You are on page 1of 309

Populationsgenetik der ersten Bauern Mitteleuropas

Eine aDNA-Studie an neolithischem Skelettmaterial

Inauguraldissertation
zur Erlangung des Akademischen Grades
eines Dr. phil.

vorgelegt dem Fachbereich 02
Sozialwissenschaften, Medien und Sport
der Johannes Gutenberg Universität
Mainz
von

Wolfgang Haak
aus Künzelsau
2006

Tag des Prüfungskolloquiums: 18. April 2006

Inhaltverzeichnis

1. Einleitung

1

2. Grundlagen zur Archäologie der Neolithisierung

3

2.2 Modelle zur Neolithisierung Europas

3

2.3 Das frühe Neolithikum in Mitteleuropa
2.3.1 Der Star4evo-Körös-Cri8-Komplex
2.3.2 Die Linearbandkeramik (LBK)

7
9
11

2.4 Zur Anthropologie des Neolithikums

14

3. Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

18

3.1 Die Neolithisierung aus Sicht der Humangenetik
3.1.1 Forschungsgeschichtlicher Hintergrund
3.1.2 Das wave-of-advance-Modell von Ammerman und Cavalli-Sforza
3.1.3 Der Einsatz von klassischen genetischen Markern
3.1.4 Kritik am wave-of-advance-Modell

18
18
18
19
22

3.2 Forschungsstand molekulargenetischer Studien
3.2.1 Mitochondriale Variabilität in Europa
3.2.2 Besiedlungsgeschichte Europas anhand von mtDNA und Y Chromosom

25
25
26

3.3 Die Haplogruppenverteilung im modernen maternalen Genpool unter besonderer
Berücksichtigung Europas

34

3.4 Methodische Grenzen populationsgenetischer Studien und Einsatzmöglichkeiten von aDNAAnalysen
42
3.5 Übersicht zu bisherigen paläogenetischen Studien
3.5.1 Stammesgeschichte sowie Vor- und Frühgeschichte des Menschen
3.5.2 Identifikation, Material- und Spurenkunde
3.5.3 Verwandtschafts- und Geschlechtsbestimmung
3.5.4 Epidemiologie, Pathologien und andere genetische Marker
3.5.5 Phylogenie und Phylogeographie
3.5.6 Rekonstruktion von Ökologie und Ernährungsgewohnheiten
3.5.7 Domestikation von Tieren und Pflanzen

44
45
46
47
47
48
49
49

3.6 Eigenschaften alter DNA
3.6.1 Grundlagen zur chemischen und physikalischen Mutagenese in vivo
3.6.1.1 Endogene chemische Mutationsmuster
3.6.1.2 Chemische Mutagene
3.6.1.3 Physikalische Prozesse
3.6.2 Postmortale Degradierung von DNA
3.6.3 Die Authentizitätskriterien der aDNA-Forschung

51
51
51
53
54
54
57

3.7 Verwendete genetische Marker
3.7.1 Eigenschaften der mtDNA und ihre Eignung als populationsgenetischer Marker
3.7.1.1 Die Struktur der mitochondrialen DNA
3.7.1.2 Die maternale Vererbung und das Fehlen von Rekombination
3.7.1.3 Homoplasmie
3.7.1.4 Die Mutationsrate
3.7.1.5 Die molekulare Uhr
3.7.2 Short tandem repeats (STRs)

59
59
59
59
60
61
62
63

4. Fragestellung und Zielsetzung der Arbeit

65

5. Material und Methoden

66

5.1 Fundorte und Proben
5.1.1 Fundorte in Deutschland

66
66

Inhaltverzeichnis
5.1.2 Fundorte in den Niederlanden
5.1.3 Fundorte in Österreich
5.1.4 Fundorte in Ungarn
5.1.5 Fundorte in Litauen
5.1.6 Fundorte in Polen
5.1.7 Fundorte in Russland
5.2 Methoden
5.2.1 Maßnahmen zur Kontaminationsvermeidung
5.2.2 Probennahme und Probenvorbereitung
5.2.3 DNA-Extraktion
5.2.3.1 Isolation von DNA aus Knochen und Zähnen
5.2.3.2 Isolation von DNA aus Mundschleimhaut
5.2.4 Die Polymerase-Ketten-Reaktion (PCR)
5.2.4.1 Das Prinzip der Polymerase-Ketten-Reaktion
5.2.4.2 Primerdesign
5.2.4.3 Amplifikation mitochondrialer DNA
5.2.4.3.1 Amplifikation der Hypervariablen Region I (HVR I)
5.2.4.3.2 Verwendung von Uracil-N-Glykosylase
5.2.4.3.3 Amplifikation von Bereichen der coding region
5.2.4.4 Amplifikation nukleärer DNA
5.2.4.4.1 Amplifikation von STRs mittels AmpFlSTR Profiler PlusTM
5.2.4.4.2 Amplifikation von STRs mittels Multiplex-PCR zur molekularen
Geschlechtsbestimmung und Verwandtschaftsanalyse.
5.2.5 Aufreinigung der PCR-Produkte
5.2.6 Agarose Gelelektrophorese
5.2.7 Klonierung
5.2.7.1 Prinzip der Klonierung
5.2.7.2 Protokoll der Klonierung
5.2.7.2.1 Vorbereitende Schritte
5.2.7.2.2 Ligation und Ligationsfällung
5.2.7.2.3 Transformation/Elektroporation und Ausplattieren
5.2.7.2.4 Vervielfältigung der Klone
5.2.8 DNA-Sequenzierung
5.2.9 Fällung von Sequenzierprodukten
5.2.10 Die Kapillar-Elektrophorese
5.2.11 Enzymverdau der PCR-Produkte der coding region

72
72
73
73
74
74
78
78
80
81
81
82
83
83
83
84
84
86
86
87
87
89
90
91
92
92
93
93
94
95
95
97
98
98
99

5.3 Auswertung
5.3.1 Definition und Berechnung der post mortem Substitutionsrate
5.3.2 Definition und Berechung der Sättigungsrate
5.3.3 Definition und Berechnung deaminierender hot spot- bzw. cold spot-Positionen
5.3.4 Netzwerke
5.3.5 Populationsgenetische Simulation mit dem Programm Simcoal 2.0

100
100
101
102
103
104

5.4 Authentifizierung

106

6. Ergebnisse

113

6.1 Probenerhaltung und Amplifikationserfolg
6.1.1 Amplifikationserfolg
6.1.2 Kontamination der Kontrollen
6.1.3 Untersuchungen zur Diagenese mittels SAXS-Analyse

113
113
116
118

6.2 Untersuchte genetische Marker
6.2.1 Mitochondriale DNA
6.2.1.1 Hypervariable Region I (HVR I)
6.2.1.2 Amplifikation und RFLP-Analyse von Abschnitten der coding region
6.2.1.3 Amplifikation langer PCR-Produkte
6.2.2 Nukleäre DNA

119
119
119
121
122
123

Inhaltverzeichnis
6.2.2.1 Short tandem repeat (STR) Genotypisierung mittels AmpFlSTR® Profiler Plus®
6.2.2.2 Short tandem repeat (STR) Genotypisierung mittels „Anthrofiler 2004“
6.2.2.3 Vergleich zwischen morphologischer und genetischer Geschlechtsbestimmung

123
127
129

6.3 Quantifizierung und Charakterisierung der postmortalen Sequenzveränderungen
6.3.1 Allgemeine post mortem Substitutionsrate
6.3.2 Sättigungsrate
6.3.3 Charakterisierung und Verteilung postmortaler Sequenzveränderungen

130
130
132
134

6.4 Vergleichende Analysen der Haplogruppenverteilung

139

6.5 Netzwerke

143

6.6 Populationsgenetische Simulation mit Hilfe des Programmes Simcoal 2.0

148

7. Diskussion

149

7.1. Methodendiskussion
7.1.1 Amplifikationserfolg
7.1.2 SAXS-Analyse
7.1.3 Verwendung von UNG
7.1.4 Kontaminationen, Kontaminationsraten und Kontaminationsvermeidung
7.1.5 Amplifikation langer mtDNA Fragmente und nukleärer DNA (ncDNA)
7.1.6 Reproduktionsstrategien zur Validierung und Authentifizierung
7.1.7 Zur post mortem Substitutionsrate und Sättigungsrate
7.1.8 Charakterisierung und Verteilung postmortaler Sequenzveränderungen

149
149
150
151
153
155
157
158
160

7.2 Die Authentizität der Proben in der Gesamtanalyse

166

7.3 Zur Populationsgenetik der ersten Bauern im frühen Neolithikum
7.3.1 Die phylogenetische und phylogeographische Auflösung der mtDNA
7.3.2 Die Haplogruppen der neolithischen Individuen

181
181
181

7.4 Die Neolithisierung Europas im Spiegel der mtDNA-Haplogruppen
7.4.1 Die Bedeutung der Ergebnisse für die Rezentgenetik
7.4.2 Die Bedeutung der Ergebnisse für die Archäologie und Anthropologie

190
196
198

8. Zusammenfassung

200

9. Literatur

202

10. Anhang

230

10.1 Zusätzliche Tabellen

230

10.2 Verwendete Puffer und Lösungen

240

10.3 Verwendete Geräte, Chemikalien und Kits
10.3.1 Geräte
10.3.2 Chemikalien
10.3.3 Enzyme
10.3.4 Kits
10.3.5 Gefäße, Einwegartikel und Schutzkleidung

240
240
241
242
242
243

10.4 Abkürzungsverzeichnis

244

10.5 Alignments der Sequenzen der neolithischen Individuen

245

Einleitung

1. Einleitung
Die Jungsteinzeit stellt eine der bedeutendsten Epochen der Menschheitsgeschichte dar.
Besonders in Eurasien ist dieser Zeitraum vom Übergang der aneignenden zur
produzierenden Lebensweise, der so genannten Neolithischen Transition, geprägt.
Der Beginn der bäuerlichen Lebensweise im eurasischen Raum erfolgte vor ca. 12 000 Jahren
in der Region des so genannten Fruchtbaren Halbmonds im Nahen Osten, eines zu
damaliger Zeit naturräumlich begünstigten Gebiets. Von dort aus verbreitete sich die neue
Lebensweise in den nachfolgenden Jahrtausenden in die umliegenden Regionen und
gelangte schließlich auf verschiedenen Wegen in das nacheiszeitliche Europa. Die
archäologische Forschung über die Neolithisierung Mitteleuropas beschäftigt sich seit langer
Zeit mit der Fragestellung, ob der Wandel, welcher in den materiellen Hinterlassenschaften
dokumentiert ist, auch einen Bevölkerungswechsel widerspiegelt. Erfolgte die Verbreitung
der neolithischen Lebensweise im Sinne einer wie auch immer gearteten Kolonisierung der
Nutzflächen durch die ersten Bauern oder wurde die Idee zu Ackerbau- und Viehhaltung
von ursprünglich jagenden und sammelnden Gesellschaften nach und nach übernommen?
Die Untersuchung der genaueren Umstände dieser so bemerkenswerten Umstellung der
Lebensweise, deren Bedeutung in der Beschreibung „Neolithische Revolution“ (Childe 1957)
Ausdruck finden sollte, ist seit jeher ein Forschungsschwerpunkt sowohl in der Vor- und
Frühgeschichte, der Anthropologie als auch zunehmend in der Genetik. In den vergangenen
Jahrzehnten wurde vermehrt mit Hilfe molekulargenetischer Methoden versucht, den
populationsgenetischen Hintergrund der Neolithischen Transition aus der heutigen
Datenlage zu rekonstruieren. Hierbei stellt die enorme populationsgenetische Dynamik des
eurasischen und vornehmlich europäischen Raumes, welche auch geschichtlich belegt ist, ein
großes Problem dar, da hierdurch der Blick in die Vergangenheit in nicht unerheblichem
Maße verschleiert wird.
Die Analyse alter DNA (aDNA) bietet sich als ideale Methode an, sich mit den zentralen
Fragestellungen der Neolithisierung Europas zu beschäftigen. Sie ermöglicht die direkte
Analyse neolithischen Probenmaterials und damit eine Art molekulargenetischer Zeitreise,
die sich den tatsächlichen neolithischen Verhältnissen zuwendet. Mit Hilfe der aDNAAnalysen können nicht nur die populationsgenetischen Fragestellungen bezüglich der
Dynamik menschlicher Besiedlungsprozesse erforscht, sondern auch die Prozesse der
Domestikation und Verbreitung von ersten Haustieren und Nutzpflanzen genauer
beleuchtet werden.
Der Ansatz mittels aDNA-Analysen bestehende Fragestellungen der Neolithikumsforschung
zu beantworten, wurde erstmalig mit dem Projekt „Die ersten Bauern in Europa und der
Ursprung der Rinder- und Milchwirtschaft. Biomolekulare Archäometrie des Neolithikums“
(gefördert vom Bundesministerium für Bildung und Forschung, Förderkennzeichen
03BUX1MZ) verfolgt.

1

und Populationsgenetik. 2 .Einleitung In der vorliegenden Dissertation werden neolithische menschliche Skelettproben vornehmlich aus Mitteleuropa mit molekulargenetischen Methoden untersucht. Ein Vergleich mit rezenten populationsgenetischen Daten soll die Bevölkerungsdynamiken in Europa vor.und Frühgeschichte. Der fächerübergreifende Ansatz verknüpft insbesondere Disziplinen wie die Vor. Molekular. während und nach dem Übergang zur bäuerlichen Lebensweise ermitteln und deren Einflüsse sowie Auswirkungen auf die heutige Bevölkerungsstruktur beschreiben. biologische Anthropologie. Die große Bedeutung der verbindenden Fragestellung macht im vorliegenden Projekt eine interdisziplinäre Herangehensweise an das Thema erforderlich.

gr. dem östlichen Baltikum und 3 . wie dauerhafte Sesshaftigkeit. Vere Gordon Childe (1957) prägte den Begriff „Neolithische Revolution“ und wollte damit den immensen kulturellen Schritt betonen. Eines von mehreren Zentren des Übergangs von Jägern und Sammlern zu Ackerbauern und Viehzüchtern ist der so genannte Fruchtbare Halbmond.und Viehhaltung und Entwicklung komplexer sozialer Verbände (bis hin zu den frühen städtischen Hochkulturen) wuchs die menschliche Bevölkerung im Vergleich zum Ende der Eiszeit bis heute auf ein mittlerweile Tausendfaches an. und sollen danach schrittweise und teilweise stark zeitversetzt in andere Regionen der Erde verbreitet worden sein. dem Auftauchen von neuen Steinwerkzeugformen im archäologischen Fundgut gerecht zu werden. Jordanien und Palästina. so dass dieser heute im Vordergrund steht.Grundlagen zur Archäologie der Neolithisierung 2. Schaf.2 Modelle zur Neolithisierung Europas Der Schritt von einer aneignenden Jäger. Ackerbau und Viehzucht sind die wesentlichen kulturellen Neuerungen der so genannten „Neolithischen Revolution“. dem Verlauf des Taurus und Zagros Gebirges folgend. Die Anzeichen von Domestikation und Landwirtschaft in archäologischen Fundzusammenhängen finden sich dort im 9. wie wir ihn heute kennen. Stein). Neu. Syrien und Irak bis fast zum Persischen Golf erstreckt. Vielmehr wurde versucht. Zunächst jedoch stand bei der Epochenbeschreibung und Begriffsbildung zum Neolithikum dieser Schritt gar nicht im Vordergrund. Mesolithikum zur Sesshaftigkeit und Agrikultur im Neolithikum ist ein sehr entscheidendes Ereignis der Menschheitsgeschichte. gr. den er im Übergang von der aneignenden zur produzierenden Wirtschaftsweise erkannte und welchen er im Vergleich mit der Industriellen Revolution bestätigt sah. lithos. welcher letztendlich zur Herausbildung und Prägung unserer heutigen Gesellschaften mit allen sozialen und wirtschaftlichen Konsequenzen geführt hat. dem Nordwesten Russlands.und Sammlergesellschaft im Epipaläolithikum bzw. durch Südost-Anatolien. Hier sollen nach archäologischen Vorstellungen Weizen und Gerste kultiviert und die Domestikation von Ziege. mit Ackerbau und Viehzucht unabdingbar verbunden. Durch den kontinuierlichen Eingriff des Menschen in die Selektion von wilden Tieren und Pflanzen entstanden domestizierte Formen. ein Gebiet. Erst nach und nach wurde der Prozess der Neolithisierung. In Folge von Ackerbau und Viehzucht und den damit verbundenen zivilisatorischen Erscheinungen. Jahrtausend v. das sich von der südlichen Levante. die in vielen Fällen die ursprünglichen Wildformen verdrängten und überlebten.B. die auch in genetischer Sicht zu einer Reihe von für den Menschen und seine Umwelt bedeutenden Effekten geführt hat. Lager. Schwein und Rind zum ersten Mal stattgefunden haben. Nach dem Ende der letzten Eiszeit vollzog sich in weiten Teilen Europas dieser als „Neolithische Revolution“ bekannte Prozess. Chr. Der jüngste Abschnitt der Steinzeit wurde demzufolge nach dem Neuauftreten von geschliffenem Felsgestein benannt (neo. Grundlagen zur Archäologie der Neolithisierung 2. In einigen Gebieten wie z.

2. Kind 1998). Clark 1965). 4 . Dies bedeutet.1): 1.immer Moden und zeitgeistliche Einflüsse eine Rolle. Antanaitis 1999). dass beide Szenarien eine Rolle spielten. Birgt bereits die Transition im Vorderen Orient eine beträchtliche Anzahl an zu klärenden Fragen hinsichtlich des Überganges selbst und seiner Faktoren bzw. sowie regional dominierende Schulen und fast dogmenhafte Lehrmeinungen. Als zugrunde liegender Motor dieses Prozesses wurde ein rasches Bevölkerungswachstum angesehen.Grundlagen zur Archäologie der Neolithisierung nördlicheren Skandinavien setzt die bäuerliche Lebensweise erst zur Eisenzeit ein (Zvelebil 1998. Somit kann der Prozess der Neolithisierung . Einer Einwanderung von Trägern der neolithischen Kultur wird keine ausschlaggebende Rolle beigemessen bzw. Whittle 1996. Zilhão 1997). jedoch zu unterschiedlichen Zeiten in unterschiedlichen Regionen einen variierenden Beitrag zur Neolithischen Transition leisteten (Zvelebil 1989. dass es (auch forschungsgeschichtlich bedingt) kaum zusammenfassende oder ganzheitliche Erklärungsansätze zur Neolithisierung Europas gibt. Sogar die politische Gesinnung der Verfechter der einzelnen Hypothesen kann im Spiegel der Wissenschaftsgeschichte sichtbar gemacht werden (ein detaillierter Überblick hierzu findet sich in Scharl 2004). in welcher der Übergang zu Ackerbau und Viehzucht in erster Linie durch Ideentransfer in kulturellen Kontaktzonen erklärt wird. Der dritte Erklärungsansatz stellt eine Synthese der beiden oben genannten Modelle dar. welches der frühbäuerlichen Gesellschaften zugesprochen wurde und somit die Verdrängung der einheimischen Bevölkerung beinhaltete und erklärte. welche kaum mehr hinterfragt werden. Zvelebil & Lillie 2000. Barker 1985. So spielen bei Fragestellungen wie dieser . Die Divergenz der Hypothesen ist größtenteils bedingt durch die zeitweilig subjektiv geführte Interpretation der Datenlage. 3. Ein zweites Erklärungsmodell benennt die gegenteilige Situation (Dennell 1983. Selbst bezüglich der Neolithisierung des mitteleuropäischen Raumes existieren zahlreiche Erklärungsmodelle.mit ca. gänzlich ausgeschlossen. Von Seiten der Archäologie bestehen bezüglich der Art und Weise der Verbreitung von Ackerbau und Viehzucht nach und in Europa drei grundlegende Erklärungsmodelle (vgl. 2002. 3. 100jähriger Forschungstradition . Der traditionellen Meinung nach basiert der Prozess der Neolithisierung Europas auf der Einwanderung von neolithischen Bauern nach Europa (Childe 1957. Piggott 1965. Demnach besiedelten neolithischen Bauern aus dem Nahen Osten geeignete Gebiete in Europa und führten die bäuerliche Lebensweise ein. Chapman 1994. Als Tatsache bleibt bestehen. so ist vor allen das vollständige Erfassen und Verstehen des Wie der Verbreitung der Idee „Ackerbau und Viehzucht“ in und über Europa ein größeres Unterfangen. Kap. Gründe.in einem kontinentalen Kontext betrachtet – als lang andauernd betrachtet werden. 2002. Thorpe 1996.

naturräumlich optimale Gebiete (z. die einen Großteil des Kontinents betreffen. die jedoch die autochthone Bevölkerung sozial und kulturell dominiert und ggf. dass für die unterschiedlichen Regionen verschiedene Hypothesen zur Neolithisierung existieren. 3.2): Sukzessive ungerichtete Besiedlung einer Region durch nachfolgende Generationen. Anthony & Brown 1991): Direkter Zug einer Bevölkerung zu einem definierten Gebiet. Streng genommen lassen sich aus archäologischer Sicht keine Beweise für eine Einwanderungswelle größeren Ausmaßes bzw. vgl. Andel & Runnels 1995): Selektive Kolonisierung durch kleine Bevölkerungsgruppen. Demic diffusion (Ammerman & Cavalli-Sforza 1984. Lößböden) aufsuchen und somit Enklaven oder Kolonien innerhalb der autochthonen Bevölkerung bilden. Allerdings finden sich im archäologischen Fundgut Beweise und Assoziationen für die Einführung von Ackerbau & Viehzucht an bestimmten Zeitpunkten. die spezifische ökonomische und gesellschaftliche Nischen besetzen. die gezielt bestimmte. Renfrew 1987. Kap.1. ist es nicht verwunderlich. der sich nicht auf wenige Faktoren vereinfachen lässt. darlegen (Thomas 1996. ist unumstritten. wie auch überall in der Welt. einen komplexen und vielschichtigen Entwicklungsprozess darstellt. Leap frog colonization (Zilhão 1993. Pinhasi et al. kontrolliert. die innerhalb Europas einen deutlich erkennbaren chronologischen Gradienten von Südwest.B. Contact: Wirtschaftliche Kontakte entlang und durch Handelsrouten. Ammerman & Cavalli-Sforza 1984. die als Kommunikationskanäle dienen und innovative Technologien rasch verbreiten ohne sich verlagernd auf die Bevölkerungsstruktur auszuwirken. Infiltration (Neustupny 1982): Graduelle Unterwanderung eines Gebiets durch kleine spezialisierte Gruppen. Wanderungsbewegungen. Zvelebil & Lillie 2000): Folk migration (Anthony 1990. Da die archäologische Erfassung meist kleinräumig erfolgt und dabei bereits im archäologischen Material ersichtlichen Verbreitungsgebieten von Fundkomplexen folgt. Diese sind in mehreren nachfolgenden Modellen zusammengefasst (Zvelebil 2000. Zvelebil 1989). Ein großes Problem stellt die Tatsache 5 . Elite dominance (Renfrew 1987): Unterwanderung eines Gebiets durch eine Minderheit. 2000). die als kulturelle Einheiten zusammengefasst werden (Price 2000). 1996): Kleinräumige wirtschaftliche Kontakte und etablierte soziale Beziehungsstrukturen zwischen Bauern und Jäger/Sammlern und den Kontaktzonen mit Transfer in beiden Richtungen. Individual frontier mobility (Zvelebil 1995.nach Nordosteuropa aufweisen (Clark 1965.Grundlagen zur Archäologie der Neolithisierung Dass die Neolithische Transition in Europa.

Grundlagen zur Archäologie der Neolithisierung dar. Das scheinbar übergangslose und schnelle Einsetzen der bäuerlichen Lebensweise in Südost. Zvelebil 1998. dass sich Migration als Prozess nicht im archäologischen Material ablesen lässt (Renfrew 1987). 6 . Zvelebil sieht jedoch in Mittel. Prinzipiell ist in den überwiegenden Teilen Europas eine kulturelle Kontinuität im Fundkomplex der meso-neolithischen Transition festzustellen. Daher ist grundsätzlich die Deutung von verwandtem Fundgut über größere Distanzen als Resultat von Handelsbeziehungen oder aber von Migration kritisch zu sehen.und Wirtschaftweise und einen damit assoziierten Bevölkerungswechsel unwahrscheinlich macht (Bogucki 1988.und nachfolgend in Mitteleuropa wirft Fragen auf. für die in der Archäologie nur eine Kolonisierung jedweder Art als Erklärung herangezogen wird.und Südosteuropa Beweise für einen Abbruch der mesolithischen Tradition und ein abruptes Einsetzen einer neuen neolithischen Sachkultur. 2002. der einen abrupten Wechsel der Lebens. das er sich nur mit einer der denkbaren Formen der Kolonisierung erklären kann. Price 2000).

eingehender dargestellt. dass Ackerbau und Viehzucht als Paket neolithischer Prägung vom Nahen Osten über den Balkan nach Mitteleuropa gelangt seien. In den nachfolgenden Kapiteln wird auf die archäologischen Kulturen. die Linearbandkeramik (LBK). balkanischen archäologischen Kulturen Star4evo und Körös (benannt nach den jeweils ersten charakteristischen Fundstätten in Star4evo in Serbien/Montenegro bzw. dort aber aufgrund des Erreichens der Nordgrenze der mediterranen Klimazone zunächst stagnierte. wobei die Ausbreitung bis ins Karpatenbecken und die ungarische Tiefebene schnell erfolgte.osteuropäischer archäologischer Forschungsmeinung wird angenommen. In dem darauf folgenden Zeitraum von ca. Scharl 2004).und hier in erster Linie . aufgrund vergleichbarer keramischer Besonderheiten in der Tradition der frühen südosteuropäischen bzw. die für die Inlandsroute der Neolithischen Transition eine bedeutende Rolle spielten und mit welchen die Mehrzahl der untersuchten neolithischen Skelettindividuen der vorliegenden Arbeit assoziiert sind. 7 . Dieser hypothetische Verbreitungsweg wird dadurch gestützt.3 Das frühe Neolithikum in Mitteleuropa Derzeit besteht in der Archäologie neben dem allgemein akzeptierten Ursprung im Nahen Osten auch der Konsens über mindestens zwei Verbreitungswege der Landwirtschaft nach Europa. Zum einen wird der mediterrane Weg in Richtung Westen entlang der Mittelmeerküste postuliert. Gronenborn 1999. welche gleichermaßen die Initialzündung für die Verbreitung der bandkeramischen Kultur darstellte (Kalicz & Makkay 1977. 500 Jahren erfolgte nach Meinung ungarischer Archäologen die Anpassung der Wirtschaftsweise an das mitteleuropäische Klima. dass die frühneolithische mitteleuropäische Kultur. Parallel hierzu sind der binneneuropäische „Landweg“ (Lüning 2000) über den Balkan und dessen Tiefebenen von besonderer Bedeutung. Diese Route beinhaltet sowohl die Mittelmeerinseln als auch Nordafrika. Gemäß traditioneller .Grundlagen zur Archäologie der Neolithisierung 2. entlang des Flusses Körös in Ungarn) zu stehen scheint (Abbildung 1 und Abbildung 2).

Die postglaziale Entwicklung des Klimas ist anhand des variierenden Sauerstoffisotopenverhältnisses (W18O) des grönländischen GRIP-Eisbohrkerns dargestellt.Grundlagen zur Archäologie der Neolithisierung Abbildung 1. Die Verbreitung frühbäuerlicher Kulturen und die möglichen Verbreitungswege der Landwirtschaft in Europa und im Nahen Osten (nach Gronenborn 2005). 8 .

die in Ostungarn lokalisiert war und deren rumänisches Pendant.3. dass sie alle als regionale Entwicklung der Protostar4evo-Stufe gelten. Dieser umfasste die regionale frühneolithische Star4evo-Kultur. Nach 6000 v. die in Südwestungarn und Serbien verbreitet war.1 Der Star0evo-Körös-Cri3-Komplex Auf die Beziehung der frühen mitteleuropäischen LBK zu südosteuropäischen Kulturen wurde bereits hingewiesen. -stilen beschrieben. Die Beziehungen der einzelnen Kulturen untereinander sowie deren chronologische Entstehung ist noch unklar. so dass sich diese drei regionalen Entwicklungen heute typologisch unterscheiden lassen (Abbildung 2). die in der Ausprägung des Star4evo-Körös-Cri8-Komplex mündete.Grundlagen zur Archäologie der Neolithisierung 2. rot-monochromer Keramik) charakterisiert ist. Scharl 2004). die Cri8Kultur (Gronenborn 1999. Chr. Einflüsse aus dem transdanubischen Raum wurden 1960 von Quitta anhand von charakteristischen Gefäßformen bzw. es lässt sich jedoch konstatieren. Entstehung und Verbreitung der frühneolithischen Kulturen im Karpatenbecken und angrenzenden Gebieten (modifiziert nach Gronenborn 1999). die Körös-Kultur. erste Neolithisierungswelle. welche hauptsächlich in der Stufe A durch Keramikfunde (Weiße Verzierungen auf rotem Grund bzw. Diese ist vor 6000 v. Abbildung 2. 9 . Das frühe Neolithikum in Südosteuropa war im Wesentlichen durch den archäologischen Fundkomplex Star4evo-Körös-Cri8 charakterisiert. noch überregional einheitlich und verkörpert die Nord-Süd-gerichtete. setzte eine Differenzierung des Keramik-Stils ein. Chr.

die sich auf die unterschiedlichen Naturräume zurückführen ließen. abgesehen von einigen präkeramischen Funden in Griechenland. 10 . Als Wirtschaftsgrundlage wurde sowohl die Haltung von Schafen. die auf eine Siedlungskontinuität hindeuteten (Preuss 1998. Viehzucht und Feldbau vorherrschend waren (Bökönyi 1989). Einkorn. die hinsichtlich der weiteren Neolithisierung des geografisch sowie zeitlich angrenzenden westlichen Bereichs der Linearbandkeramik als auslösendes Element bezeichnet werden kann. das präkeramische Neolithikum nicht nachgewiesen. Weizen sowie Linsen und Erbsen nachgewiesen (Kalicz 1990).und der Körös-Kultur nachgewiesen werden. die von zahlreichen Seen. So überwogen in der ungarischen Tiefebene. Demnach stellt die neolithische Wirtschaftsweise für den Raum des Karpatenbeckens eine unbekannte Erneuerung. In der Körös-Kultur konnten oft nur kurze Belegzeiten der Siedlungen nachgewiesen werden. Neben der Keramik konnten auch in den Subsistenzmustern Unterschiede zwischen der Star4evo. Rindern und Schweinen als auch die Kultivierung von Emmer. Zum einen bot die wasserreiche Ebene ein großes Angebot an Wild und Fisch. so dass über die Transition nur gemutmaßt werden kann. dass in beiden Gebieten auch die Jagd als Ergänzungsfaktor noch nicht in den Hintergrund getreten war. die in hügeligem Gebiet lokalisiert ist. Dagegen war im Verbreitungsgebiet der Körös-Kultur eine wesentlich höhere Siedlungsdichte feststellbar. Fluss. während in der Star4evo-Kultur. dass die Durchsetzung der landwirtschaftlichen Lebensweise im frühen Neolithikum durch die geografische Lage im Karpatenbecken unter ökologischen Gesichtpunkten unter klimatisch günstigen Einflüssen stand.und Cri8-Kulturen waren im kleineren Gebiet der Körös-Kultur mit leicht zu bearbeitenden Ackerflächen und einem dichten Wassernetz mehrere Faktoren vereint. Pavúk 1994). Gronenborn 1999). im Siedlungswesen. Somit kann erst mit dem Auftreten des Star4evo-Körös-Cri8-Komplexes Ackerbau und Viehzucht auch für den transdanubischen Raum angenommen werden (Preuß 1998. Es muss dabei betont werden. ob sich die neue Wirtschaftweise durch Migration oder durch Prozesse der Akkulturation durchsetzen konnte. ermöglichte eine effiziente Viehhaltung (vor allem im Hinblick auf die Rinderwirtschaft) und bot optimale Bedingungen für den Pflanzenbau. wohingegen bei (allerdings wenigen) Star4evo-Siedlungsplätzen mehrere Schichten zu finden waren. da sie zeitlich in ein Klimaoptimum des Atlantikums fiel (Preuss 1998). Ziegen. Weitere Unterschiede zwischen den beiden Kulturen fanden sich bei den Siedlungen bzw. Leider liegen für selbiges Gebiet nur sehr wenige mesolithische Befunde vor.und Bachläufen geprägt ist. noch der Fischfang die Jagd auf Wild. die auf häufige Siedlungsverlegungen bzw. die die nachhaltige Etablierung und Weiterentwicklung der neolithischen Lebensweise begünstigten. eine nur temporäre Sesshaftigkeit hinwiesen. wobei der Schwerpunkt auf der Viehzucht lag. Für das Gebiet Südosteuropa ist. Im Vergleich mit den größeren Gebieten Star4evo. Möglicherweise kann aus diesen Gründen besonders der in der Phase der regionalen Differenzierung prosperierenden Körös-Kultur im Rahmen des umfassenden Star4evo-Körös-Cri8-Komplexes eine besondere Rolle zugeordnet werden. Dieser Umstand ließ sich durch die günstigen ökologischen Verhältnisse des Flachlandes erklären.Grundlagen zur Archäologie der Neolithisierung Auch für das Karpatenbecken stellt sich die grundsätzliche Frage. Es wird allgemein angenommen.

führte dazu. Wellenbändern. Im zeitlichen Verlauf der Kulturstufe bildeten sich regionale Differenzierungen. Chr. in Kerngebieten begann (Transdanubien) und sich bis 5000 v. wenig bearbeitete Klingen finden. vom Pariser Becken bis in die Donauebene erstreckte (Zimmermann 2002a. dass in einem so großen Verbreitungsraum ähnliche Keramik vorherrscht. Die Zahl und Anordnung dieser Ösen (Dreizahl) ist für die Bandkeramik charakteristisch und findet sich nicht in vergleichbaren früh.bzw. Die Klingen fanden daher wohl Anwendung in sogenannten Kompositsicheln. Als Gefäßformen sind einfache Kalottenschale.2 Die Linearbandkeramik (LBK) Die Einführung der Landwirtschaft in Mitteleuropa ist mit der bandkeramischen Kultur zu verbinden. Die charakteristische Keramik zeigt als Grundmotive lineare Muster aus Spiralen. Der so genannte Schuhleistenkeil. Hierbei lassen sich zwei Tendenzen feststellen: zum einen das Herausheben der Bandmuster durch unterschiedliche Füllformen und zum anderen die Zunahme der Stichgegenüber der Ritzverzierungen (Sangmeister 1983). kugeliger Topf und bauchige Flasche mit Trichterhals bekannt. die mit Feuersteinklingen versehen wurden. Gronenborn 1999. Mäandern und Winkelbändern. Chr. Die 11 . sogenannte Lokalstile heraus. also die Hersteller und Nutzer der Keramik. die teilweise sehr stark sind. Ein weiterer Indikator für eine produzierende Wirtschaftsweise findet sich in den Feuersteingeräten. zitiert in Gronenborn 2005). also Sicheln aus Holz oder Knochen. das geschliffene Felsgestein.3. mit linearen Bändern verzierten Keramikgefäße benannt (Klopffleisch 1884) und wird daher in der Literatur meist als Linearbandkeramik oder auch Linienbandkeramik (engl. Fundmaterial aus dem gesamten Mitteleuropa unterstreicht die großräumige Reichweite und den bedeutenden Stellenwert dieser Kultur zur Zeit ihrer größten Ausdehnung. Linear Pottery Culture) bezeichnet. Hier fällt auf. Scharl 2004). Die unverzierte. Bedeutend ist hierbei weniger die Keramik selbst. mittelneolithischen Keramikgattungen. Der Fundbestand an Felsgesteingeräten wird durch Gegenstände wie Mahlsteine. Hervorzuheben sind hier als Vorrats-. Zwar besitzen diese keine für die Linearbandkeramik besondere Form oder Verzierung als Unterscheidungsmerkmale von anderen Kulturen. gröbere Keramik zeigt ebenfalls überregionale Ähnlichkeit. welche teilweise durch Schnittstiche ergänzt sein können. konnte bislang bei keiner älteren neolithischen Kultur gefunden werden. 2000b. dass man von einer kulturellen Einheit ausging und somit die Träger der Kultur. oder Kochtöpfe gedeutete Gefäße. das aller Voraussicht nach in variierenden Formaten zur spezialisierten Holzbearbeitung diente. jedoch sind hier besonders die Mahlsteine als Anzeiger für eine bäuerliche Lebensweise der Bandkeramiker herauszustellen. die sich nicht weiter typisieren lassen. wo eine Vierzahl üblich ist. Lüning 2000. besitzt in der Linearbandkeramik einen charakteristischen Vertreter. Reiber und Schleifplatten erweitert. Die Tatsache. welche 5500 v. Diese Kulturstufe wurde nach ihrer typischen. ein asymmetrisches Steinbeil. als Bandkeramiker bezeichnete (Klopffleisch 1884. als ihre großflächige Verbreitung. Auffällig an diesen Klingen ist eine bestimmte glänzende Oberfläche.Grundlagen zur Archäologie der Neolithisierung 2. die vermutlich an Schnüren aufgehängt wurden. ohne die überregionale Vergleichbarkeit zu verlieren. Das bereits erwähnte begriffsdefinierende Element des Neolithikums. zeitgleichen Jäger/Sammler-Kulturen lediglich einfache. dass sich im Vergleich zum gut dokumentierten (weil hier fast als einziges erhaltenen) Silexgeräteinventar der früheren bzw.

wobei eine bevorzugte Gefäßform nicht festzustellen ist. sowie mehrzeiliger Gerste. Beweise für Ackerbau als Wirtschaftsweise treten gelegentlich auch als Primärindizien in den Siedlungsgruben auf. vor allem Samenkörner der Weizenarten Einkorn und Emmer. Sangmeister 1983) durchgeführt worden zu sein. die vermutlich nicht tragend waren. Gräberfelder überraschend gering. Im Gegensatz zur Anzahl gefundener Siedlungen ist die Anzahl gefundener Gräber bzw.B. 8m Breite und 30m Länge. wobei auch hier eher integrierende Gesamtmerkmale festgehalten werden können. Zahlreiche Gruben unterschiedlicher Tiefe sind auf Siedlungsflächen neben und zwischen den Häusern vorhanden. Auffällig in Gräbern ist die Beigabe von Rötel und Schmuck aus Spondylusmuscheln. wo auch die Wände und ein Viertel der Längsseiten durch Spaltbohlen oder dichter gesetzte Pfosten verstärkt waren. Wahrscheinlich wurde das Getreide gedroschen und vor der Einlagerung geröstet (zumindest für Böhmen können gebrannte Lehmplatten als Röstplätze gedeutet werden) (Sangmeister 1983). Neben den Großbauten sind wenige kleinere Bauten belegt. wohingegen Gräber mit spätbandkeramischen Beigaben im Lokalstil bislang eher selten sind.Grundlagen zur Archäologie der Neolithisierung Ursache des Oberflächenglanzes konnte in Experimenten bestätigt werden. Zudem findet sich unter diesen ein großer Überhang an frühbandkeramischen Gräbern. Die Ausrichtung erfolgte immer nach Nordwesten. die bei Bearbeitung starker siliziumhaltiger Gräser entsteht. die Wände bestanden aus locker gestellten dünneren Pfosten. finden sich als weitere Nutzpflanzen Erbsen. Zweifellos lassen sich hierbei in Anwesenheit von Mahlsteinen Hinweise auf Getreidebau erkennen. eine Silex-Werkstätte in Arnsbach. Neben den Getreidesorten. Das Dach wurde von drei Ständerreihen getragen. hier vor allem Schuhleistenkeile. Teilweise sind diese auf den Wandverputz an Ort und Stelle zurückzuführen. so kann zumindest von einer fortgeschrittenen Sesshaftwerdung im Zuge des Hausbaus gesprochen werden (Sangmeister 1983). Eine geschlechterspezifische Beigabensitte ließ sich bislang nur bedingt erkennen. Die Bestattung erfolgte in Hockerlage und als Beigaben finden sich die charakteristischen bandkeramischen Gegenstände. Besonders Hausbau und Siedlungswesen sind in der Bandkeramik sehr gut untersucht. deren Nutzung unklar ist. dass sich diese Bestattungsweise und Beigabensitte als die gesamte Bandkeramik umfassendes Merkmal darstellt. Nordhessen. die vermutlich vermischt angebaut wurden. heute sind aus allen Bereichen des bandkeramischen Verbreitungsgebietes vergleichbare Hausgrundrisse bekannt. Der Grundtyp des Hauses war ein großer Bau von ca. Zusammenfassend lässt sich jedoch auch hier feststellen. wobei eine Oberflächenänderung des Silex beobachtet wurde. Bereits 1934 wurden von W. 12 . Sollten diese Klingen jedoch nur zum Schnitt von Schilf als Dachdeckmaterial gedient haben. die Proportionen jedoch immer gleich blieben. So finden sich verkohlte Pflanzenreste. Buttler die Grundrisse von Rechteckhäusern gefunden (zitiert nach Sangmeister 1983). Lein und Mohn. Linsen. wobei die Dimensionen variierten. Keramik tritt weniger häufig auf als in späteren Epochen. in anderen regelmäßiger geformten Gruben wiederum scheinen gewisse Tätigkeiten (z. als regional begrenzte Merkmalskomplexe. Brandreste des Lehmbewurfs konnten den Unterbau aus Ruten und Flechtwerk bestätigen.

13 . Die Vorstellung. Darüber hinaus müssen auch besondere Schlachtgewohnheiten und Verwertungssitten in Betracht gezogen werden. Die Grubenfunde von Wildtieren sind ebenfalls sehr gering. Die Auswahl musste nach Merkmalen der Vegetation erfolgt sein und sollte den natürlichen Anforderungen für den Regenfeldbau entsprechen. wurde durch Beobachtungen von B. Gemessen an der Quantität der Haustierfunde scheint der Stellenwert der Viehzucht nicht hoch gewesen zu sein. Am ehesten kann für die frühe Linearbandkeramik daher von einer Mischwirtschaft ausgegangen werden. Die Gesamtsicht der bandkeramischen Befunde lässt ein bäuerliches Wirtschaftsystem erkennen. Fischerei als Ergänzung oder in Notzeiten erforderlich wurde. Schwein. die sich jedoch in der Funddichte und Form gänzlich von der mesolithischen Tradition unterscheiden. dass besagte Siedlungskammern bzw. Sielmann (1972) gestützt. Landschaften auch für die Viehzucht sehr geeignet schienen. welches bereits sowohl im Siedlungswesen als auch in der Regionen übergreifenden Gesellschaftsstruktur komplexe Züge annahm. Schaf und Ziege. Gleichermaßen kann man davon ausgehen. Nun stellt jedoch eben diese bereits vollständig herausgebildete Neolithisierung der Bandkeramik die Fragen nach ihren zeitlichen und räumlichen Ursprüngen auf. deren Knochen man in den Abfallgruben fand. so dass von der Jagd als bedeutendem Wirtschaftsfaktor kaum gesprochen werden kann. dass in der Linearbandkeramik der Getreideanbau eine größere Bedeutung als die Viehzucht gehabt habe. dass dieses funktionierende System eine rasche und große Verbreitung erlangte. dass die Verteilung der Siedlungsplätze vornehmlich nach der Beschaffenheit des Bodensubstrats. Daher verwundert es auch nicht.Grundlagen zur Archäologie der Neolithisierung Im Verhältnis zu den Indizien für den Ackerbau sind solche für die Viehzucht in weiten Gebieten der Linearbandkeramik eher gering. Gleiches gilt für den Stellenwert der Jagd. Sicher nachgewiesen ist die Haltung von Rind. Dieser konnte nachweisen. Zwar liegen hier genügend Pfeilspitzenfunde aus Gräbern und Siedlungen vor. die mit wechselnder Intensität Ackerbau und Viehzucht betrieb und Jagd bzw. welche archäologisch kaum nachgewiesen werden können. des Klimas und der Anbindung an das Gewässernetzes erfolgte. Allerdings spielen für diese Interpretation die generellen Erhaltungsbedingungen eine große Rolle.

Abgesehen von dieser Arbeit liegen für das für die vorliegende Arbeit interessanten Verbreitungsgebietes der Bandkeramik keine überregionalen Vergleichsarbeiten vor. Bach & Bach 1989). welche das bislang währende anthropologische Bild dieser Epoche erweitern können. so wurden zwar die wenigen zur Verfügung stehenden Funde methodisch penibel erfasst. der Typogenese. Es stehen.B. die Interpretationen und Schlussfolgerungen wurden aber trotz geringer Materialbasis weit gefasst. Die wenigen neolithischen Funde in bestehenden anthropologischen Studien waren weitgehend auf kleinräumige bzw. so sah beispielsweise Gerhardt (1978) auch nach dem grundlegenden Paradigmenwechsel der Anthropologie. Kritik an diesen weit reichenden Interpretationen bzw. welche in einer osteometrischen Vergleichsuntersuchung das Oberrheingebiet erfasste. die anthropologischen Bearbeitungen in den meisten Fällen noch aus (z.. Diese Ansicht wurde teilweise auch noch nach den beiden Weltkriegen von einigen Anthropologen vertreten. „dass die Träger der Bandkeramik anthropologisch keineswegs eine homogene Bevölkerungsgruppe darstellen. welche sich in einigen Fällen lange gehalten haben. Herxheim. Weiterhin kann festgehalten werden. Erst in den letzten 20 Jahren konnten vermehrt Fundplätze des Neolithikums und insbesondere der Bandkeramik ergraben und dokumentiert werden. Eine Ausnahme bildet eine aktuelle Studie von C. Schwetzingen. Dieser stellt in der einzigen überregionalen Aufarbeitung des damalig bekannten Materials fest. Aus heutiger Sicht lässt sich feststellen. zumindest für den deutschen Raum. Derenburg und Halberstadt) so dass zum gegenwärtigen Zeitpunkt keine aktuelleren Bearbeitungen einzelner Regionen vorliegen.4 Zur Anthropologie des Neolithikums Da die Anthropologie mit der Archäologie einen gemeinsamen Forschungsursprung besitzt. dass diese Arbeiten heute aufgrund ihrer oft zweifelhaften typologischen Herangehensweise nur noch von forschungsgeschichtlichem Interesse sein können. Als Datengrundlage wurden vier frühneolithische und drei mittelneolithische Gräberfelder 14 ..B. somatischanthropologischem Habitus“. dass Arbeiten wie die genannten die Ideologien und dem Paradigma des damaligen Zeitgeistes entsprachen. wurde von Beginn versucht.Grundlagen zur Archäologie der Neolithisierung 2. Bernhard (1978) angeführt. „. die sich aus der Meso-Neolithischen Transition ergeben. Meyer & Alt 2005). Meyer (2004. die Hauptaufgaben derselben in der Typologie und Typognose bzw. der Zuordnung eines Typus zu einer archäologischen Kultur wurde jedoch noch in derselben Publikationsreihe von W. der konstatiert. Vaihingen. sondern regional unterschiedliche morphologische Differenzierungstendenzen aufweisen“ (Bernhard 1978).dass diese bestimmten Kulturkreise wirklich getragen waren von wohlcharakterisierten Volksstämmen von bestimmtem. regionale Materialaufnahmen beschränkt (z. dass sich die archäologischen Kulturen auch im Skelettmaterial der jeweiligen Kulturen morphologisch-morphognostisch wieder finden und charakterisieren lassen. Bach 1978. Als Beispiel sei hier Schliz (1909) genannt. mit anthropologischen Ansätzen zu lösen. Die Anthropologie des Neolithikums war zu Beginn der Forschungsarbeiten noch von der Ansicht geprägt. die Fragestellungen. Ein grundsätzliches Problem stellte die geringe Funddichte dar.

wobei sie für die geringere Variabilität der Merkmale in Südosteuropa gleichsam ein Gründereffekt und eine sehr geringe Interaktion mit autochthonen Sammler-Jäger-Bevölkerungen postulierten. Die Autoren kamen nach den Ergebnissen der Distanz. sowie von zwei Zahnmaßen an neo. 15 . in welchen zwar eine Neolithisierung Südosteuropas durch einwandernde Bauern erfolgt ist.und Zentralasien sowie Nordafrika umfasste. Als Datengrundlage diente eine Auswahl von 16 Kranial. die weitere (ideelle) Verbreitung des neolithic package jedoch durch eine Vermischung mit einheimischen Sammler-Jägern bzw. Eine Verbindung der Stichprobe von Südosteuropa konnten sie in der ausgeprägten Homogenität mit Proben aus Anatolien sehen. Dagegen konnte für die Neolithiker und Individuen der Bronzezeit aus Südosteuropa eine Ähnlichkeit mit den heute dort lebenden Bevölkerungen festgestellt werden. wobei im Falle des oberrheinischen Fundplatzes von Jechtingen der Rössener Kultur ein statistisch signifikant unterschiedliches Variationsmuster beobachtet werden konnte: „Mit der größtenteils aus Rössener Zeit stammenden Population mag hier ein neues bevölkerungsbiologisches Element erfasst sein. bronzezeitliche. West. welches zuvor im Arbeitsgebiet nicht vertreten war“ (Meyer & Alt 2005). dass bereits die Stichprobe aus Region 1 eine große Heterogenität bezüglich der Variabilität der untersuchten Merkmale aufweist. Pinhasi & Pluciennik verfolgten bereits 2004 einen vergleichbaren Ansatz.und Mandibelmaßen. dem Nahen Osten. meso-. Die Ergebnisse dieser Studie konnten unter anderem zeigen.sowie Hauptkomponentenanalysen zu den Schlussfolgerungen. die in einem überregionalen Ansatz mit morphologischen Methoden die Fragestellungen zur Neolithisierung Europas thematisieren. in einem Aufgehen in den jeweiligen autochthonen Bevölkerung der benachbarten Gebiet zu sehen ist. Das Untersuchungsgebiet beschränkte sich auf die drei Regionen (Anzahl der untersuchten Individuen in Klammern): Anatolien und die Levante (Region 1: 114). wobei erstmals wieder ein vergleichender bevölkerungsbiologischer Ansatz verfolgt wurde.und mesolithischen Skelettindividuen. Analog zur Archäologie existieren auch seitens der Anthropologie nur wenige Studien. dass für den diese Arbeit betreffenden Bereich Mitteleuropas eine grundsätzliche größere Ähnlichkeit der neolithischen Individuen mit Neolithikern anderer Regionen besteht als mit modernen Bevölkerungsgruppen Mitteleuropas. und paläolithische Individuen aus Europa. für die sie komplexere demographische Prozesse als eine graduelle demische Verbreitung annahmen. Südosteuropa (Region 5: 79) und die Mittelmeerregion von Spanien bis Griechenland (Region 6: 38).Grundlagen zur Archäologie der Neolithisierung herangezogen. Als vorläufiges Ergebnis ließ sich eine Bevölkerungskontinuität vom Frühbis ins Mittelneolithikum feststellen. Selbiges Ähnlichkeitsmuster galt auch für alle Individuen der Bronzezeit. Nach Ansicht der Autoren unterstützten die Ergebnisse dieser osteometrischen Studie daher diejenigen Neolithisierungsmodelle. die sowohl moderne. Eine aktuelle Studie von Brace und Kollegen (2006) beinhaltete die Distanzanalysen von 24 Kraniofazialmaßen an einer Stichprobe von insgesamt 1282 Individuen. Dagegen führten sie für den verbleibenden Mittelmeerraum eine höhere Heterogenität an. neo-.

16 . d. Hier diente vor allem das variierende Verhältnis der beiden Strontiumisotope 87Sr/86Sr als Grundlage. Die Untersuchungen an linearbandkeramischen Skelettindividuen aus Flomborn. in einer schwindenden Bevölkerung dagegen klein. ob sich dieses in früheren oder in späteren Jahren in einer Region mit abweichender geochemischer Strontium-Signatur aufgehalten hat. Basierend auf der Annahme. Im Vergleich mit geochemischen Kartierungen kann daher eine mögliche Herkunftsregion. zumindest aber Mobilität für das fragliche Individuum postuliert werden. 2002. die mit Hilfe von Isotopenanalysen an menschlichem Skelettmaterial die regionale Mobilität der Neolithiker in Mitteleuropa untersuchten (Price et al. 2002). dass in einer ansteigenden Populationsgröße der Anteil an Kindern und Jugendlichen hoch ist. Die Ergebnisse der einzelnen Fundorte wurden in chronologischer Distanz zur Front der neolithischen Diffusion nach Ammerman & CavalliSforza (1984) aufgetragen (vgl. sondern paläodemographische Studie wurde 2002 von Bocquet-Appel veröffentlicht. Einen weder klassisch-morphologischen noch genetischen Ansatz verfolgte die Arbeitsgruppe um Douglas Price und Alexander Bentley. die unter gegebenen ökologischen Gesichtspunkten für Sammler/Jäger errechnet wurden.Grundlagen zur Archäologie der Neolithisierung Eine weitere überregionale. 3). die er letztlich unter ansonsten identischen Voraussetzungen mit der verkürzten Stilldauer der Neolithiker begründete. wo es anstelle von Kalzium im Hydroxylapathit des Knochen bzw. welches die geochemische Signatur eines Ortes widerspiegelt (Bentley et al. Bentley et al. jedoch nichtmetrische. Die Autoren boten auf der Grundlage dieser Ergebnisse die Hypothese an. wohingegen im zeitlich leicht späteren Schwetzingen nur noch eine Mobilitätsrate von 25% zu beobachten war. Da sich Strontium in Zähnen (4-12 Jahre) schneller manifestiert als in Knochen (6-20 Jahre). Kap. kann bei einem Vergleich von beiden Proben eines Individuums festgestellt werden. Strontium gelangt über die Nahrungskette in den menschlichen Organismus. 2002) ergab eine hohe Mobilitätsrate für die Fundorte Flomborn (64%) und Dillingen (65%). Diese sah er einerseits in den Erfordernissen des intensiveren Arbeitsaufwands der bäuerlichen Lebensweise erzwungen und andererseits durch die Umstellung der Ernährungsweise im Neolithikum ermöglicht.h. dass a) vermehrt Frauen signifikant vom lokalen Strontiumverhältnis abwichen. der Zähne eingebaut wird. Als weitere Ergebnisse konnte konstatiert werden. dass es sich bei den nicht-lokalen Individuen bevorzugt um Frauen aus Sammler/Jäger-Gemeinschaften in benachbarten Regionen gehandelt haben könnte und zogen dafür ethnografische Vergleiche heran (Bentley et al. 2003). sich Werten näherten. c) vermehrt ohne LBK-charakteristischen Schuhleistenkeil bestattet wurden (Männer) und d) 85% der nicht-lokalen Individuen signifikant über dem Wert des lokalen StrontiumVerhältnisses lagen. Hieran konnte nach einer stationären Bevölkerungsgröße im Mesolithikum mit Beginn des frühen Neolithikums eine demographische Transition im Sinne einer stark ansteigenden Bevölkerung beobachtet werden. Schwetzingen und Dillingen (Bentley et al. b) die durch das 87Sr/86Sr-Verhältnis nicht von Geburt an als Ortsansässige definierten Individuen auch in der Orientierung ihrer Bestattung abwichen. 2001. wurde dieser Anteil im Hinblick auf Geburtenund Wachstumsraten von 68 ausgewählten neolithischen und wenigen mesolithischen Bestattungsplätzen untersucht. Bocquet-Appel erklärte den höheren Anteil an Kindern und Jugendlichen mit der höheren Fertilitätsrate der Neolithiker.

Gleichzeitig aber zogen sie auch die Alternativhypothese in Betracht. in welchen keine Unterscheidung in mögliche Bauern und Sammler/Jäger getroffen wurde. stattdessen aber die generell hohe Mobilitätsrate und die deutlichen Hinweise auf eine Patrilokalität der frühneolithischen Gesellschaft der LBK herausgehoben wurden. 17 .Grundlagen zur Archäologie der Neolithisierung 2002).

Die Autoren führten hierfür einen Diffusionsprozess an. Maßgeblich für die Geburtsstunde der „Archäogenetik“ war die Zusammenarbeit des Archäologen Albert Ammerman mit Cavalli-Sforza. der. erkennbare Ost-West Trends herausarbeiteten und somit die Geschwindigkeit der Ausbreitung der Agrikultur berechneten.1.2 Das wave-of-advance-Modell von Ammerman und Cavalli-Sforza Die 1984 erschienene Arbeit The Neolithic Transition and the Genetics of Populations in Europe von Ammerman und Cavalli-Sforza ist nach wie vor die Grundlage aller Debatten um die Neolithische Transition aus Sicht der modernen Genetik. die in den 70er Jahren veröffentlicht wurden. welcher mit ebenfalls kontinuierlicher Geschwindigkeit (1km pro Jahr bzw. Die Autoren profitierten zunächst von der neu entwickelten Methode der Radiokarbon-Datierung (Clark 1965). das sie erhielten.1. Nicht zuletzt war diese naturwissenschaftliche Herangehensweise eine Folge der von Lewis Binford (1968) mit beeinflussten processual archaeology. andererseits der Archäologie eindeutig neue Impulse von außen gab. um die Einwanderung von Bauern von der cultural diffusion. die Methoden quantitativer Datenanalysen auf die Fragestellungen der Archäologie zu übertragen. 25km pro Generation) in relativ schneller Zeit (innerhalb 2500 Jahren) vonstatten ging. welche mit Ackerbau und Viehzucht assoziiert waren. Gleichzeitig definierten sie die Begriffe demic diffusion. Der Begriff der demischen Diffusion wurde 18 . Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. in der Lage war. aus der Statistik kommend. war ein bemerkenswert gleichförmiger Prozess der Neolithisierung Gesamteuropas. die isochrone Karten entwarfen. indem sie auf Karten nun absolut datierter Funde. die Geschichte Europas aus Sicht der Genetik zu erzählen. der dem herkömmlichen Gedanken einer gerichteten Kolonisierung gegenüberstand. verbanden erstmalig genetische Daten mit gängigen archäologischen Fragestellungen. womit gleichermaßen der Grundstein für jede weitere Zusammenarbeit von Archäologen und Genetikern gelegt wurde.1 Die Neolithisierung aus Sicht der Humangenetik 3. der Verbreitung des neolithischen bäuerlichen Ideenguts auf die indigene europäische Jäger/Sammlergesellschaften zu unterscheiden. dass nur ein singulärer und übergreifender Mechanismus die Ursache sein konnte. Die Pionierarbeiten. geht größtenteils auf die Arbeiten von Luca Cavalli-Sforza und seinen Kollegen zurück.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. 3. Sie waren auch die ersten. deren Hypothesenbildung und nachfolgende mathematisch-statistische Prüfung einerseits dem damaligen Zeitgeist entsprach. Das Ergebnis. Diese Entdeckung einer konstanten „Neolithisierungsrate“ führte zur Schlussfolgerung. worauf die Verbreitung der Elemente des neolithischen Kulturkomplexes entlang von Konturlinien gleichen Zeitpunkts oder so genannten Isochronen aufgetragen waren.1 Forschungsgeschichtlicher Hintergrund Der Ansatz.

eine vollständige Verdrängung der Einheimischen vorausgesetzt (replacement) .3 Der Einsatz von klassischen genetischen Markern Das wave-of-advance-Modell schien geeignet zu sein. 1. Cavalli-Sforza und Ammerman hatten jedoch nicht dieses Bild im Sinne. konnten verschiedene Vorhersagen generiert und somit Hypothesen zum Wie der Ausbreitung von Ackerbau und Viehzucht erstellt werden. so sollte sich herausstellen. dass Europa und der Nahe Osten im ausgehenden Paläolithikum und Mesolithikum weitgehend isoliert waren und somit theoretisch Gelegenheit zur genetischen Differenzierung gegeben war. innerhalb der sich die neolithische Kultur mit ihren Trägern verbreitete.1. dass sich erstens der Anteil der bevorteilten Träger des Gens erhöht und zweitens in zufälliger Richtung ausbreitet. den Überschuss erneut einzusetzen. Dies umfasste hauptsächlich Antigen-Antikörper Reaktionen zahlreicher Blutgruppensysteme. 3. 19 . gleichermaßen der Schwachpunkt des wave-of-advance-Modells waren.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA häufig dem gebräuchlichen Bild der Einwanderung und Kolonisierung gleichgesetzt.A. die Gewebsantigene des HLA-Systems und eine Reihe von Enzymen. Zum anderen implizierte diese Annahme die Fähigkeit. deren Nachweis und Vererbungsmuster. Als klassische genetische Marker werden heute die Systeme all jener Gene bezeichnet. kulturellen Diffusion unerlässlich waren und welche. Der entscheidende Schritt zur Archäogenetik wurde nun durch den Einsatz von Daten der klassischen genetischen Marker erbracht. 3. die zur nachfolgenden Modellbildung bezüglich der demischen bzw. der damit die Ausbreitung eines vorteilhaften Gens durch eine Population umschrieb (Sykes 2000). sowie deren Allelfrequenzen auch schon in der prä-DNA Ära der Genetik untersucht wurden.als Homogenität von Europa und dem Nahen Osten im genetischen Substrat feststellbar sein. welches durch erwirtschafteten Überschuss ermöglicht und begründet ist. Eine demische Diffusion mit genetischem Beitrag der indigenen europäischen Bevölkerung würde zu einer graduellen Ausprägung von Genfrequenzen entlang der Hauptverbreitungsachse führen. 2. Dieses Modell hatte Cavalli-Sforza seinem Mentor R. Fisher entlehnt. Ein reine Verbreitung von Ackerbau und Viehzucht im Sinne eines Ideentransfers (cultural diffusion) würde die angenommene genetische Unterscheidbarkeit von Europa und dem Nahen Osten nicht beeinflussen und wäre somit leicht ersichtlich. Es beinhaltete die beiden Annahmen. Unter der Annahme. um die anhand der Radiocarbon-Daten beobachteten Verbreitungsgeschwindigkeit zu erklären. Demgegenüber würde eine demische Diffusion . Der Einsatz von klassischen Markern setzte zunächst einige Hypothesen voraus. Übertragen auf die neolithische Transition bedeutete dies zum einen ein natürliches Anwachsen der neolithischen Bevölkerung. welche teilweise bereits seit 70 Jahren bekannt waren (Landsteiner 1900). sondern schlugen gleichzeitig das sogenannte wave-of-advance-Modell vor. was wiederum eine damit einhergehende radiale Verbreitungswelle bedingte.

die sich später mit anderen Bevölkerungen vermischt habe. um bestimmte Verteilungsmuster von Allelen oder Dispositionen zu erhalten. Dies wurde unmittelbar als Beweis für die Hypothese der demischen Diffusion mit mesolithischem Beitrag gesehen. Sie ermöglichte es. bestärkte Cavalli-Sforza und Ammerman in der Annahme. Die Karte der ersten Hauptkomponente. Auch sie konnten zeigen. Frequenzen mehrerer Genorte für bestimmte geografische Bereiche zusammenzufassen und die Fülle der Information in wenigen Dimensionen darzulegen. welche 27% der absoluten Variation der klassischen Marker beinhaltete.Frequenzen in Nord und Nordwesteuropa. 1991). konnte nicht erstellt werden. dass es sich hierbei um Prozesse handelte. im Folgenden zur Beschreibung auch im Deutschen als PC abgekürzt) gewählt (Menozzi et al. dass die genetische Unterscheidbarkeit a priori von Europa und dem Nahen Osten nicht der Realität entsprach. wie in den drei obigen Hypothesen dargestellt wurde. Das Auffinden von hohen Rh. Ein eindeutiges Bild resultierend aus allen untersuchten Genorten (zunächst 39. Es stellte sich zudem nach und nach heraus. Die Karten der Hauptkomponenten 2 und 3. kam man zu dem Schluss. dass letztere ein Relikt einer proto-europäischen Bevölkerung darstellten. Dafür wurde die Hauptkomponentenanalyse (principal component: PC. 20 . dass etwa ein Drittel der Frequenzen ihrer Daten in einem SüdostNordwest-Gradienten zu verlaufen schien. sowie einen Ost-West-Gradienten. die nach dem Neolithikum stattgefunden hatten. Die Komplexität der gewonnenen Daten erforderte zudem den Einsatz multivariater Analysemethoden. 11% der Variation standen. also in den hypothetischen Randgebieten der neolithischen Expansion. die für 22% bzw. wie er zuvor auf der aus Radiokarbon-Daten gewonnenen Karte ersichtlich war.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Inspiriert wurde der Einsatz der klassischen genetischen Marker durch eine Beobachtung von Mourant (1954). Die Ergebnisse und Schlussfolgerungen der Arbeiten von Cavalli-Sforza wurden auch von anderer Seite bzw. Abbildung 3). welcher anhand des ausschließlichen Vorkommens des Blutgruppengens Rhesus negativ (Rh-) in Nordafrika und Europa und dort mit der größten Häufigkeit innerhalb der Basken. folgerte. später 95 (Cavalli-Sforza et al. 1989. Die nachfolgend untersuchten Gene der klassischen Marker zeigten jedoch häufig andere Verteilungsmuster. 1978). mit anderen Analysemethoden bestätigt (Sokal et al. dass es sich bei der von Mourant nicht näher benannten späteren Bevölkerung um neolithischen Bauern handeln könne (Richards 2003). 1994)). zeigten einen Südwest-Nordost-Gradient. zeigte einen Gradienten von Südost nach Nordwest. Die Ergebnisse ließen sich nun in zweidimensionalen Plots darstellen oder in den mittlerweile für die Anhänger der „Diffusionisten“ zum „Wappen“ avancierten Konturkarten für die einzelnen Komponenten (vgl. Da deren Einfluss auf die genetische Variation als geringer erkannt worden war.

Die Gesamtinterpretation der neolithischen Transition auf der Basis dieser Veröffentlichung lag jedoch auf der Hand: Die Neuankömmlinge. als anerkannte Lehrmeinung durch (Richards 2003). Somit musste konstatiert werden. dass zwar das Ausmaß einer bzw.konnte allerdings nicht befriedigend mit einbezogen werden (Ammerman & Cavalli-Sforza 1984). die nicht dem Südost-Nordwestgradienten entsprach. d. das in gewisser Hinsicht als „Selbstläufer“ bezeichnet werden kann. Sie gingen 21 . als Folge postneolithischer Migrationen. der eigentliche Nachweis des wave-of-advance-Modells jedoch nicht eindeutig erbracht werden konnte.h. dass in Simulationen mit erhöhtem Anteil an hypothetischen Mischehen. Die clines der ersten Hauptkomponente in Europa (modifiziert aus Renfrew & Boyle 2000 nach Cavalli-Sforza et al. das jeweils nur höchstens ein Drittel der Variation einen Gradienten aufweist. Ein ebenfalls kritischer Aspekt zeigte sich in der Tatsache. d. Diese Ansicht hatte sich bereits zur Veröffentlichung des 1994 erfolgten opus magnum (zitiert nach Richards 2003) von Cavalli.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Abbildung 3.der Ideentransfer . stets ein schneller Verlust der „Neolithikergene“ festzustellen war (siehe hierzu auch die aktuellen Simulationen von Currat & Excoffier 2005).h. einwandernde neolithische Bauern. Eine entscheidende Frage war mit dem umfangreichen Datensatz von Cavalli-Sforza nicht zu klären: Wie groß waren die relativen Anteile der indigenen Bevölkerung und der neolithischen „Neuankömmlinge“? Zwar konnten entsprechende Simulationen des wave-ofadvance-Modells die Prozesse der Diffusion mit und ohne Interaktion darstellen.Sforza. Ammerman & Cavalli-Sforza hatten zwar ihre Hypothesen vorsichtig formuliert. Nichtsdestoweniger setzte sich das wave-of-advance-Modell. durchgesetzt und mittlerweile auch die Autoren selbst trotz ihrer früher geäußerten Ansichten beeinflusst. The History and Geography of Human Genes. bildeten die Basis des heutigen europäischen Genpools (Richards 2003). Auf Basis ihres nun auf 95 Genorte erweiterten Datensatzes erklärten sie alle Variation. 1994). und auch dem oben erwähnten Faktor der Akkulturation besondere Achtung einzuräumen gemahnt. der kritische Faktor der Akkulturation . mehrerer Diffusionsereignisse aufgezeigt.

4 Kritik am wave-of-advance-Modell Die maßgebliche Kritik am wave-of-advance-Modell richtete sich zunächst auf die Wahl der genetischen Marker. Kritik aus den Reihen der Archäologen kam vornehmlich bezüglich der Interpretation der Gradienten der Hauptkomponentenanalyse. Für ihn stellte es das passende prozessuale Modell dar.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA sogar soweit. 1998). die einen distinkten Selektionsdruck auf das Immunsystem der frühen Viehzüchter ausgeübt haben konnten. die Hauptkomponenten-Analyse als relative Datierungsmethode zu empfehlen (Cavalli-Sforza 1996). Die Linguisten zogen noch weitgehend die Hypothese von Marija Gimbutas vor. sondern den differenzierten Anpassungszustand an die veränderte Situation an möglichen Krankheitserregern. lag es nach Fix nahe. mit dem er seine. zum HLA-System zu rechnen sind (human leucoyte antigen). 1 22 . von welchen jeweils die letzte die vorausgehende überschreibe. Die Ergebnisse von Cavalli-Sforza und Kollegen beeinflussten wiederum die Hypothesen und Modelle der archäologischen Neolithikumsforschung. Die Ursachen der möglichen überlagernden Verbreitungswellen sah jedoch Palimpsest: Pergament-. vormals als radikal bezeichnete. anzunehmen. Dass hierbei Richtungen von Südost nach Nordwest erkennbar seien. 1999) darauf hin. dass die Mehrzahl der von Ammerman und Cavalli-Sforza untersuchten Allele. die im Altertum oder Mittealter nach Abwaschen oder Abkratzen wiederbeschriftet wurden. oder Papyrushandschriften. Hypothese zur Ausbreitung der indoeuropäischen Sprachen im Rahmen der neolithischen Transition untermauern konnte. liege unter anderem daran. die eine nach Westen gerichtete Verbreitung von Proto-Indoeuropäern den bronzezeitlichen Kurgan-Kulturen der osteuropäischen Steppen zuordnete (Gimbutas 1965). dass ein beobachtbarer Gradient die Folge mehrerer Verbreitungswellen sein kann. welche einen NW-SO-Gradienten aufweisen. dass der Südost-Nordwest Gradient (Abbildung 3) der ersten PC mit der Ausbreitung der neolithischen Kulturen in Zusammenhang stünde. Da dieses einen bedeutenden Teil des menschlichen Immunsystems bildet. Demzufolge spiegelten nach Fix die beobachtbaren clines der (HLA-)Allelhäufigkeiten nicht die demische Diffusion der Populationen wider. Gerade im Hinblick auf die Domestikation von Tieren lassen sich eine Fülle neuer Krankheitserreger anführen (Zoonosen). Der Archäologe und Linguist Colin Renfrew (1987) sah sich durch das wave-of-advance-Modell in seinen eigenen Hypothesen bestätigt. Darüber hinaus wären im Rahmen der Immunabwehr auch Anpassungen an veränderte klimatische Bedingungen denkbar.1. dass es keinen eindeutigen Grund gab. dass die betreffenden Allele einer Selektion im Rahmen der Immunabwehr unterliegen. Zur Verdeutlichung wurde hierfür von Renfrew (1998) und Zvelebil (1998) der Begriff „Palimpsest“ entlehnt1. dass durch die geographische Deutung Europas als „kleine“ Halbinsel Eurasiens im Laufe der Menschheitsgeschichte mehrere mögliche Verteilungswellen in das „Becken Europa“ geflossen sind. So wies Allan Fix (1996. 3. der veranschaulichen sollte. dass dies schlichtweg einer von möglichen Wegen nach Europa darstellt. Er machte gleichzeitig deutlich. So bemerkte Zvelebil (1989.

) nicht in vergleichbarem Maß und in einigen Gebieten keineswegs in Vergesellschaftung verbreiteten und zudem der wesentliche Faktor von Austauschsystemen mit mesolithischen Bevölkerungen nicht mit einbezogen wurde (u. So stand hauptsächlich die Definition des propagierten „neolithic package“ im Vordergrund der Kritik. Die Befunde deuteten größtenteils sogar in die entgegengesetzte Richtung. der analog zu Clark (1965. Keramik. das daraus resultierende Wachstumspotential. Ethnographische Vergleiche mit australischen aborigines oder südafrikanischen Jäger/Sammlergesellschaften wurden verworfen und stattdessen 23 . der den Südwest-Nordost-Verlauf der zweiten PC als Folge der spät bzw. automatisch zu einer deutlichen Überbewertung des „neolithischen“ Einflusses in Europa führe. die den agrikulturellen Bevölkerungen zugeschrieben. dass je eine PC einer Bewegung entsprach. So ist die große Populationsdichte keineswegs archäologisch nachgewiesen. dass sich die einzelnen Komponenten dieses Pakets (z. Die erste PC mit 27% der Gesamtvariation sollte der Neolithisierung entsprechen. als ursprünglich vermutet (van Andel & Runnel 1995). Zvelebil merkte bereits 1986 an. postglazialen Reexpansion aus den glazialen Refugien im frankokantabrischen Raum deutete. den Mesolithikern dagegen versagt wurde und die gleichermaßen die Stütze des Modells darstellte. Aus heutiger Sicht überraschend spät kam daher das entsprechende Modell von Torroni (1998). a. Jedoch wurde auch diese Annahme als einheitliche Erklärung von archäologischer Seite abgelehnt. die in hierarchisch-chronologischer Abfolge stattfanden.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA auch Zvelebil (2000) eher in postneolithischen Zeiten.B. Gronenborn 2003). Für die zweite Hauptkomponente (22%) konnte jedoch kein passendes (vor-)geschichtliches Ereignis gefunden werden. Der zweite große Kritikpunkt der Archäologen an der 1984 erschienenen Arbeit von Ammerman & Cavalli Sforza lag eher im methodischen Bereich. Erst Richards (1997). siehe oben) eine Karte mit Radiokarbon-Daten für das frühe obere Paläolithikum erstellte. Cavalli-Sforza und Kollegen hatten die Reihenfolge ihrer Hauptkomponenten nach der Höhe der enthaltenen Variation zeitlich geordnet. die entlang von Flüssen. Viehhaltung etc. konnte zeigen. Getreide. das in den nun engen (postfrühneolithisch-bronzezeitlich) gespannten Rahmen passte. Zahlreiche Archäologen deuteten darauf hin. Die mesolithischen Bevölkerungen. nicht mehr aufrecht zu halten. das Vorkommen von Keramik an einem Fundpunkt als eindeutig neolithisch zu werten. dass vor allem die von Ammerman und Cavalli-Sforza verfolgte Strategie. Spätestens jetzt war die Idee. Ein weiterer Kritikpunkt am wave-of-advance-Modell betraf die Annahme einer großen Populationsdichte bzw. Seen und Küsten lokalisiert wurden. dass bereits die erste Ausbreitungswelle des anatomisch modernen Menschen nach Europa einen mit dem Prozess der Neolithisierung vergleichbaren Weg einnahm. Sie nahmen weiterhin für jede PC eine Wanderungsbewegung an. Price 2000. wiesen ein ungleich größeres Maß an Sesshaftigkeit und auch an Bevölkerungsdichte auf. für die dritte PC (11% ) mit Ost-West Verlauf der Frequenzen wurde der Einfluss von Gimbutas’ bronzezeitlichen Kurgan-Kulturen postuliert und für die vierte PC wurden die griechischen Kolonien im östlichen Mittelmeergebiet herangezogen.

Bentley et al. deren naturräumliche und klimatischen Verhältnisse am ehesten den des europäischen Mesolithikums nahe kamen (Zvelebil 1986). Zilhão 2000.B. wie z. 2004. Barnett 2000. Andererseits mehrten sich auch auf Seiten der Archäologen die Belege für Gebiete.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Analogien zu nordwestamerikanischen Indianerkulturen erstellt. Es herrscht weitestgehend Konsens über die stark ausgeprägte Komplexität des Prozesses der neolithischen Transition an sich und deren regional bzw. Bogucki 2000. Demzufolge war die mesolithische Lebensweise in Europa als vollwertige westliche Alternative zum Neolithikum zu sehen. 2003). Price 2000. Kaczanowska & Kozlowski 2003). wenn auch einige eine Verbreitung der neolithischen Kultur durch Einwanderung von außen nicht ausschließen (Bogucki 2003. dass auch die einstigen Vertreter der „Neolithischen Invasion“ mittlerweile ihre Aussagen bezüglich Größe und Einfluss derselben angepasst haben (Cavalli-Sforza 2003. 2001) und für welche nur eine Kolonisierung plausibel erscheint. Es bleibt anzufügen. 24 . räumlich unterschiedlichen Entfaltung (Gronenborn 2004). in welchen die neolithische Lebensweise schneller als mit der von Ammerman & Cavalli-Sforza veranschlagten Geschwindigkeit Verbreitung fand (Gronenborn 1999. dem der linearbandkeramischen Kultur oder auch der Cardial-Kultur.

a. und das Y-Chromosom. Avise 2000.1 Mitochondriale Variabilität in Europa Bereits seit Beginn der 90er Jahre untersuchten mehrere Arbeitsgruppen die Variationsbreite des mitochondrialen Genoms.2 Forschungsstand molekulargenetischer Studien Parallel zum Erscheinen des grundlegenden „archäogenetischen“ Werkes von Ammerman und Cavalli-Sforza (1984) zu den klassischen Markern wurden auch im molekulargenetischen Bereich entscheidende Fortschritte gemacht. So bediente sich die Gruppe um Antonio Torroni der klassischen Methode des Enzymverdaus. DNA „unendlich“ zu vervielfältigen und damit genügend Ausgangsmaterial zur weiteren Analyse zur Verfügung zu stellen.unterstützende Hypothesen von Seiten aller beteiligten Disziplinen (Richards 2003). sondern gleichermaßen auch den zu untersuchenden Abschnitt exakt einzugrenzen (vgl. von Brian Sykes) die Sequenzierung vornehmlich der schnell evolvierenden Regionen des nichtkodierenden Bereiches.2. Parallel hierzu erfolgte von anderen Arbeitsgruppen (u. Die PCR ermöglichte es nicht nur. beschrieben werden und die dabei beobachteten Verdaumuster verschiedenen Gruppen (Haplogruppen) zugeordnet werden (Torroni et al. 1997. Die zu untersuchenden mitochondrialen Genome verschiedener Herkunft wurden nach hierarchischem System mit unterschiedlichen Restriktionsenzymen verdaut.7. von Interesse. unter der Annahme. 3.2. welches nur bei Männern vorkommt. dass nun auch nicht-rekombinierende Genorte einfach und unter geringem Zeitaufwand analysiert werden konnten.1): Erstens konnten nun einfache Genealogien erstellt werden und zweitens konnten diese. Ein weiterer Vorteil der PCR lag darin. über die obliegende Mutationsrate datiert werden. das nur maternal vererbt wird. vgl. Bandelt et al. 25 . der RFLP-Methode (Restriktionsfragment-Längenpolymorphismus. Kap. die für das Entstehen oder den Wegfall einer Restriktionsschnittstelle ursächlich sind.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. Die Interpretation dieser phylogeographischen Karten war jedoch ebenfalls nicht selbsterklärend.vergleichbar mit den Isochron-Karten der klassischen Marker .3). der so genannten hypervariablen Segmente HVS I und HVS II. 1996). Kap. sondern erforderte . die nicht viel später die gleichen Fragestellungen untersuchten bzw. Aus populationsgenetischer Sicht waren in erster Linie das mitochondriale Genom. wofür der Begriff „Phylogeographie“ entworfen wurde (Richards et al. Letztlich erlaubte diese Art von Daten auch eine einfache Einordnung von Genealogien in Raum und Zeit. Somit konnten diejenigen polymorphen Positionen im Genom. dass Mutationen zufällig und somit über die Zeit gesehen linear verlaufen. Es konnten somit nicht nur die Produkte eines Gens. 3. Diese genetischen loci bargen gegenüber den klassischen Markern vor allem zwei Vorteile (vgl. Der Grundstein für alle molekulargenetischen Studien wurde durch die Entdeckung und Entwicklung der Methode der Polymerase-Kettenreaktion (PCR) gelegt. 2002). Hierbei wurden zunächst methodisch unterschiedliche Ansätze verfolgt. Kapitel 3.4). 5. an diese anknüpften. sondern das Gen selbst und seine Variationen (sofern vorhanden) erschlossen werden.

Richards and Macaulay 2001). das Ergebnis einer Expansion und Diffusion früher Ackerbauern und Viehzüchter nach Europa (Barbujani & Goldstein 2004)? Wie in Tabelle 1 deutlich wird. 3. 2005). 2001. Haplogruppen (Macaulay et al. lassen sich vor allem die beiden Modelle der ersten paläolithischen sowie der neolithischen Besiedlungswellen aus dem Nahen Osten hinsichtlich ihrer Auswirkungen auf den modernen Genpool nicht unterscheiden. 1996. 2004.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Die ersten Ergebnisse schienen im Hinblick auf vorgeschichtliche Ereignisse zunächst wenig informativ zu sein.2 Besiedlungsgeschichte Europas anhand von mtDNA und Y Chromosom Die vorgeschichtlichen Besiedlungsereignisse Europas betreffend. Erwartete Verteilungsmuster dreier Modelle zur Besiedlungsgeschichte Europas (umgezeichnet nach Barbujani & Goldstein 2004).h. Sind die an modernen Daten beobachtbaren Gradienten innerhalb Europas größtenteils das Ergebnis der (möglicherweise in mehreren Wellen erfolgten) Erstbesiedlung durch den anatomisch modernen Menschen (Homo sapiens sapiens) im Paläolithikum. Etablierung des europäischen Genpools größtenteils im Paläolithikum nacheiszeitlichen Paläolithikum Neolithikum Südost-Nordwestgradient erwartet unerwartet erwartet Nord-Südgradient unerwartet erwartet unerwartet groß klein Anteil an „paläolithischen“ Linien groß 26 . Lediglich der Anteil der jeweilig bedachten „Gründerpopulation“ variiert hier. 2004). Die grundlegenden Fragen konnten allerdings bislang nicht beantwortet werden. denn die Verteilung der europäischen Haplogruppen zeigte über weite Gebiete ein uniformes Bild (Richards et al. Erst die Verbindung beider Informationsstränge (coding region und control region) sowie die sukzessive Einigung auf eine gemeinsame Nomenklatur verbesserten die Situation und ermöglichten ein sicheres Zuordnen in verschiedene clades bzw. Diese maximale Auflösung des mitochondrialen Markers ist zum gegenwärtigen Zeitpunkt noch nicht erreicht und auch ein vorläufiges Ende ist noch nicht in Sicht. einer postglazialen Wiederbesiedlung aus den Refugien oder einer „genetischen“ Neolithisierung Europas. d. 1999). Mittlerweile wird in populationsgenetischen Studien bevorzugt das gesamte mt-Genom sequenziert. Die neuesten Arbeiten auf diesem Gebiet befassten sich nach wie vor mit der Aufschlüsselung der phylogenetischen Beziehungen der einzelnen Haplogruppen zueinander sowie der Subhaplogruppen bzw. 1998). 2004. gab es seitens der mitochondrialen Daten frühzeitig Aussagen über deren Beschaffenheit (Richards et al. um die maximale phylogenetische Auflösung zu erreichen. Haplotypen untereinander (z.B. aber häufigste europäische Haplogruppe H in etwa 15 Subhaplogruppen unterteilt werden (Loogväli et al. Die Verknüpfung von HVS I Haplogruppen mit diagnostischen Schnittstellen im kodierenden Bereich des Mitochondriums konnte durch die Sequenzierung des gesamten mitochondrialen Genoms für einzelne Haplogruppen erfolgen (Finnilä et al. So konnte unlängst die bislang wenig transparente.2. Palanichamy et al. Pereira et al. 1996). Tabelle 1. Achilli et al.

MUP. Abbildung 4. abgeschwächt werden konnten. ließen die ersten europäischen mtDNA-Studien eher eine Uniformität der Haplogruppenverteilung erkennen (Richards et al. Der neolithische Einfluss wird ebenso als gering eingeschätzt. 1996). Ergebnisse der founder analysis nach Richards et al. 50% (weiß) Konfidenzintervall der Koaleszenzzeitberechnungen der founder analysis. Die grundlegende Arbeit zur Besiedlungsgeschichte Europas aus mitochondrialer Sicht wurde von Martin Richards im Jahre 2000 veröffentlicht. Aufgeführt sind die häufigsten Haplogruppen Europas und gleichzeitig deren prozentuales Vorkommen. das in den Zeitrahmen des späten Paläolithikums fällt.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Leichter unterscheidbar scheint auf den ersten Blick das Modell der postglazialen Wiederbesiedlung aus den Refugien Südeuropas. Wie eingangs erwähnt. dass das Modell der nacheiszeitlichen Expansion nicht einfach zu interpretieren ist. Gleichzeitig wurde dies als Beweis gedeutet. LUP. 2000. melting pots der Refugien verstärkt bzw. Hier wäre ein Südost-Nordwestgradient eher unerwartet. da es letztlich unmittelbar von der vorausgehenden Dynamik der (paläolithischen) Erstbesiedlung abhängig ist und deren Verteilungsmuster in den genetischen bottlenecks bzw. dass der überwiegende Anteil an europäischen Haplogruppen ein Alter aufweist. dem Nahen Osten und Nordafrika ermittelte er mit Hilfe der founder analysis Koaleszenzzeiten für die einzelnen Haplogruppen (siehe Box 1. einem neolithischen Einfluss zuzurechnen sei. EUP: Late. etwa 20-25%. Middle und Upper Paleolitihic. Die Querbalken entsprechen dem 95% (schwarz) bzw. 27 . Es sei jedoch angemerkt. dass die meisten europäischen mitochondrialen Sequenzen auf autochthone paläolithische Vorfahren zurückzuführen seien und demnach nur ein geringerer Anteil. Er konnte damit zeigen. Auf einer stark erweiterten Basis von 4100 Individuen aus ganz Europa bzw. Abbildung 4).

Diese erfolgt durch Subtraktion der Diversität der Nachfolgepopulation von der Diversität der Ursprungspopulation.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Box 1. Daraus resultiert. Der Quotient aus der Summe der Mutationen durch die Anzahl abgeleiteter Typen aus der entsprechenden Nachfolgepopulationen wird anschließend mit der Mutationsrate des jeweiligen locus multipliziert (siehe Grafik). dass die heutige Nachfolgepopulation der Ursprungspopulation in derselben geographischen Region vorhanden ist und eine vergleichbare Diversität wie die Ursprungspopulation aufweist. Als weitere Voraussetzungen für die Analyse gelten. 2000 beruht auf dem Prinzip des Vergleichs einer Ursprungspopulation mit einer hieraus abgeleiteten Nachfolgepopulation. 2004). Hierfür müssen zunächst Gründertypen in der aus Migration hervorgegangenen Nachfolgepopulation definiert werden. dass einerseits rezente Rückwanderungen von Bevölkerungsteilen und andererseits auch Parallelmutationen erkannt und somit ausgeschlossen werden können. dass die Nachfolgepopulation eine Ersatzpopulation darstellt. Die Gründeranalyse (founder analysis) nach Richards et al. Zudem wird vorausgesetzt. Die Analyse setzt jedoch einige Grundannahmen voraus: Zum einen wird die Ursprungspopulation als die „ältere“ angesehen. Jobling et al. Anschließend wird die Anzahl der von diesen Gründertypen abgeleiteten Typen innerhalb der Nachfolgepopulation bestimmt. Beide Faktoren würden hinsichtlich der ursprünglichen Wanderung zu einer Unterschätzung der Diversität in Ursprungsund Nachfolgepopulation führen (Richards et al. 28 . Dabei wird die jeweilige molekulare Diversität der beiden Populationen bestimmt und der Zeitpunkt der Migration der Nachfolgepopulation errechnet. Founder analysis. 2000.

3. Hier spielten nicht zuletzt wissenschaftsgeschichtliche Aspekte eine Rolle. Semino et al. Mit dem gleichen Datensatz wurde auch der bis dahin als postneolithisch nicht erfassbare Südwest-Nordostgradient der zweiten Hauptkomponente von Cavalli-Sforza (vgl. So spaltete sich im Licht der neuen (molekulargenetischen) Methoden Mitte bis Ende der 90er Jahre erneut die (molekulargenetische) Forschungsgemeinschaft in so genannte „Demisten“. 2000a. Chikhi et al. B. 2000b.3) erklärt und gleichermaßen zeitlich in das ausgehende Paläolithikum datiert. Dieses Argument kann jedoch heute nicht mehr aufrecht gehalten werden (vgl. Martin Richards und Kollegen (1996. 2001). glätteten sich in den vergangenen fünf Jahren auch die Wogen der Debatte. Dieser jahrelange Disput lässt sich gut in der Literatur verfolgen und ist letztlich auf unterschiedlichen Ergebnissen von mitochondrialen und Y-chromosomalen Daten begründet (z. Bezüglich der Auswirkungen der neolithischen Periode auf den europäischen Genpool. dass ein Gradient von SO. Mit steigender Anzahl der erhobenen Daten und vor allem nach Annäherung der Methoden bzw. 1998.nach NW-Europa nicht existiert und dass nur ein geringer Anteil von ca. 1994) widerzuspiegeln. Barbujani et al. 2000c). Diese Arbeit wurde von Cavalli-Sforza und Minch (1997) stark kritisiert. Hinweise auf mögliche postglaziale Expansion aus der Iberischen Halbinsel in nordöstliche Richtung.B. Richards et al. Demnach wird auf der einen Seite versucht. 1998. gestützt auf bestimmte mitochondriale Haplogruppen. 3. existierten auch von Seiten der Populationsgenetik unterschiedliche und zum Teil gegensätzliche Hypothesen. Torroni et al. Die wichtigsten grundlegenden Arbeiten sowie auch die kritischen Ansätze beider Seiten zu dieser andauernden Diskussion sollen hier in kompakter Form wiedergegeben werden. also Befürworter der Einwanderungsund Verdrängungshypothese um Guido Barbujani. 2002. Des Weiteren wiesen sie darauf hin. Kap. Der Streitpunkt betraf die Höhe des Anteils der neolithischen Bevölkerung am heute beobachtbaren europäischen Genpool. Andere wiederum versuchten anhand molekularer Daten das Gegenteil zu beweisen. Sie hegten Zweifel an der Eignung der mtDNA als populationsgenetischer Marker selbst und führten hier als Gründe mögliches Vorkommen von Heteroplasmien an. 1998) kamen im Widerspruch zu den Resultaten der klassischen genetischen Marker von Cavalli-Sforza zunächst zu dem Ergebnis. dass bei 29 .1.3). und „Indigenisten“. auf molekularer Ebene das Modell der "demischen Diffusion" von Ammermann und Cavalli-Sforza (1984. das im extremsten Sinne von einer demographischen "wave of advance" von „Farmergenen“ und einer kontinuierlichen Verdrängung autochthoner europäischer Linien ausgeht.1. 1998.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Parallel hierzu lieferte die Gruppe um Torroni (1998. Simoni et al. Anhänger einer autochthonen Neolithisierung durch bloße Übernahme der neuen Lebensweise wie z. Cavalli-Sforza et al. Cavalli-Sforza und Minch 1997. sondern über die Interpretation derselben. 12% der Linien in Europa nahöstlichen Ursprungs sein kann. Letztlich war man sich nicht über die Ergebnisse uneinig. Diese bewegten sich polar zwischen einer Akkulturation der autochthonen mesolithischen Bevölkerung einerseits und einem Bevölkerungswandel durch einwandernde Bauern andererseits. Martin Richards. Kap. Ermöglichung einer Vergleichbarkeit. 2000a.7. 1998.

