You are on page 1of 176

1

1.1


deoxyribonucleic acid


purines : A(adenine) G(guanine),
(pyrimidines): T(thymine) C(cytosine)
weakbond ;,
(strong bond)( 1-1)

5 -3
5
P
3
OH

5 -G-C-A-A-T-3
-G-C-A-A-T-5
5 3 upstream)(downstream)

ribonucleic acid


/
t


1.2




(protein coding genes),
RNA
RNA specifying genes ,

regulatory genes

structural genes



scRNA
t


snRNA

5 3 flanking sequences) 5

promoters) promoter region)

5
3

(transcription
initiation
site)(RNA (cap site)) termination site)
RNA(mRNA) polyadenylation)(poly(A) addition site)

pre messenger RNA)(pre mRNA) 5 3 ,(untranslated


regions) (exons)(introns) mRNA
mRNA
coding regions
mRNA Lewin 1990


mRNA splicing sites or junctions 5
3 donor (acceptor)

,
3

Lewin 1990

(b)

30
5 , 5 G TACTAAC 6 A
3


8

sequence

sequence
bp 35bp . Pribnow box


mRNA

operon ( 1-3b)


5 3

Yoshitake (1985)



replicator genes), DNA ,(2)
(recombinator genes),,(3)(

attachment sites)

1.3
mRNA RNA(tRNA)

codons
reading frame
mRNA
genetic
code)
9

universal


3
4 =64
sense codons)
nonsense or stop codons)



degenerate code)
synonymous codons)
codon family)

initiation codon)AUG
10


Mycoplasma Tetrahymena
)



1.4

mutations


point mutations))
substitutions)
deletions),

insertions)

(inversions)
180

transition (transversions)




6a ,(synonymous) silent

missense (nonsense)
11

-GCAAAC- 3

5 - CAAACG- 3


Ser ACU(Thr),GCU(Ala),CUU(Leu) , CAU(His) CGC (Arg),


12

unequal crossing over) 17

replication slippage)(slipped
strand mispairing)




5
3

gaps ,


13

Levinson Gutman (1987)


frameshift


hotspots) 5 3

5 -TG-3
5 -TT-3
palindromes)( 5 - GCCGGC- 3
, 5 - GGCGCC- 3 5 -GGGCCC-3

14

Darnell,J.E.,H.F.Lodish and D.Baltimore. 1990. Molecular Cell Biology,2nd Ed.Scientific


American Books,New York.
Lewin,B.1990.Genes
.Oxford Universtity Press,New York.
Stryer,L.1988.Biochemistry,3rd Ed. Freeman,New York.
Suzuki,D. T.,A.J.F.Griffiths, J. H. Miller and R. C.Lewontin.1989.An Introducition to
Genetic Analysis,4th Ed. Freeman, New York.
Watson,J.D,N.H.Hopkins,J. W.Roberts,J.A.Steitz and A. M.
Weiner
.1987.Molecular Biology of the Gene,4th Ed. Benjamin/Cummings,Menlo Park,CA.

15

2.1
locus ,
alleles
allele frequencies gene frequencies
1 n2

1+ 2=N 1/N + 2/N =1


1/N
2/N


fixed





deterministic model

stochastic models




2.2
natural selection

16





fitness , w

absolute fitness (relative fitness)





negative or purifying selection
neutral ,

positive or advantageous selection
overdominant selection

w w

w w
w
s s

17

s
s 2
s

0.125

2.4 q=o

s t

0.99,0.75,0.25 0.01;s=0.250 t

q=0.667 Hartl

Clark(1989)

2.3








Bodmer Cavalli
Sforza (1976)







p q=1-p

i
pi

0<p 1 pi

random genetic drift




19

p0 p1 p2
pt,
p0
q0 q1 q
qt p1 p0 ,q1 q0 ,
p1 () p0
p1 p0
p p
p p p p p
cumulative behavior

2.6 0.25

0.25




lose
(extinction) fixation

20

Cavalli

Bodmer

Sforza (1976)

p 0.5

2.4
population size N,


effective population size
e
Ne N,

Nei Imaizumi,1966
Ne /3
21



Nm Nf , Ne

Ne

/2 2.7, Ne=2N/(1+N/2)
Ne


long
term effective population size

Ni i Ne Ni Ni

2.5
gene substitution
(wild type)
fixation
time
fixation probability

s
Ne

s
s
Kimura,1962 ,A2

-x

q x e 1-x 2.9 x
p q



1/(2N)
p 2.9 1/(2N) q s

22

2.10


s 0.01

0.01
0.001

Ne
1/(2N)=0.05% 2.12,
0.004%
s 0.01




conditional fixation time
q=1/(2N),[AKt-],
(Kimura Ohta,1969)

ln
6


s
s Maruyama Kimura,1974

23

,:

1/

Nei(1987)

u 1/(2N)

K=u(2.17)
Kimura,1968a



2.14
s

K=4Nsu

s
u

2.6
polymorphic)





24


expected heterozygosity gene diversity

xi i m


DNA
(nucleotide diversity)(Nei Li,1979),

xi xj
i j , ij



melanogaster
Adh Adh 11
(Kreitman,1983)


x1
x8 1/11, x9 3/11

S
S
12 =0.13%

ij 2-1 2.20, =0.007
6 (S),5 (F) S F
, ,
.: S, =0.006; F, =0.003 ,S F

D. melanogaster

, 11

. 4 ,
/

25

D. melanogaster

Hartl Clark(1989)

Nei(1987) Kreitman(1983)

2.7


synthetic theory (neo-Darwinism)



selectionism







Kimura,1968a ;King
Jukes, 1969 neutral theory of molecular evolution





1/(2Ne) Ne





26






20

Kimurra
Ohta,1971

(Nei , 1978) Hudson
, 1987)

2.2 2.3
2. A2 A1 , A2 ?
3. 2.4 2.5
4. 5 , A1 0.5, A1 A2 ,,
A1 (a)0.0,(b)0.5,(c)1.0 ?
5. 2 1 ,?
4
4
4
4
4
6. , 6 :10 10 10 10 10 10

Ne=N , 0.01 ,
?
8. 2-7 ,(a)1-S 2-S 3-S b)

Christiansen, F.B.and M.W.Feldman.1986.Population


Genetics. Blackwell
Scientific
Publications,Cambridge,MA
Crow, J.F.and M.Kimura. 1970. An Introduction to Population Genetics Theory. Harper & Row,
New York.
Hartl,D.L.and A.G.Clark.1989.Principles of Population Genetics.2nd Ed.Sinauer
Associates,Sunderland,MA.
Hedrick,P.W.1983.Genetics of Populations. Science BooksInternational, Portola Valley, CA.
Kimura,M.1983.The Neutral Theory
of Molecular Evolution.Cambridge University
Press,Cambridge.
Nei,M. and D.Graur.1984.Extent of protein polymorphism and
the neutral mutation
theory. Evol.Biol.17:73-118.

27



3.1



Jukes Cantor,1969 one-parameter model (Kimura ,1980)
(two-parameter model) (Li ,1985a)

28


0
t



3.2



3.2

29

[TS]]

3.7 3.8 3.7,, A, PA(t)


1 1/4( 3-3) , 3.8 , A, PA(t)
0 1/4 ,,PA(t) 1/4( 3-3) T

1/4
t (t) =PT(t) =PC(T) =PG(t) =1/4

0.25

-9 //

t
t

t t
t 3.7



Kimura,1980

30

3.11
t
PAA(t) =PGG(t) =Pcc(t) =PTT(t) X
t

t
3.15 ,X (t) +Y (t) +2Z (t) =1

3.2 DNA





multiple substitution multiple hits

31


t
t t
0
t



t
t

C G
,

,
T t
C t
G t



3.18b,
32

t
t




=20/200=0.1,Q=4/200=0.02

a=1/(1-0.2-0.02)=1.28,b=1/(1-0.04)=1.04, K=(1/2)ln(1.28)+(1/4)ln(1.04) 0.13

p=24/200=0.12 K 0.13


0.13
(p=24/200=0.12)


200
50 16 p=50/200=0.25,Q=16/200=0.08
a=2.38,b=1.19 k 0.48 p 66/200=0.33, K 0.43


. i/3 3 i/3
TTT(Phe)
3 ,




A


al GTT(Val)
GT (Val) GCC(Ala)

C
33

AAT(Asn) ACT(Thr) ACG(Thr)

AAT(Asn) AAG(Lys) ACG(Thr)




0.7 0.3 0.7 1+0.3 0=0.7
0.7 1+0.3 2=1.3
Miyata Yasunaga,1980 Li ,1985b

1+2
/2=1.5, (1+0)/2=0.5
Nei Gojobori,1986
Li ,1985b
MS MA
PS=Ms/Ns pA=MA/NA

nondegenerate ,
(twofold degenerate)(fourfold degenerate)(Li , 1985b)


P




(Ile)


degeneracy classes , 3
,

-

CGA AGA CGG AGG 1 ,
,; 3 (AUU AUC
AUA)

3.3

sequence alignment
34

DNA

, ,


null base


x
z
n + m=2 (x + y) + z
(3.25)


dot matrix method







35




A TCAGACGATTG (m=11)
B TCGGAGCTG (n=9)

( )
6 m-n

( ) TCAGACGATTG
TCG*GAG*KC*TG*-


( )TCAG-ACGATTG
TC-GGA-GC*TG*


gap penalty

z w


D=y+wz
(3.26)

D=y+

wkzk

(3.27)

z w
w

0+(2 6)=12,5+(2 2)=9, 2+(2 4)=10


w1=2
w2=6 2 , D



Neeldleman Wunsch,1970 Seller,1974 .
,(similarity)(similarity index)
dissimilarity
distance index
Smith ,1981

Needleman Wunsch,1970
36

3.4

restriction endonucleases)(restriction enzymes)


recognition sequences)


EcoRI),( Hind )( 3-1) splicing site)
restriction site)

sticky ends) ligase)(ligated)

Pu

;Py:

C/G:C G

restriction
fragment pattern

restriction map
37

Nei Li,1979
(Upholt,1977;Engels,1981a) (Kaplan,1983)

Aegilops sharonensis Ae. bicornis

Bam , Hind EcoRI , 6


( Graur ,1989a) Ae. sharonensis 4 , Ae. bicornis
5 3.28 2/9=0.222
1/4
3.30 0.222
=0.687
0.775

0.753
0.758 3.31

0.092



mX mY DNA X Y , m
X Y S ,

r 3.19 p^
0.25 ,
K>0.05

38

39

(g) DNA

Suzuki (1989)

.(C)DNA A,B C, D

DNA-DNA hybridization

homoduplex , 100%

heteroduplex

Tm Tm

vers(1989)


TEACL
(Hunt ,1981)

Tm,,(Britten ,1974)
p=C
m (3.34)
p

0.01 C=0.015
Tm
Caccone Powell,1989
Pan paniscus

59.50 59.12

Tm 59.31
DNA Tm 57.59

Tm 1.72

3.34 0.017-0.026

40


3.3 t=0 ,, t=0 3.1
3.10
t
t
t


3.13 3.11 , 3.14 3.15
3.12
3.13,3.14 3.15
1/4 ,
3.16 3.17

Ser Thr Glu Met Cys Leu Met Gly Gly


TCA ACT GAG ATG TGT TTA ATG GGG GGA
TCG ACA GGG ATA TAT CTA ATG GGT ATA
Ser Thr Gly Ile Tyr Leu Met Gly Ile


3.21
3.19

AATGCTTGCATGGGGCTAGTT
ATTGCTGCATGAGGCGCGCTAGT

k .

Doolittle,R.F.1990. Molecular Evolution:Computer Analysis of Protein and Nucleic Acid


Sequences, Academic Press,San Diego,CA
Li, W. H.,C.
C.Luo and C. I.Wu.1985.Evolution of DNA sequences . pp. 1-94. In R. J.
MacIntyre(ed.),Molecular Evolutionary Genetics, Plenum, New York.
Nei, M. 1987 Molecular Evolutionary Genetics, Columbia University Press, New York.

