You are on page 1of 9

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 1, pp.

90 –98, January 6, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

Outer Chain N-Glycans Are Required for Cell Wall Integrity and Virulence of Candida albicans*
Received for publication, September 21, 2005, and in revised form, November 1, 2005 Published, JBC Papers in Press, November 1, 2005, DOI 10.1074/jbc.M510360200

Steven Bates‡, H. Bleddyn Hughes‡, Carol A. Munro‡, William P. H. Thomas‡, Donna M. MacCallum‡, Gwyneth Bertram‡, Abdelmadjid Atrih§1, Michael A. J. Ferguson§1, Alistair J. P. Brown‡, Frank C. Odds‡, and Neil A. R. Gow‡2 From the ‡School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen AB25 2ZD and the §School of Life Sciences, Wellcome Trust Building, University of Dundee, Dundee DD1 4NH, Scotland, United Kingdom
The outer layer of the Candida albicans cell wall is enriched in highly glycosylated mannoproteins that are the immediate point of contact with the host and strongly influence the host-fungal interaction. N-Glycans are the major form of mannoprotein modification and consist of a core structure, common to all eukaryotes, that is further elaborated in the Golgi to form the highly branched outer chain that is characteristic of fungi. In yeasts, outer chain branching is initiated by the action of the 1,6-mannosyltransferase Och1p; therefore, we disrupted the C. albicans OCH1 homolog to determine the importance of outer chain N-glycans on the host-fungal interaction. Loss of CaOCH1 resulted in a temperature-sensitive growth defect and cellular aggregation. Outer chain elongation of N-glycans was absent in the null mutant, demonstrated by the lack of the 1,6-linked polymannose backbone and the underglycosylation of N-acetylglucosaminidase. A null mutant lacking OCH1 was hypersensitive to a range of cell wall perturbing agents and had a constitutively activated cell wall integrity pathway. These mutants had near normal growth rates in vitro but were attenuated in virulence in a murine model of systemic infection. However, tissue burdens for the Caoch1 null mutant were similar to control strains with normal N-glycosylation, suggesting the host-fungal interaction was altered such that high burdens were tolerated. This demonstrates the importance of N-glycan outer chain epitopes to the host-fungal interaction and virulence. nine, consist of a linear chain of one to five 1,2-linked mannose residues (12–14) and are known to be required for full virulence (14). The process of N-glycosylation has been studied extensively in Saccharomyces cerevisiae. N-Linked glycosylation is initiated in the endoplasmic reticulum with the transfer of the Glc3Man9GlcNAc2 oligosaccharide precursor to the protein target (15, 16). The oligosaccharide precursor is then processed by endoplasmic reticulum-resident glucosidases and a mannosidase to yield the mature triantennary Man8GlcNAc2 core (17). Outer chain branching is initiated through the addition of a single 1,6linked mannose residue to the Man8GlcNAc2 core by Och1p as the protein passes through the Golgi. Subsequently the 1,6-mannose backbone is extended by the sequential action of the mannan polymerase I and mannan polymerase II enzyme complexes. The linear 1,6linked polymannose backbone is then branched by the action of further mannosyltransferases (18, 19). These side chains in C. albicans consist of 1,2- and 1,3-linked mannose residues (20 –22) and in serotype A strains 1,2-linked mannose residues (23). The side chains and positions within the core are also modified by the addition of phosphomannan, consisting of a chain of 1,2-linked mannose residues attached via a phosphodiester bond (24). Previous studies in C. albicans have demonstrated the overall importance of glycosylation for cellular viability and virulence (25–27). Analysis of the PMT and MNT gene families required for O-glycosylation has demonstrated its relative importance in the host-fungal interaction and virulence (12, 14, 28 –31). Phosphomannan has been implicated in the interaction with phagocytic leukocytes; however, deletion of MNN4, required for phosphomannan production, demonstrated that it was not required for macrophage interaction or virulence (32). In S. cerevisiae OCH1 encodes the specific 1,6-mannosyltransferase that initiates outer chain branching through its action on the Man8GlcNAc2 core (33–35). ScOch1p is unusual among mannosyltransferases because it displays a narrow acceptor specificity requiring the whole Man8GlcNAc2 core for efficient recognition (34, 36). Mutants lacking the OCH1 gene in S. cerevisiae are viable but display temperature-sensitive growth (33). The Scoch1 mutant has a severe N-glycosylation defect, with a complete loss of the 1,6-linked polymannose backbone. N-Glycans isolated from the Scoch1 mutant consist of only Man8 –10GlcNAc2, where the Man8GlcNAc2 core is modified by the addition of 1,3-linked mannose residues to antennae of the core (35). N-Glycosylation och1 mutants have also been characterized for Schizosaccharomyces pombe and Pichia pastoris (37–39). To assess the importance of outer chain N-glycosylation in virulence and host-fungal interactions, we disrupted the C. albicans OCH1 homolog. The Caoch1 null mutant had a severe defect in N-glycosylation, displaying loss of the 1,6-linked polymannose backbone, although the core was further modified by the addition of 1,2-mannose residues. The Caoch1 null mutant displayed cell wall defects and was attenuated

Candida albicans is a commensal organism carried by a significant proportion of healthy individuals. It is the most common opportunistic fungal pathogen of humans causing superficial infections of the mucosa and in the immunocompromised host life-threatening systemic infections (1– 4). The cell wall is the immediate point of contact between fungus and host and plays an important role in adherence, antigenicity, and the modulation of the host immune response (5–9). The outer layer of the cell wall is enriched in highly glycosylated mannoproteins (10), and both the protein and carbohydrate components have been implicated in the host-fungal interaction (5, 6, 11). The study of glycosylation in C. albicans therefore has its own relevance in identifying the carbohydrate epitopes involved in pathogenesis. Cell surface mannoproteins contain both O- and N-linked oligosaccharides. The O-linked oligosaccharides, attached to serine or threo-

* This work was supported in part by Wellcome Trust Grants 063204 and 72263 (to
N. A. R. G., F. C. O., and A. J. P. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by Wellcome Trust Programme Grant 071463. 2 To whom correspondence should be addressed. Tel.: 44-1224-555879; Fax: 44-1224555844; E-mail: n.gow@abdn.ac.uk.

