thuc nhum tch xa lame knh v rt t t lame knh ln. - Nhum bng dung dch B trong 10-15 pht. Theo di n khi thy vt bi bt u nu r th dng li. - Nhng t t lame knh vo mt cc nc sch, gi 30 giy ri ly lame knh ra nh trn. - kh t nhin. - Quan st vi vt knh du x100. Tim mao vi khun c mu hng nu. 4. Nhng im cn ch - Tui ca ging phi thch hp: cn chun b ng ging trc khi nhum t 16 n 24 gi nui nhit thch hp, v t bo gi thng thng mt kh nng gi mu thuc nhum tm kt tinh khi ty bng ethanol. - V nhy ca mt s vi khun c nh hng n kt qu nhum Gram. nhum Gram cn nui chng trong cc mi trng cha t ng hn ch vic hnh thnh v nhy. - Kh mu l bc quan trng v cn k nng nht nh, v kh nng bt mu Gram dng khng phi l "tt c hoc khng". - Khng c h tm lam c vt bi vi sinh vt qu nng trn ngn la, c th lm chy v lm thay i hnh dng t bo vi sinh vt. 5. Bo co thc tp - Sau khi nhum, vi khun Gram dng c mu xanh en hay tm, Gram m c mu vng hay ta. Gii thich nguyn nhn? - Nu khng nhum b sung thuc nhum safranin hoc fuchsin, vi khun Gram m c mu g? Ti sao? - V hnh th trng knh hin vi c vi sinh vt trong trng hp nhum vi sinh vt khng c nh v nhum vi sinh vt c nh?

Trang 36

BI 6 PHNG PHP PHN LP VI SINH VT


1. Nguyn tc Phn lp vi khun l mt qu trnh tch ri mt loi vi sinh vt t qun th vi sinh vt, sau gieo chng ln b mt mi trng thch dinh dng chn lc. Sau khi cc iu kin thch hp cc vi vi sinh vt s phn chia nhiu ln to thnh nhng qun th mc ring bit gi l khun lc. Mt t t bo hoc bo t trong khun lc c cy truyn vo ng mi trng gi ging v cc iu kin thch hp chng pht trin thnh qun th mi. Qun th vi sinh vt trong ng nghim ny c gi l mt chng vi sinh vt hoc l ng ging. y l mt khu c ngha rt quan trng trong vic nghin cu v ng dng vi sinh vt. Chng vi sinh vt thun khit (hay cn gi l chng sch) c hiu l th h con, chu, dng c ngun gc t mt t bo ring l. Cc chng vi sinh vt c thu nhn t khun lc phn lp ln u cha chc thun khit v mt khun lc c th c hnh thnh bi mt hoc nhiu t bo, bo t, v th phi lm sch nhiu ln mi thu c chng vi sinh vt thun khit. Qu trnh phn lp vi sinh vt dng thun khit: Vi hu ht cc loi mu nghin cu, qu trnh phn lp vi sinh vt dng thun khit gm cc bc c bn sau: - La chn ngun phn lp vi sinh vt - To ra cc khun lc ring r t qun th vi sinh vt ban u. - Phn lp vi sinh vt thun khit. - Kim tra tinh khit ca cc khun lc. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 9 10 11 12 13 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Bnh tam gic Phu thy tinh a khuy thy tinh Cc 100ml a cn nha Bnh tia Bp in Pipette 1ml Pipette 10ml Qu bp cao su Micropipette 100-1000l n v tnh Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci S lng 1 5 1 1 1 3 3 1 1 2 1 1 1 Trang 37 Ghi ch

STT 14 15 16 STT 1 2 3 4 5 6

Tn dng c, thit b mi nhm (3 sinh vin) u tp 1000l a petri 90mm Que tri vi sinh vt Dng c dng chung My o pH Cn k thut Cn phn tch Ni hp cao p T sy T m

n v tnh Ci Ci Ci n v tnh Ci Ci Ci Ci Ci Ci

S lng 10 3 1 S lng 1 1 1 1 1 1

Ghi ch

Ghi ch

2.2. Mi trng v ho cht - Mi trng cao tht pepton: dng nui cy v phn lp vi khun - Mi trng Hansen: dng nui cy v phn lp nm men - Mi trng Czapeck: dng nui cy v phn lp nm mc 2.3. Nguyn liu khc - t vn - Qu nho chn - Th ti - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. La chn ngun phn lp vi sinh vt a. Ngun phn lp nm mc - Mt s chng nm mc nh Aspergillus oryzae, Aspergillus niger v Mucorc th phn lp cc loi nm mc ny trn cm ngui, xi lm mc tng, bnh m kh t ngy. - Thng qua mu sc ca mc nhn din. + Mc c mu trng: C th l Mucor hay Rhizopus. + Mc c mu en l Aspergillus niger. + Mc c mu xanh lc l Penicillium italicum. Loi mc ny thng c trn v cam, chanh lu ngy b. Ngun phn lp nm men - C th phn lp nm men d dng t cc mi trng nh: b mt tri cy v dch p mt s tri cy nh to, l, nho, du, m, da, trong ru np, trong cc bnh men ru, trong bia, trong nc ma, trong ht kefia - Nm men ny khi quan st trn knh hin vi thng c dng hnh cu hay hnh trng. T bo c kch thc ln, c kh nng ny chi. Khun lc cho mu trng sa c. Ngun phn lp vi khun - C th phn lp vi khun t t, nc gii kht (nc ma), nc thi, thc phm Trang 38

ti (tht, c, sa ti, rau qu ti), thc phm b i thiu

Hnh dng
Dng im Hnh trn Dng si Hnh bt k R gi Mc dng ng

Mt bn
Dp Dy Li Hnh ci gi Li nhp nh

Mp khun lc
Trn Nhn Phn thy Khe rnh Dng si xon

Hnh dng khun lc vi khun trn mi trng thch 3.2. K thut cui cy to khun lc ring r t qun th vi sinh vt trn cc mi trng phn lp a. Yu cu - Nu mu ban u dng rn phi a v dng lng bng cch: + Nghin mu. + Ho tan mu trong nc ct v trng. Sau thc hin nh mu l dng lng. + Thc hin s pha long theo phpng php pha long thp phn cho n kh t c nng cn thit. + Cy mu trn mi trng c trng ca n. - Nu ngun mu phn lp dng lng c th cy trc tip hoc pha long lm gim mt .

Ngun mu phn lp

Hnh. K thut pha long thp phn b. Phng php to khun lc n cc vi sinh vt hiu kh - C nhiu k thut ria khc nhau thc hin hp ria v to khun lc n. Mt s k thut ria thng dng: k thut ria ch T, k thut ria bn gc, k thut ria tia, k thut ria lin tc Thao tc k thut to khun lc n c thc hin nh sau: * K thut hp ria - Dng que cy vng thao tc v trng thu ging. - Ria cc ng trn a ptri cha mi trng thch hp (ria ch T v ria bn gc). Sau mi ng ria, t kh trng u que cy v lm ngui trc khi thc hin ng ria tip theo. - Bao gi a ptri, nhit v thi gian thch hp trong t m.

Trang 39

Hnh. K thut hp ria * K thut hp tri - Dng micropipette v u tp v trng, thao tc v trng chuyn 0,1 ml dch cha ging vi sinh vt ln b mt mi trng trong a ptri. - Nhng u thanh gt (que tri) thu tinh vo cn 70o, h qua ngn la kh trng. u thanh gt ngui trong khng gian v trng ca ngn la. - M a ptri, t nh nhng thanh gt ln b mt thch ca a petri. Dng u thanh gt xoay, tri u dch ging ln b mt thch. Trong khi tri, thc hin xoay a mt vi ln, mi ln khong 1/2 chu vi a to iu kin cho thanh gt tri dch ging u khp b mt mi trng. - Rt thanh gt khi a, y a, gi v nhit v thi gian thch hp trong t m. * K thut hp - Dng micropipette v u tp v trng, thao tc v trng chuyn 1 m dch cha ging vi sinh vt ln b mt mi trng trong a ptri. - khong 15 - 20 ml mi trng un chy v ngu n 45 - 55 0C vo a petri cy mu. - Xoay nh ia petri cng chiu v ngc chiu kim ng h vi ln dung dch ging c trn u trong mi trng cy. - y np a ptri, ng t nhin. c. Phng php to khun lc n cc vi sinh vt k kh - Dng mi trng c trong ng nghim em chng cch thu loi b khng kh trong mi trng. - ngui mi trng cn 45 - 500C. - Ht 0,1 ml dch nghin cu cho vo ng mi trng, y nt li, lc trn quanh trc ng nghim. - Rt nhanh mi trng ng nghim vo np di ca a ptri v y tht nhanh np trn li, sao cho gia mt np v mi trng khng cn khng kh. - Dng parafin hn kn phn tip xc gia 2 np ca a petri v nhit thch hp. - Nui trong bnh ym kh: sau khi cy vi khun xong, cho vo bnh ym kh. Thoa mt lp parafin lng ln ming bnh, t n cn hay n cy ln v t vo bnh, y np li, hoc dng my ht chn khng hoc dng ti k kh. Cho vo t m, nhit v thi gian thch hp. - Sau khi vi sinh vt pht trin, chn cc khun lc ring r trong khi mi trng, dng que cy ct c khi mi trng ri cy vo mi trng lng thch hp.

Trang 40

Hnh. Bnh nui cy k kh v ti k kh Gaspak 3.3. Phn lp thun khit - Cy vi sinh vt t khun lc mc tch ri trn a petri vo ng mi trng thch nghing mi. - Nui vi sinh vt nhit v thi gian thch hp. - Loi b cc ng b nhim, chn ra cc ng c cc chng thun khit. 3.4. Kim tra tinh khit ca ging mi phn lp C nhiu cch kim tra a. Kim tra bng cch quan st vt cy - Quan st s sinh trng ca vi sinh vt qua vt cy trn mi trng c. - Nu vt cy c b mt v mu sc ng u, thun nht chng t ging mi phn lp tinh khit th gi li. - Nu vt cy khng thun nht th loi b. b. Kim tra li thun chng ca cc loi khun lc - Chn cc khun lc ring r trn mi trng thch nghing. - Tch cc khun lc ny ra v ho tan, pha long nng cn thit trong nc ct v trng. - Nh 1 git dch trn vo a ptri c mi trng. - Dng 1 que gt phn phi git dch u khp mt thch a ptri th nht, ri a th 2, th 3. - t cc a ptri trn vo t m vi nhit v thi gian thch hp tu loi vi sinh vt. - Sau ly ra quan st cc khun lc ring r. S thun khit ca khun lc l biu hin s thun khit ca ging. c. Kim tra trn knh hin vi - Ly sinh khi vi sinh vt t ng nghim phana lp, lm tiu bn sng, tiu bn nhum mu quan st trn knh hin vi. - S ng nht v hnh dng, kch thc, mu sc ca cc t bo vi sinh vt l biu hin s thun khit ca ging vi sinh vt va phn lp. 4. Nhng im cn lu - Cc hp thch mi trng phi v trng c b mt kh nc v c rn chc, khng g gh, gip cc khun lc vi khun mc ri nhau ra. - phng s nhim tp do khng kh bn, cc thao tc phi tuyt i v trng. - Cc chng sau khi lm sch cn c kim tra li bng cch quan st hnh dng t bo di knh hin vi cng nh xc nh li cc hot tnh bit. - Vic to ra mt chng vi khun thun khit cng nh bo qun khi b tp nhim l vic lm c ngha rt ln trong hc tp, nghin cu cng nh sn xut. Trang 41

5. Bo co thc tp - Trnh by cc nguyn tc v phng php phn lp vi khun thun khit? - Nguyn tc ca vic nui tch ly? - Th no l chng vi khun thun khit (chng sch)?

Trang 42

BI 7 PHNG PHP BO QUN GING VI SINH VT


1. Nguyn tc Bo qun ging vi sinh vt l cng vic ht sc cn thit do chng d b thoi ho nu khng c bo qun ng k thut. Bo qun vi sinh vt c tm quan trng lm nn tng cho cc nghin cu c bn v ng dng lin quan n nhiu lnh vc: sinh hc, y hc, nng nghip v mi trng. Cng vic bo qun ging l thc hin cc k thut cn thit gi cho vi sinh vt c t l sng st cao, cc c tnh di truyn khng b bin i v khng b tp nhim bi cc vi sinh vt l. Qu trnh bo qun ging vi sinh vt thng c thc hin qua 4 bc: - Lm giu s lng vi sinh vt cn bo qun. - X l vi sinh vt trc khi bo qun. - Thc hin bo qun ging vi sinh vt. - Kim tra nh k kh nng sng st ca vi sinh vt bo qun. Cc chng vi sinh vt bo qun s c cung cp cho ngi s dng, do nhim v quan trng bn cnh vic bo qun l thu thp v cung cp cc thng tin quan trng ca chng vi sinh vt bo qun cho ngi s dng nh: mi trng nui cy, nhit , nhu cu dinh dng, tnh an ton sinh hc, tn phn loi v.v. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 3 4 5 6 7 8 9 10 11 12 13 STT 1 ng nghim 18 Bnh tam gic Phu thy tinh a khuy thy tinh Cc 100ml a cn nha Bnh tia Bp in Pipette 1ml Pipette 10ml Qu bp cao su Que cy Dng c dng chung My o pH Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci n v tnh Ci 5 1 1 1 3 3 1 1 2 1 1 1 S lng 1 Trang 43 Ghi ch

STT 2 3 4 5 6 7

Tn dng c, thit b mi nhm (3 sinh vin) Cn k thut Cn phn tch Ni hp cao p T sy T m My ht chn khng

n v tnh Ci Ci Ci Ci Ci Ci

S lng 1 1 1 1 1 1

Ghi ch

2.2. Mi trng v ho cht - Mi trng cao tht pepton: dng bo qun vi khun - Mi trng Hansen: dng bo qun nm men - Mi trng Czapeck: dng bo qun nm mc - Parafin lng 2.3. Nguyn liu khc - Ct sch - La hoc bobo - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. Phng php cy truyn nh k ln mi trng mi Phng php ny p dng bo qun tt c cc loi vi sinh vt. u im ca phng php ny n gin, d lm, thi gian bo qun khng lu. Tuy nhin, nhc im l tn mi trng, cng sc v thi gian. Phm cht ban u ca ging c th b thay i do nhiu nguyn nhn kh xc nh c th trong qu trnh cy truyn. Quy trnh thc hin nh sau - Thun khit li chng vi sinh vt bng cch cy tri hoc ria trn thch a. - Cy vi sinh vt t khun lc in hnh ln ng nghim mi trng thch nghing. - Nui trong t m 24-48 gi - Ly ng ging ra v cho vo t lnh bo qun 40C. - nh k cy truyn li (nm mc 3-6 thng, vi khun v nm men 1-2 thng). - C th cho thm 1% du thc vt vo mi trng nui cy ban u khi pha ch trnh mt nc. 3.2. Phng php gi ging trn mi trng thch c lp du khong Yu cu ca phng php ny l s dng du khong nh parafin lng hay vazlin phi trung tnh, c nht cao, khng cha cc sn phm c vi vi sinh vt v v trng. Phng php ny n gin nhng hiu qu cao nh kh nng lm chm qu trnh bin dng v h hp nn vi sinh vt pht trin chm li. Mi trng khng b mt nc v kh. Quy trnh thc hin nh sau: - Kh trng du khong bng cch hp 1210C trong 2h. Sau sy kh t sy 0 (170 C) trong 1 - 2h; ngui - ln b mt mi trng trong ng nghimc vi sinh vt pht trin tt mt lng du cch mp trn ng nghim 1 cm. - Dng parafin c hn kn ming ng, bnh nui vi sinh vt. - Gi ng ging vi sinh vt 4oC. 3.3. Phng php gi ging trn t, ct, ht a. Trn t, ct Trang 44

Dng bo qun cc chng vi sinh vaajt to bo t tim sinh (hoc bo t v tnh) vi thi gian bo qun t mt n nhiu nm. Quy trnh thc hin nh sau: - t, ct em ry ly ht u v ngm trong HCl hay H 2SO4 m c 8 - 12h loi b cc axit hu c trong ct. - Ra k ct n pH trung tnh. - Sy kh, thanh trng ct v gi iu kin v trng. - y ct vo ng nghim c vi sinh vt pht trin trn mi trng thch v lc tht u. - Rt ton b ct ln vi sinh vt vo 1 ng nghim khc. - Hn kn ming ng nghim, bo qun ng nghim 4oC. b Trn ht Dng bo qun cc chng c dng hnh si sinh bo t hoc khng. Thi gian bo qun c th ti 1 nm.Quy trnh nh sau: - Ht ng cc (la, bobo) c ra sch. - Nu cho ht va nt, ro nc. Cho ht vo ng nghim sch, khong ng - Ph trn cc ht ny mt lp bng thm nc - Thanh trng ht 121oC trong 40 pht. - Thanh trng 3 ln, mi ln cch nhau 24h. - Cy ging vi sinh vt trn lp bng cho mc tht dy. Hng ngy lc nh. - Sau 8 10 ngy kim tra li cht lng ca ging vi sinh vt - Gn paraffin. - Gi nhit 15 20oC. 3.4. Phng php ng kh Phng php ny lm cho t bo mt nc trng thi t do. ng thi lm gim, thm ch lm ngng hn qu trnh phn chia ca vi sinh vt. Nh chng c kh nng chu c nhiu tc ng ca ngoi cnh. Phng php ny dng nhiu trong sn xut, thi gian bo qun ln ti vi chc nm. - Sau khi nui cy, vi sinh vt c trn vi cht bo v trnh kt tinh nc trong t bo. Cht bo v c th l mt trong nhng dung dch sau: + Glycerin 10% + geletin 1% + pH trung tnh + Huyt thanh nga + geletin 1% + pH trung tnh + Ssaccharose 10% + geletin 1% + pH trung tnh + Dung dch glucose 10%, + Dung dch lactose 10%. - Phn h hp vi sinh vt vo vo ng nghim. - Cho ng nghim c cha vi sinh vt vo chu lnh nhit (-)70 (-)80oC, trong 1-5 pht. - a vo thit b ng kh (p sut = 10-4 mmHg, trong thi gian 8 14 gi ). - Sau khi lm kh, m cn 1 4%. - Kim tra li hm lng m bng giy tm CoCl2 3%. - Hn kn ng nghim kh. - Bo qun nhit 4oC 4. Nhng im cn lu - vic bo qun vi sinh vt c kt qu cn phi m bo chn ging thun khit, cha b bin i cc c tnh do t bin ngu nhin ng thi cn phi chn giai on ti u trong chu trnh sng bo qun. - Kim tra kh nng sng ca mu vi sinh vt ti cc thi im, trc v ngay sau khi bo qun; sau 1 hoc 5 nm bo qun. 5. Bo co thc tp - Trnh by nguyn tc v ngha ca vic bo qun ging vi sinh vt? - Trnh by phng php bo qun ging nm mc, nm men v vi khun? - So snh u v nhc im ca cc phng php bo qun ging vi sinh vt? Trang 45

BI 8 KHO ST S SINH TRNG CA VI SINH VT NG CONG SINH TRNG CA VI SINH VT


1. Nguyn tc S sinh trng ca vi sinh vt l s gia tng s lng t bo vi sinh vt trong qun th v tc tng trng l s sinh trng ca vi sinh vt trong mt n v thi gian. Vi khun thng sinh sn bng phng thc phn i to thnh hai t bo con cng kch thc, do vt lm tng gp i s lng t bo sng v mt t bo trong qun th s lin tc tng gp i trong pha tng trng cp s m. S sinh trng qun th vi sinh vt c nghin cu bng cch phn tch ng cong sinh trng trong mt mi trng nui cy vi sinh vt theo phng php nui cy theo m (batch culture) hoc trong mt h thng kn. C ngha l vi sinh vt c nui cy trong mt thit b kn, trong qu trnh nui cy khng thay i mi trng v thi gian nui cy cng ko di th nng cht dinh dng cng gim st, cc cht ph thi ca trao i cht cng tng ln. Nu ly thi gian nui cy l trc honh v ly s logarit ca s lng t bo sng lm trc tung s c th v c ng cong sinh trng ca cc vi sinh vt sinh sn bng cch phn i. ng cong ny c 4 giai on (phases) khc nhau.

Pha cn bng ng

Pha Log

Pha suy vong

Pha Lag

Hnh. ng cong sinh trng trong h thng kn (Theo Harley v Klein) Tnh ton nhp sinh trng ca vi sinh vt s lm c s cho cc nghin cu v sinh l hc, sinh thi hc vi sinh vt, v cn gii quyt mt s vn ng dng trong sn xut cng nghip. Trong pha log (giai on logarit) mi c th vi sinh vt tin hnh phn ct trong mt thi gian xc nh. S lng t bo tng theo phng thc 2n. Thi gian gia hai ln phn chia lin tip hay thi gian cn cho s tng i s t bo c gi l thi gian th h (generation time hay doubling time). V d a mt t bo vo mi trng nui cy, c 20 pht phn ct mt ln th sau 20 pht c 2 t bo, sau 40 pht c 4 t bo v tip tc nh vy. Bng. V d v sinh trng theo logarit Thi gian (*) S ln phn ct 0 0 20 1 40 2 60 3 80 4 100 5 120 6 2n 20=1 21=2 22=4 23=8 24=16 25=32 26=64 S lng (N0 x 2 n ) 1 2 4 8 16 32 64 lg10Nt 0,000 0,301 0,602 0,903 1,204 1,505 1,806 Trang 46

(*): Thi gian th h l 20 pht, gi thit l nui cy t 1 t bo S lng logarit t bo l 2n, n l s th h. C th biu th cc s liu trong bng bng cng thc sau y: N1 = N0 x 2x Trong : N0 l s lng t bo ban u; Nt l s lng t bo thi gian t; n l s th h. T cng thc trn c th bin i nh sau v s th h n c tnh bng logarit thp phn: Log N1 = logN0 + nlog2

Khi nui cy phn m (batch culture) tc sinh trng trong giai on logarit c th biu th bng hng s tc sinh trng bnh qun k (mean growth rate constant k). l s th h sinh ra trong n v thi gian, thng biu th bng s th h trong 1 gi:

Thi gian cn thit tng gp i tng s t bo l thi gian th h bnh qun (mean generation time) hay thi gian tn gp i bnh qun (mean doubling time) v c biu th bng g. Nu t=g th N t= 2N0. Thay vo cng thc trn ta c:

Thi gian th h bnh qun l o s ca hng s tc sinh trng bnh qun:

Thi gian th h thay i ty theo chng loi vi sinh vt, iu kin nui cy. Mt s vi khun thi gian th h khng qu 10 pht (0,17h) trong khi mt s vi sinh vt nhn thc (eucaryotic) li di ti vi ngy (Bng 14.2). Thi gian th h trong t nhin thng l di hn so vi khi nui cy. Bng. Thi gian th h ca mt s loi vi sinh vt Vi sinh vt Vi khun v Vi khun lam Beneckea natriegens Escherichia coli Bacillus subtilis Staphylococcus aureus Pseudomonas aeruginossa Clostridium botulinum Rhodospirillum rubrum Anabaena cylindrica Mycobacterium tuberculosis Treponema pallidum To Scenedesmus quadricauda Chlorella pyrenoidosa Asterionella formosa Nhit (0C) 37 40 40 37 37 37 25 25 37 37 25 25 20 Thi gian th h (gi) 0,16 0,35 0,43 0,47 0,58 0,58 4,6-5,3 10,6 Khong 12 33 5,9 7,75 9,6 Trang 47

Euglena gracilis Ceratium tripos ng vt nguyn sinh Tetrahymena geleii Leishmania donovani Paramecium caudatum Acanthamoeba castellanii Giardia lamblia Nm Saccharomyces cerevisiae Monilinia fructicola 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT nhm (3 sinh vin) 1 Gi ng nghim 2 3 4 5 6 7 8 9 10 11 12 13 STT 1 2 3 4 5 ng nghim 18 Bnh tam gic Phu thy tinh a khuy thy tinh Cc 100ml a cn nha Bnh tia Bp in Pipette 1ml Pipette 10ml Qu bp cao su Que cy Dng c dng chung My o pH Cn k thut Cn phn tch Ni hp cao p T sy

25 20 24 26 26 30 37 30 25

10,9 82,8 2,2-4,2 10-12 10,4 11-12 18 2 30

n v tnh Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci Ci n v tnh Ci Ci Ci Ci Ci