41

4.1
rate of nucleotide substitution

r=K/2T (4.1)




53

42


-9
2.79 10
-28

43



-9

0.85 10
-9
4.6 10



5 3 . 4-2
16
,
5 3 (,
-9
-9
) 5 3 1.96 10 2.10 10 ,
-9
, 3.55 10 60%
4-2 , 5 3

pseudogenes


X
Z



44

5 3

5 , 5.3/8.6

-9
3.33 10
( 4-2) 3



3
3 5 5

4.2





45





CDRs,
Tanaka Nei,1989


Hughes Nei,1989


Kimura,1983
f0

vTf
vT v
v

K=vTf0
(4 2)

vT

5 3





0.13*10 9//

0.97*10 -9//

Kimura(1983)


C

46



Wolfe ,1989a






Luo ,1989

Stryer (1988),

DNA
, 3



Wolfe ,1989a





6

Graur,1985; Li ,1985


Ticher Graur,1989
4.3




47




Stewart Wilson,1987)





Stewart and Wilson,1987)

Stewart Wilson(1987)

pH

Stewart

Wilson,(1987)

pH

4.4

Zuckerkandl Pauling,1962,1965 Margoliash,1963
Zuckerkandl
48

Pauling,1965 ,,,
,(molecular clock)





Sarich Wilson,1967


Goodman,1981

Czelusniak ,1982



Nei,1975; Wilson ,1977


Sarich Wilson,1973
relative-rate test)


AC O A (KOA) O
C (KOC)

AC, KKBC KAB


KOA, KOB KOC :

49

KOA KOB , A B
KOA KOB
KOA-KOB=0 4.3a 4.3b ,KOA-KOB=KAC-KCB KAC KBC
A B

4-5 A ,
B , KAC-KBC ,

4-5 ( A)( B) 100 (KAC-KBC) a

Li (1987a)
.


KCA-KBC (
)

Li ,1987a

Goodman,1961 (Goodman ,1971)


Wilson ,1977

50





) KAC-KBC)

**

KAC-KBC


KAC-KBC 2.3%, KAB=6.7% KOA
(6.7%+2.3%)/2=4.5%, K (KOB) 6.7%-4.5%=2.2% 4.5/2.2 2

Wu Li,1985)




1.3
-9
-9
10
2.2 10


-9
7.9 10



51

Li (1987a)


generation time effect Kohne,1970

Britten,1986

4.5


Brown ,1979


15,000-17,000

1/10,000

t



Palmer,1985 40,000bp 2,500,000bp




120,000 220,000bp ,
150,000bp(Palmer,1985)
(Nicotiana tabacum) Shinozaki ,1986
155,844bp 37 tRNA
r


Nicotiana tabacum
52



-8
5.7 10 (Brown ,1982)


Curtis Clegg,1984;Palmer,1985)

Palmer Hebron,1987)

Wolfe ,1987,1989

KA






1 3 12

Wolfe , (1987,1989b)
.

Stebbins ,1981;Chao ,1984


-9

5.1-7.1 10





4.6


pattern of spontaneous mutation Beale Lehmann,1965;Zuckerkandl
,1971

selective neutrality


53

Gojobori ,1982;Li ,1984

fij ,

AT 4.7 4.7%

Gojobori ,(1982) Li ,(1984)

59.2%
54.4%


33.2%

54

15.9%

64.5%



fGA=fCT

fAG=fTC,fAT=fTA,fAC=fTG,fCA=fGT fCG=fGC


Wu Maeda, 1987

Coulonder ,1978;Razin Riggs,1980)

f f

5 - CG3 Razin Riggs,1980)

silencing)


4.7



Kimura,1968;King Jukes,




Grantham ,1980
Escherichia coli
omp A


Grantham ,1980
Grantham ,1980
genome
hypothesis



Post ,1979 ,, tRNA
t

Ikemura,1981,1982
55

Saccharomyces cerevisiae () t

t

Leu
t
t

ompA

Sacharomyces cerevisiae


E.coli CUC CUU

tRNA (, E. coli CUC CUU tRNA2Leu )


Leu

t
t

t
t
Leu
t
, t


3
t


(Ikemura,1981) wobbling


t
t

56

4
S U , A G;, G A

t
t
4U,, omp A
,19 15 AAA, 4 AAG

Sharp ,1988





Sharp Li,1986

0 4

Sharp ,(1988)

Ikemura,1981;Kimura,1983
Sharp
Li,1986
50 Kimura,1983



57


t
Ouenzar ,1988)


Bernardi Bernardi,1985;Aota Ikemura,1986)

Bernardi ,1985)





Aota
Ikemura,1986)

4.1

Papio anubis) Pongo pygmaeus)


3

b: ATG GCG CTG TCC GCG GAG GAC CGG GCGGCT GTG CGC GCC CTG
o: ATG CGC CTG TCC GCG GAG GAC CGG GCGCTG GTG CGT GCC CTG
b: TGG AAG AAA CTG GGA AGC AAT GTT GGCGTC TAT GCT ACT GAG
o: TGG AAG AAG CTG GGC AGC AAC GTC GGCGTC TAC ACG ACA GAG
b: GCC CTG GAG AGG ACC TTC CTG GCT TTCCCC GCC ACG AAG ACC
o: GCC CTG GAG AGG ACC TTC CTG GCC TTCCCC GCA ACG AAG ACC
b: TAC TTC TCC CAC CTA GAC CTG AGC CCCGGC TCC GCC CAG GTT
o: TAC TTC TCC CAC CTG GAC CTG AGC CCCGGC TCC TCA CAG GTC
b: AGA GCA CAC GGC CAG AAG GTG GCG GACGCG CTG AGC CTC GCC
o: AGA GCC CAC GGC CAG AAG GTG GCG GACGCG CTG AGC CTC GCC
b: GTG GAG CGC CTA GAC GAC CTA CCC CGCGCG CTG TCC GCT CTG
o: GTG GAG CGC CTG GAC GAC CTA CCC CACGCG CTG TCC GCG CTG
b: AGC CAT CTG CAC GCT TGC CAG CTG CGAGTG GAC CCA GCT AAC
o: AGC CAC CTG CAC GCG TGC CAG CTG CGAGTG GAC CCG GCC AGC
b: TTC CCG
o: TTC CAG

Shaw

,(1987) Marks ,(1986)






b: TGCGGCGAGGCTGGGCGCCCCCGCCCTCCGGGGCCCTGCCTCCCCAAGCC
o: TGCGGCGAGGCTGGGCGCCCCCGCCCCC-AGGGCCCTCCCTCCCCAAGCC
b: CCCCGGACGCGCCTCACCGCCGTTCCTCTCGCAG
o: CCCCGGACTCGCCTCACCCACGTTCCTCTCGCAG

b (o)


Shaw ,(1987) Marks ,(1986)



58


m: GTAAGAGGCCTGGCGCGCCGACGCGGACGACTAGGCCTGCTTTCGGAGGG
r: GTAATAGGCCTGACGCGCGAACACGGACGACTAGGCCTGCTTTCTGAGAG
h: GTGAGAGGCCTCGCGCGCGCCGACGGACGGACGGGCCTGCTTTCTGAGGG
m: GCGCGCGCGCCGTCGCGGAGGGGAGGAGGGCTTGCGCGCAATCCCGGGCG
r: GCGCGCGCGCCGTCGCGGAGGGGAGGAGGGCCTGCGCACAGTCCCGGGCG
h: GCGCGCGCGCGGTCGCTCAGGGGAGGAGGGCCTGCGCGCAATCCCGGGCG
m: CGTTCGAGGGCGCCAGCTGGGGAACTCTCGCGCGACTAGCGGGAGGTCTC
r: CGTTCGAGGGCGCATGCTGGGGAAGTCTCGCGCGACTAGCGGAGGGTCTC
h: CGTTCGAGGGCGCATGCTGGGGAAGTCTCGCGCGACTAGCGGAGGGTCTC

Bourbon ,(1988)



(Hahn ,1986)
env) 0.0164(Li ,
1988)

1984 10 3 ,

Ikemura,T.1985.Codon usage and tRNA content in unicellular and multicellusa


r organisms.Mol.Biol.Evol.2:13-34
Kimura,M.1983.The Neutral Theory of Molecular Evolution.Cambridge University Pre
ss,Cambridge.
MacIntyre,R.J.(ed.).1985.Molecular Evolutionary Genetics.Plenum,New York.
Nei,M.1987.Molecular Evolutionary Genetics.Columbia University Press,New York.
Sharp,P.M.and W. H.Li.1986 An evolutionary perspective on synonymous codon usag
e in unicellular organisms.J.Mol.Evol.24:28-38
Steinhauer,D.A.and J.J.Holland.1987.Rapiel evolution of RNA viruses.Annu.Rev.Mic
robiol.41:409-433.

59





5.1



Nutall,1904





Fitch
Margoliash,1967;Nei,1975;Felsenstein,1988)



81
86 Woese,1987

Sogin
,1986,1989 , ,
,


5.2

phylogenetic tree
5-1
nodes branches
60

topology branch length



external nodes (internal nodes)


operational taxonomic units



unscaled ,



b scaled ,


additive

2+1+3+2=8
OTU


77

bifurcating
multifurcating
, 5-1

rooted (unrooted)( 5-2)


61

Felsenstein(1987)


true tree
inferred tree

species tree
62

gene tree (Nei,1987)


5-4

(P)

t1 t

t1-t2 Ne



t1-t2

63

5.3
Sneath
Sokal,1970 Nei,1987 Felsenstein,1988


distance matrix methods
( maxmum
parsimony methods)

UPGMA

unweighted pair group method with arithmetic mean (UPGMA)


, OTU (Sokal
Michener,1958; 77 )

ei,1975


composite OTU)



Jukes Cantor,1969)

dAB

64



AB/2

d (AB)C =(dAC+dBC)/2 d (AB)D =(dAD +dBD)/2

d (AB)C
,,OTU C OTU(AB), d (AB)C/2 ( 5-6b)

d (ABC)D/2= (dAD
G

+dBD+dCD)/3 /2

d (ij)(mn) =(dim+din+djm+djn)/4
OTU(ijk)(mn)
d (ijk)(mn) = (dim+din+djm+djn+dkm+dkn)/ 6

(5.3)

(5.4)

3.50+0.75+4.25=8.50

transformed distance method


Farris,1977;Klotz ,1979 outgroup




65



d ij =dij-diD-djD/2+d
(5.5)
d ij i=A,B C d =(dAD+dBD+dCD)/3 d d ij


d = diD/n

d =37/3

d AB , A B ,,C


/

Li,1981




neighbors

dAC+dBD=dAD+dBC=a+b+c+d+2x=dAB+dCD+2x (5.6)
x

dAB+dCD dAC+dBD

(5.7a)

dAB+dCD dAD+dBC

(5.7b)

four point condition


Sattath Tversky,1977)


72

66


.
Fitch,1981 Saitou Nei,1987
neighbor joining method

maximum parsimony tree



Eck Dayhoff,1966 ,
Fitch,1977
informative sites




2

67

5.4

cladistics
Sneath Sokal
1973 ? (cladogram)

phenetics

phenogram




distance and
character
state approaches

68



75

Saitou Nei,1986

5.5



Fitch,1971 Fitch Margoliash,1967

dAB=x+y
dAC=x+z
dBC=y+z

(5 8a)
(5 8b)
(5 8c)

Fitch Margoliash,1967

x=dAB+dAC-dBC/2
y=dAB+dBC-dAC/2
z=dAC+dBC-dAB/2

5.9a-5.9c

69

(5.9a)
(5.9b)
(5.9c)

dAC=d1(345) =(d13+d14+d15)/3,dBC=d2(345) =(d23+d24+d25)/3 , a=x b=y




c+(a+b)/2=x



7c
5.9

dAB=d12=8,dAC=(d13+d14)/2=(7+12)/2=9.5
dBC=(d23+d24)/2=11.5 5.9a-5.9c, a=x=(8+9.5-11.5)/2=3 b=y=(8+11.5-9)/2=5

dAB=d
(12)3=(d13+d23)/2=(7+9)/2=8,dAC=d (12)4=(d14+d24)/2=(12+14)/2=13,dBC=d34=11 5.9a-5.9c,
x=(8+13-11)/2=5,d=y=(8+11-13)/2=3,e=z=(13+11-8)/2=8
(a+b)/2+c=x,
,c=1


5.6







(
)

5.7

70






r=K/2T
(5.10)

T=K/2r
(5.11)

( )


r=KAC+KBC/2(2T1) (5.12)

T2= KAB/2r=2KAB T1/KAC+KBC


T2 T1 T1

(5.1

T1= (KAC+KBC)T2/2KAB
(5.14)

Li Tanimura,1987




5.8
clades)

71

5.9

Darwin,1871 Pan (Gorilla)

Homo
Pongo

Hylobates
Simpson,1961

Goodman,1963



Schultz,1963
Goodman,1962


Sarich Wilson,1967




. Miyamoto ,1987 Maeda ,1988


dHC=1.45

1.45/2=0.73
72

Pongo pygmaeus

73

Pan troglodytes
)

;H

);G,(

Homo sapiens

Gorilla gorilla)

;O,

1.54/2=0.77

Li (1987b)
5.3Kb DNA :(1) Koop (1986b)
(2

2kb) Maeda (1983,1988) 3.1kb



5!/ 4!(5-4)! =5


dHC+dGO=1.45+3.04=4.49,dHG+dCO=4.45 dHO+dCG=4.55

74

a.H,


dHC+dG(OR) =6.76<dHG+d (OR) =6.76<dH(OR) +dCG =6.82


5




5

10.2kb (Koop ,1986a;Miyamoto


,1987; Maeda ,1988)




Williams Goodman,1989

75

Williams Goodman(1989)
5-2 2

10.2 kb,


Sibley
Ahlguist,1984;Caccone Powell,1989)


5.10

Cavalier-Smith,1975

Margulis,1981






rRNA rRNA

Schwarz Kossel,1980 (Zea mays) 16SrRNA
E. coli 16SrRNA rRNA

rRNA Giovannovi 1988
Bonen ,1979

76

rRNA
Cedergren ,1988)
rRNA
rRNA


Gray ,1989) rRNA
rRNA

5.11


Saiki ,1985,1988 Scharf ,1986;Engelke ,1988


Kocher
,1989

Hagelberg ,1989


Thomas ,1989) Thylacinus cynocephalus





Sarcophilus harrisii )

Dasyurus maculatus)
Philander
opossum andersoni)

5.12


.