90 JOURNAL OF BIOLOGICAL CHEMISTRY

VOLUME 281 • NUMBER 1 • JANUARY 6, 2006

The promoter replacement cassette was produced by a modification of the published system in order to utilize PCR-directed targeting. Endo H. the region of homology to pDDB57 is underlined) and transformed into THE1 to generate a heterozygous strain.67% (w/v) yeast nitrogen base with ammonium sulfate without amino acids. The first allele of CaOCH1 was disrupted by means of the URA3 recyclable PCR-directed gene disruption system (46). mitogen-activated protein kinase. For mannosyltransferase activity assays. The recyclable URA3 cassette was amplified from pDDB57 (primer pair 5 -GAAACAGACACGAGACCTTTACTATAACTGATACTTTTGTTTCCATTTTCTTTTCCAATTATTGGGAATAAATATTTCATGTGAAATTGTGAGCGGATA-3 and 5 -GGTAATTTAGTTTACAAAATCGGTTATAAATAGAAAATATGTGCATTTAAATATATATGGGTGTGTACTCAAGGGGTTAGTTTTCCCAGTCACGACGTT-3 . Southampton. pH 6. doxycycline was added to the medium at a final concentration of 20 g/ml. 3 primer pair 5 -CTACTAGTCGACCGATCTGGACTTGTAGTTGGT-3 and 5 -GATGCATGCGGGTGTGTACACAAGGGGTT-3 . a re-integrant strain was also constructed in which a wild type copy of CaOCH1 was transformed into the null mutant. cfu. To disperse cellular aggregates. Hyphae were induced in 20% fetal calf serum.Och1p Required for Outer Chain N-Glycosylation and Virulence TABLE 1 Strains used in this study Strain CAI-4 NGY152 NGY202 NGY203 NGY204 NGY205 NGY357 NGY358 THE1 NGY359 NGY360 NGY361 NGY355 Parent strain CAI-4 CAI-4 NGY202 NGY203 NGY204 NGY205 NGY205 THE1 NGY359 NGY360 Genotype ura3 ::imm434/ura3 ::imm434 As CAI-4 but RPS1/rps1 ::CIp10 As CAI-4 but OCH1/och1 ::hisG-URA3-hisG As CAI-4 but OCH1/och1 ::hisG As CAI-4 but och1 ::hisG/och1 ::hisG-URA3-hisG As CAI-4 but och1 ::hisG/och1 ::hisG As CAI-4 but och1 ::hisG/och1 ::hisG. strains were grown in NGY medium containing 2 units/ml chitinase. The URA3 marker was then recycled by selection on SD plus 5-fluoroorotic acid (1 mg/ml) and uridine (50 g/ml). The resulting plasmid was then linearized with StuI before transformation into the Caoch1 null mutant. GDP-[14C]mannose (956 Bq. Specific activities were calculated and expressed as nanomoles transferred/mg/min. To induce -N-acetylhexosaminidase (HexNAcase).. MAPK. the SalI and SphI restriction sites are underlined. RPMI 1640.5. A conditional mutant was also constructed in which CaOCH1 was placed under the control of the tetracycline-regulated promoter (45) in strain THE1 that expresses the tetracycline transactivator (a fusion protein of Escherichia coli TetR and the activation domain of S. 0. CaOCH1 was disrupted in strain CAI-4 by sequential gene replacement and recycling of the URA3 marker by selection on SD plus 5-fluoroorotic acid (1 mg/ml) and uridine (50 g/ml).6% Triton X-100. cerevisiae HAP4). 2% glucose (w/v)) or SD (0. the region of homology to p99CAU1 is underlined) and transformed into the heterozygous mutant in the THE1 strain background. Re-integrant. Strains were grown in NGY medium (0. The URA3-TR promoter cassette was amplified from p99CAU1 (primer pair 5 -GAAACAGACACGAGACCTTTACTATAACTGATACTTTTGTTTCCATTTTCTTTTCCAATTATTGGGAATAAATATTTCGTAATACGACTCACTATAGGG-3 and 5 -TATGACTACTATTCCTAAAACGGCTAGTTTTAGATGTTTATGAACCATTTGGGGTTCTCTTAGTTGTAGCATGGGGTCTAGTTTTCTGAGATAAAGCTG-3 . respectively) and cloned into the relevant sites in pMB-7. and radioactivity was counted. 0. and the product was cloned into pGEM-T Easy (Promega Ltd.4% glucose. Amersham Biosciences). colony-forming units. 200 g of mixed membrane protein preparation was incubated for 1 h at 30 °C in 50 l of 50 mM Tris-HCl. and unincorporated GDP-mannose was removed by passage through 0. tandem mass spectrometry. Media. Reading. Strains were grown at 30 °C in YEPD (2% (w/v) mycological peptone. 0.6 ml of QAE-Sephadex. Dextra Laboratories. This work demonstrates the importance of epitopes carried on branched outer chain N-glycans for the host-fungal interaction and for virulence. UK) as the acceptor. respectively.5 (40). Mannosyltransferase Activity Assay—Mixed membrane fractions were prepared from exponentially growing cells as described previously (47). 10 mM MnCl2. 1% yeast extract (w/v). RPS1/rps1 ::CIp10 As CAI-4 but och1 ::hisG/och1 ::hisG. the strains were labeled with D-[2-3H]mannose. CAGACTGTGGGCCCGATTTAATTTGGATTTCAAG-3 and 5 TAATGCGTGGTTCTCATGTC-3 ). The CaOCH1 open reading frame plus 969 bp of its own promoter and 425 bp of its terminator sequences were amplified by PCR (primer pair 5 3 The abbreviations used are: HexNAcase. and Culture Conditions—The strains constructed and used in this work are listed in Table 1. The ura-blaster cassette was released by digestion with SacI and SphI and was flanked by 505-bp upstream and 521-bp downstream sequences complementary to CaOCH1.06 mM Man8GlcNAc2 (Oligomannose-8D1D3. EXPERIMENTAL PROCEDURES Strains. the SacI and BglII restriction sites are underlined. and Conditional Mutant Strains—The CaOCH1 gene was disrupted by the ura-blaster method (42). Labeling of Glycans and TLC—For the analysis of acid-labile and O-linked glycans. 25 mM N-acetylglucosamine). Cells JANUARY 6. Assays were carried out in triplicate. 0. at 37 °C or Spider medium (41) at 30 °C. and Lee’s medium. The plasmid insert was subcloned into the NotI site of CIp10. RPS1/rps1 ::CIp10 Source 42 44 This study This study This study This study This study This study 45 This study This study This study 27 in virulence in a murine model of systemic infection despite being able to colonize organs to almost wild type levels. specific activity 296 mCi/mmol. 0. The Ura Caoch1 null mutant was transformed with the StuI-digested CIp10 plasmid so that URA3 was expressed from the neutral RPS1 locus (43. To repress expression of the tetracycline-regulatable promoter. and 0. MS/MS.1% yeast extract) at 30 °C prior to virulence testing. endoglycosidase H. electrospray-mass spectrometry. RPS1/rps1 ::CIp10-OCH1 ura3 ::imm434/ura3 ::imm434 ade2 ::hisG/ade2 ::hisG ENO1/eno1::ENO1-tetR-ScHAP4AD-3xHA-ADE2 As THE1 but OCH1/och1 ::dpl200-URA3-dpl200 As THE1 but OCH1/och1 ::dpl200 As THE1 but och1 ::dpl200/99t-OCH1-URA3 As CAI-4 but pmr1 ::hisG/pmr1 ::hisG. pH 7. 2% glucose) with uridine (50 g/ml) as required. 2006 • VOLUME 281 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 91 .1% neopeptone. The 5 and 3 regions of homology were amplified by PCR (5 primer pair 5 -CTAGAGCTCATGCTACAACTAAGAGAACCCC-3 and 5 -GATGATGATAGATCTCGATTTCGGCATGATTCTATAAGCTTTAGC-3 . 44).077% complete supplement mixture. Neutral products were eluted with water.67% (w/v) yeast nitrogen base.5 mM 1-deoxymannojirimycin.3 activity strains were grown in SC GlcNAc (0. As a control. UK). -N-acetylhexosaminidase. ES-MS. Construction of Caoch1 Null Mutant.