S lng 1 5 1 1 1 3 3 1 1 2 1 1 1 S lng 1 1 1 1 1

Ghi ch

Ghi ch

Trang 48

STT 6 7

Tn dng c, thit b mi nhm (3 sinh vin) T m My so mu

n v tnh Ci Ci

S lng 1 1

Ghi ch

2.2. Mi trng v ho cht - Mi trng NB (Nutrient broth) - Nc mui sinh l v trng - Nc ct v trng 2.3. Chng ging vi sinh vt - Vi khun Escherichia coli 3. Tin hnh th nghim 3.1. Xy dng ng tng quan gia mt vi sinh vt v c ca dung dch nui cy. a. Pha long mu - Xc nh c ca dung dch vi khun E.coli nui cy trn mi trng NB sau 24 gi (pha long nu s o vt qu 1). Dng dch mi trng NB cha nui cy lm chng khng khi o. - Da vo s o trn, pha long thnh cc phn 2,5ml huyn ph sao cho OD 610nm t c cc gi tr ln cn 0,1; 0,2; 0,3; 0,4; 0,5 (khng c t gi tr chnh xc). - o OD610nm ca cc huyn ph va c pha, ghi nhn s o thc t. mi pha long nht nh, dng mi trng cha nui cy c pha long bng nc ct lm chng khng khi o. b. Xc nh mt t bo bng phng php m khun lc - Tin hnh pha long bc 10 lin tip mi dch huyn ph c c xc nh trn thnh cc pha long 10-6, 10-7, 10-8 trn cc ng eppendorf. Dng nc mui sinh l 0,9% lm dung dch pha long. Mi ng eppendorf dng pha long, cha sn 0,9ml dch nc mui. - Vi mi huyn ph, chn 3 pha long lin tip cui cng l 10-6, 10-7, 10-8 em nui cy. Dng micropipette, ht 0,1ml dch t mi pha long chn chuyn vo a petri cha mi trng NA. Trong iu kin v trng, dng que tri, tri u dch vi sinh vt ny khp b mt mi trng trong a petri. - Cc a petri c 370C trong 24 gi. - Sau thi gian ny, m s khun lc vi khun E.coli trn cc a petri tt c cc nng . Ch chn nhng a c lng khun lc 25-250 khun lc/a tnh s lng. - Mt t bo vi khun E.coli trong cc dch huyn ph trn c xc nh theo cng thc: C N (CFU / ghayCFU / ml ) = (n1vd1 + ... + ni vd i ) Vi : N: s t bo (n v hnh thnh khun lc) vi khun trong 1g hay 1ml mu. (CFU: colony form units) C: Tng s khun lc m c trn cc hp petri chn (c s khun lc nm trong khong t 25-250 khun lc/a) ni : S hp petri cy ti pha long th i di: h s pha long tng ng. v: th tch dch mu (ml) cy vo trong mi a c. Xy dng ng tng quan gia mt vi khun v c - Da vo s liu CFU/ml dch huyn ph thu c trn, tnh gi tr log (N/ml) cho mi gi tr mt CFU/ml tng ng vi mi d c. - V ng biu din ca log (N/ml) (trc tung) theo OD610nm (trc honh) Trang 49

log (N/ml)

7 6.8 6.6 6.4 6.2 6 5.8 5.6 0 0.1 0.2 0.3 0.4 0.5 0.6 OD610nm

Hnh. ng tng quan tuyn tnh gia log (N/ml) v OD610nm 3.2. Nui cy vi sinh vt trong h thng kn (mi trng nui cy tnh) - Cy 5ml dch E.coli sau 1 gi nui cy vo bnh tam gic cha 50ml mi trng. - Cy 2,5ml dch E.coli nui cy 24 gi vo bnh tam gic th hai cha 50ml mi trng. - Lc u hai bnh, dng micropipette vi u tp v trng ht 2ml dch mu mi bnh vo ng o. - Hai bnh nui cy c nui cy lc trn my lc, tc lc 120 vng/pht, nhit 370C. Ghi nhn thi im bt u ca qu trnh nui cy. - Dng mi trng NB mi cha nui cy lm i, o c ca mu bc sng 610nm. Ghi nhn c OD610nm ( c thi im t0). - Tin hnh thu mu cch 10 pht trong khong thi gian 90 pht v o c nh trn. Trng hp c tip cn gii hn trn hoc vt qu thang c, pha long mu 1/10 ln vi nc ct v trng trc khi o c. Trong trng hp ny, dng mi trng NB cha nui cy c pha long 1/10 ln lm i chng khi o. - Ghi nhn c ti cc thi im thu mu. - T gi c o c ca mi thi im, da vo ng tng quan tuyn tnh gia log (N/ml) v c trn xc nh gi tr log (N/ml) tng ng. - Vi cc gi tr log (N/ml) ca cc c cc thi im khc nhau, v ng tng quan gia c v thi gian nuoi cy cho mi bnh. y chnh l ng cong sinh trng ca vi khun E.coli trong mi trng nui cy tnh. 4. Nhng im cn lu - Trc khi o OD, my c chng khng bng dung dch mi trng NB - Cc thao tc ht chuyn vi sinh vt phi m bo iu kin v trng v dch huyn ph con s dng cho qu trnh nui cy xc nh mt - ng tng quan tuyn tnh phi l ng thng, qua cng nhiu im cng tt. - Phi xc nh khong tuyn tnh trn ng tuyn tnh sau khi v xong th. - Nu dung dch nui cy c gi tr OD610nm vt qu khong tuyn tnh, cn pha long trc khi o. 5. Bo co thc tp - Trong h thng nui cy tnh (h thng nui cy tnh), nn dng qu trnh nui cy pha no thu nhn c sinh khi cao nht? - Gii thch s tng quan gia c v mt vi sinh vt? - V ng tng quan tuyn tnh gia mt v c? - V ng cong sinh trng ca vi khun E.coli trong mi trng nui cy tnh?

Trang 50

Trang 51

BI 9 KHO ST S NH HNG CA CC YU T MI TRNG N S SINH TRNG CA VI SINH VT


1. Nguyn tc Cc yu t mi trng hoc tng tc ca cc yu t mi trng c tc dng kim sot tc tng trng hoc suy tn ca vi sinh vt. Trong iu kin t nhin, cc yu t mi trng thng rt dao ng, kh kim sot, do thng c s thay i lun phin qun th vi sinh vt u th theo s thay i ca iu kin mi trng. Trong iu kin phng th nghim, cc iu kin mi trng c th c kim sot, iu chnh vi sinh vt c th tng trng vi tc ti a, to nhiu sn phm bin dng mong mun. Bn cnh , vi s iu chnh cc yu t mi trng, chng ta c th kim sot theo hng km hm hoc loi b hon ton s sinh trng ca vi sinh vt. i vi mi yu t mi trng (nhit , pH, p sut thm thu, hm lng oxy...), cc vi sinh vt c ngng pht trin khc nhau. Trong ngng pht trin ny, vi sinh vt sinh trng pht trin thun li v ti u ti im cc thun ca ngng. Nu vt ngoi ngng, vi sinh vt c th b km hm hoc b tiu dit. Kho st v s nh hng ca cc yu t mi trng i vi vi sinh vt l c s quan trong trong vic ti u ha iu kin nui cy m bo s sinh trng thun li ca vi sinh vt hoc km hm loi b hon ton vi sinh vt. Trong gii hn ca bi thc hnh ny, ch i vo tm hiu v nh hng ca 3 yu t mi trng l hm lng oxy, pH v p sut thm thu n s sinh trng ca vi sinh vt. * Oxy l thnh phn hin din trong hu ht cc cu trc ca t bo, v c vai tr quan trng trong s sinh trng ca mt s vi sinh vt. Vi sinh vt hiu kh cn (aerobe) cn O2 tng trng, ngc li vi sinh vt k kh (anaerobe) khng c kh nng s dng oxy. Nhiu vi sinh vt c kh nng sng trong iu kin c hoc khng c oxy, c gi l k kh tu (facultative anaerobe). Ngoi ra, cc vi sinh vt ch tng trng trong mi trng c nng oxy thp c gi l vi hiu kh (microaerophile). * pH l gi tr o nng H+, c n hng trc tip n s tng trng ca vi sinh vt. Hu ht vi sinh vt tng trng ti u pH trung tnh. S tng hoc gim nng ion H+ l pH gim hoc tng s c hi cho vi sinh vt ni chung do lm thay i trng thi ion ha ca cc nhm protein v s sng st ca t bo. * p sut thm thu l lc m nc tc ng ln mng t bo do s phn b khng u ca cht tan trong mi trng v trong t bo cht. T bo tng trng tt nht khi p sut thm thu bn ngoi thp hn bn trong do nc c th t do i vo v lm d dng s tip nhn cht dinh dng. Ngc li, khi p sut thm thu bn ngoi cao hn th nc s thot khi t bo lm t bo mt nc gy bt li cho hot tnh hoc bin tnh cc enzyme dn n tn thng hoc git ch t bo. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml Cc 500ml n v tnh Ci Ci Ci Ci S lng 1 3 3 1 Ghi ch

Trang 52

STT 5 6 7 8 STT 1 2

Tn dng c, thit b mi nhm (3 sinh vin) n cn Que cy Bnh tia a petri Dng c dng chung T m T cy v trng

n v tnh Ci Ci Ci Ci n v tnh Ci Ci

S lng 1 1 1 3 S lng 1 1

Ghi ch

Ghi ch

2.2. Mi trng, ha cht - Mi trng nui cy vi sinh vt: Mi trng cao tht pepton nui cy vi khun - Cn 96o 2.3. Chng ging vi sinh vt - Vi khun: Escherichia coli, Staphylococcus aureus, Clostridium, Acetobacter aceti, Vibrio perfringen 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. Kho st nh hng ca oxy a. Chun b mi trng - Pha ch mi trng cao tht pepton rn mm c hm lng agar 1%. - To mi trng thch su trn ng nghim. - Mi trng sau khi hp tit trng c gi m 40oC trong bp un cch thy. b. Cy vi sinh vt - Dng que cy thng ly sinh khi vi sinh vt, cy m su vo ng thch su. Cm u que cy xung n y mi trng v rt nh nhng ln sao cho sinh khi vi sinh vt c cy theo ng thng t y n b mt mi trng trong ng nghim. - Thc hin vic gieo cy 3 chng vi khun: Clostridium, Escherichia coli v Acetobacter aceti vo 3 ng nghim. - Lm ngui nhanh mi trng bng cch t ng ng nghim vo trong mt cc nc lnh. - m 37oC trong 24-48 gi. - Sau thi gian ny, quan st v ghi nhn v tr sinh khi vi khun trong ng nghim. 3.2. Kho st nh hng ca p sut thm thu a. Chun b mi trng - Chun b mi trng cao tht-pepton b sung mui NaCl ln lt c cc nng : 0%, 5%, 10%, 20%. - Sau khi hp tit trng, rt mi trng vo cc a petri. - Ch cho mi trng ngui v ng c hon ton, lt ngc a petri, dng bt lng du chia a mi trng thnh 4 phn. b. Gieo cy vi sinh vt

Trang 53

- Mi t sinh vin s s dng 2 phn trn mi a petri cy 2 chng vi sinh vt vo: Escherichia coli, Staphylococcus aureus. Cy ria zic-zag vi sinh vt vo mi phn v trnh khng lan ng cy sang nhng phn khc. - Tin hnh cy tng t cho tt c cc a petri c 4 nng khc nhau. - Hp petri sau khi cy xong, c lt ngc v nhit 37oC trong 48 gi. - Sau thi gian ny, tin hnh so snh s sinh trng ca vi sinh vt trn cc mi trng c nng mui NaCl khc nhau. Nhn xt v kh nng chu p sut thm thu ca 2 chng vi sinh vt ni trn. Kh nng sinh trng s c nh gi qua 4 mc: + Khng pht trin: (-) + Pht trin yu: (+) + Pht trin trung bnh: (+ +) + Pht trin tt: (+ + +) 3.3. Kho st nh hng ca pH a. Chun b mi trng - Chun b mi trng cao tht-pepton c iu chnh pH ln lt c cc gi tr: pH 4,5; pH 7; pH 9. - Sau khi hp tit trng, rt mi trng vo cc a petri. - Thc hin o li gi tr pH ca cc mi trng sau khi hp tit trng bng giy o pH. - Ch cho mi trng ngui v ng c hon ton, lt ngc a petri, dng bt lng du chia a mi trng thnh 4 phn. b. Gieo cy vi sinh vt - Mi t sinh vin s s dng 2 phn trn mi a petri cy 2 chng vi sinh vt vo: Escherichia coli, Vibrio perfringen. Cy ria zic-zag vi sinh vt vo mi phn v trnh khng lan ng cy sang nhng phn khc. - Tin hnh cy tng t cho tt c cc a petri c 3 gi tr pH khc nhau. - Hp petri sau khi cy xong, c lt ngc v nhit 37oC trong 48 gi. - Sau thi gian ny, tin hnh so snh s sinh trng ca vi sinh vt trn cc mi trng c gi tr khc nhau. Kh nng sinh trng s c nh gi qua 3 mc: + Khng pht trin: (-) + Pht trin yu: (+) + Pht trin tt: (+ +) 4. Nhng im cn lu - Khi gieo cy vo mi trng thch su, ng cy phi thng, trnh dao ng lm lan vi sinh vt sang nhng vng khc. - mi trng c gi tr pH acid, kh nng ng c ca agar km, do khi cy, trnh lm dao ng mnh mi trng trnh v thch. - nhng mi trng c nng mui cao, sau khi hp tit trng, mt lng nh thnh phn mi trng c th b ta. Khi mi trng vo a petri, cn loi b phn ta ny trnh gy c mi trng trn a petri, nh hng n vic quan st. 5. Bo co thc tp - Trnh by tc ng ca cc yu t mi trng n s sinh trng ca vi sinh vt? - Nhn xt s sinh trng ca vi sinh vt trn cc mi trng c gi tr pH, p sut thm thu v nng oxy khc nhau? Trnh by theo bng sau: Nng NaCl Chng vi sinh vt Escherichia coli Staphylococcus aureus 0% 5% 10% 15% 20%

Trang 54

pH mi trng Chng vi sinh vt Escherichia coli Vibrio perfringen

4,5

Trang 55

BI 10 KHO ST C TNH SINH HA CA VI SINH VT


1. Nguyn tc Mi loi vi sinh vt c nhng c tnh sinh l, sinh ha c trng. Nhng c tnh gip n khc vi nhng loi vi sinh vt khc. Do vy, mun nh danh vi sinh vt, ta cn xc nh mt s c im sinh ha c trng ca chng. Cc c im ny biu hin s trao i cht ca vi sinh vt, th hin qua s chuyn ha cc thnh phn bit ca mi trng dinh dng dng nui cy vi sinh vt (ch yu l hot ng ca enzyme). Cc c tnh sinh ha ca vi sinh vt c th c xc nh da vo nhng mi trng nui cy chuyn bit hoc dng cc b KIT phn tch v gn y l bng cc my phn tch t ng. Kt qu ca mt th nghim xc nh c tnh sinh l, sinh ha ca vi sinh vt hoc l dng tnh (k hiu: +) hoc l m tnh (k hiu: -). Th nghim l dng tnh c ngha l vi sinh vt c th s dng c mt ngun c cht, to thnh mt sn phm, mt enzyme... Nu th nghim l m tnh th ngc li. Kt qu ca th nghim xc nh c tnh ca vi sinh vt c th nhn bit bi s thay i mu ca cc cht ch th, cc thuc th v mt s hin tng khc (hin tng si bt, hin tng ha ng mi trng...) 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 STT 1 2 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml Cc 500ml n cn Que cy Bnh tia a petri Dng c dng chung T m T cy v trng n v tnh Ci Ci Ci Ci Ci Ci Ci Ci n v tnh Ci Ci S lng 1 10 3 1 1 1 1 3 S lng 1 1 Ghi ch Ghi ch

2.2. Mi trng, ha cht - Mi trng nui cy vi sinh vt: Mi trng cao tht pepton nui cy vi khun - Cn 96o - Mi trng Phenol red base broth - ng: glucose, lactose, frutose, saccharose, maltose - Mi trng MR-VP (mi trng Clark Lubs) - Mi trng triptose broth Trang 56

- Mi trng thch ch - Mi trng NB - Mi trng gelatin - Mi trng nitrate broth - Mi trng MIU - Giy th oxidase - H2O2 30% - Mi trng Simmon citrate - Mi trng KIA - Huyt tng th ng kh 2.3. Chng ging vi sinh vt - Vi khun: Escherichia coli, Staphylococcus aureus, Clostridium, Acetobacter aceti, Vibrio perfringen 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc 3. Tin hnh th nghim 3.1. Xc nh kh nng s dng cc ngun cht hydrat carbon Cc vi sinh vt c c trng bng kh nng s dng khc nhau ngun hydrat carbon lm ngun nng lng. Cc th nghim ny nhm xc nh cc vi sinh vt s dng c ngun carbon hydrat no cho qu trnh bin dng ca n. 3.1.1. Kh nng ln men ng Thng s dng cc loi ng glucose, lactose, galactose, frutose, saccharose, maltose, rhamnose, v mt s ru nh glycerin, mannit a. C ch Cc acid + CO2 VSV ng Acid pyruvic Cc acid v khng c CO2 Vi sinh vt c cc enzyme phn gii cc loi ng trn, to cc acid hu c, lm pH ca mi trng nui cy gim, v c th to mt s cht kh nh H2, CO2. pH ca mi trng gim, lm ch th mu phenol red chuyn t sang vng. Cc cht kh sinh ra s tch t vo ng Durham, pht hin c bng mt thng. b.Mi trng - Canh dinh dng (NB) b sung 1% ng, pH 7 ( mi trng ln men ng) hoc mi trng Phenol red base c b sung cc ngun ng cn kim tra. - Ch th mu phenol red. - ng Durham. c. Gieo cy vi sinh vt - Cy vi khun Escherichia coli vo mi trng ln men ng. - em cc ng nghim nhit 37oC trong thi gian 24 gi. - Sau thi gian , tin hnh quan st v c kt qu. d.Kt qu - Ln men, sinh hi: Phenol red trong ng mi trng chuyn t sang vng, ng Durham c hi. K hiu: ( +, H ) hoc (+, G). - Ln men, khng sinh hi: Phenol red trong ng mi trng chuyn t sang vng, ng Durham khng c hi. K hiu: (+). - Khng ln men: Phenol red vn gi nguyn mu . Tt nhin, ng Durham khng c hi. K hiu: (-).

Trang 57

Hnh. Th nghim kh nng ln men ng

3.1.2. Phn ng MR (Methyl Red). a. C ch Mt s nhm ng rut nh E. coli, Salmonella, chuyn ha glucose thnh acid pyruvic.Ri tip tc chuyn ha acid pyruvic thnh ethanol, acid acetic, acid lactic, acid succinic. Cc acid to ra lm pH mi trng gim mnh, pH 4 4,5. pH ny methyl red mu , ngc li, pH cao hn th Methyl red s chuyn sang mu vng.

Hnh. C ch sinh ha ca phn ng methyl red chng E. coli v Enterobacter aerogenes b. Mi trng v thuc th - Mi trng Clark Lubs c pH 7 - Thuc th Methyl red c. Gieo cy vi sinh vt - Cy vi khun E. coli vo mi trng Clark Lubs. - cc ng nghim 37oC trong thi gian 48 gi. - Sau , nh thm vo cc ng nghim 5 10 git methyl red - Quan st v c kt qu. d. c kt qu - Phn ng Methyl red dng tnh: dung dch Methyl red trong mi trng vn gi nguyn mu . K hiu: MR (+). - Phn ng Methyl red m tnh: dung dch Methyl red trong mi trng chuyn t sang vng. K hiu: MR (-).

MR -

MR +

Trang 58

Hnh. Kt qu th nghim methyl red 3.1.3. Phn ng VP (Voges Proskauer) a. C ch Vi sinh vt chuyn ha glucose thnh acid pyruvic. Ri tip tc chuyn ha acid pyruvic thnh acetyl methyl carbinol (AMC). AMC tc dng vi - naphtol trong mi trng kim to thnh diacetyl. Diacetyl phn ng vi nhn guanidine (arginine) c trong pepton cho hp cht mu hng .

Hnh. C ch sinh ha ca th nghim VP b. Mi trng v thuc th - Mi trng Clark Lubs c pH 7 - Thuc th: bao gm hn hp NaOH 40% (KOH 10%) v - naphtol 10% trong cn. c. Gieo cy vi sinh vt - Cy vi khun Bacillus anthracis, B. cereus vo mi trng Clark Lubs. - Cc ng nghim c 37oC trong 24 gi. - Sau thi gian ny, nh vo cc ng nghim khong 10 git NaOH 40%, h nng nh, nh tip khong 10 15 git - naphtol, lcu, yn 5 10 pht. - Quan st v c kt qu. d. c kt qu -Phn ng VP dng tnh: mi trng chuyn mu cam. K hiu: VP(+). -Phn ng VP m tnh: mi trng c mu vng hoc mu nu t. K hiu: VP(-).

VP -

VP +

Hnh. Kt qu th nghim VP 3.2. Xc nh kh nng phn gii cc hp cht cha nitrogen Cc hp cht cha nitrogen thng l ngun cung cp N cho s tng hp protein ca t bo vi sinh vt. Cc vi sinh vt thng sn sinh cc loi enzym tng ng phn gii chng thnh cc cht d s dng nh acid amin, NH 3, ng thi cng c th sinh ra cc cht c tnh c nh Indol, H2S, 3.2.1. Kh nng to indol a. C ch Vi sinh vt tit enzym tryptophanase, chuyn ha tryptophan thnh indol. Indol s kt hp vi para dimethylaminobenzaldehyd trong thuc th Kovacs, to thnh phc cht Trang 59

Rosindol mu . b.Mi trng v thuc th: - Mi trng NB, pH 7 - Thuc th Kovacs. c. Gieo cy vi sinh vt - Cy vi khun E. coli vo canh NB, - Cc ng nghim c 37oC trong thi gian 24h - Sau thi gian ny, nh thm vo mi ng nghim 3 -5 git Kovacs. - Quan st mu ca thuc th v c kt qu.
Indol -

Indol +

Hnh. Kt qu th nghim sinh indol

d. c kt qu - Phn ng indol dng tnh: lp mt mi trng xut hin vng . K hiu: I (+). - Phn ng indol m tnh: lp mt mi trng c mu vng chanh. K hiu: I (-) 3.2.2. S to thnh H2S a. C ch - Vi loi vi khun c kh nng phn gii mt s acid amin cha S nh cystin, cystein, methionin c trong mi trng nui cy, to thnh H2S. C th pht hin H2S bng nhiu cch, phm vi gio trnh ny chn 2 cch. + Vi sinh vt phn gii cc acid amin cha S, to thnh H2S. + H2S sinh ra trong mi trng thch ch (hoc trong mi trng canh, H2S) s kt hp vi Pb(CH3COO)2 to thnh PbS mu en. H2S + Pb(CH3COO)2 PbS ( en ) + 2CH3COOH b. Mi trng v thuc th - Mi trng thch ch hay NB c gi giy tm acetat ch trn ming ng nghim. c. Gieo cy vi sinh vt * Cch 1: mi trng thch ch. - Dng que cy thng cy vi sinh vt vo gia ng nghim. - Cho cc ng nghim vo t m 37oC, trong 24- 48 gi. * Cch 2: mi trng canh NB. - Dng que cy vng ly vi sinh vt cy sang ng nghim mi trng canh NB. - Gi giy lc tm acetat Pb 20% (v khun) vo ming ng nghim, dng bng keo trong bn nh bt kn ming ng nghim. Trong khi thao tc, khng c dung dch mi trng nui cy chm vo giy acetat Pb. Cho vo t m 37oC, trong 24- 48 gi. d. c kt qu - Cch 1: + Mi trng chuyn mu en (+). + Mi trng khng chuyn mu (-). - Cch 2: + Giy tm chuyn mu en (+). + Giy tm khng chuyn mu (-). Trang 60

3.2.3. Kh nng phn gii gelatin a. C ch - Mt s vi khun c kh nng tng hp enzyme gelatinase ngoi bo thy phn gelatin thnh polypeptide v acid amin lm ph hy c tnh ng c ca gelatin ngay khi to < 25oC v ha lng to > 25oC. b. Mi trng MT canh NB b sung 10% gelatin, pH 7. c. Gieo cy vi sinh vt - Dng que cy thng cy vi khun Bacillus cereus hoc Bacillus anthracis vo mi trng. - cc ng nghim 37o trong 24 gi - Thc hin song song vi ng i chng khng cy vi khun. d. c kt qu Sau khi ly ra cho vo ngn di t lnh 30 pht 1gi. - Nu mi trng ha lng ( + ). - Nu mi trng ng c (-).