Ammodramus
maritimus nigrescens
A.m.nigrescens
77

Gray (1989)

Gray (1989)

78

Mullis(1990)



( A.m.peninsulae )

nigrescens peninsulae

Avise Nelson,1989
nigrescens




Avise Nelson,1989



79

Thylacinus

(Ammodramus maritimus)

rRNA

Thomas (1989)

Avise Nelson(1989)




Avise Nelson,1989)

A.m.maritima A.m.macgillivraii)
A.m.peninsulae

80

5-20 UPGMA

Avise Nelson(1989)


12345678
(a) A T G A C T A A
(b) G T G A T T G A
(c) A C G G A T A A
(d) A T G C A T T A
(e) A C G C A T C A

81

66

67 74

75

65 66
5


rRNA


Artemia salina (f) OTU

(a) GCCAACGTCCATACCACGTTGAAAGCACCGGTTCTCGTCCGATCACCGAAGTTAAGCAGC
(b) GGCAACGACCATACCACGTTGAATACACCAGTTCTCGTCCGATCACTGAAGTTAAGCAAC
(C) GCCAACGTCCATACCACGTTGAAAACACCGGTTCTCGTCCGATCACCGAAGTCAAGCAAC
(d) GCCAACGTCCATACCACGTTGAAAACACCGGTTCTCGTCCGATCACCGAAGTTAAGCAAC
(e) GCCAACGACCATACCACGCTGAATACATCGGTTCTCGTCCGATCACCGAAATTAAGCAGC
(f) ACCAACGGCCATACCACGTTGAAAGTACCCAGTCTCGTCAGATCCTGGAAGTCACACAAC

(a) GTCGGGCGCGGTTAGTACTTGGATGGGTGACCGCCTGGGAACCCCGCGTGACGTTGGCA
(b) GTCGGGCGTAGTTAGTACTTGGATGGGTGACCGCTTGGGAACACTACGTGCCGTTGGCA
(c) GTCGGGCGTAGTCAGTACTTGGATGGGTGACCGCCTGGGAACACTACGTGATGTTGGCT
(d) GTCGGGCGCGGTCAGTACTTGGATGGGTGACCACCTGGGAACACCGCGTGCCGTTGGCT
(e) ETCGGGCGCGGTTAGTACTTAGATGGGGGACCGCTTGGGAACACCGCGTGTTGTTGGCC
(g) GTCGGGCCCGGTCAGTACTTGGATGGGTGACCGCCTGGGAACACCGGGTGCTGTTGGCA

Acyrthosiphon magnoliae

rRNA

Drosophila melanogaster

Bombyx mori

Acheta

domesticus,

, (d) (Philosamia cynthia


Artemia salina

Ishikawa( 1982) ,Morton Sprague(1982),Gu (1982),Bagshaw (1987)

,)(e)

Kawata

Cave (1987), Samson

Wegnez(1988)

Felsenstein,J.1988.Phylogenies
from
molecular
sequences:
Inference
and
reliability.Annu.Rev.Genet.22:521-565
Goodman,M.(ed. ) . 1982. Macromolecular Sequences in Systematic and Evolutionary
Biology.Plenum,New York.
Hillis,D.M. and
C.Moritz(eds.).1990.Molecular Systematics.Sinauer Associates
Sunderland,MA.
Margulis,L.1981.Symbiosis in Cell Evolution.Freeman,San Francisco.
Nei,M.1987.Molecular Evolutionary Genetics.Columbia
University
Press,New York.
Sneath,P.H.A.and
R.R.Sokal.1973.Numerical
Taxonomy.
Freeman,San
Francisco.
Woese,C.R.1987,Bacterial evolution.Microbiol.Rev.51:221-227.

82

Haldane,1932 (Muller,1935)

Ohno,1970
91-92

Gilbert,1978


6.1 DNA

DNA duplication

partial or internal gene duplication ,(2)(complete gene duplication),(3)


(partial chromosomal duplication), (4) (aneuploidy or
chromosomal duplication),(5) (polyploidy or genome duplication)
regional duplication ,
(Ohno,1970) ,,,


Ohno,1970



6.2
domain

functional domain , (structural domain)(module)(Go Nosaka,1987)





Barker ,1978

(Go ,1981)

83



(
)


c










84

~ 4800bp ~3400bp,

,1983
Glycine

Phaseolus

Blanchetot
vulgaris,

max Vicia faba


Li,1983
6.3

gene elongation ,





Constant Spring Icaria

Weatherall Clegg,1979



Stein ,1980



85

Stein ,(1980)

Barker (1978)
86





6.4



85


invariant repeats

dose repetitions

Ohno,1970
r
tRNA

variant repeats




Betz ,1974
gene family
multigene family
,

(
):(s
)



59



lowly
repetitive highly repetitive

87

Xenopus laevis

Li(1983)




95



isozymes

allozymes


A4,A3B,A2B2,AB3 B4
H


4
H

4


Everse Kaplan,1975 Nadal Ginard Markert,1975

88

Markert Vrsprung(1971)


X- Nathans ,1986



X-



X- Jacobs Neitz,1986
X





6.5

unprocessed

89

Li(1983)

6.6
paralogous
orthologous

2
1 2
D
S
D

90

TD
S

r =K /2Ts

(6. 1)

r=r +r /2
(6 .2)
D

D
TD=K
/2r
(
)

D D


D


95
D

Agnatha


()
4.5-5
4.5-5 Dayhoff 1972;Dickerson Geis,1983

91

6.7





Dayhoff,1972;Doolittle,1987



Stryer,1988



4.5-5 ( 6-8)

G
A



2
2
2
2,
2
2

2
2
2
1
2 2

2
2
2
2
Wood ,1977


2.6 1

2

Zimmer ,1980
101-102

1.55-2 Efstratiadis
A
,1980

1.4
3500
Shen ,1981

92

4000 Dayhoff,1972;Efstratiadis ,1980



8000 Hardison Margot,1984;Goodman ,1984

6.8
exon shuffling
81


Doolittle,1985;Patthy,1985

93

Banyai ,1983

Patthy(1985)

pUK EGFP

fibronectin





(Kringle)
(, 3
,(Kringle)



Doolittle(1985)
Patthy(1985)




94


5
3


symmetrical exon
asymmetrical



1
2 6 11b 0 0
1 3


6.9

95

X

5 3

tRNA
Ile
Gln
tRNA
5 -CTA-3
, 5 -TAG-3 (Anderson ,1981)




96

Kornberg(1982)


mRNA




Miyata Yasunaga,1978



mRNA

D. melanogaster
Sxl tra dsx

dsx
1

Sxl tra
Sxl 3
, mRNA

D.melanogaster

()(),(Sxl), (tra)

mRNA

(dsx)

Baker(1989)

Perlman Butow,1989


cox

mRNA






-
97

mRNA

cox

T4 sum


Perlman Butow(1989)

mRNA mRNA



gene sharing (Piatigorsky
,1988)



LDH-B4, 84

Wistow ,1987
Hendriks ,1988

Piatigorsky ,1988


Piatigorsky Wistow 1989


98

6.10




(Brown ,1972)
Xenopus laevis X.borealis DNA ,
X. mulleri
Xenopus ()

X.laevis X.borealis
(Brown ,1972)

Brown ,1972

horizontal
evolution
coincidental evolution concerted evolution

(Zimmer ,1980)

Arnheim(1983)


Ohta 1980;Dover,1982;Arnheim,1983


3
Hpa ,
Hpa
, NTS


99

Hpa

EcoR

Hind

,Pvu ,

Arnheim(1983)

unequal crossing over

gene conversion

6-18 (a)(b)

Arnheim(1983)

Ohta,1980;Dover,1982;Li
,1985a

Lewin 1990



(Ohta,1984; Nagylaki, 1984) -(Jeffreys,1979;Scott , 1984)
( Dover,1982)




100

Ohta (1980)





Arnheim,1983



Lamb Helmi,1982
Nagylaki
Petes,1982;Walsh,1985

101

Ritossa
,1966;Brown Sugimoto,1973
Nakamura ,1987

Ohta,1983


Dover,1982

Dover,1982,1986 DNA
,,,(molecular drive)





Arnheim,1983;Walsh,1985
Arnheim,1983

RNA RNA



rRNA

Arnheim,1983

rRNA










Walsh,1987

Dayhoff,1972





Hardison
Margot,1984
2 3


3



102






Ohta,1983,1984;Nagylaki,1984


Weiss ,1983; Hughes Nei,1989

1

2
1



3


84


5
CAT TCG TCT TTA TTC GAA ATC GCG---TGG ACA GCG GTG AAT CTC TTT GAC GCT GTG
3

103


Cold
Spring
Harbor
Symposium
on Quantitative Biology.1987.Evolution of
Catalytic Function, Vol. 52. Cold Spring Harbor Laboratory.Cold Spring Habor,NY.
Dayhff,M.O.1972.Atlas
of
Protein Sequence and
Structure, Vol. 52. National
Biomedical Research Foundation,Silver Spring,MD.
Dover,G.A.and R. B. Flavell. (eds) . 1982. Genome Evolution, Academic Press,New York.
Li,W,- H. 1983. Evolution of duplicate gene and pseudogene,pp 14-37.In M.Nei and
R.K.Koehn (eds.) ,Evolution of Genes and Protein. Sinauer Associates,Sunderland MA.
Ohno ,S.1970.Evolution by Gene Puplication,Springer Verlag,Berlin.
Ohta,T.1980.Evolution and Variation of Multigene Families.Springer-Verlage,Berlin.

104



Barbara McClintock




7.1
transposition

mobile elements
transposable elements

conservative






Berg ,1984

(replicative)()(duplicative)



retroposition
Weiner ,1986;Temin,1989



direct repeats

D.melanogaster
P


Klaer ,1981

E,coli Tn10 , 40%
lac Z
X 5
105

Devos ,1979

Lewin (1990)

7.2

106

insertion sequences



E.coli
Shigella dysinteria


InsA InsB
, (transposase)
E.coli
Sawyer ,1987

transposons

exogenous
genes

complex tremsposons
composite transposons



IS1 23bp

E. coli Shigella dysenteria

E.coli

cat cat

tnpR bla

E.coli

tnpA

38bp (d) Staphilococcus aureus Tn554 , 5


1 (ORF)
ermA

tnpA,tnpB tnpC

pc

spc


c
7-2d P

107

D.melanogaster P

31bp , 4

(), 3 () 2900

Tn554


1681

transposing bacteriophages

38000bp

D.melanogaster

(Rubin,1983)

retroelements



complementary DNA.cDNA

Temin,1989
retroviruses


virion

(provirus)

Temin(1989)

gag,pol env ( 7-5)



long terminal repeats,LTRs


retroposons (retrotransposons)


copia

pol

Dictyostelium discoideum
D.discoideum 40
DIRS-1

Cappello ,1984


D. melanogaster G3A
( 7-5c)
pol
108


retrons
Inouye
,1989 Lampson ,

Watson (1987)

1989) Oenothera berteriana (Schuster Brennicke.1987)



pararetroviruses



Temin,1989
109

env

gag pol

pol

msr

gag 4

p70 p15

(c)

msDNA

msd

Dictyostelium

D.melanogaster

pol

pol 3 ,, ,/

discoideum

482 472bp gag-pol

p15,p12,p27,p10

Myxococcus xanthus

7.3
retrosequences retrotranscripts

Weiner ,1986

110

Linial,1987

retrofection



processed sequences

3 poly A

()

mRNA

processed gene (retrogene)








PGK X X
X


3 poly-A


McCarrey Thomas,1987 calmodulin
(Gruskin ,1987)
111

semiprocessed retrogene
5 119bp
499bp

A(poly-A)(Soares ,1985)

processed pseudogene retropseudogene


Cu/Zn

SOD-1

69.1

Danciger (1986)