containing protease inhibitor mixture (Roche Applied Science) and then disrupted with glass beads in a FastPrep machine (Qbiogene. caffeine (50 mM). Protein samples (50 g) were separated on a 4 –14% NuPAGE gel (Invitrogen) and blotted onto a polyvinylidene difluoride membrane. The suspension was adjusted to 2. UK) at 37 °C and shaken for 16 h (51). for 10 min at room temperature and then incubated in the substrate solution (0. From these data the level of Alcian blue bound to cells was determined ( g of Alcian blue bound per A600 unit of cell suspension). pH 4. The N-glycans were desalted on columns of 2. The PhosphoPlus p44/42 92 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 1 • JANUARY 6. The plates were eluted twice in the solvent (3:4:2. Finally the reaction was visualized by incubation in the substrate solution plus 0. the native sample was treated with 25 milliunits of Endo H (Roche Applied Science) for 16 h at 37 °C in 50 mM sodium acetate. 50 mM Tris-Cl. and N-glycans were released by treatment with 3750 units of peptide-N-glycosidase F (New England Biolabs. The gel was washed in 0. and the supernatant was retained for TLC analysis. The lysate was clarified by centrifugation at 21.01 and 95 l dispensed into 96-well plates.5. The remaining cellular material was pelleted. as positive control strains were also treated with Calcofluor White (100 g/ml) 2 h before collection. These cells were then inoculated into YEPD at an A600 0. Protein Extracts and Western Analysis—Activation of the cell integrity pathway was assessed by Western blot analysis utilizing the PhosphoPlus p44/42 MAPK antibody kit (New England Biolabs) that crossreacts with CaMkc1p in its phosphorylated form.01% SDS. Fractions containing glycans were pooled.5:4 ethyl acetate/butan-1-ol/acetic acid/water). at 100 °C for 5 min to remove noncovalently bound proteins. containing protease inhibitor mixture (Roche Applied Science) to a total volume of 5 ml. (50). Mass Spectrometric Analysis of Permethylated N-Glycans—Samples of permethylated glycans in 80% acetonitrile containing 0. and incubated at 100 °C for 10 min to denature cell wall proteins. 10% glycerol containing protease inhibitor mixture (Roche Applied Science) by means of glass bead disruption in a FastPrep machine (Qbiogene. Glycans were converted to their component monosaccharides in the form of partially methylated alditol acetates and analyzed by gas chromatography-mass spectrometry on a Supelco SP2380 column as described previously (53). SDS (0. 32). pH 5. SDS-extracted cell walls were then washed extensively in water. Strains were grown in YEPD at 30 °C to mid-exponential phase.8. 1 mM dithiothreitol. pH 7. Hitchin. 40 mM -mercaptoethanol. KCl (1 M). Cambridge. Phosphate groups present on the N-glycans were removed by treatment with 400 units of bovine intestinal alkaline phosphatase (Sigma) at 37 °C for 16 h.8. Cells were then pelleted. 2006 . pH 8.1 M citrate/KOH buffer.7 mM Fast Blue at 60 °C until the color developed. pH 6. Cells were then collected and washed twice with water before O-linked glycans were released by -elimination with 100 mM NaOH for 24 h at room temperature. Strains were tested for sensitivity to cell wall stressing agents by microdilution testing as described previously (27). The resulting lysate was clarified by centrifugation at 21. MS/MS spectra were recorded at 3 10 3 torr with argon as the collision gas and with collision voltages of 45–70 V. Cells were washed and resuspended in 10 mM Tris-HCl. Cell wall carbohydrate composition was analyzed by high performance anion exchange chromatography as described previously (48.02 M HCl. vanadate (80 mM). Cell walls were washed extensively in 1 M NaCl followed by water and extracted twice with 2% (w/v) SDS. Samples were mixed with native loading dye (62. The cells were washed with water and resuspended at an A600 1. 100 mM EDTA.01% bromphenol blue. UK). Congo Red (100 g/ml).500 g for 10 min. pH 6. 50 mM Tris-Cl. Cell wall stressing agents were added in a 5. A suspension of 1 107 stationary phase yeast cells was washed and resuspended in 1 ml of 30 g/ml Alcian blue in 0. 0. Preparation of Total N-Glycan—Total N-linked glycans were released from cell walls by enzymatic digest with peptide-N-glycosidase F..H]mannose (555 GBq mmol . The cells were washed twice in water and then boiled in 10 mM HCl for 1 h to release acid-labile glycans.18 mM naphthyl-GlcNAc (Glycosynth Ltd. The agents tested were as follows: Calcofluor White (100 g/ml). The membrane was blocked in phosphate-buffered saline plus 0. and dissolved in water.8. In Situ N-Acetylglucosaminidase Activity Staining—Strains were grown for 16 h in SC GlcNAc to induce HexNAcase expression.2. Phosphodiester-linked glycans were removed from the cell wall preparations by mild hydrolysis with 40 mM trifluoroacetic acid at 100 °C for 10 min. pH 4) for 30 min at 37 °C. 49). and the supernatants containing N-glycans were retained and adjusted to pH 8. UK).500 g for 10 min. Samples were analyzed in positive ion mode with capillary and cone voltages of 0. and the supernatant containing O-glycans was retained for TLC analysis. For detection of labeled carbohydrates. and 15% glycerol) and run on a 3– 8% Tris acetate-polyacrylamide gel (Invitrogen) for 1 h at 150 V under nondenaturing conditions. Cell Wall Analysis and Sensitivity Testing—Alcian blue binding was assayed essentially as described previously (27. Warrington. and lyophilized. Methylation Linkage Analysis—Methylation linkage analysis was performed on N-glycans isolated from the wild type and Caoch1 null mutant. 0. Plates were incubated at 30 °C for 16 h. All spectra were collected and processed using MassLynx software.1%). and the A620 of the supernatant was determined. UK) in 0. For TLC the samples were spotted and dried onto Silica Gel 60 TLC plates (Whatman). lyophilized.1% (w/v) SDS. Cell walls were prepared by a method modified from de Groot et al.9 kV and 40 V using a Micromass Q-ToF2 orthogonal quadrupole-time of flight mass spectrometer (Micromass.8. 1% (v/v) Triton X-100.8. pH 6. and tunicamycin (100 g/ml).85 MBq of 3 1 D-[2. and the A600 was determined. The N-glycans were further desalted by gel filtration on a Bio-Gel P2 column (25 1.8. Cambridge.8 with 1 M NaOH.5 MPa. PerkinElmer Life Sciences) for 16 h at 30 °C. resuspended in 50 mM Tris-HCl. The concentrations listed are the maximum concentration tested for each agent. SDS was removed by precipitation with potassium acetate (final concentration 20 mM) overnight on ice. 50 mM Tris-HCl.5 mM sodium acetate were loaded into nanospray tips (Micromass type F) for ES-MS and ES-MS/MS. Manchester. NaCl2 (1 M). Cells from a stationary phase culture (100 ml) were washed three times in 50 mM Tris-HCl. UK).1% Tween 20 and 5% bovine serum albumin for 2 h at room temperature. and Triton X-100 was removed by extensive extraction with toluene (52). eluted fully in water. pH 6. Alcian blue concentration was calculated by reference to a standard curve. pH 7. the plates were sprayed with En3Hance (PerkinElmer Life Sciences) and visualized by autofluorography (Kodak BioMax XLS). For endoglycosidase H (Endo H) treatment. Standardized inocula were prepared from 24-h YEPD cultures.5 cm) and eluted with water at 12 ml h 1.Och1p Required for Outer Chain N-Glycosylation and Virulence growing in 2 ml of SC GlcNAc were incubated with 1.1 M citrate/KOH buffer.5 ml of 0.5 mM Tris-HCl. Fractions were collected and glycans detected by spotting onto Silica Gel 60 TLC plates and staining with orcinol. and disrupted by three passes through a French press at 15. resuspended in 250 l of 1% (w/v) SDS.5 ml of AG-50-H over 1 ml AG-4 OH . Protein extracts were prepared in 100 mM Tris-HCl. Cell wall material was pelleted. The cell walls were washed three times with water. hygromycin B (500 g/ml). Cells were incubated in Alcian blue at room temperature for 10 min and then spun down.l volume across a range of doubling dilutions. pH 6.

