You are on page 1of 4

Diseño de tablas físicas

Significado de las restricciones: PK: Primary key FK: Foreign key AI: Auto increment N: NULL NN:NOT NULL

Tabla: PRODUCT
product_id RESTRICTIONS DATA TYPE PK VARCHAR(4 5) PRD_E_000 1 Product_name NN VARCHAR(200) Sequence NN TEXT Type NN VARCHAR(10) molecular_weight N FLOAT Isoelectric_point N FLOAT organism_id FK,NN VARCHAR(45)

EXAMPLE

TRYPTOPHAN

MTYGGTYM GTAAVAAGY LGYLYGYGQ QRR

Protein

234

7.4

ORG_Eco

Tabla: ORGANISM
organism_id RESTRICTIONS NDATA TYPE EXAMPLE PK VARCHAR(45) ORG_Eco organism_name NN VARCHAR(45) E. coli description NN TEXT ‘Escherichia coli abbreviated E. coli) is a Gram-negative, rodshaped bacterium that is commonly found in the lower intestine of warm-blooded organisms (endotherms). ‘

Tabla: GENE
gene_id product_ id FK,NN gene_na me NN orientation position _left NN position_ right NN sequence organism_id attenuator_id riboswitch _id FK,N

RESTRICTI ONS DATA TYPE

PK

NN

NN

FK,NN

FK, N

VARCHA R(45)

VARCHA R(45)

VARCHA R(45)

ENUM(‘forward’,’r everse’) default ‘forward’ Reverse

INT

INT

TEXT

VARCHAR(45)

VARCHAR(45)

VARCHAR( 45)

EXAMPLE

GEN_E_0 001

PRD_E_0 001

Trp

1234543

624245

ATGAGCTGGATTGAACGA ATTAAAAGCAACA… …TTACTCCCACCCGCAAG GCGAGCATTCCTATCTG

ORG_Eco

ATT_E_0001

RIB_E_000 1

Tabla: PROMOTER
RESTRICTIONS DATA TYPE EXAMPLE promoter_id PK VARCHAR(45) PRM_E_0001 position_plus_one N INT 56127 sequence NN TEXT GAACGCT ACGAATCTCT GTTTGCCCAG sigma_factor NN VARCHAR(10) Sigma70 organism_id FK,NN VARCHAR(45) ORG_Eco

Tabla: TERMINATOR
terminator_id RESTRICTIONS DATA TYPE PK VARCHAR(45) sequence N TEXT terminator_type N ENUM(‘rhodependent’,’rho independent’) rho dependent position_l eft N INT position_ri ght N INT orientation NN VARCHAR(45)

EXAMPLE

TER_E_0001

GAACGCGTCAGTACGATCAGTACAGTATACCGAAA CATGGATCAGTTACAGTFC

12365

12456

forward

Tabla: ATTENUATOR
RESTRICTIONS DATATYPE EXAMPLE attenuator_id PK,AI VARCHAR(45) ATT_E_0001 Sequence N TEXT ACACACACTGTGTGTATGCAGTACAGTACAGTCAGTACAGTACAGTCAGTATATAGAC

Tabla: TU
RESTRICTIONS DATA TYPE EXAMPLE tu_id PK VARCHAR(45) TUN_E_0001 tu_name NN VARCHAR(45) RpoD terminator_id FK,N VARCHAR(45) 13 position NN INT 12345 promoter_id FK,N VARCHAR(45) PRM_P_0001 organism_id FK,NN VARCHAR(45) ORG_Pae

Tabla: TF
RESTRICTIONS DATA TYPE EXAMPLE tf_id PK VARCHAR(45) TFA_E_0001 tf_name NN VARCHAR(100) Vezf1 product_id FK,NN VARCHAR(45) PRD_E_0001 organism_id FK,NN VARCHAR(45) ORG_Sty

Tabla: SMALL_MOLECULE
RESTRICTIONS DATA TYPE EXAMPLE sm_id PK VARCHAR(45) SML_P_0001 Type NN ENUM(‘nucleotide’,’aminoacid’,’metabolites’) Aminoacid molecular_name NN VARCHAR(200) Valine molecular_weight NN FLOAT 117.15 g/mol

Tabla: RIBOSWITCH
RESTRICTIONS DATA TYPE EXAMPLE riboswitch_id PK VARCHAR(45) RIB_T_0001 riboswitch_name N VARCHAR(45) Asdf sm_id FK,NN VARCHAR(45) SML_P_0001 sequence NN TEXT ATGCACACAGTGTGATCGATCAFCAGTATCAGTACAATGATCAATTAACAC ATAATATAGAGTA

Tabla: GENE_TU_LINK
RESTRICTIONS DATA TYPE EXAMPLE gene_id FK,NN VARCHAR(45) GEN_T_0001 tu_id FK,NN VARCHAR(45) TUN_T_0001