Inwieweit die Wahl der Analyse zu einem konträren Ergebnis führen konnte. nicht signifikant waren. einer Haplogruppe nicht mit dem Alter einer Population gleichzusetzen sei. Parallel hierzu erfolgten die Veröffentlichungen der Ergebnisse aus mtDNA-Studien seitens der Demisten (Simoni et al. betonte aber gleichzeitig. woraus sich Gründerereignisse sich im Vergleich zwischen Populationen ablesen ließen und aufgrund der Datierbarkeit der betreffenden mtDNA-Linien durchaus mit archäologischen Ereignissen assoziiert werden konnten. Der Anteil an putativen neolithischen Linien. Eine Parallele zur ersten Hauptkomponente von Cavalli-Sforza und der daraus abgeleiteten Neolithisierungshypothese war vordergründig offensichtlich. Basierend auf den Koaleszenzzeiten der Haplogruppen (vgl. Zudem konnte Richards zeigen. der 51% der Variation entsprachen. dass grundsätzlich das Alter eines cluster bzw. 2000a). allochthone Linien die im Neolithikum neu in Europa auftreten.h. dass Beweise für einen NordSüdgradienten. sowie der östliche und zentrale Mittelmeerbereich in ein 30 . Allerdings ließen die Autoren bewusst offen.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA einem mütterlich vererbten locus wie der mtDNA ein verwischender Effekt in einer patrilokalen Gesellschaft (wie sie für Ackerbauern und Viehzüchtern postuliert wird) anzunehmen sei. Die Antwort von Richards & Sykes (1998) stimmte Barbujanis Kritik grundsätzlich zu. ob eine paläolithische oder neolithische Expansion ursächlich für diese Muster sei. und einer verfeinerten Gründeranalyse (founder analysis) von Martin Richards änderte sich nichts Grundlegendes am mitochondrialen Bild Europas. Auch mit der grundlegenden Arbeit von 2000 inklusive einem erneut vergrößerten Datensatz. Ein weiterer Kritikpunkt folgte von Barbujani (1998). der anführte. 1999) in verschiedene Regionen auf und untersuchten diese mit Hilfe der Hauptkomponentenanalyse. Die erste Hauptkomponente. wurde um die 20% beziffert. der Balkan. Sie wiesen aber gleichzeitig darauf hin. d. dass sie sich in ihren ursprünglichen Studien auf einzelne Haplotypen innerhalb von Haplogruppen gestützt hatten. vor allem der Vergleichsgruppen im Nahen Osten. zeigte sich in der 2002 erschienenen Arbeit von Richards und Kollegen. Hierfür teilten sie Europa nach paläoökologischen Kriterien (Gamble 1996. d. Abbildung 4) wurden postglaziale demographische Ereignisse als Hauptfaktor angesehen.h. konnte jedoch vor allem im Mittelmeergebiet graduelle Verteilungsmuster herausarbeiten. zeigte nun das bekannte Bild der Südost-Nordwestgradienten. Denn es fielen zwar die gewählten Regionen im Südosten. wie es für das Modell der postglazialen Wiederbesiedlung vorsieht. dass sich lediglich die Basken und die Gruppen im Nahen Osten vom homogenen Verteilungsbild Europas unterscheiden lassen. konnte jedoch bei genauerer Betrachtung nicht dauerhaft bestätigt werden. Basierend auf dem Datensatz der Publikation aus dem Jahr 2000 machten sie sich gezielt auf die Suche nach geographischen Mustern im mtDNA-Pool Europas. Die bereits beschriebene Verknüpfung von HVS I Sequenzdaten mit diagnostischen RFLPs des kodierenden Bereichs und letztlich eine gezielte Erweiterung des Datensatzes von Richards und Kollegen (1998) bestätigte jedoch die Ergebnisse der vorausgegangenen Studie. Die Analyse von über 2600 Sequenzen bestätigte ebenfalls das homogene mtDNA Muster in weiten Teilen Europas.

welche der neolithischen „Inlandsroute“ entspräche. eine Verbindung zu Zentraleuropa. Der Analyse der maternalen Linien entsprechend. dass gerade die Datierungen für beide betreffenden Haplogruppen zu divergent seien. Vor allem die detaillierte Studie von Zoë Rosser und Kollegen unterstrich die Ergebnisse der klassischen Marker. welche ebenfalls diesen Gradienten nachwies. Jobling & Tyler-Smith 2000). King & Underhill (2002) schufen.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA gemeinsames cluster. war jedoch ganz anderer Art. So wurden innerhalb des Datensatzes putative Urpopulationen ausgewählt. Bezüglich der angemerkten SO-NW-Gradienten zweier Y-Haplogruppen. Die zeitgleiche Arbeit von Semino hingegen. Erste Untersuchungen hierzu waren analog zur mitochondrialen DNA zunächst explorativer und deskriptiver Art (Jobling 1994. Mit Hilfe von Simulationsanalysen wurde nun der jeweilige Anteil der entsprechenden Ausgangspopulationen in der jeweiligen Vermischungspopulation festgestellt. Doch konnten auch hier früh unterschiedliche Frequenzen einzelner Haplogruppen geographisch notiert werden. zog jedoch erstmals postneolithische Prozesse für das mtDNA (und eventuell auch entsprechend für das Y-chromosomale) Verteilungsmuster stärker in Betracht. erfolgten zeitgleich ausgedehnte Untersuchungen zur europäischen Variabilität des Y-Chromosoms. Semino et al. Sie fanden im Verteilungsmuster der verschiedenen Y-Haplogruppen die entsprechenden Parallelen zu allen vier Hauptkomponenten von Cavalli-Sforza und Kollegen. definierte neolithische Y-Haplogruppen und setzte deren Anteil von 22% gleich dem Beitrag an neolithischem Einfluss auf den europäischen Genpool. der hierbei verfolgt wurde. welcher die Nachkommen der ersten Ackerbauern/Viehzüchter widerspiegeln sollte. welche ca. bestand jedoch nicht. 45% der Variation und kontinentweit dem Modell der demic diffusion entsprachen. was gleichermaßen bereitwillig in der Diskussion um die Besiedlungsgeschichte aufgenommen wurde. Diese Arbeit wurde wiederum von Richards (2003) kritisiert. wie sie in der zuvor vertretenen These der hauptursächlichen postglazialen Wiederbesiedlung zu erwarten gewesen wäre (siehe auch Jobling et al. basierend hierauf. 2004). Stattdessen warnten sie vor voreiliger Verknüpfung mit archäologisch bekannten Prozessen ob der Tatsache. Auf der einen Seite wurden die Basken als Vertreter der europäischen Paläolithiker definiert und auf der anderen Seite ein Pool aus Daten aus dem Nahen Osten erstellt. Interessanterweise zeigte auch keiner der Hauptkomponenten dieser Arbeit eine Nord-Süd-Ausrichtung. 1996. boten Rosser und Kollegen keine genaue Interpretation an. wieder eine direkte Verknüpfung zum archäologischen Fundgut und sahen sich in den geographischen Parallelen von gehäuftem Vorkommen bestimmter YHaplotypen und dem Auftreten von anthropomorphen Figurinen und bemalter Keramik bestätigt. Semino und Kollegen (2000) konnten nun SO-NW-Gradienten innerhalb Europas beschrieben und bekräftigt werden. Eine kritische Überprüfung der Daten von Semino (2000) durch Chikhi und Kollegen (2002) kam zu einem höheren Wert von durchschnittlich 50-65% Anteil an neolithischen Linien (70% auf dem Balkan und sich in Gradienten bis auf die Iberische Halbinsel auf 30% verringernd). Weiterführende Interpretationen ließ auch Richards bewusst aus. denn zum einen fasste sie mehrere unplausible Annahmen zusammen (vor allem die unkritische Ansetzung der beiden 31 . Der Ansatz. Basierend auf Ergebnissen ausgedehnter Analysen von Y-Chromsomen von Rosser und Kollegen (2000) bzw.

blieb jedoch unbegründet bestehen. (1998) sowie aus den gängigen Datenbanken mit einbezog.seitens der „Demisten“ . Im Gegensatz zu den Simulationen der Demisten kamen sie zu dem Ergebnis. Das grundlegende „Dogma“. (2000) und weitere nukleäre Daten von Chikhi et al. Mit diesem bislang größten molekularen Datensatz bestätigt Dupanloup die Ergebnisse von Chikhi. dass ganz besonders die Regionen Südosteuropas vorgeschichtlich. 2000) kann daher einstweilen nur als 32 . 2003). Die diskutierten möglichen demographischen Prozesse bezogen sich jedoch in erster Linie auf historische Ereignisse. indem sie mitochondriale Daten von Simoni et al. Zum anderen wurde der Grad der Rückwanderung außer acht. Darüber hinaus boten die Autoren Ergebnisse ihrer Simulationen hinsichtlich des Neolithisierungsprozesses. d. 2004) kritisch in Augenschein und attestierte ihr methodische Mängel bezüglich der Auswahl der loci. Zwar plädierte Dupanloup nicht für ein Verhältnis dieser Art bereits im Neolithikum. den Richards (et al. sondern argumentierte bewusst für ein beobachtetes Verhältnis in heutiger Zeit. Auch hier beobachteten die Autoren graduelle Verteilungen der Y-STR-Haplogruppen. wie auch geschichtlich bedingt eine extreme Form eines „Palimpsest“ darstellten. dass der ursprüngliche Anstoß. 2000) mit einer Höhe von 20% postuliert hatte.von Isabelle Dupanloup und Kollegen (2004) knüpfte methodisch an die Arbeit (und die Daten) von Chikhi (et al. Eine weitere aktuelle Arbeit (Roewer et al. erstere heute nicht mehr nachweisbar seien. 2005) beinhaltete die Analyse von Y-STRHaplotypen von 12. Eine kürzlich veröffentlichte Studie von Currat & Excoffier (2005) nahm die Arbeit von Dupanloup (et al. dass bereits ab einer hypothetischen Vermischung von 3% der neolithischen Immigranten mit der indigenen Bevölkerung Europas. ein Beitrag nahöstlicher Linien von durchschnittlich 50% innerhalb von 12 europäischen Gruppen. Ein neuere Arbeit . (2000). dass trotz abnehmender Vehemenz der Debatte (Richards 2003) kaum ein Konsens bezüglich der Besiedlungsgeschichte Europas aus genetischer Sicht besteht. nur im Rahmen der Neolithisierung Europas erfolgt sein konnte. Y-chromosomale Daten von Rosser et al. Zusammenfassend kann nun festgestellt werden. dessen Auswirkungen wir im Verhältnis heutigen europäischen Genpool Europas beobachten. um der aktuellen Fragestellung gerecht zu werden. Roewer und Kollegen konnten allerdings erneut nachweisen.700 Individuen aus 91 Sammelpunkten Europas.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Ursprungspopulationen) und ließ keine postneolithische weitere Vermischung zu. 2000 und die Annäherung der Demisten an diesen Wert gemäß Simoni et al. Der oft zitierte und geäußerte Beitrag von 20% neolithischer Linien im europäischen Genpool (berufend auf Richards et al. 2002) an und erweitete die Vermischungsanalysen (admixture analysis) auf mehrere loci. Simulationen waren bereits auf die Fragestellung der möglichen Vermischung von Neandertalern und anatomisch modernen Menschen angewendet worden (Currat & Excoffier 2004). Die Analysen bzw. ein Umstand den sie mit der höheren Mutationsrate von STRs gegenüber binären Y-SNPs begründeten.h. Das wichtigste Argument gegen die Arbeit von Chikhi und Kollegen war jedoch das Fehlen zeitlicher Tiefe und die unkritische Zuordnung der Beobachtungen in die Periode des frühen Neolithikums (Richards et al. so dass lediglich die zeitlichen Maßstäbe verschoben werden mussten.

dass ein noch näher zu bestimmender Anteil der modernen Europäer südöstlichen Ursprungs zu sein scheint. Ob dieser Anteil letztlich auch mit der Neolithisierung Europas oder Teilen Europas in Verbindung steht. Arbeitshypothese standhalten. dass phylogenetisch feiner auflösende und umfassendere Studien mehr Klarheit in die Kontroverse bringen können. muss weiter offen bleiben bzw. Di Giacomo et al.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Anhaltspunkt bzw. 4). Die Debatte über die Besiedlung Europas ist nach wie vor im Gang und eine endgültige Lösung momentan nicht in Sicht (Forster 2004. 33 . wie aktuelle mtDNA Studien zeigen konnten (Achilli et al. Einigkeit herrscht in der Annahme. soll in der vorliegenden Arbeit beleuchtet werden (Kap. Es kann zum gegenwärtigen Zeitpunkt lediglich festgestellt werden. Pereira et al. 2004. 2005 und Loogväli 2004). 2004).

(1993) geprägt wurde. Vielmehr wird heute unter Einbezug der stetig ansteigenden Information seitens der Genetik das Wie der ersten (und einzigen?) Ausbreitung des AMH aus Afrika untersucht. die die heutige Variabilität des AMH als kontinentale in situ Entwicklung aus der bereits vor ~ 1. dass sich einerseits alle AMH auf ein evolutives Ereignis zurückführen lassen („Mitochondriale Eva“) und andererseits die heutige Diversität das Ergebnis multiregionaler Entwicklung aus einer früh erfolgten geographischen Aufsplittung ist.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. Diese Beobachtungen standen mehr im Einklang mit dem so genannten Weak Garden of Eden-Modell. wurde jedoch ebenfalls als zu vereinfachend angesehen. welches auch als Garden of Eden-Modell bezeichnet wurde und das replacement aller archaischer Menschenformen auf den jeweiligen Kontinenten beinhaltete. Die extreme Form des OOA-Modells. 1996. 1999) bestätigten den Ursprung der anatomisch modernen Menschen in Afrika in genetischer Hinsicht (Wallace 1999. da es kaum Erklärungsansätze zur heute beobachtbaren Variabilität des AMH bereit stellte. sondern vielmehr hierfür eine kontinentale Differenzierung mit Herausbildung regionaler Verbreitungsmuster als Folge einer (womöglich einzigen Expansion) oder weniger zu sehen sei. Forster et al.000 Jahren. Schurr et al. dass nicht eine stetige demografische Expansion aus Afrika für die heutige Variabilität zugrunde lag. Dieses Modell vertrat die Annahme. 200. 2004).B. 1990. das von Harpending et al. da einerseits die afrikanische Stichprobe selbst nicht repräsentativ genug war und auch die phylogenetische Analyse Unzulänglichkeiten aufwies. 34 . Es scheint sich somit auch aufgrund moderner mtDNA Studien bestätigt zu haben. dennoch wurde diese Arbeit kontrovers diskutiert. Eine Datierung ihres phylogenetischen Baum ergab ein Alter von ca. Die Anhänger der Recent Out of Africa-Modelle (OOA) sahen sich endlich in ihren Thesen unterstützt. 2001). Torroni et al. Dieses Modell im Rahmen der Ausbreitung des anatomisch modernen Menschen (AMH nach anatomically modern human) gilt heute als weithin akzeptiert. Watson et al. dass jeder Kontinent eigenständige und phylogenetisch tiefwurzelnde mtDNA Zweige aufwies (Stoneking et al. 1999. Kivisild et al.8 Millionen Jahren erfolgten Ausbreitung des Homo erectus aus Afrika erachteten. Jobling et al. Sie konnte anhand einer globalen Stichprobe von 147 Individuen zeigen. Bereits die ersten großregionalen mtDNA Studien konnten zeigen. Gegenstand der heutigen Forschung ist insofern kaum mehr die lange geführte paläoanthropologische Debatte zum OOA-Modell (z. 1994.3 Die Haplogruppenverteilung im modernen maternalen Genpool unter besonderer Berücksichtigung Europas Die wegweisende Arbeit zur Phylogenie der mitochondrialen DNA wurde 1987 von Rebecca Cann und Kollegen veröffentlicht. Bowcock et al. 1999. 1997. Kaessmann et al. 1994. Vigilant et al. Zahlreiche weitere Arbeiten sowohl am mitochondrialen Genom (Stoneking et al. die damit die Debatte der „mitochondrialen Eva“ entfachte. die wiederum nur einer Expansion aus Afrika folgte. 1991) als auch an nukleären Markersystemen (Tishkoff et al. 1990. Stringer & Andrews 1988) im Vergleich zu den Modellen der Multiregionalisten. dass alle untersuchten mtDNA-Linien auf einen afrikanischen Ursprung zurückzuführen seien.

oder Makrohaplogruppen (Makro-Hg(s)) erfassen ließen. Alle mtDNA-Linien außerhalb Afrikas können in zwei große Gruppen N und M (so genannte Makrohaplogruppen) aufgeteilt werden (Watson et al. Wenngleich noch nicht alle einzelnen Haplogruppen komplett sequenziert sind. 2004. Haplogruppen der Makro-Hg N sind mehrheitlich in Nordafrika. F. Eine unmittelbare Abspaltung der Makro-Hg R von N erfolgte wohl nur kurze Zeit danach. Einige Hgs der N-Familie (A. Diese unterscheiden sich von ihrem afrikanischen cluster L3 durch jeweils eine Mutation. K. die sich wiederum durch verschiedene weitere Mutationen unterscheiden lassen. Der Zeitpunkt. J. 2004). so ist dies gleichsam Gegenstand der aktuellen Forschung (z. R* beinhaltet. H1) und weiteren Varianten (z. 2001. F. Macaulay et al. 1998. 2005). 2000. Metspalu et al. 1999). Richards et al.000 Jahren angegeben. B. Y) kommen jedoch ausschließlich in Asien vor. Maca-Meyer et al. W. Thangaraj et al. Dies konnte durch initiale RFLP-Analysen. 1996. Die beiden Makro-Hgs beinhalten jeweils weitere Haplogruppen. Eine hypothetische.000 Jahren für das untersuchte indische cluster der Makro-Hg M diesem Wert nahe. Prinzipiell lassen sich bereits die Makro-Hgs N und M geographisch trennen. I. Darüber hinaus ließ sich anhand der Daten eine schnelle Verbreitung der M-Linien entlang der Südküste Asiens rekonstruieren (Forster & Matsumura 2005). 2000) mit ±60.und Ost-)Asien und sehr häufig bei der ursprünglichen Bevölkerung des amerikanischen Kontinents zu finden. im Folgenden auch als Hg oder Hgs) zusammengefasst werden. G. M*. Ingman et al. so überlappen die beiden Bereiche weitgehend. das die Hgs B. H1a oder H2a1) bis zum Haplotypen erfolgt. was eine feinstmögliche Auflösung der phylogenetischen Beziehung bedeuten würde.B. 2003. 2002. Sequenzierungen der HVR und letztlich durch die sukzessive Sequenzierung des gesamten Mitochondriums ausgesuchter mtDNA Varianten erreicht werden (Torroni et al. T. E. sowie reduziert schematische Darstellung der Haplogruppenverteilung der beiden Makro-Hgs N und M ist in Abbildung 5 zu sehen. 2001. welche sich wiederum in so genannten Super.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Mittlerweile liegt eine in weiten Teilen sehr detaillierte Phylogenie zur Variation des mitochondrialen Genoms vor. H. Als Ergebnis hiervon konnten die einzelnen mtDNA-Varianten (Haplotypen) in monophyletische Kladen (Haplogruppen.B. N* sowie ein cluster R. Die Haupthaplogruppen (z. putativen „Urbevölkerungen“ Südostasiens konnten diesen möglichen Zeitpunkt im Hinblick auf Makro-Hg M bestätigen (Kong et al. 2003). wobei die weitere hierarchische Untergliederung in Subhaplogruppen (Sub-Hg(s). H) werden nach Großbuchstaben benannt. Finnilä et al. V. Quintana-Murci und Kollegen (1999) kommen mit ±53. ab welchen diese lediglich durch die individuellen Nukleotidpositionen beschrieben werden. Aktuelle mtDNA-Studien an noch verbliebenen.B. z. Zieht man die bekannt großen Standardabweichungen der Koaleszenzzeitberechnungen in Betracht. 1997. So sind die Linien der Makro-Hg M vorwiegend in (Süd. Tanaka et al. Loogväli et al 2004. Mishmar et al. X. 1996. Quintana-Murci et al.B. wird von Ingman (et al. D. So umfasst die eine Großgruppe M die Hgs C. 2005. an dem beide Makro-Hgs Afrika verlassen haben. U. Herrnstadt et al. Q und Z und die andere Großgruppe N die Hgs A. Europa und Westasien verteilt. 35 .

M und R in Eurasien. Hypothetische Verteilung der Haplogruppen der Makrohaplogruppen N.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Abbildung 5. 36 .

sind charakteristische Positionen der coding region angegeben. M und R der ersten (und einzigen) Auswanderungswelle aus Afrika auch heute noch bemerkenswert wenig überlappen bzw. Richards et al. dass heute nur vier bzw. Forster et al. Für die Haplogruppen R. 1998.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Metspalu und Kollegen (2004) lokalisierten den Split von west. Derenko et al. austronesischen Raums erfolgte durch die Haplogruppen B. Torroni et al. Es sind mit Ausnahmen nur die kennzeichnenden Substitutionen der HVR I angegeben. 1999) unter Beibehaltung der Nomenklatur Torronis und wurde durch vollständige Sequenzierung des mitochondrialen Genoms spezifischer Hgs bestätigt (Ingman et al. 1996. 1994b. W. 2001). K und U. HV und H. T. 1996. X. fünf Hgs dort aufzufinden sind. Aus Sicht der mitochondrialen DNA hatte die Besiedlung Amerikas über die Beringstrasse zur Folge. ist in Abbildung 6 aufgezeigt. welche auch in Nordeuropa und Nordasien vorkommt und daher wahrscheinlich eine Verbreitung in und über zirkum(nord)polare Bevölkerungsgruppen erfahren hat (Brown et al. dass sich die Hauptverbreitungszonen der Makro-Hg N. Sie stellten weiterhin fest. 2001). Zudem findet sich dort die Haplogruppe X. die sich im Bereich der HVR I nicht unterscheiden lassen. U. die mit Hilfe von 12 Enzymen im kodierenden Bereich der mtDNA durchgeführt wurde. 1998. Q und weitere (Sub-)Hgs von M (Sykes et al. 1990. Brian Sykes zurückführen (Torroni et al. die aus Makro-Hg N hervorgegangen sind. Vereinfachtes Netzwerk der Makrohaplogruppe N.und osteurasiatischen Linien im Gebiet nördlich des persischen Golfes zwischen dem heutigen Iran und dem Industal. J. 1994a. Finnilä et al. 1998. Parallel hierzu wurde von der Arbeitsgruppe um Richards die HVR I sequenziert und dafür eine eigenständige Nomenklatur erstellt. 37 . V. 2001. Dies sind in erster Linie die asiatischen Linien A und B der Makro-Hg N und die Linien C und D der Makro-Hg M (Schurr et al. 1998. Torroni begann zunächst mit der Charakterisierung der Hgs H. Die phylogenetischen Beziehungen und die Verteilung der Haplogruppen in Europa lässt sich größtenteils auf die intensiven Bemühungen der beiden Arbeitsgruppen um Antonio Torroni und Martin Richards bzw. 2000. 2001). vermischt haben. 2000). Melton et al. Die Besiedlung des polynesischen bzw. Ein Netzwerk der phylogenetischen Beziehungen der hauptsächlich europäischen/eurasischen Hgs. I. Forster et al. 1994. Alves-Silva et al. Abbildung 6. 1996. 2000). 1995. P. Die Synthese der beiden Ansätze erfolgte durch Macaulay (et al. Lum et al. 1998. Lum & Cann 1998.

N1a und N1b der Makro-Hg N. sowie in Nordostafrika und Südwestasien vorhanden und ist Gegenstand ausführlicher Diskussion der vorliegenden Arbeit (Vgl. N1b. 1998). die sich jeweils in zwei spezifischen Mutationen in der HVR I von N unterscheiden. Hg N1a ist in gleichen Anteilen. Kap. Die Verteilung der mitochondrialen Haplogruppen in Europa. H. jedoch mit dem postulierten Alter der MHg N von ca. N1d lassen sich aufgrund von weiteren spezifischen coding region Mutationen in ein subcluster N1 zusammenfassen. Die europäischen Hgs von N stellen mit durchschnittlich 5% lediglich einen geringen Anteil aller europäischen Haplogruppen dar. zum anderen mit 5% in Pakistan und Nordostindien (Metspalu et al.000 Jahren.3. Zum einen durch die Haplogruppen I. 7. 2004).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Die Hgs Europas lassen sich durch zwei cluster beschreiben. welche die ursprüngliche Verbindung der MHg M und N zur afrikanischen Linie L3 betrifft und somit dieses cluster direkt von afrikanischen und asiatischen Hgs unterscheidet. Dieser Anteil nimmt im Nahen Osten sowie in Nordwestasien zu. N1a.2). Das Vorkommen der verbleibenden Zweige von N. weist allerdings zwei bemerkenswerte Verbreitungsgebiete mit deutlich erhöhten Frequenzen auf: zum einen in Finnland. ein Umstand. hierfür jedoch aufgrund der sehr geringen Diversität der W Haplotypen einen Gründereffekt bzw. der Hgs A und N9a. J. N1c. Abbildung 7. bottleneck vorschlägt. 60. Hg I ist im europäischen Raum vornehmlich im Norden und Nordwesten zu finden.000-50. West. Zentralasien. Die weitere Unterteilung von R 38 . 2001) einen Anteil von 11% beobachten konnte. U und K des cluster R gekennzeichnet (Abbildung 7). der auf eine weit zurückliegende Expansion hindeutet. X. allerdings in drei möglichen Subhaplogruppen in Europa. W. Allen Zweigen gemein ist jedoch ein relativ hohes Alter von etwa 25. 2004). Die überwiegende Mehrheit des europäischen mtDNA Genpools über 90% ist durch die Hgs HV. Die Hgs I.bzw. Hg W ist allgemein häufiger im Süden Europas aufzufinden (Richards et al. wo Meinilä (et al. ist auf (Ost-)Asien beschränkt. T. Spezifisch für das cluster R ist eine TaC Mutation an Nukleotidposition (np) 16223. (modifiziert nach Jobling et al.000 Jahren selbst in Einklang steht. V.

Unter diesen ist Sub-Hg H1 mit 30% die häufigste Linie. H11 (Loogväli et a.000 Jahren im Nahen Osten.600-13. Die feinere Auflösung sowie Charakterisierung der Hg H hatte lange Zeit Schwierigkeiten bereitet. H8. 13% des europäischen Genpools darstellt. dessen Auflösung sich die aktuelle Forschung zur Aufgabe gemacht hat (Loogväli et al. 1995. Zudem ist innerhalb Europas ein deutlicher Gradient von der Iberischen Halbinsel nach Nordosteuropa der Abnahme von H1 festzustellen. 2000).1. wie es bereits für Hg V vergleichsweise postuliert wurde (vgl. H4 (Herrnstadt et al. 1999. h. Quintana-Murci et al. 1998. 2001). Eine weitere Ausnahme bilden die Saami. 2004). H5. auf der Iberischen Halbinsel in Einklang bringen. jedoch verschwindend gering im Nahen Osten zu finden ist. 2001). Tambets et al. 2004) und H9 sowie H12-H15 (Achilli et al. welche im Südwesten zu 17% nachzuweisen ist. Anderson et al.400 Jahren vor heute (v. Die Häufigkeit variiert innerhalb Europa zwischen 40-60%.l. die Diversität allerdings sehr gering ist 39 . wofür Metspalu et al. Hg F unterscheidet sich an np 16304 und Hg B zeichnet sich durch eine charakteristische Deletion von 9bp sowie der HVR I Mutation an np 16189 aus. 1999. die im Nahen Osten auf ~20-30% abnimmt (Richards et al. bei welchen der Anteil an Hg V bei 40% liegt (Sajantila et al. Fedorova et al. 2004). 2004).bzw. Pereira et al. 1998) und in West. H3. H10. 1998). 2004. Als Ausnahmen konnten die Basken und Katalanen Spaniens mit einer Frequenz von 20% genannt werden (Torroni et al. 2001) im heutigen Kroatien. 2003. (2000) datiert und lokalisiert die zugrunde liegende Expansion des H cluster vor ~25. Zusammen mit der Schwesterlinie Hg V lässt sich Hg H im cluster HV vereinen. Die häufigste Haplogruppe Europas ist H. h. 2003).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA erfolgt durch spezifische Mutationen. Diese beiden Hgs sind prinzipiell auf den asiatischen Raum beschränkt. Die Linien der Hg HV selbst (HV1-3) sind vorwiegend im Gebiet des Nahen und Mittleren Ostens und im Kaukasusgebiet verbreitet. In geringen Anteilen ist Hg H auch in Sibirien und Südasien zu beobachten (Kivisild et al. von einer Ausnahme. Entgegen der ursprünglich eher uniformen Verteilung über Eurasien (wie sie auch noch in Abbildung 5 dargestellt ist) zeigen in den jeweiligen Studien von Loogväli. welche gleichermaßen ca. Die errechneten Koaleszenzzeiten für die Sub-Hgs H1 und H3 mit einer Spanne von ~8. welche sich im HVS I Bereich der diversen Linien nicht unterscheidet bzw. 2004. Diese Beobachtung lässt sich gut mit einer Expansion aus dem glazialen Refugium im frankokantabrischen Raum bzw. 2004). H6 (Quintáns et al. berichten Tolk (et al. Richards et al. Zentralasien relativ häufig (Metspalu et al. ausreichend kennzeichnend ist. Achilli und Pereira die einzelnen Sub-Hgs von H phylogeographische Verbreitungsmuster. 3. Torroni et al. Hg F betreffend. H7 (Quintáns et al. Selbiges zeigt sich bei Sub-Hg H3.000 Jahren v. welche wiederum ein großes cluster verschiedener H-Linien in sich vereint.4. Kap. Comas et al. 2004) beschrieben werden. H2 (Finnilä et al. da sie die Referenzsequenz CRS (Cambridge Reference Sequence.) passen in den Zeitraum der Hypothese. (1999) ein Alter von ~40. 2004. 1981) beinhaltet. Basierend auf vollständigen Sequenzierungen des mtDNA Genoms distinkter H-Hgs konnten sukzessive die Zweige H1. Hg V (16298) ist mit einer Frequenz von 1-6% in Europa vertreten. Loogväli et al. 2002). und auch die Auflösung der RFLP-Analyse an ihre Grenzen gestoßen war. errechnen. das durch np 73 charakterisiert ist. Derenko et al. 2005). Des Weiteren ist Hg H auch in Nordafrika (Rando et al.

2000) im Rahmen der founder analysis als putative Kandidaten für eine neolithische Expansionen erachtete (vgl.2% fällt.4% für den vorderasiatischen Raum um den heutigen Iran charakteristisch. die höchste Frequenz wird bemerkenswerterweise mit 16% für die ugrisch-sprachigen Mansi Westsibiriens berichtet (Derbeneva et al. 16219) vermutlich eine Reexpansion entlang der Nordküste Afrikas. Hg U4 (16365) ist die Zweithäufigste der europäischen ULinien. U4 (16356) und U5 (16270) und K (16224. Kap. wo sie vermehrt in Nordwestafrika zu finden ist und in Europa auf den iberischen Raum beschränkt ist. sich jedoch in weiteren charakteristischen Positionen (u. Für Hg U4 ist innerhalb Europas ein leichter Gradient von West nach Ost bzw. So fand z. 16311) vertreten. angesetzt.1). Die Datierung der Hg V auf ~10. Sub-Hgs) unterscheiden sich von cluster R durch eine charakteristische Restriktionsschnittstelle des Enzyms Hinf I in der coding region. 16069 für Hg J und 16294 für Hg T) unterscheiden lassen. Die Haplogruppe U und ihre Subhaplogruppen (Sub-Hg bzw. Hg U2 ist ebenfalls sehr selten in Eurasien. Für das hohe Alter der Hg U sprechen weiterhin die großräumige Verbreitung und die regionale Differenzierung der einzelnen Untergruppen. 16311) zählt ebenfalls zu cluster U. wurde jedoch ursprünglich aufgrund einer Rückmutation im kodierenden Bereich als eigenständige Hg beschrieben. 2000). Richards et al.2. dagegen in Europa sehr selten zu finden. dass im frühen Oberen Paläolithikum ein Großteil der ersten Bevölkerung im eurasischen Raum dieser mtDNA Linie angehört haben muss und dass sich Hg U5 sehr wahrscheinlich früh in Europa ausgeprägt hatte.000 Jahre v. dass auch für Hg J und T ein nahöstlicher Ursprung vor bzw. ihre Frequenz im Nahen Osten allerdings rasch unter 0.000-15. 1998). Dies bringt Richards zu der Annahme.000 Jahre v. tritt dafür aber mit einem vergleichsweise hohen Anteil von ca. Süden zu erkennen. und deren gehäuftes Vorkommen in Südwesteuropa sieht Torroni zudem als Beweis für eine postglaziale Expansion der Hg V aus Iberien ins Festland. 8% auf dem Indischen Subkontinent auf. Das Alter dieser Linie wird von Richards et al. 50. 1997.000 Jahren sowohl in Europa als auch im Nahen Osten (vgl. 14% durch die Linien U3 (16343).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA (Torroni et al. was ähnlich wie für Hg U5 eine Verbreitung vor der letzten Maximalvereisung (oder im Folgenden synonym: LGM für last glacial maximum) vorgibt. 68% beträgt.a. eine weitere Linie von U mit der HVR I Position 16318 ist wiederum mit einer Frequenz von 9. Beide Linien zeigen eine komplexe innere Struktur. 1998). die jedoch auch jüngere sternförmige cluster beinhalten. die beide die typische np 16126 aufweisen. K ist überall in Europa und Eurasien allgemein mit einer Frequenz von ~5% im 40 . Die Sub-Hgs U1-U6 lassen sich jedoch im Bereich der HVR I durch eine oder mehrere Mutationen charakterisieren. Die Hg J und T sind Schwesterlinien. 3. während der letzten Eiszeit angenommen werden kann. Hg U6 (16172. Die Hg U ist in Europa mit einer Häufigkeit von ca. In variierender Zusammensetzung stellen beide etwa ~20% des europäischen Genpools dar. die Richards et al. Abbildung 4. die ursprüngliche Benennung jedoch nach der Korrektur beibehalten (Hofmann et al. h. wobei der Anteil der Linie U5 innerhalb dieser ca. h. 2002). da sie überall im heutigen Europa in vergleichbaren Anteilen zu finden ist. Richards et al.B. Hg U7. (1998. Es gilt als sehr wahrscheinlich. Hg K (16224. Koaleszenzzeitberechnungen sowohl für U als auch U5 allein ergaben ein sehr hohes Alter von ca. (1998) auf ~25.

41 . für die eine frühe Ausbildung in Europa anzunehmen ist. die Europa bereits im ausgehenden Paläolithikum bzw. 2000). 1998. H1 und H3. Es lässt sich grundsätzlich sagen. welche sich sehr wahrscheinlich periglazial aus paläolithischen Vorläuferlinien entwickelten und postglazial aus den Refugialzonen verbreiteten.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA maternalen Genpool vorhanden. sowie Hgs V. dass sich der Großteil der heutigen europäischen mtDNA Variation aus Haplogruppen zusammensetzt. Dies lässt sich aufgrund der leicht höheren Haplotypendiversität und auch höheren Koaleszenzzeiten für den Nahen Osten herausarbeiten (Torroni et al. Mesolithikum vom Nahen Osten aus erreicht haben. Ausnahmen bilden lediglich Hg U5. Richards et al. mit leicht steigender Tendenz jedoch in westeuropäischen Bevölkerungen.

Cooper et al. Dies bedeutet. 42 .die zeitliche Tiefe .1 und a2. Dieser Umstand soll in Abbildung 8 verdeutlicht werden.1 angeführt). 3.B. Schätzwerte zum Zeitpunkt von Ereignissen erbracht werden. Ein rezentgenetischer Querschnitt kann lediglich die Situation zum heutigen Zeitpunkt erfassen. 2002 für pleistozäne Braunbären. 2002 für Höhlenbären. der Neolithisierung anhand des untersuchenden Datensatzes nicht zulässt. Sofern die Authentizität der erhobenen Daten gewährleistet werden kann. Letztlich müssen diese Aussagen jedoch als Annahmen bestehen bleiben. Möglicherweise muss die Analyse alter DNA aufgrund inhärenter Limitierungen auf das mitochondriale Genom beschränkt bleiben (die Ursachen hierfür sind in Kap. sowie einer geringeren Frequenz von a4. jedoch führte auch dies nicht zu einem umfassenden akzeptierten KonsensModell. Burger et al. Hofreiter et al. Barnes et al. Die Verteilung von beobachteten Typen lässt somit nur bedingt Aussagen zur Vergangenheit zu. liegt in der Tatsache begründet. Es können nur indirekt Aussagen über mögliche Verhältnisse und Zustände in der Vergangenheit erstellt werden und über Datierungsmöglichkeiten. Momentan ist nur die Analyse von alter DNA (aDNA) imstande.B. wie z.B. welche sich historischen Fragestellungen widmen. in genetischer Hinsicht gesicherte. können jedoch die direkt ermöglichten Einblicke in vergangene genetische Zustände Antworten auf gezielte Fragestellungen liefern. Ein direkter Ansatz zur Erfassung des genetischen status quo an einem beliebigen Punkt in der Vergangenheit kann daher nur durch einen gezielten zeitlichen Querschnitt erfolgen. Ein Querschnitt auf der Zeitachse zu einem früheren Zeitpunkt ergäbe zumindest einen terminus post quem bezüglich der Aufsplittung des Typs a2. Die archäologische Forschung hat längst differenziertere Modelle entwickelt. zum Zeitpunkt der Aufsplittung der Typen a2.nicht direkt an den Daten selbst ablesbar ist.7. 2004 für Höhlenlöwen). dass sie fast ausnahmslos mit modernen Daten arbeiten (müssen). Daher wird man im Rahmen der Genetik vorerst auf eine Vereinfachung von Modellen zurückgreifen müssen. Das Hauptproblem von populationsgenetischen Studien. Aussagen über vergangene Zeiten zu ermöglichen. Zusätzlich könnte bei ausreichender Stichprobengröße auch das Vorkommen einer räumlich differenzierten Linie zu diesem Zeitpunkt der Vergangenheit noch ausgeschlossen werden. dass der Hauptpunkt der historischen Fragestellung . welche eine hypothetische Verteilung fiktiver genetischer Linien in Raum und Zeit darstellt.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. der Existenz einer ausgestorbenen Linie a3 (ohne jedoch die Aufsplittung vor dem Verschwinden zu erfassen).4 Methodische Grenzen populationsgenetischer Studien und Einsatzmöglichkeiten von aDNA-Analysen Die grundlegenden Probleme rezentgenetischer Untersuchungen liegen im methodischen sowie analytischen Ansatz begründet. wie sie bereits für einige (vor allem ausgestorbene) Tierarten erbracht werden konnten (z. 1992. 2001 für Moas. Zudem liefert er Aussagen über die anteilig höhere Frequenz von a1.2. wie die der molekularen Uhr. die allerdings in den wenigstens Fällen der Realität gerecht werden können. der feine zeitliche und geographische Auflösungen eines komplexen Vorgangs wie z.

Impulse für zukünftige Analysen geben. Ein diachroner Ansatz von Untersuchungsquerschnitten durch die Zeit dürfte jedenfalls vorerst Fiktion bleiben. Abbildung 8: Schema einer phylogeographischen Verteilung von genetischen Varianten in Raum und Zeit. Erläuterungen hierzu im Text. so dass Vergleiche mit modernen Untersuchungen statistisch erschwert oder gar unmöglich sind. Zumindest aber kann jedes untersuchte Individuum wertvolle Hinweise bzw. Die roten Linien entsprechen zeitlichen Querschnitten mit den jeweiligen Frequenzverteilungen der verschiedenen Varianten in den zugehörigen Kreisdiagrammen. 43 .Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Sicherlich wird die Stichprobengröße bei alter DNA immer reduziert sein.

Millard 2001. 1997. Kap. 1992. Dies und dem Umstand. 1997. 1999). Nielsen-Marsh et al. 1999.5 Übersicht zu bisherigen paläogenetischen Studien Die Forschungsrichtung der Analyse alter DNA ist vergleichsweise jung. Collins et al. Diese Krise erfolgte im Rückblick jedoch rechtzeitig. 2000a. beschränkte man sich in den meisten frühen aDNA-Studien noch weitgehend auf die Analyse des Mitochondriums. Doran et al. 1996. Gilbert et al. verdankt der junge 44 . 1992. 1992) und aus Knochen (Hagelberg 1989. 1984. Cooper und Poinar 2001. 2005a). Die ersten Studien zu Erhalt und Isolierung von alten DNA-Molekülen wurden bereits vor der Etablierung der Technik der PCR (polymerase chain reaction) durchgeführt (Hunan Medical College 1980. Krajewski et al. Hummel et al. Zischler 1995. Dies betraf vor allem die Arbeiten. 2004.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. aus Weichteilen von ausgestorbenen Museumstieren (z. Hofreiter et al. Im Jahr 1991 erschien die erste Veröffentlichung über die Amplifikation nukleärer multicopyDNA aus Knochen (Hummel et al. Pääbo 1984. war spätestens ab diesem Zeitpunkt das Interesse seitens der Anthropologen und Archäologen geweckt. nachdem einige Arbeiten kritischer Überprüfung nicht standhalten konnten. Johnson et al. Cooper et al. (1985) sowie Mullis & Faloona (1987) ermöglichte eine anhaltende Entwicklung des Forschungsbereichs der so genannten ancient DNA (aDNA). Sykes 1997.insbesondere im Knochen . 1986). 1997. Smith et al. 1999. 1985. Der anfänglichen Begeisterung über die neu eröffneten Möglichkeiten zur Beantwortung alter Fragestellungen folgte alsbald die Ernüchterung. Horai et al. 2001. 2000. Burger et al. 1996. Doch auch die erste Veröffentlichung über nukleäre single copy-Fragmente aus prähistorischen Weichteilen war bereits 1986 erfolgt (Doran et al. Handt et al. Götherström et al.3). 1993). 3. da somit eine Reihe von Kriterien herausgestellt wurde (vgl. Nachdem 1989 die Amplifikation von Fragmenten der mtDNA aus Knochen beschrieben wurde.vermehrt werden (Colson et al. dass in der Forschungsgemeinschaft weitgehend den Kriterien zur Authentifizierung entsprochen wird. Die wesentlichen Publikationen der ersten Jahre nach der Etablierung der PCR-Technik beinhalteten Studien zur Isolierung von DNA aus bis dahin „unzugänglichen“ Materialien wie in Bernstein eingeschlossene Insekten und Pflanzen (Cano et al. Krings et al. 2002). Poinar et al. DeSalle et al. Hummel & Herrmann 1991). Burger et al. Walden & Robertson 1997).6. Pääbo et al. Higuchi et al. da sie sich als Kontamination moderner DNAMoleküle erwiesen (Pääbo & Wilson 1991. 2004. Austin et al. 2001. welche ein extrem hohes Alter bis zu mehreren Millionen Jahren propagierten. 1992. 1990. Sie entsprang Anfang der 80er Jahre der Genetik und hat sich in ihrer 20-jährigen Geschichte vom ursprünglichen Charakter eines Orchideenfachs zu einem etablierten und interdisziplinär orientierten Wissenschaftszweig der Genetik entwickeln können. Mittlerweile konnten jedoch die Erkenntnisse hinsichtlich der Erhaltungsaussichten alter DNA . Thomas et al. 1986). Ausgehend von der Situation in vivo in welcher mitochondriale DNA in vergleichsweise höherer Kopienzahl als Kern-DNA vorliegt.B. Doch erst die enzymatische Vervielfältigung gezielt gewählter DNA-Abschnitte durch die Etablierung der PCR-Techniken durch Saiki et al. 2000b. Willerslev & Cooper 2005. welche auf bis dato erfolgte methodische Unzulänglichkeiten abzielten und die zur Authentifizierung von aDNA-Resultaten herangezogen werden (Poinar et al. 1989.

der Domestikationsereignisse intensiver behandelt werden. wurde in Folge aufs heftigste diskutiert (Abbott 2003. 2001b). Die Herangehensweise.5. Krings et al. die unter anderem die bekannten Funde Lake Mungo 3 und Kow Swamp enthielten. verzichtete jedoch auf Grund dieser potentiellen Kontaminationsgefahr auf die eingehende Weiterbearbeitung der Skelettfunde. 2004). Cooper et al. In der nachfolgenden Rezeption der Arbeit wurden die Ergebnisse als Beweis dafür gewertet.und Frühgeschichte des Menschen Die wohl bekannteste Arbeit über die Analyse alter DNA wurde 1997 von Krings und Kollegen veröffentlicht. Ebenfalls für Aufsehen sorgte die Publikation der Australier Gregory Adcock und Kollegen (2001) über zehn pleistozäne bzw. Knight 2003. 3. Die Interpretation der Ergebnisse und hier besonders die postulierte phylogenetische Einordnung des Fundes Lake Mungo 3. 2004. Zahlreiche Arbeiten beschäftigten sich mit der phylogenetischen Stellung der Taxa Neandertaler und anatomisch moderner Mensch (Nordborg 1998. Die aDNA-Forschung ist in ihrer 20-jährigen Geschichte bemerkenswert interdisziplinär geworden.1 Stammesgeschichte sowie Vor. dass die Neandertaler keinen Beitrag zum genetischen Erbgut des modernen Menschen lieferten. obwohl sie die geforderten aDNAArbeitskriterien zu erfüllen schien. Eine Bestätigung der Ergebnisse erfolgte durch weitere erfolgreiche Analysen an Neandertalerfunden aus Mezmaiskaya im Nordkaukasus (Ovchinnikov et al. dass sie nie zu 100% ausgeschlossen werden kann. 2000. Die Rezeption dieser Ergebnisse erfolgt jedoch seitens der Archäologen und Paläontologen nach wie vor zögerlich und kritisch (Schäfer et al. 2000) und erneut der Feldhofer Grotte (Schmitz et al. 1999). 2002. Die erfolgreiche Untersuchung der Region HVS II wurde 1999 ebenfalls publiziert (Krings et al. Die aktuellste Arbeit an Neandertalern von Serre und Kollegen (2004) beinhaltete auch die Analyse einiger Funde zeitgleicher anatomisch moderner Menschen. Ihnen gelang es. 45 . 2000). welche grundlegend zu aktuellen Fragen beitragen konnten (Pääbo 2004). Sequenzen von weiteren Neandertaler-Individuen erschienen erst kürzlich (Serre et al. Individualisierungskraft der untersuchten Marker und die damit verbundene Problematik. Barbujani & Bertorelle 2003. 2002).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Zweig der Paläogenetik eine Reihe von Arbeiten. 2004). Cooper et al. 2004). welche zudem die Out of Africa Hypothese in Frage stellen sollte.000 Jahre) (Caramelli et al. aus dem namensgebenden Fund des Neandertalers der Feldhofer Grotte DNA zu isolieren und mtDNA-Abschnitte des HVS I zu amplifizieren. Die immer währende Kontaminationsgefahr durch den Mensch als Bearbeiter des Menschen aufgrund der zu geringen Diskriminierungs. nicht zuletzt aufgrund der scheinbar sensationellen Ergebnisse. wurde hart kritisiert (Relethford 2001).bzw. Eine Studie an zwei spätpleistozänen Funden anatomisch moderner Menschen (24. Serre et al. 2003) stand ebenso stark in der Kritik. Vindija in Kroatien (Krings et al. 2004). wobei gemäß der vorliegenden Arbeit die betreffenden Kategorien der aDNA menschlicher Quellen bzw. so dass ein Abriss der wichtigsten Arbeiten in Kategorien erfolgen muss. holozäne australische Funde. sondern in erster Linie wegen methodischer Mängel (Cooper et al. die Fragestellung und die methodische Ausrichtung der Arbeiten sind breit gefächert und von den jeweiligen einbezogenen Disziplinen geprägt. Guitérrez et al.

2004a. Jesse James (Stone et al. denn der Bearbeiter als erste Kontaminationsgefahr stellt ein methodenimmanentes Hindernis dar. 3. Abgesehen von deren 46 . 2004d. im Artenschutz Anwendung finden können (Bollongino 2000. Material. dem Verdacht der möglichen Kontamination nicht entgehen. 2000b. zusätzlich zu den erbrachten Authentifizierungsleistungen.und mesolithischen Skeletten aus Italien zu sehen (Di Benedetto et al. die Anmerkungen zur Qualitätssicherung bzw. Als prominentes Beispiel können die molekulargenetischen Untersuchungen an der als „Ötzi“ bekannt gewordenen Eismumie aus den Tiroler Alpen genannt werden (Handt et al. 2004c.5. warum die bislang publizierten Arbeiten zum Menschen immer hart in der Kritik standen und letztlich die Arbeiten. 2005b). Haak et al. 2003. aufgrund der Datenmenge kritisch zu sehen. da die beiden neolithischen Sequenzen im Gegensatz zur mesolithischen Sequenz im heutigen Genpool vorhanden seien. Haak et al. die Auslegung selbst blieb allerdings immer umstritten. Burger et al. Burger et al. der von Serre und Kollegen vertreten wird. 2001). einerseits durch methodische Logik und andererseits durch die im genetischen Rahmen sinnvollen Resultate überzeugen können (Ricaut et al. die. An diesem Fund lässt sich beispielhaft das „Einzelfundproblem“ erörtern.und Spurenkunde Veröffentlichungen dieser Art beinhalten die Etablierung von Methoden zur Speziesidentifikation bspw. Einige Studien an menschlichen vorgeschichtlichen Proben sind bezüglich ihres Zeitrahmens für die vorliegende Arbeit von besonderem Interesse. Lalueza-Fox et al. 2005a. zu Authentizitätskriterien beinhalten. 2001). Somit lässt sich leicht begründen. Die Ergebnisse dieser Arbeit wurden zwar von einem unabhängigen Labor bestätigt. Dem negativen Ansatz. 2000). im archäologischen Fundgut. welche wiederum in der Materialanalyse. dass eine genetische Diskontinuität zwischen Mesolithikum und heute bestünde. Leider wird hier oft die Bedeutung der einzelnen Arbeiten weniger an den jeweiligen Ergebnissen bemessen als an der Überzeugungskraft der Authentizitätsnachweise. 2001) und Isaac Newton (Gilbert et al. Im selben Zusammenhang sind auch die ersten Analysen an drei neo. 2004b. Keyser-Tracqui et al. 2004) oder die schon über ein Jahrzehnt andauernde Kontroverse um die Zarenfamilie (für eine aktuelle Zusammenfassung siehe Knight et al. denn die europäische Zuordnung der „Ötzi“-Sequenz war aus archäologisch-anthropologischer Sicht nicht als überraschend anzusehen. zur Kontrolle der Nahrungsmittelindustrie sowie bspw. Endicott et al.2 Identifikation. Als Beispiel kann hier der Evangelist Lukas (Vernesi et al. 2004. welches theoretisch nur durch äußerste Sorgfalt und strenge Authentizitätskriterien umgangen werden kann. von Europäern bearbeitet. 2003. Diesbezüglich ist die von den Autoren angeführte Aussage. 1994).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Die Analyse alter DNA von anatomisch modernen Menschen nimmt in der aDNAForschung zweifellos eine besondere Stellung ein. Des Weiteren erfolgten unter dem Begriff der Identifikation auch der Forensik angelehnte Arbeiten im Zuge derer mit vergleichbaren Methoden versucht wurde. historische Persönlichkeiten zu identifizieren. vielmehr kann ein europäischer Fund. stehen eine Reihe anderer Untersuchungen an menschlichen Proben gegenüber. zahlenmäßig die eigentlichen Forschungsarbeiten übertreffen. 2004) angeführt werden.

3. 3. 2004d. 2004) und darüber hinaus ethische Bedenken geäußert (Andrews et al. die im Gewebe persistieren können. 47 . wiederum Rückschlüsse auf die soziale Struktur der zu rekonstruierenden Lebensgemeinschaft zulässt (Schultes et al. 2003a. Ein Vorteil. Vergleichbar mit dem Kontaminationsproblem bei der Bearbeitung von menschlicher DNA (jedoch in noch extremerem Ausmaß) erweist sich die mikrobielle Kontaminationsgefahr (Willerslev et al. 2004. 2001. ist. 1999.a. im Gegensatz zu Pathogenen also keine äußeren Einflüsse durch falschpositive Ergebnisse die Analyse erschweren und zweitens eher selten sind. Haas et al.4 Epidemiologie. Weitere Arbeiten thematisieren den Nachweis des Pesterregers Yersinia pestis (Drancourt et al.3 Verwandtschafts. Diese Fragestellung ist insbesondere für Anthropologen und Archäologen bei binnenstrukturellen Untersuchungen innerhalb bspw. Fletcher et al. 2000a. 2000. Pathologien und andere genetische Marker Eine eher medizinische Ausrichtung erfährt die Analyse von alter DNA beim Nachweis von Pathogenen wie Viren und Bakterien. 2004).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Öffentlichkeitswirksamkeit wurden letzteren Arbeiten wenig wissenschaftlicher Nutzen zugeschrieben (Pääbo et al. 2003) oder der ankylosierenden Spondylitis (Haak et al. Jedoch werden auch diese Arbeiten kritisch betrachtet. 2005a). was u. dass ein „Kontaminant“ Träger des gleichen Merkmals ist. 2004). 1999. Eine benachbarte Arbeitsrichtung konzentriert auf den Nachweis von genetisch disponierten Pathologien wie der Zystischen Fibrose (Bramanti et al. bedeutend verringert ist. Keyser-Tracqui et al. 1998. Gilbert et al. Reid et al. da die bekannten rezenten Mikroben eine globale Verteilung zeigen. womit die Kontaminationsgefahr bzw. 1994.und Geschlechtsbestimmung Ebenfalls an die moderne Rechtsmedizin angelehnt sind die Anwendungen von Methoden zur Verwandtschafts. 2003b. 2004. 2004a). Ricaut et al. Viele Arbeiten hierzu beinhalten den Nachweis des Tuberkuloseerregers Mycobacterium tuberculosis (Salo et al. die Wahrscheinlichkeit. Schewe et al. dass erstens die zu untersuchenden Marker genetische Prädispositionen darstellen. Zink et al. einer Gräbergemeinschaft von Bedeutung. Hummel et al. Raoult et al.5. 2000b. 2003). Donoghue et al. 1998. eines Gräberfeldes bzw. 2004. der Lepra Mycobacterium laprae (Taylor et al. Haas et al. Donoghue et al.5. die kaum eine geographische Charakterisierung zulassen (Willerslev & Cooper 2005). 2003). Gerstenberger et al. 1999). da zum einen einige Bodenbakterien starke Ähnlichkeiten zum Tuberkuloseerreger aufweisen (Pääbo et al. 2005. Drancourt & Raoult 2002).und Geschlechtsanalysen. 2000. der diesen Arbeiten innewohnt. 2000. 1997. 2001) oder des Erregers der „Spanischen“ Grippe von 1918 (Taubenberger et al. 2005b) und zum anderen ein Nachweis des Pesterregers an scheinbar gesicherten historischen Proben erfolglos blieb (Gilbert et al.

2004) gezeigt werden konnte. der je nach Fragestellung erbracht werden kann und der in einigen Bereichen eine willkommene Ergänzung. 48 . 2002. 1994. 1992. 3. 2004). für Adélie-Pinguine (Ritchie et al. Leonard et al. So liegen bereits für den erfassenden Zeitrahmen der möglichen DNA-Erhaltung für sehr viele (ca. 2001. 2001a. Die phylogenetische Analyse der Sequenzen ergab. Orlando et al. das Riesenfaultier (Höss et al. Letzteres gilt allerdings nur für die Tierwelt und nur mit Einschränkungen für die Pflanzenwelt. Grizzlybären (Miller et al. 2002. wie z. 2002b). 1989. um bestehenden Fragen der Bereiche Paläontologie. Bunce et al. 1994. 2004). So verwundert es nicht. der Moa (Cooper e al. Hofreiter et al. 2003. Huynen e al. 2000) und an Bisons (Shapiro et al. Haak et al. Ein möglicher Grund hierfür ist sicherlich der enorme Erkenntnisgewinn. Seeotter (Larson et al. 1997). 1984) durchgeführt wurde.5. 2003). 50) (teilweise heute ausgestorbenen) Tiere des späteren Pleistozäns. Greenwood et al. Aber auch die Analyse von alten Funden heute noch existierender Spezies erbrachten wertvolle Einsichten in die Phylogenie und Dynamik von Populationen. Kühn et al. 1994. 2005) und der Riesenhirsch (Lister et al. leo persica) handelte und dass der Höhlenlöwe nach ca. der Beutelwolf (Thomas et al. der Allele der ABO-Blutgruppen (Hummel et al. (Archäo-)Zoologie. der genetischen Variabilität und der phylogeographischen Verbreitung liefern konnten. Für mehrere Spezies konnten sogar für gewisse Regionen und einen limitierten Zeitraum diachrone Beobachtungen der Populationsdynamik gemacht werden. wie vor allem an nordamerikanischen Braunbären (Barnes et al. 1998). Als Beispiele seien hier ausgestorbene Arten wie das Mammut (Hagelberg et a. Ein zweiter Grund ist die geringere Kontaminationsgefahr bei Einhaltung der aktuellen Standardvorkehrungen. leo senegalensis) und des asiatischen Löwen (P. womit erstmals die umstrittene systematische Stellung dieser Tiere geklärt werden konnte.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Einige Arbeiten widmeten sich auch dem molekulargenetischen Nachweis vormals klassischer genetischer Markersysteme. Loreille et al.B. 1996). 600. 2002. 2002). Hasen (Hardy et al. Ein aktuelles Beispiel der Arbeitsgruppe befasste sich mit der Taxonomie des Höhlenlöwen (Panthera leo spelaea). die an einem Museumspräparat des Quaggas (Higuchi et al. in einer großen Anzahl vorliegen. Archäologie nachzugehen. 2005) angeführt. ermöglichte per genetische Zeitreise die direkte Analyse eines mittlerweile ausgestorbenen Tieres. Höss et al. 1995). (Archäo-)Botanik bzw.000 Jahren Isolation in Europa ohne Nachkommen ausstarb (Burger et al. der Riesenadler (Bunce et al. Noro et al. sowie des Holozäns Arbeiten vor. wenn nicht ein dringendes Desiderat darstellt. welche einen nicht unbeträchtlichen Beitrag zu Fragen der phylogenetischen Stellung. so z. B. Krajewski et al. 2005. dass bis heute Studien. 2002). 1999. dass es sich bei dem Höhlenlöwen um eine Schwesterart des afrikanischen (P. der Höhlenbär (Hänni et al.5 Phylogenie und Phylogeographie Bereits eine der ersten Untersuchungen alter DNA. welche sich die Möglichkeiten der aDNA-Analysen zu Nutze machen. 2004). 2002a. leo leo und P. 2003) und Hawaiigänse (Paxinos et al.

Damit konnte sie eine unabhängige Domestikation von Wildrindern in Europa wie sie von einigen Archäologen postuliert wurde. So konnte gerade die begleitende Arbeit dieses Projektes (vgl. Zudem konnten sie auch Chloroblasten-DNA nachweisen. Permafrostböden und Eisbohrkernen nachzuweisen. als sie an Fäkalien von Bären erfolgreich DNA sowohl der Bären als auch der verdauten Nahrungspflanzen nachweisen konnten. 2003. 1999. Dieser nichtinvasive Ansatz wird standardisiert auch zur Kontrolle von Wild. die Zusammensetzung der Ernährung zu rekonstruieren. Darüber hinaus konnte gezeigt werden.000 Jahren nachgewiesen werden (Willerslev et al. 1) von Bollongino (2005) wertvolle Hinweise zum Ursprungsgebiet der modernen Hausrinder in Europa liefern.000 Jahren erfolgte. in der sie versuchten. da sich die nachgewiesenen Moleküle einerseits nur bedingt datieren und andererseits nicht reproduzieren lassen (Hofreiter 2003. Eine umfassende. 200. 2000. Ebenso ungewöhnlich war der Ansatz.5. Nutzpflanzen.7 Domestikation von Tieren und Pflanzen Veröffentlichungen dieser Art befassten sich mit Ursprung und Auswirkungen der Domestikation der heutigen Haustiere bzw.a.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. Moderne DNADaten lieferten jedoch den Nachweis für mindesten drei Domestikationsursprünge (Guiffra et al. Bollongino konnte diesen Befund direkt anhand von aDNA-Daten neolithischer Hausrinder und Auerochsen Mitteleuropas sowie aus dem Nahen Osten bestätigen. da sich neben Hinweisen zu Ernährungsweise und Gesundheitszustand auch verwandtschaftliche Verhältnisse rekonstruieren lassen (Constable et al. Bison und diversen Pflanzen und Bakterien in Schichten von teilweise sehr hohem Alter von mehreren 100. dass die Abspaltung des europäischen Auerochsen von der Population in Vorderasien und damit von den Vorläufern der späteren Hausrindform bereits vor ca. Poinar und Kollegen (1998). 1995).h. alte DNA in Sedimenten von Höhlen. sowie Hofreiter und Kollegen (2000) gelang es jeweils in ihren Studien an Koprolithen (fossile bzw. subfossile Fäkalien) sowie an Knochen. Hierbei konnten u. Kap. 2004). Kijas & Anderson et al. Es wurde bereits von Troy und Kollegen (2001) aus modernen Daten und Bailey und Kollegen aus einigen alten Funden (1996) ein rezenter.und Zootierbeständen genutzt. dass Poinar und Kollegen 2001 eine Arbeit zu menschlichen Koprolithen paläoindianischer Ureinwohner Amerikas veröffentlichten. Anhand des umfangreichen archäozoologischen Fundmaterials wurde auch für die Hausschweine eine erste Domestikation im Nahen Osten angenommen. Sequenzen von Mammut. 1995. DNA des ausgestorbenen Faultiers Nothrotheriops shastensis nachzuweisen.5. die mehrere mögliche 49 .6 Rekonstruktion von Ökologie und Ernährungsgewohnheiten Einen auf den ersten Blick ungewöhnlichen Ansatz verfolgten Höss und Kollegen (1992). Stokstad 2003). Dieser Ansatz ging soweit. Kohn et al. ausschließen. Diese Arbeiten können jedoch nur vage Hinweise zur Rekonstruktion ökologischer Verhältnisse liefern. 2001). was auch im Rahmen dieser Arbeit von vordergründigem Interesse ist. welche sie mit Daten der modernen Fauna am Fundort verglichen. 3. aktuelle Studie konnte nun unter Einbezug von 165 alten Proben eine detaillierte Phylogenie erstellen. neolithischer Ursprung der Hausrinder im Nahen Osten postuliert. d.

Zudem konnten im Gegensatz zu den Rindern keine Übereinstimmungen mit den Daten aus dem Nahen Osten bzw. Vorderasien nachgewiesen werden. Vila et al. 2002). 1997. Dies scheint zumindest für den Eurasischen Raum zuzutreffen. als dass mindestens 77 Stuten zur heutigen Variabilität beigetragen haben müssen. 2002). deren Haplogruppen allerdings weder mit geographischen Regionen noch mit einzelnen Zuchten in Verbindung zu bringen sind (Jansen et al. Ebenfalls bemerkenswert sind die Ergebnisse. dass gerade der von allen Haustieren am längsten domestizierte Hund noch eine sehr große Ähnlichkeiten mit dem Wolf besitzt. Für die Domestikation von Nutzpflanzen liegen überwiegend Resultate aus Studien mit modernen DNA-Daten vor. Luikart et al. wovon eines auf die italienische Halbinsel beschränkt bleibt. 1998. dass auch die entscheidenden Zuchtmerkmale des Mais. was auf eine stetige Einkreuzung der Wildform schließen lässt (Vila et al. wo nach Savolainen auch der Domestikationsursprung für Asien angenommen wird. 2001. Es konnte bereits anhand moderner Mikrosatellitendaten gezeigt werden. 2002) und Pferde (Lister et al. Jaenicke-Després und Kollegen (2003) konnten darüber hinaus in einer Untersuchung prähistorischer Proben zeigen. 1999. 2005). 50 . So konnten in bislang sechs Regionen von Europa bis Südostasien Übereinstimmungen von Wild.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Domestikationszentren postuliert (Larson et al. Für Amerika konnte dies nicht belegt werden. die Studien zur Phylogenie und Domestikation des Hundes/Wolfes erbrachten. denn die modernen Daten von beiden Spezies zeigen eine komplexe Struktur. nachgewiesen Interessanterweise konnten für den europäischen Raum gleich zwei solcher Gebiete bestätigt werden.bzw. die vor allem bei den Pferden die weitere Interpretation für die maternalen Linien insofern erschwert. welche als Domestikationszentren gedeutet wurden. wobei vor allem die genetische Diversität in beiden Formen vergleichbar hoch ist. das andere ganz Europa umfasst. da sich die präkolumbischen Hunde von den amerikanischen Wölfen unterscheiden lassen (Leonard et al. ein Umstand der ebenfalls auf eine bzw. Hausschweinelinien werden. Für Ziegen (Loreille et al. So zeigten diese. Eine diachrone Studie zur Hasenphylogenie einschließlich derer Domestikation unter entscheidendem Einbezug von aDNA-Daten wurde bereits 1995 von Hardy und Kollegen vorgestellt (1995). So sind bislang nur Studien zu Mais veröffentlicht worden. dass entgegen der weiten Verbreitung von Mais nur ein Domestikationsereignis stattfand. die ihn von der Wildform teosinte unterscheiden. Bar-Gal et al. Savolainen et al. Dies ist vor dem Hintergrund der schlechten Erhaltungsmöglichkeiten von organischen Pflanzenresten vor allem in gemäßigten Zonen nicht verwunderlich. zwei autochthone Domestikationsereignisse innerhalb Europa schließen lassen. 2002). bereits vor 4400 Jahren ausgeprägt und verbreitet waren. 2001) scheinen ebenfalls mehrere Domestikationsereignisse plausibel.

3. UV-Licht Endogene Mutationen durch freie Radikale des Stoffwechsels oder Replikationsfehler a) direkt: Ionisierende Strahlung (hochenergetisch): Gamma-Strahlung b) indirekt: Ionisierende Strahlung (hochenergetisch): Alpha-Strahlung Endogene chemische oder physikalische Prozesse finden ständig statt. so paart dieses mit Adenin. die zu Veränderungen der DNA-Struktur führen. steht unter konstantem Einfluss chemischer und physikalischer Prozesse. die eine Aminogruppe enthalten. z. der Aufbau und die Abfolge der Desoxyribonukleinsäuren (DNA).2.B. 5. Als Ursachen der Veränderungen gelten im Allgemeinen die Hydrolyse. das jedoch mit Cytosin paart. Passarge 2004): Mutationen im Soma: Schwach-energetische Strahlung. GaA. Kap. Dies lässt sich auch in vitro durch die Zugabe des Enzyms Uracil-N-Glykosylase (UNG) durchführen.B. Das an Position 5 methylierte Cytosin wird durch Verlust der Aminogruppe zu Thymin.2). so kann z. Bei Cytosin. Als häufigstes Beispiel sei hier die Deaminierung des Cytosins zu Uracil genannt. In der folgenden Replikation paart nun Adenin konform mit Thymin. 40:1 (Lindahl 1993). deren Ursachen ist groß.4.h. Die Deaminierung von Adenin führt zu Hypoxanthin.1. spontane Oxidation. Diese Veränderung wird in vivo von der Uracil-DNA-Glycosylase rückgängig gemacht. Die Folge ist eine Transition von AaG bzw. 51 .1 Endogene chemische Mutationsmuster Deaminierung: Sie beschreibt den Verlust der Aminogruppe –NH2 durch Oxidation oder Hydrolyse (Abbildung 9). Zerstörung der Gesamtstruktur der DNA führen können. Es kommt zum Basenaustausch CaT bzw. Eine sehr wichtige Form und Ursache für spontane Genmutationen ist die Deaminierung von 5-Methylcytosin. werden allgemein Mutagene genannt.6. zwischen somatischen Mutationen. welche mögliche deaminierte Cytosine einer DNA-Matrize (template) entfernt (vgl. endogenen Keimbahnmutationen und exogenen Faktoren. Im Folgenden sind die bekannten Mutationsmuster aufgeführt: 3.6. es kommt folglich zur Transition von CaT bzw. d. unterschieden werden (Knippers 2004. unkontrollierte Methylierung/Alkylierung und die bereits erwähnte ultraviolette Strahlung. Reaktive Substanzen.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3.1 Grundlagen zur chemischen und physikalischen Mutagenese in vivo Das genetische Material. Wird nun statt Cytosin Uracil eingebaut. führt der Verlust derselben zu einem veränderten Basenpaarungsmuster. welche zu Basenaustauschen bzw. Das Verhältnis der Deaminierungen von Cytosin zu Adenin beträgt ca.6 Eigenschaften alter DNA 3. TaC. GaA. Die Bandbreite der Prozesse bzw. Dieses wird als reguläre Base von den Reparaturmechanismen nicht erkannt. Guanin und Adenin. die direkt oder indirekt zu Keimbahnmutationen führen.

52 . Das Reaktionsprodukt 8-OxodGTP kann nun gegenüber von Adenin eingebaut werden. CaA zur Folge hat. a. Darunter wird als Mutationsauslöser häufig 8-Oxoguanin erwähnt. Reaktive OH-Gruppen entstehen u. Übersicht über die möglichen Formen der Deaminierung (Verlust der Aminogruppe NH2) durch Hydrolyse oder Oxidation. Mittlerweile sind ca. Depurinierung: Die Depurinierung beschreibt den Verlust der Purinbasen Adenin und Guanin und wird durch Hydrolyse verursacht. Diese führt zu einer Spaltung der N-glykosidischen Verbindung der Purine mit dem Zuckermolekül. Es kann jedoch auch die Guaninbase im freien Triphosphat betroffen sein. 100 verschiedene Reaktionsprodukte bekannt. Dieses oxidative Reaktionsprodukt paart nun bevorzugt mit Adenin. folglich zu einem Verlust der Basen und zu einer möglichen Deletion in der nachfolgenden Replikation. über Umwege aus Wasserstoffperoxid bei Reaktionen der Atmungskette. Somit kommt es im Vergleich zu oben zu den umgekehrten Transversionen AaC und TaG.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Abbildung 9. was die Transversionen GaT bzw. Oxidative Schäden: Hierunter fallen allgemein Schäden durch Einfluss von reaktiven Hydroxyl-Radikalen (-OH). Der größte Teil reaktiver Hydroxyl-Radikale entsteht jedoch durch ionisierende Strahlung. die durch freie Radikale verursacht werden.

Interkalierende Agenzien: Hierbei handelt es sich um meist flache Moleküle.B. Eine spontane Methylierung von Nukleotiden erfolgt jedoch auch durch die Übertragung von Methylgruppen des Co-Faktors S-Adenosyl-Methionin während der vielen natürlichen Methylierungsreaktionen der Zelle. Passarge 2004) Basenanaloga: Hierunter fällt der Einbau von analogen Basen während der Replikation.6. DNA-Alkylierung: Hierunter wird das Einfügen einer Methyl. 53 . Basenmodifizierende Agenzien: Diese verändern die Paarbindungseigenschaft von Basen innerhalb der Helix. demnach eine CaT Transition. Die Anwesenheit eines Bromatoms induziert demnach Fehlpaarungen.oder Ethylgruppe in ein Molekül verstanden. als Nitrosamine im Magen-Darm-Trakt von Säugetieren. Mineralien erfolgen. Mitomycin C. Alkylierende Verbindungen entstehen z. die den regulären Nukleotidbasen sehr ähnlich sind.B. das mit Guanin bindet. jedoch abweichende Paarungseigenschaften von der eigentlichen Base besitzen. Die Folge ist eine Paarung mit Thymin. Beispielsweise reagiert Hydroxylamin mit Cytosin. 5-Bromodeoxyuridin ist ebenfalls ein Thymin-Analogon mit vergleichbaren Eigenschaften.2 Chemische Mutagene (Knippers 2004. Das dadurch entstandene 6-Methyl-Guanin kann nur noch zwei Wasserstoffbindungen ausbilden.1. Als Beispiel sei die Alkylierung des Guanins genannt. Cross-linking agents: Hierunter fallen Agenzien wie z. Dabei wird die Wasserstoffbrücke des Sauerstoffes an Position 6 des Guanins aufgebrochen und eine Methylgruppe angefügt. Darüber hinaus können auch Verbindungen zu Proteinen bzw. Hier kann als Beispiel 5-Bromouracil angeführt werden. so dass dieses mit Adenin statt Guanin paart.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. ein Thymin-Analogon. die sich zwischen Basenpaaren einbauen und somit durch Strukturstörung zu Insertionen oder Deletionen von ein oder mehr Basen führen können. die verschiedene Abschnitte des DNA-Stranges oder verschiedene DNA-Stränge miteinander verbinden.

B. In erster Linie ist die Temperatur entscheidend. bestehende und neu auftretende Schäden können nun nicht mehr korrigiert werden.2 Postmortale Degradierung von DNA Bei lebenden.1. gesunden Zellen wird die DNA und deren Struktur unaufhörlich von Reparaturenzymen kontrolliert und fehlerhafte Stellen werden korrigiert (Lindahl 1993). Das so genannte T-C-(4-6)-Photoprodukt ist ebenfalls eine UV-induzierte konvalente Bindung zweier benachbarter Thymin. pH-Wert und elektromagnetische Strahlung den Ablauf und die Geschwindigkeit der meist chemischen Prozesse. Feuchtigkeit. Niederlegungen von toten Organismen sind die Prozesse nach der Autolyse abhängig vom umgebenden Liegemilieu (Burger et al. 2003). Es können sich auch. Diese Prozesse setzten bereits unmittelbar nach dem Tod ein und können mit speziellen Elektrophoresemethoden nachgewiesen werden (Johnson & Ferris 2002). führen all diese Faktoren zur kompletten Auflösung des Organismus und damit zum unwiederbringlichen Verlust der DNA. so dass in wenigen Fällen mit Hilfe der PCR die vereinzelten Moleküle vermehrt und anschließend analysiert werden können (Pääbo et al. Vor allem bei Bestattungen bzw. Innerer und äußerer Befall von Mikroorganismen (Bakterien. da z. die zur stetigen Auflösung der DNA führen. sofern sie innerhalb eines Gens liegen. da vor allem die Wärmeenergie sämtliche enzymatischen sowie chemischen Reaktionen direkt bedingt. Hochenergetische ionisierende Strahlung führt zu Brüchen des DNA-Rückgrates. Diese können. Wird dieser Auflösungsprozess nicht verlangsamt oder gestoppt. Nach dem Tod eines Organismus fallen diese Reparaturmechanismen weg. werden jedoch durch DNAReparaturmechanismen weitgehend korrigiert. Smith et al. Diese konvalente Bindung an den Kohlenstoff-Atomen 5 und 6 führt zu Thymindimeren.und Doppelstrangbrüchen resultiert.6. ein saures Milieu den Abbau der Mineralmatrix von Knochen und Zähnen. analog zum endogenen Zellstoffwechsel. Die relative Feuchtigkeit eines Ortes wirkt sich ebenfalls direkt auf die DNA-Degradierung aus. 54 . die wiederum zu Basenaustauschen führen (siehe oxidative Schäden). Pilzen und Insekten) trägt ebenfalls zur sukzessiven Auflösung der organischen Matrix bei. Der pHWert kann als indirekter Faktor gewertet werden. was in Einzel. 3.3 Physikalische Prozesse Als physikalischer Einflussfaktor auf das DNA-Molekül ist in erster Linie Strahlung zu nennen: UV-Strahlung induziert sehr häufig eine chemische Verbindung zwischen anlagernden Thyminnukleotiden. reaktive Ionen (freie Hydroxyl-Radikale) bilden. 1997. So beeinflussen im Wesentlichen Temperatur.6. 2004).Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA 3. aber vielfältigen Umständen kommt es zu einer Verlangsamung des Zersetzungsprozesses. die Replikation sowie auch die Transkription stören. Unter sehr bestimmten. also der die DNA schützenden Umgebung.und Cytosin-Nukleotide an den Kohlenstoffatomen 4 und 6. Neben den bereits erwähnten chemischen und physikalischen Einflussfaktoren beginnen nun auch die körpereigenen Autolysesysteme (lysierende Nukleasen) die DNA zu zerstören. da hohe Feuchtigkeit eine gesteigerte Prozessivität von Oxidationen und Hydrolysereaktionen mit sich bringt.

2) irreguläre Bindung zweier DNA-Stränge (Abbildung modifiziert nach Hebsgaard et al. Depurinierung). Diesem folgen die hydrolytisch bzw.1. die letztlich in Sequenzierungen alter DNA zu beobachten sind. Abbildung 10. Adenin und Guanin. Bollongino 2005). die im Rahmen der Amplifikationsreaktion zu Substitutionen führen können. 3. a) DNA-Schäden. 2005). Ebenfalls durch Hydrolyse verursacht sind die häufigen Brüche der N-glykosidischen Bindung. die Strangbrüche verursachen und zur schnellen und starken Fragmentierung der Moleküle führen. welche ebenfalls zur Inhibierung der PCR führen.6. Kap.6. vornehmlich der Purine Adenin und Guanin (Depurinierung. Die uns bekannten und fassbaren postmortem-Degradierungprozesse decken sich größtenteils mit solchen der Mutagenese in vivo. Als häufigste Schäden können in erster Linie die durch Hydrolyse induzierten Aufbrüche des Zuckerrückgrates genannt werden. Auf der anderen Seite sind dies die Deaminierungen (Kap. die durch hydrolytische sowie oxidative Prozesse verursacht werden: 1) Strangbrüche am Zuckerrückgrat.1. und sind zum besseren Überblick in Tabelle 2 zusammengefasst. 2) Basenverlust (meist Adenin und Guanin.Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA begünstigt (Burger et al.B. 55 .1). vgl. 4-7) Oxidative Fragmentierung der Kohlenstoff-Doppelbindungen der Basen (Hydantoine) sowie 8) des Zuckerrückgrates. welche zum Erhalt von DNA in den einzelnen Klimazonen gemacht wurden (z. im Hinblick auf die Analyse alter DNA zur Inhibition während der Amplifikation führen können. 1999). 3) Deaminierung der Basen Cytosin. 1) Bindung mit anderen DNA-Molekülen oder Proteinen.1). sowie in Abbildung 10 schematisch dargestellt. welche letztlich ebenfalls zum Strangbruch bzw. Auf der einen Seite ist dies die Bildung so genannter Hydantoine durch Umbildung der Ringstruktur der Basen. Dies deckt sich weitgehend mit den Erfahrungen. 3. b) DNA-crosslinks. oxidativ verursachten Modifikationen an den Basen selbst.

Strangbrüche Kurze Fragmente Wahl kurzer und Nukleasen. (Uracil-NGlycoslase)) Hydrolyse Deaminierung von Guanin > Xanthin - DNA crosslinks Bindung zwischen DNA-Molekulen sog. Einsatz von UNG. Strangabbruch durch Hydroxyl-Radikale (-OH) oder Verknüpfung von Purinen mit dem Zucker-Phosphatrückgrat Oxidation Hydantoine. Einsatz von N- oder mit anderen Biomolekülen Maillard Produkte Phenacyl Thiazoliumbromid (PTB) in Extraktion 56 .Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA Tabelle 2. Fragmentierung der Zuckermoleküle ggf. hydrolytische Spaltung der Reduzierung der überlappender Hydrolyse Phosphordiesterbindungen Gesamtmenge Amplikons Oxidation Fragmentierung der Basen bzw. Beeinträchtigung der Basen durch Auflösung der CDoppelbindungen Hydrolyse Depurinierung von Adenin und Guanin durch Spaltung der Nglykosidischen Bindungen Oxidation Hydrolyse Guanin > 8-Oxoguanin Deaminierung: von Adenin zu Transversion Mehrere G/CaT/A unabhängige PCRs Transition AaG Klonierung und Sequenzierung Hypoxanthin Hydrolyse Deaminierung von Cytosin zu Uracil Transition CaT Hydrolyse Deaminierung von 5-Methylcytosin zu Transition CaT Thymin (Evtl. Zusammenfassung der möglichen Schäden an alter DNA (umgezeichnet und ergänzt nach Pääbo 2004). Inhibition der PCR. Prozess/Einfluss Schadensform Auswirkung Lösungsstrategie Mikroorganismen.

Binladen et al.2). 1993). Reproduzierbarkeit. 1993). dass jedes Molekül.6. ist das der cross linking Eigenschaften der DNAMoleküle (Mitchell et al. 2005a). Gilbert et al. 3.und PostPCR-Labor aufweisen. Krings et al. PCRs sollten wiederholt von einem oder mehreren Extrakten durchgeführt werden. 1994. dass PCRProdukte nicht übertragen werden. Gilbert et al. 2005). wobei hier in erster Linie die an aDNA-Sequenzen beobachtbaren Substitutionen im Vordergrund standen. Diese Form der DNA-Bindung kann durch den Einsatz von N-Phenazylthiazoliumbromid aufgebrochen werden (Vasan et al. Hofreiter et al. Diese stellt zugleich einen Vorteil als auch einen Nachteil der Analyse alter DNA dar. Mitchell et al. 3. Hebsgaard et al. (2005) vermuten basierend auf Studien von Permafrostproben. 2003a. 2003b. Amplifikation derselben. welche falschpositive Ergebnisse erbringen können. Mittlerweile existieren mehrere Arbeiten. allerdings noch weitgehend unerforscht. vgl. denn zum einen unterstützen diese cross links die Stabilisierung der DNA und damit eine mögliche Erhaltung. zum anderen bereiten jedoch gerade diese methodische Probleme bei der Isolation der DNA bzw. das größer als 100-200 Basenpaare ist. was eine Isolation von DNA ermöglicht (Poinar et al. Pääbo et al. Hebsgaard et al. 2005b. die zu fehlerhaften Ergebnisse führen. 2005. Arbeitsbereiche sollten ein klare Trennung in PräPCR. 3. 1998. 2005. Gilbert et al. Leerkontrollen sollten sowohl bei der Extraktion als auch bei der PCR durchgeführt werden. das bezüglich der Isolationsmethoden von alter DNA von großem Interesse. (1998) durch gaschromatographische/massenspektrometrische Analysen an Koprolithenproben feststellen. 2004. 2005. Hofreiter et al. auch Kap. die hier kurz zusammengefasst werden sollen: 1. Diese konnten Poinar et al. ist. Bower et al. Eine andere Form von cross links stellen die so genannten Maillardprodukte (Vasan et al. Es sollte eine inverse Korrelation zwischen Amplifikationserfolg und Produktlänge beobachtbar sein. 2001a. um die Kontaminationsfreiheit beider Ansätze zu überwachen.6. Nukleinsäuren und bestimmter Aminogruppen von Proteinen. Leerkontrollen. 4. Pääbo 1989. 2000). sowie der Problematik der post mortem-Alterierung der DNA-Moleküle. dar. 2005. 2.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA Ein Phänomen. welche wiederum die Interpretationen der Ergebnisse beeinflussen können. 2001. eine Kondensationsreaktion von Zuckermolekülen. um gewährleisten zu können.3 Die Authentizitätskriterien der aDNA-Forschung Aufgrund der immerwährenden Kontaminationsgefahr. mindestens ein cross link Ereignis aufweist. 2001. wurden fortwährend Kriterien zur Authentifizierung von aDNA-Daten erstellt (Handt et al. Cooper & Poinar 2001. sporadische Kontaminationen aufzudecken und mögliche konsistente Sequenzveränderungen in Klonen zu 57 .1. Trennung der Arbeitsbereiche. um Ergebnisse zu bestätigen. Theoriekonformes Verhalten degradierter Moleküle. in welchen die häufigsten DNA-Schäden an alter DNA sowohl genauer beobachtet. quantifiziert als auch deren Verteilungsmuster untersucht wurden (Hansen et al.

Letztlich wird hieraus ein weiteres. alle Punkte dieser Kriterienliste zu erfüllen. Im Falle von mehr als 1000 Ausgangsmolekülen ist eine PCR-Reaktion ausreichend.” (zitiert nach Gilbert et al. Es sollte eine Quantifizierung der Ausgangsmoleküle durchgeführt werden. dass insbesondere die Probengeschichte für eine abschließende Interpretation wichtig sei. 58 . (2003) über zwei paläolithische Funde deutlich macht. Es sollte simultan auf den Erhalt von anderen Bio. 10. um laborinterne Kontaminationen auszuschließen. 7. 6.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA 5. Quantifizierung. für die Glaubwürdigkeit eines Ergebnisses von entscheidender Bedeutung sein. Neue und unerwartete Ergebnisse sollten in einem zweiten Labor unabhängig bestätigt werden. Aktuelle Studien zeigen. um die Identifikation von Sequenzveränderungen und Kontamination zu ermöglichen. dass konsistente Sequenzveränderungen zu beobachten sind (<1000 Moleküle). aber notwendiges Kriterium formuliert. deren Behandlung/Bearbeitung nach Jahrzehnten nur schwer rekonstruierbar ist. Biochemischer Erhaltungszustand. um die Wahrscheinlichkeit einzuschätzen. um dem DNA-Erhalt durch indirekten Nachweis des allgemeinen biochemischen Erhaltungszustandes mehr Plausibilität zu verleihen. Gegebenenfalls sollten in Untersuchungen zu menschlichen Proben Tierproben desselben Fundortes als Kontrolle mitgeführt werden. Dies betrifft in erster Linie Arbeiten mit menschlicher DNA. dass es in manchen Fällen nicht ausreichend ist. da die Anzahl von amplifizierbaren Molekülen von der Produktlänge und der Primerqualität abhängig ist.bzw. (2004) an der Arbeit von Caramelli et al. 9. Klonierung. Es sollten andere Proben desselben Fundortes vergleichbaren Erhaltungszustand aufweisen. So kann letztlich die Information über die direkte Bergung einer Probe für aDNA-Analysen während der Ausgrabung selbst im Vergleich zu einer Museumsprobe. Makromolekülen getestet werden. Unabhängige Reproduktion. 2005a. S. PCR-Produkte sollten kloniert und mehrere Klone amplifiziert werden. Assoziierte Funde. Kritische Beurteilung aller zusätzlich erhältlichen Informationen. identifizieren. So fordert etwa Gilbert et al. wie es Cooper et al. (2005a) besonders von diesen Arbeiten mehr Informationen zu den jeweiligen Proben sowie eine detaillierte und auch selbstkritische Diskussion derselben. „Thou shalt interpret the veracity of the data by a critical consideration of all available information. 8. Als Beispiel wird angeführt. Die Quantifizierung sollte für jedes Primerpaar erfolgen.4). die auf Amplifikation eines oder weniger Moleküle zurückzuführen sind.

7. Die Ausnahme bildet ein Bereich von ca.7.000 Mitochondrien (Lightowlers et al. Die wenigen Ausnahmen tragen jedoch nicht dazu bei.1. die vorwiegend den Elektronentransfer im Rahmen der Atmungskette und die Energieproduktion (oxidative Phosphorylierung (OXPHOS)) regulieren.1 Die Struktur der mitochondrialen DNA Die mitochondriale DNA (mtDNA) ist ein doppelsträngiges. Passarge 2004).6kB Größe (Anderson et al. das Fehlen von Rekombination und die Homoplasmie des Genoms.7 Verwendete genetische Marker 3. Die nichtkodierenden Bereiche sind sehr kurz und treten nur in sehr geringer Anzahl auf. womit eine selektive Zerstörung der männlichen Mitochondrien in den frühen Phasen der Embryogenese erfolgt (Sutovsky et al. Der Aufbau des Genoms ist kompakt. welcher zwischen den Nukleotidpositionen (nps) 16024 und 577 liegt. Das mitochondriale Genom codiert 13 Proteine. 16. jedoch sieht man die möglichen Ursachen hierfür in der mangelnden Qualität der Oozyten. sowie 22 Gene für Transfer-RNA und 2 ribosomale RNAs (Anderson et al. Die Mutationen des mitochondrialen Genoms eignen sich aus mehreren Gründen als populationsgenetisches Werkzeug. 2004. das außerhalb des Zellkerns in den Mitochondrien der Eukaryoten-Zellen liegt. Es werden wenige Fälle von paternaler Vererbung von mitochondrialer DNA bei in vitro Fertilisationen (St. welches von Proteasen als Signal erkannt wird. John et al. 1997). Sollten bei der Befruchtung einige männliche Mitochondrien in die Eizelle gelangen. 59 . eine Eizelle jedoch Hunderttausende. 2004) diskutiert. 1100bp Länge. Die Spermien tragen zwar etwa einige hundert Mitochondrien. Manfredi et al. 2003). Demnach ist die Vererbung mitochondrialer DNA über die rein mütterliche Seite allgemein akzeptiert. 1981. Sie ist ein eigenständiges Genom von ca. Darüber hinaus wird eine so genannte Ubiquitinierung postuliert. Thompson et al.7. ringförmiges Molekül.1 Eigenschaften der mtDNA und ihre Eignung als populationsgenetischer Marker 3. Diese nichtkodierende Region wird auch D-loop (displacement loop) oder control region genannt.1. 3. 1997. Alle kodierenden Bereiche liegen beieinander.2 Die maternale Vererbung und das Fehlen von Rekombination Die Vererbung der mtDNA erfolgt nur über die mütterliche Seite. eine Markierung der männlichen Mitochondrien in den Spermien mit dem Polypeptid Ubiquitin. die rein maternale Vererbung. so wären diese in den nachfolgenden Generationen kaum mehr aufzufinden.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA 3. da dort die Replikation startet und auch die Promotoren für die Transkription liegen. Die wesentlichen Charakteristika sind die höhere Mutationsrate im Vergleich zur nukleären DNA. dass eine paternale Vererbung unter natürlichen Voraussetzungen in Betracht gezogen werden kann. In jedem Mitochondrium befinden sich etwa 2-10 mtDNA-Moleküle und in jeder somatischen Zelle findet sich eine variierende Anzahl von etwa 1000-10. 1981).

genetische Drift.3 Homoplasmie Die mtDNA in unterschiedlichen Geweben ist theoretisch identisch. Da es zudem sehr unwahrscheinlich ist. Zusammen mit der maternalen Vererbung hat dies zur Folge. 3.B. Er wird durch den Mechanismus des genetischen Flaschenhalses (genetic bottleneck) erhalten bzw.7. Eyre-Walker et al. 2000 Erratum). Die Kopienzahl der mutierten Zellen ist in den meisten Fällen so gering. kann der eigentliche homoplasmische Zustand leicht bestimmt werden. 2000.7. unpassender Datengrundlage stark kritisiert (Macauley et al. deren Sequenzen mögliche Rekombination aufzeigen sollten. dass die effektive Populationsgröße im Vergleich zu autosomalen loci etwa nur ein Viertel beträgt. dass die Wahrscheinlichkeit einer Fehlbestimmung bei der Analyse von mtDNA zu vernachlässigen ist. Weitere Arbeiten. 2000). Elson et al. Da sich im Lauf der Lebenszeit eines Organismus Mutationen in den Geweben ansammeln und sich daher die Mitochondrien in den Zellen unterscheiden können. Das Fehlen von Rekombination macht mtDNA zum single locus. Die anschließende Vermehrung zu reifen Eizellen führt zur Etablierung der gleichförmigen mtDNA-Moleküle (Thorburn & Dahl 2001). erreicht: eine starke Verringerung der Anzahl an mtDNAs tritt in Stadien der Eizellgenese auf (cytoplasmatische Segregation). welche die oben genannte Möglichkeit einschränken. Kap. 1999) wurden aufgrund methodischer Mängel bzw.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA Die maternale Vererbung und das Nichtvorhandensein von Rekombination ermöglicht die einfache Verfolgung von individuellen genetischen Linien über zahlreiche Generationen hinweg und damit auch die Rekonstruktion ihrer Entwicklung im Laufe der Zeit.B.1. 60 . Zudem konnten in parallel geführten unabhängigen Analysen zum Thema Rekombination (Ingman et al. Diese Arbeit wurde jedoch aufgrund eines Alinierungsfehlers der Sequenzen revidiert (Hagelberg et al. indem die Versuche aus unterschiedlichen Geweben wiederholt werden. So wurden z.5 und Abbildung 11). spricht man hierbei von Heteroplasmien. 1999. 1999a. Allerdings wurden von wenigen Autoren Beweise für Rekombinationsereignisse postuliert.1. Jorde & Bamshad 2000. Dieser Zustand wird Homoplasmie genannt. 2001) sowie Datenneubewertungen (Piganeau & Eyre-Walker 2004) keine Hinweise auf Rekombinationsereignisse der mitochondrialen DNA erbracht werden. wie z. 1999 von Hagelberg und Kollegen Haplotypen veröffentlicht. Dieser Zustand variiert in vivo in Abhängigkeit von Gewebe mit hohem oder niedrigem Energiebedarf (s. Damit ist mtDNA als populationsgenetischer Marker sensitiver für viele demographische Veränderungen. Kivisild & Villems 2000. Kumar et al. die sich für Rekombination aussprachen (Awadalla et al. dass sich Mutationen in unterschiedlichen Geweben wiederholen. 3.