5 3 5


3
5

t
7

t
3

t

t
3


112

Weiner ,(1986)

Alu
Alu
Alu


113


Ullu Tschudi,1984 Alu 7

7

Alu 7



Alu Alu Alu
Alu

Britten ,1988

Alu Bains,1986
7


Alu Willard
,1987 Britten ,1988 Alu (Britten ,1988)

Alu

Alu

, (
) 7
Alu 7

Alu
Quentin,1988

114

Alu

Alu

Britten

(1988)





Vesuvian mode of evolution (P.Leder, Lewin,1981 )


(Graur ,1989b)


compositional assimilation
length
abridgement



Graner ,1989b
115

7.4

selfish DNA

(Doolittle Sapienza,1980;Orgel and Crick,1980)









Saccharomyces cerevisial
transposon yeast




Alu

Alu

Alu

FH626-a FH-?,

Hobbs (1986)

Hobbs ,1986

Lehrman ,1986
Alu
Markert ,1988 Alu
Calabretta ,1982
Tn10 E.coli
Chao ,1983

116


7.5
hybrid dysgenesis

Sved, 1976; Kidwell Kidwel,1976


cytotype

117

Kidwell,1983
D.melanogaster

Kidwell(1983)

Engels,1981b

D.melanogaster
Kidwell,1979



D melanogaster 117

7.6
speciation (cladogensis)



D. melanogaster
D.simulans



118

117




genetic resetting
(mechanical incompatibility)




7.7

D. melanogaster u v
-4
10

(Charlesworth Langley,1989)


w


Charlesworth,1985
D.melanogaster

Finnegan Fawcett,1986

500
-4
10 7.1 W 0.95
1-0.95=0.05 7.1
Charlesworth,1985
4
0.05/500=10


500 Rubin,1983


Chenlesworth Langley,1989

119

7.8
horizontal gene transfer

Benveniste
Todaro,1976;Bishop,1981




Salmonella typhimurium

(Higgins Hillyard,1988)






107

endogeneous retroviral sequences virogene


Benveniste,1985



Felix catus

120

Benveniste (1985)



500-1000



Papio cynocephalus, P.papio P. hamadryas
Theropithecus gelada

D.melanogaster

D.melanogaster 114
melanogaster D.mauritania,D.sechellia, D. simulans D. yakaba
(Daniels ,1990)
D.melanogaster melanogaster
willistoni saltans
, D. willistoni
D.melanogaster D.willistoni
D.melanogaster
D.melanogaster
D.willistoni
D.melanogaster D.melanogaster

D.melanogaster
121


Li ,1984

Alu ?
7 Alu
Alu

Koop (1986a) Li (1987a)


a.7

Berg,D.E.and M.M. Howe


(eds). 1989. Mobile
DNA.
Academic
Society
for
Microbiology,Washington DC
Compbell, A. 1983. Transposons and their evolutionary significance.pp.258-279.In M.
Nei and R. K. Koehn (eds) ,Evolution of Genes and Proteins .Sinauer Associates, Sunderland.
MA.
Charlesworth,B. and C. H. Langley, 1989. The population genetics of Drosophila
transposable elements.Annu.Rev.Genet.23:251-287.
Doolittle,R.F.,D
F.Feng,M.S.Johnson and M.A.McClure.1989.Origins
and
evolutionary relationships of retroviruses.Quart.Rev.Biol.64:1-30.
Lewin,B.1990. Genes IV.Oxford University press.Oxford.
Scaife,J.,D.Leach and A.Galizzi(eds.).1985.Genetics of Bacteria. Academic Press,New
York.
Shapiro,J.A.(eds) .1983.Mobile Genetic Elements.Academic Press,New York.
Varmus, H. 1988.Retroviruses.Science 240:1427-1435.
Weiner,A.M.,P. L. Deininger and A . Efstratiadis. 1986. Nonviral
retroposons:
Genes, pseudogenes, and transposable elements generated by the reverse flow
of
genetic information.Annu.Rev.Biochem.55:631-661

122

8.1


genome size C
value constant () characteristic

-12

pg
1pg=10 g


1kb=1000bp

8.2

6 10 5bp

rRNA

t


Muto ,1986

Hartl ,1986



E.coli

123

Cavalier

Smith(1985)
6

0.8 10 ,1.6 10 4.0 10

6
6
7.2 10 8.0 10 bp Herdman,1985

Wallace
Morowitz,1973

Herdman,1985


8.3

Saccharomyces cerevisiae

8.8 106bp 9.9 1011bp, 80000 (


8-3)



Paramecium aurelia P. caudatum

C C value paradox


124

Cavalier

Smith(1985)

3000 150000 Cavalier-Smith,1985

80000

6
11
3.0 10 bp 1.0 10 bp (10 ), 30%
100%(Cavalier-Smith,1985)
125

Cavalier-Smith(1985),Sparrow (1972)

8.4




repetitive DNA


single copy DNA
unique DNA



Flavell,1986
Britten Kohne ,1968

(foldback DNA)
DNA (highly
repetitive DNA)

middle repetitive DNA





126

Cot

Schmid

Deiniger (1975)

Dipodomys ordii

TTAGGG(22 ) ACACAGCGGG
Widegren
,1985






satellite DNA

.nasutoides

(Miklos,1985)



Charlesworth ,1986

Walsh,1987



D.melanogaster Responder(Rsp) 20-2500

Wu ,1988

Wu ,1989

127

D.nasutoides

Miklos(1985)






Singer,1982
5
5

10 10
tRNA



Alu

104

Singer,1982

Hutchison ,1989

poly-A

Hutchison ,1989
L1 , I
Trypanosoma brucei Ingi, Bombyx
mori R 2, Cin 4

Hutchison ,1989

Hardies ,1986
Hutchison
,1989

128

8.5



genome duplication (genome doubling)


Nei,1969
Rees Jones,1972;Grime
Mowforth,1982 119-120
9
0.60,1.18,2.16,4.51 8.53 10
Sparrow
Nauman,1976
polyploidy

Sparrow Nauman,1976


Cavalier-Smith,1985




Cavalier-Smith,1985


Down


129

- B-chromosomes (Jones,1985)



Walsh,1987

123

DNA amplification

rolling circle mode ( 8-3;Bostock,1986)


rRNA

rRNA

Bostock(1986)

130

replication slippage

slipped

strand mispairing



8.6

Zuckerkandl,1976

(Ohno,1972)

Ostergren,1945
(Orgel Crick
1980;Doolittle Sapienza,1980)
(nucleotypic)
(Cavalier Smith,1978)



Heddle Athanasiou,1975


Cavalier- Smith,1978,1985




DNA




Levinger Varshavsky,1982;James
Elgin,1986



8.7


GC content

Argos , 1979;Kagawa ,1984;Kushiro ,1987


131


E.coli
Singer Ames,1970

rRNA

Hori Osawa(1986) Muto (1986,1987)

Suevka,1964;Muto
Osawa,1987

GC mutational pressure / 3.0

Mycoplasma capricolum

E.coli 0.33

Micrococcus luteus



Mycoplasma
capricolum

Micrococcus luteus GC>0.9, / <0.11

132

Muto Osawa (1987)

8.8

Sueoka,1964

Bernardi ,1985;Bernardi,1989

133

Sueoka(1964)

Bernardi ,1985,1988
Cyprinus carpio Xenopus laevis


1 L2

3
Xenopus 1.704g/cm

isochore

Bernardi ,1985


Giemsa

Comings,1978;Cuny ,1981

Goldman
,1984;Bernardi ,1985;Bernardi,1989


Bernardi ,1985

H3

134

Cyprinus

carpio() Xenopus laevis

DNA

()()

Bernardi (1985)

Bernardi Bernardi,1985;Bernardi ,1985;Ikemura,1985;Aota


Ikemura,1986

Xenopus ()

GC ,
GC


5 3 5
GC 3

135

Ikemura Aota(1988)

Aota Ikemura (1986)

136



Bernardi ,1985;1988

selectionist hypothesis
Wolfe ,1989a




mutationist hypothesis

eeds ,1985
Holmquist,1987

127





Aota
Ikemura, 1986
Bernardi ,1985,1988


Bernardi ,1988

137

Cavalier

Smith(1985)

Cavalier-Smith(1985)




t t

Pt+1 =(1-u)Pt+v(1-Pt)

8.1

0 t

3 10-8, v=5 10-8, P0=0.20, t=10 Pt

Bernardi,G.,
B. Olofsson, J.Filipski,M.Zerial,J.Salinas,G.Cuny,M.Meunier
Rotival
F. Rodier.1985.The Mosaic genome of warm blooded vertebrates.Science 228:953-958.
Blake,R.D.and S.Early.1986.Distribution and Evolution of sequence characteristics in
the
E.coli
genome.J.Biomol.Struct. Dynamics 4: 291-307.
Britten.R.J.and D. E.Kohne.1968.Repeated sequences in DNA. Science 161:529-540.
Brutlag,D.L.1980.Molecular
arrangement
and
evolution
of heterochromatic
DNA.Annu.Rev.Genet.14:121- 144.
Cavalier Smith,T.(ed).1985.The Evolution of Genome Size.Wiley, New york. Cold Spring
Habor Symposia on Quantitative Biology.1986.Moleculur Biology of
Homo sapiens .Vol.51.Cold
Spring Habor Laboratory,Cold Spring Habor,NY.
Deininger,P.L.and G.R.Daniels.1986. The recent evolution of mammalian repetitive
DNA elements.Trends Genet.2:76-80
and

138

Dover,G.A.and R.B. Flavell(eds.). 1982.Genome Evolution.Academic Press,New York.


Jelinek,W.R.and C.W.
Schmid.1982.Repetitive sequences in eukaryotic DNA and their
expression.Annu.Rer.Biochem.51:813-844.
John,B.and G.Miklos.1988.The Eukaryotic Genome in Development and Evolution.Allen &
Unwin,London.
Singer, M. F. 1982.Highly repeated sequences in mammalian genomes.Int.Rev.Cytol.76:67-112

139

(b) (c)(e)

2 (a)47 13 (b)70 (c)


141

72
3.(a)5;(b)6
6
4.(b)17.24 10

1.(a)Physarum
polycephalum,5.37%;Oxytricha
nova,13.46%;Euplotes
aediculatus,24.48%;Dictyostelium discoideum,27.63% ;(b) DNA

3. (a)56.76%;(b)30.00%
5.Pt=0.43

142

acceptor site 3
active site

additive tree

advantageous mntation
alignment
allele(allelomorph)

allele frequency(gene frequency)

allozyme(allelozyme)

alternative splicing

amino acid RCH(NH2)COOH NH2


(COOH)

amino terminal(N-terminal)

NH2
amplification

analogy

aneuploidy(chromosomal duplication)

anticodon


antiparallel

apoprotein
archaebacteria

arithmetic mean

asymmetrical exon
autosome
back (backward) mutation
bacteriaphage( phage)
balanced polymorphism
balancing selection