Virulence Tests—Female. Kidneys and brain were removed aseptically postmortem. Groups of five or six mice were intravenously inoculated and monitored over 28 days.l volume. cerevisiae contains ScHoc1p that displays homology to ScOch1p. demonstrating clumping of cells in the Caoch1 null mutant and in the TET-OCH1 strain under repressing conditions.8% identity to ScHoc1p. Reduced Mannosyltransferase Activity toward N-Linked Core Glycan in the Caoch1 Mutant—In S. Completion of the C. and the second allele was regulated by promoter replacement. The challenge inoculum concentration was confirmed by the determination of cellular ATP content. Colonies were photographed before (B) and after (C) agar plates were washed. The remaining mannosyltransferase activity suggests that other mannosyltransferases can act on the complex Man8GlcNAc2 acceptor structure in vitro. Growth and Morphology of the Caoch1 Null Mutant—The Caoch1 null mutant had a specific growth rate of 75% of the wild type control in YEPD at 30 and 37 °C. Scale bars 1 mm. followed by an 18-amino acid membrane region before the catalytic domain. In the resulting strain.8 104 cfu/g mouse body weight in a 100. colony morphology and agar invasion after 5 days of growth at 30 °C on YEPD agar plates. 2).4% identify to ScHoc1p. albicans genome-sequencing project confirmed the CaOCH1 open reading frame (GenBankTM accession number AY064420. The null mutant also failed to induce filamentous growth on solid Spider medium (data not shown). The Caoch1 null mutant colonies invaded the agar surface more than the wild type (Fig. The 1. We carried out in vitro mannosyltransferase activity assays on mixed membrane preparations of the Caoch1 null mutant and the TET-OCH1 strain under inducing and repressing conditions utilizing Man8GlcNAc2 as the acceptor (Table 2). Mice showing signs of illness were humanely terminated. The CaOCH1 open reading frame was also placed under the control of a tetracyclineregulatable promoter in the THE1 strain that expresses the tetracycline transactivator (45). A multiple sequence alignment (ClustalW) also supports the direct sequence comparisons with the C. albicans and S. and resuspended in physiological saline to give a challenge inoculum of 1. The degree of overall sequence identity confirms that CaOch1p reported here is the true homolog of ScOch1p. the strain is referred to as TET-OCH1 ON and in repressing conditions. Mice surviving the course of the experiment were humanely terminated on day 28. the Caoch1 null mutant responded normally to the presence of 20% (v/v) serum. hemocytometer counting. The resulting Caoch1 null mutant had URA3 introduced into the neutral RSP1 locus to avoid problems with the level of URA3 expression (43. through the addition of doxycycline. in Lee’s medium or RPMI 1640. The CaOCH1 open reading frame of 1158 bp is predicted to encode a 385-amino acid type II membrane protein with a 17-amino acid cytosolic tail. immunocompentent BALB/c mice (Harlan Sera-Lab Ltd. Scale bars 10 m.7391) and identified a CaHOC1 homolog (orf19. CaOch1p displays 37. expression of CaOCH1 was repressed by the addition of doxycycline to the medium. 1C). In all cases the growth defects were restored to wild type in the re-integrant strain and the tetracyclineregulated strain displayed the same phenotype as the Caoch1 null mutant after growth in repressing conditions. The mutant also displayed a temperature-sensitive defect with a failure to grow at 42 °C (Fig. UK) were challenged intravenously with yeasts grown for 18 –24 h in NGY medium at 30 °C. TET-OCH1. and tissue burdens determined by viable counting. cellular aggregates were dispersed. 44). B and C. The mannan polymerase II complex in S. It also displays a classic DXD motif (residues 165–214) known to be required for binding the donor nucleotide sugar. orf19. Growth was scored after 3 days on YEPD agar plates at the temperatures shown. The clumping of mutant cells resulted in a FIGURE 2. In response to the weaker hypha-inducing signal of pH and temperature shift. cerevisiae Och1p initiates outer chain elongation of N-linked core oligosaccharides. washed twice with water. 1B). whereas CaHoc1p displays 25% identity to ScOch1p but 41. The TET-OCH1 strain also displayed a significant drop in transferase activity when grown under repressing conditions (73% of wild type).5 ml of water. although germ tubes were shorter.. CaOCH1 was reintroduced into the null mutant under the control of its own promoter at the RPS1 locus as a re-integrant control. The mutant also displayed an altered cellular morphology with cells forming tight aggregates and the presence of swollen cells (Fig. The cells were collected. suggesting they were the result of a failure in cell separation. It also identified regions that were only present in either the Och1p or Hoc1p homologs. RESULTS Isolation and Deletion of CaOCH1—CaOCH1 was initially isolated by screening a cDNA library with PCR primers based on an unpublished sequence displaying homology to ScOCH1. homogenized in 0. JANUARY 6. Cell and colony morphology in the Caoch1 null mutant. Loughborough. cerevisiae Och1p homologs and the Hoc1p homologs clustering together (not shown). A. Under inducing conditions. and the invading cells were predominantly hyphal. change in colony morphology from the smooth white appearance of wild type to a highly crenulated appearance in the Caoch1 null mutant (Fig.Och1p Required for Outer Chain N-Glycosylation and Virulence MAPK antibody kit (New England Biolabs) was then used to develop Western blots according to the manufacturer’s instructions. the TET-OCH1 strain appeared to overexpress Och1p with detected mannosyltransferase activity rising 2-fold (207% of wild type). When growing exponentially under inducing conditions.5% identity to ScOch1p and 33. The Caoch1 null mutant had 59% of the wild type activity. After growth in medium containing chitinase. Temperature sensitivity of Caoch1 null mutant. as TET-OCH1 OFF. The first allele of CaOCH1 was disrupted in THE1. The CaOCH1 open reading frame was disrupted in strain CAI-4 by sequential gene replacement following the ura-blaster method (42). cell morphology after growth at 30 °C for 16 h in YEPD medium. and their deaths recorded as occurring the following day.6-mannosyltransferase activity of ScOch1p is novel in that it displays a tight substrate specificity requiring Man8GlcNAc2 for efficient acceptor recognition (36). 2006 • VOLUME 281 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 93 . and viable counting.3445). the null mutant generated mixed morphologies consisting of true hyphal and pseudohyphal forms (data not shown). In terms of hyphal development. indicating either a decrease in extension rate or a structural defect limiting cell extension. FIGURE 1. 1A).