+ Hnh. Kt qu th nghim phn gii gelatin

3.2.4. Kh nng s dng nitrat ( kh NO3-) a. C ch Mt s vi khun c kh nng s dng nitrat lm ngun nhn hydro c cht trong qu trnh h hp k kh ng thi s dng nitrat lm ngun nit do c kh nng tng hp enzyme nitratreductase. Nitrat b kh thnh nitrit v ri c th b kh tip thnh NH3 hoc N2. b. Gieo cy vi sinh vt - Cy vi khun Staphylococcus aureus hoc E. coli vo mi trng nitrat - cc ng nghim 37o trong 24h. - Ly ra nh vo git thuc th Gress A (acid sulfanilic) v vi git Gress B (naphthylamin ). c. c kt qu - Mi trng c mu hng (+): Trong mi trng xut hin nhm NO2- do NO3chuyn ha. - Mi trng khng i mu (-): Trong mi trng khng c nhm NO2-. Nh vy c 2 kh nng: - Trng hp 1(-): NO3- khng chuyn thnh NO2-. - Trng hp 2(+): NO3- chuyn thnh NO2-, sau nitrit tip tc chuyn thnh NH3 hay N2 nn thuc th Gress A v + Gress B khng pht hin c. Tip tc cho bt km vo, nu xut hin mu th m tnh, nu khng i mu l dng tnh.

Trang 61 Hnh. Kt qu th nghim kh nng s dng nitrat

3.2.5. Kh nng phn gii ur (NH)2CO a. C ch: Vi loi vi khun c kh nng phn gii ur thnh NH 3, do c kh nng tng hp enzyme urease. S ph thch NH3 lm tng pH MT v c th theo di qua s i mu ca cht ch th. b. Mi trng - Mi trng MIU sung ur - Ch th mu phenol red, pH 7,2. c. Gieo cy vi sinh vt - Cy vi khun Proteus spp. vo mi trng - em 37o trong 24 gi. - Sau , ly quan st v c kt qu. d. c kt qu - Phenol red chuyn t hng sang cnh sen (+). - MT khng i mu (-).

Hnh. Kt qu th nghim kh nng phn gii ur

3.3. Xc nh mt s c tnh sinh ha khc 3.3.1. Hot tnh enzym oxydase a. C ch: Cc loi vi khun hiu kh tuyt i c enzym oxydase ( cytochrom oxydase ). C th pht hin Oxydase bng 2 cch. b. Mi trng: MT NA hoc TSA, thuc th l giy tm N-Dimethyl-Para phenylenediamine hay dd thuc th tetra methyl-para phenylenediamine. c. Thao tc Cch 1: Dng que cy vng ly vi khun trong a vi khun nui cy, pht ln giy tm thuc th. c kt qu trong vng 30 giy 1 pht. Cch 2: Dng ng nh git, nh 1 git Tetrs methyl-p-phenylenediamine ln khun lc nui cy vi khun trong a petri. c kt qu t 30 giy 1 pht. d. c kt qu - Phn ng Oxydase dng: que giy tm hoc git thuc th chuyn sang mu tm en. K hiu: Oxydase (+). - Phn ng Oxydase m: que giy vn gi mu trng c, hoc thuc th vn mu hng. K hiu: Oxydase (-).

Trang 62

Hnh. Kt qu th nghim oxidasse 3.3.2. Hot tnh Catalase a.C ch Enzym catalase thng gp vi khun hiu kh tuyt i hay ty nghi. Catalase c kh nng phn gii peroxyt tao O2 v nc. H2O2 H2O + O2 b. Mi trng a thch TSA hoc NA, pH 7,2 cy vi khun Staphyloccus aureus 37oC trong 24 gi. c. Gieo cy vi sinh vt v c kt qu - Dng que cy vng, ly y 1 vng cy vi khun ha vo git H2O2, quan st. - Phn ng Catalase dng: Git H2O2 si bt mnh hoc yu. K hiu: Catalase (+). - Phn ng Catalase m: khng c hin tng si bt. K hiu: Catalase (-). Lu nu l H2O2 3-10% khng y kn, hoc khng bo qun lnh 4 8oC, hoc qu lu, th kt qu s sai (m tnh gi).
catalase

Hnh. Kt qu th nghim catalase 3.3.3. Xc nh kh nng di ng a. C ch Mt s vi khun c tim mao (lagella) nn c kh nng di ng trong mi trng bn lng v lm c mi trng hay mc ging nh r cy xung quanh ng cy. Khi cn c th dng mui tetrazolium trong mi trng th di ng, tuy nhin cht ny c tnh c ch vi loi vi sinh vt. Triphenyltetrazolium chloride (TTC) thng c pha trc vi nng 1%, thanh trng bng mng lc vi khun 0,45m. Vic b sung TTC gip pht hin di ng d dng hn, c bit nhng trng hp kh c kt qu. b. Mi trng: Mi trng bn lng NA, ng. c. Gieo cy vi sinh vt v c kt qu - Dng que cy thng ly vi khun Bacillus subtilis, E.coli hoc Salmonella t ng ng sang ng nghim thch bn lng, trch thng t trn xung di ngay gia ng mi trng. - Cho vo t m 37oC, trong 24 48 gi. c kt qu. - Phn ng di ng dng (+): Vi khun mc lan ra khi ng cy, xa hay gn ty theo kh nng di ng ca vi khun mnh hay yu. - Phn ng di ng m (-): vi khun ch mc trn ng cy. Trang 63

(-)

(+)

(+)

Hnh. Kt qu th nghim kh nng di ng 3.3.4. Xc nh kh nng s dng Citrat a. C ch - Mt s vi sinh vt c enzyme citrat permease c kh nng s dng citrat trong MT c Na.citrat lm ngun cacbon duy nht. - Khi s dng citrat chng gii phng ra mi trng ion Na + lm tng pH ca mi trng. ng thi nhng vi sinh vt c kh nng s dng citrat lm ngun cacbon th cng c kh nng s dng mui amonium v c NH4H2PO4 lm ngun nit to ra NH3 cng lm kim ha mi trng, s thay i pH ca mi trng c nhn bit nh ch th mu Bromothymol blue. b. Mi trng: mi trng Simomns Citrat, ch th mu Bromothymol blue, pH 6.8 c. Gieo cy vi sinh vt: - Cy vi khun Salmonella spp. vo mi trng theo ng zch zc - em 37o trong 24 gi. - Sau thi gian ny, ly c kt qu. d. c kt qu - Phn ng citrat ( +): xanh bromothymol chuyn t mu lc sang mu xanh dng. - Phn ng citrat m (-): xanh bromothymol vn gi mu lc.

Hnh. Kt qu th nghim kh nng s dng citrat

3.3.5. Xc nh kh nng lm ng huyt tng


a. C ch Trang 64

Mt s vi sinh vt c kh nng tng hp enzym coagulase c bit l cc loi thuc ging Staphylococcus, enzyme ny lm ng huyt tng ngi hoc th (enzyme ny l mt protein bn vi to, c tnh khng nguyn yu). b. Mi trng: Huyt tng ngi hay th ng kh dng thng phm. Hoc c th t iu ch nh sau: * Cch ly huyt tng th Dng xylanh v trng ht 0,2ml dung dch khng ng citrat Na 3,8% (v trng), sau rt ly mu tim th. Cho mu vo ng ly tm, ly tm 1500 vng/pht/10 pht. Chit ly dch trong l huyt tng th. c. Gieo cy vi sinh vt v c kt qu - Phn huyt tng vo mi ng nghim nh 0,5ml. Cy vi sinh vt cn kim tra vo. o 37 trong thi gian 4-24 gi. Ly c kt qu. - Phn ng Coagulase (+): huyt tng th ng li t gi th 4, th 8, th 12 hoc 24 gi. Phn ng ng t m (-): huyt tng vn lng sau 24 gi nui cy (nh ng i chng).

+
Hnh. Kt qu th nghim kh nng lm ng huyt tng 3.3.6.Th nghim KIA (Kligler Iron Agar), TSI (Triple Sugar Iron Agar) a. C ch c s dng th nghim ng thi 2 kh nng: cc ngun cacbon khc nhau(glucose,lactose) v kh nng sinh H2S ca vi sinh vt. Khi cy vi sinh vt trn mi trng ny, c 3 trng hp xy ra: Ch s dng glucose: sau 18- 24h nui cy phn nghing ( b mt) tr nn c pH kim v phn ng (phn su trong ng nghim) c pH acid. Do glucose trn b mt ca mi trng c vi sinh vt oxi ha hon ton thnh CO2 v H2O thu ly nng lng. p ng nhu cu nng lng trong tng trng, vi sinh vt tip tc d ha peptone qua gii phng NH3 lm phn b mt ca mi trng c pH kim. Trong khi , phn su trong mi trng c iu kin oxy khng y , glucose c ln men k kh sinh cc acid hu c lm pH mi trng gim. S dng c glucose v lactose: sau 18-24 gi ton b mi trng u tr nn c pH acid v s bin dng ng thi c 2 loi ng gip vi sinh vt nng lng tng trng m cha cn s dng n peptone. Nu ko di thi gian nui cy qu 24 gi, b mt mi trng s tr nn kim do ht ngun cacbon v vi sinh vt phi s dng n peptone. Khng s dng glucose, lactose: vi sinh vt s bin dng peptone thu ly nng lng v vt cht cho s tng trng. Tuy nhin, do peptone ch c bin dng trong iu kin hiu kh nn hin tng kim ha mi trng ch din ra trn b mt ca mi trng. Kh nng sinh H2S: do trong mi trng sodium thiosulfat, vi sinh vt kh sunfate c th kh cht ny, nh c enzyme thiosunfat reductase gii phng H2S, H2S s phn ng vi ion Fe2+ ca ch th ferric ammonium citrate to kt ta mu en FeS. Trong cc trng hp trn, Nu s ln men ng to sn phm kh, th kh s kt t Trang 65

thnh bt kh trong ng nghim hay s lm v thch b. Mi trng - Mi trng KIA cha 2 loi ng o.1% glucose, 1% lactose. - Tng t, mi trng TSI c thnh phn nh mi trng KIA nhng c thm 1% sucrose (saccharose). c. Gieo cy vi sinh vt - Dng que cy thng ly sinh khi Salmonella. E.coli, Shigella cy thng su vo ng nghim nhng trnh chm y ng,sau ria trn b mt thch nghing. - 37oC trong18-24 gi d. c kt qu - / vng (kim/ acid): ch ln men ng glucose - Vng/ vng (acid/ acid): ln men glucose v lactose - Mi trng vn , phn b mt m hn so vi s bin dng peptone: khng ln men glucose v lactose - Nu trong ng nghim sinh kt ta mu en: c kh nng sinh H2S. - Nu c s tch ly kh, lm v khi thch hoc y khi thch kn: c kh nng sinh hi.

Hnh. Kt qu th nghim KIA 4. Nhng im cn lu - Cc chng vi sinh vt s dng kho st cc c tnh sinh ha phi c tui sinh trng nht nh 18 24 gi. Nhng chng gi ci, c th c nhng c tnh khng ng c trng. - vic nhn nh kt qu chnh xc nht, cc th nghim phi c c kt qu ng thi gian quy nh. - Mt s mi trng th nghim c ch th mu thay i theo pH, cn iu chnh pH mi trng ban u chnh xc. 5. Bo co thc tp - Trnh by ngha ca cc th nghim xc nh c tnh sinh ha ca vi sinh vt? - Gii thch c ch ca cc th nghim xc nh c tnh ca vi sinh vt?

Trang 66

BI 11 KIM SOT S SINH TRNG CA VI SINH VT


1. Nguyn tc S sinh trng ca vi sinh vt b gii hn bi mt s yu t ha l ca mi trng nh nhit , nng lng chiu x, ha cht..., da vo con ngi c th kim sot c s sinh trng ca vi sinh vt khng mong mun. Nhit cc oan c s dng rng ri kim sot vi sinh vt. Nhit cao c th tiu dit vi sinh vt do tc dng lm bin tnh enzym, mt nc v oxy ha cc thnh phn ca t bo. Nhit thp c ch s sinh trng ca chng. C th kh trng nhit cao bng phng php nhit kh hoc nhit m. Nng lng chiu x bc sng ngn (tia X, tia gamma) c kh nng ion ha phn t nc, to cc gc t do c tc dng ph hy DNA, mng lipid, protein trong t bo. Tia bc x c bc sng di hn nh tia t ngoi khng c tc dng ion ha nhng c th cm ng hnh thnh dimer ga cc base T trong acid nucleic to t bin, c th gy cht t bo. Ngoi ra, nhiu cht ha hc c kh nng kim sot s sinh trng cua vi sinh vt nh ethylen oxide, triethyl glycol, cht dit khun, cht khng sinh... Cht khng sinh l sn phm chuyn ha c to thnh bi mt nhm cc vi sinh vt, c tc dng c ch s tng trng hoc tiu dit vi sinh vt khc. Ngy nay, khng sinh c s dng ph bin trong y hc iu tr cc bnh gy ra bi vi sinh vt. Vic la chn mt cht khng sinh iu tr bnh ph thuc vo cc yu t: (1) mn cm ca vi sinh vt gy bnh i vi cht khng sinh; (2) tc dng ph ca cht khng sinh ln t bo v ln h vi sinh vt ng rut; (3) tc chuyn ha lm mt hot tnh cht khng sinh trong c th; (4) c tnh ha hc ca cht khng sinh cho php vn chuyn v tnh t ti c quan mc tiu tiu dit vi sinh vt. Tnh mn cm ca vi sinh vt i vi khng sinh c th c xc nh bng k thut khnh sinh (v d: phng php khuch tn khng sinh trn thch Kirby Bauer hoc phng php MIC pha long khng sinh lin tip tm nng c ch ti thiu...).

Hnh. S i khng ca cht khng sinh nm mc i vi vi khun 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim n v tnh Ci S lng 1 Trang 67 Ghi ch

STT 2 3 4 5 6 7 8 STT 1 2

Tn dng c, thit b mi nhm (3 sinh vin) ng nghim 18 Cc 100ml Cc 500ml n cn Que cy Bnh tia a petri Dng c dng chung T m T cy v trng

n v tnh Ci Ci Ci Ci Ci Ci Ci n v tnh Ci Ci

S lng 3 3 1 1 1 1 10 S lng 1 1

Ghi ch

Ghi ch

2.2. Mi trng, ha cht - Mi trng nui cy vi sinh vt: Mi trng cao tht-pepton - Mi trng nui cy vi sinh vt lm khng sinh : Mi trng Mueller Hinton - Cn 96o - a giy tm khng sinh: ampicillin, streptomycin, chloramphenicol, kanamycin, tetracyclin, penicillin. 2.3. Chng ging vi sinh vt - Vi khun: Escherichia coli, Staphylococcus aureus 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc - Tm bng v trng 3. Tin hnh th nghim 3.1. Kim sot s sinh trng ca vi sinh vt bng tia UV a. Chun b n UV - n UV t p, cch vt chiu 10cm trong bung chiu. Dng vi dy, xm mu che chn k, trnh tia UV chiu vo mt (c th nhn qua knh thy tinh). - Bt n cho n nh 30 pht trc khi chiu. b. Thc hin chiu x - Thc hin ht 1ml dch huyn ph vi khun E. coli cho vo hp petri v trng cha 9ml NaCl 0,9% c c t. - t hp petri ln my khuy t di hp n UV trong bung chiu. iu chnh tc ca c t mc va phi. - M np hp petri, dung micropipette vi u tip v trng thu 0,2ml dch huyn ph t bo vo mt ng Eppendorff. nh s 0 ln np ng. - Tip tc thu mu nh trn sau mi 5 pht chiu x cho n 30 pht. Ghi nhn thi gian chiu x ln np ng Eppendorff cha mu. c. Kim tra kh nng sng st ca vi khun - Chuyn v trng 0,1ml huyn ph t bo c chiu x 0, 5, 10, 15, 20, 25, 30 ln Trang 68

hp petri cha mi trng cao tht-pepton. - Dng que tri thy tinh v trng tri u dch vi khun ln khp b mt thch. - Nui trong ti trong thi gian 24 gi. - Ghi nhn s sinh trng v m s khun lc trn mi a. 3.2. c ch s sinh trng ca vi sinh vt bng cht khng sinh - Mi t sinh vin chun b sn 2 a petri cha mi trng Mueller Hinton. Mi a s dng cy mt chng vi khun l E.coli v Staphylococcus aureus. - Trong iu kin v trng, nhng u tm bng v trng vo ng ging vi khun (mi trng nui cy dng lng). Vt dch ging vi khun tha bng cch p v xoay u que tm bng vo thnh ng nghim pha trn mc dung dch trong ng. - Chuyn u tm bng sang a petri, bi u u tm bng ln b mt mi trng, kh trong 5 pht. Dng mt que tm bng v mt hp petri ring cho mi ging vi khun. - Dng bt nh du chia hp petri thnh 6 phn bng nhau. - Dng kp inox v trng, gp v t mt a giy tm khng sinh vo mt phn trn a petri. Mi phn dng cho mt loi khng sinh ring. Ghi ch tn khng sinh mi phn a. - cc a 370C trong 24-48 gi. - Sau thi gian ny, quan st v o ng knh vng v khun to ra quanh a giy khng sinh.

Hnh. a khng sinh th nghim tnh mn cm ca vi khun vi cht khng sinh 4. Nhng im cn lu - Trnh nhn trc tip tia UV. Phi eo knh lc tia UV v mang gng tay khi thc hin chiu x. - Cc que tm bng sau khi cy dch vi khun ln a petri phi c gom chung v hp kh trng trc khi loi b. - Ghi ch cn thn v tr ca cc a giy tm cc cht khng sinh khc nhau trnh nhm ln v kt qu kho st khng sinh . 5. Bo co thc tp - Trnh by c ch tiu dit vi sinh vt bi cht khng sinh? - Xc nh s lng khun lc trn cc a petri c chiu x vi thi gian khc nhau? Xc nh thi gian chiu x lm vi khun cht hon ton Trang 69

- o ng knh vng v khun ca hai loi vi khun theo cc khng sinh khc nhau? Nhn xt v tnh mn cm trn mi khng sinh ca mi vi sinh vt?

Trang 70

BI 12 XC NH KH NNG PHN GII CELLULOSE V HOT TNH ENZYME CELLULASE CA VI SINH VT


1. Nguyn tc Cellulose l thnh phn cu to c bn ca thnh t bo thc vt. Hng nm c mt lng ln cellulose c a vo trong t di dng cht thi hu c. Mc d l mt hp cht cao phn t kh bn, chng vn b phn gii mnh di nh hng ca mt s vi sinh vt trong iu kin k kh ln hiu kh, mi trng kim hay acid, m cao hoc thp cc iu kin khc nhau. Hot ng phn gii cellulose v vai tr ca vi sinh vt phn gii cellulose c nh hng ln n ph nhiu cho t v c tm quan trng c bit i vi vng tun hon carbon. Ngoi ra qu trnh phn gii cellulose ca vi sinh vt cn c ngha quan trng trong qu trnh x l cht thi c ngun gc hu c giu cellulose. Trong iu kin hiu kh, cc vi sinh vt tham gia vo vic phn gii cellulose gm nim vi khun, vi khun, x khun, nm. Chng tng hp enzyme cellulase thy phn cellulose nh sau: (C6H10O5)n + H2O + xO2 R-CHOH COOH + O2 CO2 + H2O + xKc Trong iu kin k kh, vi sinh vt sn xut enzym cellulase phn gii cellulose. Di tc dng ca cellulase v cellobiase, cellulose s c bin thnh glucose. (C6H10O5)n + 1/2nH2O + xO2 1/2n C12H22O11 Cellulose C12H22O11 + 1/2nH2O Cellobias e Cellobiose C6H12O6 Glucose Glucose s c tip tc ln men to thnh nhiu sn phm khc nh acid butyric, acid acetic, CO2, H2, CH4... nC6H12O6 CH3CH2CH2COOH + CH3COOH + H2 + CO2 + xC nC6H12O6 CH3CH2CH2COOH + CH3COOH + CO2 + CH4 + Xc Trong iu kin khng kh b hn ch, cc vi khun a m hoc a nng thuc nhm Clostridium v Bacillus s tin hnh phn gii cellulose. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Cc 100ml n v tnh Ci Ci Ci S lng 1 3 3 Ghi ch

Trang 71

STT 4 5 6

Tn dng c, thit b mi nhm (3 sinh vin) Cc 500ml n cn Que cy Knh hin vi Lame v lamelle

n v tnh Ci Ci Ci Ci Tm Ci Ci n v tnh Ci Ci

S lng 1 1 1 1 2 1 3 S lng 1 1

Ghi ch

7 8 STT 1 2

Bnh tia a petri Dng c dng chung T m T cy v trng

Ghi ch

2.2. Mi trng, ha cht - Mi trng nui cy vi sinh vt: Mi trng cao tht pepton nui cy vi khun - Cn 96o - Du soi knh - Xanh metylen - Lugol - Mi trng Vinogratxki: + KNO3: 2,5g + KH2PO4: 1,0g + MgSO4: 0,5g + NaCl: 0,5g + FeSO4: 0,01g + Mn2(SO4)3: 0,001g + Nc ct 1000 ml Phi trn cc thnh phn, iu chnh pH7,00,2. Phn phi vo cc dng c cha. Hp tit trng nhit 1210C trong 30 pht. 2.4. Nguyn liu khc - Giy lc - Bng khng thm - Bng thm nc - t vn 3. Tin hnh th nghim Trang 72

3.1. Xc nh qu trnh phn gii hiu kh cellulose bi vi sinh vt - Cho vo ng nghim 4 - 5 ml mi trng Vinogratxki. - Nhng vo dung dch trong ng nghim mt di giy lc (20 x 1,5 cm) - Dng kp st hoc si ch kp mt u di giy vo ming ng nghim. ng nghim mi trng c hp tit trng nhit 1210C trong 30 pht - Cho vo ng nghim mt cc t nh (ngun vi sinh vt) ri t ng nghim vo t m, gi 300C trong 7 - 15 ngy. - Cc vi sinh vt phn gii cellulose pht trin, tit ra enzym cellulase lm cho giy b phn hu, ho nhy c mu vng, hng, lc, cht nhy c mu sc chnh l khun lc ca vi khun. - Xc nh cc i tng vi sinh vt tham gia qu trnh phn gii hiu kh cellulose. quan st hnh thi cc vi sinh vt hiu kh tham gia vo qu trnh phn gii ny ta lm tiu bn t cc cht nhy trn b mt giy lc. - Nhum n vt bi bng Fuchsin. - Quan st tiu bn di knh hin vi vi vt knh du (x 100). 3.2. Xc nh qu trnh phn gii k kh cellulose bi vi sinh vt - Cho vo ng nghim 10ml mi trng c thnh phn nh sau: + NH4PO4: 2,0g + KH2PO4: 1,0g + CaCl2: 0,3g + Peptone: 1g + MgSO4: 0,5g + CaCO3: 5,0g - Cho mt di giy lc (10 cm x 1,5 cm) ngp trong ng nghim c mi trng. - Hp tit trng nhit 1210C trong 30 pht. B vo mt cc t nh cy ngun vi sinh vt c bo t. - t m 300C v 600C trong 1 - 2 tun. - Vi khun phn gii Xenlulose k kh pht trin 600C s lm cho mi trng c ln, phin giy lc c mu vng, nhy v nt vn dn ra. - Xc nh thnh phn loi vi sinh vt phn gii cellulose k kh. - Lm tiu bn t ch nhy ca giy v nhum n bng Fuchsin. - Quan st tiu bn di knh hin vi vi vt knh du (x 100). 3.3. Xc nh hot tnh enzym cellulase ca vi sinh vt a. Chng vi sinh vt - Th nghim c tin hnh trn cc chng vi sinh vt: - Nm mc: Penicillium, Aspergillus, Trichoderma - X khun: Streptomyces sp. - Nm men: Saccharomyces sp. b. Mi trng nui cy: Trang 73

Mi trng kim tra kh nng sinh enzym c thnh phn: + NaNO3 + K2HPO4 + KCl + MgSO4.7H2O 3g 1g 0,5g 0,5g + FeSO4 + CMC + Agar 0,01g 5g 20g

+ Nc ct 1000ml

- Cch pha ch: Ha tinh bt tan vo nc m, khuy u, un thnh h ri vo hn hp lm mi trng. iu chnh pH = 5,5 nu cy nm mc, pH = 6,8 - 7,2 nu cy x khun. Kh trng mi trng 1210C/30 pht. Phn phi mi trng vo hp petri, ngui. c. Cy cc chng vi sinh vt kim tra kh nng hnh thnh enzym cellulase - Dng que cy hnh thc th ly ging vi sinh vt cy vo tm ca a mi trng thch mt im. Mi a thch cy t 1 chng. - cc hp petri cy vo t m nhit 300C. d. Xc nh hot tnh enzym cellulase - Chng vi sinh vt va phn lp c nui cy trong mi trng thch hp pht trin thnh khun lc. - Cc enzym c trng c chng tit ra mi trng xung quanh di dng vng trong sut bao quanh khun lc gi l vng thy phn. - Cn c t l vng thy phn v ng knh ca khun lc nh gi kh nng hnh thnh enzym ca chng vi sinh vt (hot tnh enzym ca vi sinh vt). - Dng thc k c chia mm, o ng knh ca khun lc vi sinh vt pht trin trn a mi trng. Ghi ch l d (mm) - dung dch lugol ln mt thch mi trng - Enzym cellulase tit ra mi trng s lm phn gii tinh bt phn xung quanh cc khun lc to thnh vng thy phn khng mu. Phn cn li s c mu xanh. - Dng thc o ng knh vng thy phn. Ghi ch l D (mm). (Ch : o mt sau hp petri v o bng mm).