143

banding

base( nucleotide)
base pair

biased codon usage( unequal codon usage)


bifurcation(dichotomy)

bottleneck
box ()

branch

terminal( carboxy terminal)

value(genome size)

value paradox C-(C-)

capping
5
5 -5

cap site(transcription initiation site)

carboxy terminal(C-tenninal)

carrying capacity

catalyst
cDNA( complementary DNA)

census population size( papulation size)

central dogma

chimeric protein( mosaic protein)


chloroplast

chromatid

chromosomal duplication( aneuploidy)


chromosome


clade

cladogenesis( speciation)
cladogram

144

classification( taxonomy)
coding region

codominance(genic selection)

codon

codon family

codon usage
coenzyme

cofactor
coincidental evolution( concerted evolution)
coincidental substitution
colinearity

complementarity

complementary DNA(cDNA) DNA RNA DNA


complex(composite)transposon

compositional assimilation

concerted evolution(horizontal evolution,coincidental evolution)


conditional fixation time F

consensus sequence

conservative substitution
conservative transposition

constant site or constant region

convergence
convergence substitution

crossing over

cyanobacteria

Darwinian fitness( fitness)


decoding( translation)
degenerate code
145


degenerate site

degree of divergence
deleterious mutation
deletion

denaturation

deoxyribonucleic acid(DNA)

deterministic process
diagnostic
position( informative site)
dichotomy( bifurcation)
digestion

diploid

directional selection

disjunction
distance( genetic distance)
distance matrix
divergence
sequence divergence
DNA( deoxyribonucleic acid)
DNA=DNA hybridization DNA DNA

domain( functional domain)


dominance
donor
site 5
dose repetition

dot matrix

downstream 3
drift( random genetic drift)
duplex

duplication

duplicative
transposition( replicative transposition)

effective population size

electromorph
electrophoresis

endosymbiosis (endosymbiont)
host
endosymbiotic theory
146


enzyme
eubacteria

eukaryote

exon

exon duplication
exon insertion
exon shuffling
expected heterozygosity( heterozygosity, gene diversity)
extinction

fecundity
fertility
fitness(Darwinian fitness)

fixation

fixation probability
fixation time
flanking sequence
5 3
foldback DNA

fourfold degenerate site

frameshift mutation

frameshifted protein

functional constraint(selective constraint)

functional domain(domain)

gamete

gap penalty


gene DNA

gene conversion
gene duplication

147

gene
gene
gene
gene

gene

family( multigene family)


frequency( allele frequency)
pool
sharing
substitution

gene tree
generation time

genetic
code
genetic distance(distance)

genetic drift( random genetic drift)


genetic polymorphism( polymorphism)
genetic DNA ()DNA
genetic selection( codominance)
genome
genome doubling( polyploidy)
genome duplication( polyploidy)
genome size( value)
genomic compartmentalization

genotype

geometric mean

germ line cell

haploid
haploid set
haplotype

Hardy
Weinberg equilibrium

heteroduplex
heterogeneous nuclear RNA(heterogeneous RNA.heteronuclear RNA,hnRNA) RNA(

heterosis( overdominance)
heterozygosity
observed heterozygosity

expected heterozygosity
gene
diversity
heterozygote
heterozygote advantage ( overdominance)
higher taxon
148

highly repetitive DNA DNA DNA


highly repetitire genes
homoduplex

homology

homozygote
horizontal evolution( concerted evolution)
horizontal gene transfer

hotspot of mutation

hybrid dysgenesis

hybrid vigor( overdominance)
hydrogen bond

hypervariable site or hypervariable region

independent assortment(Mendel s second law)



inferred tree
informative site(diagnositic position)

initiation codon


in phase overlapping
insertion

insertion sequence
internal gene duplication(partial gene duplication)

internal node
interon(intervening sequence)



invariant repetition

inversion

isoaccepting tRNA

isochore

isozyme(isoenzyme)

junk DNA

lagging strand 5 3

leading strand 5
3

length abridgment
149

lethal mutation
ligation


ligase
Long INterspersed Element
4
4

10 10

linkage
localized repeated sequences

locus( loci)

lowly repetitive genes

match
maturation

maximum parsimony(parsimony)

meiosis(reduction division)

meiotic drive( segregation distortion)


melting

Mendelian segregation(Mendel s first law,segregation)

Mendelian second law( independent assortment)


mer

, monomer,
dimer,tetramer,multimer
homomer,heteromer

homotrimer,heteromultimer
messenger RNA(mRNA)

middle
repetitive DNA

migration
mismatch
missense mutation( nonsynonymous
mutation)
mitochondrion( mitochondria). DNA ,
,

mitosis

mobile element( transposable element)


moderately repetitive genes
module(struclural domain)

molecular clock


150


monomorphic

monophyletic
mortality

mosaic protein(chimeric protein)

mRNA( messenger RNA)
multifurcation

multigene family(gene family)


multiple substitution

mutagen
mutant
mutation

mutation rate
mutational bias

natural selection(selection)

negative selection ( purifying selection)
neighboring taxa sister taxa
neutral mutation
neutral theory(neutral
mutation theory neutral mutation hypothesis)

node

nondegenerate site
nondisjunction
nonfunctionalization(silencing)

nongenic DNA

nonsense codon ( termination codon)


nonsense mutation
nonsense strand

nonsynonymous substitution(missense substitution)

N-terminal N- ( amino terminal) nucleic acid DNA RNA


nucleotide(base)

nucleotide diversity
151


nucleotide substitution

nucleotypic

nucleus( nuclei)
observed
heterozygosity ( heterozygosity)
ontogeny

open reading frame(ORF)

operational taxonomic unit(OTU)


operon

ORF( open reading frame)
organelle

orthology
OTU( operational taxonomic unit)
outgroup

out
of
phase overlapping

overdominance(heterosis,heterozygote advantage,hybrid vigor)


palindromic sequence

parallel substitution

paralogy
pararetrovirus
parsimony
maximum parsimony
partial gene duplication( internal gene duplication)
pattern of mutation
pattern of substitution(substitution scheme)

PCR( polymerase chain reaction) phage( bacteriophage)


phase class

phase-0 intron 0 .
phase-1 intron

phase-2 intron

phenogram

phenotype
phylogenetic tree
phylogenetics
152

phylogeny
plasmid
point mutation
polarity 5 3
polyadenylation signal

polyadenylation site(poly(A)-addition site)


3
polygamy


polymerase chain reaction(PCR)

polymorphism(genetic polymorphism)

polypeptide

polyphyletic
polyploidy(genome doubling,genome duplication)


polyprotein
population
population size(census population size)

positive selection
pre-messenger RNA(pre-mRNA)

preproprotein
pretermination codon
primary amino acid

primary structure

processed gene( retrogene)


processed pseudogene( retropseudogene)
processed
sequence( retrosequence)
prokaryote(bacterium)


proprotein
prosthetic group

protein
protein-coding gene

provirus
pseudogene

purifying selection(negative selection)


153


purine

pyrimidine

quaternary structure

radical substitution
random genetic drift(drift,genetic drift)

rate of gene substitution
rate of mutation
rate of nucleotide substitution
reading frame

recessiveness
recognition sequence

recombination
recombinator
gene
reduction division( meiosis)
regional duplication
regulatory gene
relative -rate test

repetitive DNA

replacement

replication DNA DNA
replication slippage



replicative transposition(duplicative transposition)

replicator gene

replicon

reproductive barrier(reproductive isolation)

restriction endonuclease(restriction enzyme) DNA

restriction-fragment pattern

restriction site

154


restriction-site map

retroelement

retrofection





retrogene(processed gene)

retron
retroposition

retroposon

retropseudogene(processed pseudogene)





retrosequence(retrotranscript,
processed sequence)

retrotransposon
retrovirus

reverse transcriptase
reverse transcription

ribonucleic acid(RNA)

ribosomal RNA(rRNA)

ribosome

ribonucleic acid
RNA-specifying gene

Rolling-circle replication


root
root tree
rRNA( ribosomal RNA)

secondary structure


segregation( Mendelian segregation)
segregation distortion(meiotic drive)

seqregator gene

selection( natural selection)


155

selection coefficient

selection intensity(stringency of selection)

selective constraint( functional constraint)


selfish DNA DNA

self-splicing intron

sense codon
sense strand

sequence divergence(divergence)

sex-linkage

sibling species
signal peptide

silencing( nonfunctionalization)
silent substitution

simple transposon
Short Interspersed Element

10
5

Single-copy DNA( unique DNA) DNA


sister taxa(neighboring taxa)

somatic cell
somatic mutation

spacer DNA

speciation(cladogenesis)

species

species tree
splicing

splicing site or junction
split gene
standard nucleotide

sticky ends

156

stochastic process

stop( termination codon)
stringency of selection( selection intensity)
strong bond

structural domain( module)
structural gene

subspecies
substitution( gene substitution nucleotide substitution)
substitution matrix

substitution
scheme( pattern of substitution)
superfamily

symbiosis
symmetrical exon
synonymous substitution(silent substitution)

systematics

tandem duplication
taxon( taxa)

taxonomy(classification)

terminal node
termination codon(nonsense codon,stop)

tertiary structure

thermal stability

topology
trans
transcription

transcription-initiation site( cap site)


transcription-termination site


transduction
transfer RNA(tRNA)

157

transition
translation(decoding)

transposable element(mobile element)

transposition
transposon

transversion
trisomy
tRNA( transfer RNA)
true tree
twofold degenerate site

unequal codon usage(biased codon usage)



unequal crossing
over

unidentified reading frame(URF)


unique DNA(single
copy DNA) DNA( DNA) DNA

universal genetic code ()


unprocessed pseudogene

unrooted tree
untranscribed sequence( flanking sequence)
upstream 5

URF( unidentified reading frame)
V
variable site or region

variant repetition

viability
virion
virus

weak bond


wild type
wobble pairing



x-linkage( sex linkage)

158

xenology
Y
zygote

159


alignment

A
(amino acids)
abbreviations

34-37

in cow and langur lysozymes 47-48

10

(translation

of

amino acid replacements 25,

genetic information

into) 9-11
amino

acid

(Australian marsupials), 77

sequences

B
(paromomycin)77

(low

(albumin),

gene)116

(interleukin

gene)43-44

(untranslated

lipoprotein receptor

region)7

(rates of nucleotide substitutions

(leukemia), 110
(semiprocessed retrogene)111
(cytosine)6

density

in)28

30-31 42

(unweighted pair group method

()(conservative
(doublesex (

dsx

transposition)105-107
) gene)97-98

with

arithmetic

mean,UPGMA)64-65,68-69,72-74,78-81

(hemimetabola)82

(angiosperms),C 125

(nontranscribed spacer,NTS)99

(coding regions),42-44

(operator)8

(alternative splicing)97-98

(operon)8-9

(transformed distance method),

(operational taxonomic units,OTUs)

65-66,68,81
(variant repeats)87

(composite)111

()(flanking sequences)

(epidermal growth factor,EGF)94

(protein

coding genes and)7-8, 25

(rates of

nucleotide substitution

(phenogram)68
(phenetics), 68-69

in)45

(conservation biology)77-81

50-51

(pyruvate kinase), 88

(insertions)11-14, 34, 116

(coincidental evolution)99,

(insertion

(virogenes)120

IS1

106, 107

IS4

105

(horizontal

transfer from

baboons to cats)120-121

sequences)107, 124

(hylobatidae)73

(virion)108-109

(length

C (mammalian C values)125

(longterminal repeats,LTRs)109,116, 128

(mammalian

mitochondria

genetic code)10-11,34

abridgment)115

(long

term effective

size)22

(mammalian mitochondria
genome)52-53,87-88

(long

interspersed repeated

sequences),

(invariant repeats)87,88

LINEs128-129

(unequal crossing

(superfamily)88,

over)12-13,1278

(concerted evolution and)92


(genome

size

99-103

and)88

(globin)92
(overdominance genes)17,18-19,45
()(silencing)55
160

population

(silent

C(protein c)93

substitution)11

(maturase)97

(protein domain),

(overlapping genes)96-97

(inversions)11-12,116

(duplication)

(allele(s))16 25

(types of)83

(duplicate genes)

(codominant)18-19

(nonfunctionalization)89-91

(deleterious)11-14

34-35

52

(duplicative

(fixation of)20-20

22-25

28

transposition)105-106

(loss of)20-20

(recombination)16,100,117

(neutral)22-23,

(recombination

(wild type)22

enzyme)9

114

(recombinator gene)9

(allele frequencies)16,17-19

(archosauria)72

(fluctuations in)18-20

(vertical evolution), 99

(polymorphism and)24-26

(orthology)90

(low

(homozygotes)

116

(codominance and)18

(lowly expressed

(overdominance and)16

(transversions)11-12,30-32, 33-34

(purifying selection)17, 45, 47-48, 52

(point

(pattern)53,55

(alcohol dehydrogenase (

Adh

) gene)

density

116

lipoprotein receptor),
genes)56-57

mutations)11

(dot matrix method), 35,36 41


(electrophoretic alleles)25-26

(nucleotide

diversity)25-26

(directional selection)18

(inosine), 56

(leghemoglobin), 84-856

(erythropoietin gene)43

(telomere)125-126

(luteinizing hormone gene)43

(short interspersed repeated sequences),

(thyrotropin gene)43

SINEs128-129

(promotors)7, 9, 79, 115

(split genes)83

(promotor region)7

(polyploidy)83,

129

hits

,(Darwin,Charles)72-73

(multigene families)88,

(Darwinism)26

(multiple

(concerted

)31-32

evolution)98-103,

(rats), 50

(polymerase chain reaction,PCR)78-80

(gorillinae)73

(A)(poly(A)

(haploid)16,17

(polyadenylation signal)7-8, 90

DNA(single

DNA(multicopy singlestranded DNA,ms DNA)109-110

copy DNA)98-99,126-127

addition site)6-7

DNA(unique DNA)126-127,129

(polygamous species), 21

(monocotyledons)53-54,129

(cholesterol)116

(gene conversion and)127

(protease inhibitors)

(neo

86-87

(neutral theory and)26-27

(protein(s))