the N-glycosylation defect was compared with that seen in the general glycosylation mutant Capmr1 . The in situ activity assay used a naphthyl derivative of GlcNAc as the substrate and the tetrazolium salt Fast Blue for visualization after the separation of protein extracts by native gel electrophoresis. Desalted N-linked glycans were permethylated and analyzed by ES-MS and gas chromatography-mass spectrometry methylation linkage analysis. Samples are as follows: lane 1. wild type. We therefore developed an in situ activity assay for the well characterized hydrolytic enzyme HexNAcase as an alternative marker for N-glycosylation status in C. encoded by CaHEX1. FIGURE 3. TET-OCH1 OFF. The extent of mannosylphosphorylation can be detected by the extent of binding of the cationic dye Alcian blue. with 16.8 7. lane 5. in in vitro assays. 2-O-substituted Man. These were further treated with alkaline phosphatase to render the glycans neutral by removing the 6-linked phosphate groups that remain after removal of phosphomannan. 2006 . N-Glycosylation defects in the Caoch1 null mutant. lane 3.3 1. in cellassociated assays. 3A). Additionally. These sites were partially resistant to Endo H cleavage when HexNAcase was in its native nondenatured form (55). FIGURE 4. no acid phosphatase activity was detected in zymograms of the Caoch1 null mutant. A. The Caoch1 null mutant and TET-OCH1 OFF strains had reduced Alcian blue binding.6% of wild type levels.8 11.5 1. Methylation analysis of the Caoch1 null mutant glycans (Table 3) showed an almost complete loss of 6-Osubstituted Man and 2. Samples are as follows: lane 1.4 2. However. The HexNAcase of the Caoch1 null mutant had an increased electrophoretic mobility. 6) were analyzed 94 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 1 • JANUARY 6.5 ND indicates not determined. 2-O-substituted Man and 3. lane 2.6-linked arm of the wild type N-glycan structures.6-di-O-substituted Man of the core glycan and occasional outer arm branch points (Fig. lane 2.6 0.2-linked mannose residues present in the Caoch1 null mutant and TET-OCH1 OFF strains (Fig. TET-OCH1 OFF. and in secreted fractions (data not shown).2-linked mannose residues attached via a phosphodiester linkage. Caoch1 OCH1 re-integrant control. TLC analysis of phosphomannan and O-mannan from the Caoch1 null mutant and control strains. B. The TET-OCH1 strain also showed a similar increase in the electrophoretic mobility of HexNAcase after growth under repressing conditions.8 1. The purified cell walls were then treated with peptide-N-glycosidase F to release the N-linked glycans. The structure of O-mannan was also assessed by TLC analysis and displayed no change resulting from the loss of CaOCH1 (Fig.5 0. It has seven potential N-glycosylation sites and has been demonstrated to be highly N-glycosylated (54 –56).6-di-O-substituted Man. Glycosylation Defects in the Caoch1 Null Mutant—Previously.Och1p Required for Outer Chain N-Glycosylation and Virulence TABLE 2 Mannosyltranferase activity and Alcian blue binding of Caoch1 null mutant and control strains Strain CaOCH1 Caoch1 Caoch1 OCH1 TET-OCH1 ON TET-OCH1 OFF a Mannosyltransferase activity nmol transferred/mg/min S. wild type. After Endo H treatment to remove N-glycans. This had greatly reduced levels of mannosylphosphate with only small amounts of Man3 and Man4 1. 3B). respectively (Table 2).1 5. Acid-labile phosphomannan glycans (A) and -eliminated O-glycans (B) were isolated from [2-3H]mannose-labeled cells. lane 4.D. The extent of N-glycosylation was determined by activity staining for -N-acetylhexosaminidase after protein samples were separated by nondenaturing electrophoresis. Caoch1 null mutant. 4B).1 NDa 20. The electrophoretic mobility of HexNAcase of the re-integrant control and TET-OCH1 strain grown under inducing conditions was similar to wild type. (57). 9. 5). 25. Samples were also treated with Endo H as indicated to remove N-glycans. the electrophoretic mobility of secreted acid phosphatase on native gels has been used as a maker of N-glycosylation status (13. wild type. Capmr1 null mutant. as well as the 3. The re-integrant control and TET-OCH1 ON had wild type levels of Alcian blue binding. The original doubly charged [M 2Na]2 ions that were deconvoled (Fig. The N-glycosylation defect in the Caoch1 null mutant was more severe than in the Capmr1 null mutant (27) that has a general glycosylation defect (Fig. The acid-labile phosphomannan fraction was also directly resolved by TLC analysis. The positions of the origin (OR) for TLC analysis and mannose oligomers (M1–M5. the HexNAcase migrated faster through the gel as two distinct bands. However.6-di-O-substituted Man and a significant decrease in nonreducing terminal Man residues. lane 5. re-integrant control. Caoch1 null mutant. Analysis of N-Linked Glycans—Cell walls were treated with SDS/ mercaptoethanol followed by mild acid hydrolysis to remove noncovalently linked mannoproteins and phosphomannan. is induced after growth in medium containing GlcNAc as the sole carbon source. The material contained substantial amounts of nonreducing terminal Man.1 43. This result is consistent with the loss of the 1.8 0.2-linked Man. Caoch1 OCH1 re-integrant control. 6-O-substituted Man. indicating that CaOCH1 acts at an early step in N-glycan outer chain elaboration. respectively. lane 3. only low levels of acid phosphatase activity were detected for the Caoch1 null mutant.8 44. 6). 4A).1 0. The wild type. lane 2. indicating an N-glycosylation defect (Fig. The methylation analysis suggests these additional hexoses were in the form of 1. lane 3. ES-MS analysis revealed that they were larger than the conventional core ranging from Hex11HexNAc2 to Hex16HexNAc2 (Fig. and TET-OCH1 ON had a normal phosphomannan structure. and visualized by autofluorography. separated by TLC. The outer chain N-glycans contain the majority of the acid-labile phosphomannan fraction consisting of 1.6-di-O-substituted Man. 27). Alcian blue binding g bound/A600 1 cells S.1 46. TET-OCH1 ON.7 and 24. and 2. HexNAcase. albicans. samples are as follows: lane 1.6 5. Methylation analysis of the Caoch1 null mutant glycans was consistent with the residual N-linked glycans being based on the conventional Man8GlcNAc2 core glycan because they contained almost exclusively terminal Man. lane 4. mannose to pentamannose) are indicated. The methylation analysis of the wild type glycans (Table 3) was in accord with the detailed analysis of Shibata et al.D. Caoch1 null mutant. It has been reported previously that HexNAcase contains three N-glycosylation sites that receive only the mature core N-glycan and lack outer chain elongation. TET-OCH1 ON.1 7.

flucytosine. presumably because of their extreme size.6-Tetra-O-methyl-1.7 10. NaCl. and Cell Integrity Pathway Activation—Total cell wall carbohydrate composition was analyzed by Dionex HPAE-PAD. ES-MS analysis of the Caoch1 null mutant permethylated glycans. An additional band was also detected only in the Caoch1 null mutant and TET-OCH1 strain under repressing conditions. A similar sensitivity profile was seen with the TET-OCH1 strain when the initial inoculum was pre-grown under repressing conditions.3. Sensitivity. the strains were also treated with Calcofluor White.6-Di-O-substituted Man 3. The chitin/glucan/mannan ratio was 1. Attenuation of Virulence in Caoch1 —The effect of the loss of CaOCH1 on virulence was assessed in a mouse model of systemic infection. 7). Mice infected with the wild type.2H mannitol 2.5-tri-O-acetyl-1.4-Di-O-methyl-1.6. The Caoch1 null mutant was significantly attenuated in virulence with a mean survival time of 22 days.4 4. This band migrated at 49 kDa and most likely corresponds to the phosphorylated form of CaCek1p. and the product ion spectra confirmed that these contained a GlcNAc2 core and were of the triantennary oligomannose type (data not shown). The figure shows the masses (M 2Na) of glycan disodium adducts after deconvolution of the spectrum using the MassLynx maximum entropy 3 algorithm.Och1p Required for Outer Chain N-Glycosylation and Virulence TABLE 3 Gas chromatography-mass spectrometry methylation linkage analysis of wild-type and Caoch1 mutant N-glycans PMAA derivative 2. 5). compared with 6 days for the wild type control (Fig.5. 63). 7) and slightly more resistant to vanadate (data not shown). 2006 • VOLUME 281 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 95 . p 0. There was no change in sensitivity toward other agents and stress such as caffeine. or KCl (data not shown). As a positive control.0 FIGURE 5.2H mannitol 3. amphotericin B. Therefore.5.6-tetra-O-acetyl-1. which is known to activate the pathway.6-tetra-O-acetly-1.0 22.0 Caoch1 4.0:59. but doubly charged [M 2Na]2 ions were recorded from Hex11HexNAc2 to Hex16HexNAc2 species for the null mutant. The increased sensitivity to cell wall perturbing agents and constitutive activation of the cell integrity pathway confirm a cell wall defect resulting from the loss of CaOCH1.4-Di-O-methyl-1. cerevisiae (62.8:88. such that significant tissue JANUARY 6. by ES-MS/MS.4. the host-fungal interaction is altered in the Caoch1 null mutant that lacks N-glycan outer chains. Therefore.tri-O-acetyl-1.0 for the Caoch1 null mutant. The re-integrant control was completely restored in virulence with a mean survival time of 7 days.2-linked Man residues can be attached to one or more antennae of the conventional Man8GlcNAc2 core (Fig. or caspofungin (data not shown).4. A similar role has been reported for Kss1p in S.8 trace 0. Antifungal susceptibility testing demonstrated no change in sensitivity to itraconazole. Mkc1p was activated in the Caoch1 null mutant and TET-OCH1 strain under repressing conditions but was not activated in the wild type and TET-OCH1 strain under inducing conditions (Fig. The Caoch1 null mutant was hypersensitive to the cell wall perturbing agents Calcofluor White and Congo Red and to SDS that would affect both cell wall proteins and the plasma membrane (Fig. we carried out Western blotting to test whether the protein kinase C cell integrity pathway was activated by using an antibody that recognizes the phosphorylated form of the MAPK Mkc1p. Cell Wall Composition. Mild acid-treated N-linked glycans from the wild type and Caoch1 null mutant strains were permethylated and analyzed by positive ion ES-MS.01).3.6 8. re-integrant control. 60). Model of N-linked glycans in wild type and Caoch1 null mutant.6 2. CaCek1p may act in an alternative cell integrity pathway activated by glycosylation defects. we tested the null mutant for sensitivity to a range of cell wall perturbing agents and other compounds associated with glycosylation defects.2H mannitol Origin Terminal mannose 2-O-Substituted Man 6-O-Substituted Man 2.5-di-O-acetyl-1. 9. characteristics that are common to N-glycosylation mutants in other fungi (59. Because the Caoch1 null mutant had a cell wall defect.2H mannitol 2.4 for the wild type control and 1. log rank test. The null mutant was also hypersensitive to hygromycin B and tunicamycin (Fig. 8).6-Tri-O-methyl-1. No ions were recorded for the wild type structures.3:10.6-Di-O-substituted Man Peak area ratio CaOCH1 14. The decrease in the proportion of mannan was reciprocated with a rise in both glucan and chitin.4-Tri-O-methyl-1.2H mannitol 3.5:39. or Caoch1 null mutant all had similar tissue burdens in both brain and kidney (Table 4).2. To determine the effect of the Caoch1 mutation on the integrity of the cell wall.3. Analysis of cross-ring cleavage ions (58) suggests that the additional 1. FIGURE 6.2 2.5.2. It has been shown recently that this phospho-specific antibody can recognize activated CaCek1p (61).