Khun lc

Vng phn gii

d D Vng khng phn gii

Hnh. Phng php xc nh hot tnh enzym ca vi sinh vt bng vng phn gii - Tnh t l D/d. T s ny c gi tr cng cao chng t hot tnh enzym ca chng vi sinh vt cng mnh . Trang 74

- Ta ghi nhn kt qu theo mu bng sau: Chn g Vi sinh vt Quan st ln 1 Thi gian nui D d D / d Quan st ln 2 Thi gian nui D d D/d Nhn xt v kt lun

4. Nhng im cn lu - Phi o ng knh khun lc trc khi cho dung dch lugol vo a Petri o ng knh vng phn gii. - Khi o kch thc khun lc, tin hnh o mt di ca a Petri. - Khi cy sinh khi vi sinh vt vo a petri, cy vo tm a v hn ch s ri vi ca vi sinh vt ra nhng vng mi trng khc trn a (nht l i vi bo t nm mc) trnh hin tng mc lan ca khun lc vi sinh vt dn n khng xc nh c vng phn gii. 5. Bo co thc tp - Trnh by hot tnh ca enzym cellulase v c ch phn gii cellulose bi vi sinh vt? - Trnh by phng php xc nh kh nng phn gii cellulose bi vi sinh vt? - Nhn xt kh nng phn gii cellulose ca cc vi sinh vt trong mi trng t? - V hnh tiu bn nhum Gram ca cc vi sinh vt phn gii cellulose trong t? - o kch thc khun lc, kch thc vng phn gii. So snh hot tnh enzym cellulase ca cc chng vi sinh vt th nghim?

Trang 75

BI 13 NH LNG VI SINH VT BNG PHNG PHP M TRC TIP


1. Nguyn tc Phng php m trc tip l phng php nh lng da trn s quan st v m trc tip s lng t bo vi sinh vt bng knh hin vi v bung m. Phng php ny dng xc nh s lng cc loi vi sinh vt n bo c kch thc ln: nm men, to n bo, bo t mc d quan st trn knh hin vi.. Quy trnh m n gin, cho php xc nh nhanh chng s lng vi sinh vt. Tuy nhin, do quan st v m bng mt trn knh hin vi, phng php ny c mt s tr ngi: - Khng phn bit c t bo vi sinh vt sng v cht trong mu. - Khng phn bit c cc t bo vi sinh vt v ht vt th - Hn ch i vi huyn ph c mt thp do lng dung dch em m nh. Ty mc hin din ca vi sinh vt trong mu ban u, dung dch em m cn c pha long n mc ph hp (s t bo trong mt nh khng qu 10 t bo). Nguyn tc pha long: - Mu phi c pha long. Tu theo mc nhim khun ca mu ta c s c lng pha long 1/5; 1/10 ; 1/20 hay 1/10; 1/100; 1/1000.. - Dung dch dng pha long mu thng l NaCl 9% hay photphat m c v trng. - Cch pha: + Mu 1/5 : 1ml mu + 4ml NaCl 9% + Mu 1/10: 1ml mu + 9ml NaCl 9%0 - T mu 1/10(10-1) ly 1ml + 9ml NaCl 9% ta c pha long 10-2 , c nh vy ta c cc pha long tip theo 10-3, 10-4.. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 1 2 3 4 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Bnh tam gic Cc 100ml Bnh tia Pipette 1ml Bung m vi sinh vt Lamelle n v tnh Ci Ci Ci Ci Ci Ci Ci Ci S lng 1 2 1 1 1 2 1 1 Ghi ch

Trang 76

STT 5 6 7 STT 1 2

Tn dng c, thit b mi nhm (3 sinh vin) Que cy n cn Knh hin vi Dng c dng chung Ni hp cao p T sy

n v tnh Ci Ci Ci n v tnh Ci Ci

S lng 1 1 1 S lng 1 1

Ghi ch

Ghi ch

2.2. Mi trng v ho cht - Nc mui sinh l 0,9% - Nc ct v trng. - Cn 96o 2.3. Nguyn liu khc - Chng nm men: Saccharomyces cerevisiae - Bnh men thuc bc - Qu nho - Mu nc ao, h dng m s lng to n bo 3. Tin hnh th nghim 3.1. m trn lam pht knh: Tiu bn vi khun c nhum mu (nhum n).

D
20mm

= 30 - 50 Hnh. Din tch hnh vung pht knh Hnh. S di chuyn vt knh trong pht knh

a. Pht knh - Dng lam sch v bt ch m (bt lng kim), k mt hnh vung S = 400 mm2, mt trn lam. Mc ch khng cho vi khun lan ra khi din tch m. - Ht V (0.02 0.2 ml) dung dch pha long , nh vo gia hnh vung, mt trn lam. - t que cy, ngui, dng cnh vng cy u que dn u git mu ra xung quanh, va chm vo cnh hnh vung. - C nh tiu bn, nhum n bng thuc nhum blue methylen. - Nh mt git du soi, xem vt knh x100. b. Cch m - m s t bo vi sinh vt/ 1VT (VT: vi trng). - m ht tt c t 30 50 VT/ hnh vung pht knh. Theo s hnh v. Trang 77

c. Cng thc tnh S t bo/ml mu = (X x 400)/(0.0004 x V x H) X: S t bo vi khun m c trong mt vi trng 400: din tch hnh vung pht knh, bng 400mm 0.0004: din tch vi trng vt knh X100, R2= 0.0004mm2 V = th tch git vi khun pht knh H = h s pha long mu 3.2. m trong bung m a.Cu to bung m.

S vi trng c c trong S:4cm2

Tn ca loi bung m. Rnh bung m, ni cho dd vo Khung m Chiu cao ca 1 nh(1/10) Din tch ca 1 nh(1/400) Hnh. Bung m t bo vi sinh vt - Bung m l mt phin knh trong, dy, hnh ch nht. - Gia l phn lm phng, c k mt hoc hai khung m gm 400 nh. Bn ngoi c ghi tn loi bung m, v ghi cc thng s k thut nh hnh trn. b.Cu to khung m.

Rnh trn Hnh.

L knh Cu DchKhung m Thoma to mu

Trang 78
Li m vi sinh vt

Hnh. Bung m nhn mt bn Cu to mt khung m c: - Trng hp1: 1 khung c 16 ln, 1 ln c 25 nh. Vy 1 khung c 400 nh. - Trng hp 2: 1 khung c 25 ln, 1 ln c 16 nh. Vy 1 khung c 400 nh. - Din tch 1 nh l 1/400 mm2. Vy V nh = 0.1 mm x 1/400 mm2 = 1/4000mm3. c. Cch tin hnh.

Hnh. Cch np mu dung dch vi sinh vt vo bung m - t lamelle sch ph ln khung m. - Dng ng nh git ht dung dch nm men pha long, b i vi git u, bm nh vo rnh bung m, dung dch thm vo k bung m v lamelle. - Dung dch chy trn t t vo cc rnh, lan ta lp y khp lamelle, hi tha mt t. Nu b bt mc li trong lamelle th phi lm li. - t bung m ln bn kp ca knh hin vi, dng kp c nh bung m. - Thao tc knh hin vi, dng vt knh x10 iu chnh s b trc, sau dng vt knh x40 m. - m s t bo trong 5 ln (4 cnh, 1 gia), m ln lt tng nh trong 1 ln. Trong tt c cc nh cn m s t bo nm hn trong trc, sau m s t bo nm cnh pha trn v cnh bn tri ca . - m tt c 80 nh c trong 5 ln (Trng hp: 1 ln c 16 nh). - Hoc m 125 nh c trong 5 ln (Trng hp: 1 ln c 25 nh). d.Cng thc tnh. Trong trng hp bung m vi ln c 16 nh, s lng t bo trong mu ban u Trang 79

c tnh nh sau: S t bo/1 ml mu = (a x 250 x 1.000)/H Trong : a = s t bo trung bnh c trong 1 ln. 1.000 = s qui i t 1mm3 thnh 1ml (1ml = 1.000 mm3) H = h s pha long (v d: H = 10-2)

Hnh. Phng php m trc tip s lng to trong bung m

Hnh. Nhng t bo c m (mu en) v khng c m (mu xanh) trong 1 ln 4. Nhng im cn lu - Ch m c tng s t bo, khng th bit t bo no cn sng, t bo no cht. Trang 80

- Nng dch huyn ph pha long sao cho mt mi nh khng qu 10 t bo. - S dng xong phi ra bung m ngay v lau kh. - t chnh xc cao, th s t bo trung bnh m c trong 1 nh: 2.5 < a <10. 5. Bo cc thc tp - Trnh by nguyn tc v cch tin hnh ca phng php nh lng vi sinh vt bng phng php m trc tip? - Xc nh s lng to n bo trong 1ml mu thc phm phng php m trc tip? - Phng php nh lng vi sinh vt bng cch m trc tip thng p dng cho nhng i tng vi sinh vt no? Gii thch?

Trang 81

BI 14 NH LNG TNG VI KHUN HIU KH TRONG THC PHM BNG PHNG PHP M KHUN LC
1. Nguyn tc Tng vi khun hiu kh l tng s cc loi vi khun thuc nhm vi khun hiu kh tn ti trong mi trng. Trong qu trnh sinh trng v pht trin, nhm vi khun ny cn oxy cho qu trnh h hp hiu kh chuyn ha cc hp cht hu c thnh nng lng ATP cung cp cho hot ng ca chng. Cc nhm vi sinh vt hiu kh tn ti trong mi trng nc chng s phn gii tch cc cc hp cht hu c to thnh nhng sn phm cui cng l CO 2 v gii phng ATP. Tng s vi khun hiu kh l mt trong nhng tiu ch nh gi mc an ton v sinh thc phm ca thc phm. V hu nh trong tt c cc loi thc phm, nc ung, khi phn tch cht lng vi sinh vt, ch tiu tng vi khun hiu kh l bt buc phi phn tch.Cc b tiu chun v thc phm, nc ung lun c mc gii hn cho tiu chun ny. V d: theo tiu chun TCVN 7046 : 2002 ginh cho sn phm tht ti, ch tiu tng s vi khun hiu kh l: 106 khun lc/1g tht. Nu vt qu gii hn, thc phm c xem l khng an ton cho ngi s dng. Tng s cc nhm vi khun hiu kh trong mu thc phm c th c xc nh bng phng php nui cy tri trn b mt thch hoc bng phng php to hp . Thng qua s lng khun lc m c trn cc a petri cho php xc nh c lng vi sinh vt sng cn kh nng sinh trng trong mu ban u. Phng php nh lng ny da trn nguyn tc: mt vi sinh sng, trn mi trng dinh dng, sau mt khong thi gian xc nh s pht trin v hnh thnh nn mt khun lc. Tuy nhin, kt qu m chnh xc nht, s lng khun lc trn a petri phi trong gii hn nht nh. V d, nu lng mu cy vo a l 1ml th s lng khun lc vi khun trong a phi trong gii hn 25-250 khun lc, i vi nm mc l 30-50 khun lc... Nu s lng vt qu gii hn th phi tin hnh pha long v chn nhng pha long ln hn. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 9 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Bnh tam gic 250ml Cc 100ml Bnh tia Pipette 1ml Pipette 10ml Que tri n cn n v tnh Ci Ci Ci Ci Ci Ci Ci Ci Ci S lng 1 6 1 1 1 5 1 1 1 Trang 82 Ghi ch

STT 10 STT 1 2 3 4 5

Tn dng c, thit b mi nhm (3 sinh vin) Que cy Dng c dng chung Ni hp cao p T cy v trng T sy My dp mu Bt m khun lc

n v tnh Ci n v tnh Ci Ci Ci Ci Ci

S lng 1 S lng 1 1 1 1 1

Ghi ch

Ghi ch

2.2. Mi trng v ho cht - Mi trng Plate count agar (PCA) + Casein peptone: 5,0g + Cao nm men: 2,5g + Dextrose: 1,0g + Agar: 15,0g + Nc ct 1000ml Cn y cc thnh phn mi trng, phi trn, iu chnh pH=7,00,2. Nu si nh cho tan agar. Phn phi mi trng vo bnh tam gic. Hp tit trng 121 0C/20 pht, m (45-500C) phn phi vo cc a Petri. - Nc mui sinh l 0,9% - Nc ct v trng. - Cn 96o 2.3. Nguyn liu khc - Nc ma - Tht ti - Ti nilon dp mu 3. Tin hnh th nghim 3.1. Ly mu - Ty theo loi vt phm cn xc nh m ta ly mu nghin cu vi s lng v khi lng khc nhau cho ph hp. - Qu trnh ly mu c nhng yu cu sau: + Ly cc mu c tnh cht i din, lng mu va . + Dng c ly mu, cha mu phi v trng. + Mu lt xong, phi phn tch ngay, khng c qu 24h. + Mu ly phi c nhn ghi k hiu ng thi phi ghi vo s nhng c im ca mu v ni thu mu. 3.2. Pha long mu - Chun b mt s bnh tam gic cha 90ml nc mui sinh l 0,9% hoc nc peptone 1,0% v trng, mt s ng nghim cha 9ml nc mui hoc nc peptone v trng v mt s pipet 1ml v trng. * Vi mu dng lng - Ht 1ml mu nghin cu cho vo ng nghim c 9ml nc mui sinh l v trng. Trn u dung dch bng cch ht ln, thi xung 3 - 5 ln. Ta c pha long 1/10 hay 10-1. Trang 83

- Tip tc ht 1ml ng nghim 1 cho vo ng nghim c 9ml nc mui sinh l v trng th 2. Trn u dung dch bng cch ht ln, thi xung 3 - 5 ln. Ta c pha long 1/100 hay 10-2. - Tip tc nh vy ht t ng 2 sang ng 3, t ng 3 sang ng 4 ta s c c cc pha long tng ng 10-3, 10-4.

ng nui cy ban u (ng gc)

T l pha long pha long

10-1 101

10-2 102

10-3 103

10-4 104

10-5 105 pha long cui

Hnh. Phng php pha long bc 10 dung dch huyn ph (pha long thp phn) * Vi mu dng c Chun b 2 bnh tamgic c dung tch 250ml: - Bnh 1 cha 90ml nc mui sinh l hoc nc peptone 1,0% v trng. - Bnh 2 v trng v khng cha g c. - Cho mt t cn vo ci chy s v t ln kh trng. ngui. - Cn 10g mu, cho vo ci chy s, nghin nt mu hoc ng nht mu trong ti dp mu vi my dp mu - Dng ton b nc bnh 1 chuyn mu sang bnh 2. Lc 5 pht. - lng 30 giy ri tip tc pha long nh trong trng hp mu trng thi lng. - Ty theo s c on s lng vi sinh vt trong mu m pha long nhiu hay t. - Sau khi c pha long thch hp th tin hnh xc nh s lng vi sinh vt. 3.3. Xc nh gin tip s lng t bo bng cch m s lng cc khun lc mc trn mi trng thch (ISO 4833:1991) a. Nguyn tc - Cy mt th tch xc nh huyn ph cn nghin cu ln mi trng c trng trn hp petri. - Xc nh s lng t bo bng cch m s lng khun lc mc ln sau thi gian nui cy v mi khun lc l kt qu ca s pht trin ca mt t bo. b. Cch cy mu * Cy theo phng php to hp - Pha long dch huyn ph cc nng khc nhau: 10-3, 10-4 , 10-5 cy mu. - Ghi vo np hp petri c mi trng thch cc thng tin: nng pha long, ngy cy - Dng pipet v trng ly 1ml dch huyn ph cho vo mi a petri ( v trng). - Cho khong 15ml mi trng PCA nhit khong 45 0C vo hp petri. Xoay chm cho hn hp trn u. yn cho ngui. Lt ngc cho vo t m. Nui cy 300C trong 72 gi. Trang 84

- Mi mu cy 3 nng . Mi nng cy 3 hp petri. - Sau ly ra kim tra kt qu.


1 ml Dung dch mu pha long 45oC

PCA
10 -15 ml

a petri v trng
L

c g tn

Lc u a petri ngui

30oC/3 ngy

m s khun lc v tnh kt qu
Hnh. Quy trnh to hp * Phng php cy b mt - Dch huyn ph c chun b tng t nh phng php to hp . - Mi trng PCA sau khi hp tit trng, c lm ngui n khong 50-600C sau vo a Petri v trng. - a Petri cha mi trng c lm kh b mt bng cch sy trong t sy nhit 350C hoc chun b trc 2 ngy. - Dng pipet v trng ht chnh xc 0,1ml hoc 0,3ml nh ln b mt mi trng trong a petri. - Tri u dung dch vi sinh vt ln b mt mi trng bng que tri tam gic thy tinh. - Cc a petri c nhit phng 15-20 pht cho kh b mt. Lt ngc cho vo t m. Nui cy 300C trong 72 gi. - Mi mu cy 3 nng . Mi nng cy 3 hp petri. - Sau ly ra kim tra kt qu.

Trang 85

Hnh. Phng php cy tri b mt c. Cch m - Ly bt ch k 2 ng vung gc y hp petri v nh du th t tng vng I, II, III, IV. - m s lng khun lc tng vng. Nh nh du cc khun lc m. - S lng t bo trong mt gram mu c tnh theo cng thc sau y: C N (CFU / ghayCFU / ml ) = (n1vd1 + ... + ni vd i ) Vi : N: s t bo (n v hnh thnh khun lc) vi khun trong 1g hay 1ml mu. CFU: colony form units) C: Tng s khun lc m c trn cc hp petri chn (c s khun lc nm trong khong t 25-250 khun lc/a) ni : S hp petri cy ti pha long th i di: h s pha long tng ng. v: th tch dch mu (ml) cy vo trong mi a V d: trong mt trng hp phn tch 1g mu c th nhn c kt qu sau: Nng pha long 10-3 10-4 Kt qu Hp petri 1 235 26 Hp petri 2 246 36 Hp petri 3 198 17 - S khun lc c trong mu l: 235 + 246 + 198 + 26 + 36 660 N= = = 2.3x10 5 (CFU / ml ) 3 4 0,033 3x1x10 + 2 x1x10 - Vy s lng khun lc c trong 1ml mu hoc trong 1 gam mu (CFU/g hay CFU/ml) l 2.3x105 * Trong trng hp s lng khun lc c trong c hai hp petri nh hn 15 ta tnh nh sau: - Gi m l lng khun lc trung bnh c trn hai hp petri - Lng khun lc c trong mu lng l: NE=m / ml - Nu l mu c th lng khun lc c trong 1 gam mu s l: NE=mxd-k, vi d l h s pha long. * Trong trng hp s lng khun lc trong c hai hp petri nh hn 1 tnh nh sau: - Lng khun lc c trong mu lng l: NE nh hn 1 / ml - Nu l mu c th lng khun lc c trong 1 gam mu s l : NE nh hn 1xd-k, vi d l h s pha long - Ch : pha long thch hp nht nu nng ny cy trn thch a cho s khun lc trung bnh t 50 - 150 vi vi khun, x khun; 30 - 50 vi nm.

Trang 86

Bt m khun lc

Bn m khun lc My m khun lc t ng Hnh. Cc loi dng c m khun lc

4. Nhng im cn lu - Khi tin hnh pha long mu, cc dung dch phi c ht ng th tch yu cu. - i vi phng php to hp , mi trng nui cy sau khi hp tit trng phi c lm ngui n 45-500C bng b n nhit trc khi vo a petri cha dung dch vi sinh vt. - Cc a petri nui cy vi sinh vt phi c lt p trc khi nui trnh cc khun lc b mt mc loang. - Trong qu trnh m khun lc, khng c m hp petri. - Que tri thy tinh dng tri dung dch vi sinh vt c kh trng bng cch nhng vo cn 960 ri t, khng c h trc tip trn ngn la n cn. 5. Bo co thc tp - Trnh by phng php nh lng tng vi khun hiu kh trong mu bng phng php m khun lc? - So snh u v nhc im ca phng php to hp v phng php cy tri b mt? - Tnh s CFU/ml mu nc ban u?

Trang 87

BI 15 NH LNG COLIFORMS BNG PHNG PHP MPN (MOST PROBABLE NUMBER)


1. Nguyn tc T Coliforms c Blachstein s dng u tin vo nm 1893 ni v nhng vi khun Bacilli c c im hnh thi ging E.coli. Coliform l nhng trc khun, Gram (-), khng sinh bo t, h hp ty tin, c kh nng ln men lactose sinh acid v sinh hi 37oC trong 24-48 gi. Nhm Coliforms hin din rng ri trong t nhin, trong rut ngi, ng vt. S lng Coliforms trong mu c dng ch th kh nng hin din ca cc vi sinh vt gy bnh khc, ch th cho mc an ton v sinh ca mt mi trng hay mt sn phm. Nhm Coliforms gm bn ging l: Escherichia vi mt loi duy nht l E. coli; Citrobacter; Klebsiella v Enterobacter. Coliforms chu nhit l nhng Coliforms c kh nng ln men lactose sinh hi khi 44oC/24h trong mi trng EC. Coliforms phn (Faecal Coliforms hay E. coli gi nh) l Coliforms chu nhit c kh nng sinh indole khi 44.5oC/24h trong tryptone. E. coli c mt rt nhiu trong phn ngi v ng vt. Trong phn ti, m ca chng c th n 109/g. Chng c tm thy trong nc cng rnh, trong cc cng on x l v trong tt c cc ngun nc v t va mi b nhim phn t ngi, ng vt hoc do sn xut nng nghip. Gn y ngi ta ngh n E. coli c th tn ti hoc thm ch pht trin trong nhng ngun nc vng nhit i khng phi l i tng b nhim phn. T phn, coliform c th xm nhim trc tip vo thc phm trong cc cng on ch bin, cnh tc hoc phn phi.