(gene families)87-89

(twofold

(globular)84-85

sites)34-35,44-45

(internal
(intorn
(mosaic)93-94
F
161

domain duplications in)85-87


encoded)97-98

)(polymorphism)20-20
Darwinism

24-26

and)26

(dihydrofolate

degenerate nucleotide
reductase gene)113

(dichromatism)89-90
(binomial probability function)19-20

(translation)7, 9-10,77

(rates)42-45,52-54

(translational efficiency),

(selection intensity and)45-47

55-57

(synonymous

(retroviruses)107-110,115-116

(between

(retroviral sequences), 120

sequences)33 34

()(retrofection)111

(nonsynonymous site)46,,

(retrogenes)111-112,122,

(semiprocessed)111

(aneuploidy)83 129

(retropseudogene)111,112-116

(evolution)115-116

substitutions versus)45-46
two

protein

coding

DNA(junk DNA)127-128 131


(baboons), 120-122

(retrosequences)108-109,110-111, 121-122, 128-129,

(taxonomic units), ,

(segregation distortion)117

(diagnostic features)111

(types)111

(segregator gene)9-10

(retroelements)107-110,121-122

(divergence)

(classification)108-109

(concerted

(possible evolutionary pathway)109-110

(between

(retroposition)103,105-107,107-108,129

32-34

(effects on host genome)115-116

(divergence time)42

(retrotransposons)107,108-110,129

(estimation of)70-71

copia

108-109

(of humans and apes)49

DIRS

1 108-109

(molecular phylogeny)

evolution

and)102

nucleotide sequences)31-32

44-45

72-73

(retrons)108-110

(molecular paleontology)77-80

(retroposons)108-110,128-129

(molecular evolution), 5

cin

(neutral

cin

4 factor)128

(molecular

F (F factor)128

(molecular biology)5

G (G factor)128

()(molecular clock(s)48-52

Ingi
L1

I (I

factor)128

128
149-150

of

molecular

evolution)26-27,46

D (D factor)128

G3A 126-127

theory

drive)101-102

(challenges to hypothesis)49
(comparison in humans and monkeys)50-51

(pseudogenes of)128

(comparison in mice and rats)50

R2 (R2 factor)128

(comparison in rodents and

(anticodon)56-57

primates)51-52

(retrotranscripts)

(relative

(reverse transcriptase)1085-109,111,128

(variation

(cycloheximide),() 77-79

(cladogenesis), 118-119

nonviral retroposons )

rate test and)49-50


among

lineages)50-52, 71

(negative selection)17,

(nonmuscle tropomyosin gene)113

(attachment site)9-10

DNA(nongenic

(complex transposons)107

C (c

DNA)129

value paradox and)125-127

(replication slippage)12-13

14

101-102 131

(maintenance of)131

()(replication transposition)105-107,128

(nondegenerate nucleotide sites)35-36,

(replicator genes)9-10,125-126

44-46

(nonsynonymous substitution)11-13,91

(calcium

binding module), K 94

(calmodulin gene)
162

(calcium

dependent regulator protein),

(alignment)34-37

85-87

(probability)

(dissimilarity)36

(binomial)19-20

(divergence)31-32 32-35

(fixation)

22-23

rRNA

(interferon genes)

42-43

77-78

(similarity)36

(glyceraldehyde
dehydrogenase gene)113

42

phosphate

(rate

of

(nucleotide

substitutions)11-13,28-35,42-59,64,91-92
(backward)32

nucleotide substitutions in)43-44

(causes of rate variations)45-47

(hypercholesterolemia)116

(coincidental)32

DNA(highly repetitive DNA 126-127

(convergent)32

(dispersed sequences)127-128

(humans

(localized sequences 126-128

(Jukes and Cantor

(highly

expressed gene)

56-57

and

apes and)74

parameter model)28-31,32-34

41

(Gram

positive bacteria)123, 124-125, 132

(Kimura

(Gram

negative bacteria, 123,132

model)30-32,33-34

()(donor site)8,116

(in

(functional constraints)

45-47

s one

s two

lysozymes

parameter
of

cows

langurs)48

(functional domain)83

(in mammalian mitochondria)52-23

(consensus sequence)25

(molecular clock hypothesis)48-52

(codominance)18-19

(multiple)31-32

(distance matrix methods for tree

(nonrandom

reconstruction)64-67,68-69

codons and)55-59

(for humans and apes)74-75

sequences)31-35

(archaebacteria)123

(number

(fixation)16,19-21,22-25,26

sequences)32-34

of synonymous

between

between

DNA

noncoding
two protein

coding sequences)34

(concerted evolution and)101-102


22-23

two

two

(number between

28

(fixation probability)20-21

usage

DNA (number

(paleotology), 77 80

(allele)20-21,22-25

and

24-25

45

(parallel)32

48

(fixation time)22,23-24

(pattern

(conditional)23

(in plant nuclear genomes)53

(photosynthetic cyanobacteria)76-77

(rates)42

(rolling

DNA (rates in organelle DNA)52-53

circle replication)130-131

in pseudogenes)53-55

(rate variations)45-47

(Hardy

Weinberg equilibrium)17

(silent)11-12

(sponges),C 125

(species comparisons)49-52

(seaside sparrow)80-81

(species

(composite transposons)107

and)71

(nucleotides)

(synonymous)11-13

(composition)131

(two

(diversity)25-27

nucleotide

DNA (in DNA sequences)6

(one

(nonstandard)7

substitution)28-30,32-34

R NA (in RNA sequences)2

(rate

(standard)7

28

(nucleotide
163

sequences)28-37

30-30

divergence time estimations

parameter

model

of

substitution)31-34

of

parameter model of nucleotide

nucleotide

substitution)24-25,

42

(nucleotide sites),

(degeneracy classes)34-35

(lowly repetitive)88

(nucleoskeleton)131

()(nontranscribed

DNA(nucleotypic DNA)131

(orthologous)90-91

(nucleolin)59

(overlapping)95-97

(ribose)6

(paralogous)90-91

(ribonucleic acid) RNA

(ribosome)9-10

regions)8

(processed)111-112

77

(repeated)87

L7 (ribosomal protein L7 gene)113

(silencing of)55

L30 113

(split)83

L32 113

(substitution rate variations among)47

RNA(ribosomal RNA) rRNA

(substitution rate variations within)46

(nucleosome)47

(transcribed)8-10,129

131

(submandibular

gland

type

()(transcribed regions)8

protease inhibitor) 86-87

(types)7

(chimpanzees)72-76

()(untranslated regions)7-8

(erythromycin)107

(gene expression), 116

(red

(gene duplication)38-39 83

pigment gene)89

(monkeys), 50-51

DNA ,,

DNA(complementary DNA) cDNA

(complete)83

(slipped

(estimation of

strand

mispairing)12-14 101-102

date)90-92

131

(internal)83

(annelids),c 125

(nonfunctionalization

DNA (circular DNA viruses)109-110

(partial)83

(backcrosses)79

()(gene elongation)85-87

(palinodromes)126-127

(gene diversity)24-25

(mutations in)14

(gene splitting), 63

(recognition sequences and)37-38

(gene

sharing)97-99

(gene

families)87-89

and)89-91

(concerted evolution)98-103

(globins)192-93
(mechanical incompatibility), 119

(gene structure)7-10

(actin genes)43

(protein

(actin

)43

50

(regulatory genes)9-10

(actin

)43

50

RNA (RNA

113

coding genes)7-9

specifying

genes)9

(myoglobin gene)84-85,88, 92

(gene

(rates of nucleotide substitutions in)43

(gene tree)63

(myosin light chain gene)113

(gene substitution)22-25,31-32

(creatine kinase), 88

(fixation probability of)22-23

M (creatine kinase M gene)43,44

(fixation time of)23-25

(gene(s)),

(neo

Darwinism and)26

(neutral theory and)26-27

regions)7-8

(coding

frequencies)

dead

),

(rate of)24-25
(genotypes) 17-18

(defined)7
(exogenous)106-107

(genic

()(flanking

(fixation probability)22-23

regions)8

selection)18-19

(highly repetitive)88

(gene

(horizontal transfer)119-122

(concerted evolution and)100-102

164

conversion)127

(direction)101
(nonallelic)101

(rates of nucleotide substitutions

(genome(s))123-128 ,

in)44-46
(resurrection

C (c values)123

by

gene

conversion)102

(eukaryotic structure)126-129

(unprocessed)89-91,122

GC (GC content in bacteria and)131-133

(intervening sequences),

(genetic resetting)118-119

(degeneracy classes), 34

DNA (nongenic DNA and)131

(meiosis)9-10,100-101,125-126,131

(organelle)52-54

(crossing

(yeast)

(transposition effects on)115-116

over), ,
saccharomyces cerevisiae

(vertebrate organization)132-138

(nonrandom usage of synonymous

(genome duplication)83,129

codons)55-57

(genome size)88

rRNA (rRNA gene)88

DNA (DNA duplication and)83

(transposable elements)116
(structure genes)7 ,

(of eukaryotes)125-126
(evolution in bacteria)123-125

RNA

(mechanisms for increasing)129-131

(in plant mitochondria)52

(regional increase)130-131

(in prokaryotes)8-9

(genomic rearrangements),

(transcription in bacteria)7-8

116

(structural module(s)83,

(genome doubling)

(truncation), 112-113

(genome hypothesis)55-56

()

(loci)16

gene)44

(gene diversity at)24-25

(Vesuvian mode

(polymorphic)24-25

(metallothionein
of

evolution)114-116

(synthetic theory of evolution)26-27

(hormone gene)43

(cladogram), 68,72

(Giemsa banding)134

(evolutionary rate),,45-47

(vertebrate genome),

(clades)71-72

132-138

(humans and apes)73

(echinoderms),c 125

(cladistics), 68-69

(dose repetitions)87

(neighbor

(processed genes),111-112

( ) (argininosuccinate synthetase

gene)113

(processed

pseudogenes)111, 112-116

()(argininosuccinate lyase)98-99

(evolution of)115-116

(distance

(processed sequences)111

joining method), 67

methods)69

(distance

index), 36-37

(methylation)55

(complementarity

(crustaceans),c 125

CDRs)45-46

(methionine)10

()(deterministic

(formylmethionine)10,77

(absolute

(parathyroid

(pteridophytes),C 125

(thyroglobulin

(pseudogenes)44-45
102-103

122

hormone gene)43,44
75-76

87

90

92-93

128, 56,85-86,100,103-104,105-107,119,141,

(pattern

models)16

fitness)17

of

nucleotide

(open reading frames, ORFs)52, 107,109-110,128


()(mobile

elements)

(transcribed genes), 129

substitutions)53-55

(processed)89,111-116,122

elements)106-110,119-120,123-124,129-130

165

regions,

)50

50-51

determining

(transposable

(allozymes88

(defined)105

(isozymes)88-89

(donor site)106-107
(evolutionary dynamics of copy

(restriction)

number)119-120

(Mendelian segregation)19

(gene expression and)115-116

(Mendelism)26

(insertion sequences)106-107
P-M (P

(pyrimidines)6,11-12

123-124

(codon)9-10

M dysgenesis and)117-118

(retroelements)107-110

(nucleotide substitution in)11-13

(target site)106

(synonymous) 10

(transposons)106-108

(usage pattern)55-59

(null base), 34-36

(frame shift mutation)14,89-90

(codon family)10

(insects)c 125

(codon

anticodon pairing)56-57

(immunoglobulin genes)43

(hypervariable regions)45-46

(blue

pigment gene)89

(internal

(cyanobacteria)77-78,123,124-125

domain

(nonsynonymous

(hominoidea) 72-76

synonymous substitutions

(similarity index) 36

(rates

in)43

Cyprinus carpio

duplications)85-87

),C 134-135

in)45-46
of

(rifampicin)77

(extinction), 20-21

(ligase)37

(hymenoptera)129

(streptomycin) 77

(Kimura

(diploid)17

model)30-32,33-34,41

19

(amphibian),C 124-125

(dysgenesis), 116-119

(quagga)80

(gap(s))14

nucleotide substitutions

s two

88-81

(terminal)35-36

(internal

(gap penalty)36-37

(endosymbiotic theory)77-78

(triosephosphate

isomerase

repeats)83, 114

(intron(s))7-8,25,52,58-59,83,85-87,93-94,103,

gene)113

a14

(phosphodiester bonds)6-7

(exon insertion into)

( ) (phosphoglycerate

(loss of)84-85

97-98

kinase(PGK)multifamily)111, 113

(number of)8-9

(lepidoptera)81-82

(phases of)95-96

(primates), 51-52

(intron

(green

97-98

pigment gene)89

algae)77-78

encoded proteins),

(endonucleases)97

(chloramphenicol)77

(endogenous

(ovomucoid gene), 85-87

sequences)120-122

(gymnosperms),C 125

(internal

(pararetroviruses)108-1108

(cats), 120-122
(feline

leukemia

retrovirus)109-110

transcribed

sticky ends

(bird),C 125

(felidae)120-122

(guanine)6-7

(cap

(urokinase)93-94

(enzymes)
166

parameter

(south American marsupials),

34-36

(minimization)36-37

(gree

versus

site)7-8,111

(prourokinase)94

)37

spacer)99

retroviral

(urokinase

plasminogen activator gene)43

(population size)19-20

(uracil)7

(effective)20-22

(rodents)