The Caoch1 null mutant had a clear defect in the addition of the N-glycan outer chain and correspondingly displayed a weakened cell wall.5 6. 2006 . The wild type (closed squares). Caoch1 null mutant.D. Therefore. However. phosphomannan has been shown not to be required for normal host-fungal interactions or virulence (32). suggesting that O-mannan may act as a ligand in the interaction with host surfaces (12. and Caoch1 OCH1 re-integrant (open triangles) strains were quantitatively tested for sensitivity to cell wall perturbing agents using the microdilution method. This would suggest that the glycosylation defect in Caoch1 resulted in acid phosphatase becoming partially insoluble with low activity. albicans cell wall and the interaction of these epitopes with the host. As expected. FIGURE 8.2 0. Sensitivity of Caoch1 null mutant to cell wall perturbing agents.3 9.6 6. Western analysis has demonstrated that both the Cek1p and Mkc1p MAPKs are constitutively activated in the null mutant. In crude cellular extracts. the null mutant cells also invaded the agar surface.0 4. hygromycin B. Both Cek1p and Mkc1p have been shown to be important in invasive growth. respectively (64. Mice (n 5 for wild type (closed squares).0 1. but it failed to migrate into the polyacrylamide gel. Error bars are means S. low activity was detected after native PAGE. which initiates outer chain elongation.Och1p Required for Outer Chain N-Glycosylation and Virulence FIGURE 7. signaling through nutrient limiting conditions or colonial growth and physical contact. and tunicamycin). it was clear that the null mutant was growing in chains of short pseudohyphae. As an alternative we developed an in-gel activity assay for HexNAcase. The remaining phosphomannan present in the null mutant.D. After chitinase treatment.5 1. TET-OCH1 ON. TABLE 4 Mean survival times and organ burden for BALB/c mice infected with Caoch1 null mutant and control strains Strain CaOCH1 Caoch1 Caoch1 OCH1 Mean survival days S. Most notably.1 burdens are generated but evidently cause less damage resulting in an increased survival time. Loss of CaOCH1 resulted in clear defects in N-glycosylation demonstrated by the increased mobility of HexNAcase and a reduction in phosphomannan.3 6. Previously we have measured the electrophoretic mobility of secreted acid phosphatase as a marker for changes in N-glycosylation. wild type. Equal loading was confirmed with Ponceau S staining and the intensity of nonspecific bands. lane 4. Activation of the cell wall integrity pathway through the loss of CaOCH1. Samples are as follows: lane 1. The addition of N-glycans is the major form of modification of mannoproteins. The carbohydrate structure consists of the Man8GlcNAc2 core that is extensively elaborated in the Golgi by the addition of the highly branched outer chain. lane 2. Previous stud- ies have demonstrated the overall importance of glycosylation to the cell wall structure and virulence (25–27). The null mutant also displayed a significant reduction in the in vitro mannosyltransferase activ- 96 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 1 • JANUARY 6. Activation of the cell integrity pathway was determined by Western blotting using the PhosphoPlus p44/42 MAPK antibody that detects CaMkc1p (59 kDa) in its phosphorylated form. The N-glycan outer chain was shown to be necessary for normal host-fungal interactions and virulence. FIGURE 9. This antibody also detects CaCek1p (49 kDa) in its phosphorylated form. 28 –31). Virulence was assayed in a mouse model of systemic infection. Caoch1 null mutant (open squares). SDS. n 6 for null mutant (open squares). Conversely. Brain burden log10 cfu/g S. lane 3. We have extended these studies by analyzing the importance of the N-glycan outer chain epitopes. TET-OCH1 OFF. low levels of Man3 and Man4.9 4. albicans homolog of OCH1. the strains were also treated with 100 g/ml Calcofluor White as indicated. and re-integrant (open triangles)) were infected intravenously with the strains at 1. This work demonstrates the importance of N-glycan outer chain epitopes in the host-fungal interaction and virulence. These aggregates could be dispersed by treatment with chitinase suggesting that they are the result of a cell separation defect. 14.8 104 cfu/g of body weight. DISCUSSION Here we describe the importance of outer chain elongation of N-glycans in the structure of the C.D. the constitutive activation of these pathways in the Caoch1 null mutant may explain why it so readily invades the agar surface under nonhyphal inducing conditions.6 0. Kidney burden log10 cfu/g S. and the invading cells were predominantly hyphal in morphology under conditions that normally support growth by budding. HexNAcase is exclusively N-glycosylated and is readily detected in nondenaturing polyacrylamide gels. it can be used as a more sensitive marker of N-glycosylation defects. Loss of O-mannan has been shown to result in reduced adherence and the attenuation of virulence. Therefore. could be attached to the N-linked core structure or potentially O-mannan.0 1. The agents to which the Caoch1 null mutant displays hypersensitivity are shown (Calcofluor White. These aggregates of short pseudohyphae resulted in the formation of a crenulated colony morphology.5 5. the O-mannan in the Caoch1 null had a normal structure. This was achieved by disrupting the C. Protein extracts were prepared from cells in mid-exponential phase.1 2.D. Congo Red.0 1. and only low levels of cell-associated or secreted activity were seen. we were not able to detect acid phosphatase in soluble protein extracts of the Caoch1 null mutant. 65). The Caoch1 null mutant had slightly reduced growth rate and formed cellular aggregates. 6 22 7 2. Attenuation of virulence in the Caoch1 null mutant. and as a positive control for activation of the cell integrity pathway.