Für die gesamte coding region errechnete Parsons et al. 1979. dass diese Rate nicht gleichermaßen auf das Molekül verteilt ist.26 Basenaustauschen pro Position pro Million Jahren. oxidative Schäden.7. Kap.a. dass während der Reduzierung der mtDNAs während der cytoplasmatischen Segregation (vgl. Eine weitere Möglichkeit. 61 . ist die theoretische Wahrscheinlichkeit. wobei jedoch zu beachten gilt. die wiederum mutagen wirken (vgl.1). was zur schnellen Manifestierung von Mutationen führt und damit ebenfalls die ungleich hohe Mutationsrate dieses Bereichs erklärt. (2000) eine durchschnittliche Mutationsrate von 3. endogene Mutagenese.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA 3.3) per Zufall eine mutierte Form die Mehrzahl annimmt. HVS II (np 73-340) und HVS III (np 438-574). wofür Richards et al.1. Lutz et al.1. und hier besonders in drei Abschnitten innerhalb derselben. Zudem unterliegt der größte Anteil der Kotrollregion keinem Selektionsdruck.6 x 10-6 Basen pro Generation angibt. verletzlich für Mutagene vorliegt. 1991.6. Die Reparaturmechanismen der Mitochondrien sind weniger effektiv als die des Zellkerns (vgl. 3. dagegen Mason & Lightowlers 2003). Für das gesamte mitochondriale Genom gibt Ingman et al. Dies betrifft im Besonderen die Kontrollregion. in der sie einzelsträngig und damit besonders anfällig bzw.1. 1998). (2000) eine Mutationsrate von 3. die zur schnellen Fixierung von Mutationen führen kann. Ingman & Gyllensten 2001). Dies entspricht 0. Sie ist relativ gering in der Protein und RNA kodierenden coding region und hoch in der nichtkodierenden control region. Die größte Variabilität weist HVS I auf (Vigilant et al. Im Vergleich zur Kern-DNA ist die mtDNA nicht in Histone „eingepackt“ und somit anfälliger für v. 2004.4 Die Mutationsrate Die Mutationsrate mitochondrialer DNA ist durchschnittlich etwa 10x höher als in nukleärer DNA (Brown et al. Bogenhagen 1999): Die Funktion der Zellorganellen als Energielieferant der Zelle im Rahmen der oxidativen Phosphorylierung (OXPHOS) erzeugt eine hohe Konzentration an freien Radikalen. mtDNA weist pro Zeiteinheit mehr Replikationsschritte auf als nukleäre DNA. (1997) eine Mutationsrate von etwa 5 x 10-7 bis 5 x 10-6 Basen pro Generation von 20 Jahren. Diese drei Abschnitte sind besonders variabel und werden demnach auch hypervariable region (HVR) oder hypervariable segments (HVS) genannt: HVS I (np 16024-16365). 3. Die Art und Weise der Replikation der mtDNA führt zu einer vergleichsweise langen Zeitspanne. Für die vergleichsweise hohe Mutationsrate der mtDNA werden allgemein folgende Gründe angeführt (Jobling et al. Review in Shadel & Clayton. 1997.025-0.7.4 x 10-7 Basen pro Generation an.

1. Hierbei stehen wiederum zwei Möglichkeiten offen. die rezente Stammbaumanalysen als Grundlage nimmt und daher die Mutationsrate pro Generation bestimmt. 62 . Zum anderen wird die indirekte Kalibrierung verwendet. 1997. die die Anzahl divergierender Ereignisse oder umgekehrt die Menge der angesammelten Variabilität ins Verhältnis zu einem gut datierten Ereignis stellt. Allerdings wird mit dem fortgeschrittenen Wissen um die Faktoren. Die Hypothese der molekularen Uhr (Zuckerkandl & Pauling 1962) spielt hier die zentrale Rolle. Es gibt daher zwei Formen der Kalibrierung: zum einen die direkte Kalibrierung.und Populationsgenetik dazu eingesetzt.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA 3. die Mutationsraten in unterschiedlichen Organismen beeinflussen (lineage effects) (umgezeichnet nach Jobling et al. Jobling et al. Amerika) und ermittelt die Anzahl der seitdem aufgetretenen Mutationen oder man verwendet eine Außengruppe und ermittelt die Anzahl der Variationen seit dem letzten gemeinsamen Vorfahren (most recent common ancestor oder MRCA).5 Die molekulare Uhr Die Mutationsraten der DNA werden in der Evolutions. Kritik an der molekularen Uhr und den daraus erhobenen Datierungen wurde häufig geübt.B.7. Am häufigsten wird hierbei die phylogenetische Trennung von Mensch und Schimpanse und die jeweils aktuelle paläontologische Datierung des Ereignisses verwendet. evolutive Ereignisse zu datieren. dass die Evolutionsrate in allen Linien gleichförmig und über die Zeit hin konstant verläuft. Abbildung 11. 2004). Entweder wählt man die bekannte Neubesiedlung eines Gebiets oder Kontinents (z. um Informationen zum zeitlichen Auftreten bestimmter Ereignisse zu gewinnen. denn bereits die Mutationsrate stellt einen Schätzwert dar. dass sich die genaue Kalibrierung der Uhr als schwierig darstellt. Dabei ist jedoch zu beachten. 2004). Unter dieser Prämisse ermöglicht die molekulare Uhr somit. Letztlich sind die Datierungen von der genauen Kalibrierung der Uhr abhängig. welche die Mutationsraten unterschiedlicher Linien (Abbildung 11) beeinflussen und der ebenso erfolgenden Verfeinerung der Referenzdatierungen auch die Verlässlichkeit der molekularen Uhr steigen (Macauley et al. Faktoren. Sie setzt voraus.

weshalb sie weitaus häufiger als short tandem repeats (STRs) Erwähnung finden. da sie teilweise mit Krankheiten assoziiert sind (Nasir et al. Telomerregionen vor. liegt jedoch gehäuft im Heterochromatin der Centromer. Innerhalb der STRs finden sich Wiederholungseinheiten von zwei Basenpaaren. Li & elMallakh 1997).und Hexanukleotidrepeats genannt. Sie besteht aus tandemartig hintereinander geschalteten Wiederholungseinheiten. am häufigsten. wovon wiederum ein beträchtlicher Anteil hochrepetitiv ist.und Pentanukleotideinheiten für zahlreiche weitere Fragestellungen. Eine Wiederholungseinheit der STRs umfasst per Definition ein bis sechs Basenpaare. Ein gesamter Wiederholungsabschnitt von STRs erstreckt sich gewöhnlich über ~150bp. Aufbau und Nomenklatur von STRs (modifiziert nach Hummel 2003).bzw.und Hexanukleotidrepeats vorwiegend im klinischen Forschungsbereich von Interesse sind.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA 3. Die verschiedenen Klassen der hochrepetitiven DNA (nach Tautz 1993). auch leicht abgewandelter Form) direkt hintereinander geschaltet sind. die in direkte (bzw. 20% des Genoms auf STRs (Hummel 2003). Schätzungen zufolge entfallen ca. Tetra-. 63 . 1996. Penta. Während hiervon die Tri. Die Wiederholungseinheiten mit drei. Abbildung 12. so genannten Dinukleotidrepeats. die über die Molekulargenetik hinausreichen. Diese repetitive DNA findet sich über das gesamte Genom verteilt. welche gemäß ihrer Länge an einzelnen Wiederholungseinheiten in verschiedene Klassen eingeteilt sind (Tabelle 3). fünf und sechs Basenpaaren werden dementsprechend Tri-. Tabelle 3. eignet sich das Unterscheidungspotenzial der hochpolymorphen Tetra.2 Short tandem repeats (STRs) Ein großer Teil des menschlichen Genoms besteht aus nichtkodierender DNA. Typ Anzahl der loci Länge der Wiederholungseinheiten Satelliten 1-2 pro Chromosom 100-mehrere 1000bp Minisatelliten Mehrere 1000 pro Genom 9-100bp Mikrosatelliten (STRs) Bis zu 105 pro Genom 2-6bp Die Mikrosatelliten stellen hierbei die Klasse mit den kürzesten repetitiven Einheiten dar.7. vier.

so dass die Methode der Individualisierung heute eine breite und technisch sowie methodisch weitgehend kommerzialisierte Anwendung findet (Butler 2001. Das Haupteinsatzgebiet von STR-Analysen im Rahmen der genetischen Identifikation liegt heute im Wesentlichen in der Rechtsmedizin. bei Vaterschaftsgutachten. Sie ermöglichte die für eine uneingeschränkte Individualisierung erforderliche gleichzeitige Amplifikation mehrere unabhängiger STR-loci in einem Ansatz (so genannter Multiplexansatz). Abhängig vom betreffenden genetischen Fingerabdruck und der Auswahl an STR-loci ist es ab einer gewissen Anzahl von STR-loci statistisch höchst unwahrscheinlich. Hierbei bilden die beiden Allele eines STR-locus den Genotypen eines Individuums.cstl. Kap.3) angewendet werden (Butler 2001). Kap. Letztere werden je nach Maßgaben der geltenden Rechtsprechung der einzelnen Staaten verwaltet. die auf Individualebene hinabreicht. wo diese in forensischen Fällen jeglicher Art.bzw. zeitsparend erfolgen konnte. Mullis & Faloona 1987) hatte auch bedeutenden Einfluss auf die nachhaltige Entwicklung (vgl. 1985.5. 64 . aktualisiert und im Rahmen der Jurisdiktion in forensischen Fällen herangezogen. Pd power of discrimination) (Hummel 2003. 3. bei Sexualdelikten. 3.5) der STRGenotypisierung. mit welcher ein einzelnes Allel in der betrachteten Population vorkommt. die Kombination mehrerer einzelner STR-locus-Genotypen bildet wiederum den so genannten genetischen Fingerabdruck. Die statistische Wahrscheinlichkeit der Einzigartigkeit eines solchen genetischen Fingerabdrucks ist letztlich abhängig von der Häufigkeit.5. welcher gleichzeitig kosten.Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA Die Variabilität der einzelnen Allele eines diploiden STR-locus ermöglicht in Kombination mit anderen STR-loci eine hochauflösende Differenzierung. Entsprechende wissenschaftliche Vergleichdatenbanken finden sich im Internet (http://www. Butler 2001).gov/div831/strbase) bzw.nist. sind gemäß den jeweiligen staatlichen Institutionen nur bedingt öffentlich. bei Massenkatastrophen und seltener bei historischen Fragestellungen (vgl. dass eine zweite Person mit einem identischen kombinierten STR-Genotyp existiert (statistische Ausschlusswahrscheinlichkeit. Hummel 2003). Die Etablierung der PCR-Technik (Saiki et al.2 & 3.

falsifizieren? Die Aufgabe der vorliegenden Arbeit ist die Bestimmung der mitochondrialen Haplogruppen des maternalen Genpools einer neolithischen Stichprobe. Migrationen oder Kolonisierungen postuliert werden? f) Kann in diachroner Hinsicht eine Kontinuität bzw. die generellen archäologischen Fragestellung erhalten. Diskontinuität einer Bevölkerung eines definierten Raumes nachgewiesen werden? g) Können die Ergebnisse bereits formulierte Modelle zur Neolithisierung Europas verifizieren bzw. welcher sich in den archäologischen Hinterlassenschaften deutlich belegen lässt. spielt die Authentifizierung der gewonnenen Daten eine vordergründige Rolle. Fragestellung und Zielsetzung der Arbeit In den beiden vorangegangen Kapitel wurden bereits die gängigen Theorien zur Neolithisierung seitens der Archäologie als auch der Populationsgenetik beleuchtet. die sich auch genetisch differenzieren lassen? b) Lassen sich eventuell charakteristische Unterschiede zwischen den zu prüfenden genetischen Einheiten feststellen? c) Kann ein kultureller Einfluss oder gar ein Wandel. Hieraus wurde bereits deutlich.Fragestellung 4. unterschiedliche Zeiträume und auch unterschiedliche Modelle zu postulieren sind. die nachfolgend mit weiteren populationsgenetischen Fragen ergänzt werden: a) Bildeten die einzelnen archäologisch definierten Kulturen möglicherweise tatsächlich existierende Einheiten. d. e) Können unter der Voraussetzung der Unterscheidbarkeit auch Richtungsdynamiken in Raum und Zeit festgestellt werden. hauptsächlich Naturräume. Aussagen anhand der erhobenen neolithischen Daten im Vergleich mit Rezentdaten aus populationsgenetischen Studien zu den oben genannten Fragestellungen der Arbeit zu treffen. Da die Analyse von alter menschlicher DNA aufgrund der Kontaminationsgefahr ein Problemfeld darstellt. 65 .B. dass nicht ein einheitlicher Prozess oder ein Modell als Erklärung für die Neolithisierung ausreichend ist. Dennoch bleiben für die vorliegende Arbeit. Darüber hinaus sollen anhand des erhobenen Datensatzes an Sequenzen weitere Erkenntnisse zu Umfang und Art und Weise von post mortem Schäden an DNA-Molekülen gewonnen und charakterisiert werden. und somit Bewegungen von Bevölkerungen.h. Vielmehr ist unter dem aktuellen Wissenstand anzunehmen. Die umfassende Zielsetzung ist es. dass für unterschiedliche Regionen. wie z. allerdings auf die einzelnen Zeit.und Naturräume bezogen. auch in der Struktur der betreffenden Bevölkerung nachgewiesen werden? d) Inwieweit können Unterschiede zur heutigen Bevölkerung Europas als populationsgenetische Dynamik gedeutet werden.

Langensalza. Wernigerode.1 Fundorte und Proben Nachfolgend sind zunächst die wichtigsten archäologischen Informationen zu den einzelnen Fundorten angegeben. Sachsen-Anhalt Siedlung und Gräberfeld (Müller 2002) Das Landesamt für Archäologie Sachsen-Anhalts führte in zwei Abschnitten die Untersuchung eines Neubaugebietes am westlichen Ortsrand von Derenburg durch. Ldkr. Meerenstieg I wurde bereits 1994/95 ergraben und von Meerenstieg II konnten in den Jahren 66 . Thüringen Gräberfeld (Kahlke 1958/59) Das Gräberfeld von Bruchstedt wurde in den Jahren 1958/59 ausgegraben. Kr. gefolgt von der Kategorie sowie der wichtigsten Referenz zum jeweiligen Fundort. Die Auflistung erfolgt in keiner chronologischen Ordnung. 300m vom Gräberfeld entfernt. die teilweise gestört waren.1 Fundorte in Deutschland Bruchstedt.1. wobei jeweils zwei Gräber zerstört wurden. bis auf eine Ausnahme. Eine zugehörige Siedlung befand sich ca.Material und Methoden 5. die Ausrichtung häufig in nordostsüdwestlicher Richtung. Bereits zuvor war es bei Baumaßnahmen angeschnitten worden (1933. Unter anderem war die Strukturierung in Gruppen dicht beieinanderliegender Gräber mit Beigaben und isolierter eher beigabenloser Gräber auch in Bruchstedt beobachtbar. 1950). Allerdings konnten. Zudem wiesen die Keramikbeigaben auf eine spätere Phase der Linearbandkeramik hin. Im Laufe von weiteren Bauarbeiten konnte 1958/59 schließlich durch eine Rettungsgrabung das Gräberfeld bis zu seinem südlichen und westlichen Rand erfasst werden. In Abbildung 14 ist die geographische Lage der Fundorte aufgetragen und zum besseren Überblick sind die einzelnen Proben aus den jeweiligen Fundorten mit Angaben zu Probenmaterial und Datierung in Tabelle 4 aufgelistet. sofern Grabungsberichte und detaillierte Aufarbeitungen der Fundkomplexe bis Oktober 2005 vorlagen. Hierbei wurden weitere 52 Gräber gefunden. Die Titel der Fundbeschreibungen umfassen Fundort und geographische Herkunft. Die Beisetzungen erfolgten alle in Hockerstellung. Meerenstieg II. die Doppelbestattungen und Spondylus-Schmuck in Bruchstedt nicht gefunden werden. Derenburg. 5. Material und Methoden 5. Kahlke (1959) sah hier auffällige Parallelen zum 20km entfernten Gräberfeld in Sondershausen. sondern nach Ländern sowie alphabetisch geordnet.

Ein Rückgang der Besiedlung nach dieser Periode schien sich in den wenigen Funden mittelneolithischer Kulturen (Rössener Kultur. Zudem war die isolierte Lage einzelner Gräber bzw. demnach die Klappen in Frauengräbern und Armringe in Männergräbern zu finden seien (Willms 1985.mit geringen Abweichungen . Brandgräber wurden nicht nachgewiesen. 70m entfernt befand sich ein linearbandkeramischer Friedhof. sowie bronze. Kümpfen und Schalen am Kopfende beigegeben wurden. Die Rekonstruktion der bisher ergrabenen Siedlungsstruktur war durch erhebliche Erosionserscheinungen erschwert und daher nur ausschnittsweise möglich. wobei die Einzelbestattung mit 35 Fällen vorherrschend war. Als größte Beigabengruppe fand sich erwartungsgemäß die Keramik. Die Gesamtschau der Funde weist auf eine wiederholte Besiedlung des Areals hin. Nieszery 1995). einer Bestattungsgruppe im Norden des Friedhofes auffällig. Die Beisetzungen in Hockerstellung variierten von seitlicher Lage bis Rückenlage. teilweise mit hochwertiger Ausstattung. dass einige Gräber der Landwirtschaft zum Opfer gefallen waren. Andere. welche allesamt Spondylusschmuck aufwiesen. eine vermutete Nachbestattung. Die vorläufige Auswertung ergab Keramik sowohl im ursprünglicheren Flomborner Stil als auch nachfolgender und späterer Phasen. sowie von fast gestreckter bis zu extremer Hockerstellung. Die jetzige Befundsituation deutete darauf hin. W-O-Ausrichtung kam nur bei einem Viertel der Belegung vor. An Felssteingeräten fanden sich Dechsel. In nordnordöstlicher Richtung von der Siedlung ca. Die Mehrheit der Gräber wies Beigaben auf. denn teilweise lagen die Grabgruben sehr flach unter der Pflugschicht und waren demzufolge in schlechtem Erhaltungszustand. tiefer im Löss gelegene Gräber. dass ein erheblicher Teil der Siedlung im noch nicht erfassten angrenzenden (Flur-)bereich liegen müsste. Alle Gräber enthielten Körperbestattungen.Material und Methoden 1997-99 drei ha archäologisch untersucht werden. Unter den neolithischen Befunden fand sich in allen Geländebereichen Material sowohl der älteren als auch der jüngeren Linearbandkeramik. 67 . Daneben fanden sich eine Doppelbestattung. dass die Beigaben geschlechtsspezifisch verteilt wurden. Darüber hinaus war das Auffinden von Armreifen aus Spondylusmuscheln auch in einem Frauengrab bemerkenswert. Beachtlich war vor allem das Vorkommen von Spondylusmuscheln. Reibeplatten und Reibsteine sowie als Schmuckgegenstände auch Steinperlen. da bislang nördlich des Harzes keine vergleichbaren Funde bekannt waren. zeigten eine sehr gute Erhaltung. Die Erosionserscheinungen auf der Hochfläche des Meerenstiegs hatten auch hier zur Folge. 25-30m und enthielt 42 Gräber.und eisenzeitlicher Kulturen vorlag. da datierbare Keramik der linearbandkeramischen. was auf eine längere Nutzung des Friedhofes schließen ließ. eine Grabgruppe mit drei Individuen und zwei mögliche Leergräber.in O-W-Richtung. Stichbandkeramik trat seltener auf. die überwiegend als Kugelamphoren. Ein Grabfund konnte gar der römischen Kaiserzeit zugeordnet werden. Schuhleistenkeile. ging man doch bisher davon aus. Ammenslebener Gruppe) zu spiegeln. Es fanden sich deutliche Siedlungsspuren der bandkeramischen Kultur über eine Weite von mehr als 100 m. Die Anlage hatte einen Durchmesser von ca. Die Orientierung erfolgte mehrheitlich .

wobei keine Aufteilung nach Geschlecht nachzuweisen war. 14 Gräber waren so zerstört. Klingen/Abschlag. Richter berichtet. Das Flomborner Gräberfeld war beigabenreich. dass keine Ausrichtung der Toten ermittelt werden konnte (Richter 1968/69). Die Ausrichtung der Gräber war allgemein Ost-West mit Abweichungen nach Nord und Süd. Ebenso zeichnete sich aufgrund der allgemein wenigen sicheren Geschlechtsbestimmungen nur der Schuhleistenkeil als spezifisch männliche Beigabe ab. Drei Gräber enthielten weder Beigaben noch Bestattungen. Auch Storch (1984/85) kam bei einer erneuten Durchsicht des verbliebenen Materials im Rahmen seiner vergleichenden Studie zu frühneolithischen Bestattungssitten zu wenigen neuen Erkenntnissen hinsichtlich der Flomborner Funde. Zudem meldete und vermerkte Richter den Verlust einiger Beigabenstücke. das Beigabenspektrum umfasste Dechsel/Flachbeil. Von den 85 bandkeramischen Gräbern enthielten nur 67 Skelettreste. welche von Koehl (1903) als linksseitige Hocker beschrieben wurden. Kr. Die Ausgrabungen scheinen im Norden und Osten die Gräberfeldgrenze erreicht zu haben. so dass „einige Komplexe nicht ganz gesichert“ (Richter 1968/69) seien. Schnecke/Tierknochen. Storch 1984/85) Die ersten Funde wurden bereits 1900 beim Ausheben einer Kalkgrube gemacht. Dahingegen konnte Spondylusschmuck.Material und Methoden Flomborn. Alzey. Rheinland-Pfalz Gräberfeld (Richter 1968/69. dass von dem ursprünglich ins Wormser Museum gelangten Skelettmaterial ein Teil fehle und dass es bei der Inventarisierung der Grabbeigaben in zwei Etappen Verwechslungen gegeben habe. Keramik. Das ursprüngliche Ausmaß des Gräberfelds war vermutlich größer. Reibstein. der bis dahin gern als Frauenbeigabe gedeutet wurde. auch in als Männergrab angesprochenen Bestattungen gefunden werden. Schmuck. da im Westen der Gemeindefriedhof und im Süden eine Straße das Gräberfeld beschneidet. 68 . Pfeilspitzen. Richter stellte bei der Verteilung der Beigaben eine Tendenz zu Männergräbern fest. 36 Skelette lagen mit dem Kopf im Osten und 31 mit dem Kopf im Westen. Die Trennung der Beigaben nach Geschlechtern ließ er jedoch aufgrund der schlechten Datenlage bewusst aus. In den darauffolgenden drei Jahren wurden 85 bandkeramische Gräber freigelegt. Rötel/Erz (Storch 1984/85).

Gewann „Schälzig“. Wenige weitere Gräber der Rössener Kultur sowieso Hinweise auf kaum bzw. Individuum Halberstadt 2 (HAL2) aus Grab 35. Baden-Württemberg Gräberfeld (Behrends 1989) Eine erste Notgrabung wurde 1988 begonnen. nicht erhaltene Grabgruben konnten ebenfalls nachgewiesen werden. ein möglicher umfassender Graben konnte im Osten der Grabung angeschnitten werden. 1989 fortgeführt und abgeschlossen. Abbildung 13. Aus Gräber. die an Hand der Beigaben der frühen Linearbandkeramik zuzuordnen waren (vgl. Kr. Das ergrabene Areal war durch mehrere Palisadengräbchen unterteilt. wovon etwa 25 Gräber bei vorausgegangenen Bauarbeiten unbemerkt zerstört wurden. wie an acht erhaltenen Beispielen dafür erkannt werden konnte. Reste davon geborgen.Material und Methoden Halberstadt. Schwetzingen. Abbildung 13). Sachsen-Anhalt (Autze 2005) Das Gräberfeld auf dem Sonntagsfeld in Halberstadt wurde im Jahre 2000 ergraben. Rhein-Neckar-Kreis. Weitere 18 Fundpunkte waren als abgepflügte Gräber zu deuten.und Gesamtplan (Autze. „Sonntagsfeld“. Auch die landwirtschaftliche Nutzung des Geländes hat zu Verlust von Gräbern geführt. 69 . Halberstadt . Die Erhaltung der Skelette aus den Körpergräbern war sehr unterschiedlich und abhängig von der Lage. Das Gräberfeld von 40 x 100m lag auf einem ehemaligen Dünenrücken im Rheintal mit einer Ausrichtung im Streifen von Nordwesten nach Südosten. sehr wahrscheinlich Brandgräber. ein vorläufiger Bericht befindet sich im Druck (Autze 2005). Insgesamt wurden 202 Gräber bzw. pers. Sachsen-Anhalt). Diese waren in fünf deutlich erkennbare Grabgruppen unterteilt. Des Weiteren fanden sich sechs Hausgrundrisse sowie hausbegleitende Gruben. dass insgesamt 40 Gräber geborgen wurden. Die Skelette und Grabbeigaben der darüber liegenden dunklen und stark lehmigen Schicht. Mitteilung) ließ sich entnehmen. die nicht genügend eingetieft waren. Die Bearbeitung ist zum gegenwärtigen Zeitpunkt (August 2005) noch nicht abgeschlossen. Individuen aus dem Dünensand waren teilweise mit Kalksinter überzogen und daher sehr gut erhalten. als exemplarisches Beispiel für sehr guten Erhaltungszustand (Landesamt für Archäologie.

aufgrund der Größe jedoch vermutlich ein Mann. Eine einheitliche Ausrichtung der Gräber war nicht zu 70 . Seehausen. welche ans Ende der Linearbandkeramik zu stellen ist. Wenngleich viele Gräber Keramikgefäße enthielten. Die Beisetzung erfolgte überwiegend in seitlicher Hockerlage. Grab IV enthielt zwei Kinder unterschiedlichen Alters (Grab IVa Infans I und Grab IVb Infans II). die aufgrund der Lage zwischen Hinterkopf bzw. In einiger Entfernung fand sich eine sehr flach eingetiefte Restbestattung mit Bruchstücken der Armknochen und des Schädels. Eine kraniologische Untersuchung der Seehausener Funde wurde von Grimm 1964 publiziert.Material und Methoden welche vermutlich von Überflutungen bzw. worunter sich zehn Doppelbestattungen fanden. Demnach fand sich in Grab I ein Mann. Frankenhausen. vom nahen Leimbach herrühren. teilweise wurden auch extreme Lagen beobachtet. Eine Zuordnung zur Bandkeramik ließ Kahlke (1957) offen. in Grab II eine Frau und in Grab III war die Zuordnung unsicher. Thüringen Gräbergruppe (Kahlke 1957) In Seehausen wurden 1955 drei Gräber angeschnitten. Kyffhäuserkreis. Zwei weitere Gräber mit Hockerbestattungen konnten geborgen werden. Die Ausrichtung der meisten Gräber geschah in NordostSüdwest-Richtung und die Beisetzung erfolgte überwiegend in linksseitiger Hockerlage. rechter Schulterregion. waren wesentlich stärker aufgelöst. 1950-52 und 1955 wurde im Nordosten der Stadt Sondershausen ein bandkeramisches Gräberfeld ausgegraben. An Beigaben fanden sich hauptsächlich Steingeräte und Keramik. Mehrere Gräber enthielten Silexpfeilspitzen. Reibplatten mit intensiven Spuren von Rötel oder Manganerz wurden in Gräbern beiderlei Geschlechts gefunden. so bleibt die Typenauswahl gering und überwiegend auf kleine Kümpfe beschränkt. Die chronologische Einordnung erfolgte anhand der Keramik. Die zugehörige Siedlung wurde bislang nicht entdeckt. Kr. Thüringen Gräberfeld (Kahlke 1958) In den Jahren 1949. Kahlke (1957) berichtet von der vollständigen Zerstörung des ersten Grabes (Hockerbestattung mit Halsflasche und Kumpf der jüngeren Linearbandkeramik). bei Männern dagegen mehrheitlich Flachhacken zu finden. Die Keramikgefäße deuteten auf die ältere Linearbandkeramik hin. die am Kopfende des Grabes standen und vermutlich Flüssigkeiten enthielten. Grabbeigaben waren nur spärlich vorhanden. Als Beigaben fanden sich ein rot bemalter mittelgroßer Kumpf im zweiten und ein Bruchstück einer Zipfelschale im dritten Grab. Insgesamt konnten 44 (45?) Bestattungen gezählt werden. Sondershausen. als Niederlegung im Köcher zu deuten sind. die nur durch ein Zusammenschnüren der Leichen erklärt werden konnten. Des Weiteren waren Spondylus-Muscheln mit tiefem V-förmigem Ausschnitt in Frauengräbern häufig.

6 ha Siedlungsstrukturen entdeckt. welches vermutlich nur eine gewisse Zeitdauer hatte. Hierbei handelt es sich um zwei erwachsene Individuen und ein Kind.7 ha ergraben und archäologisch dokumentiert. Feuerstein. Einzelgräber lagen meist abseits. denn die wenigen Beigaben ließen eine eindeutige Korrelation zu den Siedlungsphasen nicht zu. Aschersleben-Staßfurt. 2003) Der Fundort wurde in einer groß angelegten Grabungskampagne ergraben.und Menschenknochen gut erhalten blieben. mit einigen Abweichungen wurde mehrheitlich in Nordost(Kopf)-SüdwestRichtung bestattet. Ein Gräberfeld zur Siedlung konnte nicht erfasst werden. Neben dem dichten Siedlungsbefund war ein Grabenwerk sehr auffallend. Unseburg. die 1994 begann und 2003 den vorläufigen Abschluss fand.und Steingeräte wie Reibeplatten und Fragmente von Schuhleistenkeilen. Zudem erstreckten sich die Siedlungsspuren im Südwesten über das Grabenwerk hinaus. die übrigen Befunde deuten auf eine Einordnung in die mittlere bis späte Bandkeramik. Dabei wurden auf 8 ha Grabungsfläche ca. Vaihingen an der Enz. 20-45m lang. die meisten davon als Bestattungen im Dorfgraben am Nordrand der Siedlung. Daher ist die chronologische Einordnung der Siedlungsbestattungen ungewiss. 4. Die Gräber sind beigabenlos. Diese sind N-S-orientiert und ca. 1958) ging davon aus. da es im Süden nicht vollendet wurde. Sachsen-Anhalt Siedlung mit Siedlungsbestattungen (Deffner 1999) In der Kiesgrube bei Unseburg wurde in den Jahren 1992-1999 eine Fläche von ca. Kiesgrube. die sich auf 6 ha verteilten und womit Vaihingen eine 71 . welche in linkseitiger Hockerlage mit Blickrichtung nach Süden beigesetzt wurden. Baden-Württemberg Siedlung mit Siedlungsbestattungen sowie Bestattungen im Dorfgraben (Krause 2002. Auffallend war eine gruppenartige Häufung von Gräbern in der Gesamtstruktur des Friedhofes. Die Befunde umfassen den Zeitraum von der Linearbandkeramik bis zum Frühmittelalter. Die Gräber waren vergleichsweise spärlich ausgestattet. dagegen konnten innerhalb der Siedlung drei Bestattungen in Gruben in der Nähe der Hausgrundrisse aufgedeckt werden. 200 Hausgrundrisse rekonstruiert. gesellschaftlichen Verbindung der Siedlung oder Siedlungsgemeinschaft entsprach. In den hausbegleitenden Gruben fanden sich neben charakteristischer Keramik auch Knochen. Es wurden ca. dass die Strukturierung des Gräberfeldes in Gruppen der einer verwandtschaftlichen bzw. Der Kalkgehalt im Lössboden war relativ hoch. so dass auch Tier.Material und Methoden beobachten. Kreis Ludwigsburg. Kahlke (1956. Bis 2002 wurden 131 Skelette geborgen. Jedoch zeigten sich auffallende Befunde anhand der Siedlungsstrukturen. Aus der Linearbandkeramik konnten Grundrisse von zehn Häusern aufgedeckt werden. teilweise auch als Siedlungsbestattungen. Ldkr. Eine Siedlungskontinuität wurde durch die gesamte Dauer der Bandkeramik hindurch nachgewiesen.

mündliche Mitteilung) Der niederländische Fundplatz Schipluiden-Harnaschpolder wurde im Sommer 2003 ergraben. wobei jedoch vorab einige Details der Werkzeugbearbeitung deutlich auf eine Erhaltung mesolithischer Einflüsse sprechen. Sie stellt in Zusammenhang der vorliegenden Arbeit eine Ausnahme dar. beide Sachsen-Anhalt) in Deutschland wurden im Rahmen der Magisterarbeit von Marc Tänzer (2005) untersucht. daher können kaum weitere Angaben gemacht werden.Material und Methoden vergleichsweise enge Siedlungsdynamik aufwies.1. Das von Lüning aufgestellte Modell von 0. Eine grobe vorläufige Zuordnung der Befunde deutete auf eine Zugehörigkeit zum späten SwifterbantKomplex hin. Das Gräberfeld zeigte zwei verschiedene cluster mit jeweils 13 bzw.1. 1999) Die Siedlung von Asparn-Schletz wurde ab 1983 im nachfolgenden Jahrzehnt archäologisch ergraben und dokumentiert. Das Gräberfeld befand sich auf einem fossilen Dünenrücken und wurde anhand der Befunde der späten Swifterbant-Kultur zugeordnet.3 Fundorte in Österreich Asparn-Schletz Aufgelassene Siedlung mit Skelettfunden im Grabensystem (Windl 1996. Menschliche Skelettfunde aus zwei weiteren Fundorten (Eilsleben und Unterwiederstedt.5600 Jahre v. Die beiden Grab-cluster könnten möglicherweise als Familiengruppen interpretiert werden. Die Auswertungen der archäologischen Erfassung liegen zum gegenwärtigen Zeitpunkt noch nicht vor. 5. in welchen insgesamt 44 Bestattungen erfasst werden konnten.5 ha pro Langhaus und Wirtschaftseinheit kann hier nicht gegolten haben. 5. Diese frühneolithische Kultur in den Niederlanden wurde auf 6200. Schipluiden-Harnaschpolder Grabgruppe (Liesbeth Smits. 17 Grabgruben. vielmehr ist zur Blütezeit der Siedlung eine geschlossene Gehöftsiedlung mit Dorfcharakter anzunehmen. datiert. h.2 Fundorte in den Niederlanden Ypenburg Gräberfeld (Koot & van der Have 2001) Die Ausgrabungen zur Dokumentation des Gräberfelds von Ypenburg in der Nähe von Den Haag wurden in den Jahren 1997/98 durchgeführt. da die Befundsituation deutlich auf eine kriegerische Auseinandersetzung 72 .

Menschliche Skelettfunde aus weiteren sechs ungarischen Fundorten (Szarvas 8. 2002). 1999) konnte anhand zahlreicher Hiebverletzungen und Frakturen einen gewaltsamen Tod der Individuen nachweisen. Endröd 6. Absolute C14Datierungen liegen sowohl für zwei Kohleproben (6620 BP (BM 1866R) und 6190 BP (BM 1865R)) als auch für eine menschliche Rippe aus Grab 1 vor (5840-5630 BC (OxA-9375)) (Whittle et al. Verteidigungsanlagen gegen Ende der LBK werden von den Autoren als Hinweise auf unruhige Zeiten interpretiert und können ihnen zu Folge möglicherweise als gewaltsames Ende der LBK gedeutet werden. Kretuonas und Plinkaigalis Der Fundort Donkalnis befindet sich nördlich des Birzulis-Sees im heutigen Litauen. Endröd 119. Im Nordosten Litauens liegt am namensgebenden See Kretuonas der Fundort Kretuonas 1B. 5. In der Grabenverfüllung fanden sich weitere isolierte Skelettelemente. Dévaványa – Barcéi Kishalom und Dévaványa – Katonaföldek) wurden im Rahmen der Diplomarbeit von Guido Brandt untersucht (Brandt 2005). 1996. wie z. die zunächst als spätneolithisch. für welche auch Langbauten nachgewiesen werden konnten.5 Fundorte in Litauen Donkalnis. die 1988 von János Makkay durchgeführt wurde (Makkay 1989).1. Hier fanden sich sowohl Reste einer frühneolithischen Siedlung sowie auch eine kleine Grabgruppe von 73 .bzw. Insgesamt wurden sieben vollständige und ungestörte Gräber gefunden. In den Sohlen der jüngsten Gräben fanden sich Skelette von etwa hundert Individuen unregelmäßig verteilt und in irregulären Haltungen. Die älteste Besiedlungsphase datiert in die ältere Bandkeramik.B. 5.4 Fundorte in Ungarn Szarvas 23 Grabgruppe Beim Fundort Szarvas 23 (auch Szarvas 8/23 – Egyházföld) handelt es sich um eine Notgrabung.1. jedoch später als mesolithisch eingestuft wurden. Bis auf eine Ausnahme konnte im ergrabenen Areal keine reguläre Bestattung nachgewiesen werden. Die anthropologische Auswertung von 67 Skeletten (Teschler-Nicola et al. Ecsegfalva 23A.Material und Methoden hindeutet. dessen detaillierte stratigraphische Abfolge abschnittsweise noch ungeklärt ist. des zeitgleichen Massengrabes im süddeutschen Talheim (Baden-Württemberg) und die auffallende Zunahme an Grabenwerke als Schutz. Es ließ sich um die Siedlung ein komplexes Grabensystem nachweisen. Diese wird gefolgt von Befunden der Phase der klassischen Notenkopfkeramik. Dabei fanden sich neben einigen Gefäßen bemalter Keramik auch einige Bestattungen. Die Befunde von Asparn-Schletz sowie ähnlicher Funde. die die Tötung vermutlich aller Siedlungsbewohner und die Auflassung der neolithischen Siedlung zur Folge hatten.

Diese lokale autochthone meso-neolithische Kulturstufe wird in die zweite Hälfte des siebten bis zum Anfang des sechsten Jahrtausends vor unserer Zeitrechung datiert (Mamonov 1995. Beim Individuum Plinkaigalis handelt es sich um eine von zwei spätneolithischen schnurkeramischen Bestattungen.1.. 5.1. 74 . Mitteilung). Crests 1996). 2000. persönl. in Vorbereitung). Beim Individuum aus Lebyazhinka. die Kugelamphorenkultur bis zur Schnurkeramischen Kultur der ausgehenden Jungsteinzeit nachgewiesen werden. 8680 ± 120).6 Fundorte in Polen Dudka Gräberfeld Am Fundortplatz Dudka im heutigen Polen wurden sowohl Reste einer neolithischen Siedlung als auch die zugehörgen Bestattungen gefunden. Skelettfunde eines zweiten polnischen Fundortes (Drestwo) wurden ebenfalls von Barbara Bramanti untersucht (Bramanti et al. Weitere Grabfunde für das Individuum Chekalino. welches in gleicher Weise niedergelegt wurde..a. Die zugehörigen Radiokarbondatierungen sprechen ebenfalls für eine zeitliche Einordnung ins Spätneolithikum (Jankauskas. welche innerhalb eines eisenzeitlichen Gräberfeldes bei Plinkaigalis gefunden wurden. Kap. Menschliche Skelettfunde aus weiteren zwei litauischen Fundorten (Spiginas und Kirsna) sowie weitere Individuen aus Donkalnis wurden im Rahmen des Projektes (vgl. Anhand des archäologischen Fundgutes sowie der Daten der Radiokarbondatierungen konnte eine langfristige Belegdauer vom Mesolithikum über die Szadmar-Gruppe.7 Fundorte in Russland Chekalino IV und Lebyazhinka IV Einzelgräber Die zwei Einzelgräber Chekalino und Lebyazhinka stammen aus der Region Samara östlich der mittleren Wolga im heutigen Russland. persönl. welches in gestreckter Rückenlage beigesetzt wurde. Eine absolute Datierung liegt für Muschelfunde aus der Bestattungsschicht von Chekalino vor (GIN 7085. liegen nicht vor. Insgesamt konnten 13 Gräber mit 24 Bestattungen gefunden werden. Beide sind durch Beifunde mit der YelshankayaKultur assoziiert.Material und Methoden insgesamt sechs frühneolithischen Bestattungen. ein Steinartefakt und ein Gefäß (Jankauskas. in Vorbereitung). 1) von Barbara Bramanti untersucht (Bramanti et al. fanden sich u. 5. eine Knochenharpune. Mitteilung).

39 E 11.66 E 4.51 N 20.15 E 11.71 E 48. Fundorte..19 E 5.34 N 52.15 N 53.22 E 16.05 N 48.5 E Sachsen-Anhalt Sachsen-Anhalt Bekes Megye Bekes Megye Bekes Megye Zuid-Holland Flevoland Niederösterreich Samarskaya Oblast Land Deutschland Deutschland Deutschland Deutschland Deutschland Deutschland Deutschland Deutschland Deutschland Litauen Litauen Litauen Niederlande Niederlande Niederlande Österreich Polen Russland Russland Ungarn Deutschland Deutschland Ungarn Ungarn Ungarn Polen Litauen Litauen 75 .93 N 47.52 E 11. welche keine Ergebnisse ergaben.44 E 46.83 E 20.56 N 51.78 E 10.86 N 49. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Fundort Bruchstedt Derenburg Meerenstieg II Flomborn Halberstadt Schwetzingen Seehausen Sondershausen Unseburg Vaihingen/Enz Donkalnis Kretuonas Plinkaigalis Schipluiden-Harnaschpolder Swifterbant Ypenburg Asparn-Schletz Dudka Chekalino Lebyazhinka Szarvas Breite 51.Material und Methoden Abbildung 14.75 E 23.05 E 23. sind grau sowie kursiv dargestellt (Kartengrundlage: Ancient World Mappings. *Tänzer 2005 **Brandt 2005 ***Bramanti et al.93 N 53.35 N 11.23 N 55. in Vorbereitung.73 N 54.edu/awmc/).45 E 10. die im Rahmen des Projekt von Mitarbeitern der Arbeitsgruppe „Molekulare Archäologie“ und zur übergreifenden Interpretation sowie inhaltlicher Diskussion herangezogen wurden. Herkunft und geographische Koordinaten der untersuchten Proben dieser Arbeit.23 N 51.21 E 11.03 N 47.31 N 26. Nr.9 E 8.18 N 51.66 N 46.96 E 20.35 E Bekes Megye 21 22 23 24 25 26 27 28 Eilsleben* Unterwiederstedt* Endröd** Devavanya** Ecsegfalva** Drestwo*** Kirsna*** Spiginas*** 52.54 N 49.41 N 51.unc.69 N 51.15 N 51. http://www.46 E 21.58 E Bundesland/Region Thüringen Sachsen-Anhalt Rheinland-Pfalz Sachsen-Anhalt Baden-Württemberg Thüringen Thüringen Sachsen-Anhalt Baden-Württemberg 55. Daten von weiteren Fundorten und Proben.66 N Länge 10.91 E 22.93 N 48.53 E 20.38 E 4.5 E 8.59 N 52.54 N 51.22 N 52.04 E 8. sind weiß dargestellt.

Fundort/Herkunft Flomborn Schwetzingen Derenburg Meerenstieg II Halberstadt Sondershausen Bruchstedt Kürzel FLO 4a FLO 4b FLO 4c FLO 6a FLO 6b FLO 6c SCHWE 1a SCHWE 1b SCHWE 2a SCHWE 2b SCHWE 4a SCHWE 4b SCHWE 5a SCHWE 5b DEB 1 DEB 2a DEB 2b DEB 2c DEB 3a DEB 3b DEB 4a DEB 4b DEB 5a DEB 5b HAL 1a HAL 1b HAL 1c HAL 2a HAL 2b HAL 2c HAL 3a HAL 3b SON 1 SON 2 SON 3 SON 4 SON 5 SON 6 SON 7 SON 8 SON 9 BRU 1 BRU 2 BRU 3 BRU 4 BRU 5 BRU 6 BRU 7 BRU 8 Material M47 M48 M37 M18 M46 M16 M18 P45 Fußphalange rechts M27 Ulna fragment M28 Handphalange rechts Metatarsus V links M37 M37 M47 M38 oder M48 M26 M27 M28 M18 M16 M17 M37 M47 Handphalange C33 P35 Fußphalange M28 Caninus isoliert Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Kultur/Datierung LBK. Probenart und Datierungen der im Rahmen dieser Arbeit untersuchten Proben. Stufe Flomborn LBK. Stufe Flomborn Späte LBK LBK LBK LBK LBK 76 .Material und Methoden Tabelle 4.

Kunda 7405±45 BP Narva 5350±65 BP (OxA-5926) Narva 5580±65 BP (OxA-5935) Schnurkeramik 4030±40 BP (OxA-5928) Yelshanskaya Kultur Yelshanskaya Kultur 8680±120 (GIN 7085) Swifterbant Swifterbant Swifterbant Körös-Kultur Körös 77 . C33 Femurfragment rechts Tibiafragment rechts Humerus fragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Langknochenfragment Femurfragment rechts Humerusfragment rechts M37 M47 Humerusfragment Femurfragment Femurfragment Humerusfragment M36 M46 Molar isoliert Femurfragment Kultur/Datierung LBK LBK LBK LBK Kugelamphorenkultur 4730±40 BP Zedmar 4870±110 BP Mesolithisch. I32. Fortsetzung. Kunda Mesolithisch. C43. M38. Fundort/Herkunft Seehausen Unseburg Vaihingen/Enz Asparn-Schletz Dudka Donkalnis Kretuonas Plinkaigalis Lebyachkinka IV Chekalino IV Swifterbant Ypenberg SchipluidenHarnaschpolder Szarvas 23 Kürzel SEE 1 SEE 2 SEE 3 UNS 1 UNS 2 UNS 3a UNS 3b VAI 3 ASP 2 DUD 1a DUD 1b DUD 1c DUD 2a DUD 2b DON 1a DON 1b DON 1c DON 1d DON 1e DON 2a DON 2b KRE 1a KRE 1b KRE 1c KRE 2a KRE 2b KRE 2c PLI 1a PLI 1b PLI 1c PLI 1d LEB 1a LEB 1b LEB 1c LEB 1d LEB 1e LEB 1f CHE 4a CHE 4b CHE 4c SWI 6a SWI 6b YPB 2a YPB 2b SLH 1a SLH 1b SLH 2a SLH 2b SZA23 1a SZA23 1b SZA23 2a SZA23 2b Material Langknochenfragment Langknochenfragment Langknochenfragment 54 (Kind) Oberer Molar Metacarpus rechts Phalange M3 superior M38 M26 M27 M28 M38 M47 Untere Molaren Obere Molaren Femur rechts Fibulafragment Handphalange M?8 Craniumfragment M37/M38. P35 Femur links Tibiafragment links I41. I42. P34 Tibiafragment links Humerusfragment links M48.Material und Methoden Tabelle 4.

Arbeitskleidung angelegt 78 .2. die ebenfalls im Spurenbereich vorliegen. das heißt der Eintrag von bereits amplifizierten Zielsequenzmolekülen unterbunden werden. die im Anwendungsbereich getragen wird. wo im ersten Raum die frische Kleidung abgelegt und im zweiten die Schutz. wobei Chemikalien und Verbrauchsstoffe ausschließlich nur einem Bereich zugeordnet sind. was wiederum zu falsch positiven Ergebnissen führt. überlagert werden kann. Für alle Mitarbeiter gelten strenge hygienische Vorgaben. Aus diesem Grund wird in diesem Kapitel der „Problemkreis aDNA“ vor die eigentliche Methodenbeschreibung gestellt. dass die geringe echte Zielsequenz leicht von anderen Einträgen. Ursachen für Kontaminationen sowie die im aDNA-Labor (Spurenlabor) des Anthropologischen Instituts der Universität Mainz getroffenen Gegenmaßnahmen erläutert werden.Material und Methoden 5. sowie organisatorische und pragmatische Vorkehrungen. Um diese Gefahr methodisch zu umgehen.1 Maßnahmen zur Kontaminationsvermeidung Die Analyse alter oder degradierter DNA (aDNA) erfordert besonders sensible methodische. Das Ziel der Maßnahmen ist es. sind im Anthropologischen Institut der Universität Mainz die Laborräume (prä)historischer Probenbearbeitung nicht nur räumlich von den rezentgenetischen bzw. Die Möglichkeiten der Kontamination sind divers. die keinesfalls mit der Kleidung. oder im schlimmsten Fall auch durch ihre Quantität während der initialen Zyklen der PCR „favorisiert“ werden.h. d. 1996). sowie das strikte Einhalten einer Kleidervorschrift. schwer systematisch erfassbar und zu jedem Zeitpunkt der Analyse wahrscheinlich. die stark fragmentiert vorliegende DNA. Klonierung und Sequenzierung) getrennt.bzw. nicht dem „Wettbewerb“ mit intakten Spuren fremden Ursprungs auszusetzen. Da die PCR eine sehr sensitive Methode ist.2 Methoden 5. Im Folgenden sollen die putativen Quellen bzw. Durch eine ZweiRaum-Schleuse im Eingangsbereich des aDNA Spurenlabors..h.T. insofern die zu untersuchende Zielsequenz mit den kontaminierenden Sequenzen identisch ist. d. Damit soll die Möglichkeit einer carry over-Kontamination. zusammengeführt werden sollte. Eine Identifikation dieser Form der Kontamination kann unter Umständen zeitlich erst sehr viel später durch eine statistisch ungewöhnliche Häufung bestimmter Sequenztypen entdeckt werden. ist die Gefahr groß. Die Trennung von Prä-PCR-Laborbereich und Post-PCR-Anwendungsbereich ist daher mit einer strikten „Einbahnstraßenregelung“ versehen. die in erster Linie die Authentifizierung der Ergebnisse gewährleisten müssen. die meist nur noch in einzelnen amplifizierbaren Kopien vorliegt. sondern gänzlich in zwei verschiedenen Gebäuden untergebracht. z. vor jedem Betreten des Spurenlabors sollte der Bearbeiter frisch geduscht sein und ebenso frisch gewaschene Kleidung tragen. nachfolgenden Anwendungen (vor allem PCR. Die charakteristische Problemstellung des Untersuchungsmaterials verlangt Strategien. Carry over-Kontaminationen durch PCR-Produkte Diese Form der Kontamination stellt die gefährlichste dar. Diese können durch ihre Qualität. ohne liegezeitbedingte Sequenzveränderungen (Höss et al.

UV-Bestrahlung bedingt eine Dimerisierung benachbarter Pyrimidine. die zeitschaltuhrgesteuert alle sensiblen Arbeitsbereiche über Nacht bestrahlt und daher Oberflächenkontaminationen erfassen kann. Alle Arbeitschritte im Spurenbereich von der Probenvorbereitung bis inklusive der PCR werden daher in geeigneter Schutzkleidung durchgeführt. mögliche Kontaminationen frühzeitig zu erkennen. die keine Einwegmaterialien sind. werden nach dem jeweiligen Arbeitsschritt penibel gereinigt. chirurgischem Mundschutz. einer zusätzlichen Stirn. 2 79 . Dies beinhaltet das Tragen von Reinstraumanzügen [DuPont Tyvek. werden bei der Ankunft im Mainzer Spurenlabor weitestgehend beseitigt. Diese Inaktivierung ist am effektivsten bei einer Strahlungsintensität von 400iW/cm2 (Cone & Fairfax 1993). z. wodurch die DNA bei einer möglichen Amplifizierung inaktiviert ist. um im letztmöglichen Schritt per Vergleich der Ergebnisse putative „Kontaminatoren“ zu identifizieren. wird für die initiale Probenbehandlung ein anderer Anzug als für den Ansatz der PCRs getragen. Dies geschieht durch allseitiges Bestrahlen mit UV-Licht sowie durch die mechanische Entfernung der Probenoberfläche. Moleküle der einen Probe eine andere verunreinigen. werden zudem die präventiven Maßnahmen zur Kontaminationsvermeidung mit „frischen“ Molekülen bzw. und ist in den Arbeitsprotokollen standardisiert. Hamburg] und Bestrahlung mit UV-Licht entgegengewirkt werden. Die Anzüge werden über Nacht mit UVLicht (256nm)2 bestrahlt bzw. Zusätzlich werden für einzelne Arbeitsschritte verschiedene Anzüge verwendet. die durch den Ausgräber. Das Mitführen von mehreren Leerkontrollen und Proben anderer Spezies bei Extraktion und PCR kann ebenfalls helfen. Überschuhen. Amplifikaten getroffen. Dieses zieht sich durch alle Arbeitsschritte der Bearbeitung. Kontamination durch andere Proben (Kreuzkontamination oder cross contamination) Die Proben selbst stellen ebenfalls eine mögliche Kontaminationsgefahr dar. Palmolive-Colgate GmbH. Dieser Gefahr kann nur mit strikter Einhaltung der allgemeinen intensiven Reinigungsschritte zwischen jeglichen Arbeitsschritten durch Seifenlösung. Arbeitsflächen und dergl. um den Eintrag von DNA seitens der Laborbearbeiter möglichst gering zu halten. bei der anthropologischen oder zoologischen Bearbeitung oder durch Präparierung und Archivierung in Museen oder Sammlungen oder ähnliche denkbare Situationen entstehen. Darüber hinaus verfügt das Spurenlabor in Mainz über eine aufwendige UV-Anlage.Material und Methoden wird. Alle weiteren Bestandteile der Schutzkleidung.B. beginnend bei der archäologischen Bergung der Proben bis hin zur Interpretation der Ergebnisse. regelmäßig erneuert. Luxemburg]. Kontamination durch Bearbeiter Die Kontamination durch Bearbeiter stellt vor allem im Bereich der humanen aDNA ein besonders großes Problem dar. sowie UV-bestrahlt. So können bei ungenügender Reinigung von Gegenständen. Alle bestehenden Kontaminationen einer Probe selbst. mehreren Lagen Einweghandschuhen und einem Schutzvisier. Natriumhypochlorid [DanKlorix.und Haarhaube. Möglichst alle erfassbaren „Vor“-Bearbeiter werden ebenso wie alle im Spurenlabor tätigen Personen für die entsprechenden DNAAbschnitte typisiert.

weitestgehend verhindern.Material und Methoden Kontamination durch externe Materialien. Seife und Natriumhypochloridlösung gereinigt und in einem eigens vorgesehenen Raum für mindestens 45 min/pro Seite UV-Licht ausgesetzt. wurde mit einem großzügigeren Abtrag der äußeren Probenschicht begegnet. 1997). welches sowohl für die Ansätze von Lösungen. wenn sie auch nie gänzlich ausgeschlossen werden kann (Krings et al. Ein fortwährendes monitoring der Extraktions. IEM GmbH.2. wird über Nacht unter stetigem Rühren mit UV-Licht bestrahlt. Bei Reagenzien und Chemikalien kann lediglich das Behältnis intensiv gereinigt werden. als auch für die Extraktionen und PCRs verwendet wird. die im Spurenlabor selbst angesetzt werden. dass möglichst intakte und stabile Partien der Extraktion zur Verfügung standen. Alle Proben wurden äußerlich 45min mit UV-Licht bestrahlt und die Zähne wurden zusätzlich mit Natriumhypochlorid gereinigt. Mit diesen Maßnahmen soll die Vielzahl von möglichen Quellen als auch die Quantität von putativen Kontaminanten möglichst drastisch verringert werden. Dies erfordert zudem ein gewisses Maß an gegenseitiger Kontrolle sowie ein Vermeiden jeglicher unnötiger Schritte durch exakte Logistik und verlässliche Absprachen. das zum Reinigen verwendet wird. Letzteres gilt auch für alle Lösungen. Jegliche Form und Art der Verpackung wird bereits zuvor entfernt und nach den Reinigungsschritten durch laborseitige Behältnisse ersetzt. sowie Reagenzien und Lösungen Alle Gegenstände. wird zunächst durch Umkehrosmose gefiltert [Umkehrosmoseanlage. HPLC-Wasser (High Performance Liquid Chromatography). dass DNA-Moleküle durch den schwammartigen Knochenaufbau in das Innere des Knochens diffundieren.und PCR-Reagenzien durch Leerkontrollen ist daher unumgänglich. Mit Diamanttrennscheiben und einer Rotationssäge [Typ K10 EWL. Dremel®. die bedingt durch die Einbettung in den Kiefer und durch die Dentinkrone besser vor äußeren Einflüssen geschützt waren. Anschließend wurden ca. wurde bei der Probennahme darauf geachtet. 0. deren substantia compacta noch gut erhalten war. Dieser Schritt der mechanischen Oberflächenentfernung sollte bestehende Kontaminationen verringern. Behältnisse und Verbrauchsmaterialien werden nach ihrer Ankunft im Spurenlabor gründlichst mit Wasser. 80 . Alle Gegenmaßnahmen erfordern eine hohe allgemeine Arbeitsdisziplin und Sorgfalt hinsichtlich der erforderlichen Reinigungsschritte zwischen einzelnen Proben oder einzelnen Arbeitsschritten. Mainz] und vor Verwendung mindestens 24 h mit Hilfe einer wasserdichten UV-Handlampe bestrahlt. sichtbare Erhaltungszustand des Skelettes auch ein Kriterium für die Erhaltung der DNA sein kann. Utrecht.2 Probennahme und Probenvorbereitung Da der äußere. Der Möglichkeit. Das Leitungswasser. Dies soll die Möglichkeit einer Kontamination durch Verbrauchsmaterialien. oder Zähne mit intakten Zahnwurzeln.2-1 mm der Oberfläche der gewählten Stelle oder des ganzen Zahnes mit einer Fräse abgenommen [Dremel® Fräsvorsätze und Dremel Multi®. welche nicht DNA-frei sind. In der Regel wurden Skelettteile gewählt. Niederlande]. Hinzu kommt ein hoher Grad an Verantwortlichkeit der Laborgemeinschaft gegenüber. 5. Die Chemikalien selbst werden getestet.

Die Inkubation dieser Lysesuspension erfolgte in Rotation über Nacht bei 37°C. und eine schwerere. Lipid.3) [Acros Organics. Schwalbach] (Burger et al. 5mm Kantenlänge zerkleinert.3 – 1 g Pulver in 5 ml/g 0. welche den hydrophilen Bodenbestandteilen der jeweiligen Probe zugesprochen wurde und 81 . soweit nicht anders angegeben. Schweiz] pro Probe bedingte die Auflösung der verbliebenen organischen Matrix sowie der Zellmembranen der Osteoblasten und führte zur Freisetzung der DNA. pH 8. Zwischen diesen beiden Phasen.1 Isolation von DNA aus Knochen und Zähnen a) Dekalzifizierungs.3 DNA-Extraktion 5.und andere organische Reste gebunden wurden. wodurch sich zwei Phasen bildeten: eine wässrige obere Phase. pH 7.0) [Rotiphenol®. in der sich die hydrophile DNA löste. b) DNA-Isolierung aus der Lysesuspension Die DNA-Isolierung aus der Lysesuspension beruhte auf einem modifizierten Protokoll der klassischen Phenol-Chloroform Aufreinigung.2. hydrophobe Phenolphase.oder herausgetrennt und in Teilstücke von ca. welches in 15 ml Gefäßen bei 4°C bis zum Einsatz gelagert wurde. Sambrook et al. in welcher Protein-.2. Die Zugabe von 30-60il Proteinase K [Roche Diagnostics GmbH. Alle Arbeitsschritte erfolgten unter den im vorigen Kapitel beschriebenen Maßnahmen zur Kontaminationsvermeidung.bzw. Nach erneuter UV-Bestrahlung für 45 min wurden die Probenstückchen in einem weiteren mechanischen Zerkleinerungsschritt mit Hilfe einer Kugelschwingmühle [LaborSchwingmühle MM200. Stattdessen erfolgte eine Aufreinigung und Reduzierung des finalen Volumens über 100kDa Centricon-Filtereinheiten [Amicon. die chemische Aufspaltung der mineralischen Matrix führte zu einem Ausspülen von DNA-haltigen Zellen (Osteoblasten) und organischen Zellresten aus dem suspendierten Knochenpulver.Material und Methoden KaVo.5-8.5 M Ethylendiamintetraessigsäure (EDTA.. Hänni et al.3. Belgien] aufgenommen. in der sogenannten Interphase wurden wasserlösliche Proteine sedimentiert. Biberach/Riss] wurden gezielt Abschnitte ab. allerdings ohne anschließender Fällung durch Ethanol in Anwesenheit von Natriumacetat (z. Teilweise wurde bei Molaren auf Wunsch der Probengeber die Zahnkrone abgetrennt und zu weiteren Analysen retourniert. Die obere Phase erhielt meist eine probencharakteristische Färbung. Zahnpulver gemahlen.. 5. Die Dekalzifikation bzw. Millipore GmbH. Die DNA-Isolierung erfolgte durch Zuführung von 1 Volumen Phenol/Chloroform/Isoamylalkohol (25/24/1. 1995). Der Chelatbildner EDTA bindet die zweiwertigen Mg2+ und Ca2+-Ionen aus dem Hydroxylapatit des Knochens. 1989. Buchs.B. Haan] zu Knochen. 2004). Retsch. Lyseschritt Im initialen Extraktionsschritt wurden Aliquots von 0. Geel. Karlsruhe] zur Lysesuspension und Durchmischung für ~2 min. Anschließend erfolgte eine Zentrifugation für 10 min bei 1700xg. Alle Arbeits.und Zentrifugationsschritte erfolgten bei RT.bzw. Mannheim] und 1/10 Volumen des Detergenz NLaurylsarkosin [Fluka Chemie. Carl Roth GmbH.

Die Zentrifugationsschritte zur Aufreinigung erfolgten so lange bis die Probe mit mindestens 3. Dies beinhaltete auch degradierte DNA-Fragmente unter 125bp (100kDA entsprechen ~125bp doppelsträngiger DNA). die in der nachfolgenden Amplifikation inhibierend wirken könnten. Es folgte ein Überführen der wässrigen Phase in ein neues Reaktionsgefäß und Verwerfen der organischen Phenolphase sowie der Interphase. nach deren freiwilliger Zustimmung. die kleiner als 100kDa sind. Zunächst wurde die Lösung bei max.3. Invitek. Carl Roth GmbH.2. die Probe für 2 min durchmischt und anschließend ebenfalls 10 min bei 1700xg zentrifugiert. 5. Die genomische DNA aus Mundschleimhautabstrichen wurde mit Hilfe des Prinzips der selektiven Zentrifugation über Spinsäulen mit einer Silica-Gel-Membran gewonnen [Invisorb Spin Swab Kit. Nach dem letzten Waschschritt erfolgten das Drehen der Filtereinheit und die finale Zentrifugation bei 5000xg von durchschnittlich 50-200il DNAEluat des Retentats vom Filter in das Auffanggefäß der Filtereinheit. wobei die freie doppelsträngige DNA unter gepufferter hoher Salzkonzentration an die Membran bindet.2 Isolation von DNA aus Mundschleimhaut Nach Aufklärung über Vorhaben und Zweck der Rezentkontrollen wurden Mundschleimhautabstriche von Mitarbeitern und Probengebern.5ml UV-HPLC-Wasser gewaschen wurde oder bis die Lösung klar wurde. genommen. Um Phenolrückstände zu entfernen.bis fünffach wiederholte Zugabe von 1-2ml UV-bestrahltem HPLC-Wasser zum Retentat mit einem nachfolgenden Zentrifugationsschritt bei max. Dieser Schritt der Phenolzugabe kann optional wiederholt werden (was vor allem bei starker Proteininterphase empfehlenswert ist) und wurde im Verlauf der vorliegenden Arbeit bei allen Extraktionen durchgeführt. Die Isolation erfolgte gemäß dem Protokoll des Herstellers. Darauf folgten zwei Zentrifugationsschritte mit unterschiedlichen Waschpuffern. Das Eluat wurde in Aliquots à 30il bis zum Gebrauch bei –20°C gelagert. ebenfalls entfernt werden. Im ersten Schritt wurden die Zellen der Probe durch Inkubation mit Protease aufgebrochen. Hierbei sollten alle Bestandteile der vorangegangen Schritte weitestgehend abzentrifugiert werden.und Fulvinsäuren handelte. 1000xg. wurde 1 Volumen Chloroform [Trichlormethan/Chloroform ROTISOLV®. Das Lysat wurde auf die Spinsäule aufgetragen. Hier erfolgte ebenfalls eine Phasenbildung in eine hydrophile wässrige Phase und eine hydrophobe organische Phase.Material und Methoden wobei es sich vorwiegend um Humin. Hamburg]. 1000xg bis zur vollständigen Konzentration zentrifugiert (~30-45 min). die die Reinigung der gebundenen DNA von Rückständen zum Ziel hatten. Zudem sollten alle Koextrakte. Berlin]. Im finalen Elutionsschritt wurde die gereinigte DNA unter pufferinduzierten Bedingungen (niedrige Salzkonzentration) wieder von der Membran gelöst und in das vom Hersteller bereitgestellte Auffanggefäß 82 . Karlsruhe] zugegeben. Dieser initialen Konzentration erfolgte eine Aufreinigung durch drei. währenddessen darauf geachtet. Das Filtrat wurde jeweils verworfen. Die Abnahme erfolgte mittels kommerziellen Abstrichbestecks [Heinz Herenz. wobei jede Wangeninnenseite für 30s abgestrichen wurde. dass ein kleiner Film wässriger Lösung erhalten blieb und der Filter nicht trocken zentrifugiert wurde. Zur Aufreinigung der in der wässrigen Phase gelösten DNA wurde diese auf eine 100kDa Centricon-Filtereinheit überführt.

Des Weiteren kann in der Theorie das Anlagerungsverhalten des Primers an die Zielsequenz aufgezeigt werden. Im ersten Schritt. 2003 bzw.4. der Denaturierung (denaturation) der DNADoppelstränge (bei etwa 90-95°C).Material und Methoden zentrifugiert. In drei eigenständigen Temperaturschritten. Diese dienen der DNA-Polymerase im Elongationsschritt (bei ~72°C) als Ausgangspunkt. Alle Primerpaare wurden hinsichtlich dieser Kriterien erstellt.4. 83 . Das Programm ermöglicht unter anderem die Ermittlung der theoretischen annealing-Temperatur der Primer und auch die Analyse der Tendenzen zur Bildung von störenden Sekundärstrukturen. GATC Biotech AG. um mit den jeweils komplementären Basen (freie dNTPs.2. wie primer dimer.2. 1995a. 5. Konstanz]. nur das 3´-Ende hybridisiert später.nlm. dessen Temperatur sowohl theoretisch als auch empirisch ermittelt werden kann. Beim anschließenden Annealing-Schritt (annealing). Besonderer Wert wurde auf ein balanciertes G Profil mit leicht ansteigenden Werten zum 3´-Ende gelegt. Zur Erstellung von Primern im Programm Primer Select wurde die Cambridge Reference Sequence verwendet. welche unter der accession number J01415 in Genbank (http://www.mitomap.1 Das Prinzip der Polymerase-Ketten-Reaktion Mit Hilfe der PCR (polymerase chain reaction) können DNA-Sequenzen in vitro spezifisch und mit hoher Ausbeute (Effizienz) vervielfältigt (amplifiziert) werden (Mullis & Faloona 1987). sogenannte Primer (Oligonukleotide) an die Matrize (template DNA) angelagert (hybridisiert). Vigilant et al. Desoxynukleotidtriphosphate) beide Matrizenstränge zu kopieren (elongation) (Gassen et al. stammten aus bereits etablierten Protokollen der Literatur (Handt et al. was eine höhere Spezifität des Primer gewährleistet (Burger 2000. 1995b). Die durchschnittliche DNA-Konzentration der verdünnten Extrakte betrug 20ng/il. Die übrigen Primer wurden innerhalb der Arbeitsgruppe erstellt und etabliert. Endicott et al.2. wird die DNA in Einzelstränge aufgeschmolzen.2 Primerdesign Die Mehrzahl der Primer. 1996. Rychlik. Die Lagerung der Extrakte erfolgte bei -20°C. Im nachfolgenden Zyklus dient die somit neu synthetisierte Matrizenmenge wiederum als Ausgangsmaterial.gov/ oder www. Stone & Stoneking 1998.4 Die Polymerase-Ketten-Reaktion (PCR) 5. Das Design der Primer erfolgte computergestützt mit Hilfe des Programms Primer Select des Softwarepakets Lasergene 99 [DNA STAR. 1991).nih. Der erstellte Primer besitzt somit über seine Länge hinweg eine ausgewogene Bindungsaffinität. die zur Amplifikation der Hypervariablen Region I der mtDNA verwendet wurden.org) abgelegt ist.ncbi. primer self dimer und hairpins. Eluiert wurde in 50il elution buffer. wird die Menge des von Startermolekülen (primer) eingerahmten Matrizenfragments verdoppelt. 5. 1994). die zyklisch wiederholt werden. werden die Startermoleküle.

Zudem erfolgte im Verlauf der Arbeit eine Reduzierung des Gesamtvolumens der PCR auf 25il. Zur Erzielung möglichst großer Produktausbeuten bei gleichzeitig geringer Entstehung von Primerdimeren und unspezifischen Nebenprodukten wurden einzelne Parameter variiert.3. Für die ersten drei Fragmente wurde in wenigen Fällen ein alternatives. Die Sequenzen und Fragmentlängen finden sich in Tabelle 6. Im Rahmen der PCR-Optimierung wurden in dieser Arbeit die optimalen Konzentrationen an Magnesiumchlorid (MgCl2).2. Tabelle 6). sowie die empirische annealing-Temperatur der Primer ermittelt.4.4. Die Amplifikation des langen DNA-Abschnitts erfolgte mittels sich überlappender kürzerer Fragmente (Abbildung 14. hier Fragment V genannt) amplifiziert.1 Amplifikation der Hypervariablen Region I (HVR I) Zur Bestimmung der mitochondrialen Haplogruppe der neolithischen Proben wurde ein 413bp (np 15997-16409) langer Bereich um das Hypervariable Segment I (HVS I.3 Amplifikation mitochondrialer DNA 5. Zur Überprüfung eines möglichen Erhalts langer DNA-Fragmente in den Extrakten wurde auch der gesamte 413bp lange Abschnitt (L15996 – H16410. kürzeres Primerpaar verwendet. 84 .Material und Methoden 5. was einer Halbierung aller Reagenzien entsprach. Abbildung 15. Strategie zur Rekonstruktion von längeren Sequenzen durch Amplifikation überlappender Fragmente. DNA-Polymerase und Primern. Der PCR-Ansatz zur Amplifikation mitochondrialer DNA erfolgte generell in einem Volumen von 50il (Tabelle 5).2. np16024np16365) amplifiziert und sequenziert.

1) wurde bei 60°C für 30min angefügt. Name Sequenz 5’-3’ Fragment 1 L15996 CTCCACCATTAGCACCCAAAGC L16055 GAAGCAGATTTGGGTACCAC H16142 ATGTACTACAGGTGGTCAAG Fragment 2 L16117 TACATTACTGCCAGCCACCAT H16218 TGTGTGATAGTTGAGGGTTG H16233 GCTTTGGAGTTGCAGTTGATGTGT Fragment 3 L16209 CCCCATGCTTACAAGCAAGT H16303 TGGCTTTATGTACTATGTAC H16348 ATGGGGACGAGAAGGGATTTG Fragment 4 L16287 CACTAGGATACCAACAAACC H16410 GCGGGATATTGATTTCACGG Referenz Länge (bp) Endicott et al. Der initialen Aktivierung der Polymerase (6min bei 94°C) folgten unterschiedliche Zyklenzahlen mit jeweils 30-40s Denaturierung bei 94°C.2mM 2. Anschließend wurde die PCR gestoppt und auf 8°C abgekühlt. 1981). 1996 Stone & Stoneking 1998 187 (145) 126 (87) Haak et al. Diese verfügen über einen (vor-)heizbaren Deckel (105°C).7. Vigilant et al. Standardprotokoll des PCR-Ansatzes (mtDNA).2.5mM 0. 2005b Handt et al.02ig 1U 0. Reagenzien 10x PCR Gold Buffer MgCl2 Lösung dNTP Mix AmpliTaq Gold™ BSA UNG Primer (jeweils) DNA-Extrakt H2O (UV-HPLC) Gesamt Volumen in Pl 5 5 5 0. Liste der verwendeten mitochondrialen Primer im Bereich der HVR I.5U 0. 2003. 1996 Haak et al.Material und Methoden Tabelle 5. Zur Amplifikation von Fragment V wurden die Primer L15996 und H16410 verwendet. In der Regel wurde nach fünf negativen Wiederholungen des Amplifikationsversuchs eines Fragments die Probe verworfen.5 1 1 1 1-8 Ad 50 50 Konzentration 1x 2. Die Namensgebung der Primer richtet sich nach der Nukleotidposition der 3’ Base des Primers (nach Anderson et al. heavy strand (H) Primer angegeben. Hamburg] durchgeführt.2.2iM nicht bestimmt Hersteller Applied Biosystems Applied Biosystems MBI Fermentas Applied Biosystems Roche Sigma-Aldrich Biosprings ACROS Organics Alle PCRs wurden in Thermocyclern [Eppendorf Mastercycler bzw. Mastercycler gradient. UNG wurde optional eingesetzt. Ein finaler Adenylierungsschritt in Anpassung zur nachfolgenden Ligation mit einem T-Vektor (Kap. 2005b 141(100) 162 (115) Handt et al. Die Anzahl zyklischer Wiederholungseinheiten belief sich je nach PCR auf 38-42 Zyklen. Die Produktlänge (in Klammern ohne Primer) ist jeweils beim variierenden light (L) bzw. Eppendorf. so dass auf eine Mineralüberschichtung zur Evaporationsvermeidung verzichtet werden konnte. 2005b 133 (94) 179 (138) Handt et al. 1991 Handt et al. 1996 Handt et al. 1996 162 (122) 85 . 1996 Handt et al. 30-40s bei 58°C und 30-40s Elongation bei 72°C. 1996 Haak et al. 5. Tabelle 6.

3. Somit wurden zur Bestätigung der vermuteten Haplogruppe jeweils die charakteristische Position auf der coding region gewählt und amplifiziert. wurde teilweise in die PCRs einer Extraktion zusätzlich Uracil-N-Glykosylase (UNG) [SigmaAldrich Chemie GmbH.3.2 Verwendung von Uracil-N-Glykosylase Um anhand der Sequenzen putative deaminierte Basenpositionen identifizieren zu können und sie gegebenenfalls von „echten“ polymorphen Positionen zu unterscheiden.Material und Methoden Die homogene annealing-Temperatur von 58°C aller sich überlappender Primerpaare ermöglichte auch die Kombination der Primer untereinander. np T16311C). Für alle Individuen der 86 . enthielten somit nur Repliken intakter „Uracil-freier“ Moleküle und damit keine Transitionen von Cytosin zu Thymin wie sie durch die Deaminierung von Cytosin zu Uracil im Reproduktionszyklus entstehen konnten. welches durch Deaminierung von Cytosinen entstanden sein kann. Das Enzym UNG trägt zur Spaltung der Nglykosidischen Bindung des Zuckers und der Base bei und führt damit zur Abspaltung von Uracil. München] eingesetzt. wurden Bereiche der coding region des Mitochondriums.3 Amplifikation von Bereichen der coding region In Fällen. da sich im Zuge laborinterner Optimierungsprotokolle dieser Schritt bei der Amplifikation von degradierter template DNA bewährt hatte. welche somit von inhibierenden Stoffen weitgehend unbeeinflusst bleibt. wodurch die Erkennungssequenz für das Restriktionsenzym Alu I zerstört wird. dass BSA einen stabilisierenden Einfluss auf die Prozessivität der DNA-Polymerase hat. In einem alle Extrakte umfassenden Versuch wurden nun alle Proben auf möglichen Erhalt und Koextraktion von DNA-Molekülen o 440 Basenpaaren getestet. Mit dem kombinierten Primerpaar L15996-H16410 (Fragment V) (Abbildung 15) konnte auch der gesamte Abschnitt der vier kürzeren überlappenden Fragmente I-IV amplifiziert werden. Mannheim] zur PCR hinzugefügt.2.2. Dies galt in erster Linie für Proben der beiden großen Haplogruppen H* und U*. 5. Es ist anzunehmen. Diese Kombination wurde zunächst für alle modernen Vergleichsproben etabliert und angewandt. Die Inkubation der gesamten PCR-Reaktion mit 1U UNG erfolgte bei RT für ~30min. Als PCR-Additivum wurde stets BSA (bovines Serumalbumin) [Roche Diagnostics GmbH. 5.B.4. Diese Abspaltung von Uracil (Depyrimidierung) im DNA-Molekül führt innerhalb der PCR-Reaktion zum Abbruch der weiteren Strangextension. in welchen die Sequenzanalyse der Hypervariablen Region I zur eindeutigen Haplogruppenbestimmung nicht ausreichend war. Für die Haplogruppe H* ist dies der Wegfall einer Alu I Schnittstelle an Nukleotidposition (np) 7025 durch eine Mutation an np 7028. die beide auf der HVR I der Cambridge Referenz Sequenz entsprechen können oder auch wiederkehrende polymorphe Positionen teilen (wie z. welche charakteristische Sequenzunterschiede enthalten. PCR-Produkte. Die Wirkungsweise von BSA ist noch weitgehend ungeklärt.4. amplifiziert. deren DNA-Ausgangmoleküle mit UNG behandelt wurden.

Die Amplifikationsparameter und der Reaktionsansatz für beide Systeme entsprachen dem Standard-PCR-Ansatz (Tabelle 5).1 Amplifikation von STRs mittels AmpFlSTR Profiler PlusTM Die Amplifikation von nukleären short tandem repeats (STRs) erfolgte mit Hilfe des AmpFlSTR Profiler PlusTM Kits [Applied Biosystems. Primernamen entsprechen der Nukleotidpositionen (np) der 3’ –Base und alle np sind nach Anderson et al. 2004 5. d. Name Sequenz 5’-3’ Referenz Hinf I Schnittstelle an np 12308 U5-12216 CACAAGAACTGCTAACTCATGC Izagirre et al.5il (2. 5.4.2. lediglich die Annealing-Temperatur lag für beide Primerpaare bei 55°C und die Zyklenzahl wurde auf 45 erhöht. Das finale Reaktionsvolumen der STR-PCR betrug 25il. Die Sequenzen der Primerpaare für die beiden Bereiche und jeweiligen Referenzen sind Tabelle 7 zu entnehmen.4. USA]. Dieses System ermöglichte in einem Multiplexansatz die simultane Amplifikation von neun autosomalen STR-loci und dem geschlechtsspezifischen Marker Amelogenin (Tabelle 8).2.h. 60s annealing bei 59°C und 60s Elongation bei 72°C. 1981 wiedergegeben.2. 0. 5il (1x) Primerset.Material und Methoden Haplogruppe U* ist eine Schnittstelle an np 12308 für das Restriktionsenzym Hinf I charakteristisch.4. 2004 H4-7066 GAATGAAGCCTCCTATGATGG Lalueza-Fox et al.11) zu gewährleisten. Der initialen Aktivierung der Polymerase (6min bei 95°C) folgten jeweils 60s Denaturierung bei 94°C. sowie 1-5il DNA Extrakt und die jeweilig benötigte Menge UV-HPLC-Wasser. Liste der verwendeten mitochondrialen Primer im Bereich der coding region. unter bestehenden Parametern weitere fünf Reaktionszyklen angefügt. 5.6) für den nachfolgenden Restriktionsenzymverdau (Kap. Foster City. was einer Reduzierung der Herstellerangaben um die Hälfte entsprach. Tabelle 7. 87 .5 U) AmpliTaq Gold™. Bei generell 45 Zyklen wurde nach den folgenden PCR-Bedingungen verfahren. 1996 Alu I Schnittstelle an np 7025 H3-6999 CAAACTCATCACTAGACATCG Lalueza-Fox et al.2. Zur finalen Adenylierung erfolgte ein Extensionsschritt bei 60°C für mindestens 2h oder wahlweise über Nacht. 1999 U2-12339 ATTACTTTTATTTGGAGTTGCACCAAGATT Torroni et al. um eine ausreichende Signalstärke (Kap. Der Reaktionsansatz beinhaltete 10il (1x) PCR Reaction Mix.4 Amplifikation nukleärer DNA 5. In wenigen Fällen wurde die PCRReaktion nach Überprüfung der Signalstärke nachamplifiziert.

Die neun autosomalen loci und der geschlechtsspezifische Marker Amelogenin des AmpFlSTR Profiler Plus™ Kits (modifiziert nach dem Profiler Plus™ User Manual). Diejenigen peaks. Der Auftrag der PCR-Produkte erfolgte unaufgereinigt.2 - 113 D3S1358 3p TCTA (TCTG)1-3 (TCTA)n 114-142 5-FAM D8S1179 8 (TCTR)n 128-168 JOE D5S818 5q21-31 (AGAT)n 135-171 NED vWA 12p12-ter TCTA (TCTG)3-4 (TCTA)n 157-197 5-FAM D21S11 21 (TCTA)n (TCTG)n [(TCTA)3 TA (TCTA)3 TCA 189-243 JOE (TCTA)2 TCCA TA] (TCTA)n D13S317 13q22-31 (GATA)n 206-234 NED FGA 4q28 (TTTC)3 TTTT TTCT (CTTT)n CTCC (TTCC)2 219-267 5-FAM D7S820 7q11.2.21-22 (GATA)n 258-294 NED D18S51 18q21. wurde in den meisten Fällen nur eine erste Amplifikation durchgeführt und über die Auswertungen der Gelelektrophorese (Kap. deren Produktlänge im Elektropherogramm einem existierenden Allel entsprachen.10) analysiert werden konnten und zur Reproduktion erneut amplifiziert werden sollten. Zeigte die Auswertung der ersten Amplifikation einer Probe mindestens drei auswertbare loci. welche Proben durch die Kapillarelektrophorese (Kap. so wurden weitere MultiplexReaktionen derselben Proben durchgeführt. Von jeder erfolgreichen Probe wurden von jeder Extraktion mindestens zwei unabhängige PCR-Reaktionen analysiert. 3.6). wenn die entsprechenden Allele eines locus mindestens dreimal bestätigt werden konnten. 5. Die Amplifikation der kommerziellen STR-Multiplex PCR wurde an einer Auswahl 53 subjektiv beurteilten. Die Erstellung eines Konsensus-Genotyps für die einzelnen Proben konnte dann erfolgen. 5. Der Ansatz wurde 2min bei 95°C im Thermocycler denaturiert.2. Kap.10).6) entschieden.3 - 107 JOE Y: p11.2. wurden in Klammern aufgenommen. 88 . Da aufgrund der Degradierung alter DNA mit einem geringen Amplifikationserfolg nukleärer DNA zu rechnen war (Kap. Loci Chromosom Motiv der Repeat-Einheiten Länge Fluoreszenzmarkierung Amelogenin X: p22. Je nach ermittelter Bandenstärke im vorgeschalteten Agarosegel (Kap. 5.3 (AGAA)n 273-341 JOE Zur Bestimmung der Fragmentlängen wurden die PCR-Produkte der AmpFlSTR Profiler PlusTM Reaktionen der automatisierten Kapillar-Elektrophorese [ABI 310 Genetic Analyzer. gut erhaltenen Individuen vorgenommen. allerdings nur schwach nachgewiesen werden konnten.1-22.2.Material und Methoden Tabelle 8. Applied Biosystems] versetzt und in ein ABI 310 tube [Applied Biosystems] überführt. welches mit einem Septum versehen wurde. 5. Applied Biosystems] unterzogen (vgl.6) wurden 0. Bei jedem Lauf der Kapillarelektrophorese wurde die zugehörige Allelleiter mitgeführt.5-1il PCR-Produkt mit 12il Hi-Di™ Formamid und 1il internem Längenstandard [Genescan-ROX™ 500.

2. kam auch eine zweite STR-Multiplex-PCR zur Anwendung. entwickelt (Stock 2004).2-13.1 beschrieben.1 ATCT 169-189 6-FAM DYS434 Yq11 CTAT 110-122 HEX Y-GATA A7.4. Diese wurde 2003/4 im Rahmen einer Magisterarbeit der Arbeitsgruppe Molekulare Archäologie am Anthropologischen Institut der Johannes Gutenberg Universität Mainz von Frauke Stock M. Der Multiplex-PCR Ansatz entsprach der Standard-PCR-Reaktion in Tabelle 5 mit einem Gesamtvolumen von 50il. HAL2. die fünf gonosomalen und die drei autosomalen loci der STR-Multiplex-PCR . Tabelle 9. Genort Amelogenin Chromosom Motiv der Repeat-Einheiten X: p22.1 TCTA 120-164 HEX STRX-1/DXS981 Xq11. bei welchen bereits eine erfolgreiche Amplifikation von nukleärer DNA durch das AmpFlSTR Profiler PlusTM Kit nachgewiesen werden konnte.4. 30s annealing bei 58°C und 60s Elongation bei 70°C folgten. worauf jeweils 30s Denaturierung bei 94°C.2. Die charakteristischen Eigenschaften dieser STR-MultiplexPCR sind die verkürzten maximalen Fragmentlängen der einzelnen Produkte. Die Probenvorbereitung für die weitere Kapillarelektrophorese erfolgte wie bereits in Kapitel 5. DEB4. KRE2).2 - HPRTB Xq26. KRE1. Bei 45 Zyklen wurde nach den folgenden PCR-Parametern verfahren: die initiale Aktivierung der Polymerase erfolgte für 4min bei 94°C.2 Amplifikation von STRs mittels Multiplex-PCR Geschlechtsbestimmung und Verwandtschaftsanalyse.4. wovon pro PCR-Reaktion 27il eingesetzt wurden (Tabelle 10).1-22.3-34 AGAT 182-230 HEX 89 .4. Der geschlechtsspezifische Marker Amelogenin. der in erster Linie den Bereich bis ~200bp abdeckt und sich damit für den Einsatz mit degradierten Proben eignet.A. Lediglich das Primerset wurde zuvor in einem gesonderten Mastermix angesetzt.3 - Länge in bp 93/99 Fluoreszenzmarkierung HEX Y: p11.1/DYS460 Y ATAG 118-142 6-FAM DYS391 Y TCTA 191-215 6-FAM TPOX 2p23-2ter AATG 86-114 6-FAM D13S317 13q22-q31 TATC 100-144 NED CSF1 5q33. Der finale Extensionsschritt zur Adenylierung erfolgte bei 60°C für mindestens 2h oder wahlweise über Nacht. Zudem wurden für diese Multiplex vermehrt gonosomale Marker verwendet.Material und Methoden 5. um die Geschlechtsbestimmung des Markers Amelogenin zu bestätigen (Tabelle 9). zur molekularen Bei fünf Proben (DEB3.

2. Öl.8 0.1 STRX-1 DYS391 D13 Volumen in Pl 0. wurden aufgereinigt.0 0. so dass diese in der Sequenzierreaktion das Verhältnis von dNTPs und markierten ddNTPs nicht stören. Ein Waschpuffer auf Ethanolbasis entfernte im darauf folgenden Zentrifugationsschritt überschüssige Reagenzien und Unreinheiten wie z.12 0.68 0. 1989.0 0. Dabei wurde das PCR-Produkt zusammen mit einem speziellen Puffer auf die Säule geladen und zentrifugiert. b) Enzymatische Aufreinigung mit SAP und ExoI Als kostengünstigere Alternative zur oben genannten Aufreinigung über Silicafilter wurde für die Aufreinigung der Produkte aus den Kolonie-PCR-Reaktionen eine enzymatische Aufreinigung mit SAP und ExoI angewendet. Werle et al.2 0. Die Elutionsmenge betrug 40il. Der Puffer garantierte die optimalen Bedingungen (sauer bis neutral) für die Adsorption der doppelsträngigen DNA an die Silica-Membran.5 3.7 Konzentration in PM 0. welche die Verdau. Salze. Die Aufreinigung der PCRProdukte erfolgte mit dem Qiaquick PCR Purification Kit [Qiagen. ungebundene Primer und dNTPs. sowie einzelsträngige DNA aus der PCR-Reaktion entfernten (Sambrook et al. die mit Restriktionsenzymen verdaut oder sequenziert werden sollten. Die Exonuclease I degradiert einzelsträngige DNA und Oligonukleotide (Primer) in 3’>5’ Richtung und SAP löst die Phosphatgruppen der freien Nukelotide auf.5 1.8 1. Berlin-Buch]. Puffer.bzw.0 3. also basischen Bedingungen die gereinigte DNA von der Membran gelöst und durch dieselbe hindurch in ein Reaktionsgefäß zentrifugiert. Primerkonzentrationen des Multiplexansatzes. Beide Kits beruhen auf dem Prinzip der Säulenzentrifugation in drei Schritten über eine silicabasierte Membran. Im dritten Schritt wurde mittels eines speziellen Elutionspuffers unter konträren.5 Aufreinigung der PCR-Produkte a) Aufreinigung über Silicafilter PCR-Produkte.2 0.32 0.28 5. Hilden] oder dem Invisorb® Spin PCRapid Kit [Invitek GmbH.B.Material und Methoden Tabelle 10.6 1.2 0. Primer Amelogenin DYS434 HPRTB CSF1 TPOX Y-GATA-A7. um Unreinheiten zu entfernen. 1994).08 0. Hierbei wurden in einem single tube Schritt die PCR-Produkte mit den Enzymen Exonuclease I (ExoI) und Shrimp Alkaline Phosphatase (SAP) versetzt. welche überschüssige Primer und dNTPs.7 2. 90 . Sequenzierreaktion beeinflussen oder inhibieren können. Alle Aufreinigungsschritte richteten sich nach den Protokollen der Hersteller.