(fixation probability and)22-23

(nucleotide substitution rates)50,51-52

(random genetic drift and)20-21

(retropsendogenes)113

(population

(thrombin)87

splitting), 63

(population genetics)5

(prothrombin)93-94
(Kringle

16

(allele frequency changes)16-17

module)93-94

(effective

population

size)20-22

(gene substitution)22-25

(reptiles),72

(natural selection)17-19

C (c values)125

(neo

Darwinian theory)26-27

(gametes), 20-21

(neutral mutation hypothesis)26-27

(random sampling of gametes)19-20

(polymorphism)24-26

(matched bases), 34-36

(random genetic

(purines)6, 11-12

(splicing), 97

(chromatid)110-101

(splicing

function)

drift)18-20

(chromosome)83

(splicing sites)8,37, 85, 97-98

(gene conversion and)100-102

(balancing selection)18-19,20-21,26

(mechanical incompatibility)83

(paralogy)90-91

(unequal crossing

(battleneck)22,27

(chromosomal duplication)83,129-130

(Pribnow box)8-9

(partial)83

(universal genetic code)10,34-35

(heat

shock proteins)98-99

(expected heterozygosity)24-25

chimpanzee)73-76

(initiation

(human genes)

(migration)16

codon)

(human

(codon

20

over and)69,71

gorilla

usage patterns)56-58

(provirus)108-109

(nucleotide substitution rates)51

mRNA(pre

(retropseudogenes)113

mRNA)7-8,111

(hominidae)72-73

(prebiotic evolution)5

(preproinsulin

(preproinsulin

gene)103,111-112
gene)103,111-112

(human

phylogeny)72-76

(lysozyme)87
(positive selection in)48

(hydroxanthine
phosphoribosyltransferase gene)43

()(sarcodina)C 125

(enchancers)115-116

(cows), 48-49

(strong bond)6

(lactalbumin)87

(excision

repair)14

(lactate dehydrogenase)103

(hydrogen bonds), 6

(isozymes)88-89

(regional duplication)83

A (lactate dehydrogenase A gene)43-44,50

(localized repeated sequences)125-128

B 98-99

(convergent evolution)80

(mollusks),C 125-126

(sampling), 19-20

(weak bond)6

(aldolase), 88

A (aldolase A gene)43-44,50

(Sattath and

(deletions)11-14,34-35,52,114,116

RNA (RNA

(trichromotism)89-90

167

specifying genes)7,8-10,88,125-126

Tversky s

method)

(trisomies)129-130

(random

(dispersed repeated sequence)127-129

(stochastic models)16

(color

(neutral theory and)26

sensitive pigment proteins)89

mating)17

(pigment protein), 89

(random genetic drift)16-17,18-21,48-49

(sharks),C 125-126

(clostridia)132

(upstream direction),DNA 1

(dusky seaside sparrow)80-81

(glycoprotein hormone

(origin

(Down s syndrome)129

of

(growth

life)5
hormone

gene)43-44,

50

(character

subunit)51

state methods)69

-28

(somatic

(somatostatin

(substitution),

28 gene)43

(growth

factor

module)94

mutations)11

(conditional fixation time)23-24

(reproduction),,

(regulatory gene)7,9-10,125-126

(recognition sequences)37,39

(ferredoxin), 85-87

(generation

(isozymes)88-89

time effect)51-52

(fitness)17-19,127-1289

(synonymous codons)10

(absolute)17

(nonrandom usage)55-59

(relative)17

(synonymous substitutions)11-13,55-59,91,97

(thermophilic bacteria)131,137

Mu(bacteriophage Mu)105,107-108

(nonsynonymous substitutions versus)45-46

(rates)42-45,52-54

x174 96

, 124

(between two protein

(contractile system protein gene)43

sequences)33-34

(acceptor site)8, 116

(variations among genes)47

(diptera)81-82

(synonymous sites)46-47

DNA(double

DNA(homoduplex

stranded DNA)

DNA)40

(antiparallel structure)6-7

(homologous sequences), 42

DNA-DNA (DNA

(isochores)52,156,158

DNA hybridization and)40

(lagging

strand)55

(gene location within)134

(leading

strand)55

(origin)136-138

(thermal

stability)40

(advantageous)

(horizontal gene transfer)119,119-122

(defined)11

(horizontal evolution)

(deletions)12-14

(direct repeats)105

(frameshift)14

(sequence

GC (GC

distance method),

content in bacteria and)132-133

35-37

(hotspot)14

(dot matrix method)35-36

(insertions)12-14

(sequence

(neutral)

distance method)

35-37

(point)11,53-54
(

dead

genes

(fourfold

degenerate nucleotide

(somatic)11
(spatial distribution)14

sites)34-35,44-45

(spontaneous)53-55

(four

point codition)66-67

(synonymous),,

(4

thiouridine)56-57

(types)11

(relaxin

gene)43

(hotspots of

(rate

constancy assumption)48-49,91

(rate of mutation)23-25,45,46-48

168

136

(mutation(s))11-14,16,20-20

(dicotyledons)53

coding

mutation)14

(mutationist hypothesis)137-138

(speciation), 118-119

(mutation pattern)53-55

(missense mutations)11-13

(inferred

phylogenetic trees)62-63

(phylogeny)5,49,60-81

(character-state methods)69

(deoxyribose)6
(deoxyribonucleic acid), DNA

(clades)69-70

()(topology),

(conservation biology and)80-81

(distance approaches)69

(outer memberane protein

gene,

omp

(in gene

duplication event

A)56

dating)90-92

(exon(s))8,25, 83,93-94,97

(humans and apes)72-76

(asymmetrical)95,103

(impact of molecular data)60


(mitochondria

(classes)95

and

chloroplast)77

(domains and)83-85

(molecular paleontology)77

(spatial distribution)8-9

(species

(symmetrical)95,103

(phylogenetic tree(s))60-72

(exon

(additive)61-62

insertion)92-93, 95

80

divergence time estimation)71

(exon duplication)84-86,92-94 DNA ,

(bifurcating nodes)61-62

(branches)61

(exon shuffling)83,92-96

(branching pattern)61,

(mosaic

(branch length)61,69-70

proteins

and)93-94

(phase limitations)93-96

(defined)61

(exogenous genes)106-107

(external nodes)61

(external transcribed spacers)99

(gene)63

(holometabola)81

(horizontal gene transfer and)121

(protein

coding genes)7-9,102, 123-124,

(inferred)62-63,69

143-144,

(internal nodes)61

(in chloroplasts)52

(maximum parsimony)67

(in

(multifurcating

eubacteria)8-9

nodes)62

(in mammalian mitochondria)52

(nodes)61

(nucleotide substitution)11-14,32, 34

(reconstruction methods)64-68,

(in

(for relative

plant

mitochondria)52

rate test)49-50

(rooted)61-62

(substitution rates)42-45
(transcription in eukaryotes)8

(rooting unrooted trees)70-71

(transcription

(scaled branches)61

in

prokaryotes)8-9

DNA(satellite DNA)127,129-130,131

(species)63

(stabilizing selection)18-19

(topology61-66

(unrooted phylogenetic trees)61-62,69

(unrooted)61-62,67-68,70

(rooting),70-71

(unscaled branches)61

(agnathes)91-92
C (c

76-77

values)125

A (cytokeratin endo A

gene)113

(nonsense

DNA(organelle DNA),,52-54,.
codon)

(nonsense mutations)11-13

C(cytochrome C)48-49

(species

C (cytochrome C gene)48-493,113

divergence times)

(estimation)70-71

(cytotype)117

(human and ape)72-76

(bacteria)

(species trees)62-63

GC (GC content)131-134

169

(genome size evolution in)123-124

(evolutionary implications)101-103

(bacteria transposons)107-108, 115-116

(mechanisms)100-102

(downstream direction),DNA 6

(atrial natriuretic factor)50

(ciliophora),C 125

(neo

(ciliates)77-78

RNA(messenger RNA), mRNA

(fibronectin)93-94

(informative sites)67-68,75-76,81

(restriction

fragment

Darwinian theory)26-27

(pongidae)73 (ponginae)73

patterns)37,38-40,79-81

(sex determination),,97-98

(restriction map)37-39,38-40, 41

(sexlethal(

(restriction

(thymine)1-3

sites)37, 99-101

sxl

)gene)6-7

(selection),

(restriction endonucleases)37-40

(selectionist hypothesis)136-137

Bam

38-39

(selection intensity),,47

Bbv

37-39

(selective advantage)
(fixation

probability and)22-24

EcoR

37,39,100

(fixation

time

Hae

37-39

(selective neutrality)55

Bgl

Hind

101

and)23-24

(pattern

37,100

of

nucleotide substitution

Hind 38-39

under)53-54

Hinf

37-39

(selectionism)26

Hpa

99-100

(neutralism versus)27

Nci

37-39

(hemoglobin)48-49

Not

37-39

(Constant Spring)85

Pvu

101

Icaria 85

(recognition sequences)37-39

(hemoglobin genes)92,

(splicing

(rate of nucleotide substitutions in)43

site)37

(sticky ends)37

(serum albumin)43,85-86

DNA(mitochondrial DNA)79-81

(internal domain duplication)85-86

(mitochondrial genomes)10,95-96

(fibrin)93

(endosymbiotic origin

(fibrinolysis)92

of)77

(mammalian)52-53

(plasminogen)93-94

(plant)52-53

(internal domain duplication)85-86

(mitochondria genetic code), 10-11

(fibrinogen)94

(alignment)34-37

r (r gene)43
(blood coagulation)93-95

(dot matrix method)25-36

(sequence

distance

method)35-37

Y
(proopiomelanocortin gene)50 113

(adenine)6-7
(relative

fitness)17

(relative

DNA(subgenomic circular DNA)52

rate test)49-50

(for humans versus monkeys)50-51

(subspecies)80
(nicotinamide

(for mice versus rates)50

dinucleotide(NAD )89

(for

(euglenozoa), C 125

rodents

versus primates)51-52

(mosaic proteins)93-94

()(crystallins), 97-99

(parvalbumin), 86-87

(wobbling)56-57

RNA(small nuclear RNA), snRNA

(wild

RNA(small cytoplasmic RNA), scRNA

22-25

(mice), 50

(langurs), 48-49

(concerted
170

evolution)92-93,

adenine

98-103

type allele),

(chloroplast genomes)10

(endosymbiotic origin of)77-78

(advantageous selection)17,45-46,

(substitution rates)52-54

(mitosis)9-10,100-101,125-126,131

DNA RNA (DNA

dependent RNA

polymerase),

(long

RNA
S

(s

adenosylmethiomine

Vk (vitaminK

dependent calcium

(trypsin)85,87

(functional)46,83

peptide gene)46-47
(insulin

(defined)83
(exons and)83-85

chains)46-47

(mutagens)52-53, 131
(domain(s)

93-94

(insulin gene), 43-44


(C

term)22

(sense codons)10,85

(fishes),C 125

binding module)93-94

A B (A and B

population size)20-23,27

(nucleotide substitution in)11-13

dependent methylase)107

(effective

like growth factor

(structural)46,83,

gene)43 50

(domain duplication)84-87

(proinsulin gene), 46-47

(ovomucoid gene and)85-87

(genetic resetting)119

(prevalence of)85-87

(genetic polymorphism)

(prokaryotes)

(genetic code)9-11

(endosymbiotic theory and)77-78

(degeneracy of)10

(structural genes in)8-9

55

(mammalian mitochondrial)10-11,34-35

(tropomyosin), 113

(universal)10.,34-35

(hepatitis

85-87

virus)109-110

(tropomyosin

chain)

r (acetylcholine receptor r subunit

(protists)77-78

gene)43

(apes), 72-76

(heterochromatin)129-130

(reading frame)6-9

(allozymes)88,89

DNA(heteroduplex DNA)40

(heterozygotes)

(translocation)116

(codominance and)18-19

IX (factor

IX gene)93-94

(overdominance and)18-19

(exon localization)8-9
(Responder locus),

(random
(D.

melanogaster)

127-128

DNA(hybrid

sampling

of gametes and)19

DNA) DNA

(hybrid dysgenesis)116-118

(neighbor relation methods for

(speciation

and)118-119

tree reconstruction)66-67,68,81

(apolipoprotein genes)43-44,46-47

(for humans and apes)75

43,50-51

(differential reproduction),

43-44

(marsupials),

E 43-44,50

80

(rooted phylogenetic tree)61-62

(algae),C 125

(functional gene), 112-113

(bog people)80

(deleterious mutation)