Hnh. Cu trc nhm Coliforms Nhm Coliforms trong thc phm c th c xc bng phng php MPN. Phng php MPN (phng php c xc sut cao nht, s ti kh) cn c gi l phng php pha long ti hn hay phng php chun . y l phng php dng nh gi s lng vi sinh vt theo s lng vi sinh vt c xc sut ln nht hin din trong mt n v th tch mu hay ni cch khc phng php MPN da trn nguyn tc xc sut thng k s phn b VI SINH VT trong cc pha long khc nhau ca mu. y l phng php nh lng da trn kt qu nh tnh ca mt lot th nghim c lp li mt s pha long khc nhau. Thng thng, vic nh lng ny c thc hin lp li 3 ln 3

Trang 88

pha long bc 10 lin tip, tng cng 9 ng nghim. Cc pha long c chn la sao cho trong cc ln lp li c mt s ln dng tnh v c mt s ln m tnh. T kt qu ca cc th nghim nh tnh, da vo bng Mac Crady suy ra mt c on s lng vi sinh vt c trong mu, c trnh by di dng s MPN/100ml hay s MPN/g mu. chnh xc ca phng php MPN ph thuc vo s lng ng nghim lp li trong mi pha long: s lng ng nghim lp li cng cao th chnh xc ca tr s MPN cng ln. C hai h thng MPN - H thng 9 ng - H thng 15 ng Phng php MPN c c im: - Vi sinh vt mc tiu phi c nhng biu hin c trng trn mi trng nui cy nh + S to hi: Coliforms + S i mu: S. aureus - Cho php nh lng c mt vi sinh vt thp trong th tch mu ln 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 9 10 11 STT 1 2 Tn dng c, thit b mi nhm (3 sinh vin) Gi ng nghim ng nghim 18 Bnh tam gic 250ml Cc 100ml Bnh tia Pipette 1ml Pipette 10ml Que tri n cn ng Durham Que cy Dng c dng chung Ni hp cao p T cy v trng n v tnh Ci Ci Ci Ci Ci Ci Ci Ci Ci ng Ci n v tnh Ci Ci S lng 1 15 1 1 1 5 1 1 1 9 1 S lng 1 1 Trang 89 Ghi ch Ghi ch

STT 3 4 5

Tn dng c, thit b mi nhm (3 sinh vin) T sy My dp mu Bt m khun lc

n v tnh Ci Ci Ci

S lng 1 1 1

Ghi ch

2.2. Mi trng v ho cht - Mi trng BGBL + Peptone: 10g + Lactose:10g + Oxgall: 20g + Brilliant green: 0,0133g + Nc ct: 1000ml iu ch: Cn 40g bt mi trng BGBL, b sung nc ct cho 1000ml, khuy u. Phn phi vo cc dng c cha. t ng Durham vo mi trng. em hp kh khun 121oC (1atm)/15 20 pht. pH: 7,7 0,1 - Nc mui sinh l 0,9% - Nc ct v trng. - Cn 96o 2.3. Nguyn liu khc - Tht ti - Ti nilon dp mu 3. Tin hnh th nghim 3.1. Ly mu phn tch - Mu thc phm t cc c s ch bin c ly theo tiu chun ISO : 5667 hoc TCVN 5994:1995. - Cc dng c cha mu c bo qun 40C trong thi gian ngn (6-8 gi) v -200C trong thi gian di (khng qu 36 gi). Trnh nh sng trc tip. - Trc khi phn tch, cc mu nc bo qun lnh ng phi c r ng hon ton nhit phng hoc nhit 450C trong 15 pht. 3.2. Chun b mu phn tch - Nu l mu lng, lc nh bnh mu, dng pipet v trng, ht chnh xc 10ml dung dch mu cho vo mt bnh tam gic c cha sn 90ml dung dch nc mui sinh l 0,9% hoc nc mui peptone 1%. Nu l mu rn, dng a cn, kp inox vo trng cn chnh xc 10 g mu cho vo mt bnh tam gic c cha sn 90ml dung dch nc mui sinh l 0,9% hoc nc mui peptone 1%. - Lc u bnh tam gic ha u mu, ta c pha long 10 -1. Nu l mu rn, tin hnh dp mu bng my dp. - Tin hnh pha long mu tip tc theo phng php pha long bc 10 thnh cc pha long 10-2, 10-3, 10-4... - Dng micropipet vi u tup v trng, ht cho vo cc ng nghim (lot 9 ng hoc 15 ng c phn thnh 3 nhm cho 3 nng ) c cha mi trng thch hp (v d: BGBL Trang 90

dng cho coliforms) cho s tng trng ca i tng vi sinh vt cn nh lng mt th tch chnh xc (thng l 1ml) dung dch mu 3 nng pha long lin tip. - Cc ng nghim mi trng c nhit v thi gian thch thch hp (37 oC trong 24-36h). - Xc nh s ng dng tnh (c biu hin sinh hi, i mu, c) cc lot ng th nghim 3 nng pha long tng ng. 3.3. Tnh ton kt qu - T tr s ca s ng c biu hin dng tnh tng ng ba nng pha long lin tip, tin hnh tra bng MPN (Bng tra Mac Crady) cho lot 9 ng hoc 15 ng, xc nh tr s MPN/100ml ca mu ban u. - Da vo pha long ca cc nng chn phn tch v th tch mu pha long cy vo mi ng nghim mi trng BGBL, tnh ton mt ca Coliforms hin din trong 100ml mu nc ban u. i chiu vi TCVN, xc nh cht lng ca mu thc phm. 4. Nhng im cn lu - Cc ng nghim cha mi trng BGBL c ng Durham phi hp tit trng cn thn trnh lm ln bt kh vo ng Durham. - Trong trng hp tt c cc ng nghim mi trng th nghim u dng tnh hoc u m tnh th phi tng hoc gim s ln pha long trong lot th nghim phi c ng m tnh v ng dng tnh. 5. Bo co thc tp - Trnh by c im ca nhm vi khun Coliforms? Tc hi ca chng i vi con ngi v i vi thc phm? - Trnh by nguyn tc v phng php nh lng Coliforms trong thc phm theo phng php MPN? Bng Cc ch tiu vi sinh vt ca sa ti tit trng - TCVN 7028 : 2002 Tn ch tiu 1. Tng s vi sinh vt hiu kh, s khun lc trong 1 ml sn phm 2. Coliforms, s vi khun trong 1 ml sn phm 3. E.Coli, s vi khun trong 1 ml sn phm 4. Salmonella, s vi khun trong 25 ml sn phm 5. Staphylococcus aureus, s vi khun trong 1 ml sn phm 6. Clostridium perfringens, s vi khun trong 1 ml sn phm Mc cho php 10 0 0 0 0 0

Trang 91

Bn tra MPN dng cho lot 9 ng ba nng lin tip: S ng dng tnh S ml mu s dng (ml) 10 1 0,1 0 0 0 0 0 1 0 0 2 0 0 3 0 1 0 0 1 1 0 1 2 0 1 3 0 2 0 0 2 1 0 2 2 0 2 3 0 3 0 0 3 1 0 3 2 0 3 3 1 0 0 1 0 1 1 0 2 1 0 3 1 1 0 1 1 1 1 1 2 1 1 3 1 2 0 1 2 1 1 2 2 1 2 3 1 3 0 1 3 1 1 3 2 1 3 3 MPN/100 ml 3 6 9 3 6 9 12 6 9 12 16 9 13 16 19 4 7 11 15 7 11 15 19 11 15 20 24 16 20 24 29 S ng dng tnh S ml mu s dng (ml) 10 1 0,1 2 0 0 2 0 1 2 0 2 2 0 3 2 1 0 2 1 1 2 1 2 2 1 3 2 2 0 2 2 1 2 2 2 2 2 3 2 3 0 2 3 1 2 3 2 2 3 3 3 0 0 3 0 1 3 0 2 3 0 3 3 1 0 3 1 1 3 1 2 3 1 3 3 2 0 3 2 1 3 2 2 3 2 3 3 3 0 3 3 1 3 3 2 3 3 3 MPN/100 ml 9 14 20 26 15 20 27 34 21 28 35 42 29 36 44 53 23 39 64 95 43 75 120 160 93 150 210 290 240 460 1100 -

Trang 92

BI 16 NH LNG VI SINH BNG PHNG PHP DNG PETRIFILM


1. Nguyn tc Petrifilm l mng qut ln mt lp cht dinh dng v tc nhn to gel. Khi tin hnh xt nghim, 1mL mu c cy vo Petrifilm v . Cht mu c bit trn a khin cc khun lc c mu c trng d dng phn bit bng mt thng. Cc ng k gip cho vic m s lng khun lc d dng hn. Cc phng php Petrifilm c th nghim v c AOAC cng nhn. a Petrifilm E.Coli/Coliform Count (EC) c cha Violet Red Bile (VRB), cht gel tan c trong nc lnh, cht ch th hot ng ca glucuronidase v mt cht ch th gip cho vic m khun lc d dng hn. Hu ht E.coli (khong 97%) sinh beta-glucuronidase, cht ny to ta mu xanh gn kt vi khun lc. Tm film pha trn gi bt kh sinh ra t qu trnh ln men lactose ca E.coli v coliforms. Khong 95% E.coli c sinh bt kh, cho khun lc c mu t xanh n xanh km theo bt kh trn a Petrifilm. AOAC INTERATIONAL v U.S FDA Bacteriological Analytical Manual (BAM) xc nh Coliforms l trc khun gram m, hnh que, sinh hi v acid sut qu trnh ln men chuyn ho lactose. Khun lc coliform pht trin trn a Petrifilm EC sinh acid, cht ch th pH trong a lm cho lp keo c mu . Kh sinh ra c gi li xung quanh khun lc Coliform mu l du hiu xc nh Coliform Trong bi thc hnh ny chng ta s tin hnh nh lng Coliforms trong nc gii kht ngoi ng ph (gii hn cho nc gii kht khng cn khng ng chai i vi Coliforms chai 10 CFU/1g, theo Q 867/1988 ca B y t) bng Petrifilm v phng php hp tri truyn thng so snh. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bt m khun lc Ci 1 2.2. Mi trng v ho cht - Tm petrifilm dng phn tch coliform v Escherichia coli - Nc mui sinh l 0,9% - Nc ct v trng. - Cn 96o 2.3. Nguyn liu khc - Tht ti - Ti nilon dp mu Trang 93

- Dch vi khun Escherichia coli kim chng 3. Tin hnh th nghim 3.1. Chun b mu phn tch - Dng pipet v trng ht chnh xc 10ml dung dch mu nc cn phn tch cho vo mt ti dp mu hoc mt bnh tam gic v trng. i vi mu rn cn chnh xc 10 g mu bng cn phn tch trong iu kin v trng. - B sung thm 90 ml dung dch nc mui peptone 1% hoc nc mui sinh l v trng. - Lc u bnh tam gic hoc ng nht mu bng my dp mu trong 60 giy, 6-7 nhp /giy, ta c pha long 10-1.

Hnh. Quy trnh chun b mu phn tch - Tin hnh pha long mu: Dng pipet v trng ht chnh xc 1ml dung dch mu pha long 10-1, tin hnh pha long tip thnh cc pha long 10-2, 10-3, 10-4... trn cc ng nghim chun b sn cha 9ml dung dch nc mui peptone 1% v trng hoc nc mui sih l v trng. 3.2. Cy mu - Tin hnh cy mu quy trnh m Coliforms bng phng php a v 37 oC/2 ngy lm mu i chng. - Cy dch kim chng trn mt a Petrifilm theo quy trnh nh sau: + t tm petrifilm ln mt bn phng v trng + Dng tay hoc dng kp inox lt mng film nilon ph b mt a petrifilm. + Dng pipet v trng hoc micropipet vi u tup v trng ht chnh xc 1ml dung dch mu cc pha long la chn nh ln gia mng mi trng trn a petrifilm. + Lt cun mng nilon tr li cn thn trnh to b kh, khng c tm mng film nilon ri xung + Dng tm nha chn c mt phng bn di dn mng git dung dch u khp mng mi trng trong vng cy. Dng mt lc nh n ln tm nha chn tri u mu ln vng cy trc khi lp gel hnh thnh. Trnh xoay hay trt tm nha chn mu. + Ly tm nha chn ra lp keo ng li. - Tm petrifilm c nui nhit 35-370C trong thi gian 18-24 gi. Cc tm petrifilm c th chng ln n 20 a. - m s lng khun lc c trng ca coliforms v tnh kt qu theo phng php m khun lc trc tip bng mt hay bng my m khun lc. Khun lc E.coli c mu xanh v sinh kh; khun lc Coliforms c mu v sinh kh.

Trang 94

E. coli

Coliform

Hnh. Quy trnh cy mu vo a petrifilm v cch nhn din khun lc coliforms (mu hng), E. coli (mu tm xanh) trn a petrifilm

Khng phi coliform 4. Nhng im cn lu - Khng s dng a ny ring r pht hin E. coli O157. Nh hu ht nhng mi trng kim tra E.coli/coliform khc, a ny s khng hin th c bit vi bt k dng Trang 95

O157 no hin din. - Thao tc cy mu vo a petrifilm phi cn thn trnh lm ln bt kh vo lp gel - Cc tm petrifilm c th dng phn lp nh danh vi sinh vt. - Sau khi m kt qu, cc tm petrifilm phi c hp tit trng nhit 1210C trong 30 pht trc khi loi b. 5. Bo co thc hnh - Trnh by nguyn tc nh lng coliforms bng phng php dng petrifilm? - Trnh by phng php nh lng coliforms bng phng php dng petrifilm? - Gii thch s hnh thnh mu v bt kh ca khun lc coliforms trn a petrifilm? - Tnh mt coliforms c trong mu ban u, n v CFU/ml?

Trang 96

BI 17 NG DNG VI SINH VT TRONG SN XUT THC PHM LM TNG U


1. Nguyn tc Tng l loi nc chm giu m c ch bin vi nguyn liu go np hoc ng ln v mc lm men chuyn ho protein t ht u nnh. Tng c s dng hng ngy rt li cho sc khe, c bit ph hp trong cc mn n chay. Trong qu trnh lm tng, protein kh tiu trong ht u tng c hn hp enzym protease v peptidase tit ra bi cc chng mc tng (thng nht l Aspergillus oryzae) phn gii thnh cc peptid v acid amin d tiu. Dch acid amin c th c chit mt phn lm nc tng. Phn b u qua qu trnh ngm c th c s dng lm tng ht. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 7 8 STT 1 2 3 Tn dng c, thit b mi nhm (3 sinh vin) a petri Que cy n cn R nha Ni inox Cho inox Bp in L thy tinh c np y Dng c dng chung Ni hp cao p T cy v trng T m n v tnh Ci Ci Ci Ci Ci Ci Ci Ci n v tnh Ci Ci Ci S lng 2 1 1 1 1 1 1 1 S lng 1 1 1 Ghi ch Ghi ch

2.2. Ha cht - Cn 96o - Dch x phng long 2.3. Chng ging vi sinh vt - Nm mc: Aspergillus oryzea (Mc vng hoa cau, mc tng) 2.4. Nguyn liu khc - u tng - Cm trng - Bt m - Mui n - ng ma Trang 97

3. Tin hnh th nghim 3.1. Lm mc ging - Cm t hoc cm np nu mm phn vo a petri mt lp mng khong 0,5-1mm, khng nn cht. - Hp kh trng a petri 121oC trong thi gian 40-60 pht. - ngui cm v cy bo t mc tng Aspergillus oryzae vo. - a petri nhit phng. - Sau 36-48h, quan st thy mc mc kn ht cm (ht cm c mu vng hoa cau) l c th s dng c. 3.2. S ch nguyn liu - 100g ht u nnh sau khi la chn, loi b ht lp v su mt, em rang vng v b vo ni nu cng vi nc (khong 100g u vi 300 ml nc), nu nh trong 3 - 4 gi. - Vt ht u nnh ra r, tri mng, ngui. Phn nc nu u c b sung mui n nng 15% tr li s dng trong giai on sau. - 20g bt m rang vng v trn u vo u to lp o bt, to iu kin cho mc pht trin thun li. 3.3. Giai on mc - Trn 10g mc ging vo 100g u c chun b trn. - Hn hp u mc c t trong r nha, ni thong mt, b mt c ph giy bo trnh rui nhng. - Mi ngy, dng mung o u gip mc pht trin thun li. - Sau 3-4 ngy, khi mc pht trin kn ht u, c th dng qu trnh mc li. Khi mc pht trin u khp v chng cht l lc cc enzyme do nm mc sn xut ang tin hnh phn gii protein trong ht u thnh cc axit amin t do, tinh bt thnh ng. - Qu trnh mc phi m bo nhit v m thch hp cho mc pht trin. Loi mc Aspergilluss oryzae, c nhit pht trin l 30 -32oC, m 80 -90%. 3.4. Gia on hm mc v ng tng - Ton b u sau khi mc c cho vo mt l thy tinh. - Dung dch nc nu u b sung mui n 15% chun b trn, c vo bnh cho ngp u. Dng giy bo y kn trnh rui nhng. - em phi nng bnh thy tinh trong thi gian 15-20 ngy. Trong thi gian phi phi theo di thng xuyn trnh ma v y kn vo ban m. Sau t 3-4 ngy, dng a o u l tng. - Sau thi gian ny, gn nc mui 15% ring v thay bng nc mui 8%. Tip tc em phi nng l tng trong thi gian 7-10 ngy. Sau thi gian ny, ht u s c mu vng nu p, hng m . - Sau 7 ngy, gn nc mui 8%. Trn nc mui ny vi nc mui 15%. - B sung 60g ng ma vng vo 100g b u. em nu si, s c tng ht. - Phn hn hp nc mui c b sung 20g ng, nu si s c nc tng. 4. Nhng im cn lu - Khi ng tng (phi tng) phi y k trnh rui mui v nc ma ri vo h tng. - Tng lm xong c th s dng 6 7 thng hoc c nm, tng cng ngu n cng thm ngon. - Sau khi trt u vo nu trong ni, l thy tinh v np phi em ra sch v phi kh trc khi cho u vo tr li. - Trong thi gian phi nng, mi ngy dng a di trn tng ln xung cho u. 5. Bo co thc tp - Trnh by vi tr ca nm mc Aspergillus oryzae trong qu trnh lm tng? - Trnh by s bin i ca thnh phn ht u tng trong qu trnh lm tng? Trang 98

- Trnh by tc ng ca nc mui 15% gian on hm mc?

Trang 99

BI 18 NG DNG VI SINH VT TRONG SN XUT THC PHM LM RU VANG


1. Nguyn tc Sn xut ru vang da trn c s v ha sinh xy ra trong qu trnh ln men cc loi nc qu di tc dng ca enzyme ca nm men. Di tc dng h thng enzym ca nm men, ng c chuyn ha thnh ru ethanol v CO2 cng lc sn sinh ra nng lng. Qu trnh ny gi l qu trnh ln men ethanol. Phn ng cn c s hin din ca phosphat v c: C6H12O6 + H3PO4 CH3CH2OH + H2O + CO2 + FDP Hu ht cc ging Saccharomyces (tc nhn chnh trong ln men ru vang) u ln men ng: glucose, galactose, saccharose, maltose, manose v khng ln men lactose. Cc loi ng trn hin din trong tri cy chn (nho, mnm du, da, m...) vi nng khc nhau. Do , tri cy chn l nguyn liu quan trng trong qu trnh ln men ru sn xut nhng thc ung c gi tr: ru vang, nc tri cy ln men... Trong qu trnh ln men, ng trong dch qu c nm men s dng tng sinh khi v tng hp mt s sn phm (ru, kh CO2 v glycerin, acid acetic, acid lactic, este etylacetat). Cc alcol bc cao, aldehyd acetic c to thnh t cc acid amin. Cc cht pectin b thy phn ko theo s to thnh mt lng nh metanol. Ln men ru vang thng chia thnh cc giai on: ln men chnh nhit t 20 300C khong 10 ngy hoc di hn. cui giai on ln men chnh dch ln men trong dn v protein v pectin lng xung. Ln men ph nhit t 15 18 0C. Khi lng cn hon ton, dch trong th gn, lc xong s c ru vang c th ung c, nhng cha ngon, cn phi tng tr nhit 4 100C ru vang hon thin hng v c trng. Thi gian tng tr c th l vi thng, vi nm, thm ch hng chc hoc hng trm nm. Do thi lng ca bi th nghim, qu trnh ln men ru vang ch thc hin hai giai on c bn l ln men chnh v ln men ph. 2. Dng c, mi trng v ha cht 2.1. Dng c STT 1 2 3 4 5 6 STT 1 2 3 Tn dng c, thit b mi nhm (3 sinh vin) a petri Que cy n cn R nha Bp in L thy tinh c np y Dng c dng chung Ni hp cao p T cy v trng T m n v tnh Ci Ci Ci Ci Ci Ci n v tnh Ci Ci Ci S lng 2 1 1 1 1 1 S lng 1 1 1 Trang 100 Ghi ch Ghi ch

2.2. Ha cht - Cn 96o - Dch x phng long 2.3. Chng ging vi sinh vt - Nm men: Saccharomyces cerevisiae 2.4. Nguyn liu khc - Nho chn - ng ma 3. Tin hnh th nghim Th nghim c thc hin vi 3 nghim thc: - Nghim thc 1: ln men vi ngun vi sinh vt sn c trn nguyn liu nho. - Nghim thc 2: ln men vi s b sung chng nm men thun: Saccharomyces cerevisiae. 3.1. Chun b nguyn liu - Cn 3 kg nho chn; 0,5 kg ng - Loi b cung, ra sch nho, dng tay b qu nho lm i hoc lm bn. - Cho tt c nho vo l thy tinh, b sung ng, dng mung o u. - B sung thm NaHSO3 vi hm lng 200mg/lt c tc dng chng oxy ha dch nho, loi b cc vi sinh vt c hi. - y kn np bnh. - Dch ln men c c im: pH 3,5-4,0, nng ng 20%. Nu cha t c iu kin ny, cn iu chnh qu trnh ln men t hiu qu tt nht. - i vi nghim thc c b sung nm men, dch nm men c b sung vi hm lng 2% ging (khong 100-120 triu t bo/lt). 3.2. Ln men chnh - Bnh ln men c t nhit 300C trong thi gian 7-10 ngy. Trong giai on ln men chnh, ng trong dch qu s c chuyn ha thnh ru. Nng ru t khong 8-10%. - Sau thi gian ny, ton b hn hp ru v b nho trong bnh ln men c p loi b b nho. - Dch ru thu c, rt tr li vo bnh ln men, y knh bnh tin hnh ln men ph. 3.3. Ln men ph - Bnh ln men c t trong t mt nhit 180C trong thi gian 25-20 ngy. - Trong thi gian ny, nm men v cn nguyn liu s lng dn xung. Dch ru s dn trong hn. Trong giai on ln men ph, qu trnh ln men malolactic xy ra s chuyn ha acid malic lm ru c v du hn. - Tin hnh gn dch ru, v lc thu c ru vang trong hn. Ru vang sau giai on ln men ph c mi thm c trng, v nng nh ca ru, v hi chua ngt ca dch tri cy cn st li. Ru ny c th ung c. ngon hn, dch ru cn c nhit thp 4-100C trong thi gian lu hn. 4. Nhng im cn lu - Khi chn nho dng cho ln men, cn loi b cc qu b dp nt hoc b ln men trnh nhim tp cc vi sinh vt c hi. - Trong qu trnh ln men, bnh ln men cn c y kn to iu kin k kh cho qu trnh ln men. - Trong qu trnh tch chit dch ru, trnh dng cc vt liu bng st, nhm trnh lm ta ru. - Khng c lm dp nt ht nho trnh gii phng cht c cho ngi s dng. 5. Bo co thc tp - Trnh by c ch ca qu trnh ln men ru?

Trang 101

- Trnh by cc qu trnh sinh ha xy ra trong giai on ln men chnh v ln men ph? - Nu nhng yu cu v cht lng ca ru vang nho?

Trang 102

BI 19 PHNG PHP PHN TCH NH LNG ESCHERICHIA COLI TRONG THC PHM
1. Nguyn tc Escherichia coli ln u tin c Escherich phn lp t phn ngi vo nm 1855. y l vi khun c ch nhiu v nghin cu k lng nht. Chng c tr ng rut ca ngi v ng vt mu nng. Chng c th l vi khun gy bnh c hi. E. coli l vi sinh vt ch th tiu biu nht. S c mt cng nh s lng ca chng ch ra mc v sinh trong qu trnh ch bin, bo qun, vn chuyn thc phm, nc ung cng nh s nhim phn trong mi trng. T nm 1982 pht hin thy 4 loi E. coli c kh nng gy bnh c ngun gc thc phm (Enteropathogenic-EPEC; Enteroinvasive-EIEC; Enteroinvasive- EIEC; Enterotoxigenic - ETEC, trong c chng O157:H7). Phng php phn tch E. coli trong bi ny c da trn quy trnh MPN bng s dng canh thang Lauryl sulphate tryptose (LST) vo test on chng (presumptive test), sau dng canh thang BGLB (Brilliant Green Lactose Bile Broth) v m 37 oC/24-48 h ( kim tra Coliforms). Tip theo chuyn sang mi trng canh EC (E. coli medium) 44.5oC kim tra Coliforms chu nhit. Sau xc nh Coliforms phn (E. coli gi nh) bng cch cy sang mi trng EMB (Eosine Methylene Blue Agar), chn khun lc in hnh v th kh nng sinh Indol (I). xc nh E. coli cn th ba phn ng sinh ha tip theo l Methyl Red (MR), Voges-Proskeur (VP) v Citrate (iC). E. coli l Coliforms phn v cho kt qu th nghim IMViC l + + - -. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 10 ng Durham Ci 18 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 2.2. Mi trng v ho cht - Mi trng BGBL - Mi trng EC broth - Mi trng EMB - Mi trng triptose broth - Mi trng MR-VP - Mi trng Simmon citrate - Nc mui sinh l 0,9% - Cn 96o 2.3. Nguyn liu khc - Tht ti Trang 103

- Ti nilon dp mu - Dch vi khun Escherichia coli kim chng 3. Tin hnh th nghim 3.1. Nui cy Escherichia coli - E. coli l dng coliform c ngun gc t phn, pht trin c 440,5 0C, sinh indol, sinh acid, khng sinh aceton v khng dng citrat lm ngun cacbon. - E. coli c pht hin do kh nng ln men lactose sinh hi 440,50C v c kt qu nghim php IMVIC ph hp. - Qui trnh phn tch nh lng E .coli theo phng php MPN thc hin nh sau:
Lay 10g (10ml) mau ong nhat vao 90ml nc muoi sinh ly, c 10-1

Pha loang mau 10-2, 10-3, 10-4 Chuyen 1ml dung dch 10-2, 10-3, 10-4 vao 10ml canh BGBL, moi nong o 3 ong lap lai, u 37oC, 36h Chon ong (+), cay sang canh EC, u 44.0 0.5oC trong 24-48 gi

Xc nh ng (+) mi nng , cy sinh khi vi sinh vt t cc ng (+) sang a mi trng EMB hoc Endo phn lp E.coli

U 37.0 0.5oC trong 24 gi

Chon khuan lac det, co anh kim tm, ng knh khoang 1mm e cay sang TSA hay BHI

U 37.0 0.5oC qua em Cay chuyen vao cac moi trng th nghiem sinh hoa: Canh trypton (1), MRVP (2), Simmon Citrate (1) e th nghiem phap IMViC E. coli co bieu hien sinh hoa: Indol (+), MR (+), VP (-), Citrate (-). Mot trong so cac phan ng tren sai la khong phai E.coli Ket luan: Phat hien (khong phat hien) E.coli/g