C. C.. J. and NIAID Mycoses Study Group (2003) Clin.. A. albicans. B. C. 8. C. a homolog of CaCek1p. (2000) Rev. Bailliere-Tindall Ltd. 5). consistent with the current structural model for the outer chain (57) (Fig.. Brown. Wild type N-glycans had no ions detectable by ES-MS because of their extreme size. Commensurate with the cell wall sensitivity phenotype. with elaborations from Man11GlcNAc2 to Man16GlcNAc2. Micol. Acta 1426. C. The Caoch1 null mutant had a weakened cell wall.and anti-inflammatory response components is known to be important for a number of fungal pathogens. Sandven. 634 – 643 2. 5. 239 –257 16. Pappas. the outer chain has also been reported to contain some branched side chains (57). M. Powderly. However. Dis. Singh. (1999) Biochim. American Society for Microbiology. A. N. B. R. K. A. Additionally. (1999) Biochim. Burda.. (2002) in Candida and Candidiasis (Calderone. 55–58 7. C. CaOCH1 functions in initiating outer chain elongation in C.. Westwater. and Gow. we also showed constitutive activation of the cell wall integrity pathway by assessing the phosphorylation status of Mkc1p.6-di-O-substituted mannose linkages in the N-glycan core were used to determine the stoichiometry of the various linkage groups in the outer chain. A. and invasive growth pathways and has been suggested to act as a separate pathway in vegetative cells responding to changes in protein glycosylation and acting as a further cell wall integrity pathway (62. the proportions of linkages in the wild type N-glycans may be a minimum estimate of the extent of outer chain elongation. F.. Biophys. activity toward this acceptor was not completely abolished in the null mutant. R. The Caoch1 null mutant had significantly attenuated virulence in the mouse model of systemic infection. Hube. Westwater. C.. F. although it was not activated in response to Calcofluor White. C. Therefore. L. A. Lee. Indeed. 420 – 431 14. 2006 • VOLUME 281 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 97 . and Lehle. Atrih. Med. D.. The two unique 3. Washington. R. However. J. L. M. 35. J. D. 7670 –7675 13. high burdens were tolerated by the host. Microbiol. 37.. (1993) Trends Microbiol.6-di-Osubstituted mannose. Mannosylphosphate is also added to the N-glycan core.) pp. 6. A. C. A. W. E. which would suggest that heterogeneity exists in the core N-glycan structures. Rex. Herrero. A.. Natl. Sci. 67– 86.) pp. Uccelletti. S.. Kauffman. P. H. S. 2nd Ed. Hirschberg. Bost. and Kagaya. A. heterologously expressed CaMnt1p has been shown to display activity toward a Man5GlcNAc core-like structure in vitro (66). Washington... In S. M.6-di-O-substituted mannose. and Gow. D... S. 275–285 JANUARY 6. Finding that Cek1p is constitutively active in the Caoch1 null mutant suggests a similar pathway may exist in C. Buurman... was also found to be activated constitutively in the Scoch1 null mutant and was shown to increase the expression of the 1.. pheromone response.. 87–99 12. 280. (1988) Candida and Candidosis. although in this case the resulting charged product would not be detected in the assay. Wang. Odds. J. A. 2-O-substituted mannose residues were not reduced to the level expected for a simple Man8GlcNAc2 core. D. In any case it is clear that outer chain N-glycans play vital roles in the interaction between C. Hence. P. (2002) in Candida and Candidiasis (Calderone.. background activity toward the Man8GlcNAc2 core in the Caoch1 null mutant is not unexpected. F. E. Acad.. Mangino. Hughes. tissue burdens in the kidney and brain were still found to be high in animals infected with the null mutant. Biol. One possibility is that the null mutant was able to colonize the affected tissues but could not express factors needed for invasive growth. Bain. J. and Kruppa. P. Y.. P. E. A. B. Y. Brown. Calderone.6-di-O-substituted mannose. where a strong pro-inflammatory response results in tissue damage and disease progression.. R. R.. Munro. D.. D. K. although in vivo it specifically acts in the extension of O-linked glycans (14).... A. Calderone. (ed) (2002) Candida and Candidiasis. Larsen. T.3glucan synthase Fks2p (62). Acta 1426.. J. 223–242. 6-O-substituted. P.. REFERENCES 1. 11. However. Jean Marie Francois and Blanca Aguilar¸ Uscanga (Institut National des Sciences Appliquees de Toulouse) for their help ´ with the cell wall composition analysis. U. Indeed.. P. and Gow. and Abeijon.. M. 73– 81 4. Biophys.) pp. It was also noticed that Cek1p is also activated constitutively in the null mutant. H. (1998) Proc. However.2-linked mannose residues added to one or more of the antenna residues of the core (Fig. M. Romani. A. (1997) J. and 2. M. 159 –175.. The migration pattern of HexNAcase from the null mutant is also fairly diffuse.. 461– 469 9. Odds. Acta 1426. An alternative hypothesis is that the immune response is tolerant of the Caoch1 null mutant. Hamill. suggesting that the nature of the host-fungal interaction is altered. C. A. T. 17. This confirms the absence of the outer chain glycan in the Caoch1 null mutant. W.. The presence of these modifications is in accord with the mannosyltransferase activity detected toward the Man8GlcNAc2 core in the null mutant. Washington.. in in vitro assays of activity many mannosyltransferases display low substrate specificity. Brand. Moser. 4. This required components from the high osmolarity glycerol. E. Hamilton. E. and Aebi. Therefore. However. J. C. (2005) J. E. This indicates that the null mutant has no defect in targeting and colonizing the organs normally associated with disease progression. Hyslop.. (2002) in Candida and Candidiasis (Calderone. (1998) Infect. Knauer. 63). and Domer.. Methylation linkage analysis of the N-glycans purified from the Caoch1 null mutant demonstrated an almost complete loss of 6-Osubstituted and 2. 95. cerevisiae Kss1p. and these structures would also contribute to the level to 3.. Bates. (2002) Eukaryotic Cell 1. Fukazawa. Li. Calderone. H. Li.. Thomson. Acknowledgments—We thank Dr. Biophys. S. the changes to the cell surface. C. A. R. G. even when no symptoms of disease were seen. These further modifications to the core in the Caoch1 null mutant appear to consist of chains of 1. Chauhan. 1384 –1391 10. 66. Purified N-glycans from the wild type and Caoch1 null mutant were analyzed by methylation linkage analysis and ES-MS.. R. R. Dismukes. may alter the recognition of the invading organism by cells of the innate immune system and result in a shift of the host reaction away from Th2 toward a Th1 response. Ferguson. N. G. It is not yet clear whether such modifications to the core also occur in wild type N-glycans or are the result of the lack of normal acceptor substrates for mannosyltransferases in the absence of the outer chain. N. Chem.. R. London 3. (1999) Biochim. Horowitz. Odds.. 1. as demonstrated by its hypersensitivity to a range of cell wall perturbing agents and other agents whose action is indicative of glycosylation defects. This is in contrast to the situation in S. Bertram. Iberoam. Chapman. S. The balance of pro.. A. D. MacCallum. A. Buurman. 259 –273 17. 1051–1060 15. Immun. The Man8GlcNAc2 core is a complex structure and could be modified in vivo by additions to the terminal antennae of the core by other mannosyltransferases. A. Methylation linkage analysis revealed substantial amounts of terminal mannose and 2-O-substituted.. S. Consistent with the loss of the outer chain. American Society for Microbiology.. (2002) Cell.Och1p Required for Outer Chain N-Glycosylation and Virulence ity toward the Man8GlcNAc2 core structure. N. albicans and the host during invasion and pathogenesis. there was a reduction in the proportion of terminal and 2-O-substituted mannose residues. Mycol. American Society for Microbiology. W. In the case of the Caoch1 null mutant. A. Washington. Sundstrom. L. cerevisiae where N-glycans of the Scoch1 null mutant consist of only Man8 –10GlcNAc2 (35). Edwards. Vet. B. C. Calderone. the core appears to undergo further modification in the Caoch1 null mutant.. A. J.. J. albicans that responds to severe glycosylation defects.. A. resulting from the lack of N-glycan outer chain epitopes. 5). Dominguez. Low levels of phosphomannan may also contribute to this heterogeneity. N.. R. Infect. R. American Society for Microbiology. Herscovics.. L.