(bony fishes),C 125

(fixation

probability)23
(fixation

(eukaryotes)
time)17, 23-24, 45-46, 87

(endosymbiotic

theory and)77-78

(advantageous mutation(s)16-18, 26-27, 45-46,

(gene

48-49

(genome duplication)129

(fixation probability of)22-23

(genome size)124-127

(fixation time of)23-24

(protein

(rate of gene substitution)24


171

structure)6, 84-85

coding gene structure)7-9

(repetitive

genome structure)125-129

(transition)11-12, 30-32, 34-35

(fungi)77-78

(transcription)7-8,77,111, 129

(true phylogenetic trees)70,

(transcription

(eubacteria)77-78

(transcription termination

C (C values)123-124

RNA

GC (GC content in)131-133

(transposition)101-102, 105-122, 129-130

(protein

()(conservative)105-107

coding gene in)8-9

initiation site)7-8,102
site)7-8

(transfer RNA) tRNA

(positive selection)17,45-46,

(defined)105

(in lysozymes of cow and

(duplicative)105-107

langurs)48-49

(effects on host

(mycoplasmas)123-124, 132

(horizontal gene transfer)119-122

rRNA (rRNA genes)88

(hybrid dysgenesis and)135-137

genome)115-116

(replicative)105-107,128

(branch length estimations)69-70


(orthoptera)81-82

(retrosequences and)110-116

(finger module)93-94

(speciation and)118-119

(plant genomes), 52-54

(transposable

(plant mitochondrial genome)52-54,77

and)119-120

(substitution rates)52-53

(transposable elements and)106-110

(plasmids)107-108

(types)105

DNA (DNAoriginating

element copy number

(transposase)106-107

in)123-124

(plastids),

(transposing bacteriophages)107-108

DNA(middle

(transposons)106-108

repetitive DNA)125-127

(neutral mutation)17,45-46

(complex)107

(composite)107

(fixation probability of)22-23

(effects on host genome)115-116

(fixation time of)23-24


(rate of gene substitution)24-25,45-46

Tn3 107

(stop codons, termination codons)8,9-11,85

Tn9 107

89-90,97-98

Tn10 105,116

(frameshift mutation and)14

Tn21 107-108

P53 (tumor antigen P53 gene)113

Tn554 107-108

(germ

Tn1107-108

line cells), ,

(Jukes

and

Cantor

one

parameter model)28-31,32-34,41

(centromere)

transposon yeast

), Ty

(Jukes and Cantor s formula)34

()(purple bacteria),

(globin gene),

(spontaneous mutation), 53-55

(chromosomal location)92

(natural

(evolutionary history)92-93

(advantageous)17

(families)88,92-93

(codominant)18-19

GC (GC content)134-137

(defined)17

(intron loss

during

evolution)84-85

77-78

selection)16-19, 131

(fixation probability and)22-23

(superfamily)88,92-93

(fixation time and)23-24

(globin pseudogenes), 89-91

(negative)17

(major histocompatibility complex

(neo

genes)102-103

(overdominant)14,16-17

(nonsynonymous versus synonymous

(positive)17,

substitution in)45-46

(purifying)17

(transformer (
172

tra

) gene)97-98

Darwinism and-)26-27

DNA(foldbackDNA)125-127

DNA (

selfish DNA

(in rooting unrooted trees)70-71,74-75

)115-116,131

(repressor)8
(compositional assimilation), 115-116

(in

(histone genes)8-9,87

(tissue plasminogen activator,

(rate

of

nucleotide

transformed

distance method)66

TPA)93-94

substitutions)42-44,46-47

(maximum parsimony methods),64,67-69,79,82

(module(s))83,

(for humans and apes)75-76

(outgroup),

(for marsupials)80

173

AATAA (AATAA
Acheta

(eukaryotes)124-127

box),

C (C

domesticus()82

value

Acholeplasma laidlawii()132

Cyprinus carpio

Achyrthosiphon

C (C

magnoliae(

)82

paradox)124-127,1131
()134-135

values)125

Dasyurus maculatus()80

ACTH (ACTH gene)44

Dictyostelium discoideum(

ctinobacteria(),132
Adh,

(retrotransposons)108-110

Aedes()137-138

Dipodomys ordii

Aegilops bicornis()38-39

DNA

Aegilops sharonensis()38-39

(complementary), cDNA

AIDS()58

(double

Allium cepa(

108

()125-127

stranded)6-7,40

(foldback)125-127

), C 126

Alu (Alu

sequences),(in

(highly repetitive)125-127

low

lipoprotein

(junk)131

density

receptor gene)116

Ammodramus maritimus()80-81

(middle

Amoeba dubia(),

(mitochondrial)79-81

C 125

Amoeba proteus( ),
means(),

125

Amphiuma

repetitive)125-127,129-130

(nongenic)126-127,131
(nucleotypic)131

125

Anthrobacter luteus 132

(organelle)52-54

Artemia salina()81-82

(originating in

B1 (B1

family)114,

Alu

Bacillus brevis

(B

(repetitive)126-129

chromosomes)129

selfish

Bacillus subtilis()132

(single

Boa constrictor(),

(unique)126-129

125

Bombyx mori()82, 128


owman

plasmids)123-124

(satellite)127,129-130,131

()132
B

)137-138

Birk (Bowman

DNA
Birk type protease

)115-116,131

copy)126-129

DNA (DNA

DNA hybridization)37,39-40

(humans and apes and)40,76

inhibitor), 86-87

DNA (DNA duplication)114,116,127-128,

CAAT (CAAT box)7-8

DNA (DNA polymerase)14,131

Carcarias obscurus

(),C 125

DNA (DNA amplification)79,130-131

cDNA( DNA)60,105,107-109,111

DNA (DNA

CDRs()45-46

DNA (DNA repair)51-53,106-107,111

Clostridium innocuum()132

DNA (DNA sequence)6

Clostridium pasteurianum(), 85-87

(nucleotide substitution)28-35

Clostridium

PCR (PCR amplification)77-80

perfringens()132

Coscinodiscus asteromphalus
cox

(cox

( ),C 125

I gene)97-98

replication)9-10,129

(polymorphism measurement)25-26
(restriction site)37-39

Cu/Zn (Cu/Zn superoxide dismutase

DNA (DNA sequence data), 60

gene)112-113

DNA (DNA

C (type

C virogene), 120-122

C (C value(s))143-144,(bacteria)123
174

Drosophila

mediated transposition),

()129-130,137-138,15, 101,113-114,128

P (horizontal transfer of

LDH,

Lilium formosanum

(),

elements between species)121-122

C 125

(hybrid

LINEs(long interspersed elements ,

dysgenesis)116-118

(retrotransposons)09-110

)128-129

Drosophila

Micrococcus luteus

mauritania()121-122

Drosophila melanogaster

( )82, 106-107, 116-119,

mRNA

()132-133

(alternative splicing and)97

(coding regions)7-8

121-122
(alcohol dehydrogenase

nucleotide

Mycobacterium

tuberculosis()132-133

diversity)25-26

Mycoplasma()132

(alternative splicing and)97-98

Mycoplasma capricolum()132-133

C (c value)125

Myxococcus xanthus(

(nonrandom usage of synonymous

Na, K-ATP

codons)56-574

Navicula pelliculosa

rRNA (rRNA genes)88


Rsp

Neisseria

Rsp

locus)127-128

(Na, K

cinerea()37-39

genome)52

tRNA (tRNA

C (C values)125-126
(), DNA127-128

Nocardia otitidis

Ophioglossum petiolatum(

Drosophila sechellia()121-122

ORFs,

Drosophila simulans()137,140

nova()137-138
121-122

Pan

),C 125

OTUs,

Pan troglodytes()72-76

Echymipera80

Papio

EGF(epidermal growth factor,)93-94

Papio cynocephalus()121-122

Erysiphe cichoracearum(

Papio hamadryas()121-122

anubis()57-58

Escherichia coli ()37-39,59,76-77,123-124,132-133

Papio papio()121-122

(insertion sequences)106-107

Paramecium aurelia()

,C

(nonrandom usage of synonymous

Paramecium caudatum(),

codons)55-57

Parascaris equorum(

rRNA (rRNA genes)88

PCR,

(transposable elements)105-107,116

)111

Euplotes aediculatus(

Phalanger 80

GT-AG (GT

)137-13/

AG rule)8,90

124-126
124-126

),C 125-126
PGK (

112

Phaseolus

vulgaris()84-85

GC (GC content)57-58

Philander opossum andersoni()80

(in bacteria)131-134

Philosamia cynthia ricini()82

(isochores and)134-137

Physarum polycephalum()137-138

GC (GC box)7-8

Pinus resinosa

GC (GC mutational pressure)132-133

P-M (P

Gallus domesticus(),

Pongo pygmaeus()

C 125

(),C 125

M-system), 116-118

Galycine max()84-85

Proteus

Gorilla

Protopterus aethiopicus

(),C 125

Haemophilus aegyptus()37-39

Pseudomonas fluorescens

()125

Haemophilus influenzae()37-39

P (P

Lactobacillus viridescens

Lac

Z (

Lampreta
175

gorilla()72-76

Lac

planeri

()132

Z gene)105-106
(), C 125

Oxytricha

paniscus()40

Drosophila yakuba()121-122

),C 125

(chloroplast

caviarum()37-39

Drosophila saltans()121-122

Drosophila willistoni()118-119

gene)44

(())C 125

(transposable elements)105,107-108,119-120
Drosophila nasutoides

ATPase

Nicotiana tabacum( )

genes)88

), 110

vulgaris()132-133

elements)105-106,107-108,116-119,

(horizontal transfer between


Drosophila

species)121-122

RNA

(messenger), mRNA

Streptomyces griseus()132
(modification

following

transcription)9-10,111
(pre

Strongylocentrotus()137-138
TACTAAC (TACTAAC

messenger),

mRNA

box)9-10

TATA (TATA box)7-8,90

(ribosomal), rRNA

Tetrahymena()10

(small nuclear), snRNA

Theropithecus gelada(

(transcribed),7-8

Thy

(transfer), tRNA

Thylacinus cynocephalus()80

RNA (RNA polymerase),7-8

Trichosurus()

RNA ,7

tRNA5

(concerted
RNA (RNA

7-8

RNA (RNA

1 antigen)50
80

9-10

(abundance

evolution and)102

sequences)6-7

RNA

1 (Thy

)121-122

mediated transposition),

synonymous

and nonrandom

usage

of

codons)55-57

(processed pseudogenes derived

from)112-113
tRNA (tRNA genes),9-10,87-88,95-96, 123 -124, 149

RNA (RNA

transcript)

(alternative

(in

chloroplasts)52

splicing)97

(in mammalian mitochondria)52

(retrosequences and)109-110

(in plant mitochondria)52

RNA

(transcription)

DNA (RNA

DNA hybridization)

rRNA (rRNA genes)81-82, 87-88,101-102,123,130

Trypanosoma brucei()

(in

Ty (Ty

chloroplasts)52

128

elements)116

(concerted evolution and)98-99

Ub (Ub gene), 7-8

(endosymbiotic theory and)77-78

Vicia faba()84-85

(external transcribed spacer)99-100

Xenopus()114

(internal transcribed spacer)99-100

(concerted evolution)98-99

(in mammalian mitochondria)52

Xenopus borealis()98-99

(nontranscribed spacer)99-100

Xenopus laevis

(in

C (c values)125

plant mitochondria)52

(transcription)7
(unequal
Rsp (Rsp

rRNA (rRNA genes)88

99
crossing

Xenopus mulleri()98-99

over)100-101

Zea mays

locus),

Rattus norvegicus(),
Saccharomyces cerevisiae

C 125
()124-125

-(

(nonrandom usage of synonymous

(
-

rRNA (rRNA genes)88

fetoprotein gene)48a
tubulin)44
enolase)

,98-99

-globin

gene)84-85,88,91,103,113,1134-137,

(transposable elements)116

1 92-93

Salmonella typhimurium()119-120

2 92-93

Sarcophilus harrisii()80
Schistocerca gregaria(),

()77-78

-(

codons)55-57

(codon
C 125

Shigella dysenteria(),

(rates of nucleotide substitution in)43,


106-107

SINEs(short interspersed elements ,


)128-129
Staphylococcus aureus()107

44, 49
1-(

antitrypsin)50-51

()(

snRNA (snRNA gene), 7-8


Streptococcus faecalis()132

usage patterns)57-59

(family)92-93

scRNA (scRNA genes), 7

176

()98-99,134-135

-(
132

thalassemia)97-98
tubulin gene)113

gene)84-85,88,91-93,102-103,134,136-137

-globin

(codon

usage patterns)57-59

(family)92-93
(rates of
in)43,44-45,47,49,50-51

nucleotide substitution

-(

globin gene)44-45, 92-93,100

-(

globin gene)50-51,92-93,102-103

-(

globin gene)92-93

1-(

177

globin gene)58-59,92-93