Göttingen]. dem Auftragungsort. Es wurden jeweils 10il PCR-Produkt mit 1il Schwerelösung (Bromphenolblau) vermischt und auf das mit 3il Ethidiumbromid [10mg/ml UltraPURE Ethidiumbromide solution.bzw. USA] mit einer Polaroid Kamera [MP-4 Land Camera/Filme Typ 667] bei Blende 8 für 20-25s. Die Laufzeiten wurden variiert. Die Dokumentation erfolgte unter UV-Licht [Spectroline® Transilluminator TR-302. Spectronics Corporation.2 im Anhang). die sich zwischen den Wasserstoffbrücken des DNA-Doppelstrangs einbaut.Material und Methoden Der Reaktionsansatz wurde zunächst 30min bei 37°C und anschließend im Thermocycler bei 80°C für 15min inkubiert. die PCR-Produkte liefen zur Überprüfung der PCR 30-40min bei 140V. Protokoll der enzymatischen Aufreinigung.6 Agarose Gelelektrophorese Zur Separierung und Identifizierung von DNA-Fragmenten dient die Agarose Gelelektrophorese. lokalisiert und dokumentiert werden.5 U 0. Zum Nachweis von PCR-Produkten wurden diese auf ein 2%-iges Agarosegel aufgetragen. Zur Einordnung der Produktgrößen wurden in den äußeren Geltaschen 50bp Leitern [GeneRulerTM 50bp DNA Ladder. Als Gel. 91 .5 U 1x Hersteller MBI Fermentas MBI Fermentas MBI Fermentas 5. Die Auftrennungsstärke kann durch Variation der Agarosekonzentration beeinflusst werden. Kleinere DNA-Fragmente passieren die Gelmatrix einfacher und schneller als größere. MBI Fermentas] aufgetragen. Dabei wandert die negativ geladene DNA horizontal in einem elektrischen Feld konstanter Stärke innerhalb eines Gels von der Kathode. Tabelle 11. Karlsruhe] versetzte Gel geladen. Zur Kontrolle von Verdaureaktionen von Restriktionsenzymen wurde die Laufzeit auf 50min erhöht. Westbury. GIBCO BRL® Life technologies. folglich werden die Moleküle ihrer Größe nach aufgetrennt. Durch Zugabe der fluoreszierenden Substanz Ethidiumbromid (EtBr). können die DNA-Banden anschließend unter UV-Licht (254nm) sichtbar gemacht. um die Enzyme zu deaktivieren. SAP 1U/il ExoI 20U/il 10x Reaction Buffer PCR Produkt Volumen in Pl 1 1 0. 10.2. Laufpuffer diente 1xTBE-Puffer (Kap.5 15 Konzentration 0. zur Anode. Im Laufe der vorliegenden Arbeit wurde dieses System durch eine digitale Geldokumentation ersetzt [INTAS Science Imaging Instruments GmbH.

Diese weißen Zellkolonien. Plasmide. in unserem Fall (pucC18) tragen sie zwei besondere Gene. Zellen mit intaktem Leseraster. hier Escherichia coli) eingeschleust. welche ein insert tragen (weiß). Vorab wird das Verhältnis von Vektoren und elektrokompetenten Zellen (Wirtszellen) zu Gunsten Letzterer angepasst. in unserem Fall PCR-Produkte aufzuschlüsseln und somit Moleküle unterschiedlicher Herkunft (z. welche das LacZ Gen beinhaltet. enthalten jedoch. d. so dass gewährleistet wird. Dies sind kleine. d. Die Identifikation 92 .1 Prinzip der Klonierung Vor Erfindung und Etablierung der PCR diente die Klonierung als Standardmethode zur in vivo Vervielfältigung von DNA Ausgangsmolekülen für weitere nachgeschaltete Analysen. Leon-Rot]. Statt diese in vivo Vervielfältigung nun wieder zusammenzuführen. der so genannten Transformation werden die Vektoren in Wirtszellen (überwiegend Bakterien oder Pilze. Da die Insertionsstelle für die Fremd-DNA bewusst im LacZ Gen platziert ist. die folglich ein insert in den Plasmiden tragen. neben Ampicillin (Antibiotika) und Agar agar zur Gelierung.7 Klonierung 5. dass pro Wirtszelle nur ein Vektor aufgenommen wird. von solchen unterschieden werden. ringförmige extrachromosomale DNA-Moleküle in der Zelle.2. Mischspuren) voneinander zu trennen. erscheinen daher blau. heterogene DNA. auch den „Farbstoff“ X-Gal (5-Brom-4Chlor-3-Indolyl-b-D-Galaktosid) [Carl Roth GmbH. die nach der Ligation Fremd-DNA .2. Sie werden isoliert und mit einem geeigneten Enzym an einer bestimmten Stelle aufgeschnitten und präpariert. 10. Bei intaktem Leseraster codiert das LacZ Gen die p-Galaktosidase. Die p-Galaktosidase setzt das X-Gal im Nährboden enzymatisch um und bildet Galaktose sowie den blauen Farbstoff 5-Bromo-4Chloro-3-Indol. Plasmide können je nach Klonierungzweck unterschiedlich präpariert sein.Material und Methoden 5. wird durch den Einbau das Leseraster des Gens gestört. so dass in einem weiteren in vitro Schritt mit Hilfe des Enzyms (Ligase) fremde DNA eingebaut werden kann. welche ihre DNA unabhängig replizieren können (Replikone). Anschließend werden die Plasmide wieder isoliert und die entsprechenden inserts analysiert. Somit kann die p-Galaktosidase nicht synthetisiert und X-Gal kann nicht umgesetzt werden und die bleiben Kolonien farblos (weiß). B. werden nun ausgewählt und weiter vermehrt. werden Vektoren genannt. St. eines bedingt die Antibiotikaresistenz und ein zweites.2 im Anhang). ist bei der Analyse von alter DNA die prismenartige Aufspaltung der Ausgangs-DNA von besonderem Interesse. Beim nachfolgenden Schritt. Das Prinzip der Klonierung beruht auf dem intentionellen Einbau von doppelsträngiger DNA in Plasmide.7.h. Die Agarplatten entsprechen der Nährlösung. zur Aktivierung der Operon Funktionseinheit. Das IPTG im Nährboden dient hierbei als Induktor zur Ablösung des Repressor-Proteins. also ohne insert. Die Zellen werden nach der Transformation in Nährlösung aufgenommen (LB-Medium) und anschließend auf Agarplatten ausgestrichen (vgl. welches zur Umsetzung eines Farbstoffes (X-Gal) dient. die keines tragen (blau). Karlsruhe] und den Induktor IPTG (Isopropyl-thio-galaktosid) [BioTech Trade & Service GmbH.h. Sie ermöglicht es.ein insert – enthalten. Original und Kontamination oder postmortal sequenzveränderte Moleküle. Kap. Aufgrund der Antibiotikaresistenz können die Zellen auf den Nährböden wachsen und mittels der so genannten Blau-Weiß-Selektion können nach einiger Zeit sichtbare Zellkolonien.

Jedoch wurden hierbei nicht alle vier Nukleotidtriphosphate hinzugegeben.2.7. Im dritten Waschschritt wurden 100ml 10%-iges Glycerin zugegeben.2. Düren] die Plasmide isoliert und gepoolt.2.2 Protokoll der Klonierung 5. Das Pellet wurde in ~10ml 10%-igem Glycerin aufgenommen. 5. Somit wurde jedem linearisierten Vektor ein Thymin angehängt. Mainz]. zu Aliquots von 50il aufgeteilt und bei –80°C gelagert. 5. resuspendiert und die Zellen unter gleichen Bedingungen zentrifugiert. Darauf folgten zwei Waschschritte unter Zugabe von 100ml eisgekühltem.2.4). der generellen Möglichkeit der Unterscheidbarkeit.1 Vorbereitende Schritte Herstellung elektrokompetenter Zellen Zur Herstellung elektrokompetenter Zellen wurde zunächst die Menge einer Impföse einer Escherichia coli Stammkultur in 50ml LB-Medium bei 37°C über Nacht inkubiert. welches in Escherichia coli (RRI Stamm) transformiert wurde.9) und die finale Konzentration des linearisierten Vektors auf 50ng/il eingestellt. durchschnittlich zehn Klone sequenziert. Es entstanden so genannte sticky ends (überhängende Enden). Die Menge einer Impföse des Klones wurde in 3ml LB-Medium (10% Ampicillin) über Nacht bei 37°C kultiviert.2.7. 100il der Kultur wurden mit 50% Glycerin versetzt und bei -20°C als Reserve für die Neuanzucht gelagert. KG. Aus den Übernachtkulturen wurden anschließend mit Hilfe des kommerziellen Plasmid Prep Kits [Macherey-Nagel GmbH & Co. die 93 . Die ringförmigen Plasmide wurden mit dem Restriktionsenzym SmaI (10U) bei 30°C für 1h verdaut. Tuttlingen]. Herstellung des T-Vektors und T/A cloning Als Basis für die Herstellung des T-Vektors diente ein pUC 18 Plasmid [Spende des Instituts für Molekulargenetik. Die Schnittstelle liegt auf der multiple cloning site (MCS) innerhalb des LacZ Gens. Resuspension und Zentrifugation bei 4°C für 20min. 5. Die Verdaureaktion wurde anschließend gefällt (Kap. In der vorliegenden Arbeit wurden je PCR.6nm erreicht hatte. Kg. Weitere 500ml LB-Medium wurden mit 2ml dieser Übernachtkultur angeimpft und solange auf einem Schüttler [Becton Dikinson GmbH. SmaI erzeugt sogenannte glatte Enden (blunt ends).2. Die Herstellung eines T-Vektors erfolgte nach dem Prinzip der PCR (Kap.6) überprüft. Es wurden nur diejenigen Proben kloniert und sequenziert. Heidelberg] bei 37°C inkubiert bis das Medium eine optische Dichte von ~0. sondern nur das gewünschte dTTP (Deoxynukleotidtriphosphat). Alle nachfolgenden Arbeitsschritte wurden auf Eis durchgeführt. bei welchen die für Reproduktion erforderliche Mindestanzahl von acht Fragmenten (die jeweils vier überlappenden Fragmente aus zwei unabhängigen Extraktionen) vorlag. In einem Zentrifugationsschritt bei 4°C für 15min bei 4360xg wurden die kultivierten Zellen pelletiert [Hettich Zentrifugen GmbH & Co. Die Linearisierung der Plasmid-DNA durch den Verdau wurde durch eine Gelelektrophorese (Kap. 5. autoklavierten HPLCWasser.Material und Methoden von kontaminierenden Sequenzen ist selbstverständlich abhängig von der Auflösungsstärke des untersuchten locus bzw.Produkt mindestens fünf.

da diese mit dem komplementären Adenin der finalen Adenylierung der PCR-Produkte durch die Taq-Polymerase binden konnten. Der Zentrifugationsschritt bewirkte die Trennung von zwei Phasen.2. lediglich die Volumina wurden entsprechend angepasst. Die Reaktion wurde unter einer PCR-Haube [DNA/RNA UV Cleaner. Ligationsansatz.4U/il MBI Fermentas 10x T4-Puffer 1 1x MBI Fermentas T-Vektor (~50ng/il) 1 ~5ng Eigene Herstellung Endvolumen 10 Der Ligationsansatz wurde über Nacht bei 16°C im Thermomixer [Eppendorf.7. Wiesloch] angesetzt (siehe Tabelle 12).000xg zentrifugiert. die untere organische Phase des Chloroforms. Tabelle 12.9).Material und Methoden eine effektive Ligation möglich machten. 5. 5. Das getrocknete Pellet wurde in 10il HPLC-Wasser gelöst.2 Ligation und Ligationsfällung Bei der Ligation wird jeweils ein Molekül des PCR-Produkt-Pools mit Hilfe des Enzyms T4 Ligase mit dem T-Vektor verbunden. Die nachfolgende Deaktivierung der Ligase erfolgte für 10min bei 72°C im Thermocycler. Zur Fällung des Ligationsansatzes wurde dieser mit 10il HPLC-Wasser und 10il Chloroform versetzt und anschließend für 10min bei 16. Dementsprechend erfolgte hier eine Zugabe von 2il 3M Natriumacetat pH 4. in welcher die Ligase gelöst war. Der Vektor (mit inserierter Fremd-DNA) ist anschließend wieder annähernd ringförmig. worunter auch die benutzten Reaktionsgefäße zuvor für 45min mit UV-Licht bestrahlt wurden.6 (1/10 Volumen) und 50il EtOH 100% zur wässrigen Phase.2. Es wurden generell 4il PCR-Produkt in die Ligation eingesetzt. Die anschließenden Zentrifugationsschritte entsprachen der Fällung von Sequenzierprodukten (siehe Kap. Volumen in Pl Konzentration Hersteller PCR-Produkt 4 - - T4-Ligase 1U/il 4 0. Am nächsten Tag wurde der Ansatz für 1h bei 400rpm im Thermomixer geschüttelt. Hamburg] inkubiert. MS Laborgeräte. wurde mit der Pipette abgezogen und verworfen. um den Gebrauch von HPLC-Wasser zum Erreichen des Reaktionsvolumens und daher eine mögliche Kontamination im postPCR-Bereich beim sensiblen Schritt der Ligation zu vermeiden. 94 .2. Schröder OHG.

2. um ein Wachstum nicht Antibiotika resistenter Organismen in der Lösung zu verhindern.2. Ein variierender Teil (15-100il.1) des Stammes Escherichia coli RRI (K12 Derivat.2. Ein Wachstum der Kolonien auf den Platten erfolgte bei 37°C über Nacht im Brutschrank. peqLab Biotechnologie GmbH. Alternative A) Anzüchten der Klone in LB-Medium mit anschließender Plasmid-Isolation und Kontrollverdau derselben Für jedes PCR-Produkt wurden von den Übernachtkulturen durchschnittlich 12 weiße Kolonien ausgewählt und mit einem sterilen Zahnstocher von der LB-Platte auf eine neue Kontrollplatte gepickt und anschließend in ein 15ml Falcon Gefäß mit 3ml LB-Medium überführt. Die Aufreinigung der Plasmide erfolgte in weiteren Zentrifugationsschritten über Silicamembranen. Das Einschleusen selbst erfolgt durch den Schritt der Elektroporation. 5.2.2. Durch diese Membranporen kann nun der Vektor eindringen. 1988).2.2. Der gesamte gefällte Ligationsansatz (10il. abhängig von der Konzentration der elektrokompetenten Zellen) des LB-Mediums mit den transformierten Zellen wurde im Anschluss auf LB-Agarplatten (siehe Anhang) ausgestrichen. Erlangen] überführt.4 Vervielfältigung der Klone Im Laufe der Arbeit wurden ab dem unten folgenden Schritt der Blau-Weiß-Selektion die Arbeitsprotokolle geändert und sind nachfolgend als Alternativen A (vor der Änderung) und B (nach der Änderung) angegeben.7. 5. der Austausch von genetischer Information bezeichnet. Die Vermehrung der selektierten Zellkolonien im LB-Medium erfolgte auf einem Schüttler bei 37°C über Nacht.7. Die Inkubation mit 95 . Die Isolation der Plasmid-DNA am darauffolgenden Tag erfolgte mit Hilfe eines kommerziellen Kits [NucleoSpinPlasmid® Quick Pure Kit.2. Dies bedeutet in unserem Fall das Einschleusen des Vektors in eine andere Zelle. Shunt Resistor: 201R) [EQUIBIO Easyject Prisma Elektroporator.a.2) wurde mit 50il elektrokompetenten Zellen (Kap. 5. Das Prinzip der Plasmid Isolation beruhte auf initialer alkalischer Lyse der pelletierten Zellen und anschließender Trennung der freigesetzten Plasmide von der chromosomalen DNA durch selektive Zentrifugation.7.7.Material und Methoden 5. Letzteres war zuvor mit 300il Ampicillin (10mg/ml) versetzt worden. Macherey-Nagel. Erlangen] und eine sofortige Überführung in 1ml LB-Medium.3 Transformation/Elektroporation und Ausplattieren Als Transformation wird in der Genetik u. Hierbei erzeugt ein kurzer elektrischer Puls Poren in der Cytoplasmamembran der betreffenden Zellen (Calvin et al. Düren] nach Angaben des Herstellers. Die Küvette wurde 1min auf Eis inkubiert. Feldstärke: 25µF. Kap. Aus Gründen der Zeitersparnis kam die Methode der Kolonie-PCR (Alternative B) nach ihrer Etablierung bevorzugt zur Anwendung. Sicherheitsstufe 1) versetzt und in eine gekühlte Elektroporationsküvette [peqLab Biotechnologie GmbH. Anschließend erfolgte die Elektroporation im Elektroporator (Spannung: 2500V.

auch Primerdimere oder einzelne Nukleotide während der Ligation mit dem TVektor verbunden werden. Mit Hilfe zweier Restriktionsenzyme (EcoRI und HindIII). Name M13/pUC Sequencing Primer forward M13/pUC Sequencing Primer reverse Sequenz 5’-3’ GTAAAACGACGGCCAGT CAGGAAACAGCTATGAC 96 . Insert + anlagernder MCS-Sequenz) erfolgte auf einem 2%-igen Agarosegel (Kap.5 1 4 10 Konzentration 5U 5U 1x - Hersteller MBI Fermentas MBI Fermentas MBI Fermentas - Alternative B) Kolonie PCR Als Alternative zur Anzucht der selektierten weißen Kolonien kam die direkte Amplifikation der weißen Kolonien zum Einsatz. Die Überprüfung der somit erhaltenen Fragmentlängen (Vektor bzw. Die Überprüfung des PCR-Erfolgs und gleichzeitig der richtigen Fragmentlänge (Insert + MCS-Sequenz) erfolgte mittels Gelelektrophorese (Kap. Das Standardprotokoll des PCR-Ansatzes kann Tabelle 15 entnommen werden. 5. Hierbei wurden die universellen Primer M13 forward und reverse verwendet (Tabelle 14).6).Material und Methoden Elutionspuffer im finalen Schritt wurde auf 10min erhöht. Ansatz des Plasmidverdaus. Tabelle 14. Sequenz des M13 Primerpaars.2. welche in der MCS lokalisiert sind. wurden die Plasmidextrakte geschnitten (siehe Tabelle 13 für den Reaktionsansatz). enthält BSA HPLC-Wasser Endvolumen Volumen in Pl 4 0.a.2. um die DNA-Ausbeute zu erhöhen. 30s annealing bei 58°C und 30s Elongation bei 72°C. 4il Plasmid-DNA Eco RI 10 U/il Hind III 10x Puffer R+. Der Verdau erfolgte für ein bis zwei Stunden bei 37°C. Vor der Sequenzierung des insert wurde ein Kontrollverdau der einzelnen Plasmidextrakte vorgenommen. Erfahrungsgemäß können u. ob das insert die erwartete Länge aufweist. um zu prüfen.5 0. woraus ebenfalls weiße Kolonien entstehen könnten. 5. 5. Die PCR-Parameter beinhalteten eine initiale Denaturierung bei 94°C für 5min und 25 Zyklen von 30s Denaturierung bei 94°C. Berlin] nach Angaben des Herstellers aufgereinigt (Kap.5).das insert umfassenden – multiple cloning site (MCS) liegen. Kolonie-PCR-Produkte mit erwarteter Länge wurden mit Hilfe des Invisorb Spin PCRapid Kit (Invitek. Tabelle 13.2.6). deren Schnittstellen in der .

10pmol (0.3iM) M13 forward oder reverse Primer.5 2. Weiterstadt] verwendet.5. Tamra bei ddTPs und R6G bei ddATPs).8 DNA-Sequenzierung „Cycle sequencing“ Die Sequenzierreaktion.2. Die Reaktion erfolgte im Thermocycler in 25 Zyklen für 30s bei 94°C.4. 97 .5mM 0. Es entstehen unterschiedlich lange DNA-Einzelstränge mit jeweils einer farbmarkierten Base am Strangende. Zur Sequenzierreaktion wurde der Big Dye™ Terminator Cycle Sequencing Ready Reaction Mix [Applied Biosystems. 2-4il PCR-Produkt. die auf dem Prinzip nach Sanger beruht (Sanger et al.5 2. Reagenzien 10x PCR Puffer MgCl2 Lösung dNTP Mix ABgene Polymerase Primer M13 (jeweils) H2O (HPLC) Volumen in Pl 2.5U 0. Das Fehlen einer weiteren Hydroxylgruppe am 3´-Kohlenstoff der farbmarkierten Basen verhindert nach deren Einbau eine weitere Extension am 3´-Ende.6) richtete.2. wonach die Synthetisierung des Stranges abbricht.2iM Hersteller ABgene ABgene MBI Fermentas ABgene Biosprings ACROS Organics 5. Für die Direktsequenzierung der modernen Kontrollproben sowie für einige neolithische Proben wurde jeweils ein Primer des entsprechenden Fragments aus Tabelle 6 verwendet.5il 5x Sequenzierpuffer.7. so dass die Reaktion in einem Ansatz durchgeführt werden kann (Engelke et al. unterscheidet sich von einer klassischen PCR-Reaktion durch die Zugabe von nur einem Primer sowie zusätzlich fluoreszierend markierten ddNTPs (Dideoxynukleotidtriphosphate). 3. Die Sequenzierung der Plasmidextrakte (Abschnitt 5. dessen Einsatzmenge sich nach der Signalstärke auf dem Agarosegel (Kap. Alternative A). Während der Elongationphase der Reaktion werden von der Polymerase im Zufallsprinzip neben normalen dNTPs auch ddNTPs eingebaut.2mM 0.2. 1988). 15s bei 58°C und 2min bei 60°C. und entsprechender Menge HPLC-Wasser zur Einstellung des Reaktionsvolumens von 25il. als auch der KoloniePCR-Produkte (Alternative B) erfolgte wahlweise mit den universellen pUC M13 forward oder reverse Primern.2.Material und Methoden Tabelle 15.1 0. R110 bei ddGTPs. Jede der vier Basen ist mit einem anderen Rhodaminfarbstoff markiert (hier ROX bei ddCTPs. Der Ansatz bestand aus 1il Big Dye™ Ready Reaction Mix. Standardprotokoll des Kolonie-PCR-Ansatzes . 1977).4 Gesamt 25 Konzentration 1x 2.5 0.5 16. Im Zuge von Optimierungsschritten wurde im Laufe der Arbeit die Einsatzmenge der Big Dye™ Reagenzien auf die Hälfte reduziert.

6). um verbleibendes Ethanol zu entfernen.bzw. Weiterstadt] analysiert. die mit einem viskosen Polymer gefüllt ist [POP 6.2. Weiterstadt] versehen. Die nach Größe aufgetrennten markierten Produkte/Fragmente passieren nacheinander ein Fenster in der Kapillare. Weiterstadt] aufgenommen. die durch eine programminterne Matrix wiederum den entsprechenden Basen zugeordnet werden. Die Trennstärke dieser Gelmatrix aus linearen Polymerketten ist so effizient. wobei die Intensität der Signale durch Verlängerung der Injektionszeit der Kapillare in der Probe verstärkt werden kann. Der Überstand wurde abgenommen und verworfen. 5.000xg zentrifugiert. Zur Pelletierung wurde 30min bei 13. Weiterstadt]. Analyseparameter der jeweiligen Probenart.Material und Methoden 5. Die Auftrennung basiert auf der unterschiedlichen Mobilität der Moleküle.2. Applied Biosystems. Weiterstadt] überführt und mit einem Septum [Applied Biosystems. Hamburg]. 5. können Tabelle 16 entnommen werden. von einer CCD-Kamera registriert und mit Hilfe einer Software [ABI Prism Sequencing Analysis™ 3. 98 . Die Elektrophorese erfolgt über eine Kapillare. Das Pellet wurde in 250il 70% Ethanol gewaschen und erneut für 15min bei 13.0. Applied Biosystems.000xg bei RT zentrifugiert [Eppendorf Centrifuge 5402.9 Fällung von Sequenzierprodukten Die Fällung zur Aufreinigung der Sequenzierprodukte (20il) erfolgte bei RT mit 50il 99% Ethanol in Anwesenheit von 2il 3M Natriumacetat (pH 4.10 Die Kapillar-Elektrophorese Die automatisierte Kapillar-Elektrophorese [ABI Prism 310 Genetic Analyzer. Das emittierte Licht wird von einem Hohlspiegel prismenartig aufgespalten. welche wiederum durch deren Größe und Ladung bestimmt ist. worauf die Signale der einzelnen ddNTPs als verschiedenfarbige peaks dargestellt werden. Zur Vorbereitung auf die automatisierte Kapillar-Elektrophorese (Kap. welche in der vorliegenden Arbeit zur Anwendung kamen. Das Pellet wurde in 10il Formamid [Hi-Di-Formamide.2. Der Überstand wurde erneut abgenommen und das Pellet bei 37°C getrocknet. Die Lauf. Die Ergebnisse der Sequenzierreaktion lassen sich in Form eines Elektropherogramms darstellen. Applied Biosystems.10) wurden 5il des gelösten Sequenzierprodukts und 15il Formamid in ein ABI tube [Applied Biosystems. Die Dauer der Sequenzierung über die Kapillar-Elektrophorese ist abhängig von der Produktlänge. dass Größenunterschiede von einem Nukleotid aufgelöst werden können. wo ein Argonlaser die unterschiedlichen Farbmarkierungen am Ende der Produkte zur Fluoreszenz anregt. Applied Biosystems. Weiterstadt] trennt sowohl die Produkte der Sequenzierreaktion als auch die Fragmente der AmpFlSTR Profiler PlusTM PCR-Produkte nach ihrer Größe auf.

Die Fragmentlängen der Verdaureaktion wurden auf 2-3%-igen Agarosegelen (Kap.0kv 60 36min STRs Anthrofiler 2004 POP-6TM SeqPOP6 Rapid (1ml) E 30s 15. Hamburg] für 60-90min in einminütigen Intervallen von Stillstand und Mischen bei 450rpm.5 Konzentration unbestimmt 25U 10U 1x - Hersteller MBI Fermentas MBI Fermentas MBI Fermentas 99 . die zur Bildung oder zum Verlust einer Restriktionsschnittstelle führen.Material und Methoden Tabelle 16. Parameter der Kapillar-Elektrophorese für verwendeten Proben und Systeme.2. die putative Haplogruppen-spezifische Mutationen aufweisen. Standardprotokoll des Enzymverdaus. Polymer Module InjT InjV RunV Run°C RunT Probe/System POP-6TM GS STR POP6 (1ml) F 5s 15.0kv 15.0kv 15.0kv 50 variiert Direktseq POP-6TM SeqPOP6 Rapid (1ml) E 40s 15.0kv 15.0kv 15.0kv 60 36min STRs Profiler Plus POP-6TM GS STR POP6 (1ml) A 5s 15. 5. wurden nach der PCR mit dem entsprechenden diagnostischen Enzym verdaut (Tabelle 17). Der Verdau erfolgte bei 37°C in einem Thermomixer [Eppendorf.5 oder Alu I 1 10x Puffer 1 Endvolumen 10-10.6) überprüft.11 Enzymverdau der PCR-Produkte der coding region Die PCR-Produkte aus den kodierenden Regionen des mitochondrialen Genoms. Tabelle 17. Eine Aufreinigung der Produkte war nicht erforderlich. Volumen in Pl PCR-Produkt 9 Enzym Hinf I 0.0kv 50 variiert Klonseq 5.2.

Inc. Um etwaige Tendenzen bezüglich der Herkunft der frühbäuerlichen Haplogruppen zu eruieren. Aufgrund der bekannten Längen des jeweiligen internen Standards konnten mit Hilfe des local Southern algorithms die Längen der jeweiligen Peaks berechnet werden. welche nicht mit UNG (Kap.08.3 Auswertung Alle Sequenzdaten wurden mit Hilfe der Programme Seqman und Megalign des Softwarepakets DNAStar [Versionen 4.2) behandelt wurden. 2000) verglichen. Polen und Russland.). Für das Referenzgebiet A wurde der Datensatz von Richards auf 1139 Individuen der Gebiete südöstlicher Mittelmeerraum. umfasste insgesamt 1296 Individuen aus dem heutigen Nahen Osten. 1999). Genbank. Dazu wurde zunächst die post mortem 100 . welche zeitlich als auch kulturell angrenzen. Die Bestimmung der Haplogruppen erfolgte per Vergleich mit bestehenden Daten der Literatur und den jeweiligen Datenbanken (Richards et al.2. Hierfür wurde der gesamte vorliegende Datensatz an sequenzierten Klonen von 38 eindeutig bestimmbaren Individuen verwendet. Die Fragmentlängenanalyse der STRs erfolgte ebenfalls Software-gestützt [Genescan. 5. Das Referenzgebiet B. um dem Gebiet der neolithischen Stichprobe der LBK/AVK/Körös-Kultur zu entsprechen.05 und 5. 10 Individuen der Körös-Kultur und sechs Individuen der Sammelkategorie „Nordost“ (s.Material und Methoden 5. revidiert in Andrews et al. In die Analyse der Haplogruppenfrequenzen und deren Verteilung flossen die eindeutig bestimmten Proben der begleitenden Arbeiten von Guido Brandt (2005) und Marc Tänzer (2005) mit ein. DNASTAR. Da der mit rotem Fluoreszenzfarbstoff ROX versehene interne Längenstandard konformgemäß in jeder Probe mitgeführt wurde. Dieser Datensatz beinhaltete auch die Sequenzen der Diplomarbeit von Guido Brandt (Brandt 2005) und der Magisterarbeit von Marc Tänzer (Tänzer 2005). die Gesamtzahl an beobachtbaren Linien pro PCR (Lpcr) und die Fragmentlänge des PCR-Produktes (F) bestimmt. Daraus ergab sich eine Stichprobe von 26 Individuen der LBK. 5.u.] überprüft und aliniert.1 Definition und Berechnung der post mortem Substitutionsrate Zur Bestimmung der post mortem Substitutionsrate eines Individuums wurden alle Sequenzveränderungen quantifiziert. Die Sammelkategorie „Nordost“ umfasste alle Proben aus Litauen. Anderson et al. Südosteuropa. Die post mortem Substitutionsrate (Spcr) wurde durch die Gesamtzahl der Substitutionen pro Probe und PCR (Npcr). ein Individuum der AVK. Mittel. 1981. welches auch als solches bei Richards angeführt wird.und Nord. Estonian Biocentre Database).3. wurde der Datensatz der neolithischen Proben mit zwei Referenzgebieten (A und B) aus dem Datensatz von Richards (et al. Als Referenzsequenz diente die Cambridge Reference Sequence (CRS. 2000. die nicht für die Haplogruppenbestimmung der Probe relevant waren. 2001. Röhl et al.und Nordosteuropa eingeschränkt. Applied Biosystems].4.3. accesssion nummer J01415. diente er als Eichkurve und konnte somit immanente Laufunterschiede der Elektrophorese ausgleichen.

1) konnten somit indirekt Aussagen über die Menge der Ausgangsmoleküle einer PCR gemacht werden. eine Linie kann auch in mehreren Klonen vorhanden sein. 2001a. Die Sättigungsrate (Säpcr) eines PCRProdukts wurde durch das Verhältnis der Gesamtzahl an unterscheidbaren Linien innerhalb eines klonierten PCR-Produktes (Lpcr) durch die Gesamtzahl der sequenzierten Klone einer PCR (Kpcr) bestimmt. 2003b) zu vergleichen. Es wurde davon ausgegangen. wurden ebenfalls aufgenommen. 2001. Kap.3. Gilbert et al. da sie ebenso dazu beitragen. Die Sättigungsrate Säpcr diente in erster Linie als „quasiquantitative“ Interpretationshilfe. So können aus dem errechneten Wert im Vergleich mit anderen Individuen bzw. das Verteilungsmuster der Substitutionen über die gesamte untersuchte Länge darzustellen und gleichermaßen das charakteristische Verhältnis der Substitutionsformen zueinander zu erfassen und mit bereits beschriebenen Daten (Hofreiter et al. die post mortem Substitutionsrate des Individuums wurde anschließend durch das arithmetische Mittel aller das Individuum betreffenden Raten (Sind) der einzelnen Fragmente gebildet. Die Bestimmung der allgemeinen Substitutionsrate hat daher einen deskriptiven Charakter. In Verbindung mit der allgemeinen post mortem Substitutionsrate (vgl. Zwar wurden auch arithmetische Mittelwerte für alle Individuen errechnet. Haplogruppenrelevante Positionen wurden ausgeschlossen.h.2 Definition und Berechung der Sättigungsrate Zur näherungsweisen Quantifizierung der Ausgangsmolekülzahl einer PCR wurde anhand des beschriebenen Datensatzes (vgl. dass mehr Ausgangsmoleküle in einer Reaktion vorhanden waren. Die Bestimmung der einzelnen Linien wurde zudem durch weitere Faktoren bedingt. 2001a). sofern sie sich als solche charakterisieren ließen und je eine eigenständige Linie darstellten. 5. 101 . Kap. Dieser Datensatz diente dazu.1) eine Sättigung der Klonsequenzen mit unterschiedlich substituierten Linien beschrieben. sofern sie als solche durch Gesamtschau aller Sequenzen aller Fragmente eines Individuums identifiziert werden konnten. die eindeutig als Rückmutation interpretiert werden konnten. Individuen des gleichen Fundortes indirekt Aussagen über den allgemeinen Erhaltungszustand der DNA-Moleküle des jeweiligen Individuums getroffen werden. Chimäre bzw. Hofreiter et al. Demnach galt die Formel: Säpcr = Lpcr/ Kpcr. Dagegen wurden diejenigen Positionen. 2003a. mit aufgenommen. jedoch waren diese nur in den Extrembereichen (gegen 1 bzw. gegen 0) für eine weitere Interpretation hilfreich. Mosaiksequenzen. d. den Zustand der alten DNA-Moleküle zu beschreiben.3. Als Linie wurde jede Sequenz mit (einem) eigenständigen Ereignis/Ereignissen betrachtet. 5.3. wenn der Säpcr eines PCR-Produktes gegen den Wert 1 strebte. Hansen et al. 5.Material und Methoden Substitutionsrate der einzelnen Fragmente I-IV gemäß der Formel Spcr = Npcr/Lpcr/F x 1000 errechnet. wie sie durch PCR jumping entstehen können (Pääbo 1989. Nicht als eigenständige Linie aufgenommen wurden kontaminierende Klone.

3.Material und Methoden 5. Anschließend wurde der Datensatz pro Nukleotidposition für die entsprechende. Da sich post mortem Artefakte letztendlich auch auf die Haplogruppenbestimmung auswirken können. die entweder mit UNG behandelt waren oder die eindeutig als Kontamination gedeutet werden konnten. Für diejenigen Werte. cold spot-Positionen im untersuchten Abschnitt existieren. wurde die durchschnittliche Deaminierungsrate (DCG bzw. 5. DAT) der entsprechenden Basen mit der Anzahl aller beobachteten Linien dieses Fragmentes bzw. insofern deren beobachtete Werte den Erwartungswert E über.3 Definition und Berechnung deaminierender hot spot.3. Dies geschah mit Hilfe eines s2-Tests auf dem 95% Signifikanzniveau. Demzufolge wurden diese Positionen unter Alternativhypothese H1 als hot bzw. die auf dem 95% Signifikanzniveau (p t 0. Die Deaminierungsraten für die einzelnen Basen wurden jeweilig über die gesamte Region arithmetisch gemittelt. die für die Haplogruppe der jeweiligen Probe charakteristisch sind. TaC. Hierbei sei nochmals darauf hingewiesen. C/GaT/A) jeweils das kombinierte arithmetische Mittel errechnet (DCG bzw. cold spot-Positionen zu testen. 102 . A/CaG/T) sowie C und G (Transition Typ II.2) wurde auch zur Quantifizierung von bestimmten Basenaustauschen herangezogen. wurde H0 verworfen. sollte statistisch geprüft werden. Somit konnte die absolute Häufigkeit an Deaminierungsereignissen an einer Nukleotidposition mit dem Erwartungswert E verglichen werden. wurde für die Basen A und T (Transition Typ I. Um den Erwartungswert E der jeweiligen Nukleotidposition zu erhalten. sofern sie konsistent und nicht zufallsverteilt auftreten.bzw. cold spotPositionen Im Hinblick auf die Sequenzanalyse zur Haplogruppenbestimmung wurden die Häufigkeiten der Substitutionen an einzelnen Nukleotidpositionen näher untersucht. Als Nullhypothese H0 wurde hier formuliert. wurde zunächst die post mortem Substitutionsrate der einzelnen Nukleotidpositionen bestimmt (Snp). Die Datengrundlage der post mortem Substitutionsrate (Kap. Substitutionen an Nukleotidpositionen. des überlappenden Bereiches multipliziert. demzufolge Ndeamin) reduziert. 5. ob deaminierende Basenaustausche an gewissen Nukleotidpositionen signifikant häufiger (hot spots) oder signifikant weniger häufig (cold spots) als andere vorkommen.3. Dagegen wurden Rückmutationen an diesen Positionen einbezogen. Diese errechnete sich aus der Anzahl an beobachteten Substitutionen (Nnp) an der betrachteten Nukleotidposition geteilt durch die Anzahl an Linien (Lnp) aller Sequenzen dieses Fragments. cold spots definiert. GaA. AaG.bzw. wurden ebenfalls nicht berücksichtigt. Post mortem entstandene Rückmutationen an Haplogruppen-relevanten Positionen wurden hier ebenfalls berücksichtigt. Somit erhielt man pro Position die beobachtete postmortem-Deaminierungsrate: Dnp = Ndeamin/Lnp. beobachtete deaminierte Transition (CaT. dass keine hot bzw. DAT). unterschritten. Demnach galt: Snp = Nnp/Lnp.1) sowie der Sättigungsrate (Kap. dass diejenigen Klonsequenzen nicht analysiert wurden. Da den vorliegenden Transitionen vom Typ I und II jeweils nur eine biochemisch wahrscheinliche Ursache zugrunde liegt.05) signifikant vom Erwartungswert E abwichen. Um den untersuchten Bereich des mitochondrialen D-loop auf das Vorkommen von putativen hot spot bzw.

Darüber hinaus können aus dem Muster des Beziehungsgeflechts Aussagen über die Dynamik der phylogenetischen Entwicklung abgelesen werden. Dabei können scheinbar eindeutige Beziehungen widergespiegelt werden. Ein weiterer Vorteil des Netzwerkes ist die Möglichkeit der Definition von anzestralen Typen.4 Netzwerke Die Erstellung von Netzwerken hat besonders bei Datensätzen hochvariabler Bereiche im Vergleich zu phylogenetischen Dendrogrammen eine Reihe von Vorteilen.3.1.Material und Methoden 5. So deutet beispielsweise eine Sternform auf eine (aktuelle) Expansion bspw. Das Netzwerk ist in der Lage durch Bildung von Rechtecken (sich wiedertreffende Äste) solche Konfliktsituationen unter Beibehaltung aller Information wiederzugeben. wurden bei der Netzwerkanalyse außer Acht gelassen (Bandelt et al. Suffolk. Usbekistan (Villems. Hierzu wurde die Anzahl der Proben eines bestimmten Haplotyps bestimmt und mit der Anzahl der bestehenden Mutationen zum anzestralen Haplotypen multipliziert. Die Anleitung hierfür befindet sich auf der zugehörigen website und weiterführende Instruktionen wurden Bandelt et al. Mit Hilfe von Netzwerken können komplexe Beziehungsgeflechte dargestellt werden.. 2002).180 Jahren 103 . die vom anzestralen Typus abweichen. Um das Alter eines Musters zu bestimmen. wurde der u-Wert mit der Mutationsrate multipliziert. 1999)). 1999 entnommen. die nicht der eigentlichen Datenlage entsprechen. 2000). es bietet demnach die Möglichkeit alternative Wege zweidimensional darzustellen. soweit nicht anders vermerkt. einer bestimmten Haplogruppe hin. Bezüglich des N1a-Netzwerkes waren dies alle Einzeldaten. Türkei (Calafell et al. Median joining Netzwerke wurden mit Hilfe des Programms Network 4. Epsilon entsprach jeweils dem Wert 0 und die Standardgewichtungen des Programmes wurden übernommen. UK.und/oder Rückmutationen auftreten können. möglicherweise ausgestorbenen Linien. http://www. Sparsamkeit oder auch per Zufall) entschieden werden müssen.1 [Fluxus Technology Ltd. Dies geschah für alle zugehörigen Hapotypen eines definierbaren Bereichs. Diejenigen Daten. wie sie durch das Vorkommen von Parallel. 1996). Mit Hilfe des Programms Network wurden auch Schätzwerte für das Alter einzelner abgrenzbarer Zweige und Sternformen der Netzwerke mit Hilfe des u-Wertes nach Forster 1996 errechnet. Clare.1.com] erstellt. die nach wählbaren Kriterien (nach Prinzipien der Häufigkeit. sofern diese bekannt war. Letztere stellen erfahrungsgemäß in phylogenetischen Bäumen Konfliktsituationen dar. 1999). Im vorliegenden Fall wurde die Annahme einer Transition innerhalb der Nukleotidpositionen 16090-16365 in einem Zeitraum von durchschnittlich 20. damit entspricht der u-Wert der durchschnittlichen Anzahl an Mutationen.fluxus-engineering. Armenien (Richards et al. Übergangsformen sowie von erwarteten. die an Nukleotidposition 16147 ein Thymin aufwiesen (jeweils ein Individuum aus Indien (Kivisild et al. unpubliziert). welche starke Retikulationen verursachten. Der u-Wert definiert sich allgemein durch die Summe dieser Produkte im Verhältnis zur Gesamtanzahl aller beteiligten Proben dieses Bereiches. und Ägypten (Dinka) (Krings et al. Weiterhin kann in Netzwerken das Mengenverhältnis der einzelnen Datenpunkte (in unserem Fall Haplotypen) durch proportionale Darstellung angegeben werden.

eines Zweiges von Haplotypen zu bestimmen. 2000 berechnet. die in der neolithischen Stichprobe mit 25% vertreten ist. für die keine 100%-ige Übereinstimmung des Haplotyps in der Literatur gefunden wurde. Estonian Biocentre Database 2005.3. 1996). Die Simulation wurde 4000 mal wiederholt und dabei die Anzahl der N1a Haplotypen in der simulierten modernen Bevölkerung gezählt. 2001.Material und Methoden zugrunde gelegt (Forster et al. 5. wurde im Falle der Haplogruppe N1a die discrete-generation coalescent Methode nach Laval & Excoffier (2004) angewandt. zwei (ECS1) Nukleotidposition(en) von einem entsprechenden in der Literatur dokumentierten Haplotyp ab. Insgesamt konnte von sechs neolithischen Proben keine 100%-ige Übereinstimmung des Haplotyps in der Literatur gefunden werden. 2001. Bei Erreichen des Zeitpunktes 275 Generationen vor heute wurden den jeweiligen anzestralen Linien mtDNA Linien zugeordnet.1% für die weiteren 250 Generationen angenommen. die HVR I Sequenzen der Proben HAL2. ob die moderne europäische Bevölkerung des LBK-Gebiets als direkte Nachfahren der neolithischen Bauern angesehen werden können. unpublizierte Daten. Hierbei konnte zwar in jeden Fall der Haplotyp der Probe eindeutig bestimmt werden. Als Simulationszeitraum wurden hierfür 7425 Jahre bzw. Damit sollte die Hypothese getestet werden. Ausgehend von 2300 Individuen der modernen Bevölkerung wurden Genealogien entgegen der Zeitachse erstellt. welche der Ursprungspopulation entsprechen sollte. 2003). Villems.0 Um bestehende Unterschiede in Haplogruppenfrequenzen zwischen Beobachtungszeitpunkten zu erfassen und näher zu beschreiben. Hierzu wurden extern populationsgenetische Simulationen mit dem Programm Simcoal durchgeführt. um die jeweilige genaue phylogenetische Beziehung der einzelnen Individuen innerhalb der Haplogruppe zu eruieren und gegebenenfalls mit Hilfe des u-Wertes das Alter einer Haplogruppe bzw. ob genetische Drift für eine 150-fache Ausdünnung der hohen Frequenz der Haplogruppe N1a in der neolithischen Probe als wahrscheinlich anzunehmen ist. 2000. VAI3 (U3). die Angaben hierzu finden sich in den Erläuterungen zu den entsprechenden Netzwerken. diente als Ausgangswert mit 8% der untere Wert der Binominalverteilung (95% Konfidenzintervall). Forster 1996. 275 Generationen für eine Generationsdauer von 27 Jahren veranschlagt.5 Populationsgenetische Simulation mit dem Programm Simcoal 2. Unter 2300 Individuen der modernen Bevölkerungsgruppen des linearbandkeramischen Verbreitungsgebietes konnten fünf N1a Haplotypen gefunden werden. 1999. Das Bevölkerungswachstum wurde mit 0. Die modernen Daten der jeweiligen Hgs sind der Literatur entnommen. ECS1 (alle N1a). SCHWE4 (H). Hierauf wurden die resultierenden Frequenzen 104 . wurden Netzwerke erstellt. Als heutige Vergleichsbevölkerung für das Referenzgebiet der Linearbandkeramik dienten Daten aus der Literatur (Röhl et al. Für die Frequenz der Hg N1a. UWS5. Die Standardabweichung für die jeweiligen u-Werte wurden mit Hilfe des Programmes Network nach Saillard et al. LEB1 (U5) wichen jedoch alle in einer bzw. Für Proben.45% für die ersten 25 Generationen und mit 0. Pfeiffer et al. Lahermo et al. Poetsch et al. Diese sollten prüfen.

wurde davon ausgegangen. dass in der umgebenden Population die mtDNA Linie N1a nicht vorkommt und zudem von entsprechender Grösse ist. Zunächst wurde eine genetische Isolation der zu untersuchenden Bevölkerung angenommen. Anschließend wurde die Simulation unter verschiedenen demographischen Annahmen getestet. 105 .0 wurde von Shuichi Matsumura und Peter Forster (McDonald Institute for Archaeological Research.Material und Methoden aller Nachfolger dieser anzestralen Linien in der modernen Population erfasst. University of Cambridge. Pro Generation können multiple Koaleszenz. Die Simulation mit dem Programm Simcoal 2.sowie Migrationsereignisse zugelassen werden. nachfolgend auch verschiedene Migrationsraten zwischen der zu untersuchenden und einer größeren umgebenden Population getestet. Im vorliegenden Fall wurde eine Migrationsrate von 1% pro Generation über 7425 Jahre zwischen der neolithischen Stichprobe und den umgebenden Bevölkerungsgruppen zugelassen. UK) durchgeführt. Um das Simulationsmodell einfach zu halten. um eine Rückwanderung dieser Linie in die zu untersuchende Population zu ermöglichen.

Für die genetischen Analysen selbst gilt als grundlegende Voraussetzung zur Authentifizierung der Ergebnisse als oberstes Kriterium die Vermeidung bzw. v. 1999. Balogh et al. Handt et al.B. welche Hinweise auf den Erhalt von Biomolekülen liefern können. Eindämmung von Kontaminationen. Pääbo 2004.1 beschrieben. sehr alter. dessen Um. inzwischen als nicht reproduzierbar und damit als Artefakte gelten (z.Material und Methoden 5. Die umfangreichen Maßnahmen zur Kontaminationsvermeidung wurden bereits in Kap. a. 2003) korreliert das Verhältnis von Formparameter (v-Wert) und Kristalldicke (T) eng mit dem Erhalt von Biomolekülen wie Proteinen und DNA. nichtgenetische Methoden. 5. dass einige Resultate aus früheren Veröffentlichungen.4 Authentifizierung Kriterien der Ergebnisreproduktion und Sequenzanalyse Die Einhaltung bestimmter Authentizitätskriterien bei der Gewinnung von aDNA-Daten wurde in den vergangenen Jahren gehäuft gefordert (z. Willerslev & Cooper 2005). Cooper 1997. wofür auch sieben neolithische Proben bereitgestellt wurden. Gerade im Bereich humaner DNA stellt sich hier das Problem.und Abbauprodukte im Knochen. Für die vorliegende Arbeit wurde als Anhaltspunkt für den möglichen Erhalt von endogener DNA die SAXS-Analyse (small angle X-ray scattering) als nichtgenetische Methode herangezogen. Vorgehensweisen zur Reproduktion. Ward & Stringer 1997. Die Authentifizierung von Ergebnissen ist daher besonders von der unabhängigen Reproduktion von Einzelergebnissen abhängig. Hierzu wurden bereits im Vorfeld der Arbeiten Schemata bzw. So lassen sich auch trotz strengster Vorkehrungen die Möglichkeiten der Kontamination nur weitestgehend minimieren und (zumindest derzeit) nicht gänzlich ausschließen. 2003. die im Folgenden en détail dargestellt werden: 106 . Grundsätzlich empfiehlt sich für den fraglichen Erhalt alter DNA eine unabhängige Bestätigung durch unabhängige.2. dass Bearbeiter und der „Gegenstand“ der Untersuchung derselben Spezies angehören. Insgesamt wurden 14 Proben von menschlichem Knochenmaterial untersucht. Die SAXSAnalyse wurde extern von Jennifer Hiller (FFEGI. 1992). fossiler DNA-Sequenzen.B. Burger et al. Die Notwendigkeit hierfür ist in erster Linie darauf zurückzuführen. Nach Hiller (et al. Cano et al. Cooper & Poinar 2001. 2004. sowie Sequenzauthentifizierung entwickelt. 1996. Burger et al. DeSalle et al. University of Newcastle upon Tyne) durchgeführt. Die SAXS-Analyse beschreibt die Größe und Form der Kristalle des Hydroxylapathits bzw. 1992.

die in einem überlappenden Bereich vorliegt. Die somit rekonstruierbare Konsensussequenz wird letztlich in ihren Nukleotidpositionen unterschiedlich häufig direkt bzw. sowohl bereits bei Divergenzen im Rahmen der Amplifizierbarkeit unterschiedlicher Probenmaterialien (Zähne. so wird diejenige.2. Diese Vorgehensweise ermöglicht es. wenn auch indirekt. Der Einsatz von überlappenden Primerpaaren zur Rekonstruktion von längeren Sequenzabschnitten dient nicht nur der Amplifikation von degradierten (und daher kurzen) DNA-Molekülen. Befinden sich zwei Mutationen auf einem Fragment. dass eine bestimmte Mutation. bestätigt. Von jedem Individuum werden pro Fragment (vgl. im günstigen Fall doppelt so häufig bestätigt werden kann. Knochen) sowie bei divergierenden Ergebnissen der Sequenzierung kann eine dritte bzw.h. d. Kap. 5. vierte unabhängige Extraktion mit nachgeschalteten PCRs herangezogen werden.1) mindestens zwei unabhängige PCR-Produkte aus zwei unabhängigen Extraktionen kloniert und sequenziert. Weiterhin addieren sich die Ergebnisbestätigungen aus unabhängigen Versuchen für einen phylogenetisch sinnvollen Haplotypen über die vier verwendeten überlappenden PCR-Produkte. durch erstere ebenfalls doppelt. um mögliche deaminierte Nukleotidpositionen zu identifizieren. Optionale Wiederholungen von PCRs bzw.3. die nicht im überlappenden Bereich liegt. Darüber hinaus werden von einer Extraktion zusätzliche PCRs mit UNG amplifiziert.4. wie in Abbildung 17 gezeigt wird. sofern die hieraus resultierende Mindestanzahl von acht PCR-Produkten pro Individuum erfolgreich amplifiziert werden konnte (Abbildung 16). Optional.Material und Methoden Abbildung 16. sondern darüber hinaus der Authentifizierung von Ergebnissen. wovon eine in einem überlappenden Bereich liegt. Schema der Ergebnisreproduktion. Extraktionen sind grau dargestellt. 107 . indirekt bestätigt.

können aus der Art und Zusammensetzung der sequenzierten Klone ebenfalls Aussagen zur Authentizität abgeleitet werden (siehe Abbildung 18). Die resultierende Konsensussequenz von 413bp wird aus acht Teilergebnissen zusammengesetzt. viermal und indirekt viermal unabhängig bestätigt. Die grün und blau markierten DNA-Moleküle entsprechen abweichenden Molekülen. wie sie durch postmortale Phänomene entstehen. welche mögliche Kontaminationen sein können oder sequenzveränderte Moleküle. 108 . Die überlappenden Klone zweier unabhängiger Extraktionen A und B sind in vier unterschiedlichen Farben dargestellt. Schema der prismenartigen Aufspaltung von DNA-Molekülen durch die Klonierung. Die jeweiligen Sequenzveränderungen sind von links nach rechts zweimal. Orangefarbene vertikale Linien sollen beispielhaft beobachtete konsistente Sequenzveränderungen darstellen. Schema der Sequenzrekonstruktion durch überlappende Klone. Da die Klonierung jedes PCR-Produkts die prismenartige Aufspaltung in Einzelmoleküle erlaubt. Allerdings können diese nur im Rahmen einer Gesamtschau aller Klone eines Individuums erfolgen. Abbildung 18.Material und Methoden Abbildung 17.

(Erläuterungen im Text). kontaminierende Sequenzen zu identifizieren und somit indirekt die „echte“ alte Sequenz zu bestimmen. 109 . Auf dieser Grundlage können heterogene Klonsequenzen innerhalb eines PCR-Produkts erkannt und gedeutet werden. Im letzteren Fall vermag unter günstigen Umständen ein Abgleich mit den Ergebnissen ebenfalls typisierter Bearbeitern helfen. so können diese quantifiziert und mit den als authentisch definierten Sequenzen in Relation gestellt werden. Abbildung 29. Lassen sich kontaminierende Sequenzen eindeutig einer bestimmten Haplogruppe zuordnen und darüber hinaus von post mortem-Degradierungserscheinungen abgrenzen.Material und Methoden Die Gesamtschau beinhaltet die Erfassung und Beschreibung der Integrität eines PCRProdukt-Pools. Kategorien zur Authentifizierung von Sequenzen. welche einerseits ursächlich durch postmortale Sequenzveränderungen alterieren oder aber von Kontaminationen herrühren können.

h. dass für keine der beiden (oder mehrerer) reproduzierbarer Linien eine Zuordnung zu einem möglichen Kontaminationsursprung möglich ist. In Kategorie 5 werden diejenigen Individuen aufgenommen. In Kategorie 7 fallen diejenigen Individuen. Kann keine eindeutige Tendenz zugunsten einer Linie festgestellt werden. dass eine gleichmäßige Kontamination aller Teile eines Skelettindividuums durch einen putativen Kontaminanten mit steigender Anzahl an unabhängigen Versuchen (d. Im Sinne von Kategorie 4 wird die reproduzierbare Linie als authentisch angesehen. die nachfolgend erläutert werden: In Kategorie 1 fallen die Ergebnisse derjenigen Individuen. jedoch unter der Annahme. die ebenfalls (in mindestens einem Fragment) reproduzierbar. da unter der Alternativhypothese H1 eine Kontamination nicht von der echten authentischen DNA unterschieden werden kann und folglich eine plausible Authentifizierung allein auf Ebene der Sequenzen unter Kategorie 6 nicht möglich ist. beliebig weitere Extraktion durchgeführt werden. jedoch unter der Annahme. die nicht reproduzierbar sind und nicht eindeutig einer bekannten Linie entsprechen. kann optional eine dritte bzw. kann optional eine dritte bzw. In Kategorie 3 werden diejenigen Individuen aufgenommen. Kategorie 4 basiert auf Kategorie 3. dass eine gleichmäßige Kontamination aller Teile eines Skelettindividuums durch einen putativen Kontaminanten mit steigender Anzahl an unabhängigen Versuchen (d. deren Sequenzen eindeutig und reproduzierbar aus den jeweiligen unabhängigen Versuchen hervorgehen. beliebig weitere Extraktion durchgeführt werden. Kategorie 2 beinhaltet diejenigen Individuen. in deren Sequenzen sich keine eindeutigen und reproduzierbaren Linien feststellen lassen. werden die Ergebnisse verworfen. daneben jedoch in den einzelnen Fragmenten einzelne Abweichungen vorkommen. Kategorie 6 basiert auf Kategorie 5. Ausgehend von der Nullhypothese H0. einer eindeutig identifizierbaren Kontaminationsquelle zugeordnet werden kann. Extraktionen aus Material aus anatomisch unterschiedlichen Regionen) zunehmend unwahrscheinlicher wird. Ausgehend von der Nullhypothese H0. 110 . die neben einer eindeutigen und reproduzierbaren Linie eine weitere Linie aufweisen.h. dass für keine der beiden oder mehrer Linien eine Zuordnung zu einem möglichen Kontaminationsursprung möglich ist.Material und Methoden Für die Synthese aller Einzelergebnisse der Klonsequenzen aus den überlappenden Amplifikationen eines Individuums wurde ein Maßstab zur inhaltlichen Authentifizierung in sieben Kategorien erstellt (Abbildung 19). einer eindeutig identifizierbaren Kontaminationsquelle zugeordnet werden kann. die nicht reproduzierbar. Extraktionen aus Material aus anatomisch unterschiedlichen Regionen) zunehmend unwahrscheinlicher wird. die neben einer eindeutigen und reproduzierbaren Linie eine weitere Linie aufweisen. in deren Klonsequenzen eine eindeutige und aus unabhängigen Versuchen reproduzierbare Linie festgestellt werden kann.

B. dass eine ausreichend große Menge an Ausgangsmolekülen vorliegt. welche im günstigen Fall wenige kontaminierende Moleküle überlagern kann. Andererseits weisen sequenzierte Klone. dessen zu untersuchender Proben in die Beurteilung mit ein. Sequenzveränderungen zeigen. dass sich unter der Alternativhypothese H1 trotz der vorgestellten Maßnahmen zur Kontaminationsvermeidung und der Reproduktionsschemata eine systematische Kontamination ebenfalls eindeutig und reproduzierbar im Sinne von Kategorie 1 durchsetzt. die nachvollziehbar als post mortem Modifikationen identifiziert werden. möglich. Diese ist z. 2005. Gilbert et al. 2005) eines Fundortes bzw. solchen vorzuziehen. Eine exakte Übereinstimmung aller Nukleotidpositionen mehrerer sequenzierter Klone kann einerseits die „Sauberkeit“ eines Extraktes bzw.wenn auch geringe – theoretische Wahrscheinlichkeit. als postmortal definierte. andererseits jedoch auch auf eine sehr geringe Anzahl an Ausgangsmolekülen zurückführbar sein. Darüber hinaus trägt der binnenstrukturelle Vergleich mit anderen Proben desselben Fundortes ebenfalls zur Beurteilung der Ergebnisse im Rahmen der generellen Authentifizierung bei. 111 . wenn konsistente aber ungewöhnliche Sequenzveränderungen beobachten werden können. fließen nicht in die oben angeführte Kategorisierung ein. Letzteres kann beispielsweise dann angenommen werden. welche alle unterschiedliche.Material und Methoden Abweichende Sequenzen. die Homogenität der Ausgangsmoleküle bedeuten. Diese Beurteilung erfolgt gänzlich auf der Basis der Plausibilität. dass für die Individuen eines Fundortes vergleichbare Erhaltungsbedingungen vorlagen.B. welche bereits bei einer aktuellen Grabung unter weitestgehend „sterilen“ Bedingungen genommen wurden. Ergebnisse von Proben. darauf hin. Gilbert et al. Dies geschieht unter der Prämisse. Bearbeitung nach der Grabung nur lückenhaft oder gar nicht nachvollzogen werden kann. 2003b). wenn aufgrund der unzureichenden Erhaltung in mehreren Proben eines (prä-)historischen Individuums tatsächlich keine endogene DNA mehr vorhanden sein sollte. So sind z. deren Verbleib und Behandlung bzw. Abschließend fließt auch die individuelle Geschichte (post excavation history. Umgekehrt bedeutet dies auch. Grundsätzlich besteht die . dass eine statistische Sättigung mit Klonen noch nicht erfolgt ist (Bower et al. die wiederum nur als postmortal zu erklären sind. Weiterhin können mit Hilfe der Klonierung Hinweise auf die der Amplifikation zugrunde liegenden Ausgangsmoleküle gegeben werden. Aus diesem Grund spielt bei der Authentifizierung der Ergebnisse eines Individuums die Beurteilung des makroskopischen Erhaltungszustandes der einzelnen Proben eine zusätzliche Rolle.

Pro Individuum wurden mindestens acht PCRs angesetzt. Zur möglichen laborinternen Verfolgung von Kontaminationen wurden alle Labormitarbeiter und Praktikanten des Mainzer aDNA Spurenlabors für die zu untersuchenden Genorte bzw. 2.Material und Methoden Abschließend sind alle Kriterien. Prä. wenn die entsprechenden Allele eines locus mindestens dreimal bestätigt werden konnten. Es wurde geprüft. diejenigen Personen. 2004.und PostPCR-Bereich befinden sich in unterschiedlichen Gebäuden. um heterogene Amplifikate zu detektieren. 2003. so wurden diese kloniert und sequenziert. Bereiche typisiert. typisiert. Die post excavation history der Proben wurde beurteilt. Bei allen Versuchen wurden Extraktionskontrollen (leer und andere Spezies) und PCR-Kontrollen (leer) mitgeführt. 11. 112 . wurden auch die jeweiligen Probengeber bzw. die zumindest zuletzt an oder mit den Proben gearbeitet hatten. Ein Teil der Knochenproben wurde mittels nichtgenetischem Verfahren (SAXSAnalyse) auf Erhaltungsaussichten von Biomolekülen getestet (Burger et al. 6.h. alte DNA sollte theoriekonform stark fragmentiert vorliegen und Fragmente dieser Länge nicht bzw. Die DNA-Extrakte wurden auf Amplifizierbarkeit langer Fragmente (o 455bp) geprüft. Der allgemeine makroskopische Erhaltungszustand der Proben wurde beurteilt. Durchschnittlich wurden zehn Klone pro PCR-Produkt sequenziert. 7. Alle Versuche wurden in adäquaten Räumlichkeiten durchgeführt. nochmals zusammengefasst: 1. 3. Sofern es die Situation ermöglichte. Zur Reproduktion von STRs wurden von jeder Probe je Extraktion mindestens zwei unabhängige PCR-Reaktionen analysiert. 8. 4. die der Authentifizierung von alten DNA-Sequenzen dienen und die in der vorliegenden Dissertation angewandt wurden. 5. nicht überdurchschnittlich häufig aufweisen. 2004). Ein Minimum von fünf Klonen wurde nicht unterschritten. Pro Individuum wurden mindestens zwei unabhängige DNA-Extraktionen möglichst aus anatomisch unabhängigen Körperbereichen angestrebt. Die Erstellung eines Konsensus-Genotyps für die einzelnen Proben konnte erfolgen. Hiller et al. War die Mindestanzahl von acht PCR-Produkten pro Individuum (vier Fragmente x zwei Extraktionen) erreicht. Liegemilieu und Alter) vergleichbare Ergebnisse zeigen. 9. 10. ob Individuen desselben Fundortes unter vergleichbaren Verhältnissen (d. Degradierte bzw.

Ergebnisse

6. Ergebnisse
Der vorliegenden Disseration wurden im Rahmen des Gesamtprojekts zur Neolithisierung
Europas jeweils zwei Studienabschlussarbeiten (Brandt 2005, Tänzer 2005) zugeordnet, die
kleinere Teilgebiete des Untersuchungsraumes zum Inhalt hatten. Größtenteils wurde bei
diesen auf bereits extrahierte bzw. amplifizierte Proben zurückgegriffen.
Aus diesem Grund wurden in der nachfolgenden Darstellung der Ergebnisse teilweise auch
Resultate dieser Abschlussarbeiten mit aufgenommen, da diese einerseits auf vorbereitenden
und begleitenden Arbeitsschritten der vorliegenden Arbeit beruhen und andererseits
sinnvoll im Rahmen der Datenerweiterung herangezogen werden konnten bzw. zur
umfassenden Gesamtanalyse in der abschließenden Diskussion von weiterer Bedeutung
waren. Des Weiteren wurde innerhalb der Arbeitsgruppe parallel an einer mesolithischen
Stichprobe gearbeitet. Der Einbezug von Ergebnissen oder Teilergebnisse ist an den
entsprechenden Stellen vermerkt.

6.1 Probenerhaltung und Amplifikationserfolg
6.1.1 Amplifikationserfolg
Insgesamt wurde im Laufe der vorliegenden Arbeit DNA von 87 neolithischen Individuen
extrahiert, wovon 57 aus dem ehemaligen Verbreitungsgebiet der Linearbandkeramik
stammten.
Die Amplifikation von vier sich überlappenden Fragmenten (Abbildung 17, Kap. 5.2.4.3.1)
erfolgte aus mindestens zwei unabhängigen Extraktionen. So lagen bei Proben mit guter
DNA-Erhaltung mindestens acht PCR-Produkte vor, die zur Klonierung und Sequenzierung
herangezogen wurden. Eine eindeutige Bestimmung der Haplogruppe konnte bei insgesamt
43 Individuen (74%) durchgeführt werden, wovon 29 Individuen im Rahmen dieser Arbeit
typisiert wurden. Bei 16% der Individuen konnte durch die Klonierung das Vorhandensein
mehrerer Linien (d.h. mitochondrialer Haplotypen) nachgewiesen werden. Die
verbleibenden Individuen erbrachten entweder keinen positiven Nachweis des Erhalts
mitochondrialer DNA durch Amplifikation oder keinen wiederholbaren bzw. letztlich
reproduzierbaren Nachweis aller vier Fragmente.
Zur Amplifikation der vier überlappenden Fragmente (inklusive der kürzeren Alternativen,
Kap. 5.2.4.3.1) wurden insgesamt 60 PCR-Ansätze mit 695 Reaktionen durchgeführt, welche
sich mit 500 positiven PCR-Produkten im durchschnittlichen Amplifikationserfolg von ca.
72% niederschlug. Der unterschiedliche Amplifikationserfolg der einzelnen Fragmente ist in
Abbildung 20 dargestellt. Die kürzeren Alternativen der Fragmente II und III kamen jeweils
nur in einem PCR-Ansatz zur Anwendung und flossen daher hier nicht in die Berechung ein.
Der prozentuale Amplifikationserfolg des umfassenden Fragments V (~18,5%) wurde als
Vergleichwert mit einbezogen.

113

Ergebnisse
Weiterhin wurde der Amplifikationserfolg der vier überlappenden Fragmente nach Einsatz
von UNG separat berechnet. Hier ließen sich keine auffälligen Abweichungen vom
allgemeinen Amplifikationserfolg bzw. vom Erfolg der Reaktionen ohne UNG-Zugabe
feststellen.
Amplifikationserfolg in %

Gesamt

mit UNG

ohne UNG

100
90
80
70
60
% 50
40
30
20
10
0
440bp

187bp

179bp

162bp

162bp

V

I

III

II

IV

Fragmente/Länge

Abbildung 20. Amplifikationserfolg der Fragmente I-V in der Reihenfolge ihrer Produktlänge.

Der Amplifikationserfolg der einzelnen Proben wurde auf vergleichbare Weise berechnet
(Abbildung 21). Hierbei wurden Proben der Arbeiten von Brandt und Tänzer (2005)
berücksichtigt, insofern sie im Rahmen dieser Arbeit extrahiert und amplifiziert worden
waren.
Es wurde lediglich ein allgemeiner Amplifikationserfolg der Probe berechnet, ungeachtet
dessen, ob die Probe ein reproduzierbares Ergebnis ergab oder nicht. Bei 21 von 55 hierin
erfassten Proben (38,2%) konnte ein Amplifikationserfolg von 100% beobachtet werden,
wenn nur die vier kurzen Fragmente betrachtet wurden. Darüber hinaus war auf Grundlage
aller fünf Fragmente festzustellen, dass unter einem (hier hypothetischen) Schwellenwert
von ~50% nur etwa 12,8% der Proben lagen.

114

115
Abbildung 21. Durchschnittlicher Amplifikationserfolg der einzelnen neolithischen Proben mit
und ohne Einbezug der Ergebnisse des 440bp langen Fragments V.
0%

25%

50%

75%

100%

BRU2
SLH1
SLH2
SON2
SWI6
YPB2
SEE2
UNS1
SON1
DUD1
YPB4
BRU3
DEB2
TRE1
SON5
LEB1
DEB3
KRE1
SZA8 1
SEE1
VAI3
SCHWE1
SCHWE4

Gesamt

DEB5

ohne Fragment V

DEB1
FLO1

HAL2

Amplifikationsrate

SCHWE2
ECS1
END6 2
SCHWE5
DON1
ASP2
BRU4
DUD2
DON2
DBK1
DKF1
END6 1
END6 3
HAL3
SZA23 3
SZA8 3
DEB4
FLO6
FLO4
UNS2
HAL1
KRE2
END119 1
END119 2
SZA23 2
SZA8 2
CHE4
SZA23 1

Ergebnisse

Ergebnisse

6.1.2 Kontamination der Kontrollen

Im Rahmen der Gesamtzahl an PCR-Ansätzen zur Amplifikation der mitochondrialen HVS I
wurden insgesamt zehn Ansätze bzw. Teile des PCR-Ansatzes verworfen, wenn mehrere
Leerkontrollen positive Signale zeigten bzw. die entsprechenden Tier- und
Extraktionskontrollen eines gemischten Ansatzes aus mehreren Extraktionen positiv waren
(Kap. 5.2.1). In 67 PCR-Ansätzen mit 140 Leerkontrollen waren sechs positiv (~4,3%). Der
durchschnittliche Anteil an positiven Extraktionskontrollen lag bei 13,5% und der
durchschnittliche Anteil positiver Tierkontrollen bei 32%.
Der Anteil an positiven Kontrollreaktionen der einzelnen Fragmente ist in Abbildung 22
dargestellt. Hier war zu beobachten, dass die Häufigkeit von positiven Leer- und
Extraktionskontrollen besonders bei der Amplifikation der kürzeren Fragmente zunahm.
Gleichermaßen kann das absolute Ausbleiben von positiven Signalen bei insgesamt 59
Kontrollreaktion der 292 PCR-Reaktionen des Fragments V festgehalten werden.

Anteil positiver Kontrollreaktionen in %

LK positiv

EXLK positiv

TK positiv

100

80

60
%
40

20

0
440bp

187bp

179bp

162bp

162bp

V

I

III

II

IV

Fragmente/Länge

Abbildung 22. Prozentualer Anteil an positiven Kontrollreaktionen in den unterschiedlichen
Fragmenten. LK = Leerkontrolle, EXLK = Extraktionsleerkontrolle, TK = Tierkontrolle (vgl. Kap.
5.2.1).

Ob in einigen Fällen trotz negativer Leerkontrollen Proben von sporadischen oder
systematischen Kontaminationen betroffen waren, konnte erst nach der Sequenzierung und
Abgleich aller Ergebnisse eines Individuums bestimmt werden. Nach Auswertung der
sequenzierten Klone beinhalteten 77% der untersuchten Proben putative kontaminierende
Sequenzen.

116

Ergebnisse
In Abbildung 23 wurde der Anteil an kontaminierenden Klon-Sequenzen mit dem
allgemeinen prozentualen Amplifikationserfolg der Proben aus den vier entsprechenden
kurzen Fragmenten I-V verglichen. Sieben von 11 Individuen, die einen Amplifikationserfolg
von 100% aufwiesen, zeigten keine kontaminierenden Sequenzen. Dahingegen wiesen alle
anderen Individuen Spuren von Kontaminationen im Bereich von 1,2% (HAL3; DON1) –
44,1% (BRU4) auf. Die deutlichsten Anteile an kontaminierenden Sequenzen zeigten BRU4
und UNS2 mit 44,1% und 41,6%, respektive. Die kontaminierenden Sequenzen entsprachen
in beiden Fällen dem direkten Bearbeiter und konnten daher eindeutig identifiziert werden.
Ingesamt ließ sich im Hinblick auf den höheren Amplifikationserfolg eine Tendenz zu
Gunsten von Zahnproben entdecken, zumal bei der Mehrzahl der Proben mit 100%
Amplifikationserfolg jeweils DNA aus Molaren extrahiert wurde.

Kontamination vs. Amplifikationserfolg

Kontaminierende Klone in %

60

80

100

Amplifikationserfolg in %

SZA23 1

KRE2

HAL1

DEB4

ASP2

DEB1

HAL3

CHE4

HAL2

SZA23 2

FLO4

UNS2

FLO6

DON1

SCHWE4

DUD2

VAI3

SEE1

DEB5

SCHWE2

KRE1

BRU4

SCHWE1

LEB1

DEB3

DEB2

0

20

40

%

Individuen

Abbildung 23. Anteil der kontaminierenden Klon-Sequenzen im Vergleich mit dem
durchschnittlichen Amplifikationserfolg der erfolgreich typisierten Proben aus den vier kurzen
Fragmenten I-IV.

117

Ergebnisse

6.1.3 Untersuchungen zur Diagenese mittels SAXS-Analyse
Die Ergebnisse der SAXS-Analyse sind in Abbildung 24 und 25 dargestellt.

eta vs. T
0,0600
UNS 1,1
SZA23 2B

0,0500

SPI3,3
KR2,2

0,0400

DK4,2

eta

SWI6A
0,0300

LEB1A
DR1,3
DR2,3

0,0200

BADÜ2,2
SCHWE4

0,0100

SEE1
SON1
DON1C

0,0000
3

3,5

4

4,5

5

5,5

6

MHS 1

Dicke T in nm

Abbildung 24. Ergebnisse der SAXS-Analyse. Das Punktediagramm zeigt die paarweisen Werte für
den Index der Kristallstruktur (Y-Achse) sowie die Dicke der Kristalle (X-Achse). Farbig dargestellt
sind die Ergebnisse von untersuchten neolithischen Proben (Dreiecke), sowie bronzezeitliche und
mesolithische Proben (Kreise). Das rote Quadrat entspricht der Referenzprobe eines modernen
menschlichen Knochens (MHS).

eta vs. T Rind und Mensch
0,060

0,050

eta

0,040

0,030

0,020

0,010

0,000
2

2,5

3

Mensch
Rind
Rind moderne Referenz jung

3,5

4

4,5

5

5,5

6

Dicke T in nm

Mensch moderne Referenz
Rind moderne Referenz alt

Abbildung 25. Ergebnisse der SAXS-Analyse im Vergleich mit Rinderproben.

118

FLO4. DUD2.2. Eine Ausnahme stellte die Probe SCHWE 5 dar. Die vier überlappenden Primersysteme zur Analyse der HVR I Kernregion (Kap. DEB1.h.2 Untersuchte genetische Marker 6.) in der Diskussion (Kap. 10.5). da in beiden Fällen gleich mehrere Linien. 7. UNS2 DON2. Amplifikationserfolg. VAI3 DEB3. nämlich eine Reproduktion der Sequenzen über Direktsequenzierung mehrerer unabhängiger PCR-Produkte. DEB4. SCHWE2. Die Ergebnisse dieser Proben wurden verworfen. DON1. DON2) konnten massive Kontaminationen festgestellt werden. 119 .2. RFLP-Analyse. FLO6. HAL3. HAL1.1 und 10. DEB2.1) und der anschließenden Sequenz im Bereich der Nukleotidpositionen 15997-16409 ließen sich aus 63% aller aDNA-Extrakte amplifizieren. Kategorisierung der Sequenzdaten der Individuen hinsichtlich der Authentizitäts.4. Sequenzierung der HVR I. d. SEE1. SZA23 1 CHE4. Die Haplogruppenbestimmung der 27 bestimmbaren Proben (inklusive der unsicheren Proben (BRU4. Tabelle 28. Bei zwei Individuen (DUD1. STRTypisierung usw. SCHWE5.1 Hypervariable Region I (HVR I) Alle Ergebnisse der mitochondrialen Sequenzanalyse wurden nach dem in Abbildung 17 gezeigten Reproduktionsschema erstellt. SZA23 2. LEB1 DEB2. Im Rahmen dieser Arbeit wurden insgesamt 2434 Klone von 26 Individuen (ohne SCHWE5) sequenziert. Kategorie 1 2 3 4 5 6 7 Individuen ASP2.2). SCHWE1. SCHWE4 BRU4. Die zum laborinternen Abgleich verwendeten entsprechenden Sequenzabschnitte aller typisierten Bearbeiter der neolithischen Proben sowie der Mitarbeiter der Arbeitsgruppe sind anonymisiert in Tabelle 10. Reproduktionskriterien.Ergebnisse 6. HAL2.1.bzw. UNS2) ergab 24 unterschiedliche Haplotypen (Tabelle 19). Substitutionsrate. Von 29 Individuen (inklusive SCHWE 5) konnte in 27 Fällen an Hand konsistenter Basenaustausche in den Klonsequenzen eine eindeutige Bestimmung der Haplogruppe im Sinne der Kategorisierung gemäß angewendeter Authentizitäts. KRE2. 5. Die Alignments aller Sequenzen der untersuchten Proben sind im Anhang aufgeführt (Kap.bzw.2 im Anhang aufgeführt. für die versuchsweise ein umgekehrter Ansatz verfolgt wurde.2.1 Mitochondriale DNA 6. DUD1 Eine detaillierte Erörterung der einzelnen Proben im Hinblick auf die Authentizität der Ergebnisse erfolgt in einer Gesamtbetrachtung aller Teilergebnisse (Probengeschichte. Haplotypen in den Klonsequenzen beobachtet werden konnten. Reproduktionskriterien nach Abbildung 19 durchgeführt werden (Tabelle 18).3. KRE1. DEB5.

T 16270.T 16320.T 16320.C 16233.C 16223.C 16126.C 16224.Ergebnisse Tabelle 19.T 16319.T 16248.C 16391.T 16069.T 16270. Die reproduzierten Ergebnisse der Arbeiten von Brandt (2005) und Tänzer (2005) sind grau dargestellt.C 16147.T 16224.C 16126.C 16311.C 16294.T 16192.C 16223.A 16172.C 16270.T 16256.C 16224.T 16248.A 16172.A 16172.T 16304.C 16172.C 16294.T 16286.T 16241.G Haplogruppe H* U5a1 N1a K* N1a HV* HV* H* N1a H* HV* T K* K* V N1a T T T H* T J* W K N1a U3 T J* N1a K* H* H* N9a I H* HV* D4a U5b2 U5b2 U5b2 U5b1 U5a1 U5a 120 .T 16192.C 16292.C 16294.C 16311.T 16355.A 16147.C 16147.C 16192.C 16357.T 16320.T 16224.A 16261.T 16294.T 16192.T 16296.T 16311.C 16298.C 16129.C 16294.T 16355.A 16355.T 16311.T 16270.T 16320.C 16189.T 16355.T 16270.C 16223.T 16362.A 16343.A 16172.C 16311.C 16126. Aufgeführt sind die abweichenden Positionen im Bereich der HVR I von Nukleotidposition 1599716409.C 16129.C 16126.C 16223.T 16248.T 16093.G 16294.C 16223.C 16249.C 16147.T 16355.C 16256.C 16147.T 16126.T 16399.C 16311.T 16248.C CRS 16147.C 16311.T 16270.A CRS 16311. Unsichere/Rekonstruierte Bestimmungen sind kursiv gezeichnet.T 16296.T 16248.T 16189.T 16248.T 16362.C 16311.T 16224.T 16256. Bei der Bestimmung der Haplogruppen wurden die Ergebnisse der RFLP-Analyse bereits mit einbezogen.A 16172.T 16296.T 16304.T 16355.C 16223.T 16126.T 16093.A 16154.C CRS CRS 16223.T 16304.C 16126.C 16086.A 16223.T 16192.C 16249. Kürzel ASP2 BRU4 DEB1 DEB2 DEB3 DEB4 DEB5 EIL1 FLO1 FLO2 FLO3 FLO4 FLO5 FLO6 HAL1 HAL2 HAL3 SCHWE1 SCHWE2 SCHWE4 SCHWE5 SEE1 UNS2 UWS2 UWS5 VAI3 DBK1 DKF1 ECS1 END119 1 END6 1 END6 2 SZA23 1 SZA23 2 SZA23 3 SZA8 1 SZA8 2 DON1 KRE1 KRE2 DUD2 CHE4 LEB1 HVR I Sequenz CRS 16192.T 16274.T 16270.T 16129.T 16296.T 16069.T 16304.T 16296.A 16223. Reproduzierte Ergebnisse der Sequenzanalyse und Haplogruppenbestimmung.T 16257.T 16292.T 16294.C 16311.

n.2 Amplifikation und RFLP-Analyse von Abschnitten der coding region Die Primersysteme für die zusätzliche Amplifikation von bestimmten Abschnitten der kodierenden Region des Mitochondriums. mögliche Haplogruppe H* Nicht H*. Ergebnisse des Verdaus mit diagnostischen Restriktionsenzymen Hinf I und Alu I.d. ließen sich bei allen Proben erfolgreich amplifizieren. n.2. war nicht mehr für alle in Frage kommenden Proben genügend Extrakt und/oder Probenpulver vorhanden.1. Probe ASP2 DEB4 DEB5 EIL1 FLO2 FLO3 HAL1 SCHWE4 END6 1 END6 2 SZA23 3 SZA8 1 DON1 KRE1 KRE2 DUD2 CHE4 LEB1 np 12308 Hinf I n. nicht U* U* U* U* U* U* U* 121 .Ergebnisse 6.d.d. In Tabelle 20 sind Ergebnisse der Verdaureaktionen zusammengefasst.d.d. Eine Analyse des Schnittmusters ließ sich in allen fraglichen Fällen durchführen.d.d. n. n. welche bei Proben mit nicht eindeutig bestimmbaren Haplogruppen durchgeführt wurden. Der Status einer Schnittstelle für das jeweilige Enzym an den designierten Nukleotidpositionen (np) ist durch + (vorhanden) bzw.d. n. um alle Ergebnisse der RFLP-Analyse zu reproduzieren. nicht U* H* H* H* H* Nicht H*. = nicht durchgeführt.d.d. n. nicht U* Nicht H*. – (nicht vorhanden) gekennzeichnet. + + + + + + np 7025 Alu I + + + + n. nicht U* H* H* H* Nicht H*. n. Beachte: n. Da diese zusätzliche Analyse erst zum Ende der Arbeit hin durchgeführt wurde. Tabelle 20.

Die Haplogruppenbestimmung erfolgte wie bereits beschrieben (Kap.1. Probe BRU1 BRU1 BRU1 BRU4 CHE4a CHE4b DEB1 DEB1 DEB3a DEB3a DEB4a DUD2b END119 1b END119 2b FLO2a HAL1b HRX1 KRE1a KRE1a KRE2a KRE2a SEE3 SON6 SZA23 1a SZA23 1b SZA23 2b SZA8 2b TRE1 UNS2 UWS10 UWS2b UWS4 UWS4 UWS4 UWS6 UWS8b UWS9 VIE1 Klone 1 5 2 3 2 5 6 2 5 1 1 1 HVR Sequenz 16189C 16311C 16189C 16311C 16189C 16311C 16189C 16311C 16192T 16256T 16270T 16294T 16192T 16256T 16270T 16294T 16147A 16172C 16223T 16248T 16355T 16147A 16172C 16223T 16248T 16355T 16189C (16267T ?) 16189C 16126C 16163G 16186T 16189C 16221T 16294T 16189C 16041G 16311C 16140C 16189C 16243C 16223T 16290T 16294T 16319A 16362C CRS 16311C 16192T 16270T 16192T 16270T (16378T) 16192T 16270T 16192T 16270T 16309G 16172C 16223T 16227G 16278T 16292T 16362C 16223T 16257A 16261T 16223T 16257A 16261T 16129A 16223T 16311C 16357C 16391A (16093C) 16129A 16223T (16249C) 16362C 16207G 16233T 16381C 16390A 16189C 16311C 16126C 16189C 16294T 16296T 16108T 16129A 16162G 16172C 16304C 16069T 16126C (16223T) 16256T (16258G) 16270T (16399G?) 16256T 16270T (16399G) 16189C 16069T 16126C 16126C 16189C (16259T) 16294T 16296T 16189C 16311C Hg H* H* H* H* U5a U5a N1a N1a H* H* T1? H* B5b I/A H* H*/HV U5b2 U5b2 U5b2 U5b2 H* W N9a N9a I D4a ? H* T F J U5 U5 H* J T H* 122 . sind fett gedruckt.2. 6. ist die Anzahl der Klone in Spalte 2 vermerkt. sind kursiv dargestellt. Sofern ein PCR-Produkt kloniert wurde.1. die mit der des Bearbeiters identisch waren.Ergebnisse 6. die der Konsensus-Sequenz der kurzen überlappenden Fragmente entsprachen. HVR I Sequenzen und Haplogruppenbestimmungen aller amplifizierten 440bp-langen Fragmente. Sequenzen.3 Amplifikation langer PCR-Produkte Die Ergebnisse der Amplifikationen des Fragments V sind in Tabelle 21 dargestellt.2. Tabelle 21.1). Sequenzen.

Keine der Proben ergab eine vollständige Genotypisierung aller loci des Multiplexsystems. Die übrigen acht Proben ließen sich vor allem im Bereich der kürzeren Marker bis 200-250bp erfolgreich typisieren. ein durch die Degradierung und Fragmentierung der DNA bedingter Ausfall von erwarteten Allelen. was einem allgemeinen Genotypisierungserfolg von ~17% entsprach.2. da diese nicht einem Allel der mitgeführten Allelleiter entsprachen. Aus dieser wird ersichtlich. So zeigten nur zwei Reaktionen der insgesamt 260 Leer-. dass bei diesen neun Individuen eine STRGenotypisierung mehrerer loci reproduzierbar durchgeführt werden konnte. FGA.3 im Anhang aufgeführt. 123 . Damit konnte ein hoher Anteil an allelic dropout. Die Kontaminationsrate der PCR-Ansätze mit dem AmpFLSTR® Profiler Plus® Kit war mit ~0.2. In beiden Fällen konnten durch die Kapillarelektrophorese auch hier nur Artefakte nachgewiesen werden. D7S820 und D18S51. Ein Beispiel eines Elektropherogrammes anhand der Probe HAL2 ist in Abbildung 26 gezeigt. festgestellt werden.2.h. dass mehrheitlich nur ein Allel von einem oder wenigen Genorten der Multiplex bestimmt werden konnte. Es konnte ebenso beobachtet werden.2. deren Allele in diesem Multiplexsystem einer Produktlänge bis zu 341bp entsprechen. konnten nicht erfolgreich amplifiziert werden.2 Nukleäre DNA 6.Ergebnisse 6.1 Short tandem repeat (STR) Genotypisierung mittels AmpFlSTR® Profiler Plus® In Tabelle 22 ist eine Auswahl von neun erfolgreich reproduzierten typisierbaren Individuen dargestellt. Extraktionsund Tierkontrollen eine Bande auf dem Agarosegel. Die autosomalen loci D13S317. die sich jedoch nach der sensitiven Analyse durch die Kapillar-Elektrophorese (Kap. Lediglich bei der ungarischen Probe SZA23 1 konnten bis auf D18S51 alle loci erfolgreich typisiert werden. Die Ergebnisse aller einzelnen Typisierungen sind in Tabelle 10. d.10) in den meisten Fällen als Artefakte der Multiplexreaktion herausstellten. Häufig zeigte die Mehrzahl der untersuchten Proben eine Bande auf dem Agarosegel im erwarteten Längenbereich von 107-341bp. 5.8% sehr niedrig.

D21S11 und D13S317 sind nur noch sehr schwach zu erkennen. die Farben der Allelleitern in den einzelnen panels entspricht den jeweiligen Fluoreszenzfarbstoffen. 124 .Ergebnisse Abbildung 26. Die Produkte der neolithischen Probe sind orange dargestellt. wobei im Fall der loci D5S818. D13S317 und D7S820 gelb durch grau ersetzt wurde. STR-Genotypisierung der Probe HAL2 mittels AmpFLSTR® Profiler Plus®. Das Elektropherogramm zeigt beispielhaft die stete Abnahme der peak-Höhe der einzelnen PCR-Produkte bei gleichzeitig steigender Produktlänge (obere Skala ~ Länge in bp). Die Allele der loci FGA.

2 X 16/17 DEB1 NM5 N80.4 X (15/16/17) 11/15 12 15/16 29 21 KRE1a NJ13 N26. Die Ergebnisse aller Typisierungen finden sich in Tabelle 10. Ergebnisse der STR-Genotypisierung mittels AmpFLSTR® Profiler Plus® ausgewählter Proben.7 X/Y 16/18 8/13 12 16/18 28/30 (9) (21)/24 HAL2b NL9 N64_19 X/Y 16/18 8/13 12 16/18 28/30 10/(12) HAL2b NL9 N64_9 X/Y 16/18 8/13 12 16/18 28/30 9 X/Y 16/18 8/13 12 16/18 28/30 HAL2 KRE1a NJ13 N19.7 X (10)/(14)/16 13 KRE1b NG3 N14.2 11/12/13 7-2 9 11/13 12 11 12 11/13 12 11/13 12 N16.9 Y? 16/17 11/15 12 (15)/16 (28) (14) KRE1a NM12 N79.17 X (17)/18 DEB3a NG10 N26.1 DEB1 NM5 N79.4 X 18 (10)/11 12 (17)/18 11/13 12 X 12 14 14 DEB3a NH3 DEB3 vWA (16)/17 (16)/17 DEB4a NC N11.5 X/Y 18/19 13/14 13 X/Y 18/19 13/14 (11)/13 16/17 (10) DEB4 9 HAL2a NK7 N47. Allele in Klammern weisen auf eine peak-Höhe t 10 % des Schwesterallels bzw. Beachte: ld = locus dropout.3 X DEB3a NH3 N26.2 X 18 X 17 DEB1 Artefakte D21S11 D13S317 FGA D7S820 D18S51 13/14 14 DEB3a NG10 N17.4 X 16/17 11/15 (12) 16 28/29 KRE1a NM12 N80.6 X KRE1 21 21 (21) (20) (13) 21 28/29 X 16/17 11/15 12 24 12 (15)/16 28/29 (21) 125 .3 KRE1b ND4 N26.7 X/Y 16/18 8/13 12 (15)/16/18 (28)/30 (11) (24) HAL2a NK7 N46.13 X/Y 18/19 13/14 11/13 16/17 (30) 9/(12) DEB4a NC N13.2/32. Die Zusammenfassung der einzelnen Typisierungen zum Konsensus-Genotyp ist jeweils grau hinterlegt.3 X/Y 18/19 13/14 11/13 16/17 (29/30 9/(12) (24) (10) DEB4a NF N12.5 X/Y 18/19 13 16/17 DEB4b NK5 N46.Ergebnisse Tabelle 22.1 X (14)/15/(17)/18 13 DEB1 NG8 N20.15 X DEB1 NH N16.3 X/Y 18/19 13/14 13 16/17 (30) 9 (23) (10) DEB4a NF3 N26.18 X 17 DEB1 NG8 N17.13 X 16/17 11/15 11/12 15/16 KRE1a NJ13 N20.5 13 14 13 31.3 (14)/(17)/18 DEB3a NG10 N20.3 11/12 KRE1b NG3 N26. Die typisierten loci (Spalten 4-13) sind entsprechend ihres Längenbereichs sortiert.4 X 16/17 11/(15) (12) 16 28/29 KRE1b ND4 N15. auf unsicheren oder generell schwachen Nachweis hin.10 X/Y 18/19 13/14 11/13 16/17 DEB4b NK5 N47. Probe Extrakt PCR Amel D3S1358 D8S1179 D5S818 DEB1 NG8 N16.3 im Anhang.4 X 17/18 DEB3b NK4 N47.4 X (17)/18 DEB3b NK4 N46.