Trang 104

a. Mi trng nui cy Mi trng tng sinh: mi trng BGBL 2% hoc Lauryl sulphat tryptose * Mi trng BGBL 2% (Brilliant Green Bile Lactose 2%) - Peptone : 10g - Lactose : 10g - Mt b : 20g - Dung dch 0,1% Brilliant Green: 13,3 ml - Nc ct va : 1000ml Ha tan peptone v lactose trong 500ml nc ct. Ha 20g mt b trong 200ml nc ct, trn hai dung dch, thm nc ct ti 975ml. Chnh v pH 7,4 250C. Cho thm 13,3ml dung dch Brilliant Green 0,1% trong nc ct. Thm nc ct cho 100ml. Rt vo cc ng nghim c 16mm c ng Durham, hp thanh trng 1210C trong 15 pht. * Mi trng Lauryl sulphat tryptose - Tryptose : 10g - Lactose : 5g - Dikali hydrophosphat : 2,75g - NaCl : 5g - Natri lauryl sulphat :0,1g - Nc ct va :1000ml un ha tan thnh phn trn trong nc ct, rt vo ng nghim c dung tch ph hp, hp thanh trng 1210C trong 15 pht. Chnh pH l 6,8 * Mi trng Trypton Soya Agar (TSA) - Trypton :15g - Soya peptone :5g - NaCl :5g - Agar :15g - Nc ct :1000 ml un nng ho tan cc thnh phn, phn phi vo dng c cha v hp kh trng 1210C trong 15 pht. pH 7,30,2. b.Phng php tin hnh - Dng pipet v trng, ht chnh xc ly 10ml mu nc th nghim cho vo mt bnh tam gic c cha 90ml nc mui sinh l 0,9% hoc nc mui peptone 1% v trng. Lc u, c pha long 10-1. - Tin hnh pha long bc 10 mu 10-1 thnh cc pha long 10-2, 10-3, 10-4... - Ly 1ml 3 pha long cui cy vo cc ng nghim cha 10ml mi trng tng sinh BGBL hoc LSB. 370,50C trong 24-48 gi. - Tin hnh 3 ng nghim mi nng pha long - Ch cc ng dng tnh (ng c biu hin sinh hi, i mu, ha c), cy chuyn sang cc ng mi trng canh EC. 440,50C. Ghi ch nng tng ng cho cc ng canh EC ng vi cc ng BGBL hoc LSB dng tnh. 3.2. Phn lp Escherichia coli a. Mi trng phn lp * Mi trng EMB (Eosine Methylen Blue agar) - Peptone : 10g - Lactose : 10g - Dikalihydrophosphat : 2,75g - Eosine : 0,4g - Methylen xanh : 0,0065g - Agar :15g - Nc ct va : 1000ml X l agar trc n ng nht. un ha tan cc thnh phn trn trong nc ct. Hp thanh trng 1210C trong 15 pht. iu chnh pH l: 7,2 250C Trang 105

* Mi trng Endo - Peptone :10g - Lactose : 10g - Cao tht :10g - NaCl : 5g - Fushin baz : 0,04 g - Na2SO3 : 2,5 g - Agar : 15g - Nc ct va : 1000ml un ha tan cc thnh phn trn trong nc ct. Hp thanh trng 1210C trong 15 pht. iu chnh pH l: 7,4 250C b. Ha cht, mi trng th phn ng sinh ha * Mi trng MRVP (Metyl Red Voges Prokauer) - Dextrose hoc glucose : 5g - Peptone : 5g - Dikalihydrophosphat : 5g - Nc ct va : 1000ml Cch pha: un ha tan cc thnh phn trn trong nc ct cho vo ng nghim c dung tch ph hp. Hp thanh trng 1210C trong 15 pht. iu chnh pH l: 7,4 250C * Mi trng thch Simons Citrat - Amonidihydrophosphat : 1g - Dikali hydro phosphat : 1g - NaCl : 5g - Natricitrat : 2g - Magie sunfat : 0,2g - Bromothymol xanh : 0,08g - Agar : 12,5g - Nc ct va : 1000ml Cch pha: un ha tan cc thnh phn trn trong nc ct. Hp thanh trng 1210C trong 15 pht. iu chnh pH l: 6,6 250C * Nc peptone - Peptone : 10g - NaCl : 8,5g - Nc ct : 1000ml Cch pha: Cch pha: un ha tan cc thnh phn trn trong nc ct. iu chnh pH l: 7,0 250C, cha trong ng nghim hoc bnh c dung tch ph hp. Hp thanh trng 1210C trong 15 pht. Nu cha dng th bo qun trong ti 0 50C khng qu 1 thng * Thuc th Kovac - c s dng th phn ng indol - Ha 5g p-dimetylaminobenzaldehyd vo 75 ml amyl alcohol, un nh 50550C n tan ht, ngui v cho thm 25ml H2SO4 m c. c. Phng php tin hnh * Phn lp - Xc nh s ng mi trng canh EC dng tnh (ng c biu hin ha c, sinh hi). Chn cc ng nghim c phn ng dng tnh cy sang mi trng phn lp (mi trng EMB hoc Endo), 370C trong 24h - Nhn dng khun lc E.coli: + Trn mi trng EMB: khun lc mu tm, nh kim, trn, b u, ng knh khong 0,5mm + Trn mi trng Endo: Khun lc mu , nh kim, trn, b u, ng knh khong 0,5mm

Trang 106

Hnh. Khun lc c trng ca Escherichia coli trn mi trng EMB * Th phn ng sinh ha - Tin hnh th phn ng sinh ha cc khun lc nghi ng l E.coli. - Phn ng Indol: Cy khun lc nghi ng vo ng nghim cha 5ml nc peptone 370C trong 24h. Cho thm 0,5ml thuc th Kovac bng cch cho chy dc theo thnh ng nghim + Mi trng chuyn mu : indol (+) + Mi trng khng i mu: indol (-) - Phn ng MR (metyl red): cy khun lc nghi ng vo 2 ng nghim, mi ng cha 5ml mi trng MRVP 370C t 48 - 96h. Cho vo mt ng nghim vi git metyl red pH trung tnh hoc kim yu + Mi trng chuyn mu : MR (+) + Mi trng khng i mu: MR (-) - Phn ng VP (Voges Proskauer) cho vo ng nghim cha mi trng MR-VP cn li khong 0,6ml dung dch - naphtol v 0,2ml dung dch KOH lc u, yn trong 2h. + Mi trng i sang mu eosin hoc c vt eosin pht trin trong vng 15 pht : VP (+) + Mi trng khng chuyn mu : VP (-) - Phn ng citrat: Cy ria khun lc nghi ng ln mt nghing ca mi trng simon citrat, 370C trong 24h. + Mi trng i mu lc sang xanh dng v xut hin khun lc: citrat (+) + Mi trng khng i mu, khng mc khun lc: citrat (-) d. c kt qu Pht hin c E.coli khi: - Mi trng EC: ha c, v sinh hi. - C khun lc in hnh trn mi trng EMB hoc Endo. - Trc khun Gram m. - Cc phn ng sinh ha: I (+); MR (+); V(-) ; Citrat (-) 3.3. Xc nh kt qu - ng nghim cho kt qu (+) trong mi trng canh EC v khun lc E.coli gi nh trn mi trng EMB hoc Endo cho kt qu th nghim IMViC nh trn l ng nghim c E.coli. Thc hin tng t cho tt c cc ng nghim cho kt qu (+) trong mi trng EC v to c khun lc E.coli gi nh trn mi trng EMB hoc Endo. Ghi nhn s lng cc ng nghim c E.coli (+) mi pha long. - Dng bng tra MPN xc nh mt vi sinh vt trong mu v biu din di dng ch s MPN/g hay MPN/ml mu ban u cha pha long.

Trang 107

Hnh. Kt qu th nghim IMViC (+ + - -) xc nh E. coli 4. Nhng im cn lu - Tin hnh nhum Gram vi sinh vt phn tch tt c cc bc th nghim? - Cc ng nghim mi trng tng sinh cha mt lng ln vi sinh vt gy bnh, trnh khng lm ri ra mi trng. - Cc th nghim sinh ha c nhn nh kt qu bng cc thuc th. Cn s dng ng thuc th cho tng th nghim? - Thuc th Methyl red c pha trong cn 960, cn ch trnh khng c gn la n cn. 5. Bo co thc tp - Trnh by c im ca vi khun E. coli? - Trnh by quy trnh phn tch nh lng E. coli trong thc phm theo phng php MPN? - Gii thch c ch ca cc th nghim sinh ha xc nh E. coli? - Xc nh mt MPN/ml ca E. coli trong mu thc phm ban u?

Trang 108

BI 20 PHNG PHP PHN TCH SALMONELLA SPP. TRONG THC PHM


1. Nguyn tc Salmonella l vi khun thuc h Enterobacteriaceae, c hnh que Gram m, khng sinh bo t, sng hiu kh ty nghi nhng pht trin tt trong iu kin hiu kh. Hu ht c kh nng di ng nh tim mao. Hu ht c kh nng to H2S (tr S. typhi) C kh nng ln men sinh acid t glucose, mannitol, khng ln men lactose, sucrose, khng to Indol. C kh nng to enzyme lysine decarboxylase. Hin din trong nhiu loi thc phm. y l nhm i tng vi sinh vt nguy hi, c th gy ng c vi mt thp (khong 1 triu t bo/g). Trong hu ht cc loi thc phm, ch tiu Salmonella lun bng 0 (khng c php pht hin trong thc phm). Qu trnh phn tch Salmonella thng bao gm bn bc: tng sinh, tng sinh chn lc, phn lp v khng nh. Bc tng sinh chn lc thng dng cc loi mi trng chuyn bit tu vo ngun mu thu nhn c. Bc khng nh nhm xc nhn cc khun lc c trng cho Salmonella xut hin trn mi trng phn lp. Bc ny da trn vic s dng cc th nghim sinh ho v th nghim huyt thanh c trng cho Salmonella. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bt m khun lc Ci 1 2.2. Mi trng v ho cht - Dung dch BPW - Mi trng SCB - Mi trng XLD - Mi trng KIA - Nc mui sinh l 0,9% - Nc ct v trng. - Thuc nhum tm kt tinh - Dung dch lugol - Thuc nhum Fuschin - Cn 96o 2.3. Nguyn liu khc - Mu tht g ti - Ti nilon dp mu - Dch vi khun Salmonella kim chng Trang 109

3. Tin hnh th nghim 3.1. Tin tng sinh v tng sinh chn lc - Thc hin ng nht 25g mu thc phm vo trong 225ml dch BPW. 37 0C trong 16-24 gi. - Sau thi gian , tin hnh cy chuyn 0,1ml dch vi sinh vt c tin tng sinh sang mi trng tng sinh chn lc l SCB hoc RV (nn dng c hai loi mi trng ng thi). 370C trong 24 gi. - Cc ng dng, nghi ng c s hin din ca Salmonella, khi mi trng c mu gch, c cn lng, c th c vng. 3.2. Phn lp Salmonella a. Mi trng phn lp Phn lp Salmonella trn mt trong cc mi trng sau: * Mi trng SS Agar (Salmonella - Shigella agar) - Thnh phn: - Cao tht : 5g - Pepton : 5g - Lactose : 10g - Mt b : 8,5g - Natri Citrat : 8,5g - Natrithiosulphat : 8,5g - St Citrat : 10g - Brilliant green 0,1% : 0,33ml - trung tnh1% : 2,5ml - Agar : 13,5g - Nc ct , : 1000ml Cch pha: un si ha tan hon ton thnh phn trn trong nc ct, ngui ti 450C, trong ni cch thy, rt vo mi hp petri 15 - 20ml mi trng. Khng hp thanh trng mi trng. Chnh pH = 7,0 250C * Mi trng thch Mac Conkey - Thnh phn: - Pepton : 20g - Lactose : 10g - NaCl : 5g - Mt b :1,5g - Cristal violet 0,1% : 1ml - trung tnh 1% : 3ml - Agar : 13,5g - Nc ct, :1000ml Cch pha: un si ha tan cc thnh phn trn trong nc ct, chnh pH l 7,2 250C . Hp thanh trng 1210C trong 15 pht * Mi trng Xylose lysine desoxycholate agar (XLD) - Cao nm men :3g - NaCl :5g - D(+) xylose :3.5g - Lactose :7.5g - Sucrose :7.5g - L(+) lysine :5.0g - Sodium desoxycholate :2.5g - Sodium thiosulphate :6.8g - Ammonium iron (III) citrate :0.8g - Phenol red :0.08g - Agar :15g Trang 110

- Nc ct 1 lt - pH 7.4 0.2 un si mi trng, khng hp, ngui n 500C ri a, khng gi qu 1 ngy. b. Cch tin hnh Quan st mu cy trong mi trng tng sinh. Sau 24 gi Salmonella lm c u mi trng Selenite Broth, c th hi lng cn v to vng mng, mu mi trng chuyn t trong sut ban u sang mu gch. Lm bin mu mi trng Muller - Kauffmann t xanh lc sang vng Phn lp - Dng que cy vng cy ria canh trng t mi trng tng sinh ln a petri cha mi trng phn lp KIA v HE. Cn cy tha to khun lc ring bit. 37 0C trong 24 gi. Trn cc mi trng phn lp, Salmonella to cc khun lc trn, hi li trong, b u c ng knh khong 2 - 4mm, i khi c tm en. - Nhum Gram cc khun lc nghi ng. Th phn ng sinh ha nu Gram (-)

Hnh. Khun lc ca Salmonella trn mi trng XLD

Hnh. Khun lc ca Salmonella trn mi trng HE

3.3. Th phn ng sinh ha xc nh Salmonella a. Mi trng v ho cht th phn ng sinh ha * Mi trng KIA (Kligler's Iron Agar) - Cao tht : 3g - Cao nm men : 3g - Pepton : 15g - Proteose Pepton : 5g - NaCl : 5g - Lactose : 10g - Glucose : 1g - St sunfat : 0,2g - Natrithiosunfat : 0,3g - trung tnh 0,5% : 6ml - Agar : 12g - Nc ct, : 1000ml Cch pha : un si ha tan hon ton thnh phn trn trong nc ct, ngui n 450C trong ni cch thy, chnh pH l 7,4 25 0C. Rt vo cc ng nghim lm thch

Trang 111

nghing mt lng sao cho khi mi trng ng li th th tch phn y gp i phn nghing * Mi trng TSI (Triple Sugar Iron Agar) - Cao tht : 4g - Pepton : 4g - Dextrose : 1g - Lactose : 10g - Saccharose : 10g - NaCl : 5g - Natrithiosunphat : 0,08g - Natrisunfit : 0,4g - St sunfat : 0,2g - trung tnh1% : 2,5ml - Agar : 15g - Nc ct : 1000ml Cch pha: un si ha tan hon ton thnh phn trn trong nc ct, ngui n 450C trong ni cch thy, chnh pH l 7,3 25 0C. Rt vo cc ng nghim lm thch nghing mt lng sao cho khi mi trng ng li th th tch phn y gp i phn nghing * Mi trng MIU (Motility Indol Urea Medium) - Trypton : 30g - Kali dihydrophosphat: 1g - NaCl : 5g - phenol 0,25% : 2ml - Agar : 4g - Nc ct, : 1000ml Cch pha: un si ha tan thnh phn trn trongnc ct, lc qua giy lc v hp thanh trng 1210C trong 15 pht, iu chnh pH l 6,8. ngui ti 450C trong ni cch thy. Cho thm vo mi trng nng chy mt lng Ure 20% theo t l 1 ure/ 9 mi trng. Rt vo ng nghim c dung tch ph hp tng lng 5ml v thng ng. Dung dch Ure c pha bng nc ct v kh trng bng lc khun. * Mi trng Lysine Decacboxylase broth (LDC) - Yeast extract : 3g - Glucose : 1g - L-lysine : 5g - Bromocrezol purple : 0.016g - pH : 6.1 0.2 Ho tan cc thnh phn, phn phi vo cc dng c cha v kh trng 1210C trong 15 pht. b. Tin hnh - Cy m su ri cy ria vi khun t nhng khun lc nghi ng ln ng thch nghing cha mi trng TSI hoc KIA. Cy m su vo mi trng MIU. Cy sinh khi vo mi trng LDC, Manitol phenol red broth, MR-VP. Cc ng nghim c 370C trong 24 gi. - Trn mi trng TSI hoc KIA cc khun lc Salmonella c mu en : dihydrosunfu (+), gi nguyn mu ca phn nghing: lactose (-), saccharose (-); phn y i mu t sang vng: dextrose hoc glucose (+), to nhng bt kh trongnn thch, c sinh hi - Trn mi trng MIU Salmonella mc lan khi ng cy thng c tnh di ng, khng lm bin mu mi trng t hng nht sang m: Urease (-). Cho ln b mt mi trng MIU 0,5 ml thuc th Kovac, Salmonella khng lm thuc th: indol (-) - Trn mi trng LDC Salmonella pht trin s lm c v chuyn mu mi trng t vng sang tm (LDC (+), LDC (-) khi mi trng c mu vng.

Trang 112

- Trn mi trng Manitol phenol red broth, Salmonella ln men manitol to acid, lm mi trng chuyn t hng nht sang vng Manitol (+) - Trn mi trng MR-VP, Salmonella cho th nghim VP (-) 3.4. c kt qu th nghim sinh ha xc nh Salmonella Mu c Salmonella khi: - Lm c mi trng tng sinh - To khun lc c trng trn mi trng phn lp - Trc khun Gram m - C tnh di ng - Lactose (-), Saccharose (-) - Dextrose hoc Glucose (+) - Dihydrosunfua (+) - Urease (-) - Indol (-) - Manitol (+) - VP (-) 4. Nhng im cn lu - Salmonella l nhm vi sinh vt nguy hi, cn ht sc cn thn khi phn tch. Mang gng tay, khu trang trong qu trnh lm th nghim. - Cc mi trng tng sinh chn lc, mi trng phn lp Salmonella c cc thnh phn d bin tnh nhit cao, do , khng c hp tit trng khi pha ch. 5. Bo co thc tp - Trnh by quy trnh phn tch Salmonella trong thc phm? - Ti sao khi phn tch Salmonella trong thc phm, ch cn phn tch nh tnh? - Gii thch c ch ca cc phn ng sinh ha xc nh Salmonella? - Nu kt qu v kt lun v s hin din ca Salmonella trong mu thc phm ban u?

Trang 113

Quy trnh phn tch nh tnh Salmonella ng nht 25g mu vi 225g BPW 37 0,5oC trong 16 24 gi Chuyn 0,1ml canh khun sang ng nghim cha 10ml Selenite Cystine Broth hoc RV 37 0,5oC trong 24 gi Cy phn lp sang mi trng XLD v HE 37 0,5oC trong khong 24 gi Chn khun lc c trng: trong sut, c hay khng c tm en, cy sang TSA hay BHI 37 0,5oC qua m

Cy chuyn vo mi trng th nghim sinh ha: KIA, Mannitol Phenol Red Broth, Urea Broth, Lysine Decarboxylase Broth Canh Trypton, MRVP

37 0,5oC trong khong 24 gi

Biu hin ca Salmonella Trn KIA/TSI: /vng, H2S (+),Gas (+) Urea (-); indol (-); mannitol (+); LDC (+), VP(-) Ngng kt vi khng huyt thanh O a gi

Pht hin (khng pht hin) Salmonella/25 g

Trang 114

BI 21 PHNG PHP PHN TCH NH LNG BACILLUS CEREUS TRONG THC PHM
1. Nguyn tc Bacillus cereus c pht hin ln u tin bi Hauge nm 1949 khi phn tch mu xt vani gy tiu chy ti bnh vin Oslo, Na uy.Vi khun Bacillus cereus phn b ph bin trong t nhin, nhim vo cc loi thc n qua m hay tr lnh lu, thng gy ng c thc phm. Ngoi cc c t gy ng c thc phm l diarrhoed v emetic, Bacillus cereus c th gy ra s nhim trng v nhim c khc nhau nh: nhim trng mu, vim mng no, v nhim trng mt. Qu trnh phn tch nh lng Bacillus cereus trong thc phm c th c thc hin theo phng php MPN hoc phng php m khun lc. Khun lc ca Bacillus cereus trn mi trng phn lp MYP c xc nh bng cc phn ng sinh ha c trng. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bt m khun lc Ci 1 2.2. Mi trng v ho cht - Dung dch TSP - Mi trng MYP - Mi trng nitrate broth - Mi trng phenol red dextrose broth - Nc mui sinh l 0,9% - Nc ct v trng. - Thuc nhum tm kt tinh - Dung dch lugol - Thuc nhum Fuschin - Cn 96o - Lysozyme - Mi trng thch tyrosin - Mi trng MR-VP - Mi trng TSA * Dung dch m phosphat : c s dng pha long - Dung dch m + KH2PO4 :34g + Nc ct :500ml Trang 115

Chnh pH = 7,2. Cho nc ct vo 1000ml. Hp 121oC, 15 pht. - Pha long s dng + Dung dch m :1,25ml + Nc ct :98,75ml Phn phi 90ml vo cc erlen v 9ml vo cc ng nghim. Hp kh trng 121oC, 15 pht. * Mi trng Manitol - Egg - Yolk polymyxin (MYP) - Cao tht :1g - Peptone :10g - Mannitol :10g - NaCl :10g - Phenol red :2,5ml - Thch :15g - Nc ct :900ml pH = 7,20,2. Hp 121oC, 15 pht. ngui n 500C. - Dung dch Polymixin B 0,1% Ha 500.000 n v polymixin B sulfat trong 50ml nc ct v trng. Bo qun 4oC. - Egg yolk emulsion 50%: sn phm thng mi. Mi trng hon chnh: b sung 2,5ml dung dch polymixin B v 1,25ml egg yolk emulsion vo 225ml mi trng thch c bn kh trng v lm ngui 50oC. Trn u v 10 - 15ml vo cc a petri. * Mi trng Phenol Red - Dextrose Broth c s dng th nghim kh nng ln men glucose ca vi sinh vt. - Proteose peptone No.3 :10g - Cao tht :1g - Dextrose :5g - NaCl :5g - Phenol red :0,018g - Nc ct :1000ml o Hp kh trng 121 C, 10 pht. pH cui = 7,40,2. * Mi trng Nitrat Broth : c s dng trong khng nh sinh ha - Cao tht :3g - Peptone :5g - KNO3 :1g - Nc ct :1000ml o Hp kh trng 121 C, 15 pht, pH cui = 7,00,2. * Mi trng MR - VP: c s dng trong khng nh sinh ha - Peptone :5g - Glucose :5g - Phosphate buffer :5g - Nc ct :1000ml Phn phi mi trng vo cc ng nghim v hp kh trng 121oC, 15 pht, pH cui= 7,50,2. * Mi trng Trypticase Soy Agar (TSA) : c s dng bo qun, phc hi vi sinh vt trong qu trnh th nghim - Trypticase peptone :15g - Phytone peptone :5g - NaCl :5g - Nc ct :1000ml

Trang 116

un nng, phn phi mi trng vo cc ng nghim, hp kh trng 15 pht, 121oC. t ng nghim nghing. pH cui = 7,30,2. * Mi trng thch Tyrosine: Dng th nghim kh nng phn hy Tyrosine ca Bacillus cereus - Nutrient agar - Cao tht :3g - Peptone :5g - Agar :15g - Nc ct :1000ml o Hp kh trng 121 C, 15 pht. pH cui = 6,80,2. - Dung dch Tyrosine 5% Tyrosine :5g Nc ct :100ml Hp kh trng 121oC, 15 pht. Mi trng hon chnh: trn 90ml mi trng Nutrient agar un chy lm ngui 45oC vi 10ml dung dch Tyrosine 5%, phn phi 10ml vo cc a petri. * Mi trng Nutrient Broth vi lysozyme Nutrient Broth - Cao tht :3g - Peptone :5g - Nc ct :1000ml o Hp kh trng 121 C, 15 pht. pH cui = 6,80,2. Lysozyme 0,1% - Lysozyme hydrochloride :0,1g - Nc ct :100ml Lc bng mng lc v trng. Mi trng hon chnh: ha 1ml lysozyme 0,1% vi 99ml mi trng Nutrient Broth, phn phi vo cc ng nghim. * Thuc th Voges - Proskauer - a-Naphtol :5g - Etanol 96% :100ml Bo qun 0 - 5oC trong l ti. * Dung dch Kali hydroxit 40% (KOH) - Kali hydroxit (KOH) :40g - Nc ct :100ml * Thuc th nitrit Thuc th A - Acid sulfanilic :8g - CH3COOH 5N :1000ml Thuc th B - a-Napthol : 2,5g - CH3COOH 5N :1000ml Thuc th hon chnh - Dung dch A 0,25ml - Dung dch B 0,25ml 2.3. Nguyn liu khc - Mu tht heo ti - Ti nilon dp mu - Dch vi khun Bacillus cereus kim chng 3. Tin hnh th nghim 3.1. Chun b mu phn tch ti phng th nghim

Trang 117

- Mu a v phng th nghim, m ra cho vo khay v trng. Dng ko v kp v trng ly i din 10g mu cho vo bao PE v trng trong iu kin v trng. - Mu c ng nht vi 90ml dung dch m phosphat bng my dp mu c dung dch pha long 10-1. - Dng pipet v trng ht 1ml dung dch pha long 10-1 sang ng nghim cha 9ml dung dch m phosphat c dung dch pha long 10-2. Ty theo mc nhim bn ca mu m tin hnh pha long cc nng cao hn. 3.2. Cy mu ln mi trng MYP - Chn 2 nng pha long thch hp, ht 0,1ml dch pha long vo mi a MYP (mi nng 2 a). Dng que gt tri cn thn cht nui cng nhanh cng tt. 30 oC, trong thi gian 24 - 48 gi. - Chn v m cc a c t 15 - 150 khun lc c trng ca Bacillus aureus (dt, ng knh 2 - 3mm, b hnh rng ca, mu hng, xung quanh c vng c). Chuyn 5 khun lc nghi ng ny ln mi trng phc hi TSA , 30oC qua m trc khi tin hnh cc th nghim sinh ho.