and Ernst.. and Poulain. H... 2639 –2646 40. C. A. 416. G.. Acad.. and Suzuki. F. Oliver. J.. E. C. Sci. Y. C. A. Natl. 5732–5739 48. 102.. N. K. 41– 45 35.. Atrih. Fiuza... Microbiol. Thomas. S. E. 65–70 47.. and Ernst. T. Hobson. Eisman. IRL Press at Oxford University Press. G. Brown. Reinhold. 1297–1306 50. 148 –153 41. C.. C... A. and Kopetzki.. 55. and Cannon.. S. C. L.. V. Natl. Orlean. A. (1994) J. 182. and Ferguson. Yoshimatsu. M. (2005) J. T. Niimi. Okawa.. Schroppel. N.. M. Hughes. U. Tanaka. Lee. Stevenson. Chem.... H. U. Chem. Arai. (2001) FEBS Lett. Immun.. A. Murad.. R. B. Davidson. Meloche. Lee. A. Gomez. 2737–2749 62. Horecka. Hellingwerf. H. Satoh. T. F. 865– 871 53. Miyauchi. D. Schroppel. S. 1543–1553 56... (1997) FEMS Microbiol.. Y. B.. Prill.. Enloe. 270. S.. (2003) Proc.. A. T. Y. Kokado. Jigami. Zhang. (1992) EMBO J.. Schaller. S. E. (1992) in Lipid Modification of Proteins: A Practical Approach (Hooper. (1994) Science 266. J. Chem.. Shepherd.. 279. M. P. 547–550 37. 36. Schroppel. Chem... Natl. A. and Suzuki. S. R. Kaigorodov. S. Cannon. Richardson.. Dallies. J. (1975) Sabouraudia 13. G. Imai. K. D.. A. 464 – 472 57. Suzuki. A. 88.. A.... Suzuki.. Nombela. M... and Sprague. M.. 275. Acad.. 4100 – 4110 24.. 412. and Gow. 309 –322 19. Kobayashi. A. B. P. R.. T.. Rella. Haselbeck. D. Bobrowicz. MacCallum. 66. Immun. R. (1998) Yeast 14.. J. Wilson. Heinsbroek. 29 – 42 26. J. Vecchiarelli. H.. Arisawa. R... 191–203. 1723–1726 42. Hisamichi. 92. Tarentino. (2002) J. 717–728 43. Y. 60.. Suzuki. C... Y. Munro. Y.. Prescott. Tanaka. Y. I. J. (1992) Infect.. Satoh. Nagasu. 223–227 20... Aoki. Jr. Kawamata. 955–965 51. Haga. Gale. F. C. 280.. Leberer. T.. W. (2000) Yeast 16. (2000) Infect. J. Whitton. G.Och1p Required for Outer Chain N-Glycosylation and Virulence 18. Trinel.. A. Nakanishi-Shindo. Prill. L. N. Short. Lee. 2006 . A. (1997) FEBS Lett.. B. S. Chem. Kobayashi. H. Watanabe.. M.. and Pla. Liu. T. 26338 –26345 36. Gow. C.. and Campbell. M.. Kobayashi.. 235–242 22. (2005) J. M. Environ.. Warit. N. Geysens. 146 –158 49. Tsukahara. Hata-Sugi. Biol. (1997) Arch. Sci.. (2003) Fungal Genet. 498. I. A. 168. A.. R. Timpel. H. B. C. 12679 –12684 63. Kohler.. S. S. (1994) Microbiology 140. Jigami. 11.. Sci. M..... Fonzi. and Aoki. de Jong. K... U.. and Gow. H..... Lewis. D. E.. M. S.. M. Biol. Francois. and Stateva. A. A. R. S. D. C. Nett. 39628 –39635 33. Timpel.. U. M. Odds. J. R. D. E.. A. (1991) Proc. R. Bertram. N.. Najima.. (2004) Eukaryotic Cell 3. 3063–3071 30.. Strecker. H. S. C. K. and Mitchell. Niimi. Suzuki. M. and Gerngross. Chem. T.. Y.. M. Toda.. R.. C. Shibata... C. Brown.. C. de Groot. 96. Bates. 5576 –5581 66. Kobayashi. H. J. Miele. 1772–1784 59. (2004) J. Jr. M. G. Jenkinson. Timpel. Bacteriol. J. N.. (2005) Microbiology 151. M. F. L. and Contreras. N. F. C... Y. K. A. Osaka. and Jigami. K.) pp. Nakayama. Mio. and Paquet. S. Shibata. S. D. Y. Natl. J. Strahl-Bolsinger. J. M.. B. A. Kojima. R. A. A. Chem. Biol. Walmsley. 100.. F. L. G. M. N. T. A.. N. Munro. and Odds. M. Biol. and Jigami. A... and Okawa. 3209 –3212 61. N. Microbiol. (1995) J.. K. K. Shibata. A. 546 –560 31. S. H. (2005) Proc. Biol. 273. L. M. U.. Thomson.... Cullen. Dekker. P. T. M. Buurman.. A.. N. C. Y. S.. (2005) Infect. C. Dean. G. 70. Bacteriol. Vervecken. Tanaka. (1998) J. Ziegelbauer. and Shepherd. K. S.. Nagasu.... Y.. Y.. Hughes. K. Munro. B.. 73. M. (2000) J. Lett. (2004) Appl. Y. K. B. Kobayashi. W. Poster. Brand. A. Harcus. H. A. Selvaggini. and Turner. Brown... J. (1999) Proc. C. Hamilton. R. D. J. M.. H. 75– 80 38. T. Corbucci. (2005) Mol. and Elion. C. A. (1987) J.. (1985) Biochemistry 24. Ballou.. Y. Nakayama.... Mohamed. J. B. J.. A. (1995) Anal. J. B. (1995) FEBS Lett. Kikuchi. (2000) Genetics 155. M. H. J. (1995) Proc. Buckley. N. and Ernst. 268. Nakayama.. Chem. 1156 –1166 27. Nakayama. D. S. K.. Kung. Shimma. Odds.. (1992) Phytochemistry 31. Biol.. M. S. Lehnert.. Jouault. R. R. M.. 40. E. (2000) Yeast 16. Rouabhia... F. K.. P. C. H.. 4665– 4671 52. (1993) Genetics 134.. A. Davis. Biol. U. S. Cunningham. K. J. Nishikawa. Cannon. F. Sullivan. Y. Kumamoto. 152... J. P. Lehle.. Schultz. K. R... (1994) FEBS Lett. 167–171 23. Acad. Immun. Sci. 1147–1153 21. V. 6712– 6719 46.. G. Li. (2000) Mol. and Whiteway. T. H. W.. Haga-Toda... S.. Choi. Shibata. Reinhold. B. J. Cutler. Navarro-Garcia. Acta 1426. A. A. S. and Shepherd. Y. A. N. A.. Eiden. S. (2000) J. De Vusser. 900 –909 45. Shibata. Lepage.. Klinkert. R. C. S. Hitzeman. and Jigami. Arisawa. 203–206 25. Kuromitsu. D.. Bates. M. M. de Boer. 1113–1122 58. Microbiol. P. and Suzuki. and Klis.. Bacteriol. A.. and Brown. Sci. 2713–2721 65.. 262. Yamazaki. and Dean. Molloy. Broadbent.. T. and Gow. Y. T. N. G. and Costello... (1999) Biochim. Wildt.. L. N. O.. Ferguson. 67.. MacCallum. K. Giasson. (1997) FEBS Lett.. (1998) Infect. Biol. P. L. Takahata. H. J. and Gow. 184. K.. Y. Miyagawa. J. Microbiol. Ikuta. K. Natl. 370. 2511–2519 34.. L. E. Biophys. D. MacCallum. and Jigami. S. and Ballou.. Y.. D.. and Fink.. (2001) FEBS Lett. Dean. 280. V.. S.. K. Immun. 489. Ohkubo. 1287–1291 60.. Bates. Y. J. G. F. 68. P.. Kiuchi.. C. A. Acad. de Koster. Csank. K. S. K.. Chem. N. S. N. N. S. Satoh. Niimi. Yoko-o. G... Biol. E.. E. S.. 18933–18938 98 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 1 • JANUARY 6. 325–327 44.. 2640 –2647 55. Zink. Munro.. M.. 20837–20846 29. Acad. 5022–5027 39.. (1993) J. W. and Suzuki. Oxford 54. D. 176. and Irwin. C... A. B.. and Plummer. 345. F. A.. (2004) Eukaryotic Cell 3. N...... 4571– 4580 32. R. 1005–1018 64. P. and Ernst. 23408 –23415 28. N. J. A. A. L. Nagahashi. S. Nakanishi-Shindo. Barelle. Strahl-Bolsinger. D. Callewaert. M.