8 X/Y 15/17 13/(14) 12/13 SZA23 3a NN3 N80.14 KRE2b NK14 N46.3 X/Y 15/17 (14) KRE2a NM11 N80.2 X 15/17 12 SZA23 2b NO2 N204.Ergebnisse Tabelle 22.10 X/Y 15/17 9/14 11/12 KRE2a NM11 N79.2 X 17 SZA23 2b NO2 N82.2 X (14)15 8 SZA23 2b NO2 N219. Fortsetzung.3 X/Y 15 - 21 - X/Y 15/17 (12/15) 15/16 SZA23 3a NN3 SZA23 3 (12/15) 28 28/29 13/14 13 14/17 - 13/14 12/13 14/17 28/(29) 20+2/\21-2 - - - (20) 126 .2 X/Y 15/17 13/14 12/13 (13)14/17 28/29 SZA23 3b NO3 N81.2-29 11 20 (16) SZA23 3b NO3 N82.3 X/Y 15/17 (14) KRE2b NK14 N47.3 X/Y 15 13/14 12/13 14/17 28/28.6 X/Y 14 13/14 11 14/16 26/29.8 X/Y 15/17 13/14 12/(13) 14/17 SZA23 3a NN3 N203.2+ 11+/13+ 22/23 (7/8) SZA23 1b NO1 N204.1 X/Y 14 13/14 11 14/16 26 X/Y 14 13/14 11 14/16 26/(30) 11/13 22/23 7/8 18/19 (30)h 11/(12) (21) (12)h (21)h SZA23 1 SZA23 2a NN2 N79.7 X 15/17 12 11 SZA23 2a NN2 N203.5 X/Y 15/17 9/14 11/12 KRE2a NJ14 N26.14 KRE2 (11) (14)/15 vWA D21S11 D13S317 FGA D7S820 D18S51 15/16 28 16/18 10/14 20 (28) 16 28 16/18 28 (19)/20 19 Artefakte 9/(13)/14 X/Y 15/17 9/14 11/12 16/ld 28 SZA23 1a NN1 N79.1 X/Y 14 13/14 11 14/16 26/29. Probe Extrakt PCR Amel D3S1358 D8S1179 D5S818 KRE2a NJ14 N19.2 X/Y 14 13/14 (10)/11 12/14/16 26/30 X (8)/12 11 ld/19 14/17 SZA23 2 15/17 11 (11)/12 18/19 8/(10)/13 (19) 11 22/23 7/8 19 N79.7 X 15 12 11/13 SZA23 2a NN2 N80.1 X 15/17 SZA23 2a NN2 N218.2-30) 11+2/13+2 22/23 (7/8) SZA23 1b NO1 N81.14 X/Y 15/17 (13)/14/(15) 11/12 KRE2a NJ14 N20.1 SZA23 2b NO2 N81.6 X/Y 14 13/(14) (11) 14/16 26/(29.2/30 11/13 SZA23 1a NN1 N80.3 ld/Y 15/17 13/14 14/17 28 (9)/10+2 20+ (9) SZA23 3b NO3 N204.1 X/Y 14/19 13/14 11 14/16 26/30 11+2/13+2 22/23 7/8 SZA23 1b NO1 N82.1 X/Y 14 13/14 (10)11 14/16 26/30 12/14 SZA23 1b NO1 N219.

af = Artefakte. KRE2) konnten mehrere loci des Multiplexansatzes „Anthrofiler 2004“ wiederholt erfolgreich amplifiziert werden. wenngleich die längeren Produkte der übrigen loci eindeutig und reproduzierbar bestimmt werden konnten. Tabelle 23. 5.3 13. Die typisierten loci (Spalten 2-9) sind entsprechend ihres Längenbereichs sortiert.3 13.3 (11/12) 11 af 10 10 13 13 13. Dies betraf vor allem die der loci Amelogenin und DYS434. Die Zusammenfassung der einzelnen Typisierungen zum Konsensus-Genotyp ist jeweils grau hinterlegt.3 (11/13) In der hochauflösenden Kapillar-Elektrophorese (Kap. Ergebnisse der STR-Genotypisierung mittels „Anthrofiler 2004“. dass einige Primersysteme im Multiplexansatz vermehrt Artefakte bildeten.3 13 10 10 10 10 10 10 11 11 11 11 11 (13) 10/14 10/14 HPRTB 13 af 13 13 13 13 13 13 13 14 14 14 14 14 14/15 14/15 13.3 13.2 Short tandem repeat (STR) Genotypisierung mittels „Anthrofiler 2004“ Bei fünf ausgewählten Proben (DEB3.2. HAL2. auf unsicheren oder generell schwachen Nachweis hin. Weiterhin konnte bei Individuum HAL2.Ergebnisse 6. KRE1. 127 .3 13. allelic dropout bei Amelogenin festgestellt werden.2. DEB4. Beachte: ad = allelic dropout. welche jeweils in drei von fünf Fällen nicht typisiert werden konnten (siehe auch Abbildung 27). Probe Amel TPOX DYS434 D13 DEB3a DEB3a DEB3a DEB3a DEB3b DEB3b DEB3 DEB4a DEB4a DEB4a DEB4a DEB4b DEB4b DEB4 HAL2a HAL2a HAL2b HAL2b HAL2 KRE1a KRE1a KRE1b KRE1b KRE1 KRE2a KRE2a KRE2b KRE2b KRE2 af af af af af af 8/11 8/11 8/11 8/11 11 8 8/11 8 8 8 8 8 8 8 8/11 8/11 8/11 8/11 8/11 8 8 11 af 11 af af af 9/13 9/13 9/13 13 13 13 (9)/13 9/12 9/12 9/12 9/12 9/12 9/12 9/12 9/11 9/11 9/11 9/11 9/11 13/14 11/13 X/Y X/Y X/Y X/Y X/Y af X/Y ad/(Y) X/Y X/Y ad/Y X/Y af/(Y?) af af af af af af af 8/9 8/9 9 9 9 9 9 af 9 9 9 9 9 9 af af af af af af af af Y-GATA STRX1 CSF1 13.10) zeigte sich. Kontaminationen der Kontrollen wurden keine festgestellt.3 13.3? 13.3 13.2. Eine Zusammenfassung aller Typisierungen ist in Tabelle 23 gezeigt. Allele in Klammern weisen auf eine peak-Höhe t 10% des Schwesterallels bzw.

Einige Systeme bildeten jedoch im Multiplexansatz vermehrt Artefakte. Die Farbgebung der peaks der PCR-Produkte ist an die entsprechenden Fluoreszenzfarbstoffe der loci angelehnt. Die Allelleiter ist orange wiedergegeben (für DYS391 lag zum Zeitpunkt der Untersuchung keine Allelleiter vor). DYS434 und Y-GATA zu sehen ist. wie vor allem im Bereich von Amelogenin. STR-Genotypisierung der Probe DEB4 mittels „Anthrofiler 2004“. dass der Multiplex-Ansatz „Anthrofiler 2004“ im Vergleich mit AmpFlSTR® Profiler Plus® Kit keine wesentlichen Vorteile bietet. 128 . Das Elektropherogramm zeigt die erfolgreiche Amplifikation aller loci außer CSF1.Ergebnisse Da insgesamt festgestellt wurde. Abbildung 27. wurden keine weiteren Versuche mit dem „Anthrofiler 2004“ durchgeführt.

Das bedeutete für Proben von weiblichen Individuen mögliche Heterozygotie bei X-chromosomalen Systemen und ein Negativnachweis (Nichtamplifikation) von Y-chromosomalen Markern. sofern diese am Skelett ermittelt werden konnte.2. DEB1 und DEB3 in ihrer Tendenz bestätigt werden.2. Da beim Multiplex-Ansatz des „Anthrofiler 2004“ besonders beim Marker Amelogenin häufig Artefakte zu beobachten waren. 5. Individuum AmpFlSTR® Profiler Plus® „Anthrofiler 2004“ Amelogenin Morphologische Geschlechtsbestimmung DEB 1 X nd wahrscheinlich weiblich DEB 3 X X? wahrscheinlich weiblich DEB 4 X/Y X/Y männlich HAL 2 X/Y X/Y männlich KRE 1 X X? weiblich KRE 2 X/Y X/Y? männlich SZA23 1 X/Y nd männlich SZA23 2 X nd weiblich SZA23 3 X/Y nd männlich 129 . DYS434. Tabelle 24. Vergleich der genetischen und morphologischen Geschlechtsbestimmung.3 Vergleich zwischen morphologischer und genetischer Geschlechtsbestimmung In neun Fällen.2.2). Y-GATA und STRX1 (Kap. Es konnte festgestellt werden. konnte das Ergebnis mit der morphologischen Geschlechtsbestimmung abgeglichen werden.4.B. Der Vergleich beider Methoden ist in Tabelle 24 zusammengefasst.4. Für männliche Proben waren der Nachweis von Y-chromosomalen Markern sowie der Status für Xchromosomale Marker erforderlich. Zudem konnten durch die Kombination beider Methoden morphologisch nicht absolut entscheidbare Fälle wie z. Beachte: nd = nicht durchgeführt. in welchen eine Bestimmung des Geschlechts molekulargenetisch möglich war.Ergebnisse 6. dass beide Methoden in allen vergleichbaren Fällen übereinstimmten. erfolgte die Geschlechtsbestimmung in erster Linie durch Kombination der gonosomalen Marker HPRTB.

4 im Anhang aufgeführt. Eine Interpolation dieser Daten ergab eine Zunahme der Substitutionsrate um 1. Substitutionsrate 25 20 15 ‰ 10 5 FLO5 SZA8 1 SZA8 2 CHE4 SEE1 FLO2 UWS5 LEB1 END6 1 END6 2 UWS2 FLO4 SZA23 1 SZA23 3 HAL2 KRE1 KRE2 DKF1 ESC1 SZA23 2 FLO1 DEB1 DEB3 END119 HAL3 DBK1 FLO3 DON1 HAL1 FLO6 SCHWE4 DEB4 DEB5 VAI3 EIL1 SCHWE2 ASP2 SCHWE1 0 Individuen Abbildung 28.3. Post mortem Substitutionsraten Sind der untersuchten neolithischen Individuen. Die zugrunde liegenden Werte der einzelnen Fragmente (Spcr)sind in Tabelle 10. jedoch gleichzeitig die Zunahme von post mortem Substitutionen beobachtet werden konnte. Somit ließ sich zusammenfassend feststellen.3 Quantifizierung und Charakterisierung der postmortalen Sequenzveränderungen 6. 6.1 Allgemeine post mortem Substitutionsrate In Abbildung 28 sind die Substitutionsraten Sind aller erfassten Individuen dargestellt.66‰ pro Abnahme der Produktlänge um 10bp. Die durchschnittliche post mortem Substitutionsrate Sind aller erfasster Individuen lag bei 13. Hierbei wurden auch die Sequenzen der erfolgreich reproduzierten Proben der Arbeiten von Brandt (2005) und Tänzer (2005) einbezogen.1). dass bei der Verwendung von kürzeren Fragmenten zwar der Amplifikationserfolg erhöht wurde (vgl. Die Proben wurden nach Höhe der Substitutionsrate (in ‰) angeordnet.Ergebnisse 6. Für die einzelnen überlappenden Fragmente. Kap. wurde ebenfalls eine Substitutionsrate (Sfrag) ermittelt.1. Die Individuen der integrierten Abschlussarbeiten von Brandt (2005) und Tänzer (2005) sind in hellerem Grauton abgesetzt. Hierbei ließ sich eine auffällige Tendenz der Zunahme an Substitutionen bei gleichzeitiger Abnahme der Produktlänge des Fragments feststellen. 130 .08‰. Die Ergebnisse sind in Abbildung 29 dargestellt. die zur Amplifikation der HVR I verwendet wurden.

70 12 ‰ 10 8.88 8 6 4 2 0 187bp 179bp 162bp 162bp 141bp 133bp 126bp I III IV II IIk IIIk Ik Fragmente Abbildung 29. 131 .90 17.79 14.02 14 16.36 18 16 14. Die Fragmente sind nach der jeweiligen Produktlänge sortiert. IIIk). IIk.59 12. Substitutionsrate der einzelnen Fragmente I-IV und deren kürzere Alternativen (Ik.Ergebnisse Substitutionsrate der einzelnen Fragmente 20 18.

5455 1.1667 0.4201 0.0000 IV 0.5556 0.8750 0.7273 0.6000 DEB1 0. Individuum ASP2 SEE1 HAL3 HAL2 HAL1 DEB3 DEB4 DEB5 FLO4 I 0.7285 0.4526 0.Ergebnisse 6.4000 0. drei Werten pro Spalte eines Fragments beziehen sich auf unabhängige PCR-Produkte aus unterschiedlichen Extraktionen.7500 0.0000 0.1000 0.8571 0.3636 0.4545 0.6167 0.0000 0.4000 0. Angaben von zwei bzw.4444 0.7778 0.4286 0.8000 0.6667 0.2000 0.2500 0.5556 1.9167 0.4289 0.6000 0.7143 1.7778 0.4167 0.4167 0.1667 0.0000 0.8750 UWS5 0.5000 0.7778 0.6583 132 .5000 0.6667 0.3000 0.6074 0.6250 0.1667 0.7273 0.7620 0.2857 0.8161 0.5556 0.5000 0.5714 0.2857 0.3. Sättigungsrate Säpcr der Fragmente I-IV sowie arithmetischer Mittelwert der betreffenden Proben.3636 0.0909 1.6667 0.3333 0.6142 0.2500 0.4000 0.6429 0.8000 0.4767 0.3333 0.8333 0.6000 0.2 Sättigungsrate Die Werte der Sättigungsrate Säpcr für die einzelnen PCR-Produkte sowie für die Individuen sind in der nachfolgenden Tabelle 25 aufgeführt.6000 SCHWE4 0.6185 0.6667 0.7620 0.7273 SCHWE1 0.2500 0.4545 0.7778 0.1429 0.6667 0.8000 1.2500 0.6667 0.7196 0.4286 KRE1 KRE2 0.5000 0.6364 0.3000 0.3750 0.4545 0.6667 0.4000 0.8333 0.6518 0.6667 0.8000 0.6667 0.5714 0.5000 0.7778 0.6667 0.2000 0.6250 0.5451 0.2727 0.5000 SCHWE2 DON1 0.0000 0.5833 Mittelwert 0.6565 0.5714 1.2500 0.3333 0.9000 0.5000 0.6667 0.6364 0.5000 0.6250 0.5556 0.6000 0.6667 0.2857 0.3000 0.4444 0.5000 0.6679 0.7500 0.2500 Sättigungsrate der einzelnen Fragmente IIa II IIIa III 0.6000 0.3333 0.8333 0.0000 0.6000 0.8750 1.4615 0.5137 0.8182 0.5714 0.8750 0.0909 0.2879 0.4898 0.3846 0. Tabelle 25.8000 FLO2 FLO6 0.5833 0.3333 0.4167 0.7778 0.6667 0.1818 1.3636 0.2560 0.9091 CHE4 LEB1 VAI3 FLO5 0.0000 0.0000 0.3383 0.5000 1.6667 0.0000 0.

5455 1.8571 Sättigungsrate der einzelnen Fragmente IIa II IIIa III 0.2222 0.4000 0.0000 0.6250 0.6250 0.1667 0.0000 0.4545 0.3556 0.8750 0.6667 0.4167 0.6667 0.4286 1.8571 0.6000 0.0000 0.6250 0.6250 0.4286 0.1667 0.2857 0.Ergebnisse Tabelle 35.6250 0.2857 0.8571 1.4726 0.6250 0.3750 0.0000 0.2500 0.7500 0.5833 0.1250 0.0000 FLO1 FLO3 SZA8 1 SZA8 2 END119 1 END6 1 END6 2 ESC1 ESC1 DBK1 DKF1 SZA23 1 SZA23 2 SZA23 3 Mittelwert 0.4167 0.6391 IV 0.5000 0.5000 0.6616 0.8182 0.6101 0.7500 0.5000 0.4167 0.0000 Mittelwert 0.3000 0.6000 0.5714 0.5000 1.7500 0.6667 0.6250 0.4000 0.7143 0.7500 1.4286 0.6250 0.0000 0.8750 0.5000 0. Fortsetzung Individuum UWS2 I 0.6068 1.7500 0.0000 0.8000 1.5349 0.6667 0.1250 0.6250 0.7500 0.5556 0.5766 0.5714 0.5000 1.8000 0.7500 0.1667 0.0000 1.0000 0.5455 0.7143 0.8750 0.4286 0.5000 0.8268 0.2500 0.5714 0.7500 0.5000 0.0000 1.8750 0.7778 1.6000 0.8750 0.7000 0.7143 0.5000 0.8000 0.7143 1.5000 0.2500 0.6000 0.5060 0.2500 0.5938 0.7500 0.3750 0.3333 1.6000 0.5884 0.0000 0.8333 0.0000 0.8000 1.7821 0.8000 0.5556 1.5541 0.1667 0.0000 0.7976 0.1667 0.0000 0.7500 0.6000 0.5000 1.5000 0.6021 0.5000 0.5686 133 .4655 0.1250 0.0000 0.

19% 0. Die theoretisch mögliche Transversion GaC wurde nicht nachgewiesen.98% 0.3 Charakterisierung und Verteilung postmortaler Sequenzveränderungen Der zugrunde liegende Datensatz beinhaltete 2434 Sequenzen bzw.42% C >G C >A 0. die Aufschlüsselung der einzelnen Fragmente finden sich in Tabelle 10.5 im Anhang.859 Nukleotidpositionen.70% 0.Ergebnisse 6.00% T >G T >A G >T G >C 0. Aus Abbildung 30 wurde ersichtlich.28% 0% C >T T >C G >A A>T A>G A>C Abbildung 30. Zunächst wurden die jeweiligen Basenaustauschmöglichkeiten auf dem light strand des Bereichs np 15997-16410 einzeln quantifiziert. 134 . Die exakten Werte hierzu bzw. 285. Transversionen bleiben deutlich unter 1%. Darauf folgte die komplementäre Transition GaA mit ~14%.68% 70% 60% 50% 40% 30% 20% 14. Die prozentualen Anteile der möglichen Typen eines Basenaustausches sind in Abbildung 30 gezeigt.14% 0.42% 0. Anteil d er einzelnen B asen austau sche 80% 75.06% 10% 4. dass die Transition von Cytosin zu Thymin mit ~76% die häufigste Form des Basensaustauschs darstellte.03% 3. Die komplementären Transitionen TaC und AaG stellten mit jeweils ~4% einen geringeren Anteil dar. Prozentualer Anteil der möglichen Formen der Basensubstitution.09% 0.3.

welche die komplementären aber reversen Substitutionen T/AaC/G umfassen. Bezüglich der Typ II Transitionen konnte festgestellt werden.08% Transversion Pyrimidin-Purin 1. Verhältnis der Basenaustausch-Typen Transversion Purin-Pyrimidin 1. stellten mit ~90% die häufigste post mortem DNAModifikation dar. um festzustellen.Ergebnisse Die anschließende Einteilung in die von Hansen et al. dass eine Normalverteilung vorlag. dass mit jeweils einer Ausnahme (C an np 16040 und G an np 16273) alle anderen Nukleotidpositionen. G tragen mindestens einmal deaminiert waren. nach welchen für die Transitionen vom Typ I bzw. ergab die in Abbildung 31 gezeigte Verteilung. Die Typ I Transitionen. welche die komplementären Substitutionen C/GaT/A beinhalten. konnte mit Hilfe des Kolmogorov-Smirnov-Anpassungstests auf dem 95% Signifikanzniveau bestätigt werden (pCytosin =0. II jeweils nur eine biochemisch wahrscheinliche Substitution zugrunde liegt.17% 8. (2001) erstellten Kategorien der Transitionen und Transversionen.483 und pGuanin = 0.608). Die Transversionen spielten mit insgesamt ~2% der post mortem Substitutionen eine vernachlässigbare Rolle. Zunächst wurde geprüft.01% Transition Typ I 89. waren mit ~8% nur in geringerem Maße festzustellen. ob die beobachteten Häufigkeiten an C und G eine Normalverteilung aufwiesen. die ein C bzw. Der Datensatz wurde auf die Transitionen des Typs I und II reduziert. Anteil der post mortem Substitutionen in den Kategorien der Transversionen und Transitionen. einzelne Positionen besonders oder weniger häufig mutierten. Die Nullhypothese H0.74% Transition Typ II 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Abbildung 31. ob innerhalb der untersuchten Region der mitochondrialen control region von np 15997-16409 Bereiche bzw. Die Typ II Transitionen. Die Transition Typ I entspricht T/AWC/G und Typ II C/GWT/A. 135 .

wobei das Adenin an np 16091 nicht betroffen war. Insgesamt konnten somit 39 hot spots und 17 cold spots definiert werden. welche signifikant häufiger bzw. wobei neben den Cytosin-Positionen C16184. Eine Systematik im Verteilungsmuster der verbleibenden hot spots bzw. Die beobachteten Deaminierungshäufigkeiten der übrigen Cytosine in diesem poly C-stretch lagen ebenfalls über dem Erwartungswert E des Bereichs. Dieser umfasste sechs Cytosine in Folge an np 16375-16380. waren jedoch nicht signifikant. cold spots konnte nicht festgestellt werden.Ergebnisse Auf der Basis dieses Datensatzes mit jeweils kombinierten Erwartungswerten für die Typ I und II Transitionen wurden diejenigen Nukleotidpositionen bestimmt. wo eine signifikante Häufung von TaC auftrat. die besonders anfällig für Deaminierungen waren. Abbildung 32). Zum einem betraf dies den Abschnitt np T16090-T16092-T16093-T16094. Der dritte Bereich mit signifikanter Häufung von Deaminierungen betraf ebenfalls einen poly C-stretch. Bei allen drei Abschnitten handelte es sich um poly-Nukleotid-stretches. 136 . Anhand der Verteilung der hot spots ließen sich drei kurze Abschnitte herausstellen. Die zweite Häufung konnte im poly C-stretch von np 16184-16193 erkannt werden. wobei cold spots nur bei den sehr häufigen und normalverteilten C und G Positionen festzustellen waren (Tabelle 26. d. wovon lediglich Position C16380 nicht signifikant häufiger deaminiert war. welches das benachbarte C an np 16095 ebenfalls beinhaltete.1. 7. weniger häufig postmortal ausgetauscht waren.7). um Bereiche in welchen eine Base gehäuft hintereinander vorkommt.C16188 und C16190 auch das Adenin an np 16183 sowie das Thymin an np 16189 signifikant vom Erwartungswert E abwichen.h. Ein Abgleich mit bereits in der Literatur erwähnten putativen hot spot Mutationen sowie eine detaillierte Erörterung derselben erfolgt im Rahmen der Diskussion (Kap.

0000001 C16260 15 303 0.9048 0.0011949 T16025 3 245 0.1943 0.6837 0.0543 7.7561 9.3425 0.0041 7.0101 0.0000 8.0051430 Dnp E Z2 p 137 .4694 0.0135 0.6847 7.4983 0.0066 8.8927 3.9762 0.0006621 G16196 1 302 0.0194927 G16106 2 258 0.1905 7.0101 0.0071 1.4983 0.0497 8.0033 8.8515 0.0028631 C16282 3 303 0.2487 0.7463 0.6224 0.0640 8.1748 0.1104 6.9304 0.0018174 T16093 3 258 0.0208111 C16245 1 303 0.8634 7.0062755 C16187 22 302 0.8927 4.6963 57.1104 18.5649 10.0000616 C16366 1 297 0.0050217 C16378 17 297 0.5948 9.0050217 C16379 19 297 0.6909 0.0057648 C16190 19 302 0.8927 29.0000000 C16242 15 303 0.0116 0.0825 8.0122 16.8314 0.7971 0.5820 0.8927 0.6986 7.9050 9.5948 9.8634 3.0728 8.0018174 T16092 3 258 0.3833 9.3231 0.4568 0.5720 17.0165239 C16186 17 302 0.9050 5.0041 7.5293 0.6963 7.2475 0.5661 0.6847 16.0000328 C16099 14 258 0.8634 4.0480 17.0000 7.0194927 G16118 7 560 0.Ergebnisse Tabelle 26.0000000 C16173 3 302 0.0081274 T16249 3 303 0.0058953 C16259 25 303 0.0004957 C16394 15 297 0.0232 0.0345 0.0079952 G16336 4 576 0.0078 7.0084742 T16224 8 583 0.0000000 G16319 6 576 0.1943 0.0405604 G16273 0 303 0.0183115 C16150 15 302 0.2911 5.0033 8.4354 5.0024681 C16221 35 583 0.0572 8.4168 0.5471 0.8634 5.0122 0.0089571 C16375 24 297 0.0572 8.0082600 G16213 5 605 0.0057648 C16184 15 302 0.8634 4.6847 7.8634 22.0018174 T16094 3 258 0.0122 0.0099 8.4559 0.6963 7.7041 0.5720 4.7254 0.0718 0.9050 4.6224 0.0159938 T16311 9 576 0.0139 16.8927 4.1905 0.0428758 C16114 14 258 0.1905 5.0018174 C16095 19 258 0.1641 0.0011949 G16033 1 245 0.0116 0.0808 8.0137 1.8634 11.4354 5.8927 8.5720 5.1905 5.7166 7.8716 0.0000102 C16188 23 302 0.7166 6.0073291 T16090 3 258 0.0156 1.7254 0.0016970 G16346 8 576 0.0495 8.8285 0.0392800 C16185 16 302 0. np Y Mutationen Y Linien G16000 1 245 0.8716 0.3296 0.0488995 A16183 3 302 0.9591 0.0099 0.0104 16.0069 16.0099 0.0481484 T16298 5 600 0.0600 17.0171228 C16133 26 560 0.0464 16.0116 0.0563 8.7166 4. Hot & cold spots von np 15997 – 16410.0572 8.0495 8.0051430 T16406 3 297 0.0125 16.1317 0.3280 44.7254 0.3296 0.8036 0.5948 9.0199441 T16126 4 560 0.0505 8.0514 0.8285 0.5720 5.0099 8.0052 0.8788 0.5927 0.0000153 C16222 28 583 0.0405604 G16244 2 303 0.0333185 A16399 3 297 0.0083 1.0209666 C16040 0 245 0.7166 7.5649 10.7166 7.0392800 T16172 7 302 0.4568 0.0083 17.0497 8.0000021 T16189 3 302 0.4701 0.0116 0.0021047 G16303 7 576 0.0736 7.0762 8.0303234 T16356 4 297 0.0543 7.0209666 T16002 3 245 0.0034 8.7166 26.0530 8.0050217 C16377 17 297 0.8634 19.0000002 C16376 17 297 0.7166 12.0099 0.0629 8.5948 9.7254 0.8927 7.2487 0.3441 32.8634 6.9050 7.8716 0.1003 0.8927 5.

Deaminierungsrate Dnp der einzelnen Basen.h. Zugrunde liegt die prozentuale reduzierte. d. 0 1 2 3 4 5 6 7 8 15997 16002 16007 16012 16017 16022 16027 16032 16037 16042 16047 16052 16057 16062 16067 16072 16077 16082 16087 16092 16097 16102 16107 16112 16117 16122 16127 16132 16137 16142 16147 16152 16157 16162 16167 16172 16177 16182 16187 16192 16197 16202 16207 16212 16217 16222 16227 16232 16237 16242 16247 16252 16257 16262 16267 16272 16277 16282 16287 16292 16297 16302 16307 16312 16317 16322 16327 16332 16337 16342 16347 16352 16357 16362 16367 16372 16377 16382 16387 16392 16397 16402 16407 Ergebnisse .138 Abbildung 32. Verteilung der hot und cold spot Positionen der Typ I und II Transitionen innerhalb des Bereichs von np 15997-16409. nur auf Typ I und II bezogene.

K und T) fanden sich sowohl in der LBK als auch in der Körös-Kultur. H. wurde zunächst die Verteilung der bestimmten Hgs auf der Ebene der assoziierten Kultur dargestellt (Abbildung 33).4 Vergleichende Analysen der Haplogruppenverteilung In die Analyse der Haplogruppenfrequenzen und deren Verteilung flossen die eindeutig bestimmten Proben der begleitenden Arbeiten von Guido Brandt (2005) und Marc Tänzer (2005) mit ein. 139 . Daraus ergab sich eine Stichprobe von 26 Individuen der LBK. Die übrigen Haplogruppen (J. Polen und Russland. LBK/AVK % Körös Nordost 100 90 80 70 60 50 40 30 20 10 0 U3 V N9a D4a I J H* HV K T W N1a U5 Abbildung 33. 10 Individuen der Körös-Kultur und sechs Individuen der Sammelkategorie „Nordost“ (s. D4a). einem Individuum der AVK. die heute nur in Asien vorkommen (s. HV. Da nur eine Probe der AVK-Kultur untersucht wurde und diese zudem kontemporär zur LBK zu sehen ist. Demgegenüber fanden sich unter der Stichprobe LBK auffallend viele Individuen mit der Hg N1a. Hierbei ließen sich einige Unterschiede zwischen den Kulturen bzw. Stichproben feststellen.u. Es wurden nur Haplogruppen aufgetragen.3).u. W und V waren jeweils einmal in der LBK-Stichprobe vertreten. Alle sechs Individuen der Sammelkategorie „Nordost“ zeigten ausschließlich Haplotypen. Die Haplogruppen U3. Anteil der Haplogruppen in den unterschiedlichen frühneolithischen Kulturen. wurde diese zur Stichprobe der LBK zugeordnet. So fanden sich unter der kleinen Stichprobe von zehn Individuen zwei Haplotypen (N9a. die Hg U5 zugehörig sind.). Die Stichprobe „Nordost“ umfasst alle Proben aus Litauen. die innerhalb der neolithischen Stichprobe typisiert wurden (Die exakten prozentualen Werte sind in Tabelle 10.6 im Anhang aufgeführt). U5. 2. die nicht in der Körös-Kultur auftraten. Da aus archäologischer Sicht die Beziehung der LBK zur Körös-Kultur von vordergründigem Interesse ist (Kap. die anderen Kulturstufen zuzuordnen sind.Ergebnisse 6.).

4% (vier Individuen). Verteilung der Haplogruppen der neolithischen Stichproben der LBK/AVK und der Körös-Kultur mit dem auf heute übertragenen Verbreitungsgebiet. in der Körös-Kultur mit 30% (drei Individuen) und im heutigen Gebiet mit 43% vertreten ist. Auffallend war ebenfalls die relativ hohe Frequenz der Hg U5 (10. Kap. Es wurden nur Haplogruppen aufgetragen. 140 .Ergebnisse LBK/AVK % Körös Heutiges Gebiet 45 40 35 30 25 20 15 10 5 0 U3 V N9a D4a I J H* HV K T W N1a U5 Abbildung 34.3%) im heutigen Referenzgebiet. dagegen in der LBK/AVK-Stichprobe jeweils einmal vertreten und bleiben auch im heutigen Referenzgebiet unter einer Frequenz von 5%. Der Vergleich der Haplogruppenfrequenzen der neolithischen Stichprobe mit den Stichproben der Referenzgebiete A und B (vgl. K. Der Vergleich der Frequenzen der Haplogruppen der frühneolithischen Kulturen ist in Abbildung 34 aufgetragen. T und I ein umgekehrtes Verhältnis. W und U3 waren unter den Individuen der Körös-Kultur nicht. Dagegen zeigten die Hgs HV. 3. dass es sich sowohl bei der Hg N1a der LBK-Stichprobe als auch bei den asiatischen Hgs N9a und D4a der Körös-Kultur um Ausnahmen der jeweiligen Kulturen handelte (vgl.6 im Anhang aufgeführt). Am deutlichsten ließ sich diese an der Hg H festmachen.3). da diese bei beiden frühneolithischen Kulturen häufiger zu finden waren als bei Individuen des heutigen Referenzgebiets. Aus dem Vergleich der neolithischen Proben mit der heutigen Situation innerhalb desselben Gebietes wurde ersichtlich. wohingegen Hg U5 nicht bei den Stichproben der Körös-Kultur und lediglich einmal bei unter Individuen der LBK/AVK auftrat. wenngleich der höhere Wert der Körös-Stichprobe (10%) durch die geringe Stichprobenzahl (n=1) relativiert wird.3) ist in Abbildung 35 dargestellt. 5. Die Hgs V. Kap. die innerhalb der LBK-Stichprobe mit 15. Eine Zunahme der Frequenz war auch für Hg J und U5 festzustellen. Zudem war eine Dynamik innerhalb der übrigen Haplogruppen feststellbar. die innerhalb der neolithischen Stichprobe typisiert wurden (Die exakten prozentualen Werte sind in Tabelle 10.

2000) als neolithisch datiert wurden (vgl.2. Die Hgs J und T1. 3. Weitere höhere Frequenzen in der neolithischen Stichprobe fanden sich bei den Hgs K (11. Hg H war in beiden Stichproben deutlich weniger häufig (<25%) als im heutigen Gebiet der LBK/KörösKultur (> 40%). 4. mit einer Ausnahme für die untersuchten Proben der Region nördliches Osteuropa stand. Hg HV jedoch zeigte mit ~9 % eine höhere Frequenz als in Referenzgebiet A. 141 .9%). wie bereits erwähnt. Die asiatischen Hg N9a und D4a der Stichprobe der Körös-Kultur waren in keiner der beiden modernen Stichproben zu finden.2).3%) und U5 (16.76%) bzw. wobei letztgenannte Hg.3%) in der neolithischen Gesamtstichprobe deutlich vom Referenzgebiet B des Nahen Ostens und des Kaukasus und vom auf heute übertragenen Verbreitungsgebiet (A) der frühneolithischen Kulturen abhebt. gar nicht (Hg T1) vertreten. die von Richards (et al.Ergebnisse Hieraus wurde erneut ersichtlich. dass sich Hg N1a mit einer hohen Frequenz (14. Kap.7%). T (14. Ähnlichkeiten zwischen der neolithischen Stichprobe und dem Referenzgebiet Nahost/Kaukasus war bei den Frequenzen der Hg H und HV festzustellen. waren in der neolithischen Stichprobe nur sehr gering (Hg J.

142 .0% 5% 10% 15% 20% 25% 30% 35% 40% 45% A B C D E F H HV Ref A LBK/Körös heute I J K L M N* N1a R T* T1 Ref B Nahost+Kaukasus U* U3 U5 V W X Neolithikum div Ergebnisse Abbildung 35.7 im Anhang aufgeführt). (Die exakten prozentualen Werte sind in Tabelle 10. Vergleich der Haplogruppenfrequenzen der neolithischen Gesamtstichprobe mit den entsprechenden heutigen Referenzgebieten in Europa und im Nahen Osten.

Die Individuen HAL2 und UWS5 lagen auf bislang undokumentierten aber vorhersagbaren Nodien. die sich durch bestimmte Mutationen voneinander unterscheiden ließen (Abbildung 36). Identische Haplotypen mit Individuum DEB1 fanden sich im modernen Datensatz bei einem Individuum aus Armenien (Richards et al. VAI3 (U3). Aus dem Netzwerk von 101 N1a Haplotypen wurde ersichtlich. Mitteilung). Metspalu et al. Die Individuen DEB1. SCHWE4 (H) dargestellt. 2000) und einem Ägypter (Krings et al. H7 als auch H* zu finden war (Loogväli et al. 2004). wurde sie bei weiteren Untersuchungen in den Vordergrund des Interesses gerückt. So konnte ein afrikanischer Zweig durch die charakteristische Position 16147G von dem europäischen und dem zentralasiatischen Zweig unterschieden werden. 1995. H5.Ergebnisse 6. Mitteilung). ECS1 (alle N1a). (Für SCHWE4 wurde kein Netzwerk erstellt. persönl. 2000. dem russischen Tschawasch (Bermisheva et al. Der zentralasiatische Zweig unterschied sich weiterhin durch die Position 19189C vom europäischen Haplotyp. Der Haplotyp der Individuen DEB3 und FLO1 fand sich insgesamt 13-mal bei Individuen aus dem Iran (Richards et al. Alle neolithischen Individuen. der Slowakei (Koledová 2005). Turkmenistan (Quintana-Murci et al. Richard Villems. da die entscheidende HVR I Mutation np 16304 innerhalb der sehr großen und häufigen Hg H eine wiederkehrende Mutationen darstellte und daher auf dem Niveau der Sub-Hgs von H sowohl bei H1*. 1999). zwei Individuen aus Jemen (Kivisild et al. 143 . Russland (Richard Villems. 2004) und die nähere phylogenetische Auflösung der Hg H zum Zeitpunkt der vorliegenden Arbeit noch Gegenstand der aktuellen Forschung ist. LEB1 (U5). 2004). die bislang undokumentiert waren.5 Netzwerke Im Folgenden sind die Netzwerke der einzelnen Haplogruppen für fünf der sechs neolithischen Proben HAL2. persönl. welche die Mutation 16147A aufwiesen. 2004). 2004) sowie fünf Individuen aus Estland (Sajantila et al.) Da die Hg N1a im Vergleich mit Rezentdaten der europäischen Bevölkerungsgruppen durch die hohe Frequenz aufgefallen war und zudem drei Haplotypen aufwies. für die keine 100%-ige Übereinstimmung des Haplotyps in der Literatur gefunden wurde (Abbildungen 36-39). DEB3 und FLO1 belegten die zentralen Nodien des Netzwerks. waren im europäischen Zweig zu finden. mit Ausnahme des Individuums ECS1. dass die Hg N1a eine phylogeographische Verzweigung aufwies. UWS5.

2000. 2005). 2004. 1999.nih. Helgason et al. Kreisausschnittsgrößen entsprechen proportional den jeweiligen absoluten Häufigkeiten. 2003. Mountain et al. Die Kreis.sowie Parallelmutationen sind kursiv wiedergegeben. Bermisheva et al. unpublished data. 2004. Babalini et al. 2003. südwestasiatische Zweig (grün) enthält N1a Haplotypen. Die Probe ECS der ungarischen AVK-Probe ECS1 ist ebenfalls noch undokumentiert. Rück. wohingegen der europäische Zweig (blau) und dessen zentralasiatischer Zweig (orange) durch np 16147A definiert sind. Watson et al. Sajantila et al. Brehm et al. 2004. Opdal et al. Baig et al.html. 2004. Lahermo et al. Knight et al. Tambets et al. 2001. 1995. Quintana-Murci et al. 1998. Estonian Biocentre Database 2005. 2000. Kivisild et al 1999. 2005. Calafell et al. 2000. 2002. 2001. 2000. Ricaut et al. Poetsch et al. 2003.ncbi. 2003. Forster 1996. N1a: Röhl et al. Richards et al.gov/Genbank/index. 1999. Villems. Koledová 2005. wovon sich zwei der Proben (UWS5 und HAL2) auf bislang nicht dokumentierten. 1995.Ergebnisse Abbildung 36. Krings et al. Pfeiffer et al. aber vorhersagbaren Nodien befinden.bzw. 2003. 2002. 2004. http://www. Der afrikanische bzw. 2005.nlm. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg N1a (umgezeichnet nach Haak et al. Das Netzwerk lässt sich durch drei phylogeographische Zweige beschreiben. Die neolithischen Proben sind rot dargestellt. 1996.. Metspalu et al. welche farblich hervorgehoben sind. 1997. Pakendorf et al. 2001. 144 . Passarino et al. die durch np 16147G charakterisiert sind. Pereira et al. Derenko et al. Kivisild et al.

Die neolithische Probe SZA23 1 ist schwarz dargestellt. 2004. 2000b. Kreisausschnittsgrößen entsprechen proportional den jeweiligen absoluten Häufigkeiten. 2004. Wen et al. 2005. 2004). Behar et al. Mitteilung). 1981).315 Jahren mit einer hohen Standardabweichung von 10. Estonian Biocentre Database. Datenbanken entnommen: Richard Villems. 145 .Ergebnisse Durch das Netzwerk der Haplotpyen der Hg N9a (Abbildung 37) konnte gezeigt werden. 2001. Die Kreisbzw. eine Usbeke (Quintana-Murci et al. Kivisild et al. Fucharoen et al.751 Jahren. Die modernen N9a Haplotypen sind folgender Literatur bzw. 2002a. Quintana-Murci et al. 2004. 2004. 2002. Die Mutationen entsprechen der CRS –16000 (Anderson et al. die den identischen Haplotyp aufwiesen: drei Han-Chinesen (Yao et al. 2002b).75 und ein Alter von 35. 1996. Die Koaleszenzzeitberechung für das gesamte Netzwerk ergab einen u-Wert von 1. Abbildung 37. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg N9a. Die weitgehend sternförmige Struktur des Netzwerks wies zudem auf eine vergleichsweise junge Expansion der Hg N9a ausgehend von dieser zentralen Nodie hin. ein Miao-Chinese (Wen et al. Yao et al. persönl. Horai et al. Insgesamt konnten sieben Individuen gefunden werden. unpublizierte Daten. dass der Ht 16223 16257A 16261 des neolithischen Individuums SZA23 1 der Körös-Kultur der zentralen Nodie des Netzwerkes entspricht. Tanaka et al. 2005) sowie ein Uighure und ein Kirgise (beide Richard Villems.

2005. Das Netzwerk der Hg U3 zeigte eine sternförmige Struktur.72 4616. Brehm et al. 1981). unpublizierte Daten. Lutz et al. Form (Mutationen) Innerer Kreis (1) Äußerer Kreis (2) Gesamtes Netzwerk [-Wert 0. Koaleszenzzeitberechnungen für die Verbreitung der Hg U3. dass die Verbreitung der Hg U3 im Vergleich zu anderen Hg relativ rezent erfolgte. Estonian Biocentre Database.Quintana-Murci et al. . 2000. Behar et al. 146 . Passarino et al. Die Kreis.2009 Jahre 10362. 2004.905 1.87 Abbildung 38. Dieser Ht 16343 stellt auch die anzestrale Form der Hg U3 dar. 2004. 2004. Richards et al. 2003. Pfeiffer et al. Die Mutationen entsprechen der CRS –16000 (Anderson et al. Die Datierungen der Hg U3 sind in Tabelle 27 dargestellt. Palanichamy et al.10 5046.22875 0. Babalini et al. 2004.bzw. 2002.25009 SA in Jahren 3197.51351 0. 2003. Kivisild et al. Crespillo et al. Al-Zahery et al. Die modernen U3 Haplotypen sind folgender Literatur bzw.Ergebnisse Aus dem Netzwerk der Haplogruppe U3 aus 234 Haplotypen moderner Daten wurde ersichtlich. Metspalu et al. Maca-Meyer et al.6 Standardabweichung 0.9 24233. Kreisausschnittsgrößen entsprechen proportional den jeweiligen absoluten Häufigkeiten. 2003. Koledová 2005. dass das Individuum VAI3 eine abgeleitete Variante des zentralen und heutzutage häufigsten Haplotypen 16343 darstellte (Abbildung 38). 1998. 2000.15846 0. von welcher sich VAI3 durch eine weitere Mutation an np16319 unterschied. 2001. Pereira et al. die darauf schließen ließ. Tabelle 27. 2000. Die neolithische Probe VAI3 ist schwarz dargestellt.7 18262. 1999. Poetsch et al. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Haplogruppe U3. Datenbanken entnommen: Villems.

In Abbildung 39 ist der Ausschnitt der beiden Sub-Hgs U5a1 und U5a dargestellt. Die Nukleotidpositionen entsprechen der revidierten CRS (Andrews et al. CHE4 und BRU4 sind schwarz wiedergegeben. Abbildung 39. in Vorbereitung). Die proportionalen Anteile der Proben LEB1. 1999). Aus dem Netzwerk wurde die phylogenetische Stellung der beiden mesolithischen russischen Individuen CHE4 und LEB1 und des linearbandkeramischen Individuums BRU4 ersichtlich. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg U5 (modifizert nach Bramanti et al. 147 .Ergebnisse Das Netzwerk der Haplogruppe U5 wurde innerhalb eines Parallelprojekts der Arbeitsgruppe in Kooperation mit der Arbeitsgruppe des Estonian Biocentre erstellt. Insgesamt wurden ~9300 Haplotypen der Hg U5 untersucht. Diagnostische Mutationen der coding region sowie außerhalb der HVR I sind in eckigen Klammern dargestellt.

dass sich unter drei weiteren meso. Darüber hinaus endeten 95% der Läufe mit einer Anzahl von 119 bis 259 N1a Individuen in der simulierten modernen Stichprobe. dass die angenommene Migrationsrate von 1% pro Generation nicht ausreicht. Bei zwei weiteren bronzezeitlichen Individuen aus Litauen wurden andere Haplotypen (H und T2) festgestellt. 148 .5) ergaben. um die niedrige moderne N1a-Frequenz zu erklären. dass unter den 2300 Individuen der heutigen Vergleichsbevölkerung des linearbandkeramischen Referenzgebietes mindestens 74 Individuen der Haplogruppe N1a zu finden sein müssten. in Vorbereitung).6 Populationsgenetische Simulation mit Hilfe des Programmes Simcoal 2. die im Rahmen einer von Barbara Bramanti parallel durchgeführten Studie der Arbeitsgruppe untersucht wurden. der insgesamt 123 mal in der modernen Stichprobe der Hg U5 vertreten war (Bramanti et al. ebenfalls zwei Individuen der Hg U5 und eines der Hg U4 befanden.0 Die Ergebnisse der Simcoal Simulationen (Kap. 5. soll hier angefügt werden. da nur 5. 6.5% aller Läufe mit einer Anzahl unter sechs Individuen endete. Die Simulationen unter Zulassung von Migrationsereignissen zeigte. Da es für die nachfolgende Diskussion von Interesse ist. Der Haplotyp des Individuums BRU4 fand sich insgesamt 16-mal in europäischen Populationen. Der Haplotyp des Individuums CHE4 konnte jeweils noch einmal in einer deutschen und einer tschechischen modernen Stichprobe gefunden werden.und neolithischen Individuen aus Polen und Litauen. dass die moderne europäische Bevölkerung des LBK/AVK-Gebiets direkte Nachfahren der neolithischen Individuen sind und die geringe N1a-Frequenz durch genetische Drift entstanden war. dass die Probe LEB1 bislang undokumentiert war und sich durch eine Transversion an np A16241C von dem häufigen anzestralen Haplotyp U5a1 unterschied.Ergebnisse Es konnte gezeigt werden.3. konnte abgewiesen werden. Die zugrunde liegende Hypothese.

Bereits die ersten aDNA-Analysen wiesen auf die starke Fragmentierung sowie post mortem Schädigung der DNA hin. Ausschlusskriterien eingeschränkt werden kann. der sich in den Daten der vorliegenden Arbeit aus mindestens acht unabhängigen Versuchen berechnen lässt. Aus Abbildung 23 wird deutlich.2) werden.1.h. In dieser Hinsicht entspricht mit Ausnahme des Fragments IV die Zunahme des allgemeinen Amplifikationserfolgs bei gleichzeitiger Abnahme der Produktlänge den Erwartungen bzw. Höss et al. sofern die Klonsequenzen in der Gesamtansicht keine Zeichen von kontaminierenden Linien zeigen. er korrelierte negativ mit der zu erwartenden Produktlänge der Allele. welche demnach lediglich eine Amplifikation von DNA-Fragmenten im Bereich von 100-500bp ermöglicht (Pääbo 1989.3. Willerslev & Cooper 2005). Pääbo et al. ASP2 und DEB1 anzunehmen (vgl. Im Folgenden soll daher die Diskussion der einzelnen Methoden bzw.1. 2004 bzw. Kap. darstellen Gleichzeitig ist im Bereich humaner alter DNA der Bearbeiter selbst .6. 3. 6. Kap. 1996b. Kap. Pääbo et al. Auch bei der Amplifikation der einzelnen loci der STRS war der generelle Amplifikationserfolg theoriekonform. Der Amplifikationserfolg einer Probe. siehe auch aktuelle Reviews von Mitchell et al.als methodenimmanentes Risiko zu betrachten. dessen mögliche (passive) Beeinträchtigung von Ergebnissen nur durch aufwändige Arbeitsstrategien bzw. d. vgl. Methodendiskussion Die postmortale Labilität der DNA-Moleküle stellt für die Analysen alter DNA ein zentrales methodisches Problem dar. Willerslev & Cooper 2005. nicht automatisch 100% beträgt bzw. HAL1.als Kontaminationsquelle . den bisherigen eigenen Erfahrungen (appropriate molecular behaviour nach u. liefert.1 Amplifikationserfolg Es lässt sich anhand der gewonnenen Ergebnisse beobachten. 1994. a. KRE2. dass der Amplifikationserfolg bei Proben. Finden sich jedoch Anzeichen für Kontaminationen kann der prozentuale Wert des Amplifikationserfolgs nur noch als Annäherungswert dienen. bei höherem Anteil an 149 . Dies ist vor allem für die Proben SZA23 1. Handt et al. Abbildung 20).1.2). 6. Punkt 3: theoriekonformes Verhalten degradierter Moleküle).Diskussion 7. höher liegt als dieser Wert bei unkontaminierten Proben. 2004. 7. 7. einen deutlichen Hinweis auf die Erhaltung von endogener Proben-DNA im Rahmen der Fragmentlängen der untersuchten PCR-Produkte (vgl. 7.1. dass der Amplifikationserfolg deutlich negativ mit Zunahme der Produktlänge korreliert (Kap. dass eher das Gegenteil der Fall ist. DEB4. die kontaminierende Sequenzen aufweisen. Erstaunlicherweise zeigt sich.1).h.1. der angewandten Strategien vor der Diskussion der Einzelergebnisse einer jeweiligen Probe im Gesamtansatz geführt (Kap. Diskussion 7. 2005. d.

dass ab einem bestimmten Schwellenwert des Amplifikationserfolgs (hier 50%) nicht mehr mit dem Erhalt von authentischer endogener DNA zu rechnen ist.1. Huminsäuren die PCR ebenfalls beeinflussen.B.1. Bollongino 2005. In beiden Fällen kann davon ausgegangen werden. Weiterhin denkbar wäre. Biomolekülen wird damit den Authentizitätskriterien der aDNA-Forschung entsprochen (vgl. Kap. Möglicherweise kann daraus gefolgert werden. dass die PCR-Produkte eine mosaikartige Verteilung von Mutationen aufweisen. dass auch die kontaminierenden DNA-Moleküle durch die „DNA-feindlichen“ Maßnahmen der Kontaminationsvermeidung (Kap. SZA23 2. dass nur 10. 6. um festzustellen. die eine Amplifikation aufgrund zahlreicher Strangabbrüche inhibieren. aber in ausreichender Menge vorliegt.1.Diskussion kontaminierenden Sequenzen ist auch eine Abnahme des Amplifikationserfolgs zu beobachten (Kap. DON1) und schlecht erhaltenen.1 wird ersichtlich.6. so dass die Amplifikation von wenigen intakten Molekülen sowohl der endogenen DNA als auch von wenigen kontaminierenden DNA-Molekülen einfachen stochastischen Wahrscheinlichkeiten unterliegt. dass der allgemeine Amplifikationserfolg dem „Alles oder Nichts-Prinzip“ folgt. Dies bedeutet. welche indirekt einen Anhaltspunkt für die Erhaltungsaussichten von Biomolekülen liefern sollten (vgl.1. So genannte spiking Experimente. kann nur erahnt werden. wurden nicht vorgenommen (Pusch & Bachmann 2004. 6. 2004b).3). dass 75% der Proben einen Amplifikationserfolg von 75% und deutlich höher aufweisen. dass keine endogene DNA mehr vorhanden ist oder mit den verwendeten Fragmentlängen nicht mehr amplifizierbar ist.3. dass der allgemeine Amplifikationserfolgs abrupt abbricht. Kap.B. ob dieses auch die Amplifikation ausreichend intakter DNA beeinflusst. 6 % der Proben einen Amplifikationserfolg unter 50% bestätigt die Beobachtung. 3. Mit einem simultanen Test auf Erhaltung von Makro. was gleichermaßen einen raschen Abbruch des Nachweises von DNA suggeriert. Ob andere mögliche Koextrakte wie z.1) ebenfalls fragmentiert vorliegen bzw. Es lässt sich generell feststellen.1).bzw. weniger gut (SON1) oder gar nicht amplifizierbaren Proben (SWI 6) 150 . Punkt 7: Biochemischer Erhaltungszustand). Serre et al. bei welchen ein PCR-Ansatz rezenter Kontroll-DNA mit variierenden Konzentrationen eines fraglichen inhibierenden Extraktes versetzt werden.2 SAXS-Analyse Ergänzend zum Amplifikationserfolg können die Ergebnisse der nichtgenetischen SAXSAnalyse angeführt werden.2. dass in den meisten Fällen mitochondriale DNA entweder gut erhalten und amplifizierbar oder aber keine DNA mehr vorhanden war. Die Klonsequenzen des Beispiels DUD1 (47. dass die endogene DNA in stark fragmentiertem und modifiziertem Zustand. depurinierte oder dimerisierte Positionen aufweisen. die größtenteils als sporadische Amplifikation von Hintergrundkontaminationen zu deuten ist. 5. konnte daher aus einem Spektrum an gut erhaltenen und amplifizierbaren (z. 6. Die Tatsache. Aus Abbildung 20 in Kap. 7. Da zum Zeitpunkt der Analyse schon Amplifikationsergebnisse vorlagen. Dies lässt sich möglicherweise dadurch erklären.6%) zeigen. SEE 1.

wo die jeweiligen Schwellenwerte für betreffende Aussagen liegen.2.1 anzumerken. wie sie durch die post mortem Deaminierung von Cytosinen entstehen. welcher der Kristalldicke entspricht. dass sowohl Struktur und Größe der Kristalle im Knochen Hinweise auf möglichen Erhalt von endogener DNA im jeweiligen Abschnitt geben können. Da nach angegebenem T-Wert (5. mehr degradierte Vergleichsdaten und vor allem auch mindestens drei moderne Referenzen unterschiedlichen biologischen Alters (z. Die Daten zur kristallinen Struktur der Knochenmatrix sowie zur durchschnittlichen Größe derselben bestätigen weitestgehend die Ergebnisse.B. dass es sich hierbei nicht um endogene DNA des Knochens handelte.51nm) ein Amplifikationserfolg nicht zu erwarten wäre. sowohl der visuellen Einschätzung des Erhaltungszustand nach Konsistenz (und Farbgebung) als auch der Amplifikations. Für sie liegen zwar Amplifikationserfolge vor. die bei der Hitzedenaturierung der PCR den betreffenden Strang fragmentieren. ob anhand des gezeigten Datensatzes eindeutige Korrelate vorliegen bzw. die aus einer dieser Arbeit angeschlossenen Untersuchung entstammt. ASP2.3.B. die Probe SWI6 des niederländischen Fundortes Swifterbant nicht erfolgreich amplifiziert werden (Abbildung 21 und 24). Dasselbe ist für die Probe UNS1. von echten Mutationen unterscheiden zu können.5). Im Rahmen der Datenauswertung der vorliegenden Arbeit kann jedoch auch 151 . Fragmente III und IV im Anhang unter Kap. allerdings sprechen diese für eine mögliche Kontamination der Probe. Darüber hinaus können die weiteren Fragen.3 Verwendung von UNG Der Einsatz von UNG in der PCR-Reaktion war zu Beginn der vorliegenden Arbeit dafür vorgesehen.4. juvenil . So kann aus den vorliegenden Werten (Kap. kann davon ausgegangen werden. Reproduktionserfolge. In der Tat kann bei der Verwendung von UNG eine starke Reduzierung der G/CaA/T Basensubstitutionen beobachtet werden (z.adult/matur – senil) nötig sind. und die Sequenzanalyse der Probe ebenfalls auf eine Kontamination hindeutet. 6. Die Ergebnisse der SAXS-Analyse zeigen. Dies ermöglichte eine bessere Einschätzung der Ergebnisse der SAXSAnalyse.B. so dass dieser nicht mehr zur weiteren Amplifikation zur Verfügung steht (vgl. UNG entfernt das zu Uracil deaminierte Cytosin aus dem DNA-Doppelstrang und schafft somit einzelsträngige Lücken. Allerdings erlaubt die SAXS-Analyse nicht. Daher kann hier postuliert werden. 7. Ein Vergleich mit parallel untersuchten Rinderproben zeigt. 2001).Diskussion ausgewählt werden. nicht beantwortet werden. siehe Abbildung 25).1.1. die mehr als nur deskriptiver Art sein sollen. artifizielle Basensubstitutionen. welche durch eine hohen vWert von den anderen Proben abweicht. Kap.2) nicht auf das Vorhandensein von nukleärer DNA wie bei Probe SZA23 geschlossen werden. aus den indirekten Daten (Struktur und Größe der Kristalle) auf die Quantität und Qualität der DNA zu schließen.bzw. Ähnliches gilt für die Probe SON1. dass vor allem die modernen Proben eine große Streubreite hinsichtlich der Indices aufweisen (welche letztlich vom biologischen Alter des Individuums abhängig ist. 5. dass für Aussagen. So konnte z.2 und Hofreiter et al. Im Vergleich mit anderen Proben fällt SWI6 durch eine höheren T-Wert auf. 10.

wonach einmal mehr die Verwendung von UNG in Frage gestellt wird. dass es bei der Klonierung von PCRProdukten nur dann zum scheinbar konsistenten Durchschlag von post mortem entstandenen Mutationen kommt.3. sofern eine dezidierte Reproduktionsstrategie verfolgt. eine fragliche Nukleotidposition mindestens zweimal unabhängig reproduziert wird und zudem eine Klonierung der PCRProdukte erfolgt. Sequenzen finden sich in den mit UNG amplifizierten PCR-Produkten der Individuen SCHWE4. als kontaminierend bestimmte.h. war eine für den Sequenzhaplotyp bestimmende Position fraglich. dass die angewandten Strategien der Reproduktion sowie die Klonierung der PCR-Produkte ausreichend sind. Zudem weist Hofreiter darauf hin. Somit kann festgehalten werden. Im Zuge der Interpretation der hier gewonnenen Ergebnisse lässt sich sagen. Die mit UNG behandelten PCR-Produkte der Probe SCHWE2 und UNS2 zeigen kontaminierende Sequenzen des Bearbeiters. dass die Verwendung von UNG zur Lösung von unklaren Nukleotidpositionen nicht nötig ist. bei welchen durch gezielte Primerwahl die vornehmlich menschliche Hintergrundkontamination ausgeschlossen werden kann und eine Klonierung der PCR-Produkte nicht notwendigerweise immer durchgeführt werden muss (vgl. Weitere. Bei SCHWE1 zeigt das UNG-PCR-Produkt von Fragment I der Extraktion B kontaminierende Sequenzen. In keinem der 42 Fälle.Diskussion gezeigt werden. welche allesamt eine vergleichbar geringe Ausgangmenge an endogenen Molekülen aufweisen. wenn die Ausgangszahl an endogenen Molekülen in der PCR sehr gering ist. d. Dies lässt sich im vorliegenden Datensatz an mehreren Beispielen u. 7. Bereits Hofreiter und Kollegen (2001) stellen fest. Bollongino 2005). in welchen eine Haplogruppe eindeutig bestimmt werden konnte. Somit lässt sich insgesamt die Hypothese Hofreiters bestätigen. Wie die Auswertung der Daten im Hinblick auf hot spot Mutationen zeigt (Kap. Dabei erhöht sich zusätzlich die Wahrscheinlichkeit. so dass sie durch eine nachgeschaltete weitere Amplifikation mit UNG entschieden werden musste. a. 152 . dass bei der Verwendung von UNG in solchen Fällen gleichzeitig die Gefahr besteht. im Rahmen der angewandten Reproduktionsstrategie ist es jedoch sehr unwahrscheinlich. Ein mögliches Einsatzfeld bleiben aDNA-Analysen tierischer Proben.2 und 11). sind zwar einige der definierten hot spots auch für die Bestimmung von Haplogruppen von Bedeutung. der Schwetzinger Stichprobe zeigen (vgl. dass wenige Moleküle einer bestehenden Hintergrundkontamination aufgrund ihres intakten Zustandes bevorzugt amplifiziert werden. dass genau die betreffende Position mehrfach unabhängig bestätigt wird.3). 5. die letzten endogenen DNA-Moleküle von der Amplifikation auszuschließen. dass der Einsatz von UNG für zukünftige aDNAStudien an menschlichen Proben aufgrund der großen Gefahr der gezielten Verstärkung der Hintergrundkontamination nicht empfohlen werden kann. Kap. SEE1 und SON1. um echte Mutationen von post mortem entstandenen Basensubstitutionen zu unterscheiden.

hängt in erster Linie vom Arbeitsschritt ab. Zwar kann durch die vorgestellten Maßnahmen zur Kontaminationsvermeidung das Ausmaß eingeschränkt und zudem können einige Formen der Kontamination größtenteils logistisch vermieden werden. nicht genauer eingegrenzt werden. Reagenzien. wobei im Falle einer begleitenden Kontamination abweichende Sequenzen meist nur in einem Fragment.4 Kontaminationen. dass sich nur die wenigsten kontaminierenden Sequenzen eindeutig zuordnen lassen. Letzteres ist z. Anhand der errechneten Kontaminationsrate lässt sich jedoch im Vergleich feststellen.h. die sich in anderen Fragmenten nicht wieder finden bzw.B. 5. 6. In seltenen Fällen ist eine eindeutige Bestimmung einer kontaminierenden Linie und somit eine direkte Identifizierung der Kontaminationsquelle möglich (z. Entscheidend ist jedoch. stets zu rechnen. Inwieweit sich diese Form der Kontamination reproduzieren lässt. Weiterhin lässt sich feststellen. verfolgen lassen. Es lässt sich insgesamt feststellen. Dies wird darin deutlich.1. d.B. dass in den Fällen DEB2. nur bei der stark kontaminierten Probe DON2 der Fall. UNS2. DEB2. dass diese Form der Kontamination durch den Bearbeiter sich deutlich stärker niederschlägt. Da sich diese jedoch nicht reproduzieren lassen. Kontaminationsraten und Kontaminationsvermeidung Mit Kontaminationen ist bei der Analyse alter DNA. ein absoluter Ausschluss an Kontaminationen ist im Bereich menschlicher aDNA derzeit nicht denkbar (Kap. FLO6 und SCHWE4 durch weitere Labormitarbeiter). Es lässt sich weiterhin beobachten. BRU4 und UNS2 die Kontaminationsquelle identifiziert und damit ausgeschlossen werden kann.1). selten über mehrere Fragmente hinweg verfolgt werden können. SCHWE4). hauptsächlich auf sporadische Kontaminationen der PCRReaktionen zurückgeführt werden.1. Abbildung 23). d. dass die Rückführung von Kontaminationen zu deren Quelle von der Form und dem Zeitpunkt der Kontamination abhängig ist. sofern sie den 153 .B. FLO6. kann die eigentliche Quelle. DEB5. insbesondere von humaner alter DNA. Kap. dass diese Form der sporadischen.B. Eine Identifizierung eines Probengebers war nur in einem Fall (DON2) möglich. die im Rahmen der Probenvorbereitung nicht eliminiert wurden. wohingegen der Nachweis in mehreren Fragmenten einer Extraktion für eine Kontamination während der Extraktion der DNA oder in hierfür vorbereitenden Schritten sprechen. Prinzipiell ist dies auf die Amplifikation in überlappenden Fragmenten zurückzuführen. So deutet die Kontamination nur eines Fragments auf eine Verunreinigung der PCR-Reaktion hin (z.2.2.Diskussion 7. womit die verbleibenden Ergebnisse.2 sowie Abbildung 22). Kontamination meist unter 15% liegt (vgl. in welchem die Probe kontaminiert wurde. So können Kontaminationen der einzelnen Fragmente. Gefäße oder Spuren weniger DNA-Moleküle. nicht identifizierbaren sowie nicht in der Probe selbst und in anderen Proben reproduzierbaren.h. KRE1). DON1. dass der überwiegende Anteil der beobachteten Kontaminationen durch keine der angewandten Maßnahmen zur Kontaminationsvermeidung erfasst wird. 6.1. In den meisten Fällen ist eine mosaikartige Verteilung von unterschiedlichen kontaminierenden Sequenzen in variierenden Anteilen innerhalb der vier Fragmente zu erkennen (z. BRU4 durch den direkten Bearbeiter bzw. wobei in Rahmen des Vergleichs der Kontaminationsraten Werte um 40% zu beobachten sind (vgl. Kap.

crossing over–Kontaminationen keine Rolle gespielt haben können. Allein die Tatsache. Eine genaue Eingrenzung der Kontaminationsquelle kann jedoch nicht erfolgen. wie sie sich aus zufällig gewählten Probengebern bzw.2 gesondert behandelt. Kap. dass innerhalb der 43 meso. wurde die Verwendung 3 Die Verwendung von UNG bei der Amplifikation von aDNA spielt ebenfalls eine nicht zu unterschätzende Rolle bei der Detektion bzw. die sich jedoch nicht identifizieren lässt. ist in keinem einzigen Fall zu beobachten.3. schließt das Vorkommen von systematischen Kontaminationen im Rahmen des Untersuchungszeitraumes aus.4) gerecht werden.Diskussion Anforderungen der Reproduktionsstrategien (vgl. für die Ergebnisse vorliegen. Punkt 9). Die Verwendung von Tierproben kann im Rahmen dieser Arbeit nur unter Vorbehalt diskutiert werden. Aufgrund der Tatsache. 3. Eine besondere Form der Kontamination stellt die wiederkehrende Beobachtung einer bestimmten DNA-Sequenz im Rahmen der vorliegenden Arbeit dar. 5. Dieser Umstand der hohen beobachtbaren Variabilität kann somit als Beweis dafür gesehen werden. den Probengebern zu finden ist. unter Vorbehalt als authentische DNA angesehen werden können. Kap. Diese Problematik wird in Kapitel 7.3 Als ergänzende Kontrollen für Analysen von humaner aDNA wird seitens der Authentizitätskriterien der aDNA-Forschung die Verwendung von assoziierten Tierfunden vorgeschlagen (vgl. Zudem stammen die Proben von vier verschiedenen Probengebern und wurden zu unterschiedlichen Zeitpunkten bearbeitet. da die Bearbeitungsschritte bis zur Extraktion nicht den kontrollierten Bedingungen der Versuche des Bearbeiters unterlagen. SEE1. Labormitarbeitern ergäbe. UNS2. DEB5 und SCHWE2 beschrieben werden. weder in den Proben noch in den Labormitarbeitern bzw.h. so dass zur Extraktionskontrolle vier Rinderproben der parallel laufenden Arbeit (Bollongino 2005) des gemeinsamen Projekts herangezogen wurden. Eine somit „quasi-systematische“ Kontamination mit genannter Linie kann in den Proben DUD1. Zudem unterscheidet sich auch unter der Annahme von starken Verdünnungseffekten die Zusammensetzung der Hgs in der neolithischen die Stichprobe deutlich von der einer naheliegenden Kontaminationsstichprobe.6. d. Eine systematische Form der Kontamination. wie sie durch den Eintrag von PCR-Produkten denkbar wäre. da die betreffende Position in Sequenzen aus sieben unabhängigen PCR-Reaktionen sowie vier unabhängigen Extraktionen zu finden ist. 154 . wie sie möglicherweise in einer Charge von externen PCRReagenzien vorhanden sein kann.1. 29 verschiedene Haplotypen festgestellt werden konnten. Für die untersuchten neolithischen Individuen konnten keine assoziierten Tierproben der zugehörigen Fundplätze akquiriert werden. Quantifizierung von möglichen Kontaminationsquellen. Möglicherweise handelt es sich in diesem Fall um sehr geringe Spuren einer konstanten Hintergrundkontamination. welche von den laborseitigen Dekontaminationsmaßnahmen nicht erfasst werden können. dass bei der Amplifikation der vier Tierproben einerseits gehäuft positive Signale erhalten wurden und sie nicht direkt mit den untersuchten Fundorten assoziiert sind.und neolithischen Individuen. dass systematische Kontaminationen in Form von carry over bzw. Hierbei handelt es sich um eine kontaminierende Linie mit der charakteristische Position 16309G.

vier PCRs für die Fragmente I und IV und 11 PCRs für Fragment V) eingestellt. dass unter Einhaltung der in Kap. Dies ist in der Praxis allerdings nur in den wenigstens Fällen. bei aktuellen Grabungen.5 Amplifikation langer mtDNA Fragmente und nukleärer DNA (ncDNA) Die Ergebnisse der Amplifikation des langen mtDNA Fragments V. zeigt deutlich. TRE1 und auch BRU4. UNS2.Diskussion derselben als Versuchskontrollen nach wenigen Versuchen (jeweils drei PCRs für die Fragment II und III. und DUD2) und welche aus diesem Grund frühzeitig verworfen wurden. dass die in dieser Arbeit verwendeten Primer nicht auf Ausschluss der Amplifikation von Rinder-DNA getestet wurden. Zum anderen kann die Möglichkeit einer menschlichen Kontamination der Rinderproben nicht a priori ausgeschlossen werden. Dessen ungeachtet ist eine Verwendung von Tierproben als Kontrolle nur dann sinnvoll. Die gehäuften positiven Signale lassen sich zum einen dadurch erklären. In zwei vergleichbaren Fällen (UNS2. BRU4) tritt bei der Sequenzierung des langen Fragments deutlich die kontaminierende Linie des Bearbeiters vor. Der Abgleich der Sequenzierungsergebnisse mit den Sequenzen der kurzen Abschnitte zeigt nur in sieben Fällen eine Übereinstimmung.2. 2005a. Zum anderen kann bei Proben. 2005b). VIE1). wenn sie unmittelbar mit der zu bearbeitenden menschlichen Probe assoziiert ist und unter allen Umständen die identische Behandlung während und nach deren Ausgrabung (post excavation history) aufweist (Gilbert et al.1. d. welche bei der Amplifikation der kurzen Fragmente keine oder nur geringe Amplifikationserfolge aufwiesen (SEE3. Diese Annahme wird zum einen durch die Tatsache bekräftigt. welches der Gesamtlänge des Bereichs der überlappenden vier kurzen Fragmente entspricht.6) valide Ergebnisse erzielt werden können.h. in welchen keine Übereinstimmung vorliegt. dass die Kontaminationsgefahr bei der Bearbeitung von humaner aDNA sehr groß und allgegenwärtig ist. Der Amplifikationserfolg liegt unter 20%. Daraus kann bereits geschlossen werden. wobei dieser Wert aus den nachfolgenden Gründen zu vernachlässigen ist. 7. 5. in den meisten Fällen auch ein reproduzierbares Ergebnis bei der Analyse der nukleären Genorte festgestellt werden (KRE1. Dadurch lässt sich auch der hohe Anteil von 100% positiver Tierkontrollen (drei aus drei Versuchen) in Abbildung 22 relativieren. zu erwarten. dass in den Fällen. die auch zu einem geringeren Anteil innerhalb der Klonsequenzen der kurzen Fragmente zu finden ist. Kap. Im vorliegenden Fall zeigen die erhaltenen Daten allerdings. 2004). SZA23 2. KRE2. Gerade weil bereits in vivo in der Zelle ein ungleiches Verhältnis der Kopienzahl von mtDNA und ncDNA zu Ungunsten letzterer 155 . Zusammenfassend lässt sich feststellen. dass nur in seltenen Ausnahmen noch intakte Moleküle der entsprechenden Länge (> 440bp) vorliegen. von einer Kontamination ausgegangen werden kann (BRU1. deren Ergebnisse übereinstimmen. 7. dass bei einigen Proben lange Fragmente amplifiziert werden konnten. DEB1). indem kontaminierende Anteile definiert und ausgeschlossen werden (siehe im Gegensatz hierzu auch Pääbo et al.und Authentifizierungsstrategien (vgl.1 beschriebenen Maßnahmen zur Kontaminationsvermeidung sowie durch die in dieser Arbeit verwendeten Reproduktions.1. SZA23 1.

Zwar wird durch die bereits beschriebenen Maßnahmen ein Eintrag dieser Hautzellen minimiert. kann auch in der postmortalen Situation davon ausgegangen werden. Balogh et al. Die Wahrscheinlichkeit der Kontamination mit mtDNA ist daher um ein vielfaches größer als die nukleärer DNA. Diese Tatsache spiegelt sich deutlich im Anteil der kontaminierten Leerkontrollen wider (vgl. Hypothetische Anteile von aDNA-Molekülen und Hintergrundkontamination. Die gepunktete Linie verdeutlicht ein hypothetisches Niveau an Molekülen einer (gemischten?) Hintergrundkontamination. Abbildung 40. kann jedoch nicht gänzlich verhindert werden (Kap.2. 5. in allen Versuchen zu nukleärer DNA jedoch bei 0% liegt. Eine charakteristische Eigenschaft der abgeschilferten Hautzellen besteht darin. Kap.1). 2005). Dies gilt jedoch nur eingeschränkt für die Mitochondrien der Zellen. auch die mtDNA in größerer Menge vorliegt. die sich bei der Amplifikation von mtDNA in Werten bis zu 32% (Tierkontrollen) niederschlägt. sofern sich ncDNA nachweisen lässt. dass in den meisten Fällen der Zellkern bereits vor der Abschilferung abgebaut wurde (vgl. deren Anzahl der Moleküle die der endogenen DNA je nach Probe überschreitet. dass bei einer ausreichend großen Menge an mtDNA Kopien noch einige intakte lange Moleküle für eine Amplifikation zur Verfügung stehen. liegt in der Beschaffenheit der putativen Kontaminationsquelle begründet. 2002). Weiterhin lässt dieser Umstand es plausibel erscheinen. Die unterschiedlich grauen Flächen stellen Beispiele für die Gesamtmenge an endogenen DNA-Molekülen zweier Proben dar. 2004. Entscheidend für die Beurteilung einer Probe hinsichtlich der Authentizität ist sicherlich die 156 . dass die Mehrzahl der Kontaminationen einer Probe von Zellen abgestoßener Hautschuppen stammen. dass es sich bei der erfolgreichen Amplifikation langer mtDNA Fragmente (bei nicht übereinstimmenden Sequenzen) in erster Linie um Kontaminationen handelt. 6. Es kann als sehr wahrscheinlich angesehen werden. Der Grad der DNA-Degradierung und -Fragmentierung hängt in erster Linie von der individuellen Geschichte der Probe und damit von den diversen Einflussfaktoren innerhalb dieser Zeitspanne ab (Pääbo et al.Diskussion vorliegt. Willerslev & Cooper 2005. dass. Mitchell et al. Ein weiterer Grund für die Annahme.1).

Zwar weisen die Allele der einzelnen Genorte in phylogeographischer Hinsicht auch Unterschiede zwischen einzelnen Bevölkerungen auf. Kretuonas. Szarvas 23.1.6 Reproduktionsstrategien zur Validierung und Authentifizierung Es zeigt sich in den Daten der vorliegenden Arbeit. Der kritische Punkt bezüglich des Erhalts endogener DNA ist dann erreicht. in welchen mehrere Individuen eines Fundortes untersucht wurden. die eine Empfehlung für eine detaillierte Binnenanalyse zulassen. jedoch c) generell gute Erhaltungsbedingungen für den jeweiligen Fundort attestiert werden. Im Falle der Funde von Derenburg. Reproduktionsschemata in Abbildungen 16 und 17. allerdings bemessen sich diese in Frequenzunterschieden einzelner Allele. welche nicht im 157 . nicht erreicht werden. wenn ihr Anteil an Fragmenten einer gewissen Länge den Anteil der Hintergrundkontamination erreicht bzw. Im Rahmen dieser Arbeit hat die Amplifikation nukleärer STR-Genorte daher die Funktion des zusätzlichen Informationsgewinns. 7. liegen nukleäre Ergebnisse für mehrere Individuen vor. Da sich die Profile der STR-Genotypisierungen voneinander unterscheiden. unterschreitet. insofern sich diese in ihrer Tendenz bestätigen und ein plausibles Gesamtbild liefern. aber die Wahrscheinlichkeit einer Fehlinterpretation der Ergebnisse zugunsten von kontaminierenden Linien durch die Synthese von mehreren Ergebnissen aus unterschiedlichen unabhängigen Versuchen in hinreichendem Maße verringert werden konnte (vgl. In Abbildung 40 ist ein hypothetisches Schema der DNA-Erhaltung dargestellt. sondern auch generell innerhalb von aDNA-Analysen aufgrund der grundsätzlich limitierten Erhaltung nukleärer DNA. und somit indirekt auch weitere phylogenetisch sinnvolle Positionen derselben Sequenzen. dass zwar eine Kontamination nie absolut ausgeschlossen.Diskussion aus mehreren Analysen gewonnene Einschätzung des allgemeinen Erhaltungszustands (vgl. die mit der klassischen morphologisch-anthropologischen Bestimmung abgeglichen werden kann. alle Kap.4). Darin wird deutlich gemacht.2). Kap. sowie die Kriterien zur Authentifizierung von Sequenzen in Abbildung 19. Die hierzu benötigten Stichprobengrößen können bislang nicht nur in der vorliegenden Arbeit. da hierdurch diagnostische Positionen. 5. 7. Die Verwendung von überlappenden Fragmenten zur Amplifikation eines langen DNA-Abschnitts erweist sich als großer Vorteil (sofern die überlappenden Bereiche ausreichend groß gewählt sind). der aufgrund der Auflösung auf Individualebene eine mögliche Überwachung hinsichtlich systematischer Kontaminationen bietet. dass der Gesamteindruck von einer Probe Hinweise auf die Wahrscheinlichkeit des Erhalts valider Ergebnisse liefern kann. Eine besondere Rolle spielt vor allem die Geschlechtsdiagnose. die in diesen Bereichen liegen. Die Amplifikation nukleärer aDNA STR loci macht im Rahmen einer populationsgenetischen Fragestellung nur eingeschränkt Sinn. kann a) eine systematische Kontamination aber auch b) eine nähere Verwandtschaft der Individuen untereinander ausgeschlossen. Zudem liefert die erfolgreiche und reproduzierbare Amplifikation von einigen loci wichtige Anhaltspunkte für die Interpretation der Ergebnisse aller Untersuchungen zu einem Individuum.

B. wobei die Bestätigung der Ergebnisse durch eine Direktsequenzierung der PCR-Produkte aus einer bzw.3‰) hoch.2).6‰.2 geführt.1. jedoch mindestens fünf pro PCR-Produkt reduziert werden. Im Rahmen einer Kostenreduzierung kann generell die Anzahl der Klone auf durchschnittlich acht. Es kann daher eine direkte Abhängigkeit der post mortem Modifikationen von den vorherrschenden Bodenverhältnissen postuliert 158 . SCHWE2.0‰ und 4. nur die PCR-Produkte einer Extraktion zu klonieren. 4 und 5) beobachtet werden. 7. um charakteristische Positionen vierfach zu bestätigen. die die Klonsequenzen liefern können (vgl. 6. wie sie bei SCHWE5 exemplarisch angewandt wurde. Szarvas 23 (SZA23 1. Da dennoch eine theoretische Wahrscheinlichkeit besteht. um eine Validität der Ergebnisse im Sinne der verwendeten sieben Kriterien zu gewährleisten (vgl. optional zwei weiteren Extraktionen folgen sollte. dass sich eine systematische Kontamination ebenfalls eindeutig und reproduzierbar im Sinne einer der sieben Kategorien durchsetzen kann. um innerhalb eines PCR-Produktgemischs die Erfassung aller möglichen Moleküle hinsichtlich des 95% Konfidenzintervalls zu garantieren. Dies macht weitgehend eine Wiederholung der PCR eines Fragments überflüssig und daher ist eine Amplifikation pro Fragment pro Extraktion ausreichend. Von einem gänzlichen Verzicht der Klonierung. Daher wäre auch denkbar. Dagegen sind die Werte der beiden Proben des Fundortes Szarvas 8 (SZA8 1 und 2) mit 4. Mim Bowers und Kollegen (2005) empfehlen dagegen pro PCR-Produkt die Sequenzierung von mindestens 20 Klonen. Es zeigt sich zudem an den vorliegenden Daten. sofern PCR-Produkte aus zwei unabhängigen Extraktionen vorliegen. 2 und 3) sowie für Derenburg (DEB1. spielt bei der endgültigen Authentifizierung der Ergebnisse eines Individuums die Beurteilung aller Informationen zu den einzelnen Proben eine bedeutende Rolle (Gilbert et al. Im Hinblick auf zukünftige Analysen können aus den Erkenntnissen der vorliegenden Arbeit Empfehlungen für alternative Reproduktionsstrategien ausgegeben werden. 17.3.2‰ vergleichbar gering. SCHWE1. Dennoch weisen die Autoren nachdrücklich auf die wesentlich wichtigere Bedeutung der mehrfachen unabhängigen Reproduktion hin. Kap. 23. die post mortem Substitutionsraten der drei Proben aus Schwetzingen ähnlich (SCHWE4.2). Abbildung 19). bei der Analyse menschlicher aDNA abgesehen werden.6‰. 3. dass die ermittelten post mortem Substitutionsraten unterschiedlicher Individuen desselben Fundortes ähnlich hohe oder niedrige Werte aufweisen. 22. 2005a). Es lässt sich feststellen. Die Diskussion aller Ergebnisse im Rahmen einer Gesamtanalyse auf Individualebene wird daher in Kapitel 7. insofern das zur Verfügung stehende Probenmaterial nicht ein limitierender Faktor darstellt. So sind z. mehrfach unabhängig bestätigt werden. 7.Diskussion überlappenden Bereich liegen. sollte jedoch aufgrund der Zusatzinformation.7 Zur post mortem Substitutionsrate und Sättigungsrate Die Berechnung der allgemeinen post mortem Substitutionsrate liefert in mehreren Aspekten einen Anhaltspunkt zur Interpretation der gewonnen Daten (vgl.1 und 7. Kap. dass die beschriebene Mindestzahl an Versuchen innerhalb des Reproduktionsschemas ausreichend ist. Eine allgemeine Übereinstimmungen der Höhe der post mortem Substitutionsrate kann auch für die Funde aus Kretuonas (KRE1 und 2).

Diskussion werden. hat zudem Einfluss auf die Frage. Es kann durch Interpolation der gewonnenen Daten gezeigt werden. nicht getrennt verlaufen. welche wiederum einerseits stochastischen Prozessen unterliegt und andererseits von der Einsatzmenge an Extrakt bzw. Kap. welche zur Fragmentierung und Modifikation von DNA-Molekülen führen. Dieser Umstand kann leicht durch den unterschiedlichen Erhaltungszustand der Proben erklärt werden.1 und Abbildung 29). dass kürzere Fragmente von Molekülen vergleichsweise mehr Basenmodifikationen aufweisen. andererseits auf nur noch wenige erhaltene Moleküle. Entsprechend kann eine vergleichsweise niedrige post mortem Substitutionsrate einerseits auf eine ausreichend große Menge intakter Moleküle hindeuten.1).3. Die Sättigungsrate ist daher nur als Annäherungswert bei der Betrachtung der einzelnen 159 . bestätigen. gleich 0.2) aller PCR-Produkte ist nur in extremen Fällen (nahe bzw. die sich von 3. Das arithmetische Mittel der Sättigungsrate (Kap. Dieses Ergebnis legt die Vermutung nahe. was wiederum als Indikator für eine ausreichend große Ausgangszahl an Molekülen zu Beginn der PCR gesehen werden kann. der Aussagen zur Art und Weise der DNADegradierung bzw. 6.3.3. Die post mortem Substitutionsrate lässt somit Rückschlüsse auf generell vorherrschende Erhaltungsbedingungen zu. Die Sättigung eines Fragments ist zuvorderst von der Menge an Ausgangsmolekülen während der initialen Reaktionszyklen abhängig. Fragmentierung zulässt. dass bei abnehmender Produktlänge um 10bp eine Zunahme der post mortem Substitutionsrate um 1. Können innerhalb einer bestimmten Anzahl Klone dieselbe Anzahl an Linien anhand unterscheidbarer Substitutionen festgestellt werden. Sofern die post mortem Substitutionsrate getrennt für die einzelnen Fragmente berechnet wird. trotz der geringen Anzahl an durchgeführten PCR-Reaktionen und somit der reduzierten Datenlage.15‰ bis 17. so deutet dies auf eine nicht erreichte Sättigung der Klonsequenzen mit unterschiedlich substituierten Molekülen hin.66‰ vorliegt (vgl. letztlich der verwendeten Extraktionsmenge bzw. nahe bzw. Als Interpretationshilfe dient hierbei die Tatsache. Der Umstand. ob sich anhand der Häufung von Mutationen an einzelnen Positionen und deren Verteilung innerhalb der HVR I signifikante Muster erkennen lassen (siehe Kap. da sie lediglich das Verhältnis der Anzahl der Klone zur Anzahl der beobachtbaren Linien beschreibt und in beiden Fällen einen vergleichbar niedrigen Wert annimmt. dass die Mechanismen. In Kombination mit der Sättigungsrate lassen sich auch Aussagen über die Menge und Qualität der endogenen DNA treffen. dass im Falle weniger erhaltener Moleküle die wenigen beobachtbaren Substitutionen in mehreren Klonsequenzen konsistent auftreten. 6. lässt sich ein deutlicher Trend feststellen. Möglicherweise können die hydrolytischen und oxidativen Schäden der DNA unmittelbar auf die Einflussfaktoren Feuchtigkeit und Sauerstoffgehalt der jeweiligen Böden zurückgeführt werden.6‰ erstreckte. gleich 1) aussagekräftig. 6. Die kürzeren Alternativen der Fragmente I-III können die allgemeine Tendenz. Hierbei kann auch die Sättigungsrate nicht zur Interpretation herangezogen werden. Eine hohe post mortem Substitutionsrate kann daher als fortgeschrittener Zustand der Degradierung betrachtet werden. Ergänzend hierzu lässt sich bei Proben des Fundortes Flomborn eine auffällige Streuung der Werte der post mortem Substitutionsrate feststellen. des Probenmaterials bei unterschiedlichen Extraktionen abhängt.

8 Charakterisierung und Verteilung postmortaler Sequenzveränderungen Die beobachteten Anteile der einzelnen Formen der Basensubstitutionen (Kap. 2001. 6. dass die Deaminierung der Cytosine durch hydrolytische Prozesse die weitaus häufigste Ursache für Basensubstitutionen bei alter DNA darstellen. wobei hier die Deaminierung der Adenine im Vordergrund steht. Hansen et al. die Polymerase der in vivo Replikation durch E. Der Anteil von 2.3. 2001). was wiederum eine Identifikation einfach macht. 7. 2003b. 2001a. coli und die Polymerase der finalen Sequenzierreaktion [Applied Biosystems].1. die Berechnung des Anteils an Transversionen verfälschen. 2003b) konstatiert – nicht bestätigt werden. 160 . Bollongino 2005. Mit einem Anteil von ~8% ist die Transition vom Typ II (A/TaG/C) am zweithäufigsten vertreten. dass auch postmortal nur die biochemische Deaminierung von C und A als wahrscheinlich erachtet werden kann (Hofreiter et al. womit die Fehlerrate der Polymerase bei 1.859 analysierten Basenpaaren konnten 48 Transversionen festgestellt werden. ist anhand des vorliegenden Datensatzes für die kombinierten postmortalen Transitionen I und II ein wesentlich geringeres Verhältnis von 11:1 festzustellen. Das Verhältnis der Deaminierungen von C und A von 40:1. Dem kann jedoch entgegnet werden. Binladen et al. sondern mehrere Polymerasen als Einflussquellen beteiligt sind. Hofreiter et al. die ABgene Taq Polymerase [ABgene] der Kolonie-PCR.68 x 10-4 liegt. In einer Gesamtzahl von 285. Die Berechnung der Fehlerrate der Polymerase gestaltet sich jedoch schwierig. 2001a. Der zehnfach höhere beobachtete Wert an Transversionen kann daher als Resultat der einzelnen Fehlerraten der hintereinander geschalteten Polymerasen betrachtet werden. dass der Anteil an Transversionen innerhalb der regulären Mutationen ebenfalls sehr gering ist und daher die wenigen „echten“ Transversionen in der Regel als charakteristisch für einige Haplogruppen gelten. Basierend auf der Annahme. So sind dies insgesamt vier Polymerasen: die AmpliTaq Gold Polymerase der initialen Amplifikation. Die Qualität der DNA-Ausgangsmoleküle für die jeweilige PCR spielt hinsichtlich der möglichen Fehleinbauten der Polymerase sicherlich eine ebenfalls nicht zu unterschätzende Rolle. Abbildung 30 & 31) entsprechen im Wesentlichen der Verteilung vorausgegangener Publikationen (Hansen et al. die nicht als solche erkannt wurden. macht deutlich.wie auch schon von Gilbert (et al. Die Tatsache. wie es von Lindahl (1993) in vivo beobachtet wird.Diskussion PCR-Produkte sinnvoll und kann aufgrund der „quasi-quantitativen“ Eigenschaften das Auftreten von kontaminierenden Sequenzen innerhalb eines Individuums erklären.25% Transversionen kann möglicherweise als Summe von Polymerasefehlern gedeutet werden. dass einige kontaminierende Sequenzen. Die Fehlerrate bzw. Weiterhin wäre denkbar. da an der endgültigen Ausprägung der vorliegenden Sequenzen der Klone nicht nur eine. 2005). kann jedoch . Genauigkeit für die AmpliTaq Gold Polymerase wird vom Hersteller [Applied Biosystems] als 1-2 x 10-5 angegeben. dass die Transition vom Typ II (C/GaT/A) mit ~90% vertreten ist.3. Gilbert et al.