Hnh. Khun lc B.cereus trn mi trng Mossel

Hnh. Khun lc B.cereus trn mi trng MYP

3.3. Khng nh Bacillus cereus bng cc phn ng sinh ha - Th nghim kh nng ln men glucose: cy vi khun t mi trng TSA sang mi trng thch glucose, 35oC trong 24 gi. Bacillus cereus cho phn ng dng tnh lm i mu mi trng t sang vng. - Th nghim kh nng chuyn ha nitrat thnh nitrit: cy vi khun t mi trng TSA sang mi trng nitrat, 35oC trong 24 gi. Bacillus cereus c phn ng dng tnh nn sau khi nh thuc th vo canh khun chuyn sang mu cam trong 10 pht. - Th nghim Voges - proskauer: cy vi khun t mi trng TSA sang mi trng canh MR - VP, 35oC trong 48 gi. Bacillus cereus cho phn ng dng tnh: mi trng chuyn sang mu hng khi cho thuc th a-Naphthol vo (trc khi nh a-Naphthol vo phi lm kim ha mi trng nui cy bng KOH 40%). - Th nghim Tyrosin: cy vi khun t mi trng TSA sang ng thch nghing Tyrosin, 35oC trong 48 gi. Khun lc Bacillus phn hy tyrosin to khong trong xung quanh khun lc. - Th nghim Lysozyme: cy vi khun t mi trng TSA sang ng nghim cha mi trng Nutrient Broth vi 0,001% lysozyme, 35oC trong 24 gi. Bacillus pht trin lm mi trng c u. 3.4. Tnh ton kt qu: NR S Bacillus cereus trn 1g mu = n V f Trong : Trang 118

N: tng s khun lc m c n: s lng a m f: pha long tng ng V: th tch dch mu cy vo trong mi a R: t l xc nhn = t l gia s khun lc nghi ng cho th nghim dng tnh so vi s khun lc nghi ng. 4. Nhng im cn lu - Bacillus cereus l nhm vi sinh vt nguy hi, cn ht sc cn thn khi phn tch. Mang gng tay, khu trang trong qu trnh lm th nghim. - Cc mi trng phn lp Bacillus cereus c cc thnh phn d bin tnh nhit cao, do , khng c hp tit trng khi pha ch. 5. Bo co thc tp - Trnh by quy trnh phn tch Bacillus cereus trong thc phm? - Ti sao khi phn tch Bacillus cereus trong thc phm, ch cn phn tch nh tnh? - Gii thch c ch ca cc phn ng sinh ha xc nh Bacillus cereus? - Nu kt qu v kt lun v s hin din ca Bacillus cereus trong mu thc phm ban u?
Lay 25g mau ong nhat vao 225ml pepton em, c 10-1 Pha loang mau 10-2, 10-3, 10-4
Chuyen 0,1ml dung dch 10-2, 10-3, 10-4 cy tri vao a petri mi trng MYP, u 30oC, 30h

m tt c cc khun lc c trng co mau hong eosin, lecithinase dng tnh trn a petri Chon 5 khuan lac c trng cay sang TSA hay BHI, u 30oC, 24h Cay th sinh hoa: phenol red glucose broth, gram, nitrate broth, VP, Tyrosine agar, Lysozyme broth

Ket luan Bacillus cereus

Trang 119

BI 22 PHNG PHP PHN TCH NH LNG STAPHYLOCOCCUS AUREUS TRONG THC PHM
1. Nguyn tc Staphylococcus aureus (t cu vng) c Robert Koch pht hin vo nm 1878 thng qua phn lp t m ca cc ung nht. Staphylococcus aureus thuc h Micrococcaceae (cu khun). T cu khun hin nay c pht hin c 20 loi , c chia lm 2 nhm: nhm coagulase (+) v coagulase (-). Staphylococcus aureus thuc loi coagulase (+). Hin din nhiu ni trong mi trng v trn c th ngi. Gy nhiu bnh nguy him trn da, trong c th bng cch tit cc c t nh hyaluronidase, hemolysine, leukocidine, exfoliatine, 5 c t rut enterotocxine A, B, C, D, E v c t gy hi chng sc nhim c. Nguyn tc pht hin s hin din v nh lng s lng ca Staphylococcus aureus trong thc phm da vo s xut hin ca khun lc in hnh (ch nh bi s kh ca Kali tellurite v lng trng) trn mi trng phn lp Baird-Parker v phn ng dng tnh coagulase trong dch huyt tng th. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bt m khun lc Ci 1 2.2. Mi trng v ho cht - Mi trng BPA b sung kali tellurite v lng trng - Huyt tng th ng kh - Nc mui sinh l 0,9% - Thuc nhum tm kt tinh - Dung dch lugol - Thuc nhum Fuschin - Cn 96o * Dung dch Saline Peptone Water (SPW) c s dng pha long vi sinh vt, thnh phn nh sau: - Pepton :1g - NaCl :8,5g - Nc ct :1000ml Phn phi 9ml vo cc ng nghim v 90ml vo cc erlen. Hp kh trng 121oC, 15 pht. pH cui = 7,0. * Mi trng Baird-Parker - Tryptone 10g Trang 120

- Cao tht 5g - Cao nm men 1g - Sodium pyruvate 10g - Glycine 12g - Lithium chloride.6H2O 5g - Agar 20g - Nc ct 1000ml o Hp kh trng 121 C, 15 pht. pH cui = 7,0 0,2. Mi trng hon chnh: thm 5ml Bacto EY tellurite enrichment c lm m 45 oC vo 95ml mi trng c bn c un chy v lm ngui 45 oC, trn u v 10 - 15ml vo cc a pettri v trng. * Mi trng Trypticase Soy Agar (TSA): c s dng bo qun, phc hi vi sinh vt trong qu trnh th nghim - Trypticase peptone 15g - Phytone peptone 5g - NaCl 5g - Nc ct 1000ml un nng, phn phi mi trng vo cc ng nghim, hp kh trng 15 pht, 121oC. t ng nghim nghing. pH cui = 7,30,2. 2.3. Nguyn liu khc - Mu tht heo ti - Ti nilon dp mu - Dch vi khun Staphylococcus aureus kim chng 3. Tin hnh th nghim 3.1. Chun b mu phn tch - Mu a v phng th nghim, m ra cho vo khay v trng. Dng ko v kp v trng ly i din 10g mu cho vo bao PE v trng. Mu c ng nht vi 90ml dung dch SPW bng my dp mu c dung dch pha long 10-1. - Dng pipet v trng ht 1ml dung dch pha long 10-1 sang ng nghim cha 9ml dung dch SPW c dung dch pha long 10-2. Ty theo mc nhim bn ca mu m tin hnh pha long cc nng cao hn. 3.2. Cy v mu - Chn nng pha long thch hp, cy 0,1ml dch pha long vo a mi trng Baird Parker, dng que cy tam gic tri u mu cho n khi kh. Thc hin tng t vi 2 a mi trng Baird Parker khc. 37oC trong 24 - 48 gi.

Hnh. Khun lc c trng ca Staphylococcus aureus trn mi trng BPA 3.3. c kt qu - m ring s khun lc c trng Nt (trn, en, bng, c qung sng, qung trong xung quanh khun lc) v khng c trng Na ca Staphylococcus aureus.

Trang 121

- Cy 5 khun lc c trng v 5 khun lc khng c trng sang ng thch nghing TSA. 30oC trong 24 gi. 3.4. Php th khng nh * Th nghim catalase - Mc ch: chn on phn bit khm vi khun Staphylococci vi khm vi khun Streptococci v Pneumococci. Staphylococci c emzyme catalase s phng thch O2 t H2O2 to hin tng si bt. - Th nghim c thc hin bng cch ho mt t sinh khi vi sinh vt ly trc tip t khun lc trn mi trng BPA vo git H2O2 trn lame knh. Kt qu: + Hin tng si bt xy ra ngay lp tc sau khi H 2O2 tip xc vi vi khun c catalase (+) cocci ny l Staphylococci. + Khng c hin tng si bt: catalase (-) nhm cocci ny l Streptococci * Th nghim coagulase - Cy sinh khi vi khun t mi trng TSA sang cc ng nghim cha huyt tng th, 37oC. - Theo di kt qu phn ng ng huyt tng sau 2, 4, 6, 8 v 24 gi. Staphylococcus aureus cho phn ng huyt tng dng tnh (c khi ng huyt tng hnh thnh). 3.5. Tnh ton kt qu 1 ( N t Rt + N a Ra ) Mt Staphylococcus aureus trong 1g mu (CFU/g): S = nVf Trong : - f: h s pha long, V: th tch mu cy - n: s a tho iu kin - Nt: tng s khun lc c trng - Na: tng s khun lc khng c trng - Rt: t s gia khun lc c trng cho th nghim khng nh (+) so vi s khun lc c trng - Ra: t s gia khun lc khng c trng cho th nghim khng nh (+) so vi s khun lc khng c trng 4. Nhng im cn lu - Staphylococcus aureus l nhm vi sinh vt nguy hi, cn ht sc cn thn khi phn tch. Mang gng tay, khu trang trong qu trnh lm th nghim. - Th nghim coagulase c th thc hin trn dch huyt tng th ng kh hoc dch huyt tng th ti. - Dung dch H2O2 dng lm th nghim coagulase phi c bo qun nhit thp trnh lm mt hot tnh khi s dng. 5. Bo co thc tp - Trnh by c tnh v c tnh ca vi khun Staphylococcus aureus? - Trnh by quy trnh phn tch nh lng Staphylococcus aureus? - ngha ca vic xc nh ch s Ht v Ha? - Xc nh kt qu phn tch nh lng Staphylococcus aureus trong mu tht ban u?

Hnh. Kt qu th nghim coagulase trn dch huyt tng th (m tnh: I, dng tnh: II, III, IV, V) Trang 122

Quy trnh phn tch Staphylococcus aureus trong thc phm: Cy 0,1 0,3 ml dung dch mu (10-1) ln b mt mi trng Baird Parker agar, trang u bng que tam gic ngc a 37 0,5oC trong 48 gi m s khun lc c trng (Nt) v s khun lc khng c trng (Na) Chuyn 5 kl c trng v 5 kl khng c trng sang mt TSA 37 0,5oC qua m Cy chuyn vo ng cha 0,3ml huyt tng 37 0,5oC v theo di sau 2, 4, 6, 8 gi. Nu khng c kt qu dng tnh s n 24 gi. Xc nh t l dng tnh Rt (KL c trng) v Ra(KL khng c trng) Kt qu: s S. areus (CFU/g) S= 1 ( N t Rt + N a Ra ) nVf

Trang 123

BI 23 PHNG PHP PHN TCH VIBRIO CHOLERAE TRONG THC PHM (Tiu chun: TCN 200:2004)
1. Nguyn tc Vibrio cholerae thuc ging Vibrio, h Vibrionaceae l phy khun gram m, k kh tu nghi, c kh nng di ng nhanh, phn ng oxidase dng tnh, pht trin c nhit 420C, ln men ng sacarose, kh lysin; pht trin c mi trng khng c mui nhng khng pht trin c mi trng c nng mui ln hn hoc bng 6 %; nhy vi hp cht c ch phy khun O/129 Vibriostat. Vibrio cholerae l nhm vi khun nguy him (tc nhn gy bnh t), thng xm nhim vo cc loi thy hi sn. C kh nng pht dch nhanh. Trong tt c cc loi thc phm, ch tiu i vi i tng ny bng 0 (khng c pht hin trong 25g thc phm). Pht hin Vibrio cholerae bng cch tng sinh trong mi trng lng chn lc v cy chuyn phn lp trn mi trng rn chn lc. Nhng khun lc nghi ng c khng nh bng th nghim sinh ho v khng huyt thanh. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bt m khun lc Ci 1 2.2. Mi trng v ho cht * Nc pepton kim: Ancalin Peptone Water (APW) - Pepton : 10,00 g - Natri clorua : 10,00 g - Nc ct : 1000ml - pH 8,50,2 ( nhit 250C) Ho tan cc thnh phn, chnh pH theo yu cu ri chia vo cc bnh cha thch hp. Hp nhit 1210C trong 10 pht. Khi bo qun phi vn cht np bnh, trnh bay hi nc v pH b thay i. * Mi trng phn lp: Thch Thiosunfat-Citrat-Bile-mui-Sacarose (TCBS thch) - Pepton : 10,00 g - Cao nm men : 5,00 g - Natri xitrat : 10,00 g - Na2S2O3 : 10,00 g - Mt b : 5,00 g - Sacarose : 20,00 g - Natri clorua (NaCl) : 10,00 g Trang 124

- St (III) citrat (FeC6H5O7) : 1,00 g - Natri cholate : 3,00 g - Xanh bromthymol : 0,04 g - Xanh thymol : 0,04 g - Thch : 15,00 g. - Nc ct v trng 1000ml - pH 8,6 0,2 ( nhit 250C). un si ho tan hon ton cc thnh phn ri lm ngui ngay ti nhit khong 500C. Rt 15 - 20 ml vo cc a petri v trng. Trc khi s dng phi lm kh a mi trng bng cch qua m nhit trong phng hoc t a trong t m nhit khong 370C - 450C. Khng hp kh trng mi trng Mi trng, thuc th sinh ho * Thch st ba ng: Triple Sugar Iron agar -TSI - Pepton : 15,00 g - Proteose pepton : 5,00 g - Cao tht b : 3,00 g - Cao nm men : 3,00 g - NaCl : 5,00 g - Lactose : 10,00 g - Sacarose : 10,00 g - Glucose : 1,00 g - FeSO4 : 0,20 g - Na2S2O3 : 0,30 g - phenol : 0,024 g - Thch : 12,00 g - Nc ct : 1000 ml - pH = 7,40,2 ( nhit 250C) Ho tan cc thnh phn, chia vo mi ng nghim khong 5 ml. Hp nhit 1210C trong 15 pht. Trc khi mi trng ng, t cc ng nm nghing sao cho phn thch ng cao khong 2 - 3 cm v phn thch nghing khong 4 - 5 cm. * Thch st hai ng: Klingler Iron Agar -KIA - Polypepton pepton : 20,00 g - NaCl : 5,00 g - Lactose : 20,00 g - Dextrose : 1,00 g - St ammoni xitrat : 0,50 g - Na2S2O3 : 0,50 g - Phenon : 0,025 g - Thch : 15,00 g - Nc ct : 1000 ml - pH = 7,40.2 ( nhit 250C) Ho tan cc thnh phn, chia vo mi ng nghim khong 5 ml. Hp nhit 1210C trong 15 pht. Trc khi mi trng ng, t cc ng nm nghing sao cho phn thch ng cao khong 2 - 3 cm v phn thch nghing khong 4 - 5 cm * Hugh - Leifson Glucose - Pepton : 2,00 g - Cao nm men : 0,50 g - NaCl : 30,00 g - Dextrose : 10,00 g - Tm bromcresol : 0,015 g - Thch : 3,00 g - Nc ct : 1000 ml Trang 125

- pH = 7,40,2 ( nhit 250C) un nng ho tan hon ton cc thnh phn trn ri chia vo mi ng nghim khong 5 ml. Hp nhit 1210C trong 15 pht. * O/F Glucose - Trypton : 2,00 g - Natri clorua (NaCl) : 5,00 g - K2HPO4 : 0,30 g - Xanh bromthymol : 0,03 g - Thch : 2,00 g - Glucose : 10,00 g - Nc ct : 1000ml - pH = 6,80,2 ( nhit 250C) un si ho tan cc thnh phn ri rt 5 ml mi trng vo mi ng nghim. Hp nhit 1210C trong 15 pht . * Canh thang mui trypton c gii nng NaCl l: 0; 1; 3; 6; 8 v 10 % NaCl (k hiu ln lt l: T1N0; T1N1; T1N3; T1N6; T1N8 v T1N10) Ho tan 10 g trypton trong 1 lt nc ct. Sau , thm ln lt : 10, 30, 60, 80 v 100 g NaCl c cc canh thang trypton c gii nng NaCl nh trn. Sau , khuy u, ri chnh pH sao cho mi trng sau khi hp c pH = 7,2 0,2 ( nhit 25 0C). Tin hnh rt 5 ml mi trng vo mi ng nghim. Hp nhit 1210C trong 15 pht. Cc ng mi trng phi c nt cht trong qu trnh bo qun trnh bc hi nc lm thay i nng mui. * Mi trng th decarboxylase (Mi trng c bn) - Pepton : 5,00 g - Cao nm men : 3,00 g - Glucose : 1,00 g - Tm bromcresol : 0,02 g - Nc ct : 1000 ml - pH = 6,50,2 ( nhit 250C) Tu theo loi mi trng cn pha, thm 5 g mt trong cc loi axitamin: L-lysin hoc L-arginin hoc L-ornithin vo mi trng c bn trn. Sau , rt 5 ml mi trng vo cc ng nghim, ni lng np. Hp nhit 1210C trong 10 pht. Cc ng phi c nt cht trong khi bo qun v sau khi cy. * Canh thang ur - ur : 20,00 g - Na2HPO4 : 9,50 g - K2HPO4 : 9,10 g - Cao nm men : 0,10 g - phenol : 0,01 g - Nc ct : 1000ml - pH = 6,80,1 ( nhit 250C) Ho tan cc thnh phn. Khng c hp kh trng, lc v trng bng mng lc c ng knh l l 0,45 ml. Sau , rt khong 1,5 - 3,0 ml vo cc ng nghim hoc a petri c sy v trng. * Canh thang bromcresol ( Mi trng c bn) - Pepton : 10,00 g - NaCl : 5,00 g - Cao tht b : 3,00 g - Tm bromcresol : 0,04 g - Nc ct : 1,00 lt - pH = 7,00,2 ( nhit 250C)

Trang 126

Ho tan cc thnh phn trn, chnh pH sao cho mi trng sau khi pha t yu cu nh trn ri rt 2,5 ml vo cc ng nghim. Hp nhit 1210C trong 10 pht. Pha cc loi dung dch cacbonhydrat 50% (nh: sacarose, lactose, D-cellobiose, arabinose, D-manniton v D-mannose) trong nc ct ri lc v trng. Thm 0,2780,002 ml dung dch ny vo ng nghim cha 2,5 ml mi trng c bn. Mi trng cui cng c nng carbohydrat l 5%. * Thch trypton mui 2% : TSA 2% NaCl - Trypton : 10,00 g - NaCl : 20,00 g - Thch : 20,00 g - Nc ct : 1000 ml - pH = 7,20,2 ( nhit 250C) un si ho tan cc thnh phn trn. Hp nhit 121 0C trong 15 pht. Sau , ngui n nhit khong 45 - 500C ri rt ra a hoc ng nghim. * Thuc th Oxidasse Ho tan 1,0 g N-tetrametyl-p-phenylenediamine.2HCl vo 100 ml nc ct v trng. ng dung dch trong l sm mu hoc bc l trong giy bc. Bo qun dung dch nhit 2 - 80C, s dng trong vng 7 ngy. * Du khong v trng Rt khong 20 - 50 ml du khong vo bnh c np xoy. Hp du nhit 121 0C trong 30 pht. * Thuc th ONPG - Dung dch m: Natri dihydro phosphat ngm 1 phn t nc (NaH2PO4.H2O) : 6,90 g Nc ct : 45,00 ml Dung dch hydroxit natri (NaOH) 30 % (w/v) : 3,00 ml Ho tan NaH2PO4.H2O trong nc ct. Thm dung dch NaOH 30% v chnh pH = 7,0 ( nhit 250C), thm nc ct va 50 ml. Bo qun dung dch nhit 2 - 80C. - Dung dch ONPG: ONPG (o-nitrophenyl-D-galactoside ) : 80,00 mg Nc ct 370C : 15,00 ml Dung dch m : 5,00 ml Ho tan ONPG trong nc ct nhit 370C. Thm dung dch m vo ri lc u. Bo qun nhit 2 - 80C. Trc khi s dng phi lm m dung dch n nhit 370C. * Cc a 10 mg v 150 mg O/129 Vibriostat Ct giy lc thnh cc mnh trn ng knh khong 5 - 6 mm ri t vo cc a petri, hp kh trng. Chun b a 150 mg O/129 Vibriostat: ho tan 2,4 - diamino - 6,7 - diisopropyl pteridin photphat (O/129) trong nc ct v trng theo t l 15,0 mg/ml, nh 10ml dung dch ny vo mi a. Chun b a 10 mg O/129 Vibriostat: ho tan 2,4 - diamino - 6,7 - diisopropyl pteridine phosphat (O/129) trong nc ct v trng theo t l 1,0mg/ml, nh 10ml dung dch ny vo mi a. Sy kh cc a, bo qun trong t lnh, trnh nh sng. 2.3. Nguyn liu khc - Mu thy sn ti (nghu, s, mc...) - Ti nilon dp mu - Dch vi khun Vibrio cholerar kim chng - Cn 96o 3. Tin hnh th nghim 3.1 Chun b mu Chun b mu thc phm Trang 127

Cn v trng 25 g mu thu sn vo mt ti PE v trng. Ct cc mu ln thnh cc mnh nh ri thm 225 ml nc pepton kim APW vo ti, nghin bng my nghin ng nht trong 2 pht. Mu kim tra thng v d: mu nghu Ly phn tht ca 10 - 12 con nghu (k c nc) ri ct nh, trn u. Sau , nghin bng my nghin ng th 50 g mu hu trong 450 ml nc pepton kim APW trong 2 pht. Chia dung dch mu ny vo 2 bnh v trng, mi bnh cha 250 ml ri pha long thnh hai dy bng cch trn u 10 ml dung dch mu trong 90 ml nc pepton kim APW. mu hai ch nhit l 37,00C1,00C v 42,00C0,20C. 3.2 Tng sinh a. i vi mu thng thng cc bnh cha mu chun b (k c mu chng dng v mu chng m) nhit 37,00C1,00C trong 6 - 8 gi. Sau , phn lp, phn cn li tip 16 - 24 gi ri phn lp li. b. i vi mu nghu 1 dy pha long 10-1 n 10-2 nhit 37,00C1,00C trong 6 - 8 gi v 16 - 24 gi. 1 dy pha long 10-1 n 10-2 nhit 42,00C0,20C trong 6 - 8 gi. 3.3. Phn lp v c kt qu trn a Sau khi nui cc ch nhit v cc khong thi gian tr, khng lc, dng khuyn cy ly dch mu trn b mt cy ria vo mi trng TCBS thch. cc a TCBS thch nhit 37,00C1,00C trong 18 - 24 gi. Trn mi trng TCBS thch, khun lc V. cholerae trn, hi dt, bng, mu vng (do vi khun ln men sacarose), gia m v c vin m xung quanh.