Tabla: SYNONYM
RESTRICTIONS DATA TYPE EXAMPLE synonym NN VARCHAR (45) ECK0341 gene_id FK,N VARCHAR(45) GEN_E_0001 tu_id FK,N VARCHAR(45) TUN_E_0001 promoter_id FK,N VARCHAR(45) PRM_E_0001 product_id FK,N VARCHAR(45) PRD_E_0001

Tabla: REGULATION_GENE _LINK
RESTRICTIONS DATA TYPE EXAMPLE Gen_id FK,NN VARCHAR(45) GEN_P_0001 Regulation_id FK,NN VARCHAR(45) REG_P_0001

Tabla: REGULATION
RESTRICTI ONS DATA TYPE EXAMPLE regulatio n_id PK VARCHAR (45) REG_E_0 001 binding_site_possiti on_left N VARCHAR(45) 365618 Binding_site_possiti on_right N INT 289371 orientation N INT forward Activity N VARCHAR (45) Active tf_id FK, NN VARCHAR (45) TFA_E_00 01 sm_id FK, N VARCHAR (45) SML_E_0 001 growth_con dition N VARCHAR(45 ) LB gene_id NN VARCHAR (45) GEN_E_0 001

Fecha/hora 27/09/12 2:08 AM

Cambio(s) Se mezclaron los 3 archivos de tablas para meter en este archivo todas las tablas, se reviso coherencia entre este archivo y el codigo para generar la base de datos, hubo cambios en tipos de dato. Se adiciono la tabla organism Se formateó a todas las tablas para que todas tuvieran el mismo formato y se cotejó que coincidieran el tipo de dato en todos los campos donde se halle dado elemento y se compararon con las tablas de entidad relación Se agrego la columna growth_conditions a la tabla REGULATION. Se modifico el ejemplo de la tabla SYNONYMS. Se anexo la tabla PROMOTER_TF_LINK. Se anexo una descripcion de los significados de las acotaciones en el campo restrictions

Autor Erika Cruz

Estado/Versión 0.4- Falta revision

27/09/12 1:43 PM

Edahí González

0.5

08/10/12 11:40 PM

Erika Cruz

0.6

10/10/12

Se agrego la restricción Null al campo attenuator_id de la tabla TU. Se cambio el nombre a la tabla Molecule a Small_molecule.

Karla Manzano

0.7

Se cambio el orden de las tablas para conincidieran con el orden de creación del script. 11/10/12 Se cambio el tipo de dato a varchar(45) en los campos ‘molecular_name’ y ‘riboswitch_name’ de las tablas ‘SMALL_MOLECULE’ y ‘RIBOSWITCHES’ respectivamente. Se cambió el tipo de dato a todos los id a VARCHAR(45), a la tabla PRODUCT se agregó el campo “organism”, “product_name” y se cambió el tipo de dato de “product_name” a VARCHAR(200). A la tabla ORGANISM se agregó el campo “organism_id”. A la tabla TERMINATOR se agregó el campo “tu_id” , el campo “orientation” y se eliminó el campo “tu_id”. A la tabla ATTENUATOR se quitaron los campos “post_left” y”post_right”. Se quitó el campo “attenuator_id” de la tabla TU y se colocó en la tabla GENE. Se cambió el formato de los identificadores. Se añadió “gene_id” a la tabla REGULATION. Se elimina la tabla link entre Product y TF,se cambia la dirección del enlace entre riboswitch y gene, se añade la tabla link entre regulación y gene. Se añaden los campos binding_site_position_left y binding_site_position_right a la tabla regulation Se añade el campo 'orientation' a la tabla REGULATION Erika Cruz

0.8

15/11/12 00:28

Edahí Gonzalez

2.0

22/11/12

Miguel Ibarra

3.0

03/12/12 8:32 03/12/12 23:27

Erika Cruz

4.0

Se elimino la opcion AUTO_INCREMENT a las tablas PRODUCT, ATTENUATOR, SMALL_MOLECULE, GENE, PROMOTER, TERMINATOR, TU, TF y REGULATION. Se cambiaron los siguientes tipos de datos: Tabla ORGANISM, campo Description: NULL a NOT NULL. Tabla GENE, campos position_left y position_right: INT UNSIGNED a INT. Tabla PROMOTER, campo position_plus_one: INT UNSIGNED a INT. Tabla TU, campo position: INT UNSIGNED a INT. Tabla TU, campo promoter_id: NOT NULL a NULL. Tabla REGULATION, campo sm_id: NOT NULL a NULL. Tabla REGULATION, campos binding_site_left y binding_site_right: VARCHAR(45) a INT. Tabla REGULATION, campo activity: NULL a NOT NULL. Se cambio el nombre del campo orientation a strand de la tabla REGULATION.

Erika Cruz

5.0