Sigurdardottir et al. dass eine gewisse Heterogenität bezüglich der Mutationsraten innerhalb der HVR I herrscht. 161 . als im kodierenden Bereich des mitochondrialen Genoms. hot spots (Stoneking 2000) oder auch als speedy transitions (Bandelt et al. Zahlreiche populationsgenetische Arbeiten beschreiben die unterschiedlichen Mutationsbzw. Gilbert et al. Tully et al. 2003b. Fliss et al. dass in der HVR der Anteil an Parallelmutationen 31-fach höher ist. Von den 39 signifikanten hot spots dieser Arbeit fallen 28 in diesen Bereich. obwohl diese Region keinem selektiven Druck unterliegt. 2000. Tumorzellen. sowie Heteroplasmien in Stammbaumstudien. die eine gesteigerte Mutationsrate besitzen und daher als fast sites (Excoffier & Yang 1999). 1996). post mortem Substitutionsraten und deren Verteilung auf der HVR I auf Basis von Daten alter DNA liegt bisher nur von Gilbert (et al. 1993). C16222. 2003ab) vor. Innerhalb des vergleichbaren Bereichs aller Studien (np 16092-16362) sind insgesamt 110 hochvariable Positionen zu beobachten. 2002. Anhand der Tabelle 28 wird deutlich. 2002). C16259) definiert werden. T16099. dass hier auffällig häufig Positionen betroffen sind. die möglicherweise auf die unterschiedlich verwendeten methodischen Ansätze zurückzuführen sind (Malyarchuk & Rogozin 2004. die eine unterschiedliche Mutationsrate bestimmter Positionen zu erklären versuchen. Finnilä et al. C16190. Forster et al. In Tabelle 28 sind zum Vergleich die als post mortem hot spots definierten Positionen der vorliegenden Arbeit mit Werten aus Studien zu in vivo Mutationsraten aufgetragen (Malyarchuk & Rogozin 2004. die auch als phylogenetisch polymorphe Positionen der HVR I bekannt sind (Stoneking 2000. dass bezüglich der Definition von Positionen mit hoher Mutationsrate bereits einige Differenzen bestehen. Substitutionsraten der einzelnen Positionen innerhalb der mtDNA Variabilität und definieren in unterschiedlichen Ansätzen Positionen. C16133. Excoffier & Yang 1999.Diskussion Es ist lange bekannt.und Rückmutationen besondere Probleme dar.6%) nur von jeweils einer einzigen Studie bestätigt. T16095. Bandelt et al. Darunter befinden sich neun Positionen welche sich lediglich durch Daten alter DNA von Gilbert (et al. dass innerhalb der HVR I häufig wiederkehrende Mutationen in phylogenetisch entfernten mitochondrialen Linien zu finden sind (Richards et al. Wakeley 1993. Eine vergleichbare Arbeit zu Degradierungsmustern. (2001) weisen darauf hin. Studien zu Mutationen in Keimbahn-. Erratum) (A16219) sowie in der vorliegenden Arbeit (T16094. Hinsichtlich der Verteilung der HVR I Mutationen und deren Häufigkeiten existieren seitens rezenter Daten bereits einige Hypothesen. Tatsächlich sind davon 37 Positionen (33. weisen ebenfalls darauf hin. Die Gesamtzahl von 110 fraglichen hot spot-Positionen scheint entsprechend der untersuchten Länge von 271 Basenpaaren sehr hoch zu sein. Hasegawa et al. 2000. 2003a). 2002) bezeichnet werden. 2000. Besonders für die Klassifizierung von Haplogruppen stellen Parallel. C16185. Es scheint daher.

0051 0. Die Positionen mit signifikant höherer Mutationsrate aus den übrigen Arbeiten (Malyarchuk & Rogozin 2004.0058 0.0018 0.0005 0. 1613016379 (W93) und 16024-16362 (H93).0000 1 X X X X X X X X X 2 2 4 3 2 3 X X X 0.0018 0. 16024-16382 (M99).0000 0. Erratum (G03).0000 0.0000 0.0012 np X X X 0.0000 0. W93 und Hasegawa et al. Bandelt et al. 1999 (M99) wurden als Quartile standardisiert.05) angegeben. Die Daten von Gilbert et al.0059 X X 0.0004 0. 2003b.0063 0.0051 162 .0393 0. 16092-16365 (MR04).0000 0.0406 X X X X X 0. Die Querbalken begrenzen den untersuchten Bereich der einzelnen Arbeiten: 15997-16409 vorliegende Arbeit. welche einer durchschnittlich x-fach höheren Mutationsrate entsprechen.0000 X X X 4 4 X X X X X 1 2 3 X X X X X X X X X 2 3 2 A C T C C T G C C A C C C T C A C C T G C C T A C C C A C C C T A C T A T A A G C T C C A C T C C T T C C C C C C C C A A T 16241 16242 16243 16245 16248 16249 16255 16256 16257 16258 16259 16260 16261 16263 16264 16265 16266 16270 16271 16274 16278 16287 16288 16289 16290 16291 16292 16293 16294 16295 16296 16298 16300 16301 16304 16309 16311 16316 16318 16319 16320 16325 16327 16335 16343 16344 16352 16354 16355 16356 16357 16360 16362 16375 16376 16377 16378 16379 16394 16399 16402 16406 p 0.0050 0.0165 0.0183 X 1 X X X 0. 1605616409 (G03).0000 0. MR04.0050 0.0050 0.0018 0.0007 1 2 4 4 2 X 1 1 1 1 X X X X X X X X X X X X X X X X X X X X X 3 4 4 X X X X X X 4 4 X X X X X 1 0. Vergleich derjenigen Positionen.0000 1 1 2 X X X X 2 1 3 X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X 1 X 2 2 X X 2 2 4 X 4 4 2 4 X X 2 4 4 4 X X 2 3 4 X X X X X X X X X X X 4 4 4 X X 3 4 X X 2 2 X X X 3 X 3 2 3 2 X X 4 4 X X X 2 0. Wakeley 1993.0406 X X 1 4 2 2 3 1 1 2 X X X X X X X X X X X X 0. 1993.0012 0.Diskussion Tabelle 28. Für die Ergebnisse der vorliegenden Arbeit sind nur die P-Werte der signifikant unterschiedlichen Positionen (t0.0001 1 X X X X X X X X X X X X X 0.0333 0.0195 0.0085 2 4 0.0058 0. H93) sind mit X angegeben.0195 0. T T A A T T T T T C C C C T G C T T G C C C G A A C C C T C C C A A C C C C C T C C C T A G C A T C A C C C T A A T C A C A C np p 16002 16025 16051 16078 16086 16090 16092 16093 16094 16095 16099 16111 16114 16126 16129 16133 16136 16140 16145 16147 16148 16150 16153 16163 16166 16167 16168 16169 16172 16173 16176 16179 16182 16183 16184 16185 16186 16187 16188 16189 16190 16192 16193 16209 16212 16213 16214 16216 16217 16218 16219 16221 16222 16223 16224 16227 16230 16231 16232 16233 16234 16235 16239 0. 16051-16365 (B02). 16024-16362 (EY99). 2002.0171 4 X X X X 3 1 X X X X X X X X 4 4 4 2 2 2 4 X 4 4 X X 0. für die eine gesteigerte Mutationsrate festgestellt wurde.0021 4 X 0. Excoffier & Yang 1999 (EY99) und Meyer et al.0393 X X X X X X 2 X X X 3 0.0018 0. Der hellgrau hinterlegte Bereich entspricht dem vergleichbaren Abschnitt aller acht Studien. B02.

dass bezüglich der Häufigkeiten von Basensubstitutionen und deren Verteilung innerhalb der vergleichbaren Region der HVR I Unterschiede zwischen der in vivo und post mortem Mutagenese bestehen. C16242. T16099. C16320. liegt eine Normalverteilung vor (vgl.2) innerhalb der untersuchten Region von np 15997-16409 gleichförmige und größtenteils zufällige Verteilung aufweist. C16187. T16249. dass die hydrolytische Deaminierung als häufigste Ursache von Basensubstitutionen (vgl. die Positionen T16094. C16256.3. Weitere 14 signifikante Positionen der vorliegenden Arbeit (T16092. Bis auf Position T16099 kommen nur alle Mutationen mindestens einmal in einer Haplogruppe vor (http://www. C16114. Richards et al. Gilbert et al. Es zeichnet sich ab. 2003b). 2002 (15). Es lässt sich grundsätzlich feststellen. B02. 2000). C16234. die für den vergleichbaren Bereich definiert wurden. die in vivo eine erhöhte Mutationsrate aufweisen und von mindestens einer Studie bestätigt werden (C16173 (B02). A16183. A16309. Kap. Insgesamt zeigt sich in 16 Übereinstimmungen mit den Daten von Malyarchuk & Rogozin (2004) die größte Ähnlichkeit. W93). Insgesamt acht signifikante hot spots finden keine Entsprechung in den Daten der zum Vergleich stehenden Arbeiten (T16094. 2003b) nur acht Übereinstimmungen. vier Positionen. C16222. C16133. T16304. Kap. C16223. T16224. C16184. Richards et al. C16150. Hierunter finden sich die sechs Positionen T16093. C16355. welche ebenfalls auf eine Deaminierung des Cytosins auf dem H-Strang zurückzuführen sind (Hofreiter et al. C16362). G16274. T16209. 2001. C16259 sind als Parallelmutationen sogar in mindestens drei Haplogruppen vertreten. Für die beobachteten sehr hohen post mortem Substitutionsraten der Basen C und G. Dies entspricht 71.2% aller Positionen des vergleichbaren Bereichs. C16148. A16293. wovon jedoch keine für eine bestimmte Hg bestimmend ist. T16172. Umgekehrt finden sich auch 18 Positionen. Hasegawa et al. 3.mitomap. Erstaunlicherweise zeigen sich zur vergleichbaren post mortem-Studie von Gilbert (et al. C16290. C16190. C16185. C16221. Die Erläuterungen hierzu werden weiter unten dargelegt.org/.B. 6. C16245 (MR04.Diskussion Dagegen stimmen insgesamt 20 von 28 Positionen in ihrer gesteigerten Mutationsrate mit sowohl in vivo als auch post mortem-Daten überein. A16260. C16186. welche auf Basis der vorliegenden aDNA-Sequenzen alle von Deaminierung betroffen sind. C16291. aber keine signifikant höhere post mortem Mutationsrate zeigen (C16111. T16095. C16185. Stattdessen finden sich unter den 13 cold spots der vorliegenden Arbeit. C16259).3). G16319. 1999 (je sieben).6. gefolgt von Bandelt et al. die übereinstimmend eine erhöhte Mutationsrate in vivo aufweisen (und mindestens von vier der sechs Studien bestätigt sind). die von mindestens sieben der acht beteiligten Studien bestätigt sind und die allesamt als Parallelmutationen in verschiedensten Haplogruppen vorkommen (z. T16298 und T16356) stimmen mit Daten mindestens einer der rezenten Studien überein und finden sich ebenfalls vermehrt als Parallelmutationen in den unterschiedlichen mtDNA-Linien. C16278. C16188. 2000). C16294.4% der hot spots dieser Arbeit und 18. Wakeley 1993 (acht) und Excoffier & Yang 1999 und Meyer et al. 163 . 1993 (neun). G16213 (MR04. C16222. T16189 und T16311. B02) sowie die Position G16319 (alle Studien außer EY99)).

1991. dass die Anzahl der Substitutionen eines PCR-Produkts von der Produktlänge abhängt (vgl. Kap. Aus den Angaben der Publikation wird jedoch deutlich. die neben den Reparaturmechanismen (Bogenhagen 1999) die Integrität des DNAMoleküls in vivo bestimmen. dass ein Produkt dieser Länge daher vergleichsweise weniger Substitutionen aufweist als ein Kürzeres. 2003a) erläutern. Abbildung 29). Diese Beobachtung lässt sich anhand der wenigen Klone.3. in welchen eine sehr deutliche Übereinstimmung der in vivo und post mortem berechneten Daten der vorliegenden Arbeit vorliegen. als dass diese vier der sechs Positionen darstellen. Als weitere Faktoren. d. Ohno et al. Es konnte deutlich nachgewiesen werden. vielen Deaminierungen. 2003b). dass dieser Abschnitt durch ein insgesamt ca. in welcher der betreffende Bereich der LDR1 durch das 162bp lange Fragment IV amplifiziert wurde. welche möglicherweise auch für die Situation nach dem Tod des Organismus eine Rolle spielt (Gilbert et al. sich deutlich von Ergebnissen der übrigen (inkl. dass gerade in diesem Bereich eine Häufung von Deaminierungen vorliegt. dass bei fortgeschrittener Degradierung und direkt bedingter Fragmentierung von DNA-Molekülen ebenfalls eine erhöhte Anzahl von Substitutionen zu finden ist. der vorliegenden) Arbeiten unterscheiden (Tabelle 28). Gilbert berichtet von einer low damage region (LDR1) von ca. die für das lange 440bp lange Fragment V vorliegen. Meyer et al.1. Kap. 6. die sich im Laufe der Zeit an der betreffenden Position ansammelt. wie auch für den Bereich MT5 (np 16194-16208. dass die Positionen 16129.Diskussion Es kann daher angenommen werden. 16187 und 16189. die eine (mögliche) 164 . Die Definition von fraglichen hot spots auf Basis von degradierten bzw. lässt sich an einem Beispiel von Gilbert (et al. 2003a.3. Das bedeutet gleichermaßen. zeigt stattdessen. deren Daten ebenfalls nur durch die Amplifikation des genannten langen Abschnitts erhoben wurden. dass in diesem Fall nur diejenigen Moleküle amplifiziert wurden. die vor allem im Bereich des C-stretches (np 16375-16380) fünf signifikante Positionen aufweist (vgl. somit aber keine weitere Bestätigung durch aDNA-Daten erfahren. Als Ursache für die unterschiedlichen Mutationsraten in vivo wie auch post mortem wird häufig die Sekundärstruktur der DNA herangezogen (Malyarchuk & Rogozin 2004). 6. Dennoch macht es deutlich. dass im Rahmen der postmortalen hydrolytischen Prozesse je nach Fortschritt der DNA-Degradierung die Wahrscheinlichkeit für eine Deaminierung beispielsweise jedes Cytosins als gleich hoch angesehen und daher die Häufung der Substitutionen als zufällige Summe erachtet werden kann. Dieser Umstand ist insofern misslich. was jedoch bislang nicht nachgewiesen werden konnte. 25 Basenpaaren im Bereich von np 16370-16395 und postuliert ferner einen möglichen Schutz dieses Bereichs durch eine Assoziation mit einem Protein. ohne Depurinierungen bzw.h. Der Vergleich mit Werten dieser Arbeit. Erratum) liefert die Tatsache. Einen weiteren Hinweis auf die formal unzulässige Vergleichbarkeit mit den Daten von Gilbert (et al. 1999) angenommen wird. Dass dieser Umstand einen direkten Vergleich mit anderen aDNA-Daten erschwert. welche noch intakt waren. bestätigen. Es ist demnach nicht ungewöhnlich. 400bp langes PCR-Produkt (np 16055-16410) amplifiziert wurde. modifizierten DNASequenzen ist allgemein als schwierig zu betrachten. Eine Amplifikation über diese Länge ist jedoch im Rahmen von Analysen degradierter DNA unüblich.3). können Bereiche angeführt werden. 16172.

16236-16238. Dies betrifft den Bereich des stop codons des 7S DNA Stranges (16104-16106) als auch den eines möglichen Kontrollelements MT5 (np 16194-16208. Daher sind Rückschlüsse auf die Situation in vivo. Ferner lässt sich feststellen. Ohno et al. 16306-16308. 2003b) angedeutet werden. können innerhalb des vorliegenden Datensatz nicht als konserviert beschrieben werden. dass auch jegliche Interpretation von Häufigkeitsverteilungen der Mutationen seitens der Untersuchungen degradierter DNA nur unter Vorbehalt zu betrachteten sind. da sie durch die verwendete Reproduktionsstrategie als solche erkannt werden und daher bei der Bestimmung der Haplogruppe ausgeschlossen werden können. sofern in vivo etwaige Mechanismen oder Assoziationen bestehen (welche in der Literatur ebenfalls nur als Vermutungen formuliert werden). Gilbert et al.für die Haplotypenbestimmung keine wesentliche Rolle spielen. KTNCNK) wiederholt an np 16099-16101. Insgesamt kann festgestellt werden. Meyer et al. Bei der Betrachtung der Mutationsraten beider Bereiche zeigt sich jedoch keine signifikante Verringerung der Mutationsrate (vgl. die die Heterogenität der post mortem Substitutionsrate direkt beeinflussen. Degradierung bestimmter Bereiche haben. Die Gesamtbetrachtung der Häufigkeitsverteilung der post mortem Mutationsrate legt die Vermutung nahe. 16313-16315. Auch die von Malyarchuk & Rogozin (2004) als „cold“ beschriebenen CAT Trinukleotide. 16332-16334 und 16339-341 wieder finden und deren Funktion auch in vivo ungeklärt ist. 2003a). diese postmortal keinen erkennbaren Einfluss auf die Konservierung bzw. siehe oben bzw. wie gezeigt werden konnte. Abbildung 32). dass die post mortem entstandenen Basensubstitutionen auch wenn sie. die sich im Rahmen des Motivs GTACAT (bzw. in geringem Anteil den existierenden Mutationen und vor allem den bekannten Parallelmutationen entsprechen .Diskussion funktionale Aufgabe besitzen. 1999. 1991. nicht zulässig. wie sie von Gilbert (et al. 165 . 16321-16323. 1611516117. 16159-16161. dass.

dass jedoch auch intakte Moleküle derselben Länge amplifizierbar sind.1.3. 6. 6. 2005ab).2.1) und der RFLP-Analyse (Kap. Ergänzend wird auch die allgemeine post mortem Substitutionsrate (im Vergleich von Proben gleicher Fundorte) angeführt (Kap. 5. der externen Diagenese-Studie mittels SAXS-Analyse (Kap. welches ASP2 zudem von Hg U ausschließt. Hierbei soll weitestgehend der Forderung nach einer umfassenden Diskussion aller Einzelergebnisse unter Einbezug der post excavation history der Proben entsprochen werden.1.1. Die Probe ASP2 des österreichischen Fundortes Asparn-Schletz zeigt in allen 79 Klonsequenzen von acht PCR-Produkten aus zwei unabhängigen Extraktionen eines Molaren reproduzierbar keine Abweichung von der Cambridge Reference Sequence CRS (Anderson et al. Hierdurch kann Hg H sowohl durch den für Hg H charakteristischen Wegfall der Alu I Schnittstelle sowie durch das negative Ergebnis von Hinf I. In die individuelle Ergebnisdiskussion zur Authentizität der untersuchten Proben fließen in erster Linie die Ergebnisse der Haplogruppenbestimmung (Kap. das Ergebnis jedoch im Rahmen der Gesamtanalyse als authentisch im Sinne der Kategorie 1 betrachtet werden. Der Amplifikationserfolg der vier überlappenden Primerpaare von 100% deutet auf eine ausreichend große Menge an mtDNA-Molekülen der entsprechenden Länge von ca. folgt auf die Einzeldiskussion eine Gesamtbeurteilung im Fundkontext.1) und der Amplifikation von langen mtDNA Fragmenten (Kap. Wurden mehrere Individuen eines Fundortes/Gräberfeldes untersucht. 200bp hin.5). 6. Die UNG-Klonsequenzen können bestätigen. bestätigt werden.4 (Abbildung 19) vorgestellten Kategorien ein. 10. Dagegen war die Amplifikation des langen mtDNA Fragments V sowie von nukleärer DNA nicht möglich. Von den acht PCR-Produkten aus zwei unabhängigen Extraktionen wurde pro Fragment eines mit UNG amplifiziert.2). 6.3) sowie von nukleärer DNA (Kap. ASP2 ist die einzige vorliegende 166 .2) unterstützt. des Amplifikationserfolgs (Kap. Da sich jedoch auch einige Haplotypen der Hg U bzw. Diese wird durch die Ergebnisse der morphognostisch beurteilten Probenerhaltung. Die allgemeine post mortem Substitutionsrate der Produkte ohne UNG-Verwendung zeigt mit 22.2.1).2) unter den in Kap.1. Es sind keine kontaminierenden Linien feststellbar.64‰ im Vergleich den zweitgrößten Wert aller untersuchter Proben. 6. Hierbei soll in erster Linie die allgemeine Plausibilität des Erhalts endogener DNA diskutiert werden. 6. Die Gesamtanalyse der Ergebnisse erfolgt in alphabetischer Reihenfolge und die Klonsequenzen sind in ebensolcher im Anhang aufgeführt (Kap.Diskussion 7. 1981). Insgesamt kann bei ASP2 ein fortgeschrittener Zustand der DNA-Degradierung bzw. R im Bereich der HVR I nicht von der CRS unterscheiden. wurde zur genaueren Hg-Bestimmung ein Enzymverdau mit Hinf I und Alu I charakteristischer Positionen der coding region nachgeschaltet. Fragmentierung festgestellt werden.2.2. Somit kann mit großer Wahrscheinlichkeit Hg H angenommen werden. 6.1. wie sie vermehrt in der aktuellen Literatur gefordert wird (Gilbert et al.2 Die Authentizität der Proben in der Gesamtanalyse Im Folgenden ist eine umfassende Gesamtbeurteilung der Einzelergebnisse zu den jeweiligen Individuen im Hinblick auf deren Authentizität aufgeführt.

Lediglich ein Klon des Fragments II und einer des Fragments III weichen von dieser Sequenz ab. wurde keine allgemeine post mortem Substitutionsrate bestimmt. 16256T. Dieser Umstand entspricht im Wesentlichen auch der subjektiv als sehr gut beurteilten. In den Klonsequenzen von BRU4 des Thüringer Fundortes Bruchstedt können drei verschiedene Linien verfolgt werden. Der Amplifikationserfolg liegt bei etwa 73. der Amplifikationserfolg (100%) und die Reproduzierbarkeit des Haplotyps durch die erfolgreiche Amplifikation der langen mtDNA Fragmente V aus beiden Extraktionen weist auf eine sehr gute Erhaltung mitochondrialer DNA hin. 16270T. Eine weitere Einbindung in den Kontext des Fundortes kann bei diesem Fund nicht erfolgen. in Klonen eines PCR-Produkts. Da die beiden unabhängigen Extraktionen an einem Langknochenfragment durchgeführt wurden und eine dritte unabhängige Reproduktion aus einer weiteren anatomischen Region nicht unternommen werden konnte. Es sind dies Haplotyp 16189C. 16311C (Hg H) des direkten Bearbeiters. Da die Kontaminationsrate bei BRU4 mit 44. Der erfolgreiche Verdau mit Hinf I in der coding region kann die Einordnung in Hg U bestätigen. dessen Sequenz ebenfalls bei einem Labormitarbeiter zu finden ist. Eine weitere Diskussion im Rahmen des Fundortkontexts kann daher nicht erfolgen. kann die authentische Konsensussequenz im Sinne von Kategorie 3 bestimmt werden.2% sehr hoch ist. Die Amplifikationen der Extraktion A wurden alle mit UNG durchgeführt. 16311C (Hg H) des Verfassers der vorliegenden Arbeit. 16362C. 2004) bestimmt werden können. welcher jedoch aufgrund der hohen Kontaminationsrate wenig aussagekräftig ist. Diese vier Nukleotidpositionen können jeweils aus allen vier Fragmenten der unabhängigen Extraktionen bestätigt.Diskussion österreichische Probe der frühen LBK. Hg H dagegen nur in zwei Fragmenten reproduziert werden.6%). 16270T. Als Haplotyp kann eindeutig und reproduzierbar 16147A. 16223T. Insgesamt kann jedoch der definierte Haplotyp des Individuums CHE4 als authentisch (Kategorie 2) betrachtet werden. Die geringe Kontaminationsrate (2. die als Hg U5a1 (Tambets et al. Die Amplifikation der Fragmente II. Die 84 Klonsequenzen aus zwei unabhängigen Extraktionen des mesolithischen russischen Individuums CHE4 aus Samara Guberna zeigen einen reproduzierbaren eindeutigen Haplotyp 16192T. 16355T und damit Hg N1a bestimmt werden. so verbleiben Sequenzen des Haplotyps 16192T. 16172C. Schließt man diese Klonsequenzen als Kontamination der naheliegenden putativen Quellen aus.43‰ sehr gering und scheint den allgemein guten Zustand der DNA-Moleküle zu bestätigen. 16248T. allgemeinen Erhaltung der Knochenmatrix des Individuums.7%. III und IV wurden bei Extraktion A mit UNG 167 . Die Amplifikation von nukleärer DNA blieb dagegen auf zwei loci beschränkt und war zudem nicht reproduzierbar. deren charakteristische Positionen in fünf von acht PCRProdukten festgestellt werden und Haplotyp 16304C (Hg H). Die Amplifikation des 440bp langen Fragments V ist bei einer Extraktion erfolgreich und die Direktsequenzierung zeigt ebenfalls Ht 16189C. 16294T (Hg U5a1). Die post mortem Substitutionsrate der PCR-Produkte der Extraktion B ist mit 5. 16256T. Die 88 Klonsequenzen aus jeweils unabhängigen Extraktionen eines Molaren des Individuums DEB1 des linearbandkeramischen Fundortes Derenburg beinhalten keine kontaminierenden Sequenzen (0% Kontaminationsrate).

In der Gesamtbetrachtung der Ergebnisse wird deutlich.21‰ vergleichbar nahe bei DEB1. Die wiederholte Amplifikation von Extraktion A ohne UNG kann die Positionen 16224C. da die Klone häufig konsistente post mortem Artefakte zeigen (Fragment I und III). Bei Individuum DEB2 zeigen die Sequenzen von insgesamt 114 Klonen eine hohe Kontaminationsrate von 38. Die Amplifikation des langen mtDNA-Fragments V ist bei zwei von drei Extraktionen erfolgreich und kann den Haplotyp des Individuums bestätigen. Die übrigen PCR-Produkte zeigen mit 13. Die Amplifikationsrate fällt mit 64% gering aus. 16172C. Die 87 Klonsequenzen aus unabhängigen Extraktionen zweier Molaren des Individuums DEB3 zeigen die teilweise aus vier unabhängigen PCR-Reaktionen reproduzierten Positionen 16147A.4% inklusive langer Fragmente und die erfolgreiche Amplifikation von kurzen nukleären loci bis ~150bp. Pro überlappendes Fragment wurde jeweils eines mit UNG amplifiziert. Aufgrund der Gesamtbetrachtung der Einzelergebnisse sowie der Tatsache. In Anbetracht der sehr reduzierten Menge intakter Moleküle ist die Amplifikation weniger kontaminierender aber intakter Moleküle durch die UNG-PCR nicht verwunderlich (vgl.6 %. Letzteres konnte jedoch bei einer dritten Extraktion erfolgreich amplifiziert werden. Kap. Lange mtDNA Fragmente können nicht amplifiziert werden. Initiale Versuche zur Amplifikation von nukleären Markern ergaben bis auf Amelogenin ebenfalls keine Ergebnisse. 16320T. Zudem stimmt die molekulargenetische Geschlechtsbestimmung mit der morphologischen überein. womit für dieses Produkt eine Kontamination angenommen werden muss. Der Amplifikationserfolg aus den Extrakten zweier Molaren zeigt mit 57. Für einen generell guten Erhaltungszustand der DNA von DEB1 spricht weiterhin der hohe Amplifikationserfolg von 100% der überlappenden Fragmente I-IV bzw.1. dessen Authentifizierung nur auf der Tatsache der mehrfachen unabhängigen Reproduktion der Hg K beruht (Kategorie 4). Die Klonsequenzen von Extraktion B zeigen den Haplotyp 16224C. die UNG-Sequenzen der A Extraktion zwei Linien (u. lässt sich aber größtenteils auf das längste überlappende Fragment I (187bp) sowie das lange Fragment V zurückführen. 16311C der Hg K. Die Sequenz weicht jedoch von der der kurzen überlappenden Fragmente ab. die zudem noch stark modifiziert sind. 16248T. Auch die Ergebnisse der Geschlechtsbestimmung beider 168 . 16355T und somit einen Haplotyp der Hg N1a. 16223T. 71. 16311 bestätigen. so dass diese in überlappenden Bereichen gelegenen Positionen von jeweils vier unabhängigen PCR-Reaktionen bestimmt sind. Das Individuum DEB2 stellt in somit ein „Grenzfall“ der DNA-Erhaltung dar. sind die Sequenzen des Individuums DEB1 als authentisch (Kategorie 1) zu sehen. dass die wenigen erfolgreichen PCR-Reaktionen auf eine sehr geringe Anzahl an Molekülen zurückgehen.5‰ eine durchschnittliche post mortem Substitutionsrate.4). 7. Die allgemeine post mortem Substitutionsrate wurde nicht bestimmt.a.1% den geringsten Wert im Vergleich mit allen typisierbaren Proben. Vier Sequenzen des Fragments III weichen von den übrigen ab (16311C). 200bp. dass die Amplifikationen der Fragmente I-IV der Extraktion A mit UNG eindeutig von den Klonsequenzen der Extraktion B abweichen. Dagegen zeigen die Produkte der nukleären PCR-Reaktionen reproduzierbare Ergebnisse aus allen drei Extraktionen bis zu einer Länge von ca.Diskussion durchgeführt. dass DEB1 die sehr seltene Hg N1a trägt. 16189C. eine Kontamination durch den Verfasser der vorliegenden Arbeit kann jedoch ausgeschlossen werden). Die post mortem Substitutionsrate der PCR-Produkte ohne UNG-Einsatz liegt mit 14. Dies ist vor allem damit zu begründen.

Der hohe Amplifikationserfolg von 81. 2000). Fünf Klonsequenzen weichen von den beobachteten ab (Kontaminationsrate 3. dass aufgrund der allgemeinen erfolgreichen Reproduzierbarkeit der HV Region. Bei Individuum DEB4 ist in 68 Klonsequenzen keine kontaminierende Sequenz zu sehen (0% Kontaminationsrate). 16300G als Teilsequenz der Hg X bestimmt werden. der STR-Genotypisierung und der Tatsache. liegt mit 17.7‰ im Bereich der vier anderen Individuen aus Derenburg. so dass im Rahmen der weiteren populationsgenetischen Analyse dieser Haplogruppe nur ein Individuum einfließen kann. Insgesamt betrachtet. Der Erhalt nukleärer DNA konnte ebenfalls nachgewiesen und die Ergebnisse von sechs von zehn Markern reproduziert werden. jedoch auch nicht ausgeschlossen werden. so dass die Sequenz des Fragments V als Kontamination eingestuft werden kann. HV als auch R zu beobachten ist (Richards et al. 16278T. Eine mögliche verwandtschaftliche Beziehung des Individuums zu DEB4 des gleichen Haplotyps kann daher nicht festgestellt.1. Die für Hg X weiterhin charakteristische Mutation 16189C kann jedoch in den Klonen des Fragments II nicht festgestellt werden. Die charakteristische Position 16311C kann durch vier unabhängige PCR aus wiederum zwei unabhängigen Extraktionen zweier Molaren bestätigt werden. Die 89 Klonsequenzen des fünften Individuum aus Derenburg – DEB5 – zeigt ebenfalls reproduzierbar die Position 16311C und kann mit Hilfe des Enzymverdaus in die Hg HV bzw.9%. Die Klonsequenzen der einzelnen Fragmente zeigen keine konsistenten post mortem Artefakte. Ein weiterer Klon des Fragments III kann durch np 16223T. Insgesamt lässt sich feststellen. Das molekulargenetisch definierte Geschlecht des Individuums stimmt ebenfalls mit der morphologischen Bestimmung überein. R eingeordnet werden. Die Sequenzierung ergibt den Haplotyp 16126C 16163G 16186T 16189C 16221T 16294T (Hg T1). Der Enzymverdau ergab den Ausschluss der Hg U und H. H. 7. Die post mortem Substitutionsrate von 17. Drei weitere Sequenzen zeigen die Mutation 16309G.Diskussion Methoden stimmen überein. Die genauere Einordnung die Hg erfolgt mittels Enzymverdau diagnostischer Positionen der coding region. Der Amplifikationserfolg der vier kurzen Fragmente liegt bei 100%. Beide kontaminierende Sequenzen sind nicht unter den typisierten Labormitarbeitern oder betreffenden Archäologen zu finden. von einem Erhalt endogener DNA ausgegangen werden kann (Kategorie 3). dass DEB3 mit Hg N1a eine seltene europäische Hg aufweist. Das lange mtDNA-Fragment V sowie nukleäre DNA ließen sich nicht nachweisen. die sich jedoch von DEB1 unterscheidet. Die post mortem Substitutionsrate von DEB5. dessen PCR-Produkte alle ohne den Einsatz von UNG amplifiziert wurden. kann aufgrund der reproduzierbaren Ergebnisse und der subjektiven exzellenten Erhaltung der Molaren vom Erhalt endogener DNA des Individuums DEB4 ausgegangen werden (Kategorie 1). Eine davon kann als Rückmutation von 16311 durch eine post mortem erfolgte Deaminierung erklärt werden. die Amplifikation des langen mtDNA-Fragments ist nur einmal in fünf Versuchen erfolgreich. so dass von modifizierten Molekülen in ausreichender Menge ausgegangen werden kann.7) sowohl bei Hg U.4%). 16255A.6‰ des Individuums liegt im oberen Drittel aller neolithischer Proben. R) als Hg bestimmt werden konnte. die eindeutige Reproduzierbarkeit der Ergebnisse 169 . da 16311C in der HVR I als häufig wiederkehrende Mutation (siehe auch hot spot Mutationen. Kap. so dass HV (bzw. Eine wiederholte Amplifikation und Direktsequenzierung der vier kurzen Fragmente kann die Position 16311C bestätigen.

Für eine Probe des Femurs des Individuums liegen Ergebnisse aus der externen SAXS-Analyse vor. IV 4 16192T 16256T 16270T U5 A II. Der besseren Übersicht wegen sind diese in Tabelle 29 wiedergegeben: Tabelle 29.Diskussion und der allgemeine vergleichbar gute Erhaltungszustand der Probe lassen den Nachweis authentischer alter DNA plausibel erscheinen (Kategorie 2). die weiterhin plausibel begründet werden können. dass sie zum Zeitpunkt der Probennahme frisch geborgen waren und in ungewaschenem und unbearbeitetem Zustand kühl lagerten. Erläuterungen im Text. III. IV 170 . IV 2 16257T H A III B III 3 16223T 16298C 16325C 16327T 16355T C A II. Die Gesamtbeurteilung der Ergebnisse für DON1 lassen den Erhalt authentischer DNA plausibel erscheinen (Kategorie 3). Die charakteristischen Positionen des Haplotyps 16192T. womit die Kontaminationsrate bei 1. III. so dass eine Erhaltung von endogener DNA als wahrscheinlich erachtet werden kann. die bei der Probennahme noch in den Alveolen geschützt waren. IV B II.7% liegt. Die Werte für die Indices der Dicke und Struktur der Kristalle der Knochenmatrix von DON1 weichen nicht von den Werten der rezenten Vergleichskontrolle ab. Die Amplifikation des langen mtDNA Fragments sowie von nukleärer DNA ist bis auf einige Signale des Markers Amelogenin nicht erfolgreich. Identifizierbare mtDNA-Linien in DON2. Die 105 Klonsequenzen des Individuums DON2 zeigen insgesamt sieben identifizierbare mtDNA Linien. Bei allen fünf Proben wurden Molaren zur DNA-Extraktion verwendet. 16270T der Hg U5a1 lassen sich eindeutig in den Sequenzen der unabhängigen Extraktionen aus zwei Molaren bestimmen und bestätigen. somit ist der hohe Amplifikationserfolg sowie die Reproduzierbarkeit von eindeutigen Ergebnissen nicht überraschend. die von den übrigen abweicht. Der Amplifikationserfolg ist mit 89% überdurchschnittlich und die post mortem Substitutionsrate von 17. III 5 16294T 16296T 16304C T A III 6 CRS H? A III 7 16215G 16224C 16311C K B II. Unter den 79 Klonsequenzen des mesolithischen litauischen Individuums DON1 ist nur eine Sequenz (16311C) in Fragment III zu beobachten. III. Die fünf untersuchten Individuen des Gräberfeldes bei Derenburg/Meerenstieg II zeigen im Allgemeinen vergleichbare valide Ergebnisse. Dieser Umstand engt den Rahmen von möglichen Kontaminationen vor der Bearbeitung weitgehend ein.53‰ liegt vergleichbar mit anderen reproduzierten Proben im Rahmen der erwarteten Modifikationen alter DNA. Linie HVR I Sequenz Hg Extraktion/Fragment 1 16145A 16176G 16209C 16223T 16390A N1b A II. Ein Vorteil der Derenburger Proben ist. Die Zugehörigkeit zu Hg U kann durch Enzymverdau mit Hinf I ebenfalls bestätigt werden. Die vergleichbaren post mortem Substitutionsraten der Proben weisen auf einheitliche vorherrschende Bodenverhältnisse in Derenburg hin. Die subjektive Beurteilung des Erhaltungszustand aller Molaren sowie der Erhaltung der Knochenmatrix der Proben kann als sehr gut bezeichnet werden.

die jedoch nicht unterschieden werden können.8%) ungenau.7). Ein Problem für die Interpretation stellt Position 16189C dar. dass in Sequenzen aus der Extraktion A eines Molaren sechs verschiedene Linien zu verfolgen sind und in den Sequenzen der B Extraktion eines Kranialfragments drei Linien feststellbar sind. Aufgrund der beobachteten Situation wurden keine weitere Extraktionen oder PCR-Reaktionen mehr unternommen und die Ergebnisse des Individuums DUD1 verworfen (Kategorie 7). Die andere Linie kann durch die np 16189C. im Haplotyp des langen Fragments als auch in dem des Verfassers wiederfindet.1. kann jedoch nur in zwei Fragmenten reproduziert werden. Acht Sequenzen der B-Extraktion entsprechen in Fragment III zudem der CRS. die zudem ein hot spot darstellt (vgl. Lediglich in den Sequenzen des Fragments II lässt sich np 16192T reproduzieren. In Klonsequenzen der erfolgreichen Amplifikation des langen mtDNA Fragments V aus Extraktion B findet sich ebenfalls der Haplotyp 16189. keine derselben lässt sich reproduzieren. 171 . 7. 16270T als Hg U5b1 bestimmt werden. so kann für DUD2 die Hg U5b1 angenommen werden (Kategorie 4). Kap. Aus diesem Grund kann für die Sequenzen von Fragment II der B-Extraktion ebenfalls ein Anteil an Kontaminationen angenommen werden. Hiermit wird die Berechung der Kontaminationsrate (27. Dahingegen kann die Mutation 16270T in keinem der Klone festgestellt werden. In den 97 Klonsequenzen des Individuums DUD2 lassen sich mindestens zwei mtDNALinien feststellen. eine Kontamination der Probe durch diesen scheint daher sehr wahrscheinlich und kann aufgrund der Zuordnung ausgeschlossen werden. Linie 1 könnte nach Kriterien der Reproduzierbarkeit die mögliche echte Sequenz des Individuums DON2 darstellen. womit in diesem Fragment eine dritte Linie gezeigt werden kann. Linie 2 entspricht dem Haplotyp des Probengebers. Ähnlich verhält es sich mit den 89 Klonsequenzen des polnischen mittelneolithischen Individuums DUD1. Die Gesamtinterpretation der Authentizität der Ergebnisse ist durch die wiederkehrende Mutation 16189C erschwert. Die Sequenzen der übrigen Fragmente zeigen ebenfalls mehrere Linien. Die Ergebnisse der Probe werden daher aufgrund der insgesamt hohen Anzahl an kontaminierenden Linien in Sinne von Kategorie 7 verworfen.h. wenngleich in den Sequenzen der B Extraktion jeweils nur durch einen Klon. Eine Linie entspricht dem Haplotyp des Verfassers der vorliegenden Arbeit (16189C. stellen jedoch über die vier Fragmente verteilt eine mosaikartige Verteilung dar. die sich als häufig wiederkehrende Mutation sowohl im putativen Haplotyp von DUD2. die der CRS entsprechen.Diskussion Anhand der tabellarischen Übersicht lässt sich feststellen. d. Folgt man dessen ungeachtet streng den Kriterien der Reproduktion. Die einzelnen Positionen finden sich in bekannten Hgs wieder. eine Bestätigung durch Ergebnisse aus Extraktion B ist jedoch nicht erfolgt. Die Position 16270T kann in Fragment III durch drei unabhängige PCR bestätigt werden. In Extraktion A desselben finden sich zusätzlich Sequenzen. jedoch ist vor allem in den überlappenden Bereichen keine Konsistenz einer Position zu beobachten. 16311C) und ist nur in den Klonen der Extraktion B zu sehen. Die Linien 1 und 2 lassen sich in Sequenzen beider Extraktionen in unabhängigen PCR-Reaktionen nachweisen. Aus mehreren PCR-Reaktionen der Extraktion A zur Amplifikation nukleärer DNA können sogar reproduzierbare Allele von drei kurzen STR-loci bestimmt werden. Der Amplifikationserfolg von 75% der Probe ist aus diesem Grund ebenso nur als Näherungswert zu sehen.

In der Gesamtbetrachtung lassen sich die Ergebnisse des Individuums FLO4 in erster Linie durch die Reproduzierbarkeit in Kombination mit dem hohen Amplifikationserfolg und der subjektiv als gut beurteilten Erhaltung der beiden Molaren als authentisch ansehen (Kategorie 3). Fragment III der Extraktion A zeigt in acht Sequenzen zusätzlich die charakteristischen np 16224C. 16311C der Hg K. 16294T. vgl. 7. 16311C der Hg K. 16304C der Hg T2.4). Weitere sieben abweichende Sequenzen finden sich in Fragment I und III der Extraktion A. so dass sie jeweils durch vier unabhängige PCR-Reaktionen aus zwei unabhängigen Extraktionen zweier Molaren bestätigt sind. Ein langes mtDNA Fragment kann nur in einem Fall erfolgreich amplifiziert werden. was wiederum auf eine modifizierte. Die Sequenzen der Klone des Individuums FLO6 ergeben die Bestimmung des Haplotyps 16224C. FLO5.1. Die Einzelpositionen können jedoch nicht eindeutig einer Hg zugeordnet werden. der allgemeine Amplifikationserfolg der vier kurzen Fragmente liegt bei 90%. Im Rahmen der Magisterarbeit von Marc Tänzer (2005) wurden vier weitere Individuen (FLO1. Als Summe der Einzelergebnisse kann der Erhalt authentischer DNA des Individuums FLO6 als sehr wahrscheinlich angesehen werden (Kategorie 3). Hiervon weichen die Klonsequenzen des Fragments III vom Haplotyp FLO6 ab. Dementsprechend ist der Anteil an kontaminierenden Sequenzen mit 25% im Vergleich zu anderen Proben hoch.durch vier unabhängige PCR aus Extraktionen zweier Molaren bestätigt. Die Fragmente I-III der Extraktion B wurden unter Verwendung von UNG durchgeführt. Allerdings zeigen die als post mortem definierten Substitutionen (10. Alle drei Positionen liegen innerhalb der überlappenden Bereiche. FLO2. stellt jedoch eine Kontamination dar (vgl. 6) des linearbandkeramischen Gräberfelds aus Flomborn untersucht. Eine Amplifikation von nukleärer DNA war in keinem der Fälle erfolgreich. Auch für diese Proben liegen durchweg reproduzierbare Ergebnisse für die HVR I vor. weichen doch die post mortem Substitutionsraten der einzelnen Proben stark voneinander ab. FLO3. daneben auch einige die in diesem Bereich der CRS entsprechen. Kap. Kap. 16249C. Es lassen sich Sequenzen mit den jeweiligen Positionen 16309A. Das lange mtDNA Fragment sowie nukleäre DNA können nicht erfolgreich amplifiziert werden.6‰) innerhalb der Klone mehrere Konsistenzen.Diskussion Von 94 Klonsequenzen des Individuums FLO4 zeigen 79 reproduzierbar die Positionen 16126C. Insbesondere np 16224 und 16311 sind . Ein identischer Haplotyp findet sich auch unter den Labormitarbeitern.im überlappenden Bereich gelegen . so dass insgesamt von einer geringen Menge an erhaltenen Molekülen ausgegangen werden kann. der Amplifikationserfolg der kurzen Fragmente liegt jedoch bei 100%. 16311C feststellen. Fragment V sowie nukleäre DNA können nicht nachgewiesen werden. Soweit die generelle Amplifizierbarkeit mitochondrialer DNA als vergleichendes Kriterium herangezogen werden kann und kongruente Ergebnisse für den Fundplatz Flomborn liefert. Eine weitere Amplifikation des Fragments III ohne UNG sowie eine Direktsequenzierung aller vier Fragmente einer unabhängigen dritten Extraktion eines Molars bestätigt jedoch den Haplotyp 16224C. womit eine Sättigung der Klone mit variierenden post mortem Substitutionen noch nicht erreicht ist.6‰ vergleichbar mit Proben aus Derenburg. aber ausreichende Menge an Ausgangsmolekülen hinweist. 16311C (Hg K). 16249C. Der Anteil an Sequenzen mit post mortem Substitutionen zeigt nur wenige Konsistenzen. Die hohe post mortem Substitutionsrate des Individuums FLO6 ist mit 17. Dieser 172 .

Das lange mtDNA Fragment V kann in vier Versuchen ebenfalls einmal amplifiziert werden. die nicht mit UNG behandelt waren. Da die Position 16298C als Einzelereignis im Bereich der HVR I auch bei Hg H zu finden ist. 16320T. 16355T charakteristische Positionen der Hg N1a. 16223T. Die post mortem Substitutionsrate liegt mit 10. Die für die Bestimmung der Hg V charakteristische Position 16298C liegt im überlappenden Bereich der Fragmente III und IV und wird somit von vier unabhängigen PCR aus unabhängiger Extraktion zweier Molaren bestätigt. 2005) kaum erfasst werden (siehe auch Richter 1968/69). So liegen für sechs von zehn loci der STR-Genotypisierung reproduzierbare Ergebnisse vor. Da der Fundplatz Flomborn bereits vor über 100 Jahren ergraben wurde. Die Kontaminationsrate liegt bei 3. Diese beiden können als post mortem Deaminierungen bestimmt werden. wobei auch hier keine Sättigung der post mortem Substitutionen in den Klonen festzustellen ist (0. 16248T. Die Tatsache jedoch. wurde ein Enzymverdau mit Alu I durchgeführt. PCRProdukte. Der Amplifikationserfolg der kurzen mtDNA Fragmente liegt bei 100% und die post mortem Substitutionsrate des Individuums bei 17. Die Sequenzierung ergibt eine Übereinstimmung mit der CRS. spricht insgesamt gegen eine systematische Kontamination der Proben und für eine Authentizität der erhaltenen DNA-Sequenzen. Bei zwei Sequenzen zeigt Position 16298 ein von Hg V abweichendes Thymin. 16147A. dass bei der Berechnung insgesamt weniger Sequenzen einflossen. 16172C. 12 CaT Transitionen aufweisen.Diskussion Umstand lässt sich durch zwei Beobachtungen erklären: zum einen weisen die Skelettfunde von Flomborn unter subjektiver Beurteilung einen sehr heterogenen Erhaltungszustand auf und zum anderen kamen im Gegensatz zu vergleichbaren Fundorten wie Halberstadt oder Derenburg (bei welchen ausschließlich Molaren verwendet wurden) für jedes Individuum Proben unterschiedlicher anatomischer Regionen zum Einsatz. die sich ebenfalls in ihrer spezifischen Eignung für den Erhalt von Biomolekülen unterscheiden. Die 87 Klonsequenzen des Individuums HAL2 zeigen mit 16086C. kann die post excavation history (Gilbert et al. kann hier von einer Kontamination ausgegangen werden. Da dieses Ergebnis ebenfalls nicht reproduziert wird (und in der coding region bereits H ausgeschlossen werden konnte). die eine Länge von 250bp überschreiten. In den 78 Klonsequenzen des linearbandkeramischen Individuums HAL1 aus Halberstadt sind keine kontaminierenden Sequenzen nachzuweisen.5.45% und der Amplifikationserfolg der kurzen Fragmente bei 100%. Insgesamt betrachtet kann der Erhalt von endogener DNA für das Individuum HAL1 als wahrscheinlich erachtet werden (Kategorie 1). Letzterer bestätigt sich im Amplifikationserfolg von nukleärer DNA.72). Es können vereinzelt nukleäre loci mit kurzen Produktlängen amplifiziert jedoch nicht reproduziert werden.5‰. der in Abbildung 13 (Kap. da die betreffenden Sequenzen weitere acht bzw. Zum einen kann dies aus der Tatsache resultieren. Zum anderen kann dies durch den überdurchschnittlich guten Erhaltungszustand erklärt werden. Die vergleichende Analyse der Einzelergebnisse des Individuums HAL2 macht den 173 .2) deutlich wird. wobei Hg H ausgeschlossen werden konnte.9‰ unter den Werten der beiden anderen untersuchten Individuen aus Halberstadt. dass bei sechs untersuchten Individuen sechs unterschiedliche Haplotypen valide bestimmt werden konnten. Diese können in allen Sequenzen sowohl aus Amplifikationen mit UNG (Extraktion B) als auch ohne (Extraktion A) bestätigt werden. konnten jedoch nicht amplifiziert werden.

16234T. 2004). sowie III und IV liegen. Eine Hg-Bestimmung der fraglichen kontaminierenden Sequenzen kann nur unsicher erfolgen. Die post mortem Substitutionsrate liegt mit 15‰ leicht über dem Durchschnitt. Für den Erhalt ausreichend intakter Moleküle spricht die erfolgreiche Amplifikation des 440bp langen mtDNA Fragments V aus einer Extraktion. 16270T der Hg U5b aufweist.26%). dass zur Analyse der Individuen aus Halberstadt ausschließlich Molaren verwendet wurden. Kontaminationsrate 1. Die in allen Analysen konsistente Reproduzierbarkeit und der beobachtbare 174 . 16235G (Sub-Hg B4e) als Mutationen in Sub-Hgs der asiatischen Hg B beschrieben (Yao 2002a. Von den 79 Klonsequenzen des Individuums HAL3 weist lediglich ein Klon in Fragment IV eine abweichende Sequenz auf (16390A. So konnten sieben von zehn STR loci erfolgreich und wiederholbar typisiert werden. Auch die Amplifikation nukleärer DNA ergab reproduzierbare Ergebnisse. welches in den Klonsequenzen bzw. Die drei Individuen des neolithischen Fundorts Halberstadt zeigen durchweg reproduzierbare Ergebnisse und weisen im Rahmen einer subjektiven Beurteilung einen sehr guten Erhaltungszustand auf. 16296T. durch die post mortem Substitutionsrate deutlich wird. 16270T der Hg U5b. jedoch nicht in der vorliegenden Kombination bekannt. Dieser Umstand und die Tatsache. 16126C. verringert die Wahrscheinlichkeit einer Kontamination im Zeitraum nach der Grabung. Vier Klone des Fragments III aus Extraktion B zeigen die abweichenden Positionen 16217C. die zum Zeitpunkt der Probennahmen noch geschützt in den Alveolen vorlagen. Von den 62 Klonsequenzen des litauischen neolithischen Individuums KRE1 zeigen 58 reproduzierbar die charakteristischen Nukleotidpositionen 16192T. 2002b. Die post mortem Substitutionsrate liegt mit 11. Die Kontaminationsrate liegt somit bei 8%. Die übrigen Klone zeigen im Vergleich zur CRS Mutationen an nps 16093C. die charakteristisch für Hg T2 sind. zumal mit Hg N1a eine seltene europäische Hg nachgewiesen ist (Kategorie 2). kann im Falle des Individuums HAL3 vom Erhalt authentischer DNA-Sequenzen ausgegangen werden (Kategorie 2). welches ebenfalls die Positionen 16192T.5‰ unter dem Durchschnitt. Der Amplifikationserfolg der vier kurzen mtDNA Fragmente liegt bei 100%. Wie auch die Funde aus Derenburg wurden diese unmittelbar nach der Grabung beprobt. 16294T. womit das Individuum KRE1 eindeutig als weiblich bestimmt werden kann.Diskussion Erhalt authentischer DNA sehr wahrscheinlich. 16304C. bevor eine Weiterbearbeitung (Reinigung und morphologische Bestimmung) der Skelette vorgenommen wurde. Der Nachweis von nukleärer DNA sowie des langen mtDNA Fragments V konnte jedoch nicht erbracht werden. Bis auf Position 16093C können alle Positionen durch vier unabhängige Versuche bestätigt werden. Eine UNG-behandelte Amplifikation des Fragments I kann den Erhalt von intakten Molekülen identischer Länge bestätigen. Aufgrund der eindeutigen Reproduzierbarkeit der Ergebnisse und des charakteristischen Degradierungsmusters. da sie im Überlappungsbereich der Fragmente I und II. denn es sind sowohl die Positionen 16217C. Dagegen bestätigt die RFLP-Analyse die Zugehörigkeit zur Hg Bestimmung U5b der HVR I. Die integrierte molekulargenetische Geschlechtsbestimmung durch den Marker Amelogenin steht im Einklang mit der morphologischen Geschlechtsbestimmung. 16235G. 16234T (Sub-Hg B4) als auch 16217C.

welche durch die Positionen 16294T. Der Amplifikationserfolg der kurzen mtDNA Fragmente liegt bei 100%. Die Mutationen der HVR I sind charakteristisch für Hg U5b. sodass die Art der verwandtschaftlichen Beziehung weitergefasst werden muss. dass beide Individuen einen identischen Haplotyp zeigen. 16256T. welche der CRS entsprechen und zum anderen weitere vier Sequenzen in Fragment III und IV der Extraktion B. nukleärer DNA und einer fast identischen post mortem Substitutionsrate widerspiegelt. Die STR-Genotypisierung des Individuums ergab ebenfalls reproduzierbare Ergebnisse für sechs von zehn untersuchten loci. Das Ergebnis der STR-Genotypisierung schließt jedoch die putative Labormitarbeiterin als Kontaminationsquelle aus. Die einmalige Amplifikation des Fragments V bestätigt ebenfalls den vorliegenden Haplotyp 16192T.Diskussion allgemein gute Erhaltungszustand des Individuums KRE1 machen den Nachweis authentischer DNA sehr wahrscheinlich (Kategorie 2). Darüber hinaus kann auch die RFLP-Analyse die Zugehörigkeit zu Hg U sicherstellen.7%). Die beiden Individuen KRE1 und KRE2 des litauischen Fundortes Kretuonas zeigen ein sehr ähnliches Ergebnismuster. Da zudem der Haplotyp der beiden Individuen übereinstimmt und dieser auch unter den weiblichen Labormitarbeitern zu finden ist. war eine mögliche Kontamination der Proben und insbesondere des weiblichen Individuums KRE1 nicht auszuschließen.genetischer Fingerabdruck vorliegt und die molekulargenetische Geschlechtsbestimmung mit der morphologischen übereinstimmt. dass beide zudem den identischen mitochondrialen Haplotyp aufweisen.8‰ mit KRE1 vergleichbar. Die Gesamtbetrachtung der Ergebnisse lässt für beide Individuen aus Kretuonas ein Erhalt von authentischer DNA sicherstellen. wobei auch hier die integrierte Geschlechtsdiagnose als männlich mit der morphologischen Einschätzung übereinstimmt (Kategorie1). lässt zudem eine anderweitige Kontamination sehr unwahrscheinlich erscheinen. insofern sich die Datierungen überschneiden. III und IV. 1699G vertreten sind. da keine Übereinstimmung der Allele feststellbar ist. das sich im Erhalt langer mtDNA. dass ein . Dies sind zum einen sechs Sequenzen in den Fragmenten II. 16270T. Von den 60 Klonsequenzen des mesolithischen russischen Individuums LEB1 kommen zehn Sequenzen als kontaminierend in Frage (Kontaminationsrate 16. zumal in den verbleibenden 50 Klonsequenzen eindeutig und reproduzierbar die Positionen 16192T. die kombinierte Wahrscheinlichkeit. dass KRE1 von einer weiblichen Person kontaminiert ist und KRE2 von einem männlichen Individuum. Die post mortem Substitutionsrate des Individuums KRE2 ist mit 11. Da sich keine der beiden kontaminierenden Linien reproduziert wieder finden. Der Umstand. Letztgenannte Positionen finden sich auch bei einem Labormitarbeiter. kann weitgehend als verwandtschaftliche Beziehung innerhalb der Fundortsituation gedeutet werden. Die STRGenotypisierung schließt aber eine nähere Verwandtschaft im Sinne einer Blutsverwandtschaft ersten Grades (in diesem Falle von Bruder und Schwester oder von Mutter und Sohn) aus. 16304C als Teilbereich der Hg T identifiziert werden können. welche charakteristisch für 175 . können diese ausgeschlossen werden. In den 72 Klonsequenzen des Individuums KRE2 sind keine kontaminierenden Sequenzen zu beobachten (Kontaminationsrate 0%). Die Tatsache.wenn auch nicht vollständiger . ist dagegen sehr gering. 16270T. So wäre zwar theoretisch möglich. 16241C.

16296T.B. dass trotz mehrfach konsistenter Basenaustausche valide Ergebnisse erzielt werden können. was sich in einer sehr geringen Sättigung der einzelnen PCR-Produkte zeigt (z.3‰ abzuleiten ist.Diskussion Hg U5a1 sind.4) deutlich von post mortem Artefakten unterscheiden lassen (Kategorie 2). Jedoch kann bei 15 der 22 Sequenzen der Haplotyp (16189C. unterscheiden sich nicht wesentlich von rezenten Vergleichsdaten. B.68‰ vergleichsweise gering. F. Aus genetischer Sicht sprechen für die Authentizität der Sequenzen bzw. a. Einen indirekten Hinweis auf Erhalt von endogener DNA kann im Falle von Individuum LEB1 das Ergebnis der SAXS-Analyse liefern.5. eine Sättigungsrate von 0. N9a. Diesbezüglich liegen auch keine Amplifikate nukleärer sowie langer mtDNA Fragmente vor. Insgesamt lässt sich feststellen.7%. Die Kontaminationsrate liegt somit bei 11.4% vergleichsweise niedrig. bzw. 16294T. In allen zehn hieraus resultierenden Klonen kann die Position 16126C nicht bestätigt werden. welche ebenfalls authentische Ergebnisse zeigen (z. Der Amplifikationserfolg ist mit 71. aber stark basenveränderte Moleküle zur erfolgreichen Amplifikation zur Verfügung standen. 16304C die charakteristischen Mutationen der Hg T2. Die 89 Klonsequenzen des Individuums SCHWE2 zeigen mit 24. Die Klonsequenzen zeigen jedoch. Dies kann mit Einschränkungen auf die geringe Anzahl der nicht mit UNG-behandelten Sequenzen (in diesem Fall nur Produkte der Extraktion B. die sich durch die in der Arbeit verwendeten Schemata der Reproduktion und Authentifizierung (Kap.B.7% einen vergleichsweise hohen Anteil an kontaminierenden Sequenzen. SCHWE 1 zeigt insgesamt sehr viele konsistente Substitutionen innerhalb der Klone eines Produkte. M*) der südostasiatischen Makro-Hg M auftritt.4%. die in die Berechnung einflossen. 16311C) des Verfassers der vorliegenden Arbeit erkannt und damit als 176 . Eine genauere Eingrenzung der fraglichen kontaminierenden Linie in SCHWE1 ist daher nicht möglich. SZA23 2 und DON1). der daraus erfolgten Haplogruppenbestimmung von LEB1 die Reproduzierbarkeit der Ergebnisse und das phylogenetisch sinnvolle Ergebnis. dass im Falle des Individuums SCHWE1 von einer fortgeschrittenen DNA-Degradierung und Fragmentierung ausgegangen werden kann. welche in verschiedenen Haplogruppen (u. Alle Positionen befinden sich innerhalb überlappender Bereiche der vier Fragmente. die keine Kontamination darstellen) zurückgeführt werden. Die Amplifikation des langen Fragments V sowie nukleärer DNA blieb aus. Stattdessen ist die Position 16111T konsistent vertreten. Die 88 Klonsequenzen des LBK-Individuums SCHWE1 zeigen an Positionen 16126C. Die Werte der Indices für die Struktur und Dicke der Mineralkristalle im Knochen sind vergleichbar mit Proben anderer Fundorte. Die post mortem Substitutionsrate des Individuums LEB1 ist mit 8. so dass nur wenige intakte.166 des Fragments III der B Extraktion) und in dieser Kombination auf sehr wenige Ausgangmoleküle schließen lässt. so dass alle Positionen durch vier unabhängige Versuche bestätigt sind. Der allgemeine Amplifikationserfolg der vier kurzen mtDNA Fragmente liegt bei 66. Dies lässt sich deutlich auf den starken Grad der Degradierung zurückführen. Eine von drei Amplifikationen von Fragment I der Extraktion B wurde unter Verwendung von UNG durchgeführt. Die Einordnung in Hg U wird weiterhin durch die RFLP-Analyse der np 12308 der coding region bestätigt. Somit kann trotz des vorliegenden Einzelergebnisses der Erhalt endogener DNA als wahrscheinlich erachtet werden (Kategorie 3). welcher anhand der sehr hohen post mortem Substitutionsrate von 23.

Der Amplifikationserfolg von 79% ist aufgrund des erhöhten Anteils an Kontaminationen nur bedingt informativ. drei unabhängige Versuche bestätigt werden. d. 16296T festgehalten werden. Schließt man diese 22 Sequenzen aus. sie entsprechenden in Sequenzen des Fragments III der CRS. Schließt man diese Sequenzen aus. LEB1. anzunehmen.9% aufgrund des kontaminierenden Anteils nur eingeschränkt als Interpretationshilfe herangezogen werden. Alle vier Positionen sind wegen ihrer Lage in überlappenden Bereichen vierfach unabhängig bestätigt. Poetsch et al. Aufgrund der Reproduzierbarkeit der Sequenzpositionen und unter Ausschluss der primären und offensichtlichen Kontaminationsquelle ist im Rahmen des charakteristischen Erscheinungsbilds alter DNA im Falle von SCHWE2 die Authentizität der Ergebnisse als sehr wahrscheinlich anzunehmen (Kategorie 5). jedoch scheint es plausibel. womit sich ein mit SCHWE1 vergleichbares Gesamtbild bestätigen ließe. womit die Zugehörigkeit zur Hg H bestätigt ist.h. Dieser Haplotyp ist ebenfalls bislang nicht in der Literatur bestätigt worden. dass der eigentliche Wert darunter liegt. Der Amplifikationserfolg kann mit 88. die für Bestimmung eines Haplotyps der Hg T3 diagnostisch sind. Eine einzelne kontaminierende Sequenz in Fragment IV kann dem Bearbeiter zugewiesen werden. Die post mortem Substitutionsrate von SCHWE4 liegt mit 17. 2003. Der Verlust der Alu I Schnittstelle an np 7025 konnte durch die RFLP-Analyse nachgewiesen werden. In einer Gesamtbetrachtung der Ergebnisse kann 177 . Diese finden sich nur in den mit UNG behandelten PCR-Produkte der Extraktion B wieder. Die Amplifikation des langen mtDNA Fragments sowie von nukleärer DNA blieb erfolglos.6‰ ähnlich hoch wie die der vergleichbaren Schwetzinger Individuen SCHWE1 und SCHWE2. einem bereits existierenden Haplotyp entsprechend. wohingegen die Sequenzen des Fragments IV die Positionen 16305T. so können eindeutig und reproduziert die Positionen 16126C. Eine weitere Linie (16309G) mit sieben Klonsequenzen findet sich in Fragment III der Extraktion A. 2001). Sehr wahrscheinlich handelt es sich hierbei um einen abgeleiteten Haplotyp der in Europa häufigen Hg H 16304C. was sich vor allem in den Versuchen mit UNG bestätigt. so dass eine Einordnung im Sinne eines phylogenetisch sinnvollen Ergebnisses. Letztere finden sich in dieser Kombination bislang nicht in Rezentdaten wieder (Richards et al.Diskussion Kontaminationsquelle identifiziert werden. 16304C durch zwei bzw. Die endogene DNA liegt nur noch in stark fragmentiertem und modifiziertem Zustand vor. 16294T. Die post mortem Substitutionsrate liegt mit 22. 16292T.B. in welchen eine geringe Ausgangsmenge intakter kontaminierender Moleküle scheinbar bevorzugt amplifiziert wird. welche ebenfalls authentische Ergebnisse aufweisen (z. nicht vorgenommen werden kann. Die kontaminierenden Linien unterscheiden sich im überlappenden Bereich. SZA23 2 und DON1).1% ebenfalls einen hohen Anteil an kontaminierenden Sequenzen. so können in den verbleibenden 60 Klonsequenzen die Positionen 16286T. Die 17 betreffenden Sequenzen stammen aus UNGbehandelten PCR-Produkten der Fragmente III und IV der A-Extraktion. Die 77 Klonsequenzen des Individuums SCHWE4 zeigen mit 22. Pfeiffer et al.6‰ ebenfalls überdurchschnittlich hoch. 16362C aufweisen. kann jedoch nicht näher eingegrenzt werden. d. Die Ergebnisse der SAXS-Analyse zeigen für die Indices der Struktur und Dicke der Mineralkristalle im Knochen vergleichbare Werte mit anderen Proben. 2000.h. Nukleäre DNA sowie das lange mtDNA Fragment V konnten nicht nachgewiesen werden.

16296T der Hg T feststellen. Eine Substitutions. 16126C. sind sie nicht nur innerhalb eines Fragments aus unabhängigen Extraktionen mehrfach bestätigt.2% führt (siehe auch Kap. dass bei ausreichender Anzahl der unabhängigen Wiederholungen eines Experiments auch durch die Direktsequenzierung valide Ergebnisse zur Haplogruppenbestimmung erzielt werden können (Kategorie 2). jedoch hauptsächlich aus Gründen der Reproduzierbarkeit. Eine Amplifikation nukleärer DNA sowie des mtDNA Fragments V blieb erfolglos. Fragment III zeigt in allen 11 Klonsequenzen der Extraktion die abweichende Position 16309G. vier PCR-Versuche bestätigt. Im Rahmen der Direktsequenzierung bleibt ein genauere Definition dieser Position jedoch spekulativ. Mögliche Beeinträchtigung bzw. welche für Hg J charakteristisch sind.Diskussion somit. Die Sequenzen derselben stimmen bis auf Fragment III mit denjenigen der Extraktion A überein. Die 90 Klonsequenzen des Individuums SEE1 des linearbandkeramischen Fundortes Seehausen zeigen in den mtDNA Fragment I und II eindeutig und reproduzierbar die Positionen 16069T. Einschränkungen der Reproduzierbarkeit eines Ergebnisses durch post mortem Sequenzveränderungen oder durch kontaminierende Sequenzen lassen sich jedoch nur bedingt feststellen. Die PCR-Produkte des Individuum SCHWE5 wurden lediglich direkt sequenziert. allerdings wurden für jedes Fragment mindestens drei unabhängige PCR-Reaktionen herangezogen. Die Amplifikationen der mtDNA Fragmente I-IV der B-Extraktion wurden unter Verwendung von UNG durchgeführt. 6. somit liegen für SCHWE5 lediglich die Ergebnisse der Direktsequenzierung zur Bewertung vor. sondern zusätzlich durch die Produkte des überlappenden Nachbarfragments.B. Kontaminationsrate auf Basis von Klonsequenzen kann daher nicht zum Vergleich herangezogen werden.2). der sich deutlich in der hohen post mortem Substitutionsrate. eines von sieben PCR-Produkten der Fragmente III und IV zusätzlich zu den beschriebenen Positionen auch 16304C. Halberstadt und Kretuonas – kongruente Einzelergebnisse bezüglich der Güte der noch erhaltenen DNA. Eine entsprechende Position konnte nicht unter den Bearbeitern gefunden werden. für das Individuum SCHWE4 vom Erhalt endogener DNA-Sequenzen ausgegangen werden (Kategorie 4).1.bzw. deren unterschiedliche Sequenzen ebenfalls für eine Authentizität der Einzelergebnisse und gegen eine mögliche systematische Kontamination sprechen. Im Falle von Schwetzingen kann jedoch insgesamt von einem fortgeschrittenen Zustand der DNAFragmentierung sowie DNA-Modifizierung gesprochen werden. Für das Individuum SCHWE5 wurde eine alternative Reproduktionsstrategie angewandt. So zeigt z. Der Amplifikationserfolg der vier kurzen Fragmente I-IV liegt bei 100%. was möglicherweise auf eine kontaminierende alternative Hg T-Sequenz zurückgeführt werden könnte. In den Sequenzen lassen sich eindeutig und reproduzierbar die Positionen 16126C.wie Derenburg. womit der Ursprung der 178 . Hervorzuheben ist hierbei vor allem die Häufung der T-Haplotypen. Die Positionen sind durch zwei bzw. 16294T. Zusammenfassend lässt sich sagen. was zu einer Kontaminationsrate von 12. Die untersuchten Individuen des linearbandkeramischen Gräberfelds Schwetzingen zeigen in der vergleichenden Betrachtung . (eingeschränkt) im Amplifikationserfolg sowie in der Anfälligkeit für Kontaminationen beim Einsatz von UNG niederschlägt. Da diese Positionen in überlappenden Bereichen liegen. Trotz dieses weniger guten Erhaltungszustandes lassen sich eindeutige Ergebnisse erzielen.

Der Amplifikationserfolg der Probe liegt bei 100% und auch das lange Fragment V konnte einmalig erfolgreich amplifiziert werden und den bestehenden Haplotyp I belegen. 16257A. der Erhalt von authentischer DNA postulieren (Kategorie 2). In der Gesamtbetrachtung aller Einzelergebnisse ist für das Individuum SZA23 2 der Erhalt von authentischen DNA Sequenzen (Kategorie 2) als sehr wahrscheinlich anzunehmen.8% und die post mortem Substitutionsrate bei 6. 16261T sind konsistent in allen unabhängigen Versuchen nachweisbar. ohne jedoch die Position 16223T zu bestätigen. Der allgemeine Amplifikationserfolg der vier kurzen mtDNA Fragmente liegt bei 81. wenngleich die weiteren Ergebnisse der Sequenzauswertung auf eine sehr reduzierte Anzahl qualitativ gut erhaltener Moleküle hindeuten. Die Amplifikation von nukleärer DNA ergab eine valide STR-Typisierung für fünf von zehn der untersuchten loci. Weitere drei Sequenzen im dritten Fragment zeigen wiederum Position 16223T ohne 16311C zu bestätigen. Der scheinbar außerordentlich gute Erhaltungszustand der DNA der Probe spiegelt sich zum einen in einem Amplifikationserfolg von 100% wider und zum anderen im reproduzierbaren Nachweis von neun von zehn loci der STR-Genotypisierung (~280bp). Da zum Zeitpunkt der Probennahme die untersuchten Wurzeln der Molaren noch im festen Verbund und geschützt in den Alveolen vorlagen. Insgesamt betrachtet lässt sich. Möglicherweise handelt es sich hierbei um eine Rückmutation der Position 16311 durch eine Deaminierung.3%) Unterschiede zu den reproduzierten Positionen 16126A. die als Haplotyp der Hg I bestimmt werden können. Die Werte für die Indices der Kristalldicke und -struktur des Knochenminerals weichen nur in geringem Maße von der rezenten Vergleichsprobe ab. kann im Rahmen einer Gesamtbetrachtung aller Ergebnisse sowie der Probengeschichte vom Erhalt authentischer DNA ausgegangen werden (Kategorie 1). zeigen in Fragment III np 16311C. 16223T. Die Positionen 16223T. Die kontaminierenden Sequenzen entsprechen in Fragment I der CRS bzw. da die Werte der Indices annähernd denjenigen der rezenten Vergleichsprobe entsprechen. 16391A. Die Amplifikation des 440bp langen Fragments V ist ebenfalls aus beiden Extraktionen erfolgreich möglich und kann die Positionen des Haplotyps N9a bestätigen.34) widerspiegelt. Die post mortem Substitutionsrate entspricht mit 13‰ dem durchschnittlichen Wert aller untersuchter Individuen. 16357C. Von den 60 Klonsequenzen des Individuums SZA23 2 zeigen fünf Sequenzen (8.6‰ leicht unter dem Durchschnitt. Auch die morphognostische Beurteilung des Erhaltungszustandes der bearbeiteten Molaren kann als sehr gut bezeichnet werden.92‰ weit unter dem Durchschnitt von 13‰. was sich in der sehr niedrigen Sättigungsrate (0. 16311C. In den Klonsequenzen lassen sich einzelne post mortem Artefakte konsistent in mehreren Klonen verfolgen. Die Ergebnisse der SAXS-Analyse bestätigen den möglichen Erhalt intakter DNA.Diskussion Kontamination ungeklärt bleibt. Die post mortem Substitutionsrate der Probe liegt mit 10. In den Klonsequenzen des Individuums SZA23 1 des ungarischen Fundortes Szarvas 23 können keine kontaminierenden Sequenzen festgestellt werden. Die Amplifikation von nukleärer DNA und des langen mtDNA Fragments V blieb ohne Erfolg. aufgrund der Reproduzierbarkeit der Sequenzpositionen in Kombination mit den Ergebnissen der Diagenesestudie. 179 .

von anderen divergierende. 180 . allerdings nicht in allen Fragmenten.5% ist nur bedingt aussagekräftig. weitere Raten wurden daher nicht ermittelt. Die 101 Klone des linearbandkeramischen Individuums UNS2 enthalten mit 41. können 36 dem Haplotyp des Bearbeiters (16189C. der aufgrund des Ausschlusses der zahlreichen. 16343G als Haplotyp der Hg U3 bestimmt werden. woraus eine Limitierung der Ausgangsmolekülzahl zu erkennen ist. die als kontaminierend definiert wurden. so dass auch im Falle des Fundortes Szarvas 23 von kongruenten Ergebnissen gesprochen werden kann.Diskussion Vom Fundort Szarvas 23 der Körös-Kultur wurde eine weitere Probe (SZA23 3) im Rahmen der Diplomarbeit von Guido Brandt (2005) untersucht.1. 16292T der Hg W. Nukleäre Genorte zur eindeutigen Identifizierung der Kontaminationsquelle mittels STR-Genotypisierung können allerdings nicht erfolgreich amplifiziert werden. Von den insgesamt 42 Sequenzen. Diese zeigt ebenfalls eindeutige und valide Ergebnisse sowohl der mitochondrialen HVR I als auch der nukleären Genorte der STR-Genotypisierung. welche in Fragment III der CRS entspricht. Im Rahmen der Gesamtbetrachtung kann die Authentizität der Sequenzen (Kategorie 2) und die resultierenden Haplotypenbestimmung des Individuums VAI3 aufgrund der eindeutigen Reproduzierbarkeit der definierenden Mutationen als sicher gelten. 16311C) zugeordnet werden. Die verbleibenden Sequenzen können eindeutig und reproduzierbar durch die Positionen 16319A. so dass sie jeweils durch vier unabhängige Versuche bestätigt werden können.im überlappenden Bereich von Fragment III und IV gelegen . 6.6% den zweitgrößten Anteil an kontaminierenden Sequenzen (vgl. Der Amplifikationserfolg von 90. In der Gesamtbetrachtung lässt sich hier ein Fall an DNA-Erhaltung im „Grenzbereich“ beschreiben. Die Kontamination durch den Bearbeiter lässt sich ebenfalls in beiden unabhängigen Extraktionen finden. dass die Kontamination der Probe in den Arbeitsschritten vor der Extraktion stattgefunden hat.durch vier unabhängige Versuche bestätigt sind. da sie .1%). Enz findet sich nur eine. d. zeigt jedoch auch den Haplotyp des Bearbeiters. Die Amplifikation des langen mtDNA-Fragments V ist in einem Fall erfolgreich. Aus diesem Grund muss davon ausgegangen werden. Kap. aber identifizierbaren kontaminierenden Sequenzen und der eindeutigen Reproduzierbarkeit der Hg W als authentisch im Sinne der Kategorie 5 angesehen werden kann. Der Amplifikationserfolg der vier kurzen mtDNA Fragmente liegt bei 82%. Diese Positionen liegen innerhalb der überlappenden Bereiche der Fragmente II und III sowie III und IV. Die visuelle Überprüfung der putativen authentischen Sequenzen zeigt eine starke Modifizierung der Sequenzen mit bis zu 13 Deaminierungen in einzelnen Fällen. weitere fünf zeigen die mehrfach beobachtete Position 16309G und eine weitere Sequenz des Fragments IV entspricht der CRS. Sequenz (2.2. die visuelle Überprüfung der Basensubstitutionen deutet jedoch aufgrund konsistenter Deaminierungen von Cytosinen in mehreren Klonsequenzen auf keine Sättigung der Klone hin. Die Berechnung der post mortem Substitutionsrate wurde nicht durchgeführt. Das lange mtDNA-Fragment V sowie nukleäre Genorte können nicht erfolgreich amplifiziert werden. Die verbleibenden Sequenzen zeigen reproduzierbar die Positionen 16223T. Abbildung 22). In den 47 Klonsequenzen des Individuums VAI3 des linearbandkeramischen Fundortes Vaihingen a.

ausreichend. Bereits jetzt zeigen diese Studien. da gleichermaßen eine Konfliktsituation mit der Mutation 16320T entsteht. Parallelmutationen im Bereich der HVR I verflacht sein kann.Diskussion 7. T und J. Finnilä et al.3. da sie zumindest in heutigen Referenzgebieten eine homogene Verbreitung aufweisen. K. deren Ausprägung ansonsten durch Rück. Eine Ausnahme bildet das Individuums ECS1. UWS5) sowie der zeitgleichen Alföld Linearbandkeramik (ECS1) dar. FLO1.2 Die Haplogruppen der neolithischen Individuen Haplogruppe N1a Die Hg N1a stellt mit 24% die häufigste Hg innerhalb der neolithischen Individuen im Bereich der LBK (DEB1. DEB3. Möglicherweise stellt diese Position eine Parallelmutation im europäischen Zweig der Hg N1a dar. 2005.bzw. 2005). deren Sub-Hgs Gradienten innerhalb Europas zeigen (Loogväli et al. Herrnstadt et al. Meist muss letztere zugunsten der Vergleichbarkeit niedriger angesetzt werden. 4) der vorliegenden Arbeit ist jedoch die phylogeographische Auflösung. Im Vergleich mit mtDNA-Daten aus modernen populationsgenetischen Studien fällt auf.1 Die phylogenetische und phylogeographische Auflösung der mtDNA In näherer Zukunft wird die zunehmende Anzahl an Gesamtsequenzierungen des mtGenoms eine sehr hohe Auflösung der mtDNA Variabilität bieten. Kap. Hinzu kommt. aus verschiedenen Publikationen ersichtlich wird (Ingman et al. welches die charakteristische Mutation 16189C des asiatischen N1a-Zweigs zeigt. dass in vielen Studien zu rezentgenetischen Verteilungsmustern nicht immer eine vergleichbar tiefe phylogenetische Auflösung vorliegt. dass die höchstmögliche Auflösung der mtDNA auch deutlichere phylogeographische Muster ergibt. Als Beispiel kann hier die detaillierte Auflösung der Hg H genannt werden. ein Gefälle innerhalb der Frequenzen.3 Zur Populationsgenetik der ersten Bauern im frühen Neolithikum 7.B. Die neolithischen 181 . Nicht alle europäischen Haplogruppen zeigen im Rahmen der derzeit bekannten phylogenetischen Auflösung ein phylogeographisches Muster bzw. wie z. 2001). Hgs auch bezüglich der Besiedlungsgeschichte Europas während des frühen Neolithikums nur eingeschränkt aussagekräftig.2% zu finden ist (Abbildung 41). Achilli et al. Dies betrifft im Rahmen der vorliegenden Arbeit vor allem die Haplogruppen H. 2002. 2000. Alle neolithischen N1a-Individuen sind im europäischen Zweig des phylogenetischen Netzwerks zu finden. welche zur weiteren Interpretation zur Ursprung und Verbreitungsrichtung(en) einer Hg Hinweise geben können. Im Hinblick auf die Fragestellungen (vgl. dass Hg N1a in heutigen europäischen Bevölkerungen nur noch mit einer Häufigkeit von durchschnittlich 0.3. Pereira et al. Daher sind einige Haplotypen bzw. HAL2. 2004. 7. welche die Haplotypenanalyse auf der Basis der Sequenzierung der HVR I und der RFLP-Analysen diagnostischer kodierender Bereiche liefern kann.

Die Kreise entsprechen proportional der lokalen prozentualen Häufigkeit an N1a Haplotypen. Russland (Richard Villems. 2004) sowie bei fünf Individuen aus Estland (Sajantila et al. Kap. Die Mehrzahl der durch eine weitere Mutation abgeleiteten Formen dieses häufigen Haplotyps findet sich heute in Europa. Deutschland (Pfeiffer et al. wobei der kleinste Kreis 0. 2000. 2002). Die Koaleszenzzeitberechnung für das sternförmige Muster der 182 . Frankreich (Richard Villems. unpubliziert). Abbildung 36). Ungarn (Lahermo et al. weshalb hierfür eine Verbreitung in Europa angenommen werden kann. 2000). Identische Haplotypen zum zentralen Haplotyp des Individuum DEB1 finden sich in der Rezentbevölkerung bei einem Individuum aus Armenien (Richards et al. Tschawasch (Bermisheva et al. 2003). der Schweiz (Forster 1996). Verbreitung der drei Zweige der heutigen N1a Haplotypen. Nodien. Die Haplotypen der bislang undokumentierten Nodien.18% entspricht. Richard Villems.3. Die durch eine weitere Mutation von UWS5 abgeleiteten N1a Linien finden sich rezent in Norwegen (Opdal et al. 2004). zeigen eine deutliche europäische Affinität. Interessanterweise stellt dieser Haplotyp im Netzwerk die Verbindung zum afrikanisch/südwestasiatischen Zweig der Hg N1a dar.Diskussion N1a Individuen . 1995. 2001) und in einer kroatischen Minderheit im italienischen Molise (Babalini et al. 2000) und einem Individuum aus Ägypten (Krings et al. 5. bei Individuen aus dem Iran (Richards et al. Metspalu et al. die heute nicht mehr dokumentiert sind (vgl. Der Haplotyp der Individuen DEB3 und FLO1 findet sich insgesamt 13 mal wieder. Blaue Kreise entsprechen dem europäischen Zweig. welche die linearbandkeramischen Individuen HAL2 und UWS5 einnehmen. 2000) und Norwegen (Passarino et al. 1999). Die abgeleiteten Linien von HAL2 finden sich in Portugal (Pereira et al. 2005). Abbildung 41. unpubliziert). orangefarbene Kreise dem zentralasiatischen Zweig und grüne Kreise dem afrikanischen/südwestasiatischen Zweig des N1a Netzwerk aus Abbildung 36.außer ECS1 .belegen zentrale Nodien bzw.4. 2004). 1998). unpubliziert). zwei Individuen aus Jemen (Kivisild et al. der Slowakei (Koledová 2005). Turkmenistan (Quintana-Murci et al.

dass der asiatische N1a Zweig dem paneuropäischen zentralen Haplotyp entspringt.5) und der geographischen Verteilung der N1a Haplotypen. Baig et al. Dies ist zum einen ein skythenzeitliches Individuum (Ricaut et al. Die N1a Haplogruppen des südwestasiatischen/afrikanischen Zweiges finden sich heute hauptsächlich in Jemen. 6. dass die Verbreitung der asiatischen N1a Typen von Europa aus erfolgt sein muss. fallen die Werte der Standardabweichungen (hier in Jahren) sehr groß aus. 2002). 2002). Die eigentlichen asiatischen Linien. 1997). Die Koaleszenzzeit für den nicht sternförmigen afrikanisch/südwestasiatischen Zweig der Hg N1a beträgt 23. unpubliziert). dem auch DEB3 und FLO1 angehören. Da die Datenanzahl verhältnismäßig klein ist. kann nur bedingt von einer Monophylie dieses Zweiges ausgegangen werden. 2004) zieht hierfür die lange historische Beziehung der Populationen um das Rote Meer und den Golf von Aden heran. 2004) und auch in Griechenland und in Kabardino-Balkarskaja im Kaukasus (Richards et al.Diskussion betreffenden Linien beläuft sich auf 10.294 ± 7865 Jahre. Die Expansion des zentralasiatischen bzw. wofür er die geringe Variabilität der afrikanischen Linien (die häufigste zentrale Nodie im Netzwerk) im Vergleich zu den jemenitischen N1a Linien. in der 183 . Die Tatsache. wenn der häufigste asiatische Haplotyp miteingerechnet wird. 2003). 1995. unpubliziert). 14.B. Insgesamt kann anhand der Daten der Hg N1a festgestellt werden. Da Hg N1a in den rezenten Populationen vergleichsweise selten zu finden ist. bei den Udmurten (Richard Villems. die durch die Mutation 16189C charakterisiert sind. 2000). unpubliziert) und auch unter den Komi-Permjaken (Bermisheva et al. 2003). welcher in einem Parallelprojekt der Arbeitsgruppe untersucht wurde. Kasachen und Russen (alle Richard Villems. da jedoch nur wenige Daten vorliegen. Darüber hinaus finden sich in Westasien auch einige europäische N1a Linien. Eritrea (Kivisild et al. 2004). finden sich bei den turksprachigen Bashkiren.849 ±.8506 Jahre. und zum anderen durch die eindeutig spätere Expansionszeit der asiatischen N1a-Linien. 2000). lässt sich folgern. Eine Gesamtsequenzierung eines bzw. Komi-Permjaken und Tschawaschen (Bermisheva et al. Tigrinen und Gurages zu zählen sind. Kalmyken. wie z. dass die nordostafrikanischen N1a Linien zu den semitisch-sprechenden Amhara.763 ± 3429 Jahre bzw. Somalia (Watson et al. Anhand des Netzwerkes (Abbildung 36. 2002) und bei den Burjaten (Pakendorf et al. dass die Hg N1a eine ungewöhnlich weite Verbreitung aufweist und dass trotz dieser Verbreitung eine ausgeprägte genetische Verbindung der pan-eurasischen Populationen besteht bzw. Tansania (Knight et al. Er sieht die afrikanischen N1a Linien als sekundär nach Nordostafrika verbreitet an. Äthiopien. Altai (Derenko et al. mehrerer N1a mt-Genome steht noch aus und sollte weiteres Licht in die phylogenetische Beziehung der N1a Topologie bringen. Zum einen wird dies dadurch gestützt. Kap. Indien (Mountain et al. der Türkei (Tambets et al. kann als weiteres mögliches Indiz für eine spätere Verbreitung nach Afrika gesehen werden. Kivisild (et al. 2004). Turkmenen (Richard Villems. Interessanterweise finden sich in der Nodie der häufigsten asiatischen Linie auch zwei (prä-)historische Individuen. die ebenfalls europäische Haplotypen aufweisen. unpubliziert) und Tschawaschen (Bermisheva et al. bestehen nur vereinzelt Daten zu weiterauflösenden coding region Mutationen. 2003) und zum anderen ein Individuum aus einem sarmatischen Kurgan (Joachim Burger. anführt. westsasiatischen N1a-Zweiges lässt sich auf 5765 ± 3813 Jahre datieren.

bleibt abzuwarten. Yao et al. Es ist bekannt. FLO5. D4a Die hohen Frequenzen der asiatischen Hg N9a. K und T liegen kaum detaillierte Rezentdaten auf der Basis von Gesamtsequenzierungen des mt-Genoms vor. Abbildung 37). J (SEE1. EIL1. Lahermo et al. mehrmals von innerasiatischen Bevölkerungsgruppen. U3 (VAI3). HAL3. 1998). D4a in der Körös-Kultur (jeweils 10%) sind möglicherweise auf die geringe Stichprobengröße zurückzuführen und könnten in einer repräsentativen Stichprobe niedriger liegen. SCHWE 1. 2005. W (UNS2) und I (SZA23 2) ist insgesamt zu gering. 2002a. Aus diesem Grund müssen die gewonnenen Daten umso mehr dem kritischen Vorwurf standhalten. SZA23 3). Die beiden asiatischen Hgs stellen innerhalb der Körös-Stichprobe ein unerwartetes Ergebnis dar. 16257A. so z. insbesondere das Karpatenbecken. welche in (Nord-) bzw. d. Awaren und den Magyaren besetzt bzw. T (FLO4. 16261T) der Hg N9a (vgl. drei Nanai (alle Richard Villems. Der Haplotyp der Probe SZA23 1 entspricht der zentralen bzw. DBK1). 184 . d. FLO6 UWS2. es finden sich keine asiatischen Hgs im maternalen Genpool der heutigen ungarischen Bevölkerung. Inwieweit diese einer (einzelnen) geschichtlichen Epoche bzw. END119). DKF1). Daher ist es durchaus vorstellbar. SCHWE4. d. FLO2. Die Haplogruppen N9a. wie in unserem Fall der Neolithisierung. END6 2. wie den Skythen. Eine genaue Entsprechung des Haplotyps findet sich u.a. Für die im eurasischen Raum häufigen Haplotypen der neolithischen Individuen mit den Hgs J. K (DEB2. 2004). Han-Chinesen (Yao et al. unpubliziert) sowie einem Uighuren (Yao 2000). 2000. anzestralen HVR I Sequenz (16223T.Diskussion Vergangenheit bestanden haben muss. Ostasien die größte Häufigkeit zeigt (Wen et al. zugeordnet werden kann.a. 2004) und Kirgisistan (Comas et al. 2004). in einem Individuum aus Kirgisistan. charakteristische asiatische Hgs zu finden sind. U3. welche heute in Südostasien ihre höchste Frequenz (2-8%) aufweist (u. Die genauere Betrachtung von populationsgenetischen Studien der heutigen Bevölkerungsgruppen Ungarns zeigt jedoch ausnahmslos eine charakteristisch europäische Verteilung der Haplogruppenfrequenzen (Semino et al. dass im mitochondrialen Genpool der modernen Bevölkerung Ungarns innerasiatische Einflüsse. END6 1. dass das heutige Gebiet Ungarns. Tanaka et al. 2005. 16362C) stellt ebenfalls die anzestrale HVR I Sequenz der Sub-Hg D4a von Hg D4 dar. 2002a) und Yao-Chinesen (Wen et al.h. 2005). Die Haplogruppen H. in Usbekistan (Quintana-Murci et al. Hunnen. Der Haplotyp der SZA8 2 (16129A. jedoch vereinzelt auch in westasiatischen Bevölkerungen zu beobachten sind. J. als dass allein von Seiten der Haplogruppen weitreichende Aussagen zur geographischen Herkunft der Individuen gemacht werden könnten. 16223T. eines bestimmten Prozesses. T.h. 2 und 5. I und W Die phylogenetische Auflösung der Individuen der Hg H (ASP2. sie seien Beweise für eine Kontamination mit moderner DNA von Probengebern. K. besiedelt wurde (Kiszely 1979). 2000). Wen et al.h. Tanaka et al.B.