Hnh. Khun lc c trng ca Vbrio cholerae trn mi trng TCBS 3.4 Th nghim sinh ho v khng huyt thanh a. Th nghim sinh ho s b Chn t nht 3 khun lc nghi ng trn TCBS thch cy chuyn sang mi trng khng chn lc TSA 2% NaCl. nhit 37,00C1,0oC trong 18 - 24 gi. Khun lc mc trn mi trng ny c s dng thc hin cc th nghim sinh ho. * Th nghim trn mi trng TSI, KIA Cy chuyn cc khun lc t mi trng TSA vo cc ng thch nghing TSI hoc KIA. Ni lng cc np ng to iu kin hiu kh. Nui nhit 37,00C1,00C trong 18 - 24 gi. Trn mi trng TSI, V.cholerae lm phn thch nghing v thch ng ca mi trng chuyn mu vng, khng sinh hi v khng sinh H2S. Trn mi trng KIA, phn thch nghing c mu v thch ng mu vng, khng sinh hi v khng sinh H2S. * Th nghim vi cc canh thang trypton mui

Trang 128

Cy khun lc t mi trng TSA vo cc ng canh thang mui trypton c gii nng NaCl l: 0; 1; 3; 6; 8 v 10 %. Nui nhit 37,01,0 0C trong 18 - 24 gi, ri li cc ng m tnh sau 18 - 24 gi na. V. cholerae pht trin c trong ng canh thang c nng NaCl l 0%, 3% v lm c mi trng. * Th nghim ln men - oxy ho Cy khun lc t mi trng TSA vo 2 ng mi trng bn lng Hugh-Leifson glucose hoc O/F glucose. Ph khong 1 - 2 ml du khong v trng vo mt trong 2 ng. cc ng nghim nhit 37,01,00C trong 1 - 2 ngy. V. cholerae ln men glucose lm mi trng Hugh - Leifson t mu tm chuyn thnh vng v mi trng O/F t mu xanh thnh vng. * Th nghim oxidase t giy lc ln mt np a petri, nh khong 2 - 3 git thuc th oxidase. Dng que cy bch kim (platin) hoc que cy nha dng mt ln; hoc que g v trng ly cc khun lc t mi trng TSA ria ln v tr nh thuc th oxidase. V. cholerae lm vt ria c mu tm thm hoc xanh thm sau 10 giy . Ch thch: khng dng que cy bng crm hoc bng st trong th nghim ny. * Nhum gram V. cholerae l vi khun gram m, hnh cong dng du phy. b. Th nghim sinh ho khng nh * Th nghim pht trin nhit 420C Cy vi khun t TSA vo mt ng canh thang trypton 1% NaCl. nhit 0 42,0 C0,20C trong 18 - 24 gi. V. cholerae pht trin c nhit 420C lm mi trng b c. * Th nghim cacbonhydrat Cy vi khun t TSA vo cc ng canh thang bromcresol c cha mt trong cc lai cacbohydrat: sacarose, lactose, D-cellobiose, arabinose, D-manniton, D-mannose. cc ng canh thang nhit 37,00C1,00C. Phn ng dng tnh khi mi trng c mu vng, m tnh khi mi trng gi nguyn mu . V. cholerae cho phn ng sacarose, manniton, mannose dng tnh v lactose, cellobiose, arabinose m tnh. * Th nghim decacboxylase/dehydrolase Cy vi khun t mi trng TSA vo cc ng canh thang ornithin, lysin, arginin v ng i chng khng c axit amin. Mi ng c ph 1 - 2 ml du khong v trng. cc ng nhit 37,00C1,0 0C trong 18 - 24 gi. Phn ng dng tnh khi mi trng gi nguyn mu tm hoc hi m hn. Phn ng m tnh khi ton b ng canh thang c mu vng n nh trong 4 ngy (tng t mu ca ng i chng). V. cholerae cho phn ng lysin v ornithin dng tnh, phn ng arginin m tnh. * Th nghim ur Cy vi khun t TSA vo canh thang ur, nhit 37,00C1,00C trong 18 - 24 gi. V. cholerae cho phn ng m tnh nu mi trng gi nguyn mu tm hng. * Th nghim ONPG Ly vi khun pht trin trn mi trng TSI hoc t mi trng khng chn lc khc c cha 1,0% lactose vo ng nghim c cha 0,25 ml nc mui sinh l, ho tan. Thm 1 git toluen vo ng ri lc u, yn trong 5 pht. Thm 0,25 ml dung dch ONPG. ng nghim nhit 37,00C1,00C. Kim tra ng nh k trong 24 gi. V. cholerae cho phn ng ONPG dng tnh khi dung dch c mu vng. C th dng a ONPG thay cho thuc th ONPG. Ho tan khun lc nghi ng vo ng nghim cha 0,2 ml nc mui sinh l. t a ONPG vo y ng ri m v c kt qu nh trn. * Th nghim tnh nhy cm vi hp cht c ch phy khun O/129 Vibriostat Dn vi khun ln a thch TSA 2% NaCl. t cc a O/129 c cha 10 mg hoc 150mg Vibriostat vo cc v tr khc nhau. Sau , lt ngc a ri nhit 37,01,0 0C Trang 129

trong 18 - 24 gi. V. cholerae khng pht trin c do b c ch bi Vibriostat to mt vng v khun xung quanh cc a O/129. * Th nghim khng huyt thanh Nh 1 git khng huyt thanh ln lam knh sch v mt git nc mui sinh l ln mt v tr khc ca lam. Dng que cy v trng khc nhau chuyn vi khun t TSA ln hai git dung dch trn ri phn tn u vi khun. Kt lun dng tnh khi c hin tng ngng kt git c khng huyt thanh v khng c hin tng ngng kt git nc mui. S dng chng chng dng v chng chng m trong qu trnh thc hin. Tm tt th nghim khng huyt thanh V. cholerae theo Bng 1 v Bng 2. Bng . Phn bit V. cholerae O1 v V. cholerae non - O1 Khng nguyn Khng huyt Dung dch mui thanh a gi O1 sinh l Chng c kt qu sinh ho + tng t V. cholerae Chng c kt qu sinh ho tng t V. cholerae Chng c kt qu sinh ho + + tng t V. cholerae

Kt lun V.cholerae O1 V.cholerae non- O1 Chng khng c hiu vi khng nguyn O nhm 1

Bng. Phn bit cc kiu huyt thanh chng V.cholerae O1 Khng nguyn Khng huyt Khng huyt Dung dch thanh Inaba thanh Ogawa mui sinh l V. cholerae O1 + V. cholerae O1 + V. cholerae O1 + + V. cholerae O1 -

Kt lun Chng Inaba Chng Ogawa Chng Hikojima Chng khng c hiu

3.5. c kt qu Pht hin hoc khng pht hin c V. cholerae trong 25 g mu. 4. Nhng im cn lu - Mi trng tng phn lp Vibrio l TCBS c mt s thnh phn bin tnh nhit cao, khng c hp tit trng. - Chng Vibrio cholerae (gy bnh t) l loi vi sinh vt nguy him, cn thn trong qu trnh thc hnh. Mang khu trang v gng tay trnh b xm nhim. Cc dung dch vi sinh vt, dng c v mi trng nui cy cn c hp tit trng cn thn sau khi th nghim. - Dch pepton kim (APW) tng sinh chn lc Vibrio, sau 24 gi s c mi kh chu, khi hp tit trng loi b, cn bc k bng ti nilon. - kt qu phn tch chnh xc, nn s dng mi trng tng hp dng ng kh cho tt c cc bc th nghim. 5. Bo co thc tp - Trnh by c tnh sinh l v gy bnh ca Vibrio cholerae? - Trnh by quy trnh phn tch Vibrio cholerae trong thy sn? - Gii thch c ch ca cc th nghim sinh ha v khng huyt thanh s dng trong qu trnh phn tch xc nh Vibrio cholerae?

Trang 130

BI 24 PHNG PHP PHN TCH CLOSTRIDIUM PERFRINGENS TRONG THC PHM


1. Nguyn tc Vi khun Clostridium perfringens thuc nhm vi khun Gram dng. a s sng k kh, a nhit v c kh nng sinh bo t chu nhit. Clostridium perfringens thy gii mnh protein v chuyn ha acid amin to mi kh chu. Clostridium perfringens sinh c t trong thc phm v gy bnh hoi t vt thng. Clostridium perfringens c phn tch bng cch s dng mi trng c cha st v sulphite. Khun lc mc trn mi trng c mu en do phn ng gia S2- v Fe2+. 2. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 1 STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bnh k kh Ci 1 6 Bp un cch thy Ci 1 7 Bt m khun lc Ci 1 2.2. Mi trng v ho cht * Mi trng Sulphite polymyxin sulphadiazin (SPS agar) c s dng nh lng Clostridium perfringens - Peptone :15g - Yeast extract :10g - Ferric citrate :0,5g - Sodium sulphite :0,5g - Polymycin B sulphate :0,01g - Sodium sulfadiazine :0,12g - Agar :13,9g - Nc ct :1000ml Phn phi vo ng nghim. Hp 15 pht 121oC. pH cui = 7,00,2. * Dung dch Buffered Peptone Water (BPW) c s dng pha long vi sinh vt - Peptone :10g - NaCl :5g - Na2HPO4.9H2O :9g - KH2PO4 :1,5g - Nc ct :1000ml Trang 131

Phn phi 9ml vo cc ng nghim v 90ml vo cc erlen. Hp kh trng 121oC, 15 pht. pH cui = 7,00,2. * Mi trng Wilson Blair ci tin (Sulfite Iron Wilson Blair agar) c s dng nh lng Clostridium perfringens - Glucose :20 g - Peptone :10g - NaCl :5g - Cao tht :5g - Agar :20g - Nc ct :1000ml un si, phn phi vo ng nghim hoc hp petri. Hp 121oC. pH cui = 7,00,2. t lnh. Khng c dng trc 24 gi v sau 5 ngy. * Dung dch phn st 5% (pha trc khi dng) * Dung dch Na2SO3 5% (pha trc khi dng) 2.3. Nguyn liu khc - Mu thy sn ti (nghu, s, mc...) - Ti nilon dp mu - Dch vi khun Clostridium perfringens kim chng - Cn 96o - Ti k kh Gaspak 3. Tin hnh th nghim * Phng php SPS 3.1. Cch mu - Mu a v phng th nghim, m ra cho vo khay v trng. Dng ko v kp v trng ly i din 25g mu cho vo bao PE v trng. Mu c ng nht vi 225ml dung dch BPW bng my dp mu c dung dch pha long 10-1. - Dng pipet v trng ht 1ml dung dch pha long 10-1 sang ng nghim cha 9ml dung dch BPW c dung dch pha long 10-2. Ty theo mc nhim bn ca mu m tin hnh pha long cc nng cao hn. 3.2. Cy v mu - Ly 1ml mu pha long, ng nht cho vo a petri - Cho 15 - 20 ml thch SPS vo mi a, o a, trn u. ng li - Lt p a, trong bnh k kh. 35 - 370C trong 24h. 3.3. c kt qu - m tt c cc khun lc c trng ca Clostridium perfringens (trn, en, c ng knh 3mm). 3.5. Tnh ton kt qu S khun lc trong 1g mu bng trung bnh cng s khun lc nghi ng c trong 2 ng nghim nui cy (cng nng ) nhn vi h s pha long tng ng v chia cho 10. * Phng php Wison Blair ci tin 3.6. Chun b mu phn tch ti phng th nghim - Mu a v phng th nghim, m ra cho vo khay v trng. Dng ko v kp v trng ly i din 25g mu cho vo bao PE v trng. Mu c ng nht vi 225ml dung dch BPW bng my dp mu c dung dch pha long 10-1. - Dng pipet v trng ht 1ml dung dch pha long 10-1 sang ng nghim cha 9ml dung dch BPW c dung dch pha long 10-2. Ty theo mc nhim bn ca mu m tin hnh pha long cc nng cao hn. 3.7. Cy v mu - Chn 2 nng pha long thch hp. Cho 10ml dung dch pha long (mi nng 2 ng) vo ng nghim c cha mi trng Wilson Blair ci tin lm ngui 45oC. Cho thm 2ml dung dch Na2SO3 v 5 git phn st 5%. Tip tc lm nh sau: - Lc u Trang 132

- un cch thy 75oC, 15 pht - Lm ng nhanh - 37oC trong bnh k kh trong thi gian 18 - 24 gi 3.8. c kt qu m tt c cc khun lc c trng ca Clostridium perfringens (trn, en, c ng knh 3mm). 3.9. Tnh ton kt qu S khun lc trong 1g mu bng trung bnh cng s khun lc nghi ng c trong 2 ng nghim nui cy (cng nng ) nhn vi h s pha long tng ng v chia cho 10. 4. Nhng im cn lu - Phn st v Na thiosulfat cn pha ring r v b sung sau khi hp tit trng. - Chng Clostridium perfringens l loi vi sinh vt nguy him, cn thn trong qu trnh thc hnh. Mang khu trang v gng tay trnh b xm nhim. Cc dung dch vi sinh vt, dng c v mi trng nui cy cn c hp tit trng cn thn sau khi th nghim. - kt qu phn tch chnh xc, nn s dng mi trng tng hp dng ng kh cho tt c cc bc th nghim. 5. Bo co thc tp - Trnh by c tnh sinh l v gy bnh ca Clostridium perfringens? - Trnh by quy trnh phn tch Clostridium perfringens trong thc phm? - Gii thch c ch ca cc th nghim sinh ha s dng trong qu trnh phn tch xc nh Clostridium perfringens? Quy trnh phn tch Clostridium perfringens trong thc phm: ng nht mu, x l mu 80oC

Cy trn a vi mi trng SPS 45oC, lc u

B sung thm mi trng SPS

37oC trong bnh k kh, trong 24 48 gi

m khun lc mu en ng knh khong 3mm

Trang 133

BI 25 PHN TCH VI SINH VT TRONG THC PHM BNG PHNG PHP PCR (POLYMERASE CHAIN REACTION)
1. Nguyn tc Cc phng php truyn thng pht hin vi sinh vt gy bnh trong thc phm bao gm cc bc nui cy trn mi trng chn lc v hng lot cc th nghim ho sinh khng nh s hin din ca mt loi gy bnh nht nh, v thng ko di vi ngy n vi tun. Trong nhng nm va qua, cc phng php nhanh hn, chuyn bit hn nhm pht hin cc vi sinh vt gy bnh trong thc phm da trn nguyn tc sinh hc phn t v min dch hc nh phng php lai phn t, PCR, ELISA c thit lp. PCR (Polymerase Chain Reaction) l k thut c ng dng ph bin khc phc c cc nhc im ca phng php truyn thng nh kh nng pht hin nhanh v c hiu mm bnh. Cc nghin cu hin nay trn th gii ang tp trung vo khng nh kh nng s dng PCR nh phng php tiu chun kim tra v sinh thc phm. PCR l mt k thut nhm to ra mt lng ln bn sao DNA mc tiu trong ng nghim da vo cc chu k nhit. K thut ny c nh khoa hc ngi M Kary Mullis pht minh vo nm 1985. S phn tch sn phm PCR bng in di s cho php pht hin vi sinh vt mc tiu d trn s so snh vi cc trnh t DNA c trng ca vi sinh vt chun. Xt nghim bng k thut PCR thng c kt qu chnh xc rt cao, tnh c hiu ln. Tuy nhin kt qu cng cn ty thuc trnh ca k thut vin, phng tin my mc lm vic v vic qun l cht lng. 2. 2. Dng c, mi trng v ha cht 2.1. Dng c Tn dng c, thit b mi STT n v tnh S lng Ghi ch nhm (3 sinh vin) 1 Gi ng nghim Ci 1 2 ng nghim 18 Ci 15 3 Bnh tam gic 250ml Ci 1 4 Cc 100ml Ci 1 5 Bnh tia Ci 1 6 Pipette 1ml Ci 5 7 Pipette 10ml Ci 1 8 Micropipette 100-1000l Ci 1 9 u tp 1000l Ci 10 ng Eppendorf 0,2. 0,5 ml; 1,5 10 Ci 5 ml chuyn dng cho PCR STT Dng c dng chung n v tnh S lng Ghi ch 1 Ni hp cao p Ci 1 2 T cy v trng Ci 1 3 T sy Ci 1 4 My dp mu Ci 1 5 Bnh k kh Ci 1 6 Bp un cch thy Ci 1 7 Bt m khun lc Ci 1 8 My PCR Ci 1 My ly tm dng cho ng 9 Ci 1 eppendorf 1,5 ml 10 My vortex Ci 1 11 Thit b in di ngang v b Ci 1 ngun in di c in th hot Trang 134

Tn dng c, thit b mi n v tnh S lng Ghi ch nhm (3 sinh vin) ng t 80 150 volt Hp n soi UV c knh lc 12 Ci 1 302mm 13 B chp nh trn n UV Ci 1 2.2. Mi trng, ha cht a. Ha cht * Mi: Gm hai mi invA1 v invA2 c thit lp cch nhau 520 bp trong gen invA c vai tr trong qu trnh xm nhim Salmonella vo thnh rut ng vt v ngi. Trnh t ca hai mi nh sau : invA1 : 5' - TTGTTACGGCTATTTTGACCA -3' invA2 : 5' - CTGACTGCTACCTTGGCTGATG - 3' Nng mi s dng trong phn tch c pha long thnh 6 pM trong m TE. m TE c thnh phn nh sau : 10 mM Tris-HCl (pH = 8), 1 mM EDTA. * Hn hp dng trong khuch i PCR 1,1x - Taq polymerase: 0,025 U/ml (1,25 U/50 ml) - Tris - HCl (pH = 8,8 nhit 25oC): 75 mM - Sunphat amon (NH4)2 SO4: 20 nM - Tween 20: 0,01% (v/v) - dNTP (dATP, dCTP, dGTP, dTTP): 200 mM (mi loi) - Magi clorua (MgCl2) 1,5 mM - Tt c cc thnh phn trn c pha ch trong nc ct 2 ln v bo qun nhit 4oC trong 1 thng. C th bo qun nhit - 20 oC trong 1 nm. Khng nn r ng v ti ng dung dch pha ch nhiu ln. * Thang ADN Nn s dng thang o ph hp c th c lng c on khuch i 520 bp. C th s dng sn phm khuch i c kch thc 520 bp bit trc lm thang o trong phng php ny. * Agarose S dng trong k thut ny l loi dng in di ADN c kch thc nh hn 1000 bp. * m in di TAE 1x - Tris: 4,84 g - Na2EDTA 0,5M, pH = 8,0: 2 ml - Axit axetic bng: 1,14 ml - Nc ct cho : 1000 ml Nn pha ch thnh dung dch 10x (m c 10 ln), khi s dng mi pha long vi nc thnh dung dch 1x. * m ti mu 6x - Glyxerol: 30 % - Xanh bromphenon: 0,25 % - Tris: 200 mM - Na2EDTA: 20 mM Cc thnh phn trn c pha trong nc ct, bo qun nhit 4oC. * Thuc nhum AND: dung dch etyl bromua nng 10 mg/ml b. Mi trng nui cy vi sinh vt Dung dch m pepton - Pepton (C5H10O5): 10,0g - Natri clorua (NaCl): 5,0g - inatri hyro pht phat (Na2HPO4): 3,6 g - Kali ihyro pht phat (KH2PO4): 1,5g STT Trang 135

- Nc ct: 1000 ml Ho tan cc thnh phn trong nc ct, un tan, phn phi vo trong cc bnh cha ph hp. Hp kh trng nhit 121oC trong 15 ph. pH sau khi kh trng l 7,0 0,2 25oC. 2.3. Nguyn liu khc Mu thc n ng ph, tht g ti sng, hi sn, trng v sn phm ca trng, rau x lch, thc n gia sc nhim vi sinh vt t nhin. 3. Tin hnh th nghim 3.1. Ly mu Cn chnh xc 25 g mu (hoc mt khi lng chnh xc tu theo yu cu) ri cho vo bnh tam gic hoc bao PE v trng. 3.2. Tng sinh Nhm lm tng s lng Salmonella trong mu, cc t bo b suy yu hay tn thng cng c phc hi v pht trin. Giai on ny c tin hnh trong mi trng khng chn lc v trn nguyn tc c mt phn khi lng mu s b sung 9 phn khi lng mi trng tng sinh. Nu ly 25 g mu, phi b sung 225 g mi trng tng sinh dung dch pepton m. mu c mi trng tng sinh nhit 37,0oC 1,0oC trong khong 18 gi 2 gi. 3.3. X l mu gii phng ADN Giai on ny nhm thu nhn sinh khi sau khi tng sinh, ra sch mi trng sau khi nui cy, ph v t bo gii phng ADN. Cch x l nh sau: - Lc u canh khun tng sinh. Ht 0,5 ml vo trong ng eppendorf c th tch 1,5 ml, ly tm vi tc 10 000 vng/pht trong 5 pht ri loi b phn mi trng lng bn trn. Ra sinh khi bn di vi nc ct v trng ri tip tc ly tm vi ch nh trn loi b phn nc. - Huyn ph sinh khi trong ng vi 0,5 ml nc ct v trng. un si cch thu trong 10 pht. Ly tm huyn dch sau khi un vi tc 10 000 vng/pht trong 5 pht lng cc mnh v t bo xung y. Phn dch trong bn trn c coi l khun ADN tin hnh phn ng khuch i. 3.4. Khuch i Giai on ny nhm lm tng s lng bn sao on ADN ch trn my lun nhit (thermocycler) bng hai mi c trng. Qu trnh khuch i c tin hnh trong khong 30 chu k. - Chun b ng khuch i Ht 45 ml hn hp khuch i PCR 1,1 x cho vo trong ng nghim PCR c th tch 0,2 hoc 0,5 ml, thm vo 1 ml mi mi invA1 v invA2 c nng 6 pM v 3 ml mu khun ADN. Tng th tch trong mt ng khuch i l 50 ml. i chng dng: thay dch khun ADN mu bng dch ADN ca Salmonella chun bit. i chng m: thay dch khun ADN mu bng nc ct v trng. - Chng trnh khuch i Cc ng khuch i c t vo trong my lun nhit. Chng trnh khuch i nh sau: duy tr nhit 95oC trong 5 pht lm bin tnh hon ton cc si ADN trong mu. Tip theo l 35 chu k, mi chu k c 3 bc nh sau: 95oC/60 giy; 54oC/45 giy v 72oC/60 giy. Sau khi kt thc 35 chu k, mu c gi nhit 72oC trong 10 pht, sau gi n nh nhit 20oC cho n khi in di. 3.5. in di sn phm khuch i - Chun b gel in di agarose 1% Gel agarose 1 % pha trong m TAE 1x c un chy hon ton v vo khay in di c sn cc lc to ging. Gel in di phi c dy khong 3 - 4 mm. Gel sau khi chun b c ngm chm hon ton trong m TAE. - Chun b dch in di Mu sau khi khuch i c nhum vi 10 ml m ti mu 6x ri trn tht u. Trang 136

- in di Mt ging trong gel in di c s dng cho thang ADN chun hay mu i chng dng. Np 10 ml dch in di chun b vo trong gel agarose. Tin hnh in di trong 60 pht hiu in th 100 vn. 3.6. Nhum ADN, quan st sn phm khuch i - Chun b dung dch nhum mu Pha dung dch nhum ADN nh sau: cho 0,2 ml etyl bromua 10 mg/ml vo 0,5 lt nc, pha vo trong khay cha c ming rng hn bn gel in di. - Nhum gel Ngm bn gel in di vo dung dch nhum trong 10 pht. Ra gel bng nc trong khong 3 - 5 pht loi b phn etyl bromua d. - Quan st, chp hnh Cho bn gel nhum ln hp n soi UV, ng knh bo v, bt n ri quan st cc vch sng ca ADN xut hin trn bn gel. Sau , chp hnh lu tr kt qu. 3.7. c v gii thch kt qu Kt qu phn tch ch c xem xt kt lun khi mu i chng dng tnh c sn phm khuch i ADN vi kch tc 520 bp v mu i chng m khng c sn phm ny. Mu c kt lun l dng tnh Salmonella khi c sn phm khuch i 520 bp trn bn gel. Mu c kt lun l m tnh khi khng c sn phm khuch i, hay sn phm khuch i c kch thc khc hn 520 bp. 4. Nhng im cn lu - Mang khu trang v gng tay cao su sch trnh lm tp nhim sn phm PCR - Khng iu chnh ngoi khong th tch cho php c ht khi s dng cc micropipette. - Tun th ng cc bc thao tc khi chun b phn ng PCR v khi vn hnh my lun nhit PCR. - Phi dng knh bo v mt khi quan st sn phm in di trn gel agarose di n UV. 5. Bo co thc tp - Trnh by nguyn tc phng php PCR trong xc nh vi sinh vt ca thc phm? - Trnh by vai tr ca mi xui, ngc trong phn ng PCR? - Gii thch ti sao phn ng PCR ch nn tin hnh khong 35 chu k? - Trnh by nguyn tc v phng php c bn in di sn phm PCR? - Trnh by kt qu xc nh Salmonella spp. trong mu thc phm ban u bng phng php PCR?

Trang 137

TI LIU THAM KHO


1. L Duy Linh, Trn Th Hng, Trnh Th Hng, L Duy Thng. 2010. Thc tp vi sinh c s. NXB i hc Quc Gia Tp. H Ch Minh. 2. Trn Vn Minh, Dng Nht Linh. 2008. Thc tp vi sinh c s. Ti liu lu hnh ni b. Trng i hc M Tp. H Ch Minh. 3. L Xun Phng. 2004. Th nghim vi sinh vt hc. NXB i hc Nng. 4. Trn Linh Thc, Nguyn c Hong, Phm Th Phng Trang, Phm Thi Hng Ti. 2001. Thc tp vi sinh vt hc. NXB i hc Quc Gia Tp.H Ch Minh. 5. Trn Linh Thc.2002. Phng php phn tch vi sinh vt trong nc, thc phm v m phm. NXB Gio dc. 6. Benson. 2001. Microbiological Applications Lab Manual, eighth edition. The McGraw-Hill companies. 7. Harley Prescott. 2002. Laboratory Exercises in Microbiology, fifth edition. The McGrawHill companies. 8. N.F. Lightfoot, E.A. Maier. 2003. Microbiological Analysis of Food and Water: Guidelines for Quality Assurance. Elsevier Science.

Trang 138