Haplogruppe K Die Haplotypen der Hg K von drei neolithischen Individuen (DEB2. welcher überall in Europa häufig ist (vgl. FLO5. 16126C. dass dessen Expansion zeitlich weiter zurückliegt.Diskussion Haplogruppe J Die Individuen der Hg J (SEE1. 16126T der Hg J. die den anzestralen Haplotyp der Hg J darstellen. Richards gibt als Koaleszenzzeit für die Hg K und damit für den anzestralen Typ 10. Abbildung 42. Dennoch kann eine Verbreitung der mtDNA-Linien J1a und J1b1 im Rahmen der Verbreitung der bäuerlichen Lebensweise nicht ausgeschlossen werden. finden sich nicht in der neolithischen Stichprobe. für die Richards & Macaulay eine europäische Expansion postulieren. Absolute Häufigkeiten des anzestralen Haplotyps der Hg J (modifiziert mit freundlicher Genehmigung von Peter Forster. Richards & Macaulay 2000). da sie zu Beginn ihrer Expansion mit Sicherheit noch in geringerer Frequenz vorlagen und sich die Auswirkung der Expansion erst in den nachfolgenden Epochen deutlicher manifestiert haben kann. 16126C. 16261T). mtradius database 2005). Der schwarze Kreis lokalisiert den aus den Daten geschätzten Verteilungsursprung (centre of gravity). Ein Fehlen der beiden Sub-Hgs kann daher auch aus stochastischen Gründen angenommen werden.000-15. Der K-Haplotyp (16224C. 16172C. 16145A. 16311C) der Individuen UWS2 und FLO6 weicht durch die Mutation 16249C vom anzestralen Haplotyp ab. Bemerkenswerterweise ist diese Linie sehr selten im eurasischen 185 . DKF1) zeigen beide die HVR I Sequenz 16069T. Dieser Haplotyp ist mit 41% der häufigste innerhalb des Astes der Hg K (Richards et al. Abbildung 42. Helgason et al. anzestralen HVR I Sequenz (16224C. 16311C) der Hg K. 2000). 16261T) und J1b1 (16069T. 2000. 16145A. Die grauen Kreisflächen entsprechen proportional der absoluten Häufigkeit des Haplotyps 16069C. daher kann angenommen werden. so kann deren Einfluss auf den europäischen Genpool als gering betrachtet werden. Dabei ist jedoch kein Gefälle innerhalb Europas zu beobachten. Das phylogenetische Netzwerk der Hg K ist nicht sternförmig. Sollten die beiden Individuen SEE1 und DKF 1 als Anteil der Gründertypen zu rechnen sein. END119 1) entsprechen der zentralen bzw.000 Jahre an. Die Sub-Hgs J1a (16069T. 16249C. 16231C. 16222T. 16126C.

kann für dieses Gebiet der LBK kein nahöstlicher Einfluss festgestellt werden. HAL3 und FLO4 finden sich überall in Eurasien verteilt (Richards et al. h. obwohl deren Frequenz (2. 2004). 2000. Richards et al. da dieser bislang unbekannt ist. 16343G) des Individuums VAI3 lassen sich keine detaillierten Aussagen zur Herkunft treffen. 2005. unpubliziert). oder aber es reflektiert die Tatsache. die der verschiedenen Sub-Hgs T2 zugeordnet werden können. Tambets et al.. nicht in der prähistorischen Stichprobe zu finden ist. deren anzestrale Haplotyp weist jedoch eine Expansion vor 10. Auch die übrigen T2-Linien der Individuen SCHWE1 & 5. 2000). 186 . In Europa selbst findet sich nur eine durch eine Mutation an np 16180 abgeleitete Variante in Italien (Babalini et al. weist eine weite Verbreitung in Eurasien auf. 2004). Da sich die Expansionszeit von Hg U3 und das mögliche Ursprungsgebiet der Verbreitung mit dem Beginn des Neolithikums decken. Babalini et al. Behar et al. unpubliziert). 2000) und findet sich häufig in Europa sowie im Iran und in Indien (Metspalu et al. Die Hg U3 ist nicht sehr häufig. Es kann angenommen werden. kann Hg U3 durchaus als potentieller Träger der bäuerlichen Lebensweise betrachtet werden. von der VAI3 durch die Mutation 16319 abgeleitet ist. der zentralmediterranen Stichprobe von Richards (et al. dass die Expansion von T1 sich erst in postneolithischer Zeit im europäischen mtDNA-Pool manifestierte. Haplogruppe U3 Zum U3 Haplotyp (16319A.362.3%). der Kaukasus-Region (Richards et al. Da T2 sehr wahrscheinlich eine postglaziale Verbreitung in Europa erfahren hatte (9300-16. Sie findet sich sowohl von Portugal im Westen (Pereira et al.800 Jahre v. Der Haplotyp des Individuums SCHWE2 wird in der Literatur auch als T3 oder T2c bezeichnet (Koledová 2005. dass diese Linie entweder ausgestorben ist oder noch nicht dokumentiert wurde. Es ist jedoch bemerkenswert.8%) im gesamteuropäischen Datensatz von Richards der der Hg T2 (2. Diese anzestrale Linie.4%) entspricht. der weitere Aussagen zuließe.200 Jahre v. h.) und zudem der Fundort Schwetzingen als mittel. 2000).Diskussion Genpool und findet eine genaue Entsprechung nur in einem Individuum einer Stichprobe von Uighuren (221 Individuen) und in einem weiteren in einer Stichprobe von 161 Usbeken (Richard Villems. Haplogruppe T Die Individuen der Hg T zeigen allesamt unterschiedliche Haplotypen. dass die verwandte Hg T1.72 Jahren auf. Möglicherweise stellt das Fehlen von T1 ein stochastisches Problem der kleinen Stichprobe dar. 2000) als auch in der Altai Republik in Zentralasien (Richard Villems. Richards datiert das Alter des T1 Zweigs auf 6100-12. 2005) bzw.7 ± 3197. 2000) und im Iran (Metspalu et al. Interessanterweise finden sich die meisten T2-Individuen in Schwetzingen und Flomborn am westlichen Rand des LBK-Verbreitungsgebietes. 2000. Die höchste Frequenz des anzestralen Haplotyps findet sich heute in der Türkei. 2004) und zeigen in der gegenwärtigen phylogenetischen Auflösung keinen geographischen Schwerpunkt. Die Frequenz von T1 ist im Nahen Osten mit 4 % deutlich höher als in Mitteleuropa (2.bis spätlinearbandkeramisch anzusehen ist. Koledová 2005. die neben J und U3 als potentieller genetischer Anteil des neolithic package beschrieben wird (Richards et al.

der Türkei und dem Iran (Richards et al. finden sich in den Sub-Hgs H1. da bereits gezeigt werden konnte. Sequenzierung und Klonierung diagnostischer Abschnitte nötig sein. an. 46% der Hg H-Variation bildet (Pereira et al. 2000. H* zugeordnet werden. was für eine postglaziale Expansion spricht. dagegen ist H1 im Nahen Osten nur zu 6% vertreten und beinhaltet 14% der Hg H Variation (Loogväli et al. Individuen. H7 bzw. 16304C) ist bislang undokumentiert. Tambets et al. welcher durch die Limitierungen der aDNA unweigerlich entsteht.Diskussion Haplogruppe H Da die feinere phylogenetische Aufschlüsselung der Hg H erst aktuell erfolgt ist (Looväli et al. Am häufigsten ist H1 auf der Iberischen Halbinsel vertreten. Für die Hg V wird eine postglaziale Expansion aus dem frankokantabrischen Refugium angenommen (Torroni et al. 1998. Richards et al. H5a. H2*. 2005). Haplogruppe HV Die Hg HV der Individuen DEB4. Der Haplotyp des Individuums SCHWE4 (16286T. DEB5.h.200 Jahre v. ist theoretisch die genaue Einordnung der neolithischen Individuen der Hg H möglich. 2005). Als Koaleszenzzeit des Zweiges H5* gibt Loogväli 12. allerdings nur durch weiterführende Analysen im kodierenden Bereich der mtDNA. 2000) vorkommt. da sie mit einer deutlich höheren Frequenz in Westeuropa (~20% bei Basken und Katalanen Spaniens) zu finden ist. dass die häufigen post mortem Mutationen auch die Schnittstellen eines Enzyms betreffen können (Haak et al. da diese mit 30% die häufigste Sub-Hg innerhalb der Hg H darstellt und ca. Pereira et al. die dem Anspruch des geringsten Aufwandes an Probenmaterial gerecht werden kann. 2004). H4 und H* (Loogväli et al.7% im Datensatz von Richards et al. welche in der HVR I der CRS entsprechen (ASP2. FLO3 und SZA8 1 ist wenig bekannt. 13% des gesamteuropäischen Genpools ausmacht (Loogväli et al. dagegen jedoch sehr selten im Nahen Osten. 2004). SZA23 3) können den Sub-Hgs H1. 2004). H3. wie z. 2000) und im Kaukasusgebiet (Metspalu et al. H2a. H2a. Hierzu wird zunächst die Etablierung einer hierarchischen RFLP-Analyse bzw. da sie in vielen europäischen Bevölkerungen nur in geringen Frequenzen (1. 2000. H4. welche wie FLO2 in der HVR I die Mutation 16093C zeigen. 2004. EIL1. 2004). Eine 187 . Metspalu et al. in der Türkei (Tambets et al. Sehr wahrscheinlich kann aufgrund der Häufigkeiten im rezenteuropäischen mtDNA-Pool auch für FLO2 die Zugehörigkeit zu SubHg H1 angenommen werden. wo diese Sub-Hg ca. 2004). 2004). 2001). Als Koaleszenzzeit der Hg H1 gibt Loogväli 13. Sehr wahrscheinlich ist dieser Haplotyp eine durch die Mutation 16286T abgeleitete Variante der Sub-Hg H5* bzw. Die Individuen. END6 1 &2. Torroni et al. zeigt rezent eine paneurasische Verbreitung. Mit großer Wahrscheinlichkeit sind sie der Hg H1 zuzuordnen. die in der HVR I durch die Mutation 16298C gekennzeichnet und mit einer Frequenz von 1-6% in Europa vertreten ist. 2004.700 ± 4. Haplogruppe V Der Haplotyp V des Individuums HAL1 zeigt den anzestralen Haplotypen der Hg V. Weiterhin wird zu prüfen sein. findet sich jedoch am häufigsten im Iran (Metspalu et al. 2000. Der anzestrale Haplotyp dieses Zweiges. 1999).B.400 ± 3000 Jahre an. Achilli et al. der in HVR I nur durch np 16311C charakterisiert wird. inwieweit mehrere diagnostische coding region Mutationen durch RFLP-Analysen erfolgen können.

1998). wie z. Kap. Vor allem der Zweig U5b1 der sub-Hg U5b ist im heutigen Europa häufig und weit verbreitet. Haplogruppe I Der Sequenzhaplotyp 16129A. wo U5 nach Hg H die zweithäufigste Hg darstellt.400 Jahren an. 16223T. Haplogruppe W Der Haplotyp des Individuums UNS2 der Hg W zeigt ebenfalls die anzestralen Linie (16223T.und Nordeuropa verbreitet ist (Richards et al. die Diversität allerdings sehr gering ist (Torroni et al.400 Jahre vor heute. 1998). als im Nahen und Mittleren Osten (32. Haplogruppe U5 Die Individuen der nordosteuropäischen meso. da sich in den bislang veröffentlichten Daten nur eine Entsprechung in einem Individuum aus Deutschland findet (Lutz et al. 16270T) des Individuums DUD2 entspricht 188 . Der mutmaßliche Expansionszeitraum aus dem Rückzugsgebiet wird von Richard (et al. den innerasiatischen Steppen. 16311C. 2004).900 Jahren angegeben. Diese Variante kann zumindest heute als sehr selten bezeichnet werden. 2004). 1995.4). Die Individuen KRE1.400 ± 8300).000 ± 8700 Jahre v. neolithischen Vergleichsgruppe (KRE1.) weiter zurückreichen. LEB1) zeigen alle einen Haplotyp der Hg U5.100-28.5% zu erwähnen sind (Tambets et al. 16391A des Körös-Individuums SZA23 2 stellt innerhalb der Haplogruppe I eine abgeleitete Variante dar. Die übrigen mesound neolithischen Individuen der Paralleluntersuchung von Barbara Bramanti (vgl. Richards (et al. 2004). KRE2. wohingegen U5b2 vorwiegend in Westund Südeuropa und in Skandinavien zu finden ist (Tambets et al. Russland (Malyarchuk et al.B.9% gleichmäßig in Mittel. h. 2004. U5b2 eine detaillierte Auflösung der mtDNA coding region nötig wäre. Hg W ist mit einer geringen Frequenz von 1.900 ± 11.100-16. In sehr niedriger Frequenz (~0.Diskussion nordeuropäische Ausnahme bilden die Saami.300-58. DUD2. in Vorbereitung). Metspalu führt zudem eine erhöhte Frequenz von W in Westindien an und weist gleichzeitig darauf hin. Richards setzt für Hg I ein Alter von 32. woraus die Autoren auf einen Gründereffekt schließen.und Westeuropa vertreten. Tambets et al. Der putative Haplotyp (16189C. in Polen. Hg I ist mit einer niedrigen Frequenz (< 2%) in Europa vertreten. dagegen nimmt die Frequenz in (Nord-) Osteuropa zu (Richards et al. 16357A. bei welchen der Anteil an Hg V bei 40% liegt (Sajantila et al.3.8%) findet sich die Hg V auch in den turksprachigen Populationen Westasien bzw. DON1.bzw. KRE2 und DON1 können der Sub-Hg U5b zugeordnet werden. dass die errechnete Koaleszenzzeit in Indien (37. 2004). weisen bereits auf eine bemerkenswerte Häufung der Hg U5 im Baltikum bzw. wobei für eine eindeutige Zuordnung zu U5b1 bzw. 2000) und fällt in Zentralasien wieder unter 2% (Metspalu et al. 2000) datiert die Verbreitung in Europa auf 17. wobei sie im Gegensatz zu Hg W eher in West. 2000) vor 11. Der höchste Anteil an U5-Linien findet sich heute unter den finno-ugrisch sprechenden Bevölkerungsgruppen Nord-Nordosteuropas.) und in Zentralasien (27. Auch in den heutigen Populationen des vergleichbaren Gebiets zeigt U5 eine hohe Frequenz (9-11%). 2002) und Litauen (Kasperaviciute et al. CHE4.100 Jahre v. 1998. 2000). Bramanti et al. h. 5. die ebenfalls der Haplogruppe U5 angehören. 16292T) dieser Haplogruppe. Osteuropa im ausgehenden Mesolithikum hin. worunter besonders die Saami mit 42.

16270T. in Vorbereitung).B. 5. 16256T. 3. Richards et al. datieren. 189 .000 Jahre v. U5b2) durchaus ein sternförmiges Muster auf (Tambets et al. U5b1. findet jedoch in der modernen europäischen Bevölkerung eine exakte Entsprechung in Deutschland und Tschechien (Bramanti et al. datiert wird (vgl. h.000 Jahren v. vgl.3. Erstaunlicherweise lassen sich diese allesamt auf eine Koaleszenzzeit von ca. 2004.4. U5a. deren Koaleszenzzeit auf ca. Abbildung 42).Diskussion der häufigsten zentralen mtDNA von U5b1. in Vorbereitung). Kap.000-13. Der Haplotyp des Individuums LEB1 unterscheidet sich durch eine Transversion an np A16241C von dem häufigen anzestralen Haplotyp U5a1. Das phylogenetische Netzwerk von Hg U5 zeigt insgesamt betrachtet kein sternförmiges Expansionsmuster. Kap. 45. Der Haplotyp des Individuums CHE4 ist ebenfalls durch eine Mutation (16294T) von der zentralen Nodie abgeleitet.B. Der Haplotyp U5a1 (16192T. 11. klimatische Änderungen zum Ende des Oberen Pleistozäns (Tambets 2003). allerdings weisen die zahlreichen Sub-Hgs (z. h. U5a1.000-50. 16362C) des einzigen linearbandkeramischen U5-Individuums BRU4 findet eine genaue Entsprechung in 16 weiteren Individuen aus europäischen Populationen (Bramanti et al. Die Haplogruppe U5 kann als „Prototyp“ eines pan-westeurasischen cluster von Hgs angesehen werden (Tambets 2003). 2000). Ein synchrones Expansionsmuster bei allen Ästen der U5 Phylogenie kann nur durch umfassende Veränderungen hervorgerufen werden. wie z.3.

zentralasiatischen Haplogruppen beobachtet werden. wie er sich aus dem archäologischen Fundmaterial herleiten lässt. dass beide frühneolithische Kulturen als Hintergrund einen spätpaläolithisch bzw. Es kann somit zwar von einer grundsätzlichen genetischen Beziehung der beiden Kulturen gesprochen werden.Diskussion 7. kann anhand der vorliegenden Datenlage nicht erkannt werden. ob b) sich eventuell charakteristische Unterschiede zwischen den zu prüfenden genetischen Einheiten feststellen lassen? Hieraus ergibt sich folglich die abschließende Fragestellung. welche sowohl in den modernen europäischen Bevölkerungen (Richards et al. Hier stellt sie mit 25% die häufigste Haplogruppe und übertrifft somit innerhalb der LBK/AVK-Stichprobe die Hg H.4 Die Neolithisierung Europas im Spiegel der mtDNAHaplogruppen Im Folgenden sollen die einzelnen Fragestellungen der Arbeit auf der Basis der gewonnenen Ergebnisse diskutiert werden. Im Bereich der benachbarten LBK sowie der zeitgleichen Alföld Linearbandkeramik (AVK) ist dagegen die hohe Frequenz der Hg N1a auffallend. doch ein direkter genetischer Einfluss von Seiten der Körös-Kultur auf die LBK. ob c) ein kultureller Einfluss oder gar ein Wandel. 2000) als auch in der gesamtneolithischen Stichprobe die häufigste Hg darstellt. HV. Bei der Körös-Gruppe kann ein bemerkenswertes Auftreten von süd. schließt sich unmittelbar die Frage an. Weitaus deutlicher können Unterschiede zwischen beiden Kulturen herausgearbeitet werden. welche allesamt nach der Eiszeit in Europa vorherrschend waren. mesolithisch charakterisierbaren mtDNA Genpool aufweisen. und T festmachen lässt. Es lässt sich jedoch herausstellen. Aus archäologischer Sicht drängt sich zunächst die Frage nach der genetischen Identität der beiden frühbäuerlichen Kulturen der Körös-Gruppe (Ungarn) und der Linearbandkeramik (Mitteleuropa) auf. die sich auch in genetischer Hinsicht differenzieren lassen? Wenn dem so ist. Diese spiegelt sich in den vergleichbaren Frequenzen der europäischen Haplogruppen H. Sicherlich kann die Stichprobe der Körös-Kultur nur mit Einschränkung als repräsentativ angesehen werden. auch in der Struktur der betreffenden Bevölkerung nachgewiesen werden kann? Die populationsgenetischen Studien der hier untersuchten maternalen Linien der KörösKultur und der LBK belegen eine basale Ähnlichkeit zwischen beiden Kulturen. Da sich das Vorkommen von N1a auf den Bereich der LBK/AVK beschränkt und zudem dort unerwartet häufig zu beobachten ist (sechs von 24 LBK/AVK 190 . Bilden a) die beiden archäologisch definierten Kulturen möglicherweise tatsächlich existierende Einheiten darstellen. somit kann der Vergleich mit der LBK nur ein vages Bild der genetischen Beziehungen liefern. welcher sich in den archäologischen Hinterlassenschaften deutlich belegen lässt.bzw. K und J wider. welche auch in der größeren Stichprobe der LBK nicht zu finden sind. der sich vornehmlich am Vorhandensein der Hg H. K. Eine weitere Gemeinsamkeit ist das Fehlen der Hg U (mit der Ausnahme von U3 bei VAI3 der LBK) in den Stichproben beider Kulturen.

und welche sich nach dem Rückzug des Eisschildes wieder über Europa verbreiteten. falsifizieren? Mögliche Szenarien und Hypothesen. dass eine nicht zu gering einzuschätzende Bevölkerungsdynamik in Mitteleuropa nach dem frühen Neolithikum zu einer starken Ausdünnung dieser mütterlichen Linie geführt haben muss. und somit Bewegungen von Bevölkerungen in Raum und Zeit. Wie bereits erwähnt. die in genetischer Hinsicht über die Refugien hinaus in Verbindung standen. 7500 Jahren lässt erkennen. Hierzu können in erster Linie die Hgs K. Vor diesem Hintergrund lassen sich die weiteren Beobachtungen. kann der maternale Genpool der bearbeiteten neolithischen Stichprobe (bzw. der europäische mtDNA Pool zur Zeit des frühen Neolithikums) als autochthon europäisch bezeichnet werden. 150-fach höhere Häufigkeit dieser Haplogruppe vor ca. diskutieren. W. die innerhalb der neolithischen Stichprobe wie auch im Vergleich mit Daten aus modernen populationsgenetischen Studien gemacht wurden. Diskontinuität einer Bevölkerung eines definierten Besiedlungsraumes nachgewiesen werden? g) Können die Ergebnisse bereits formulierte Modelle und Hypothesen zur Neolithisierung Europas verifizieren bzw.2% zu finden ist. FLO1) als auch im ca. Die ca. N1a findet sich sowohl im Westen der LBK (im rheinhessischen Flomborn. W. die sich unter den neolithischen Individuen finden. obwohl viele mtDNA-Linien (H. 800 km entfernten heutigen Ungarn (Ecsegfalva. dass. dass Hg N1a in heutigen europäischen Bevölkerungen nur noch mit einer Häufigkeit von maximal 0. K. H. Daraus ergibt sich die Vorstellung einer paläoeuropäischen Bevölkerung entlang der Gletscherzonen. Die entsprechenden Fragestellungen lauten: d) Inwieweit können Unterschiede zur heutigen Bevölkerung Europas als populationsgenetische Dynamik gedeutet werden? e) Können unter der Voraussetzung der Unterscheidbarkeit auch Richtungsdynamiken festgestellt werden. evtl.B. Migrationen oder Kolonisierungen postuliert werden? f) Kann in diachroner Hinsicht eine Kontinuität bzw. ECS1). die postglaziale Wiederbevölkerung Europas im Wesentlichen den mitochondrialen Genpool bestimmt hat (Richards et al. Expansion der Hgs innerhalb Europas wird einerseits durch die synchronen Koaleszenzzeiten der meisten Hgs gestützt und andererseits durch die Vielzahl der anzestralen mtDNA-Linien der Hg J.Diskussion Individuen). 2000. Dies bedeutet. Tambets et al. können meist exemplarisch an Hg N1a dargelegt werden. V und N1a und weitere Sub-Hgs von H und U gezählt werden. welches durch einen lokalen Gründereffekt entstanden ist. V. Dieses Bild 191 . Im Vergleich mit Daten aus modernen populationsgenetischen Studien fällt auf. U5. V) auch vor der letzten Maximalvereisung in Europa vorhanden waren. kann man möglicherweise soweit gehen und im Fall von N1a von einem genetischen Marker der (Linear-)Bandkeramik sprechen. dass es sich bei der Verbreitung von Hg N1a nicht um ein kleinräumiges Phänomen gehandelt haben kann. welche sich auf die oben genannten Fragestellungen beziehen. U4. Die Koaleszenzzeitberechnungen der Hg (inklusive der Ergebnisse dieser Arbeit) zeigen. T. 2002). bestätigt. wie z. Die postglazial charakterisierte Besiedlung bzw. N1a und U5b.

welche heute im Nahen Osten häufiger ist als in Mitteleuropa und im Gegensatz dazu die Zunahme der autochthonen europäischen Hg H begründen. Kap. dass ein gewisser Anteil der untersuchten Stichprobe sich vom lokalen IsotopenMuster deutlich abhob. Weiterhin ist vorstellbar. Die Ergebnisse dieser Studien. Südosteuropa sehen und verstünde man die Verteilung der Stichprobe als Momentaufnahme der Situation im Frühneolithikum. dass unabhängig von der Geschlechterverteilung bereits ab einer hypothetischen 3%igen Vermischung der neolithischen Immigranten mit der indigenen Bevölkerung Europas. Fasst man diese Hg als erweitertes genetisches neolithic package zusammen. Die Ergebnisse der Simcoal Simulationen für N1a zeigen.2). Dies ist eine plausible Erklärungsmöglichkeit. unter der weiteren Annahme von Hg HV als nahöstlichen Einfluss steigt dieser weiter auf ~36 %. dieser Annahme folgend. 2. (2003) konnten zeigen. der in dieser Rechnung bei 6 % liegt. Im Falle von Schwetzingen befanden sich unter der Anzahl dieser. vgl. kann folgendes Szenario angenommen werden: Hg N1a ist unter den einwandernden neolithischen Bauern häufig. Allerdings lässt sich in diesem Szenario nicht die ins Neolithikum datierte Expansion der Hg U3.2.2. auch aus Schwetzingen und Flomborn. Abbildung 41). Kap.a. dass die Annahme von genetischer Drift als alleiniger Ursache für die starke Verdünnung der N1a-Frequenz nicht ausreicht und daher andere populationsdynamische Prozesse eine Rolle gespielt haben müssen (Kap. dass vorwiegend Männer die mosaikartig verteilten fruchtbaren Lößgebiete Mitteleuropas urbar machten und dabei lokale Partnerinnen aus dem (noch mesolithischen) Umland wählten. 7. die Einwanderer heute nicht mehr nachweisbar seien. welche mit Hilfe der Analyse stabiler Isotopen die regionale Herkunft neolithischer Individuen (u. Hinzu kommt der asiatische Einfluss der Hg N9a und D4a.5). Die Autoren konnten zeigen. allerdings in deutlich geringerer prozentualer Häufigkeit (vgl. (2003) beschreiben. Frauen autochthon) wäre der Anteil der allochthonen mtDNA-Linien bereits nach einer Generation beträchtlich eingeschränkt und könnte bald nicht mehr nachgewiesen werden.2) orientiert. 192 . Nimmt man N1a unter der obigen Annahme hinzu.3. T1 und auch J als einwandernde Bauern vom Nahen Osten bzw. so hätte dieser neue genetische Einfluss innerhalb der LBK/AVK/Körös-Gruppe einen Anteil von 9 %. welche sich am Prinzip des archäologischen Modells der leap frog colonization (vgl. Kap. von ihm benannten „Migranten“. Da die Träger der Hg N1a allesamt zur frühbäuerlichen linearbandkeramischen Kultur (bzw. die Individuen mit der Hg U3.4). AVK) gerechnet und damit als „Neolithiker“ bezeichnet werden können.Diskussion entspricht im Wesentlichen auch der heutigen Situation. 5. Price et al. Bentley et al. wie sie z.3. Auch die Ergebnisse aktueller Simulationen von Currat & Excoffier (2005) können unter diesem Gesichtspunkt interpretiert werden (vgl. Kap.3. ein großer Anteil an Frauen. T1 und J des vermeintlichen genetischen neolithic package beschreiben (vgl.B. 3. Unter der Annahme dieses Geschlechterverhältnisses (Männer allochthon. Das letztgenannte Modell würde analog zur Hg N1a auch die Abnahme der Frequenz der Hg HV erklären. 2001) untersucht. wurden ähnlich interpretiert. 5. vergrößert sich der Anteil auf 27 %. in der N1a ebenfalls eine enorme Verbreitung zeigt. Unterstützende Thesen zu dem angenommenen Szenario einschließlich der möglichen Form der Partnerwahl finden sich in ethnohistorischen Beispielen. wird jedoch in den nachfolgenden Generationen durch eine Vermischung mit der zahlenmäßig überlegenen autochthonen Bevölkerung bald verdrängt. Bentley et al. Möchte man.

dessen hohe Bevölkerungsdynamik bekannt ist. 7. sondern auch zeitgleiche Individuen des Nahen Ostens sowie Meso. die zur heute beobachteten Frequenz geführt hat. Für die bemerkenswerten asiatischen Hgs N9a und D4a. dass im geographischen Gebiet des Nahen Ostens bzw. dass zum Zeitpunkt des frühen Neolithikums vor ca. zeigt sich auch hier. als dass hierfür bereits ein Hinweis auf einen Wandel zu erkennen ist. Die archäologischen Belege für spätere vergleichbar enorme Umwälzungen wie die der Neolithischen Transition. wie bereits erwähnt. Zieht man den rezenten Datensatz der N1a Individuen zum Vergleich heran. um bei der vorliegenden hohen N1a-Frequenz im Zeitraum der vergangenen 7500 Jahre die niedrige heutige Frequenz der Hg N1a zu erreichen. der Körös-Kultur) zur Klärung der Fragestellungen vergrößert werden. die heute als klassisch asiatische Hgs bezeichnet werden. Gegen diese Möglichkeit sprechen jedoch. Die gänzliche Verdrängung von (asiatischen) Hgs mit sehr niedrigen Frequenzen scheint zumindest in Europa. 7500-8000 Jahren auch mtDNA-Linien in geringer Frequenz in Europa vorkamen. Es ist durchaus anzunehmen. dass Hg N1a vor und während des Neolithikums in Mitteleuropa generell häufiger auftrat und dessen Frequenz bis zum heutigen Zeitpunkt schlichtweg verdriftet ist. dass der Anteil an sicher autochthonen mtDNA-Linien mit ~58 % dennoch überwiegt. die überall in Eurasien und Nordwestafrika gleichmäßig gering ist. mag die Annahme von genetischer Drift als Ursache für das Fehlen im rezenten europäischen mtDNA-Genpool zutreffend sein. sind gering. Somit kann plausibel erscheinen. dass diese vermeintliche geographische Trennung ein Produkt genetischer Drift über Jahrtausende von Jahren hinweg darstellt. ob eine autochthone oder allochthone Bevölkerung oder beide Träger einer hohen N1a Frequenz sind. die Ergebnisse der Simcoal Simulation. ostasiatischen Raum nicht als absolut zu sehen ist. der sich möglicherweise im mtDNA Genpool widerspiegeln sollte. dass gerade dieser Anteil durch einen späteren Einfluss von zentralasiatischen turksprachigen Bevölkerungen erklärt werden kann (vgl. Abbildung 41 in Kap.Diskussion stellt sich heraus.2). Eine weitere mögliche Erklärung setzt die Annahme voraus. nicht verwunderlich zu sein.bzw. Darüber hinaus lässt sich bereits hier grundsätzlich feststellen.3.a. dass sich die „kontinentale“ Trennung der MHg M und N in einen eurasischen Raum und ein zentral. welcher sich schnell verdünnt. dass genetische Drift als alleinige Ursache nicht ausreichend ist. Vielmehr kann davon ausgegangen werden. so bleibt als Erklärungsansatz nur eine postneolithische Bevölkerungsdynamik. Schließt man genetische Drift für die Verdünnung der N1a-Frequenz aus. Darüber hinaus zeigt sich. Ein Problem dieses Erklärungsansatzes. dass in der Körös-Stichprobe kein N1a Individuum gefunden wurde. die gleichermaßen die Annahme einer Auswirkung auf die europäischen Populationen in genetischer Hinsicht rechtfertigen.und Paläolithiker Europas einbezogen werden müssen. Die 193 . dass nicht nur die Stichprobengrößen (v. die bei der Stichprobe der Körös-Kultur zu finden waren. der N1a als neolithischen Einfluss in Mitteleuropa ansieht. Das Ende der Bandkeramik und die Entstehung der nachfolgenden jungsteinzeitlichen Kulturen in Mitteleuropa erfolgt nicht so abrupt (Gronenborn 2005b). die zeigen konnten. stellt die Tatsache dar. in Südosteuropa nur sehr wenige N1a Individuen zu finden sind. Hierbei ist es unerheblich.

3. denn es würde bedeuten. ob nicht dort bereits eine Durchmischung von europäischen und westasiatischen mtDNA-Linien stattgefunden hat. 7. Price 2000. die sie trotz der umgebenden frühbäuerlichen Kulturen im Südwesten als auch im Westbaltikum in der zeitlich sehr verzögerten Annahme der bäuerlichen Lebensweise durch die indigene Bevölkerung sehen. liefern die Ergebnisse der mtDNA-Analysen an den Individuen aus Polen. Da neben neolithischen auch mesolithische Funde untersucht wurden. Zvelebil und Lillie (2000) bestätigen dieses Bild. die einen ständigen und immer neu überlagernden Einfluss auf den europäischen maternalen Genpool gehabt haben können.7. Dies lässt sich im uniformen mtDNA-Pool der kleinen Stichprobe erkennen. dass Hg U5. in dem sie für das östliche Baltikum eine sehr langsam verlaufende Neolithisierung ansetzen. Möglicherweise kann dies bedeuten. die sich bis auf ein Individuum (Hg U4) aus Varianten der Hg U5 zusammensetzt. den Kelten und der nachfolgenden Völkerwanderung nur die bekanntesten Beispiele für Ereignisse genannt werden. offensichtlich in der LBK/Körös-Gruppe nicht vorkommt (wenn man die Probe BRU4 ausklammert. erreicht (Dennell 1992. Kap. Es stellt sich die kritische Frage. dass die Analyse von frühneolithischen Individuen 194 . Erst unter bronzezeitlichen Individuen finden sich andere Haplogruppen. Litauen und Russland ein sehr reduziertes Bild. die eine spätere Aufschlüsselung während des Neolithikums unmöglich macht? Dies stellt aus genetischer Sicht ein Problem der ungenügenden phylogenetischen Auflösung dar. dass weder die LBK noch die südosteuropäischen Kulturen (in genetischer Hinsicht) eine wesentliche Rolle bei der Transition im nördlichen Osteuropa gespielt haben. können die Ergebnisse auch im Hinblick auf diachrone Trends betrachten werden. wobei mit den bronzezeitlichen Hochkulturen im Nahen Osten. Hierzu werden einige grundsätzliche Annahmen gemacht. Im Folgenden soll auf Basis der hier angeführten Erklärungsmöglichkeiten für die frühneolithische Variabilität in Europa ein hypothetisches und möglichst parsimonisches Bild der Auswirkungen der Neolithisierung auf den europäischen mtDNA Genpool erstellt werden. Zvelebil & Lillie 2000). Unter Einbezug von weiteren Individuen der gleichen Region aus einer begleitenden Arbeit (vgl.2). woraus bereits die Frage resultiert. um Unterschiede in den südeuropäischen Refugien zu etablieren? Nicht zuletzt stellt auch der Nahe und Mittlere Osten ein Refugium dar. Kap.2) kann deutlich von einer genetischen Kontinuität während der neolithischen Transition im nördlichen Osteuropa gesprochen werden. dem Antiken Griechenland. vgl. wie sie in Mitteleuropa definiert wird. sollten vielmehr als Produkt unzähliger größerer und kleinerer (prä-)historischer Bevölkerungsbewegungen gesehen werden. dem Imperium Romanum.Diskussion populationsgenetischen Prozesse. Während die Situation in Mitteleuropa in genetischer Hinsicht komplex wirkt. Die vordergründig genetische Kontinuität im baltischen Raum deckt sich weitgehend mit den archäologischen Hinweisen. dass die Neolithisierung im waldreichen Osteuropa langsamer vorgeschritten ist und dementsprechend erst in der eigentlichen Bronzezeit die vollständige Neolithisierung. ob sich die Bevölkerungsgruppen im Nahen Osten und in Europa nacheiszeitlich genetisch unterschieden haben? War die letzte Maximalvereisung zeitlich ausreichend lange. die zur Herausbildung der heutigen Situation geführt haben. trotz der Häufung in diesem Gebiet. Auffallend ist.

Grundsätzlich treffen im Bereich der LBK. so zeigt vor allem letztere. Nachfolgend sollen ergänzend einige grundsätzliche kritische Bemerkungen zur vorliegenden Arbeit angeführt werden. deuten jedoch auf die Wichtigkeit dieser Gebiete hinsichtlich der kulturellen (wie auch genetischen) Vernetzung hin (Detlef Gronenborn. es bleibt jedoch zu prüfen.Diskussion Südosteuropas und Westasiens kaum eine Trennung erkennen lassen dürften. Mag auch die Hg HV durch ihre heutige Häufigkeit im Nahen Osten eine Verbindung zu diesem Gebiet darstellen. V. im gesamten Mitteleuropa Einflüsse aus mehreren Richtungen aufeinander. dass während der Wiederbesiedlung aus den Eisrandzonen Südosteuropas bzw. nur ein stark verwaschenes und abgeflachtes Bild der Haplogruppenverteilung dar. 7. Westasien ebenfalls durch Gründereffekte einzelne regionale Häufungen entstanden sind. wann in prähistorischen Stichproben die Frequenzen der vermeintlichen Hgs des neolithic package zunehmen. Hinweise darauf zeigen die Fundorte Schwetzingen. T und K.K. Andererseits besteht auch die Möglichkeit. die bislang vorliegen. die möglicherweise noch während des Neolithikums erkennbar sind. wie gezeigt werden konnte. Die wenigen Erkenntnisse. osteuropäischen Populationen kann im Vergleich mit heutigen Populationen auch in den Hgs K und N1a gesehen werden (vgl.h. d. die auch in der Körös-Kultur zu finden ist. Dies zeigt. T1 und U3 ist zum Zeitpunkt des frühen Neolithikums nur schwach bis gar nicht ausgeprägt. Kap. dass die Fundsituation spärlich ist. Im Gegensatz hierzu besteht durchaus die Wahrscheinlichkeit. D4a). Die überwiegende Mehrheit der neolithischen mitteleuropäischen Bevölkerung besitzt. wo N1a vorherrschend ist und das östliche Baltikum. eine Verbindung zu Populationen Zentralasiens (N9a. Bestätigungen für Beziehungen in dieser Richtung liegen auf archäologischer Basis bislang nur wenige vor. Unter dieser zweiten Annahme versteht sich auch die folgende Rekonstruktion der Situation im Neolithikum basierend auf den hier gewonnenen Ergebnissen. W. Eine Verbindung zu westasiatischen bzw. wo U5 sehr häufig ist. charakteristische europäische Hgs. wo Hg T dominiert.T.2). wie sie durch die modernen Daten dokumentiert ist. dass zwar die geschätzte Expansionszeit dieser Hgs im Zeitrahmen des Neolithikums einsetzt. mündl. Diese Annahme wird sich jedoch erst durch weitere ausgedehnte Untersuchungen verifizieren oder falsifizieren lassen. Mitteilung). wohingegen in Mitteldeutschland neben diesen auch die Hgs N1a. Im Westen der LBK finden sich im Wesentlichen die (süd-) westeuropäischen Hgs H. prinzipiell autochthon europäisch (H. Dies lässt sich hauptsächlich mit der politischen Lage der vergangenen Jahrzehnte begründen und bedeutet keinesfalls. Mitteleuropa nördlich der Donau. die je nach Region in ihrer Frequenz variieren. sofern 195 . HV anzutreffen sind. wenngleich in umgekehrter Richtung von Westen nach Osten. Besonders die geringe Stichprobenzahl der Körös-Kultur. denn ohne Zweifel stellt die heutige Situation in Europa. dass sich einerseits in den Refugien durch Isolation und damit verbundenen Gründereffekten bestimmte Frequenzverschiebungen zugunsten einzelner Hg ereigneten. Theoretisch sollten sich nach der Wiederbesiedlung Europas regionale Charakteristika ergeben. Der Einfluss von weiteren vermeintlich neuen neolithischen Linien wie J.J) geprägt. Dies betrifft zunächst die Definition der einzelnen neolithischen Stichproben.3.

dass die verwendeten Kategorien der LBK/AVK-Stichprobe. größeren Gräberfeldern. Sicherheit bezüglich der Zuordnung von Individuen zu einem gemeinsamen kulturellen Hintergrund kann nur innerhalb geschlossener Fundsituationen. Die große Problematik der rezenten Populationsgenetik Europas liegt in der Tatsache begründet. Dokumentationslücken bedingt. dass die moderne gesamteuropäische Bevölkerung durch eine Vielzahl historischer Ereignisse geprägt ist.B. Als weiteren Kritikpunkt lassen sich Zuordnungsprobleme anführen. Abbildung 8).4. die rezente Studien liefern. Auch hier kann angefügt werden.und frühgeschichtlichen Epochen zu machen (vgl. die unter Umständen die Frequenzen der Haplogruppen verzerren würden. da grundsätzlich verwandtschaftliche Beziehungen innerhalb einer Gemeinschaft möglich sind. Hierbei sollten auch trotz möglicher längerer Belegdauern eines Friedhofes die zeitlichen Diskrepanzen gering sein.B. 7. zum einen durch natürliche Fund.Diskussion sie getrennt behandelt wird. Dass auch rein logistische. Generell ist der Umstand der geringen Datengrundlage. dass die Untersuchung weiterer Proben und die gleichzeitige Ausdehnung sowohl in geographischer als auch zeitlicher Hinsicht die hier getroffenen Aussagen klarer erscheinen werden lassen. die sowohl die Gesamtheit der neolithischen Stichprobe als auch die einzelnen neolithischen Kulturen deutlich von heutigen mitteleuropäischen Populationen unterscheiden lassen. 3. durchaus bekannt ist. Die Besonderheit dieser Ergebnisse ist. identische Haplotypen nur einmal gewertet werden. kann mit Sicherheit nur mit Einschränkung als repräsentativ für das frühe Neolithikum im Karpatenbecken gesehen werden kann. die intern zeitliche Divergenzen von mehreren Jahrzehnten bis hin zu wenigen Jahrhunderten aufweisen können. die (prä-)historische Fragestellungen verfolgt. Die Zuordnung zur archäologischen Kultur ist jedoch in allen Fällen gesichert. zeitliche Probleme bei der Probenakquisition bzw. dass es anhand der Datenlage. Im Falle dieser Arbeit kommen zusätzliche Limitierungen seitens der Erhaltung der zu untersuchenden DNA hinzu. Bereitschaft zur Bereitstellung eine große Rolle spielen. nicht möglich ist. der Körös-Kultur sowie die der Sammelgruppe Nordosteuropas deutlich als künstliche Einheiten verstanden werden müssen. womit von einer zwar zeitlich inkongruenten. Somit muss konstatiert werden. Im Umkehrschluss bedeutet dies. technische. mit Einschränkung der HV Haplotypen und auch der zwei asiatischen Linien innerhalb der Stichprobe der Körös-Kultur interessante und bemerkenswerte Ergebnisse. Kap. wie z. Allerdings muss bei der Einbeziehung von mehreren Individuen eines Fundplatzes beachtet werden.bzw. dass sie als solches aus der Sicht der rezenten populationsgenetischen Studien nicht erwartet worden wären. aber kulturell sinnvollen Einteilung zum Vergleich der neolithischen Proben ausgegangen werden kann. dass z.1 Die Bedeutung der Ergebnisse für die Rezentgenetik Die aDNA-Analysen liefern mit der hohen Frequenz an N1a Haplotypen. das in jeder Wissenschaft. angenommen werden. Trotz der noch spärlichen Datengrundlage lassen sich aber bereits entscheidende Strukturen feststellen. dass die Ergebnisse der aDNA-Analyse einen Beleg dafür liefern. die die kulturelle Identität bzw. sei dahingestellt.4. endgültige Aussagen über die populationsgenetische Situation in vor. die Datierung einzelner Funde betrifft. ein Problem. die sich zwar in archäologischen sowie später in 196 .

Diskussion
schriftlichen Quellen wiederfinden, deren Auswirkungen auf das Gesamtbild des
europäischen Genpools, und hier besonders des mtDNA Genpools, aber weitgehend
unbekannt sind. Das vielmals geäußerte Bild des genetischen Palimpsests (vgl. Kap. 3.1.4)
charakterisiert die rezente Datenlage sehr treffend. Diese wiederholte „genetische
Überschreibung“ erschwert die Rekonstruktion von historischen Geschehnissen enorm. Ein
ursächlicher Faktor ist nach Meinung von Bandelt et al. (2002) rein methodologischer Art
und betrifft die grundsätzliche Definition von (rezenten) Populationen, die in der Literatur
nicht konform gehandhabt wird. So werden einerseits Staatsgrenzen und andererseits
Sprachgrenzen als Unterscheidungskriterium herangezogen. Bandelt führt an, dass sich
Sprachen und Ernährungsgewohnheiten bzw. Subsistenzstrategien ändern können, während
Genotypen auch unter verschiedensten Bevölkerungsstrukturen erhalten bleiben. Was die
Kritik an der Definition von Populationen betrifft, so versteht er diese auch nicht als absolut
und sieht deren Notwendigkeit im Sinne von Arbeitshypothesen durchaus gerechtfertigt
und fordert gleichzeitig, bestehende Konzepte nicht zugunsten von mystischen
Verbindungen zu mtDNA Urmüttern zu verwerfen (Sykes 2003).
Ein weiteres Problem stellt die Datierung von populationsgenetischen Ereignissen dar.
Oftmals wird der Zeitpunkt einer Trennung von genetischen Linien mit der Trennung von
Populationen gleichgesetzt. Bereits Cavalli-Sforza (1998) macht deutlich, “it is the date of
population splits, not the birth of individuals carrying the first mutation, that is of interest for
comparison with archaeological dates, which usually refer to the early settlement of new areas” und
macht damit deutlich, dass eine Koaleszenzzeitberechung zwar das Alter der Hg berechnen,
jedoch nicht dem Alter der jeweiligen (fraglichen) Population entspricht, die Träger
derselben sind.
Die Tatsache, dass die meisten Hgs älter sind als die Populationen, die wir heute –
ungeachtet der genauen Definition - kennen bzw. zu rekonstruieren versuchen, hat bereits
Sykes (1999) deutlich gemacht. Daher ist und bleibt es schwierig Populationen genetisch zu
charakterisieren, insbesondere wenn ohnehin eine hohe historische Dynamik der
betreffenden Bevölkerungen vorliegt. Des Weiteren ist der Umgang mit Koaleszenzzeiten
einzelner Hgs für die Datierung bestimmter Epochen weiterhin kritisch zu sehen, solange
diese nicht durch weitere Daten anderer Hgs gestützt werden.
Durch die Ergebnisse der vorliegenden Arbeit kann gezeigt werden, dass die Analyse alter
DNA im Stande ist, die beiden dargestellten Probleme der Rezentgenetik zu umgehen. Zum
einen ist es möglich, ungeachtet der bevölkerungsdynamischen Prozesse, die genetische
Variabilität einer (kulturell oder chronologisch definierten) Bevölkerung direkt zu
definieren. Zum anderen können hierdurch bestehende Koaleszenzzeitberechnungen der
einzelnen Hgs gestützt werden, da somit indirekt Bestätigungen in fraglichen Epochen im
Sinne von termini ante quem bestimmt werden.

197

Diskussion

7.4.2 Die Bedeutung der Ergebnisse für die Archäologie und Anthropologie
Die Ergebnisse der ersten umfangreichen aDNA-Analysen zum mitteleuropäischen
Neolithikum zeigen für den Bereich der LBK und der Körös-Kultur ein komplexes Bild. Auf
der einen Seite offenbaren die Linearbandkeramiker durch die Hg N1a eine charakteristische
genetische Signatur und auf der anderen Seite finden sich in der kleineren Körös-Stichprobe
unerwartet ostasiatische mtDNA-Linien, wobei die verbleibenden Linien in beiden Gruppen
wiederum ähnlich (häufig) sind und zudem eine vergleichsweise hohe Diversität aufweisen.
Insgesamt deutet sich für die Verbreitung der archäologischen Sachkultur, die unter der
Epoche LBK zusammengefasst wird, ein vielschichtiger Prozess an, der abhängig vom
einzelnen Fundplatz ein variierendes Bild von neuen Einflüssen als auch unter diesen
autochthon weiterentwickelten Elementen aufzeigt (Gronenborn 1999; 2003; 2005).
Dagegen weist die angrenzende Stichprobe des nördlichen Osteuropa - aufgrund der kleinen
Probenanzahl unter Vorbehalt betrachtet - eine eher eingeschränkte Diversität der Hgs auf.
Hierin zeigen sich Parallelen zu den Forschungsergebnissen der Archäologie der letzten
Jahrzehnte. Die Situation im nördlichen Osteuropa, welche durch eine zeitlich stark
verzögerte und langsame Annahme der bäuerlichen Lebensweise geprägt war, spiegelt sich
in der geringen Haplogruppendiversität dieser Arbeit wider. Auf Basis der vorläufigen
Ergebnisse kann daher für diese Region im betreffenden Zeitraum angenommen werden,
dass keine tiefgreifenden Umwälzungen stattgefunden haben, die sich genetisch feststellen
lassen.
Grundsätzlich lässt sich anmerken, dass in Verknüpfung mit den Ergebnissen der aDNAAnalysen für den geographischen Raum der LBK sich das Modell der leapfrog colonization
(Kap. 2.2) am ehesten als plausible Erklärungsmodell für die Neolithisierung Mitteleuropas
anbietet (Zvelebil & Lillie 2000, Zvelebil 2000), wenngleich nicht für alle feinchronologischen
Phasen und alle ökologischen Kleinräume in gleichem Umfang.
Gleichzeitig werfen die Ergebnisse der vorliegenden Arbeit weitere Fragen auf, die sich für
zukünftige Aufgaben empfehlen. So stellt sich nicht nur für die Archäologen die Frage,
welche Verbindung sich hinter den möglichen asiatischen Linien verbirgt und welcher
bevölkerungsdynamische Prozess als Erklärung für die starke Verdünnung der
(linearbandkeramischen?) N1a-Linien herangezogen werden kann. Dennoch kann postuliert
werden, dass nur eine verstärkte multidisziplinäre Herangehensweise ein detailliertes Bild
dieser komplexen Transition erbringen kann. In der mitteleuropäischen, archäologischen
Forschung der letzten Jahrzehnte ist grundsätzlich eine Abwendung von reduktionistischen
Modellen spürbar (Gronenborn 2006), welche sich gleichermaßen in der detaillierten
regionalen und überregionalen Aufarbeitung der Funde als auch in der zunehmenden, sowie
nachhaltigen Rezeption von naturwissenschaftlichen Methoden, wie z.B. der Isotopen- , der
DNA, sowie der Klimaforschung widerspiegelt (Price et al. 2001, Bentley et al. 2002,
Gronenborn 2003; 2005). Auch kritische Aufarbeitungen wie z.B. die aktuelle Arbeit von
Prien (2005), welche vor soziologischem Hintergrund die Nachweisbarkeit von
unterschiedlichen Formen von Wanderungsbewegungen beleuchtet, an ausgewählten
Fallbeispielen prüft und darüber hinaus allgemeine Interpretationsrichtlinien liefert, bieten
einen längst überfälligen theoretischen Neuansatz. Im Sinne von Prien liefern auch meines
Erachtens gerade die oft unzureichenden Begriffsdefinitionen der einzelnen

198

Diskussion
Wanderungsbewegungen, die oft vereinfachend unter dem Oberbegriff Migration
zusammengefasst werden, die Grundlage für eine Überinterpretationen der tatsächlichen
Wanderungsdynamik. Dass die Ausbreitungsrichtungen der neolithischen Lebensweise den
bekannten mesolithischen Handelsrouten folgten, ist allgemein akzeptiert (Gronenborn
1999). Weiterhin konnte aktuell in der, diese Arbeit begleitenden, Dissertation von
Bollongino (2005; Bollongino et al. 2005) gezeigt werden, dass die neolithischen Hausrinder
Mitteleuropas genetisch identisch mit den Hausrindern des Nahen Ostens sind und keine
autochthone Domestikation in Europa stattgefunden hat, was wiederum bedeutet, dass diese
Tiere – wie auch Schaf und Ziege – verhandelt wurden. Hieraus lässt sich veranschaulichen,
dass das neolithische Mitteleuropa mit Vorderasien direkt oder indirekt in Kontakt stand
und die kulturellen Einflüsse vorrangig auf ideellem Wege über mehrere Jahrhunderte
hinweg verbreitet wurden. Dass bei diesem Prozess - auf bekannten Wegen - auch Menschen
über weite Distanzen mobil waren, wird hierbei vorausgesetzt, jedoch ist dies nur
eingeschränkt für gewisse Bevölkerungsteile überzeugend und mit großer
Wahrscheinlichkeit nicht für diejenigen, welche in vollem Umfang Ackerbau und Viehzucht
betrieben haben. In gewisser Hinsicht stellt diese Meinung gleichsam ein Desiderat an die
künftige Neolithikumsforschung dar, worin nun in detaillierter Aufarbeitung von einzelnen
Fundplätzen
unter Einbezug
aller
aktuell
möglichen
archäologischen
wie
naturwissenschaftlichen Methoden vergleichende Binnenanalysen durchgeführt werden
müssten. Von besonderem Interesse wäre hierbei, ob sich bspw. bestimmte genetische Linien
zusätzlich durch abweichende Isotopenprofile, Beisetzungsformen und charakteristische
Beigabenensembles oder umgekehrt bestätigen und bestimmten Traditionen bzw. und
letztlich archäologischen Kulturen zuordnen lassen. Eindeutige Hinweise auf multitraditionelle Gemeinschaften finden sich nicht nur in den Isotopen-Arbeiten von Bentley und
Kollegen (2002, 2003), sondern grundsätzlich im westlichen Verbreitungsgebiet der LBK, wie
z.B. im hessischen Bruchenbrücken und im süddeutschen Vaihingen a.d. Enz (Gronenborn
2003, 2006). Die große Diversität der Haplogruppen der vorliegenden Arbeit, sowie deren
phylogeographische Affinitäten passen gut in dieses frühneolithische Gesellschaftsbild.
Gronenborn führt aus, „...what previously appeared as culturally - and by implication ethnically –
homogenous LBK villages were in reality focal points of varying cultural traditions with differing
regional origins across Central Europe” (2006), wobei nach den Ergebnissen dieser
Dissertationen, die Einzugsgebiete auch geographisch weiter gefasst werden können oder
gar müssen.
Somit bleibt festzuhalten, dass die genaue Aufschlüsselung dieser multi-traditionellen
frühneolithischen Gemeinschaften die Aufgabe der kommenden interdisziplinären Ansätze
sein muss.

199

Zusammenfassung

8. Zusammenfassung
Die vorliegende Dissertation ist eine molekulargenetische Studie an humanem neolithischem
Skelettmaterial.
Im zentralen Blickpunkt stand die Bestimmung der Variabilität der mitochondrialen
Haplogruppen einer frühneolithischen Stichprobe aus drei unterschiedlichen Kulturkreisen,
welche die Linearbandkeramik (LBK und AVK), die Körös-Kultur und eine
Sammelkategorie osteuropäischer spätmeso- und frühneolithischer Kulturen umfasste. Im
Vergleich dieser Gruppen untereinander sowie mit Rezentdaten moderner Populationen aus
vergleichbaren Gebieten Mittel- und Osteuropas sowie dem Nahen Osten sollten bestehende
Modelle und Hypothesen zur Neolithisierung Mitteleuropas geprüft werden.
Insgesamt konnte für 43 neolithische Individuen aus 16 Fundorten der reproduzierbare
Nachweis endogener DNA erbracht werden. Eine eindeutige Haplogruppenbestimmung
konnte durch die Sequenzierung vier überlappender Fragmente der mitochondrialen
Hypervariablen Region I sowie durch RFLP-Analyse zusätzlicher charakteristischer
Nukleotidpositionen für alle 43 Individuen durchgeführt werden.
Die neolithischen Individuen der Linearbandkeramik sowie der Körös-Kultur zeigten eine
hohe Diversität an bekannten europäischen Haplogruppen, wohingegen die kleinere
Stichprobe aus dem Gebiet Osteuropas eine auffällige Homogenität aufwies.
Neben einigen Frequenzunterschieden zur modernen mitteleuropäischen Bevölkerung war
innerhalb der LBK/AVK-Stichprobe eine bemerkenswert hohe Frequenz der Haplogruppe
N1a festzustellen, welche nicht in den beiden anderen neolithischen Stichproben zu finden
war und auch in der heutigen Rezentbevölkerung Eurasiens und Nordafrikas nur mit einer
durchschnittlichen Frequenz von 0,2% vertreten ist. Innerhalb der Individuen der KörösKultur fanden sich zwei Haplotypen, welche heute nicht in Europa bekannt sind, dagegen
jedoch in Süd- bzw. Nordostasien gehäuft vorkommen.
Die Ergebnisse der aDNA-Analysen bestätigten im Wesentlichen das komplexe Bild der
Neolithischen Transition in Mitteleuropa und konnten die, für diesen Raum postulierte,
Hypothese der leap frog colonization weitestgehend unterstützen. Auch für den
geographischen Vergleichsraum des nördlichen Osteuropa konnten Parallelen zur
etablierten Sichtweise der archäologischen Forschung zu diesem Gebiet und den
vorliegenden Ergebnissen der aDNA-Analysen aufgezeigt werden. Die zeitlich verzögerte
Annahme der neolithischen Lebensweise im waldreichen nördlichen Osteuropa spiegelt sich
in der reduzierten Diversität an mtDNA-Haplogruppen wider.
Die vorliegende Dissertation konnte nicht nur durch die z.T. unerwarteten Ergebnisse der
Haplogruppen-Bestimmung, sondern vor allem durch die umfangreichen und elaborierten
Reproduktions- und Authentifizierungprotokolle deutlich machen, dass der Nachweis von
humaner
alter
DNA
trotz
der
allgegenwärtigen,
methodenimmanenten
Kontaminationsgefahr unter streng kontrollierten Bedingungen möglich ist.

200

Zusammenfassung
Gleichermaßen konnte veranschaulicht werden, dass die aDNA-Analyse wertvolle Hinweise
auf das genetische status quo einer Population liefern kann, welche nicht bzw. nur in sehr
eingeschränkten Maße von rezenten DNA-Daten abgeleitet werden können.
Als sekundäres Ergebnis erlaubte der bislang größte vorliegende Datensatz von ~2500
Klonsequenzen zudem einen detaillierten Einblick in Häufigkeiten und Verteilungsmuster
von post mortem Sequenzveränderungen. Es konnten für den mitochondrialen Bereich der
Nukleotidpositionen 15997-16409 so genannte hot bzw. cold spots definiert werden, welche
für die Auswertung und Interpretation von zukünftigen Sequenzierungen der
Hypervariablen Region I des mt-Genoms von entscheidender Bedeutung sein werden.

201

Literatur

9. Literatur
Abbott A (2003) Anthropologists cast doubt on human DNA evidence. Nature 423:468
Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, Scozzari R, Cruciani F, Zeviani M, Briem E,
Carelli V, Moral P, Dugoujon JM, Roostalu U, Loogvali EL, Kivisild T, Bandelt HJ, Richards M,
Villems R, Santachiara-Benerecetti AS, Semino O, Torroni A (2004) The molecular dissection of
mtDNA haplogroup H confirms that the Franco-Cantabrian glacial refuge was a major source for the
European gene pool. Am J Hum Genet 75:910-918
Adcock GJ, Dennis ES, Easteal S, Huttley GA, Jermiin LS, Peacock WJ, Thorne A (2001) Mitochondrial
DNA sequences in ancient Australians: Implications for modern human origins. PNAS 98:537-542
Al-Zahery N, Semino O, Benuzzi G, Magri C, Passarino G, Torroni A, Santachiara-Benerecetti AS
(2003) Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal
and of post-Neolithic migrations. Mol Phylogenet Evol 28:458-472
Alves-Silva J, da Silva SM, Guimaraes PE, Ferreira AC, Bandelt HJ, Pena SD, Prado VF (2000) The
ancestry of Brazilian mtDNA lineages. Am J Hum Genet 67:444-461
Ammerman AJ, Cavalli-Sforza LL (1984) The Neolithic Transition and the genetics of populations in
Europe. Princeton University Press, Princeton
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP,
Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981) Sequence and organization of the
human mitochondrial genome. Nature 290:457-465
Andrews LB, Buenger N, Bridge J, Rosenow L, Stoney D, Gaensslen RE, Karamanski T, Lewis R,
Paradise J, Inlander A, Gonen D (2004) Ethics. Constructing ethical guidelines for biohistory. Science
304:215-216
Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (1999) Reanalysis
and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23:147
Antanaitis I (1999) Concerning the transition to farming in the East Baltic. Documenta Praehistorica
26:89-100
Anthony DW (1990a) Migration in Archaeology: The baby and the bathwater. American
Anthropologist 92:895-914
Anthony DW (1990b) Migration in Archaeology: the baby and the bathwater. American
Anthropologist 92:895-914
Anthony DW, Brown DR (1991) The origins of horseback riding. Antiquity 65:22-38
Austin JJ, Ross AJ, Smith AB, Fortey RA, Thomas RH (1997) Problems of reproducibility--does
geologically ancient DNA survive in amber-preserved insects? Proc R Soc Lond B Biol Sci 264:467-474
Autze T (2005) Ausgrabungen auf dem Sonntagsfeld in Halberstadt. Archäologie in Sachsen-Anhalt
3:in press
Avise JC (2000) Phylogeography. Harvard University Press, Cambridge MA
Awadalla P, Eyre-Walker A, Smith JM (1999) Linkage disequilibrium and recombination in hominid
mitochondrial DNA. Science 286:2524-2525

202

Richards M (2003) What molecules can't tell us about the spread of languages and the Neolithic. Kaplan M. Science 295:2267-2270 Barnett WK (2000) Cardial pottery and the agricultural transition in Mediterranean Europe. Burger J. Hammer MF. James IT. Chikhi L (1998) Evidence for Paleolithic and Neolithic gene flow in Europe. Della PS. Israel. Bach A (1989) Paläoanthropologie im Mittelelbe-Saale-Werra-Gebiet. Price TD. Weimar. Lüning J. Tolk HV. Hedges RE. Colson IB. Gronenborn D. Mol Biol Evol 16:37-48 Bandelt HJ. Skorecki K (2004) MtDNA evidence for a genetic bottleneck in the early history of the Ashkenazi Jewish population. Fullagar PD (2002) Prehistoric Migration in Europe: Strontium Isotope Analysis of Early Neolithic Skeletons. Kulkarni KM (2004) Mitochondrial DNA diversity in tribal and caste groups of Maharashtra (India) and its implication on their genetic origins. Giampaolo R. Tarsi T. Bertorelle G (2003) Were Cro-Magnons too like us for DNA to tell? Nature 424:127 Barbujani G. Martinovic K. Bertorelle G. Cambridge University Press. Richards MB. Ann Hum Genet 68:453-460 Bailey JF. Macaulay V (2002) The fingerprint of phantom mutations in mitochondrial DNA data. Rosengarten D. Annu Rev Genomics Hum Genet 5:119-150 Barker G (1985) Prehistoric Farming in Europe. Renfrew C (eds) Examining the Farming/Language Dispersal Hypothesis. Baig MM. Quintana-Murci L. Schneider PM. Am J Hum Genet 62:488-492 Barbujani G. Martinez-Labarga C. Cambridge. Bender K. Contini I. Archäologische Ausgrabungen in Baden-Württemberg 1990:45-48 Bentley RA. Eur J Hum Genet 12:355-364 Behrens RH (1989) Ein Gräberfeld der Bandkeramik von Schwetzingen. Mader O. Rhein-Neckar-Kreis. Khan AA. Ancient Biomolecules 4:9-17 Barbujani G. Röhl A (1999) Median-joining networks for inferring intraspecific phylogenies. Forster P. Goldstein DB (2004) Africans and Asians abroad: genetic diversity in Europe. pp 144-182 Behar DM. Current Anthropology 43:799-804 203 . Bonne-Tamir B. Janicijevic B. Cambridge Barnes I. McDonald Institute for Archaeological Research. Garrigan D.Literatur Babalini C. Eur J Hum Genet 13:902-912 Bach A (1978) Neolithische Populationen im Mittelelbe-Saale-Gebiet. Biondi G. Sykes BC (1996) Ancient DNA suggests a recent expansion of European cattle from a diverse wild progenitor species. Villems R. Gurwitz D. Cambridge University Press. Quintana-Murci L. Macaulay V. Macaulay VA. Khalaily H. Proc R Soc Lond B Biol Sci 263:1467-1473 Balogh MK. Kivisild T. In: Bellwood P. Alt KW (2003) STR genotyping and mtDNA sequencing of latent fingerprint on paper. Weimar. Pericic M. Horwitz LK (2002) Ancient DNA Evidence for the Transition from Wild to Domestic Status in Neolithic Goats: A case study from the site of Abu Gosh. pp 99-111 Bar-Gal GK. Ducos P. Sujoldzic A. Matheus P. Richards M. Shapiro B. I. Barac L. Jensen D. Salas A. Forensic Sci Int 137:188-195 Bandelt HJ. In: Price TD (ed) Europe's First Farmers. Villems R. Bach H. Wahl J. Rudan P. Rickards O (2005) The population history of the Croatian linguistic minority of Molise (southern Italy): a maternal view. Am J Hum Genet 71:1150-1160 Bandelt HJ. Bradley DG. Cooper A (2002) Dynamics of Pleistocene population extinctions in Beringian brown bears.

Bestimmung humanökologisch relevanter Tierarten aus historischen. Biol. pp 128-163 Binford SR (1968) Post-Pleistocene adaptions. Quintyn CB. Khusnutdinova E (2002) [Diversity of mitochondrial DNA haplotypes in ethnic populations of the Volga-Ural region of Russia]. aDNAAnalytik an anthropologischem Fundmaterial. Johannes Gutenberg Universität Mainz Bollongino R. Abteilung Historische Anthropologie und Humanökologie. Georg-August-Universität Göttingen Bollongino R (2005) Die Herkunft der Hausrinder in Europa. In: Price TD (ed) Europe´s First Farmers. In: Schwabedissen H (ed) Die Anfänge des Neolithikums vom Orient bis Nordeuropa. Binford LR (eds) New perspectives in archaeology. Chikhi L. Nature 368:455-457 Brace CL. Lett. musealen und forensischen Materialien durch Sequenzierung mitochondrialer Genorte. Cambridge University Press. Alt KW. Early agriculture and its consequences in NorthCentral Europe. Hummel S. Scozzari R. Edwards CJ. Cambridge Bogucki P (2000) How agriculture came to North-Central Europe.. Bökönyi S (1989) Definitions of animal domestication. Qifeng P (2006) The questionable contribution of the Neolithic and the Bronze Age to European craniofacial form. Cavalli-Sforza LL (1994) High resolution of human evolutionary trees with polymorphic microsatellites.. Price TD (2003) The Neolithic transition in Europe: comparing broad scale genetic and local scale isotope evidence. Hum Biol 75:105-115 Brandt G (2005) Die Haplotypenverteilung neolithischer Siedlungsgebiete der Körsö-Kultur. Allen JC. Johannes Gutenberg Universität Mainz Brehm A. Pereira L. Herrmann B (2003) Ancient DNA analysis of the delta F508 mutation. Antiquity 77:63-66 Benz M (1998) Why should we plant.. Segucki N. Daten und einethnologisches Modell zur Neolithisierung im Vorderen Orient. Nelson AR. Freiburg i. Cruciani F. Hum Genet 114:77-86 Brown MD. Bradley D (2005) Early history of European domestic cattle as revealed by ancient DNA. Manolis SK. Ruiz-Linares A. Chiarelli B.Literatur Bentley RA. In: Binford SR. Diplomarbeit. London. Schurr TG. Kidd JR. Villems R. Minch E. Bandelt HJ. Tambets K. Amorim A (2003) Mitochondrial portraits of the Madeira and Acores archipelagos witness different genetic pools of its settlers. Fox SC. Aldine Publishing Company. Chicago. Institut für Zoologie und Anthropologie. Wallace DC (1998) mtDNA haplogroup X: An ancient link between Europe/Western Asia and North America? Am J Hum Genet 63:1852-1861 204 . Mol Biol (Mosk) 36:990-1001 Bernhard W (1978) Anthropologie der Bandkeramik. Current Anthropology 43:637-650 Bogenhagen DF (1999) Repair of mtDNA in vertebrates. Published online December 2005 Bowcock AM. Teil VIIIb Köln. Hosseini SH. Cambridge. PNAS 103:242-247 Bramanti B. pp 131-341 Bocquet-Appel JP (2002) Paleoanthropological Traces of a Neolithic Demographic Transition. Cambridge University Press. pp 22-27 Bollongino R (2000) Speziesidentifikation an Spuren-DNA. Albert-Ludwigs-Universität. Burger J.? Theorien. Kivisild T. Tomfohrde J. Bermisheva M. Eine aDNA-Studie an neolithischen Knochenfunden. Torroni A. In: Clutton-Brock J (ed) Unwin Hyman Ltd. Am J Hum Genet 64:1276-1281 Bogucki P (1988) Forest farmers and stockherders. Br.

Anthropol Anz 55:193-198 Burger J. PNAS :-7 Cavalli-Sforza LL (1996) The spread of agriculture and nomadic pastoralism. Cooper A. In: Ammerman AJ. Proc Natl Acad Sci U S A 76:1967-1971 Bunce M. RFLP-Analyse und STR-Genotypisierung alter DNA aus archäologischen Funden und historischen Werkstoffen. PLoS Biol 3:9 Bunce M. Berlin Calafell F.. Jr. UCL Press. Poinar HN. Collins MJ. Ann Hum Genet 60 ( Pt 1):35-49 Cann RL. Universität Göttingen Burger J. Hummel S. Boston. In: Harris DR (ed) The Origins and Spread of Agriculture and Pastoralism in Eurasia. Casoli A. Thermochimica Acta 365:141-146 Burger J (2000b) Sequenzierung. Barnes I. Menozzi P. Wess T. Cooper A (2003) Extreme reversed sexual size dimorphism in the extinct New Zealand moa Dinornis. Loreille o. George M. Eriksson T. Barbujani G. Archaeological Institute of America. Lalueza-Fox C. Electrophoresis 20:1722-1728 Burger J. Princeton Cavalli-Sforza LL. Rosendahl W. Henke W (1999) DNA preservation: A microsatellite-DNA study on ancient skeletal remains. Holdaway RN (2005) Ancient DNA provides new insights into the evolutionary history of New Zealand's extinct giant eagle. Worthy TH. Vernesi C. Underhill P. The Neolithic transition in Europe: Looking back. Lari M. Shapiro B. Walter deGruyter. Poinar JrGO (1992) Isolation and partial characterization of the DNA from the bee Proplebeia dominicana in 25-40 milion year old amber. Hoppitt W. Angelicheva D. Mol Phylogenet Evol 30:841-849 Buttler W (1938) Der donauländische und der westische Kulturkreis der jüngeren Steinzeit. Bertorelle G (2003) Evidence for a genetic discontinuity between Neandertals and 24. Nature :172-175 Burger J. Lerner HR. Handbuch der Urgeschichte Deutschlands 2. Liegemilieu als Faktor für den Erhalt von DNA. Szulkin M. Am J Hum Genet 61:247-254 205 .000-year-old anatomically modern Europeans. Gotherstrom A. Med Sci Res 20:249-251 Caramelli D. Willerslev E. Stoneking M. Drummond A. Minch E (1997) Paleolithic and Neolithic lineages in the European mitochondrial gene pool. Dupanloup I. Wilson AC (1979) Rapid evolution of animal mitochondrial DNA.Literatur Brown WM. Chiarelli B. Hiller J. Ford T. Paolo B (eds) The widening harvest. Brenig B. pp 297-314 Cavalli-Sforza LL. Kalaydjieva L (1996) From Asia to Europe: mitochondrial DNA sequence variability in Bulgarians and Turks. Princeton University Press. London. Trends in Genetics 14:60-65 Cavalli-Sforza LL (2003) Returning to the Neolithic transition in Europe. pp 51-69 Cavalli-Sforza LL (1998) The DNA revolution in population genetics. Nature 325:31-36 Cano RJ. Wilson AC (1987) Mitochondrial DNA and human evolution. Mallegni F. Fuchs R. Species determination and STR-genotyping from ancient DNA in art and artefacts. Herrmann B. Hemmer H. Hummel S. looking forward. Herrmann B (2000a) Palaeogenetics and cultural heritage. Pfeiffer I. Alt KW (2004) Molecular phylogeny of the extinct cave lion Panthera leo spelaea. Hummel S. Ancient Biomolecules 3:227-238 Burger J. Tolun A. Herrmann B (1997) Nachweis von DNA-Einzelkopiesequenzen aus prähistorischen Zähnen. Piazza A (1994) The History and Geography of Human Genes. Hummel S. Bertranpetit J. Herrmann B (2001) Mitochondrial and nuclear DNA from (pre)historic hide-derived material.

Vercauteren M. Lao O. Proc Prehist Soc 31:57-73 Collins MJ. Bertorelle G. Wells RS. Eur J Hum Genet 12:495-504 Cone RW. Aunger R. Mourer-Chauvire C. Macaulay V. Sirajuddin SM. Bertranpetit J (2004) Admixture. Bentley GR. Rambaut A. Waite ER. Hansen AJ. Wilson AC. Nature 373:393 Cooper A. Austin J. Lalueza-Fox C. Anderson S. Paredes M. Ward R (2001a) Complete mitochondrial genome sequences of two extinct moas clarify ratite evolution. Nichols RA. Ancient Biomolecules 1:109-117 Comas D. London Clark JGD (1965) Radiocarbon dating and the expansion of farming culture from the Near East over Europe. Willerslev E (2004) Ancient DNA: would the real Neandertal please stand up? Curr Biol 14:R431-R433 Cordaux R. Stringer C (2001b) Human origins and ancient human DNA. Pascali V. Proc Natl Acad Sci U S A 89:8741-8744 Cooper A (1997) Reply to Stoneking: ancient DNA--how do you really know when you have it? Am J Hum Genet 60:1001-1003 Cooper A. Valverde JL (2000) Mitochondrial DNA sequences for 118 individuals from northeastern Spain. Beaumont MA (2002) Y genetic data support the Neolithic demic diffusion model. Science 292:1655-1656 Cooper A. Excoffier L (2004) Modern Humans Did Not Admix with Neanderthals during Their Range Expansion into Europe. Luque JA. van Duin AC (1999) Predicting protein decomposition: the case of aspartic-acid racemization kinetics. Ramirez E. Drummond AJ. Proc Natl Acad Sci U S A 95:9053-9058 Chikhi L. Saha N. and dispersals in Central Asia: evidence from maternal DNA lineages. Bailey JF. Plaza S. Calafell F. Philos Trans R Soc Lond B Biol Sci 354:51-64 Colson IB. von Haeseler A. Pusey AE (1995) Nuclear DNA from primate dung. Stoneking M (2003) Mitochondrial DNA analysis reveals diverse histories of tribal populations from India. Fairfax MR (1993) Protocol for ultraviolet irradiation of surfaces to reduce PCR contamination. Rambaut A. Eur J Hum Genet 11:253-264 Crespillo M. Proc Natl Acad Sci U S A 99:11008-11013 Childe VG (1957) The Dawn of European Civilisation. Nature 409:704-707 Cooper A. Routledge & Kegan Paul.Literatur Chapman J (1994) The origins of farming in Southeast Europe. Science 289:1139 Cooper A. Paabo S (1992) Independent origins of New Zealand moas and kiwis 75. Destro-Bisol G. Yuldaseva N. Barbujani G (1998) Clines of nuclear DNA markers suggest a largely neolithic ancestry of the European gene pool. Barbujani G. Int J Legal Med 114:130-132 Crests AA (1996) The new craniological material of Neolithic time from the Territory of forest-Steppe Volga Region in connection with the problem of the origin of Ural race. 6th edn. PLOS Biology 2:e421 206 . Sykes BC (1997) The Preservation of Ancient DNA and Bone Diagenesis. Fernandez R. Chambers GK. The herald of anthropology 1:121-141 Currat M. Collins DA. pp 133-156 Chikhi L. migrations. Packer C. Willerslev E. Poinar HN (2001) Ancient DNA: do it right or not at all. PCR Methods Appl 3:S15-S17 Constable JJ.

Signoli M. Paoli G. Denisova GA. In: Cowan CW. Chenal-Francisque V. Dambueva IK. Dang LV. Raoult D (1998) Detection of 400-year-old Yersinia pestis DNA in human dental pulp: an approach to the diagnosis of ancient septicemia. Nigro L. Kerimova MG. Akar N. Dorzhu CM. Dutour O. Zakharov IA (2001) The presence of mitochondrial haplogroup x in Altaians from South Siberia. Nature 323:803-806 Drancourt M. Stoneking M. Archäologische Berichte aus Sachsen-Anhalt 1999/1:73-81 Dennell R (1983) European Economic Prehistory: a New Approach. Am J Hum Genet 69:237-241 Derenko MV. Stenico M. Vigilant L. Castex D. Ldkr. and plague pandemics. Spigelman M. Excoffier L (2005) The effect of the Neolithic expansion on European molecular diversity. Grzybowski T. Proc Natl Acad Sci U S A 95:12637-12640 Drancourt M. Minnikin DE (1998) Mycobacterium tuberculosis complex DNA in calcified pleura from remains 1400 years old. Nasidze IS. Czarny J. Hauswirth WW (1986) Anatomical. Derbeneva OA. Anagnou N. Starikovskaya EB. Wheeler W. Agee OF. Novelletto A (2004) Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe. Proc Biol Sci 272:679-688 Deffner A (1999) Von der Linearbandkeramik bis ins Frühmittelalter: die Ausgrabungen in der Kiesgrube von Unseburg. Papola F. Lanzinger M. Ciavarella G. Roux V. Wallace DC. Lett Appl Microbiol 27:265-269 Donoghue HD. Loutradis A. Barbujani G. Kakpakov VT. Fournier PE. Barbujani G (2000) Mitochondrial DNA sequences in prehistoric human remains from the Alps. Eur J Hum Genet 8:669-677 Di Giacomo F. Kovatchev D. Mandarino V. Malyarchuk BA. Ann Hum Genet 67:391-411 DeSalle R. Popa LO. Chikhi L. Paabo S.000-yr-old human brain tissue from the Windover archaeological site. Miscicka-Sliwka D. Aschersleben-Staßfurt. Jr. Gavrila L. Gatesy J. Raoult D (2002) Molecular insights into the history of plague.. Sukernik RI (2002) Traces of early Eurasians in the Mansi of northwest Siberia revealed by mitochondrial DNA analysis. Hum Genet 115:357-371 Donoghue HD. Ballinger WE. Washington (DC). Mol Biol Evol 21:1361-1372 207 . Cucci F. Pappa KI. Science 257:1933-1936 Di Benedetto G. Am J Hum Genet 70:1009-1014 Derenko MV. Malaspina P. Grzybowski T. Raoult D (2004) Genotyping. Bertorelle G. cellular and molecular analysis of 8. Miscicka-Sliwka D. Brdicka R. Krings M. Kozlov AI. London Dennell R (1992) The origins of crop agriculture in Europe. Holton J. Czarny J. ein Zwischenbericht. Grimaldi D (1992) DNA sequences from a fossil termite in OligoMiocene amber and their phylogenetic implications. Gernaey-Child AM. Spigelman M (2001) PCR primers that can detect low levels of Mycobacterium leprae DNA. Orientalis-like Yersinia pestis. Tofanelli S. Laipis PJ. Luca F. Mammi' C. Wozniak M. Malyarchuk BA. Zias J. Emerg Infect Dis 10:1585-1592 Dupanloup I. Ogata H. Tran-Hung L. Academic Press. Smithsonian Institution Press. Di SL. Banyko J. Crubezy E. Michalodimitrakis EN. Pedicini G. J Med Microbiol 50:177-182 Doran GH. Microbes Infect 4:105-109 Drancourt M. Dickel DN. Aboudharam G. Terrenato L. Zakharov IA (2003) Diversity of mitochondrial DNA lineages in South Siberia.Literatur Currat M. Watson PJ (eds) The Origins of agriculture: an International Perspective. Barbujani G (2004) Estimating the impact of prehistoric admixture on the genome of europeans.

Matsumura S (2005) Evolution. Cambridge University Press. Andrews RM. Did early humans go north or south? Science 308:965-966 Fucharoen G. Caballero OL. Villems R. Spigelman M (2003) Widespread occurrence of Mycobacterium tuberculosis DNA from 18th-19th century Hungarians. Jen J. Bermisheva MA. University of Hamburg Forster P. Lehtonen MS. Turnbull DM. Usadel H. Am J Hum Genet 68:1475-1484 Fix AG (1996) Gene frequency clines in Europe: demic diffusion or natural selection? J Roy Anthropol Inst (NS) 2:625-643 Fix AG (1999) Migration and Colonization in Human Microevolution. Smith NH. Holton J. Sidransky D (2000) Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Buta MR. De Leo G. Smith JM (1999) How clonal are human mitochondria? Proc Biol Sci 266:477-483 Fedorova SA. Lalueza-Fox C. Rickards O. Salerno A. Röhl A. Horai S (2001) Mitochondrial DNA polymorphisms in Thailand. Howell N (2001) Analysis of European mtDNAs for recombination. Eleff SM. Stringer C. Metspalu E. Hansen AJ. Donoghue HD. Cambridge University Press. Cali F. Bandelt HJ (1996) Origin and evolution of Native American mtDNA variation: a reappraisal. Proc Natl Acad Sci U S A 99:13950-13954 Forster P (1996) Dispersal and differentiation of modern Homo sapiens analysed with mitochondrial DNA. Yang Z (1999) Substitution rate variation among sites in mitochondrial hypervariable region I of humans and chimpanzees. Willerslev E.Literatur Elson JL. Am J Phys Anthropol 120:144152 Fliss MS. Khusnutdinova EK (2003) [Analysis of mitochondrial DNA haplotypes in yakut population]. Majamaa K (2001) Phylogenetic network for European mtDNA. Forster P. D`Anna R. Chinnery PF. Pap I. Cambridge Fletcher HA. Ayala G. Hoener PA. Kouvatsi A. Mirisola M. Romano V (2001) Continental and subcontinental distributions of mtDNA control region types. Proc Natl Acad Sci U S A 85:544-548 Excoffier L. Cooper A (2003) The genetic origins of the Andaman Islanders. Am J Hum Genet 68:145-153 Endicott P. Willkomm H. Harding R. Gilbert MT. Trans R Soc Lond B 359:255-264 Forster P. Lightowlers RN. Mol Biol Evol 16:1357-1368 Eyre-Walker A. Am J Hum Genet 72:178-184 Engelke DR. Cambridge Gamble C (1999) The Paleolithic Societies of Europe. De Stefano G. Am J Hum Genet 59:935-945 Forster P. Collins FS (1988) Direct sequencing of enzymatically amplified human genomic DNA. Wu L. Cambridge University Press. Forster P (2004) Ice Ages and the mitochondrial DNA chronology of human dispersals: a review. Torroni A. Fucharoen S. Villems R. Mol Biol (Mosk) 37:643-653 Finnila S. Flugy A. Science 287:2017-2019 Forster L. Maksimova NR. Lutz-Bonengel S. Cambridge 208 . J Hum Genet 46:115-125 Gamble C (1986) The Palaeolithic settlement of Europe. Brinkmann B (2002) Natural radioactivity and human mitochondrial DNA mutations.

Hummel S. Collins MJ (2005b) Biochemical and physical correlates of DNA contamination in archaeological human bones and teeth excavated at Matera. 6500-5000 cal BC. Jena. Ljubljana. White W. Univerzav Ljubljani. pp 79-91 Gronenborn D (2004) Comparing Contact Period Archaeologies: The Expansion of Farming and Pastoralist Societies to Europe and to Southern Africa. Titball RW. Hansen AJ. Rudbeck L. Steele J (2003) Neolithic transition in Europe: the radiocarbon record revisited. Barnes I (2005a) Assessing ancient DNA studies. Turner-Walker G.Priester . Prentice MB (2004a) Absence of Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague victims. Paabo S (1999) Nuclear DNA sequences from late Pleistocene megafauna. Smith C. Genetics 154:1785-1791 Gkiasta M. Penkman KEH. Lübeck. and culture change in western temperate Eurasia. Cooper A (2003a) Characterization of genetic miscoding lesions caused by postmortem damage. Shennan S. The Hague Giuffra E. Willerslev E. Ulm Gerstenberger J. Tobin DJ. Higham TF. Cooper A. Sachse GE.haplotyping of ancient DNA. Am J Hum Genet 72:4861 Gilbert MT. Cooper A (2004b) Ancient mitochondrial DNA from hair. Neubauer W (eds) Zeitreise 209 . Hansen AJ. Andersson L (2000) The origin of the domestic pig: independent domestication and subsequent introgression. Possnert G. Microbiology 150:341-354 Gilbert MT. Filozofzka Fakulteta. Cuccui J. Italy. Capelli C. Kjolbye-Biddle B. Collins MJ. Lidén K (2002) Bone preservation and DNA amplification. Oddelek za Arheologijo. Trends in Ecology & Evolution. Gustav Fischer Verlag. Rudbeck L. Jans ME. Hofreiter M. Shapiro B. Gimbutas M (1965) Bronze Age Cultures in Central and Eastern Europe. Schultes T. Carlborg O. Curr Biol 14:R463-R464 Gilbert MTP. Kijas JM. Janaway RC. NielsenMarsh CM. Richards MP. Bandelt H-J. acculturation. Prangenberg K. Lynnerup N. Willerslev E. Arthur P. J Arch Sci 32: 785-793. Mol Biol Evol 16:1466-1473 Grimm H (1964) Kraniologische Beschreibung der bandkeramischen Menschenreste von Seehausen in Thüringen. Wilson AS. Cooper A (2003b) Distribution patterns of postmortem damage in human mitochondrial DNA. Stuttgart. Archaeometry 44:395-404 Greenwood AD. Eur J Hum Genet 7:469-477 Gilbert MT.. Antiquity 77:45-62 Götherström A. Hansen AJ. Lynnerup N. Mouton & Co. In: Daim F. Rudbeck L. Hack B. Ausgrabungen und Funde 9:233-237 Gronenborn D (1999) A variation on a basic theme: the transition to farming in southern central Europe.Häuptlinge. Russel T. 226-260 Gronenborn D (2005a) Bauern . J World Prehistory 13:123-210 Gronenborn D (2003) Migration. O'Connell TC. Barnes I. In press Gilbert MTP. Herrmann B (1999) Reconstruction of a historical genealogy by means of STR analysis and Y. XXX edn. Jeon JT. In: Budja M (ed) Documenta Praehistorica. Hansen AJ.Literatur Gassen HG. Die Anfänge der Landwirtschaft und die frühe Gesellschaftsentwicklung zwischen Orient und Europa. Barnes I. Amarger V. Am J Hum Genet 72:32-47 Gilbert MT. Willerslev E. Biddle M. Bunce M. Lynnerup N. Willerslev E. Schulte E (1994) PCR-Grundlagen und Anwendungen. Before Farming. Angerbjörn A. Lynnerup N.

Whelan S. Bowden DK (2000) Evidence for mitochondrial DNA recombination in a human population of island Melanesia. Tänzer M. Marcsik A. comment]. Burger J. Verlag Berger. Cook CE. Schiefenhovel W. Thomas MG. Paabo S (1994a) Ancient DNA: methodological challenges. Palfi G. Proc Natl Acad Sci U S A 91:12336-12340 Hanni C. Spektrum der Wissenschaft 2. Zink A. Sykes B. Gronenborn D. Mol Biol Evol 19:1359-1366 Haak W. Marin A (2002) A reanalysis of the ancient mitochondrial DNA sequences recovered from Neandertal bones. Am J Clin Pathol 114:428-436 Hagelberg E. Villems R. Bramanti B. Schaffner W. Stone A. Nucleic Acids Res 23:881-882 210 . Laudet V. Cummings V (eds) Going Over: the Mesolithic-Neolithic Transition in North-West Europe. Brousseau T. Bowden DK (1999) Evidence for mitochondrial DNA recombination in a human population of island Melanesia. Sanchez D. Szeimies U. Hedges R (1989) Ancient bone DNA amplified. Clegg JB. Nerlich AG (2000a) Molecular evidence for different stages of tuberculosis in ancient bone samples from Hungary. Erratum. Science 310:1016-1018 Haas CJ. Forster P. in press Guitérrez G. Whelan S. Nature 342:485 Hagelberg E. Stehelin D. Frauendorf E.Wien Gronenborn D (2005b) Freundliche Übernahme. Burger J. Richards M. Taberlet P (1994) Tracking the origins of the cave bear (Ursus spelaeus) by mitochondrial DNA sequencing. Sher AV. Am J Phys Anthropol 113:293-304 Haas CJ.Geheimnisvolle Kreisgräben. Goldman N. Stehelin D (1995) Isopropanol precipitation removes PCR inhibitors from ancient bone extracts. Gruber P. Renfrew C. Ulrich-Bochsler S. Arthritis Rheum 52:3318-3319 Haak W. Schiefenhovel W. Krings M. Proc R Soc Lond B Biol Sci 266:485-492 Hagelberg E. Szeimies U. Brandt G. Ardagna Y. Laudet V. Lio P. Rühli FJ. Baryshnikov GF. Bauer K. Ward RH. Anthropol Anz 62:397-410 Haak W. Alt KW (2004) ABO genotyping by PCR-RFLP and cloning and sequencing.. Hedges R. Molnar E. Experientia 50:524-529 Handt O. Simanainen J. Georgiev O. British Academy. Goldman N. In: Whittle A. Burger J (2005b) Ancient DNA from the first European farmers in 7500-year-old Neolithic Sites. Proc R Soc Lond B Biol Sci 267:1595-1596 Handt O. Palfi G. London. Science 264:1775-1778 Handt O. 56-61 Gronenborn D (2006) Beyond the Models: ‘Neolithization’ in Central Europe. Lister AM (1994) DNA from ancient mammoth bones [letter. Kilger C. Nerlich AG (2000b) Detection of leprosy in ancient human skeletal remains by molecular identification of Mycobacterium leprae. Matsumura S. Paabo S (1996) The retrieval of ancient human DNA sequences. Horn . Am J Hum Genet 59:368-376 Hanni C. Alt KW. Trommsdorff M. (1994b) Molecular genetic analyses of the Tyrolean Ice Man. Zink A. . Katalog zur Niederösterreichischen Landesausstellung. Alt KW (2005a) Molecular evidence of HLA-B27 in a historical case of ankylosing spondylitis. Dutour O. Böni T. Reischl U. Höss M. Clegg JB.Literatur Heldenberg. Jr. Lio P. Nature 370:333-334 Hagelberg E. Krings M.

Spaulding WG. Current Anthropology 34:483-496 Harpending HC. Phillips MJ. Willerslev E. Stefansson K. Munzel S. Asian. Paabo S (2000) A molecular analysis of ground sloth diet through the last glaciation. Martin PS. Poinar HN. Preston G. Thompson TJ. Nagel D. Dennebouy N. Davis RE. Paunovic M. Kocher TD. Possnert G. Gerbitz KD (1997) Population genetics and disease susceptibility: characterization of central European haplogroups by mtDNA gene mutations. Elson JL. Mounolou JC. Rabeder G. Casane D. Paabo S (2002a) Ancient DNA analyses reveal high mitochondrial DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears. Mourier T. Goodacre S. Biomaterials 24:5091-5097 Hiller JC. Bosnes V. Fahy E. Conard N. J Mol Evol 37:347-354 Hebsgaard MB. Howell N (2002) Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African. Wiuf C. Jambresic G. Ward R (2000) Sampling Saturation and the European MtDNA Pool: Implications for Detecting Genetic Relationships among Populations. Wilson AC (1984) DNA sequences from the quagga. Jaksch M. Bowman B. Jaenicke V. Sigurdardottir S. Wess TJ (2003) Bone mineral change during experimental heating: an X-ray scattering investigation. Boyle K (eds) Archaeogenetics: DNA and the population prehistory of Europe. Freiberger M. Olefsky JM. Kuch M. Turnbull DM. Am J Hum Genet 68:723-737 Herrnstadt C. Weiss G. and European haplogroups. Stefansson K. Chamberlain AT. Monnerot M (1995) Rabbit mitochondrial DNA diversity from prehistoric to modern times. Mol Biol Evol 18:262-265 Hardy C. Rogers AR. Capelli C. In: Renfrew C. Mertens S. J Mol Evol 40:227-237 Harpending HC.Literatur Hansen AJ. Nature 312:282-284 Hiller JC. Hickey E. Bauer K. Anderson C. Hum Mol Genet 6:1835-1846 Hofreiter M. Gulcher JR. correlation with D loop variants and association with disease. Sherry ST. Stoneking M (1993b) Structure of ancient human populations. Nat Rev Genet 2:353-359 Hofreiter M. Paabo S (2001b) Ancient DNA. Waits L. Mol Biol Evol 19:1244-1250 211 . Am J Hum Genet 70:1152-1171 Higuchi R. Meyer S. Poinar HN. Arctander P (2001) Statistical Evidence for Miscoding Lesions in Ancient DNA Templates. Cambridge. Ghosh SS. Paprotta A. Willerslev E (2005) Geologically ancient DNA: fact or artefact? Trends Microbiol 13:212-220 Helgason A. Paabo S (2001a) DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Evison MP. Sykes B (2001) mtDNA and the Islands of the North Atlantic: Estimating the Proportions of Norse and Gaelic Ancestry. Serre D. Callou C. Rogers AR. Ryder OA. Krings M. Haeseler AA. Bezold R. Mol Ecol 9:1975-1984 Hofreiter M. Beal MF. J Arch Sci 31:1349-1359 Hofmann S. Chamberlain AT. Wess T (2004) Small angle X-ray scattering: a high-throughput technique for investigating archaeological bone preservation. an extinct member of the horse family. Nucleic Acids Res 29:4793-4799 Hofreiter M. Stoneking M (1993a) The genetic structure of ancient human populations. Current Anthropology 34:483-496 Hasegawa M. Di RA. McDonald Institute for Archaeological Research. pp 285-294 Helgason A. Wilson AC (1993) Toward a more accurate time scale for the human mitochondrial DNA tree. Ward R. Sherry ST. Serre D. Collins MJ. Aholt S. Vigne JD.

Conard N. Kahle M. Nature 425:175-178 Ingman M. Weiss G. Strategies and Applications. Hayasaka K. Murayama K. Anthropol Anz 58:15-21 Hummel S. Am J Hum Genet 59:579-590 Höss M. Jambresic G. Omoto K. Proc Jpn Acad 65:229-233 Horai S. Herrmann B (1991) Y-chromosome-specific DNA amplified in ancient human bone. Int J Legal Med 116:327-333 Hummel S (2003) Ancient DNA Typing. Nature 359:199 Höss M. Waits L. Matsubayashi S. Electrophoresis 20:1717-1721 Hummel S. de la Rua C (1999) An mtDNA analysis in ancient Basque populations: implications for haplogroup V as a marker for a major paleolithic expansion from southwestern europe. New York Hunan Medical College (1980) Study of an ancient cadaver in Mawangtui Tomb No. Nagel D. ate M. Proc Natl Acad Sci U S A 93:181-185 Höss M. Knauer F. Springer. oike H. Dilling A. Pääbo S. with special reference to the peopling of Japan.Literatur Hofreiter M. Murayama K. Paabo S. Pääbo S. Haffner S.1 of the HanDynasty in Changsha. Gyllensten U (2000) Mitochondrial genome variation and the origin of modern humans. Herrmann B (2000) Megaplex DNA typing can provide a strong indication of the authenticity of ancient DNA amplifications by clearly recognizing any possible type of modern contamination. akai N (1989) DNA amplification from skeletal remains and their sequence analysis. Schroder W (1992) Excrement analysis by PCR [letter] [see comments] 74. Nature 408:708-713 Ingman M. Schmidt D. Methods. Schultes T. Nature 370:333 Höss M. Kahle M. Herrmann B (1999) Ancient DNA profiling by megaplex amplications. Paabo S (1996a) Molecular phylogeny of the extinct ground sloth Mylodon darwinii 50. Heidelberg. Capelli C. Am J Hum Genet 65:199-207 212 . Pan IH (1996) mtDNA polymorphism in East Asian Populations. Gyllensten U (2001) Analysis of the complete human mtDNA genome: methodology and inferences for human evolution. Naturwissenschaften 78:266-267 Hummel S. Martin P. Nucleic Acids Res 24:1304-1307 Hummel S. Poinar HN (2003) Molecular caving. Munzel S. Kaessmann H. Herrmann B (2002) AB0 blood group genotyping of ancient DNA by PCR-RFLP. J Hered 92:454-461 Izagirre N. Curr Biol 13:R693-R695 Horai S. Bramanti B. Harihara S. Hayasaka K. Krings M. Rabeder G. pp 184-187 Huynen L. Meyer S. Schultes T. Fucharoen G. Paunovic M. Zastawny TH. Dizdaroglu M. Scofield RP. Berlin. Ancient Memorial Press. Lambert DM (2003) Nuclear DNA sequences detect species limits in ancient moa. Millar CD. Kohn M. Mead JI. Bramanti B. Hattori Y. Mol Biol Evol 19:1244-1250 Hofreiter M. Park KS. Paabo S (1996b) DNA damage and DNA sequence retrieval from ancient tissues 47. Jaruga P. Currant A. Vereshchagin NK (1994) Mammoth DNA sequences. Paabo S (2002b) Ancient DNA analyses reveal high mitochondrial DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears.

Crubezy E. looking forward. Budapest. Budapest Kalicz N (1990) Frühneolithische Siedlungsfunde aus Südwestungarn. Peoples & Disease. Forster P. pp 227-248 Kaessmann H. Am J Hum Genet 73:247-260 Kijas JM. Quellenananalyse zur Geschichte der Starcevo-Kultur. Alt-Thüringen 2:63-69 Kahlke HD (1958) Ein Gräberfeld mit Bandkeramik im Stadtgebiet von Sondershausen. Kucinskas V. Makkay J (1977) Die Linienbandkeramik in der Grossen Ungarischen Tiefebene. Nat Genet 22:78-81 Kahlke HD (1957) Gräber mit Bandkeramik von Seehausen bei Bad Frankenhausen. Hum Mol Genet 3:107-114 Jobling MA. Ausgrabungen und Funde 3:180-182 Kahlke HD (1959) Ein Gräberfeld mit Linienbandkeramik von Bruchstedt. Bemerkungen zur Ausbreitung der Linearbandkeramik im südlichen Mitteleuropa. Proc Natl Acad Sci U S A 99:10905-10910 Jobling MA (1994) A survey of long-range DNA polymorphisms on the human Y chromosome. Heissig F. Science 302:1206-1208 Jansen T. Comp Biochem Physiol 81B:1045-1051 Jorde LB. Ludes B (2003) Nuclear and mitochondrial DNA analysis of a 2. Buckler ES. Boston. Andersson L (2001) A phylogenetic study of the origin of the domestic pig estimated from the near-complete mtDNA genome. Germania 76:1-24 213 . Trends Genet 16:356-362 Jobling MA. Weber J. Hurles MA.000year-old necropolis in the Egyin Gol Valley of Mongolia. Olek K (2002) Mitochondrial DNA and the origins of the domestic horse. Kozlowski JK (2003) Origins of the Linear Pottery complex and the Neolithic transition in Central Europe. Levine MA. In: Ammerman AJ. Kasperaviciute D. Science 288:1931 Kaczanowska M. Paabo S (1999) DNA sequence variation in a non-coding region of low recombination on the human X chromosome. The Neolithic transition in Europe: Looking back. Olson CB. Origins. Stoneking M (2004) Y chromosome and mitochondrial DNA variation in Lithuanians. Garland Publishing. disease and selection 1. Ann Hum Genet 68:438-452 Keyser-Tracqui C. Gilbert MT. Akadémiai Kiadó. Bamshad M (2000) Questioning evidence for recombination in human mitochondrial DNA. Oelke H. Paolo B (eds) The widening harvest. Tyler-Smith C (2000) New uses for new haplotypes the human Y chromosome. Ausgrabungen und Funde 4:229-233 Kalicz N. New York Johnson LA. Pääbo S (2003) Early allelic selection in maize as revealed by ancient DNA. Hurles M. Archaeological Institute of America. Ferris JA (2002) Analysis of postmortem DNA degradation by single-cell gel electrophoresis. Doebley J. Cooper A. J Mol Evol 52:302-308 Kind CJ (1998) Komplexe Wildbeuter und frühe Ackerbauern. Magyar Nemzeti Múzeum. Renfrew C. Kr. Goodman M (1985) Isolation and characterization of deoxyribonucleic acid from skeletal remains and their sequence analysis. Langensalza. Smith BD. von Haeseler A. Forensic Sci Int 126:43-47 Johnson PE.Literatur Jaenicke-Despres V. Tyler-Smith C (2004) Human Evolutionary Genetics.

VI. Sömmerda und Nienstedt. Den Haag Krajewski C. Geberhiwot T. van der Have B (2001) Graven in Rijswijk. Villems R (2004) Ethiopian mitochondrial DNA heritage: tracking gene flow across and around the gate of tears. Mastana SS. Heft II. J Hum Evol 44:627-632 Knight A. Knauer F. Papiha SS. White PS. pp. Parik J. Mountain JL (2004) Molecular. Bratislava Kong QP. De Steentijmensen van Ypenburg. Bamshad MJ. Louis D. Mountain JL (2003) African Y chromosome and mtDNA divergence provides insight into the history of click languages. Oldenburg Verlag. Dixon ME. Mol Biol Evol 19:1737-1751 Kivisild T. 1-49 Kivisild T. Mol Ecol 4:95-103 Koledová Z (2005) Tracing the maternal genetic roots of Slovaks . Parik J. Rosa A. München-Wien. Braun MJ (1992) Phylogenetic relationships of the thylacine (Mammalia: Thylacinidae) among dasyuroid marsupials: evidence from cytochrome b DNA sequences. Ann Hum Biol 31:129-138 Koehl C (1903) Die Bandkeramik der steinzeitlichen Gräberfelder und Wohnplätze in der Umgebung von Worms: Festschr.phylogenetic and phylogeographic analysis of mitochondrial DNA variability in Slovak population. Halle a. Bandelt HJ. Yao YG. Papiha SS. Kaldma K. Driskell AC. Shen SP. Versammlung der Deutschen Anthropologischen Gesellschaft. Reidla M. Zhivotovsky LA. allg. Metspalu E. Stoffella A. Baverstock PR. forensic and haplotypic inconsistencies regarding the identity of the Ekaterinburg remains. Watkins WS. Hum Genet 113:391-405 Koot H. Underhill PA (2002) Congruent distribution of Neolithic painted pottery and ceramic figurines with Y-chromosome lineages. Litwin DE. Green LD. Am J Hum Genet 75:752-770 Klopffleisch F (1884) Charakteristik und Zeitfolge der Keramik Mitteldeutschlands. Parik J. Underhill PA. Tolk HV. Zhu CL. Metspalu M. Comenius University. Wang Y. Lin AA. Ruhlen M. Usanga E. Palanichamy MG. Bd. Westerman M (1997) DNA phylogeny of the marsupial wolf resolved. Kass DH. Ferak V. Brehm A. Knight A (2003) The phylogenetic relationship of Neandertal and modern human mitochondrial DNAs based on informative nucleotide sites. Villems R (2002) The emerging limbs and twigs of the East Asian mtDNA tree. Otto Hendel. Laos S. zur 34. Curr Biol 9:1331-1334 Kivisild T. Chen C. Henn BM. Saale. Curr Biol 13:464-473 Knight A. Science 288:1931 Kivisild T. Pennarun E. Buckley L. Worms Kohn M. Mortensen HM. Reidla M. In: Schwidetzky I (ed) Rassengeschichte der Menschheit. Metspalu E. Proc Biol Sci 250:19-27 214 . Antiquity 76:707-714 Kiszely I (1979) Rassengeschichte von Ungarn. Paabo S (1995) Conservation genetics of the European brown bear--a study using excremental PCR of nuclear and mitochondrial sequences 60. In: Klopffleisch F (ed) Die Grabhügel von Leubingen. Zhang YP (2003) Mitochondrial DNA sequence polymorphisms of five ethnic populations from northern China. Zhivotovsky LA. Villems R (2000) Questioning evidence for recombination in human mitochondrial DNA. d. Schroder W. Koninklijke De Swart. Mir MR. Proc Biol Sci 264:911-917 Krajewski C. Villems R (1999) Deep common ancestry of indian and western-Eurasian mitochondrial DNA lineages.Literatur King R. Liu M.

Caramelli D. Fortea J. Rowley-Conwy P. Sampietro ML. Paunovic M. Rottmann O (2005) Molecular Phylogeny of Megaloceros giganteus the Giant Deer or Just a Giant Red Deer? Zoolog Sci 22:1031-1044 Kumar S. de la RM. Science 307:1618-1621 Larson S. Bertranpetit J (2004) Unravelling migrations in the steppe: mitochondrial DNA sequences from ancient central Asians. Fleming M. Facchini F. Proc R Soc Lond B Biol Sci 271:941-947 Lalueza-Fox C. Rosas A (2005) Neandertal evolutionary genetics: mitochondrial DNA data from the iberian peninsula. Bentzen P (2002) Loss of genetic diversity in sea otters (Enhydra lutris) associated with the fur trade of the 18th and 19th centuries. Sampietro ML. Possnert G. Sistonen P. Bertranpetit J. Albarella U. Paabo S (1997b) Neandertal DNA sequences and the origin of modern humans [see comments]. Paabo S (2000a) A view of Neandertal genetic diversity. Hedrick P. Krainitzki H. Bakteriol. Karcagi V. Wheeler J. Mol Biol Evol 22:1077-1081 Landsteiner K (1900) Zur Kenntnis der antifermentativen. Paabo S (1999) DNA sequence of the mitochondrial hypervariable region II from the neandertal type specimen. Stone A. Bastir M. Finlayson H. Tschentscher F. Capelli C. Vila C (2002) Ancient DNA evidence for Old World origin of New World dogs. Paabo S (2000b) A view of Neandertal genetic diversity. Schmitz RW. Science 288:1931 Lahermo P. Geisert H. Dobney K. Savontaus ML (2000) MtDNA polymorphism in the Hungarians: comparison to three other Finno-Ugric-speaking populations. Matisoo-Smith E. 27:375-362. Ludt CJ. Beres J. Puder Y. Grossschmidt K. Brand T. Willerslev E. Nat Genet 26:144-146 Krings M. Zbl. Krainitzki H. Etnier M. Nat Genet 26:144-146 Kuehn R. Hereditas 132:35-42 Lalueza-Fox C. Stoneking M. Grossschmidt K. Lari M. Cooper A (2005) Worldwide phylogeography of wild boar reveals multiple centers of pig domestication.Literatur Krause R (2001) Die bandkeramischen Siedlungsgrabungen von Vaihingen an der Enz. Cell 90:19-30 Krings M. Archäologische Ausgrabungen in Baden-Württemberg 2001:33-36 Krause R (2002) Zum Abschluss der Grabungen1994-2002 in der bandkeramischen Siedlung bei Vaihingen an der Enz. Guillen S. Geisert H. Gilbert MT. Kreis Ludwigsburg. Martinez-Maza C. Krainitzki H. Excoffier L (2004) SIMCOAL 2. Stoneking M. Mol Ecol 11:1899-1903 Laval G. Pettener D. Cell 90:19-30 Krings M. Possnert G. Meyer S. Cooper A (2000) Population genetics of ice age brown bears. lytischen und agglutinierenden Wirkungen des Blutserums und der Lymphe. Bioinformatics 20:2485-2487 Leonard JA. Kreis Ludwigsburg. Castri L. Stoneking M (2000) Questioning evidence for recombination in human mitochondrial DNA. von HA. Schmitz RW. Larson G. Geisert H. Schmitz RW. Wayne RK. Capelli C. Valadez R. Tschentscher F. Fang M.0: a program to simulate genomic diversity over large recombining regions in a subdivided population with a complex history. Science 298:1613-1616 215 . Archäologische Ausgrabungen in Baden-Württemberg 2002:34-39 Krings M. Jameson R. Robins J. Paunovic M. Paabo S (1997a) Neandertal DNA sequences and the origin of modern humans. Proc Natl Acad Sci U S A 97:1651-1654 Leonard JA. Meyer S. Lowden S. Calafell F. Dowling T. Proc Natl Acad Sci U S A 96:5581-5585 Krings M. Andersson L. Stone A. Wayne RK. Schroeder W. Laitinen V. von HA.

Cann RL (1998) mtDNA and language support a common origin of Micronesians and Polynesians in Island Southeast Asia. Edwards CJ. Gonzalez AM. Cann RL. Monnerot M (1997) First Distinction of Sheep and Goat Archaeological Bones by the Means of their Fossil mtDNA. Rudolf Habelt GmbH. Scozzari R. Vigne J-D. and the Manners and Cusotms of Modern savages London Luikart G. Nock DA. Richards M. Int J Legal Med 111:67-77 Maca-Meyer N. Philippe M. Bunce M. Khusnutdinova EK. Richard C. Kadwell M. Proc Natl Acad Sci U S A 98:5927-5932 Lum JK. Jordan WC. Orlando L. Am J Hum Genet 61:983-990 Macaulay V. Mol Biol Evol 21:2012-2021 Loreille O. Bonne-Tamir B. Curr Biol 11:200-203 Lubbock J (1865) Prehistoric Times. Forster P. Michalodimitrakis EN. Dennebouy N.Literatur Li R. Anagnou NP. Richards MB. Barac L. Martinson JJ. Laos S. Pennarun E. Richards M. Torroni A (1999a) The emerging tree of West Eurasian mtDNAs: a synthesis of control-region sequences and RFLPs. Bandelt HJ (1997) mtDNA mutation rates--no need to panic. Reidla M. Derenko MV. Balanovsky OP. Vigne JD. Callou C. Barnes I (2005) The phylogenetic position of the 'giant deer' Megaloceros giganteus. Ursus arctos. lineages. and brown bear. Cabrera VM (2001) Major genomic mitochondrial lineages delineate early human expansions. Chaventre A. Bouvet J. I. Hickey E. Pollak S (1998) Location and frequency of polymorphic positions in the mtDNA control region of individuals from Germany. Pericic M. Watson E. Ursus spelaeus. Hardy C. Gusar V. Tambets K. Am J Hum Genet 63:613-624 Lüning J (2000) Steinzeitliche Bauern in Deutschland . Moisan JP. Roostalu U. Sykes B. Metspalu E. El-Mallakh RS (1997) Triplet repeat gene sequences in neuropsychiatric diseases. Am J Phys Anthropol 105:109-119 Lum JK. Flores C. Balanovska EV. Taberlet P. Stanley HF (1998) Ancient and Modern DNA in a Study of Horse Domestication. Rudan P. Stepanov V. Bendall KE. Sykes B. Usanga E. Mikerezi I. Am J Hum Genet 64:232-249 Macaulay V. van P. Parik J. Harv Rev Psychiatry 5:66-74 Lindahl T (1993) Instability and decay of the primary structure of DNA. Malyarchuk BA. Proc R Soc Lond B Biol Sci 266:2037-2039 216 . Tolk HV. Ancient Biomolecules 2:267-280 Lister AM. Kivisild T. as illustrated by Ancient Remains. Thomas MG. Lunkina A.die Landwirtschaft im Neolithikum. Bonn Lutz S. Gielly L. Treinen-Claustre F. Taberlet P (2001) Multiple maternal origins and weak phylogeographic structure in domestic goats. Sykes B (1999b) Mitochondrial DNA recombination-no need to panic. Vega E. Weisser HJ. Kaagan LM. Heizmann J. Golubenko M. Richards M. Nature 362:709-715 Lister AM. Claustres M. Excoffier L. Pappa KI. Cruciani F. Jorde LB (1998) Mitochondrial and nuclear genetic relationships among Pacific Island and Asian populations. Bradley DG. Guida V. Hanni C (2001) Ancient DNA analysis reveals divergence of the cave bear. Nature 438:850-853 Loogvali EL. Larruga JM. Puzyrev V. BMC Genetics 2: Macaulay VA. Golge M. Villems R (2004) Disuniting uniformity: a pied cladistic canvas of mtDNA haplogroup H in Eurasia. Journal of Archaeological Science 24:33-37 Loreille O. Grechanina E. Patou-Mathis M.

Hum Hered 52:160-170 Melton T. Derenko MV. Auswertung und Gedanken zur Deutung im Kontext der Linienbandkeramik. Ann Hum Genet 68:324-339 Mamonov AE (1995) The Yelkshankskaya complex of stand Chekalin IV. Oppenheimer S. Metspalu E. Torroni A. Genetics 152:1103-1110 Millard AR (2001) Deterioration of bone. eingereicht. Kaldma K. BMC Genet 5:26 Meyer C (2004) Vergleichend osteometrische Studie zur Frage der Kontinuität früh. Ismail P. Wiley. Meyer S. Science 308:1034-1036 Makkay J (1989) Archaeological sites of Hungary. Jahresschrift für mitteldeutsche Vorgeschichte 88:31-66 Meyer C. Ldkr. Skorecki K. Deka R (eds) Genome Diversity: Applications in human population genetics. Pallotti F. Science 210:786-792 Metspalu. Hudjashov G. Schon EA (1997) The fate of human spermderived mtDNA in somatic cells. Torroni A. Papadopoulou LC. Kürbis O. Am J Hum Genet 63:1807-1823 Menozzi P. Semino O. In: Papiha SS. Reidla M. Kluwer Academic/Plenum Publishers. Kivisild T. Zainuddin Z. Rogozin IB (2004) Mutagenesis by transient misalignment in the human mitochondrial DNA control region. Raja JM. Pollard M (eds) Handbook of Archaeological Sciences. Villems R (2004) Most of the extant mtDNA boundaries in south and southwest Asia were likely shaped during the initial settlement of Eurasia by anatomically modern humans. Ancient cultures of foreststeppe Volga Region Samara Manfredi G. Scozzari R. Clifford S. von HA (1999) Pattern of nucleotide substitution and rate heterogeneity in the hypervariable regions I and II of human mtDNA. Serk P. Cruciani F. Bandelt HJ. Kaldma K. Ann Hum Genet 66:261-283 Malyarchuk BA. pp 121-134 Metspalu M. Hill C. Mansfelder Land. Grzybowski T. Behar DM. Rengo C. Clarke D. Gilbert MT. In: Brothwell D. Tambets K. Parik J. New York. Majamaa K (2001) Evidence for mtDNA admixture between the Finns and the Saami. Wozniak M. Czarny J. Kivisild T. Meehan W. Thyagarajan D. Finnila S. Alt KW (2005) Kultur.und Bevölkerungswandel am Oberrhein? Ein osteometrischer Vergleich früh. Johannes Gutenberg Universität Mainz Meyer C. Bulbeck D. Karmin M. Shaari NK. Alt KW (2004) Das Massengrab von Wiederstedt. Taha A. Papiha SS. Goodwin W. Stoneking M (1998) Genetic evidence for the protoAustronesian homeland in Asia: mtDNA and nuclear DNA variation in Taiwanese aboriginal tribes.und mittelneolithischer Populationen. Magisterarbeit.Literatur Macaulay V. Martinson J.und mittelneolithischer Populationen. Blackburn J. Piazza A. In: Makkay J (ed) Archaeological sites of Hungary Budapest Malyarchuk BA. Miscicka-Sliwka D (2002) Mitochondrial DNA variability in Poles and Russians. Richards M (2005) Single. Batzer M. pp 633-643 217 . rapid coastal settlement of Asia revealed by analysis of complete mitochondrial genomes. Villems R (1999) The Trans-Caucasus and the expansion of the Caucasoid-specific human mtDNA lineages. Weiss G. Am J Hum Genet 61:953-960 Meinila M. Mastana S. Endicott P. Cavalli-Sforza LL (1978) Synthetic maps of human gene frequencies in Europeans. Achilli A. Parik J.

Das Altertum 30:213-218 Pääbo S (1985) Molecular cloning of Ancient Egyptian mummy DNA. Journal of Archaeological Science 27:1139-1150 Nielsen-Marsch CM (2000b) Patterns of Diagenesis in Bone II: Effects of Acetic Acid Treatment and the Removal of Diagenetic CO2. Kharitonov VM. Cavalli-Sforza LL (1995) Demographic history of India and mtDNA-sequence diversity. Brown MD. Bocherens H. Gotherstrom A. Dubrovo IA. Dupuy BM. Chen E. Brandon M. Goodwin W (2000) Molecular analysis of Neanderthal DNA from the northern Caucasus. Rognum TO. Egeland T (1998) Increased number of substitutions in the D-loop of mitochondrial DNA in the sudden infant death syndrome. Takahashi A. Archeologické Rozhledy 34:278-293 Nielsen-Marsch CM (2000a) Patterns of Diagenesis in Bone I: The Effects of Site Environments. Argant A. Hansen A (2005) Damage and repair of ancient DNA. Otte M. Jahresschrift für mitteldeutsche Vorgeschichte 85: Mullis KB. Am J Hum Genet 63:1237-1240 Noro M. Mol Biol Evol 19:19201933 Ovchinnikov IV. Macaulay V. based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes. Vege A. Hosseini S. in the major noncoding region of mitochondrial DNA by intraspecific nucleotide conservation. J Mol Evol 46:314-326 Ohno K. Hebert JM.Literatur Miller CR. Willerslev E. Liden K. Acta Paediatr 87:1039-1044 Orlando L. Meerenstieg II. Blackwell. Bhattacharyya S. Waits LP (2003) The history of effective population size and genetic diversity in the Yellowstone grizzly (Ursus arctos): implications for conservation. Kato M (1998) Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius. Suzuki H. Thenot A. Am J Hum Genet 56:979-992 Mourant AE (1954) The Distribution of the Human Blood Groups. Clark AG. Kumar S. Ruiz-Pesini E. Goldberg YP. Ldkr. Gadgil M. Proc Natl Acad Sci U S A 100:171-176 Mitchell D. Sukernik RI. Nature 314:644-645 218 . Ikebe S. Easley K. Ottolenghi C. Nature 404:490-493 Pääbo S (1984) Über den Nachweis von DNA in altägyptischen Mumien. Hanni C (2002) Ancient DNA and the population genetics of cave bears (Ursus spelaeus) through space and time. Mutat Res 571:265-276 Mountain JL. Yoshida MC. Bonjean D. Methods Enzymol 155:335-350 Nasir J. Oxford Müller U (2002) Vorläufige Ergebnisse der Untersuchungen in Derenburg. Tanaka M. Ohbayashi T. Golik P. Mt5. Journal of Archaeological Science 27:1151-1159 Nieszery N (1995) Linienbandkeramische Gräberfelder in Bayern. Hum Mol Genet 5 Spec No:1431-1435 Neustupny E (1982) Prehistoric migration by infiltration. Wernigerode. Wallace DC (2003) Natural selection shaped regional mtDNA variation in humans. Nordborg M (1998) On the probability of Neanderthal ancestry. Olckers A. Proc Natl Acad Sci U S A 100:43344339 Mishmar D. Hayden MR (1996) Huntington disease: new insights into the relationship between CAG expansion and disease. Romanova GP. Biochem Int 24:263-272 Opdal SH. Stave AK. Ozawa T (1991) Identification of a possible control element. Verlag Marie Leidorf. Underhill PA. Espelkamp. Faloona FA (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Masuda R.3. Ino H.

molecular cloning. Proc Natl Acad Sci U S A 86:1939-1943 Pääbo S. Hatina J. Fleischer RC (2002b) mtDNA from fossils reveals a radiation of Hawaiian geese recently derived from the Canada goose (Brantacanadensis). Bradley DG. Am J Phys Anthropol 120:211-224 Palanichamy MG. Ann Hum Genet 64:491-506 Pereira L. Leonard JA. Chaudhuri TK. AlGazali L. Brinkmann B (2001) The results of an mtDNA study of 1. Steighner R. Serre D. 2. Int J Legal Med 112:291-298 Pfeiffer H. Golge M. Hofreiter M (2004) Genetic analyses from ancient DNA. Stuttgart Passarino G. Zhang YP (2004) Phylogeny of mitochondrial DNA macrohaplogroup N in India. Wang CY. Muniec DS. Forster P. Krause J. James HF. Sorenson MD. Georg Thieme Verlag. Rolf B. Fleischer RC (2002a) Prehistoric decline of genetic diversity in the nene. Khan F. Holland MM. Forster P (1999) Expanding the forensic German mitochondrial DNA control region database: genetic diversity as a function of sample size and microgeography. Poinar H. Stoneking M (2003) Mitochondrial DNA evidence for admixed origins of central Siberian populations. Kuch M. Behar DM. Berry DL. Bandelt HJ. Proc Natl Acad Sci U S A 99:1399-1404 Pereira L. Garcia O. Eyre-Walker A (2004) A reanalysis of the indirect evidence for recombination in human mitochondrial DNA. Olson SL. Holland MM (1997) A high observed substitution rate in the human mitochondrial DNA control region. Underhill PA (2002) Different genetic components in the Norwegian population revealed by the analysis of mtDNA and Y chromosome polymorphisms. liston-Greiner R. Annu Rev Genet 38:645-679 Pakendorf B. Agrawal S. Jackson J. Saunders SR (eds) Biological Anthropology of the Human Skeleton New York Pfeiffer H. Ortmann C. Woodyatt N. Amorim A (2000) Diversity of mtDNA lineages in Portugal: not a genetic edge of European variation. Amorim A (2005) High-resolution mtDNA evidence for the lateglacial resettlement of Europe from an Iberian refugium. Palla V.Auflage. Holland KA. Ballou JD. Weedn VW. Macaulay V. Hebler J. Albarran C. Wiebe V. Gill P. Rodewald A. Tarskaia LA. Wilson AC (1991) Miocene DNA sequences .Literatur Pääbo S (1989) Ancient DNA: extraction. Brinkmann B. Vigilant L. James HF. Richards M. Cavalli-Sforza LL. Heredity 92:282-288 219 .200 inhabitants of a German village in comparison to other Caucasian databases and its relevance for forensic casework. Eur J Hum Genet 10:521-529 Pavúk J (1994) Zur relativen Chronologie der älteren Linearkeramik. Morris AA. Wilson MR. Huhne J. based on complete sequencing: implications for the peopling of South Asia. Lin AA. Rohland N. characterization. Nat Genet 15:363-368 Passarge E (2004) Taschenatlas der Genetik. In: Katzenberg MA. Alonso A. Genome Res 15:19-24 Petrusewsky M (2000) Metric analysis of skeletal remains: methods and applications. Kong QP. and enzymatic amplification. Goios A. Olson SL. Prata MJ. Int J Legal Med 114:169-172 Piganeau G. Sullivan K. Jaenicke-Despres V. Spitsyn VA. Cavalleri GL. Science 296:1827 Paxinos EE. Sun C. Jósa András Múzeum Evkönyi 36:135-149 Paxinos EE. Am J Hum Genet 75:966-978 Parsons TJ. Soodyall H. Borresen-Dale AL.a dream come true? Curr Biol 1:45-46 Pääbo S.

Hofreiter M. Gronenborn D. pp 14-24 220 . Chaix R. Cano RJ. Spaulding WG. Semino O. McElreavey K. Martin PS. Sobolik KD. Bachmann L (2004) Spiking of contemporary human template DNA with ancient DNA extracts induces mutations under PCR and generates nonauthentic mitochondrial sequences. Behar DM. Edinburgh Pinhasi R. In: Renfrew C. Al-Zahery N. Varez-Iglesias V. Qasim MS. Paabo S (1996) Amino acid racemization and the preservation of ancient DNA. Proc Natl Acad Sci U S A 98:4317-4322 Price TD (2000) Europe´s First Farmers. Poinar GO. Bryant VM. Campridge University Press. Nature 363:677 Poinar HN. Am J Hum Genet 74:827-845 Quintans B. Mohyuddin A. Phillips C. Tyler-Smith C. Lüning J. Evershed RP. Science 281:402-406 Poinar HN. Science 272:864-866 Poinar HN. Antiquity 75:593-603 Prien R (2005) Archäologie und Migration. Krause D. Semino O. Jr. Carracedo A (2004) Typing of mitochondrial DNA coding region SNPs of forensic and anthropological interest using SNaPshot minisequencing. Boyle K (eds) Archaeogenetics: DNA and the population history of Europe. Cambridge. Stankiewicz AB. Rudolph Habelt GmbH. Bland H. Geburtstag dargebracht. McDonald Institute for Archaeological Research. Kuch M. Foley RA. Nat Genet 23:437-441 Quintana-Murci L. Cambridge Price TD. Coppa A. Scozzari R. Torroni A. University Press. Wittig H. Ayub Q. Vergleichende Studien zur archäologischen Nachweisbarkeit von Wanderungsbewegungen. Lahr MM (2000) Spatial and Temproal Patterns in the Mesolithic-Neolithic Archaeological Record of Europe. Bonn Pusch CM. Deutsche Akademie der Wissenschaften zu Berlin. Spaulding WG. Bentley RA. Possnert G. Stankiewicz BA. Pluciennik M (2005) A Regional Biological Approach to the Spread of Farming in Europe. Barnes I. McElreavey K (2004) Where west meets east: the complex mtDNA landscape of the southwest and Central Asian corridor. In: Grimm P (ed) Varia Archaeologica. Hoss M. Bandelt HJ. Wells RS.Literatur Piggott S (1965) Ancient Europe from the beginnings of agriculture to classical antiquity. Wahl J (2001) Prehistoric human migration in the Linearbandkeramik of Central Europe. Current Anthropology 45:S59-S82 Poetsch M. Paabo S (2001) A molecular analysis of dietary diversity for three archaic Native Americans. Berlin. Akademie Verlag. Mol Biol Evol 21:957-964 Quintana-Murci L. Santachiara-Benerecetti AS. Wilhelm Unverzagt zum 70. Forensic Sci Int 140:251-257 Quitta H (1960) Zur Frage der ältesten Bandkeramik in Mitteleuropa. Lareu MV. Paabo S (1998a) Molecular coproscopy: dung and diet of the extinct ground sloth Nothrotheriops shastensis [see comments]. Santachiara-Benerecetti AS (1999) Genetic evidence of an early exit of Homo sapiens sapiens from Africa through eastern Africa. Kuder T. Bada JL. Passarino G. Lignitz E (2003) Mitochondrial diversity of a northeast German population sample. Sayar H. Salas A. Universitätsforschungen zur prähistorischen Archäologie 120. (1993) DNA from an extinct plant. pp 45-56 Pinhasi R. Forensic Sci Int 137:125-132 Poinar H. Rengo C. Cooper A. Prähistorische Zeitschrift 38:1-38 Quitta H (1964) Zur Herkunft des Neolithikums in Mitteleuropa.

Keyser-Tracqui C. Fedoseeva A. Am J Hum Genet 59:185-203 Richards M. Am J Phys Anthropol 123:351-360 Ricaut FX. Bandelt HJ. Vona G. Romano V. Corte-Real H. Bradley D. Sykes B. Macaulay V. Boyle K (eds) Archaeogenetics: DNA and the population prehistory of Europe. Am J Hum Genet 68:13151320 Richards M (2003) The neolithic invasion of Europe. Bourgeois J. Macaulay VA. Cammaert L. Papiha S. Macaulay V. Rengo C. Keyser-Tracqui C. Alekseev AN. Demaine A. Ludes B (2004d) Genetic analysis of human remains found in two eighteenth century Yakut graves at At-Dabaan. Cali F. Int J Legal Med 118:24-31 Richards M. Macaulay V (2001) The mitochondrial gene tree comes of age. Ludes B (2004b) Genetic analysis of a ScythoSiberian skeleton and its implications for ancient Central Asian migrations. Macaulay V. Dimitrov D. Aboudharam G. near-eastern. Bandelt HJ. J Anthropol Res 54:417-419 Ricaut FX. Sellitto D. Taubenberger JK (1999) Origin and evolution of the 1918 "Spanish" influenza virus hemagglutinin gene. Proc Natl Acad Sci U S A 97:12800-12803 Reid AH. Larrouy G. Stefanescu G (2000) Tracing european founder lineages in the near eastern mtDNA pool. In: Renfrew C. Cruciani F. Fanning TG. Drancourt M (2000) Molecular identification by "suicide PCR" of Yersinia pestis as the agent of medieval black death. Villems R. Demaine A. London Renfrew C (1998) Comments on Cavalli-Sforza and Otte. pp 139-152 Richards M. Vega E. Ludes B (2004a) Ancient DNA analysis of human Neolithic remains found in northeastern Siberia. Gonzalez AM. Crubezy E. Bandelt HJ (1998) Mitochondrial DNA analysis of northwest African populations reveals genetic exchanges with European. Rychkov O. Forster P. Pinto F. Ann Hum Genet 62 ( Pt 3):241-260 Richards M. Sykes B (1996) Paleolithic and neolithic lineages in the European mitochondrial gene pool. Wilkinson-Herbots H. Hill E. Proc Natl Acad Sci U S A 98:390-391 Renfrew C (1987) Archaeology and language: The puzzle of Indo-European origins. Hickey E. Sykes B. Keyser-Tracqui C. Am J Phys Anthropol Ricaut FX. Thomas M. Ludes B (2004c) Genetic analysis and ethnic affinities from two Scytho-Siberian skeletons. Cambridge. Rychkov Y. Am J Hum Genet 67:1251-1276 Richards M. Crubezy E. Crubezy E. Hum Biol 76:109-125 Ricaut FX. Papiha S. Triantaphyllidis C. Annu Rev Anthropol 32:135-162 221 . Hedges R. Hultin JV. Pettitt P. Golge M. Hernandez M. Crubezy E. Ludes B. Hedges R. Ann Hum Genet 62 ( Pt 6):531-550 Raoult D. McDonald Institute of Archaeological Research. Sykes BC (1998) Phylogeography of mitochondrial DNA in western Europe. Larruga JM. and sub-Saharan populations. Keyser-Tracqui C. Cape. Kolodesnikov S.Literatur Rando JC. Am J Hum Genet 61:251-254 Richards M. Crubezy E. Bandelt H-J (1997) Reply to CavalliSforza and Minch. Am J Hum Genet 62:491-492 Richards MB. Macaulay V (2000) Genetic Data and the Colonization of Europe: Genealogies and Founders. Rychkov S. Cabrera VM. Sykes B (1998) Reply to Barbujani et al. Kivisild T. Forster P. Proc Natl Acad Sci U S A 96:1651-1656 Relethford JH (2001) Ancient DNA and the origin of modern humans. Guida V.

Lambert DM (2004) Ancient DNA enables timing of the pleistocene origin and holocene expansion of two adelie penguin lineages in antarctica. Lari M. Kalaydjieva L. Pielberg G. Brinkmann B. Alzey. Lalueza-Fox C (2005) The genetics of the pre-Roman Iberian Peninsula: a mtDNA study of ancient Iberians. Proc Natl Acad Sci U S A 74:5463-5467 Sangmeister E (1983) Die ersten Bauern. Ann Hum Genet 69:535-548 Sanger F. Forster P. Norby S (2000) mtDNA variation among Greenland Eskimos: the edge of the Beringian expansion. Gedde-Dahl T. Lao O. Adojaan M. Pandya A. Corte-Real HB. Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Krawczak M (2005) Signature of recent historical events in the European Y-chromosomal STR haplotype distribution. Zerjal T. Tranebjaerg L. Nicholson J. Comas D. Rootsi S. Kr. Lukka M. Nafa K. Golge M. Evgrafov O. Lessig R. Maniatis T (1989) Molecular cloning. Norby S. Glisic S. Decorte R. Peterlin B. Lynnerup N. Santos FR. Lahermo P. Paabo S (1995) Genes and languages in Europe: an analysis of mitochondrial lineages 30. Barbujani G. Stefanescu G. Bandelt HJ. Jobling MA (2000) Y-chromosomal diversity in Europe is clinal and influenced primarily by geography. Cold Spring Harbor. Mainzer Zeitschrift 63/64:158179 Ritchie PA. Gibb GC. In: Müller-Beck H (ed) Urgeschichte in Baden-Württemberg pp 429-479 222 . Holcomb TA (1994) Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Millar CD. Dubrova YE. Proc Natl Acad Sci U S A 91:2091-2094 Sambrook J. Brede G. Am J Hum Genet 67:718-726 Sajantila A.Literatur Richter I (1968) Die bandkeramischen Gräber von Flomborn. Previdere C. Mitchell RJ. rather than by language. Mullis KB. Anttinen T. Caramelli D. Tyler-Smith C. 2 edn. Gilissen A. Forster P (2001) An annotated mtDNA database. Jobling MA. Beckman G. Armenteros M. Mol Biotechnol 3:129-134 Saiki RK. Horn GT. Hurles ME. Agusti B. Amos W. Mikelsaar AV. Lu TT. de KP. Forster L. Aufderheide AC. New York Sampietro ML. Hum Genet 116:279-291 Röhl A. Livshits LA. Mol Biol Evol 21:240-248 Roewer L. Croucher PJ. Willuweit S. Bosch E. Amorim A. Sistonen P. Issel-Tarver L. Calafell F. Kivisild T. Saillard J. Scharf S. Science 230:1350-1354 Saillard J. Beckman L. Maria S. Krumina A. Fritsch E. Tolun A. Roewer L. DiRienzo A. Int J Legal Med 115:29-39 Rosser ZH. Patsalis PC. Genome Res 5:42-52 Salo WL. Faloona F. A laboratory manual. Rubinsztein DC. Beckman L. Hill EW. Kravchenko SA. Malaspina P. Prata MJ. Kucinskas V. Bertranpetit J. Meitinger TA. McElreavey K. Cooper G. Cold Spring Harbor University Press. Savontaus ML. Villems R. Biotechniques 18:84-90 Rychlik W (1995b) Selection of primers for polymerase chain reaction. Kayser M. Arroyo E. Tyler-Smith C. Lavinha J. Bradley DG. Arnheim N (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Baroni C. Pereira L. Sykes BC. Kayser M. Erlich HA. Bertranpetit J. de KP. Alavantic D. Aula P. Buikstra J. Nicklen S. Jeziorowska A. Am J Hum Genet 67:1526-1543 Rychlik W (1995a) Priming efficiency in PCR. Parik J.

Francalacci P. Barnes I. Ausgewählte Modelle und Hypothesen. Underhill PA (2000a) The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. suggesting they derived from four primary maternal lineages. Am J Hum Genet 59:964-968 Semino O. Serre D. Science 290:1155-1159 Semino O. Merriwether DA. Smith FH (2002) The Neandertal type site revisited: interdisciplinary investigations of skeletal remains from the Neander Valley. Possnert G. Teschler-Nicola M. Kosintsev P. Matheus PE. Langaney A. Pybus OG. Science 306:1561-1565 223 . Cooper A (2004) Rise and fall of the Beringian steppe bison. Hummel S. Paabo S (2004a) Mutations Induced by Ancient DNA Extracts? Letter. Passarino G. Petersen I (2005) Inter-laboratory validation of PCR-based detection of Mycobacterium tuberculosis in formalin-fixed. Hillgruber F. Paabo S. Wallace DC (1999) Mitochondrial DNA variation in Koryaks and Itel'men: population replacement in the Okhotsk Sea-Bering Sea region during the Neolithic. Hansen AJ. Storer J. Santachiara-Benerecetti AS (1996) A view of the neolithic demic diffusion in Europe through two Y chromosome-specific markers. Paunovic M. Proc Natl Acad Sci U S A 99:13342-13347 Schultes T. Am J Phys Anthropol 108:1-39 Semino O. Stephenson RO. Rahden/Westf. Schulz R (2004) Heißer gegessen als gekocht? Eine kritische Betrachtung paläogenetischer Forschungen zur Abstammung des Menschen. Keddie G. Hofreiter M. Germany. Kaufmann SH. Binladen J. Am J Hum Genet 46:613623 Schurr TG. PLoS Biol 2:313-317 Shadel GS. Beckman LE. Vollmer E. Sukernik RI. Kunz ML. Tedford R. Ulrichs T. Lawrence DN. Anthropol Anz 58:37-44 Schurr TG. Passarino G. Primorac D. Herrmann B (2000) Ancient DNA-typing approaches for the determination of kinship in a disturbed collective burial site. Lundeberg J. Feine S. Santachiara-Benerecetti AS (2000b) MtDNA and Y chromosome polymorphisms in Hungary: inferences from the palaeolithic. Haswell K. paraffin-embedded tissues. Dietel M. Gan YY. Kouvatsi A. Cavalli-Sforza LL. Beres J. Liu A. Paabo S (2004b) No evidence of Neandertal mtDNA contribution to early modern humans. Krainitzki H. Baryshnikov GF. Martin LD. Annu Rev Biochem 66:409-435 Shapiro B. Froese DG. Limborska S. Mennecier P. Fellous M. Quintana-Murci L. Bonani G. Santachiara-Benerecetti AS. Hodge JA. Willerslev E. Goldmann T. Hofreiter M. Mol Biol Evol Serre D. Chech M. Nerlich A. Czeizel A. Eur J Hum Genet 8:339-346 Serre D. Science 298:1610-1613 Schäfer J. Virchows Arch 447:573585 Schmitz RW. EAZ 1/2004:1-34 Scharl S (2004) Die Neolithisierung Europas. Oefner PJ. Harington CR. Mika A. Knowler WC. Driver JC. Starikovskaya YB. Brega A. Luo J. Weiss KM. Baretton GB. Wallace DC (1990) Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies. Pahl S. Lin AA. De BG. Grosser M. Arbuzova S. Passarino G. Rambaut A. Davydov S. Sher AV. Zhang YP. neolithic and Uralic influences on the modern Hungarian gene pool. Zink A. Ballinger SW. Leitner T (2002) Genetic evidence for an East Asian origin of domestic dogs. Wilson MC. Leidorf. Bauer U. Burns JA. Zimov S. Gilbert MT. Clayton DA (1997) Mitochondrial DNA maintenance in vertebrates. Schluns K. Schewe C. Marcikiae M.Literatur Savolainen P. Drummond AJ. Mika B.

Science 239:1263-1268 Sutovsky P. Riley MS. Köln. Chamberlain AT. Bertranpetit J. Jans MME. A mitochondrial DNA perspective. Bowles EJ. Collins MJ (2001) Neanderthal DNA. Am J Hum Genet 66:262-278 Simoni L. Pettener D. Reprod Biomed Online 8:24-33 224 . Ein Beitrag zur Urgeschichte des südlichen Oberrheins. pp 1-65 Sigurdardottir S. Die Anfänge des Neolithikums vom Orient bis Nordeuropa Böhlau. Gulcher JR. Pettener D. Prigodich RV. Lloyd RE. Wilson AC (1990) Geographic variation in human mitochondrial DNA from Papua New Guinea. Bhatia K. Science 300:407 Stone AC. Helgason A. Genetics 124:717-733 Stoneking M (2000) Hypervariable sites in the mtDNA control region are mutational hotspots. J Arch Sci 32:105-113 Sokal RR. Am J Hum Genet 66:1599-1609 Simoni L. Starrs JE. assisted reproductive technologies and mtDNA inheritance. Collins MJ (2003) The thermal history of human fossils and the likelihood of successful DNA amplification. Jorde LB. Vermeer C. Stefansson K. Reproduction 127:631-641 Stokstad E (2003) Paleontology. Barbujani G (2000a) mtDNA Haplogroups and Frequency Patterns in Europe. Am J Hum Genet 62:1153-1170 Stoneking M. Thomas EC. Barbujani G (2000c) Reconstruction of prehistory on the basis of genetic data. Calafell F. Collins MJ (2005) Diagenesis and survival of osteocalcin in archaeological bone. Calafell F. Andrews P (1988) Genetic and fossil evidence for the origin of modern humans. Oden NL (1989) Spatial patterns of human gene frequencies in Europe. Van LK. Barbujani G (2000b) Geographic patterns of mtDNA diversity in Europe. Day BN. Harding RM. Stringer CB. Oden NL.Literatur Sielmann B (1972) Die frühneolithische Besiedlung Mitteleuropas. Stoneking M (1998) mtDNA analysis of a prehistoric Oneota population: implications for the peopling of the New World 20. Am J Hum Genet 67:1029-1032 Storch HP (1984) Frühneolithische Bestatttungssitten. Nielsen-Narsh CM. Cooper A. Am J Hum Genet 66:1177-1179 Smith CI. Calafell F. Bertranpetit J. Stringer C. Stoneking M (2001) Mitochondrial DNA analysis of the presumptive remains of Jesse James. Pettener D. Bertranpetit J. Nature 351:143-145 St John JC. Am J Phys Anthropol 80:267-294 Sokal RR. Donnelly P (2000) The mutation rate in the human mtDNA control region. Not just old but old and cold? Nature 410:771-772 Smith CI. Acta praehistorica et archaeologica 16/17:23-54 Stringer CB. Ancient DNA pulled from soil. El SS (2004) The consequences of nuclear transfer for mammalian foetal development and offspring survival. Riley MS. J Forensic Sci 46:173-176 Stone AC. Chamberlain AT. Craig OE. Wilson C (1991) Genetic evidence for the spread of agriculture in Europe by demic diffusion. Sutovsky M (2004) Degradation of paternal mitochondria after fertilization: implications for heteroplasmy. Am J Hum Genet 66:1173-1177 Simoni L. McCauley T. J Hum Evol 45:203-217 Smith CI.

Kivisild T. Geberhiwot T. Coll Antropol 23:437-450 225 . Pennarun E. Kawamori R. Sato Y. Gusar V. Hattori N. McDonald Institute for Archaeological Research. Osipova L. Young D. Hirose N. Damba L. Moisan JP. Parik J. Khusnutdinova E. Parik J. Magisterarbeit. Zhadanov S. Bruchenbrücken. Damba L. Hirose R. Voevoda M. Metspalu E. Flomborn. Umetsu K. Brown IN. Golubenko M. Guo LJ. Furedi S. Boyle K (eds) Archeogenetics: DNA and the population prehistory of Europe. Loogvali EL. Kivisild T. Golge M. Erbenheim. In: Renfrew C. Stepanov V. Molleson T (2000) A Medieval Case of Lepromatous Leprosy from 13-14th Century Orkney. Tolk HV. Boyle K (eds) Archaeogenetics: DNA and the population prehistory of Europe. Rudan P. Mikerezi I. Am J Hum Genet 57:1463-1475 Sykes B (1997) Really ancient DNA. Gerold F. McDonald Institute for Archaeological Research. pp 23-30 Sykes B (2003) Die sieben Töchter Evas. Basel Taylor GM. Help H. Chaventre A. Beckman L. Gubina M. Tolk HV. Koziel S. Larruga JM. Pshenichnov A. Stingeder G. McDonald Institute for Archaeological Research. Maruyama W.Unterwiederstedt. Pliss L. Metspalu E. Parik J. Lights turning red on amber. Tautz D (1993) DNA Fingerprinting: State of Science. Richards M (1995) The origins of the Polynesians: an interpretation from mitochondrial lineage analysis. DeStefano GF. Mizuno Y. Philos Trans R Soc Lond B Biol Sci 354:131-138 Sykes B (2000) Human Diversity in Europe and Beyond: From Blood Groups to Genes. De Stefano GF. Renfrew C (eds) Examining the farming/language dispersal hypothesis. Oshida Y. Cabrera VM. Suzuki R. Leiboff A. pp 219-236 Tambets K. Bujatti-Narbeshuber M. Villems R (2004) The western and eastern roots of the Saami--the story of genetic "outliers" told by mitochondrial DNA and Y chromosomes. Fuku N. Cambridge. Shimokata H. Richard C. Barac L. In: Renfrew C. Grechanina E. Johannes Gutenberg Universität Mainz. Bastei Lübbe. Low-Beer J. Prohaska T. Bermisheva M. Reidla M. Reidla M. Michalodimitrakis E. Beckman L. Shinoda K. Rudan I. Anagnou N.Literatur Sykes B. Dissertationes biologicae Universitatis Tartuensis Tanaka M. Balanovsky O. Latkoczy C. Tetzner S. Eilsleben. pp 449-457 Tambets K. Villems R (2000) The Topology of the Maternal Lineages of the Anatolian and Trans-Caucasus Populations and the Peopling of Europe: Some Preliminary Considerations. In: Bellwood P. Bergisch Gladbach Tambets K. Fujita Y. Khusnutdinova E. Pappa KI. Balanovska E. Papiha S. Ferak V. Krumina A. Ogawa O. Kivisild T. Kaldma K. Watkins M (1999) Evidence of Genocide 7000 BP. Shimodaira H (2004) Mitochondrial genome variation in eastern Asia and the peopling of Japan. Cambridge. Ohta S. Cambridge. Tolk HV. Usanga E. Pericic M. Scotland. Serk P. Villems R (2002) Complex signals for Population Expansions in Europe and Beyond. Takeyasu T. Shamoto-Nagai M. Laos S. Komel R. Widdison S. Gonzalez AM. Baumanis V. Puzyrev V. Metspalu E. Rootsi S. Yamada Y. Voevoda M. Birkenhäuser. Neolithic Paradigm and Geo-climatic Realitiy. Demirtas H. Kurata M. Tanaka Y. J Arch Sci 27:1133-1138 Teschler-Nicola M. Kutuev I. Terzic R. Nature 386:764-765 Sykes B (1999) The molecular genetics of European ancestry. Arai Y. Rickards O. Genome Res 14:1832-1850 Tänzer M (2005) Populationsgenetische Analysen alter DNA humaner Individuen von fünf neolithischen Fundplätzen . Bermisheva M. Am J Hum Genet 74:661-682 Tambets K (2004) Towards the understanding of post-glacial spread of human mitochondrial DNA haplogroups in Europe and beyond: a phylogeographic approach.

Wilson AC (1990) Spatial and temporal continuity of kangaroo rat populations shown by sequencing mitochondrial DNA from museum specimens 81. Rasalkar AA. Lahermo P. Karger B. Krings M (1996) Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. In: Harris DR (ed) The Origins and Spread of Agriculture and Pastoralism in Eurasia. Janicijevic B. Chaubey G. Neel JV. Laitinen V. London Tishkoff SA. Kidd JR. Sellitto D. Dahl HH (2001) Mitochondrial disorders: genetics. Rickards O. from human mtDNA. Klaric IM. Sutovsky P (2003) Ubiquitination of prohibitin in mammalian sperm mitochondria: possible roles in the regulation of mitochondrial inheritance and sperm quality control. Bonne-Tamir B. Schaffner W. J Mol Evol 31:101-112 Thompson WE. Savontaus ML. Wilson AC. Pakstis AJ. Villems R. Forster P. Villems R. Eur J Hum Genet 9:717-723 Torroni A. Santachiara-Beneceretti AS. prenatal diagnosis and reproductive options. D'Urbano L. Huoponen K. Novelletto A. Cruciani F. Wallace DC (1994b) Mitochondrial DNA "clock" for the Amerinds and its implications for timing their entry into North America. Barac L. Janicijevic B. Sellitto D. Obinu D. Martinez-Cabrera V. Kivisild T. Am J Hum Genet 62:1137-1152 Torroni A. Wallace DC (1994a) mtDNA and Y-chromosome polymorphisms in four Native American populations from southern Mexico. Coppa A. Francalacci P. Moral P. Chen YS. Semino O. Bandelt HJ. Richards M. Hickey E. Campbell H. Proc Natl Acad Sci U S A 91:1158-1162 Torroni A. SantachiaraBenerecetti AS. Semino O. Paabo S. Rengo C. Scozzari R. Science 308:996 Thomas J (1996) The cultural context of the first use of domesticates in continental Central and Northwest Europe. Genetics 144:1835-1850 Torroni A. Morelli L. Lindenbauer K. Archäologie Österreichs 7:4-12 Thangaraj K. Singh L (2005) Reconstructing the origin of Andaman Islanders. Lott MT. Pericic M. Spannagl M (1996) Anthropologische Spurensicherung. Routledge. UCL Press. Biol Reprod 69:254-260 Thorburn DR. Wallace DC (1996) Classification of European mtDNAs from an analysis of three European populations. Parik J. Forster P. Science 271:1380-1387 Tolk HV. Barrantes R. Scozzari R (1998) mtDNA analysis reveals a major late Paleolithic population expansion from southwestern to northeastern Europe. Kanz F. Rudan P. Huoponen K. Savontaus ML. Singh VK. Am J Med Genet 106:102-114 Thorpe I (1996) The Origins of Agriculture in Europe. pp 310-322 Thomas RH. Speed W. Koivumaki S. Tambets K. Kivisild T. Am J Hum Genet 54:303-318 Torroni A. counseling. Tolk HV. Bonne-Tamir B. Reddy AG. Santachiara-Benerecetti AS. Cheung K. Scozzari R (2001) A signal. Francalacci P. Scott CR. Rudan P (2001) The evidence of mtDNA haplogroup F in a European population and its ethnohistoric implications. Rengo C. Metspalu E. Moral P. Moral P. London. Am J Hum Genet 69:844-852 226 . of postglacial recolonization in Europe. Die traumatischen und postmortalen Veränderungen an den linienbandkeramischen Skelettresten von Asparn/Schletz. Rudan I. Schurr TG. Nature 340:465-467 Thomas WK. Gerold F. Dietzsch E. Ramalho-Santos J. Kivisild T. Al-Zaheri N. Macaulay V. Sykes B. Bandelt HJ. Petrozzi M. Savontaus ML.Literatur Teschler-Nicola M. Villablanca FX. Paabo S (1989) DNA phylogeny of the extinct marsupial wolf 83. Winter M.

evolution. Nature 382:275-278 Vernesi C. Science 291:474-477 Wahl J (1989) Zum Stand der Neolithikum-Forschung in Südwestdeutschland. Boric D. Christensen B. Cambridge Whittle A. Secchieri E. Gene 238:211-230 Ward R. Forster P. Lu D. Volker M. Bucala R. He Y. Barbujani G (2001) Genetic characterization of the body attributed to the evangelist Luke. Su B. Anteus 25:63-117 Willerslev E. Wilson AC (1991) African populations and the evolution of human mitochondrial DNA. Maldonado JE. Mol Biol Evol 22:725-734 Werle E. Wayne RK (1999) Phylogenetic relationships. Arctander P (1999) Diversity of Holocene life forms in fossil glacier ice 11. Li F. Cerami A. Gao S. Marino MA. Cambridge University Press. Huang W. Zhang Y. J Mol Evol 37:613-623 Walden KK. Pettitt P. Fiehn W (1994) Convenient single-step. J Hered 90:71-77 Vila C. Chamberlain AT. Leonard JA. Hawkes K. Deka R. Bandelt HJ (1997) Mitochondrial footprints of human expansions in Africa. Marklund S. Nature 388:225-226 Watson E. Harpending H. Homo 40:99-105 Wakeley J (1993) Substitution rate variation among sites in hypervariable region 1 of human mitochondrial DNA. Magee DA.Literatur Troy CS. MacHugh DE. Runnels CN (1995) The earliest farmers in Europe. Wayne RK. Gao Y. Katti E. Renner M. Nucleic Acids Res 22:4354-4355 Whittle A (1996) Europe in the Neolithic. Malaspina P. Richards M (2002) In the beginning: New Radiocarbon Dates for the Early Neolithic in Northern Serbia and South-East Hungary. Sykes BC. Jin L (2005) Genetic Structure of Hmong-Mien Speaking Populations in East Asia as Revealed by mtDNA Lineages. Zhang F. Hansen AJ. Novelletto A. Li H. Terlecky I. Basgen J. Bartosiewicz L. Ulrich P (1996) An agent cleaving glucose-derived protein crosslinks in vitro and in vivo. Gotherstrom A. Marin VT. Zhang X. one tube purification of PCR products for direct sequencing. Kapurniotu A. Am J Hum Genet 67:432-443 van Andel TH. Mao X. Wagle D. Dong Y. Brown MD. Bernhagen J. Proc Natl Acad Sci U S A 98:13460-13463 Vigilant L. Stringer C (1997) A molecular handle on the Neanderthals. Stoneking M. Antiquity 69:481-500 Vasan S. Liden K. Parsons TJ. Steighner RJ. The Creation of New Worlds. Jin J. Robertson HM (1997) Ancient DNA from amber fossil bees? Mol Biol Evol 14:1075-1077 Wallace DC. Cunningham P. Zhang X. Bradley DG (2001) Genetic evidence for Near-Eastern origins of European cattle. Am J Hum Genet 61:691-704 Wen B. and genetic diversity of the domestic dog. Ellegren H (2001) Widespread Origins of Domestic Horse Lineages. Caramelli D. Nature 410:1088-1091 Tully LA. Sandberg K. Proc Natl Acad Sci U S A 96:8017-8021 227 . Holland MM. Di BG. Teichberg S. Shih D. Schneider C. Xiao C. Prenger VL (2000) A sensitive denaturing gradient-Gel electrophoresis assay reveals a high frequency of heteroplasmy in hypervariable region 1 of the human mtDNA control region. Richards M. Egan J. Science 253:1503-1507 Vila C. Lott MT (1999) Mitochondrial DNA variation in human evolution and disease. Loftus RT. Steffensen JP. Bailey JF. Chakraborty R. Simoni L.

eine Spurensicherung. Wolf H. Nerlich AG (2001) Molecular analysis of skeletal tuberculosis in an ancient Egyptian population. Haas CJ. Bandelt HJ. Fu YX. Rastogi N. Reischl U. Planck D (eds) Menschen. Zeiten. Räume . Kong QP. Reischl U. Gilichinsky DA. Zhang YP (2004) Different matrilineal contributions to genetic structure of ethnic groups in the silk road region in china. Evolution oder Revolution? In: Menghin W. Wiuf C. N. Ronn R. Zhang YP (2002a) Phylogeographic differentiation of mitochondrial DNA in Han Chinese.Archäologie in Deutschland. Zhang YP (2000) Evolutionary history of the mtDNA 9-bp deletion in Chinese populations and its relevance to the peopling of East and Southeast Asia. Epidemiol Infect 130:239-249 Zink AR. In: Menghin W. Sola C. Brand TB. Kong QP. Bunce M. Cambridge. Wolf H. Am J Phys Anthropol 118:63-76 Yao YG. pp 135-138 Zink A. Proc Biol Sci 272:3-16 Willms C (1985) Neolithischer Spondylusschmuck. Shapiro B. Höss M. Mitchell D. Gilbert MT. Hansen AJ. Barnes I. Cooper A (2005) Ancient DNA. Binladen J. Stuttgart. pp 144-182 Zilhao J (2001) Radiocarbon evidence for maritime pioneer colonization at the origins of farming in west Mediterranean Europe. J Hum Genet 47:311-318 Yao YG.Hundert Jahre Forschung. J Med Microbiol 50:355-366 Zink AR. pp 133-134 Zimmermann A (2002b) Die ersten Bauern. Katalog des NÖ Landesmuseums. Wiuf C. Nie L. Brand TB. Mol Biol Evol 21:2265-2280 Zilhao J (1997) Maritime pioneer colonization in the Early Neolithic of the west Mediterranean. Hum Genet 107:504-512 Yao YG. Bandkeramik. Hansen AJ. Zeiten. J Clin Microbiol 41:5350-5351 Zischler H. Zhang YP (2002) Phylogeographic analysis of mtDNA variation in four ethnic populations from Yunnan Province: new data and a reappraisal. Cooper A (2004) Long-term persistence of bacterial DNA. Theiss. Science 300:791-795 Willerslev E. Szeimies U. Harpending H. Zhang YP (2002b) Genetic relationship of Chinese ethnic populations revealed by mtDNA sequence diversity. Proc Natl Acad Sci U S A 98:14180-14185 Zimmermann A (2002a) Der Beginn der Landwirtschaft in Mitteleuropa.Archäologie in Deutschland. Grabner W. Nerlich AG (2003a) Molecular study on human tuberculosis in three geographically distinct and time delineated populations from ancient Egypt. 393 Asparn a. Räume .d. In: Price TD (ed) Europe's First Farmers. Kivisild T. Handt O. Planck D (eds) Menschen.F. Wang CY. Yuan ZG. Gilichinsky D. Reischl U. Stuttgart. Porocilo 24:19-42 Zilhao J (2000) From the Meoslithic to the Neolithic in the Iberian Peninsula. Cambridge University Press. Curr Biol 14:R9-10 Willerslev E.Literatur Willerslev E. Theiss. Germania 63:331-343 Windl H (1996) Rätsel um Gewalt und Tod vor 7000 Jahren. Science 268:1192-1193 228 . Testing the model against the evidence. Grabner W. Watkins WS. von Haeseler A (1995) Detecting Dinosaur DNA. Am J Hum Genet 70:635-651 Yao YG. Cooper A (2003) Diverse plant and animal genetic records from Holocene and Pleistocene sediments. Zhu CL. Zaya Yao YG. Nerlich AG (2003b) Characterization of Mycobacterium Tuberculosis Complex DNAs from Egyptian Mummies by Spoligotyping.

evolution. Cambridge University Press.Literatur Zuckerkandl E. and genetic heterogeneity. pp 379-394 229 . Academic Press. Porocilo 22:107-150 Zvelebil M (1996) The agricultural frontier and the transition to agriculture in the circum-Baltic region. In: Renfrew C. Mesolithic Societies of Temperate Eurasia and their Transition to Farming. Bullman B (eds) Horizons in biochemistry. London. Routledge. Cambridge. Richards C (eds) Understanding the Neolithic of North Western Europe. the Neolithic and social change at the MesolithicNeolithic Societies of Temperate Eurasia and their Transition to Farming. Renfrew C (eds) Examining the farming/language dispersal hypothesis. pp 1-36 Zvelebil M (2000) The social context of the agricultural transition in Europe. Cambridge. In: Zvelebil M (ed) Hunters in transition. Pauling L (1962) Molecular disease. or what was spreading with the Neolithic: a reply to Ammerman. Cambridge. Boyle K (eds) Archaeogenetics: DNA and the Population Prehistory of Europe. University of London Press. In: Kasha M. McDonald Institute for Archaeological Research. In: Harris D (ed) The origin and spread of Agriculture and Pastoralism in Eurasia. pp 189-225 Zvelebil (1986) Mesolithic Prelude and Neolithic revolution. pp 5-15 Zvelebil M (1989) On the transition to farming in Europe. pp 57-92 Zvelebil M (2002) Demography and Dispersal of Early Farming Populations at the MesolithicNeolithic Transition: Linguistic and Genetic Implications. pp 57-79 Zvelebil M. New York. Lillie M (2000) Transition to agriculture in Eastern Europe. Antiquity 63:379-383 Zvelebil M (1995) Neolithisation in eastern Europe: a review from the frontier. In: Price TD (ed) Europe´s First Farmers. In: Bellwood P. Cambridge. pp 323-335 Zvelebil M (1998) What´s in a name: The Mesolithic. London. McDonald Institute for Archaeological Research. Cambridge University Press. In: Edmonds M.

1. Anhang 10. Magistranden und Praktikanten.1 Zusätzliche Tabellen Tabelle 10. Diplomanden.Anhang 10. HVR I Sequenz und Haplogruppenbestimmung Labormitarbeiter. Individuum # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 HVR I Sequenz 16189C 16217C CRS 16051G 16162G 16259T 16189C 16189C 16263C 16189C 16311C 16263C 16304C 16304C 16304C 16311C 16354T 16069T 16126C 16069T 16126C 16069T 16126C 16222T 16069C 16092C 16126C 16261T 16284G 16290T 16093C 16224C 16311C 16224C 16311C 16224C 16245T 16311C 16126C 16294T 16304C 16136C 16356C 16223T 16356C 16223T 16356C 16192T 16270T 16189C 16192T 16270T 16298C 16216G 16261T 16298C aller anonymisierter Haplogruppe B H* H* H*/U* H* H* H* H* H* H* H* J* J* J* J* K K K T U4 U4 U4 U5 U5 V V 230 .

Anhang Tabelle 10. Individuum # 1 2 3 4 5 6 7 8 9 10 11 12 HVR I Sequenz CRS 16257T 16304C 16291T 16390A 16235G 16261T 16166G 16311C 16129A 16172C 16069T 16126C 16069T 16126C 16224C 16311C 16224C 16258G 16078G 16126C Haplogruppe H* H* H* H* 16291T 16293G H/J1 ? H? 16223T 16311C 16391A I 16265G 16291T 16319A J* 16145A 16172C 16261T J1 K 16311C K 16294T 16296T T* 231 . HVR I Sequenzen und Haplogruppenbestimmung der Probengeber.2.

8 X 15 (10)/(13)/14 BRU5 NF N12.3 X DEB2b NK3 N46.13 15/15 ASP2 NK12 N47.3 X 15/17 12/14 11 19 29.18 DKF1a NN14 N218.11 DBK1b NO13 N204.2) 11/12 AJD15 NC9 N26.3 XY 18/19 13/14 13 16/17 (30) 9 (23) (10) NF3 N26.3 DEB4a NF DEB4a 23 13 11 16/17 13 artefakte 13/14 14 X 13 14 13 11/13 (11)/12 (14)/(17)/18 9 (17)/18 11/13 12 11 12 12 14 31.10 X 15/(17) 12/14 11 (18)/19 29/(31.2/32 ASP2 NH N16.2 X 15/17 12/14 11 19 29.10 XY 18/19 13/14 11/13 16/17 DEB4b NK5 N47.12 DKF1b NO14 N204.12 DEB1 NG8 N16.12 17 9/15 ASP2 NK12 N46.4 X DEB4a NC N11.13 XY DEB4a NC N13.1 X (14)/15/(17)/18 DEB1 NG8 N20.1 DON2b NK9 N47.2/32 AJD15 NF10 N12.10 X DEB5a NI N18.2/32.14 DON1a NK10 N47. Probe Extrakt PCR Amel D3S1358 D8S1179 D5S818 vWA D21S11 D13S317 AJD15 NC9 N13.12 XY 16 13 BRU3 NJ4 N19.Anhang Tabelle 10.1 DON2a NM4 N80.5 XY 18/19 13 16/17 DEB4b NK5 N46.11 X 16 DON1b NJ11 N20.1 DEB1 NM5 N79.10 X 11 DON1b NJ11 N19.2 X DEB2b NK3 N47.5 XY 18/19 DEB5a NI N18.10 X 15 12/14 11 (18)/19 (29) AJD15 NF10 N26.3 X DEB3a NH3 N26.3 (X) DEB3a NG10 N17.2 X 16/17 DEB1 NM5 N80.17 DEB3a NG10 N26.2 X DON2a NJ12 N19.2 11/12/13 7-2 23 (16)/17 11/13 12 11/13 12 18 (10)/11 12 18/19 13/14 11/13 16/17 (30) XY 18/19 13/14 11/13 16/17 (29/30 9/(12) (24) (10) N12.12 X/Y 13 DBK1a NN13 N218.4 BRU5 NC N13.9 X (31) (10) DON2b NK9 N46.5 DEB3a NH3 N16.3 DEB3a NG10 N20.8 X? X 14/15 10 FGA D7S820 D18S51 (9) (20) 11/12 16/17 CH4a NL2 N64_2 DBK1a NN13 N203.13 X/Y DBK1b NO13 N219.3.4 X (17)/18 DEB3b NK4 N46.4 X 17/18 DEB3b NK4 N47.15 X DEB1 NH N16.18 X 17 DEB1 NG8 N17.12 X DON2a NJ12 N20. Ergebnisse aller einzelnen STR-Typisierungen.2 X 18 DEB2a NG N17.9 X(Y) 13/14 (16)/17 9/(12) 13 (11)/12 12/(15)16 (9)h 7/13 8/13 12/13 232 .3 X DON2a NM4 N79.

10 (11)h D21S11 D13S317 FGA D7S820 D18S51 (13)/14 16 31.2 Amel D3S1358 D8S1179 D5S818 vWA DUD2a NJ10 N19.6 (13)14/15 END6 2a NN7 N218.4 X (15/16/17) 11/15 12 15/16 29 21 KRE1a NJ13 N26.6 X 18 END6 1b NO6 N219.3 END119 2b NO5 N204.4 X 16/17 11/(15) (12) 16 28/29 (13) 21 KRE1b ND4 N15.2 FLO1re NL10 N64_10 X FLO4a NI N18.5 Y 16 (8)9 12 11+1/(16)/17 END6 1a NN6 N218.6 X 16/(17)18 (12)/13/14 10/11/12 17-2 29.3.8 Artefakte 17/18 9+1/(13)14 X (16-2)17-2 16 16/18 31.7 XY HAL2b NL9 N64_19 HAL2b NL9 N64_9 HAL3a NI N18.4 X 15 14 11/13 (15)16/(17)18 END6 1a NN6 N203.7 X 18 (12)13 12 17 30 END6 3a NN8 N218.Anhang Tabelle 10.5 X 17/18 END6 3a NN8 N203.13 Artefakte 14/16 (9)/(13)/14 12 15/16 ECS 1a NN12 N203.7 XY 16/18 HAL2a NK7 N46.5 KRE1a NJ13 N19.4 X HAL1b NI11 N20.7 (10)/(14)/16 13 12 KRE1b NG3 N14.3 END119 1a NN4 N218.6 21 (20) 28/29 X 11/12 24 X 233 .2 10/11 29 (10) 21 12/13 HRX1 NG N14.8 X DUD2b NK13 N47.15 X END119 1a NN4 N203.16 Y EIL1b NR8 N219.13 X 16/17 11/15 (7)/10/11 11/12 15/16 KRE1a NJ13 N20.11 ad/Y 18 8/15 HAL2a NK7 N47.11 (14)15 9+1/(13)14 ECS 1a NN12 N218.9 Y? 16/17 11/15 12 (15)/16 (28) (14) (21) KRE1are NM12 N79.14 10/11 (15-1)h EIL1a NS10 N218.2 8 26 14 18 32+1 (10)11 19+1 (14)/15 (14)/15 12 (14) (10)/11 13/14 (10)/11 15/17 8/13 12 (15)/16/18 (28)/30 (11) (24) 16/18 8/13 12 16/18 28/30 (9) (21)/24 XY 16/18 8/13 12 16/18 28/30 10/(12) XY 16/18 8/13 12 16/18 28/30 9 31.3 KRE1b NG3 N26.5 ad/Y FLO4a NI5 N20.10 X 16 13/14 DUD2a NJ10 N20.4 X (15)/16 HAL1b NI N18.1 X 16 13 12 16/17 DUD2a NJ10 N26.2/32. Probe Extrakt PCR DUD1b NG N14.1 ad/Y HAL1a NF N12.2 END119 1b NO4 N219.12 XY HAL1b ND N13.2 21/22 14-1/15-1 (14-1)h/18 EIL1a NS10 N203.12 X HAL3a NI12 N20. Fortsetzung.13 X HAL3b NK8 N47. Ergebnisse aller einzelnen STR-Typisierungen.2/32.5 X 15 13/14 11/12/13 END119 2b NO5 N219.4 X/Y 18 9/13 13 END6 1b NO6 N204.5 12/16 END6 2a NN7 N203.13 Y EIL1b NR8 N204.3 KRE1b ND4 N26.7 XY FLO4a NK1 N46.4 X 16/17 11/15 (12) 16 28/29 KRE1are NM12 N80.

6 X/Y 14 13/(14) (11) 14/16 26/(29.11 UWS10 NE N11.3?) (16?) 31.8 X/Y 15/17 13/(14) 12/13 14/17 28 SZA23 3a NN3 N80.2)/33. Probe Extrakt PCR Amel D3S1358 D8S1179 D5S818 vWA KRE2a NJ14 N19.7 ad/Y VIE1 NG N14.5 XY 15/17 9/14 11/12 KRE2a NJ14 N26.2 UWS2b NH N16.14 LEB1a NL1 N64_1 SCHWE1a NI N18.12 VAI3 NK11 N46.2-30) 11+2/13+2 22/23 (7/8) SZA23 1b NO1 N81.10 XY 15/17 9/14 11/12 16/18 KRE2are NM11 N79.8 Y 15 (7)8 (14)/15 D21S11 D13S317 FGA 28 10/14 20 D7S820 D18S51 (28) (19)/20 19 Artefakte 9/(13)/14 (7)+1 X (8)/11/12 (8)/13 (9)/(12)/13/14 (14/15) 11/12 11 (11)/12 SZA8 2b NO10 N219.1 X/Y 14 13/14 11 14/16 26 SZA23 2a NN2 N79.2+ 11+/13+ 22/23 (7/8) (12/15) SZA23 1b NO1 N204.9 TRE1 NH N16.3 X/Y 15/17 (14) (11) 16/18 28 KRE2b NK14 N47.9 X SCHWE4a NL13 N64_13 X SCHWE4b NI N18.3.3 Y 15/17 13/14 14/17 28 (9)/10+2 20+ (9) SZA23 3b NO3 N204.2 X 15/17 12 SZA23 2b NO2 N204.5 UWS4 NE N11.9 SCHWE4b NI9 N20.11 X VIE1 ND N15.3 X/Y 15 13/14 13 14/17 - - 21 - SZA8 1a NN9 N203. Fortsetzung.1 X 15/17 18/19 (30)h SZA23 2a NN2 N218.2 9/12 X 16 16/17 18/19 14/(15)/(16) (10)/11 (15)/16 (6?) (19) (17)/18 234 .2 X (35.6 SZA23 1a NN1 N79.14 XY 15/17 (13)/14/(15) 11/12 15/16 KRE2a NJ14 N20.3 X/Y 15 13/14 12/13 14/17 28/28.Anhang Tabelle 10.11 X (13)/14 UWS9 NH N16.8 X 8/11/12/13 UWS6 NH N16.1 UWS10 NC N13.1 X/Y 14 13/14 11 14/16 26/29.2/30 11/13 22/23 7/8 SZA23 1a NN1 N80.7 X 15 12 11/13 SZA23 2a NN2 N80.1 UWS1 NE N11.10 UWS2 NE N11.7 (12/15) 18/19 (19) 11 19 15/16 20+2/\21-2 - 10/11 (8.8 X SCHWE2b NI8 N20.1 X/Y 14/19 13/14 11 14/16 26/30 11+2/13+2 22/23 7/8 SZA23 1b NO1 N82.8 X/Y 15/17 13/14 12/(13) 14/17 28/29 11/(12) (21) SZA23 3a NN3 N203.2 X (14)15 8 SZA23 2b NO2 N219.9 UWS8b NH N16.2 X 17 8/(10)/13 SZA23 2b NO2 N82.2 X/Y 15/17 13/14 12/13 (13)14/17 28/29 (12)h (21)h - - SZA23 3b NO3 N81.7 X 15/17 12 11 SZA23 2a NN2 N203.14 KRE2b NK14 N46.3 X/Y 15/17 (14) 16 28 KRE2are NM11 N80.1 SZA23 2b NO2 N81.2 XY 14 13/14 (10)/11 12/14/16 26/30 SZA23 3a NN3 N79.4 UWS5 NE N11.1 X/Y 14 13/14 (10)11 14/16 26/30 12/14 SZA23 1b NO1 N219.2-29 11 20 (16) SZA23 3b NO3 N82.6 X/Y 14 13/14 11 14/16 26/29.14 UNS3a ND N15. Ergebnisse aller einzelnen STR-Typisierungen.2?) (6?) (7)/(9) 11/12 (24)/25 (32.10 SON6 ND N13.5 X UWS5b NH N16.7 SCHWE2a NL12 N64_12 SCHWE2b NI8 N18.

90 5.00 FLO4 Fragment IIIk 1620916303 16.56 8.15 7.98 28.25 27.85 16.04 27.74 21.20 31.00 7.25 0.82 3.00 5.34 10.98 0.96 13.91 14.40 24.46 5.76 6.17 13.92 14.25 12.34 CHE4 LEB1 VAI3 FLO5 8.07 10.48 11.79 17.39 8.15 0.04 10.50 23.04 13.15 4.93 13.26 12. Substitutionsrate der einzelnen Amplifikationen aller neolithischer Individuen.43 25.00 10.92 28.78 17.57 13.70 0.80 5.96 DEB3 DEB4 Fragment II 1611716233 SCHWE1 12.09 7.15 0.17 10.56 17.4.00 16.62 2.51 21.94 19.49 13.92 17.39 5.64 8.89 24.36 7.17 16.39 KRE1 KRE2 3.09 9.93 20.74 43.30 6.25 40.20 9.68 19.70 17.55 14.43 8.72 22.74 15.Anhang Tabelle 10.00 11.49 18.04 21.49 22.13 3.69 0.25 23.00 DEB1 Fragment III 1620916348 Fragment IV 1628716410 Ø 21.29 22.20 6.59 17.80 32.39 41.70 19.45 5.59 8.38 11.63 13.13 10.39 32.93 9.54 5.32 13.00 17.52 8.00 16.57 17.83 18.45 10.06 14.79 3.25 25.43 0.10 SCHWE2 DON1 24.39 17.21 17.56 28.55 36.39 HAL2 HAL1 Fragment IIk 1611716218 DEB5 8.49 33.04 13.27 10.34 16.85 SEE1 HAL3 11.00 6.57 235 .14 31.73 0.45 FLO2 17. Individuum Fragment Ik 1599616055 Fragment I 1599616142 ASP2 9.53 11.70 38.46 6.11 4.09 6.29 16.34 18.93 16.93 4.72 10.74 10.10 10.43 7.37 26.43 7.00 5.26 7.60 0.44 FLO6 3.04 21.14 16.54 SCHWE4 5.54 6.12 23.15 9.15 10.00 8.69 16.

66 12.39 9.4.69 15.43 41.80 UWS2 5.62 10.70 18.36 12.67 13.88 17.00 25.70 14.20 11.34 0.00 0.86 10.66 3.04 4.95 9. Individuum Fragment Ik Fragment I Fragment IIk Fragment II Fragment IIIk Fragment III Fragment IV 1599615996161171611716209162091628716055 16142 16218 16233 16303 16348 16410 UWS5 3.66 0.92 11.84 6.04 12.19 0.26 19.43 10.84 10.25 0.87 8.45 8.25 17.39 7.87 7.90 9.93 13.60 8.92 9.20 5.71 10.83 15.15 0.94 11.45 SZA8 2 3.19 10.86 12.97 4.96 0.00 6.66 32.75 8.00 6.62 8.66 13.64 FLO1 EIL1 Ø 10.59 13.06 9.43 8.00 0.30 10.90 20.36 14.49 23.90 5.87 0.45 30.59 8.70 7.70 10.10 14.57 3.25 6.94 0.00 5.08 236 .20 2.20 20.17 16.79 10.70 15.70 15.02 8.55 END6 1 END6 2 ESC1 DBK1 DKF1 SZA23 1 SZA23 2 12.13 20.17 14.20 4.30 17.43 11.12 4.17 7.57 17.22 6.62 10.37 8.29 34.00 END119 1 16.50 34.20 18.15 5.93 9.10 3.75 3.48 8.26 19.00 17.00 0.14 3.79 23.00 4.35 10.45 8.56 30.79 27.06 6.67 8.45 26.39 6.00 9.39 25.84 11.02 10.20 13.15 12.59 16.59 10.33 8.79 0.71 6.70 FLO3 19. Substitutionsrate der einzelnen Amplifikationen aller neolithischer Individuen.43 5.89 16.82 8.35 3.64 13.84 13.17 8.59 17. Fortsetzung.66 13.53 14.85 27.00 SZA8 1 3.22 6.34 SZA23 3 Durchschnittliche Substitutionsrate 18.90 11.88 11.56 19.90 8.70 11.25 13.21 15.88 24.11 9.87 10.Anhang Tabelle 10.80 24.65 9.37 23.90 13.

06 A>T 0 3 0 6 0 5 1 15 0.5 Aufschlüsselung der einzelnen Substitutionen.19 C>A 1 2 0 1 0 3 2 9 0.Anhang Tabelle 10.09 G>C 0 0 0 0 0 0 0 0 0 G>A 2 109 6 75 2 44 62 300 14.68 C>G 0 0 0 2 0 1 1 4 0.42 T>A 0 1 0 1 0 0 1 3 0.14 G>T 0 0 0 1 0 1 0 2 0. Fragment Austausch Ik I IIk II IIIk III IV Summe % C>T 22 220 31 397 38 447 460 1615 75.42 T>C 0 33 1 14 1 18 18 85 3.03 A>C 0 1 0 1 1 2 1 6 0.98 T>G 0 5 0 3 0 0 1 9 0.28 Summe 25 390 39 522 44 544 570 2134 100 237 .70 A>G 0 16 1 21 2 23 23 86 4.

00 8.00 0.00 10. Gebieten sowie in Referenzgebiet A (LBK/Körös-Gebiet heute).00 10.00 0.00 0.6.93 HV 7.23 10.00 100.35 U5 3.00 0.85 10.00 1.00 1.00 10.00 9.00 0.85 0.00 T 19.Anhang Tabelle 40.00 42.85 0.87 W 3.00 0.00 0.00 0.90 N1a 23.08 0.04 N9a 0.93 K 15. Referenzgebiet A Haplogruppe LBK/AVK Körös Nordost U3 3.14 V 3.04 H* 15.38 10.00 0.00 10.55 J 3.85 0.69 10.38 30. Exakte Werte zu Abbildungen 33 und 34.00 0.00 0.00 0.00 D4a 0.00 0.00 I 0.27 LBK/Körös heute 238 .00 1.00 4. Prozentualer Anteil der Haplogruppen in den unterschiedlichen frühneolithischen Kulturen bzw.00 5.00 0.00 2.85 0.00 0.

46% 14.00% U3 1.01% 0. Prozentuale Anteile der Haplogruppen in der gesamten neolithischen Stichprobe sowie in zwei modernen Referenzgebieten.62% 6.38% J 9.93% 23.49% 4.00% div 0.02% 0.00% B 0.38% U5 10. Haplogruppe Referenzgebiet A Referenzgebiet B LBK/Körös heute Nahost+Kaukasus Neolithikum A 0.27% 2.00% C 0.00% F 0.26% 0.81% 1.35% 0.78% 16.76% 3.18% 0.00% M 0.15% 0.55% 1.38% E 0.23% 0.18% 1.00% N* 0.16% 0.17% 11.09% 0.29% R 0.77% 0.14% 4.38% N1a 0.00% 5.26% 2.67% HV 1.38% W 2.38% X 1.33% 14.00% 1.70% 2.47% 0.61% 8.62% 2.61% 16.08% 0.93% 8.77% 2.09% 2.04% 0.00% 0.67% V 4.72% 0.00% U* 6.16% 2.04% 9.85% 2.95% 7.76% 9.23% 0.00% 239 . Ergänzende exakte Werte zu Abbildung 35.00% D 0.31% 0.85% 0.Anhang Tabelle 10.14% I 2.29% T1 3.00% 0.25% 4.26% 1.00% T* 5.70% 1.76% K 5.00% H 42.90% L 0.7.

Applied Biosystems. Eppendorf.2 Verwendete Puffer und Lösungen LB-Medium (1 Liter): Trypton 10 g Hefeextrakt 5g NaCl 5g in Aqua bidest lösen und auf einen Liter auffüllen LB-Platten: Trypton 10 g Hefeextrakt 5g NaCl 5g Agar-Agar 15 g Ampicillin (10 mg/ml) 10 ml IPTG 47. Eppendorf.1 Geräte ABI PRISM™ 310 Genetic Analyzer. Weiterstadt Brutschrank. Karlsruhe Elektroporationsküvetten. INTAS Science Imaging Instruments GmbH.25% Bromphenolblau in 50ml H2O lösen 20 g 0. Eppendorf.Anhang 10. Utrecht. Hamburg Eppendorf® Mastercycler gradient 5331. Chemikalien und Kits 10.3 Verwendete Geräte. Niederlande Elektrophorese Gelkammer Midi.6 g Tris 432 g Borsäure 222. Carl Roth GmbH.4 g in Aqua bidest lösen und auf zwei Liter auffüllen 6 x Agarose-Ladepuffer: 40% w/v Sucrose 0. Eppendorf. Dremel.125 g 10. Hamburg 240 .6 mg X-Gal 100 mg in Aqua bidest lösen und auf einen Liter auffüllen 20 x TBE-Puffer (2 Liter): Na2 EDTA 18. Heraeus. peQLab Biotechnologie GmbH. Eppendorf® Biophotometer. B.3. Hamburg Eppendorf® Mastercycler. Eppendorf. Braun Digitales Geldokumentationssystem. Typ B 5042 Certomat® H und Certomat® U.-Bez. 5415C und 5402. Art. Hamburg Eppendorf® Centrifuge 5415R. Göttingen Dremel Multi. Hamburg Eppendorf® Thermomixer comfort 5355.

Merck. Typ N-90M UV-Transilluminator [Spectroline® Transilluminator TR-302] Vortexer Heidolph Typ REAX 1R. MILLIPORE Mischrotator (Eigenbau) P1000. GIBCO BRL®. 19021 R1 MILIPORE Milli-Qplus Filteranlage. Frankreich pH-Meter CG 838. Life technologies GmbH. 85989824 Bromphenolblau Na-Salz. Art. MBI fermentas GmbH. BioTech Trade & Service GmbH.2 Chemikalien 10 x EDTA-Puffer. Carl Roth GmbH. Art. Labor-Schwingmühle MM200. Carl Roth GmbH. GFL® 3025. Karlsruhe dNTP-Mix.-Bez.KG. St.-Bez. Palmolive-Colgate GmbH. Belgien IPTG. Consort E 143. Geel.-Bez. Darmstadt Natriumhypochlorid DanKlorix. Leon-Rot Loading Dye Solution.-Nr. St.. Leutkirch i. membraPure. Carl Roth GmbH. KaVo Elektrotechnisches Werk. ABI PRISM Applied Biosystems 2-Propanol. Gesellschaft für Labortechnik GmbH. GENterprise. Janke & Kunkel GmbH & Co. Retsch. Art. Karlsruhe Ethanol. Art. Polaroid Polaroid™-Filme. peQLab Biotechnologie GmbH Gelkammern. Karlsruhe Ampicillin Natriumsalz. Acros Organics. 159815 KaVO EWL K11 Typ 4980. MBI fermentas GmbH. Schott Polaroid ™-Kamera. Carl Roth GmbH. P20. Jouan GmbH. Karlsruhe Rotator. Rotipuran®. Leon-Rot Natriumacetat. Wiesbaden Zentrifuge Jouan GR 412. Karlsruhe Borsäure. Geel. Belgien EtBr-Stammlösung. Merck. Unterhaching 10. Burgwedel Säge KaVO EWL. Leon-Rot EDTA. Weiterstadt HPLC-Wasser. P10 PIPETMAN®. IKA-Werk.A. Applied Biosystems. Leon-Rot Hi-Di-Formamide.Anhang EQUIBIO Easyject Prisma Elektroporator. P100. Roche Diagnostics. Karlsruhe Agarose MEEO. St. Carl Roth GmbH. St. Rotipuran®. Carl Roth GmbH. Labotec. Karlsruhe GeneRulerTM 50 bp DNA Ladder. Acros Organics. Hamburg 241 . Carl Roth Chemikalien/Laborbedarf. Land Camera MP-4 mit Rotfilter. Darmstadt Bovines Serum Albumin (BSA). Art. Typ 667 Powersupply. Karlsruhe Agar-Agar. Typ 4990 (Handstück) UV-Lichtanlage.A. Benda.-Bez.3. Haan membraPure Aufbereitungsmodul. Mainz Agarose ultraPURE. HU10 IKA-Combimag RCT Magnetrührer. Mannheim. Gilson® Medical Electronics S. Carl Roth GmbH. MBI fermentas GmbH.

Mannheim Trichlormethan/Chloroform ROTISOLV®HPLC. Karlsruhe. St. Mannheim Shrimp Alkaline Phosphatase (SAP). Applied Biosystems. GIBCO BRL®. Roche Diagnostics. Carl Roth GmbH. Mannheim Proteinase K. Art.250 242 . Fluka. Steinheim T4-gene 32 protein.-Nr. MBI fermentas GmbH. EL0015 Uracil-N-Glykosylase. MBI fermentas GmbH. Life Technologies GmbH. Karlsruhe TTP-Mix. Rotisolv®HPLC. eigene Herstellung X-Gal.3 Enzyme Abgene DNA Polymerase. 2315. Frankfurt Eco RI. Berlin-Buch NucleoSpin® Plasmid Quick Pure Kit. Frankfurt Roti®-Phenol/Chloroform.-Nr. New England Biolabs® GmbH. Leon-Rot Sma I. MBI fermentas GmbH. Carl Roth GmbH. Karlsruhe Sucrose.3 10. Karlsruhe Trichlormethan/Chloroform. Invitek GmbH. MBI fermentas GmbH. St. St. New England Biolabs® GmbH. Roche Diagnostics.3. Art.3. peQLab Biotechnologie GmbH UltraPURE Ethidiumbromide solution. Life technologies GmbH. St. Roche Diagnostics. Leon-Rot Proteinase K in Tris-HCl. Riedel-deHaen. MBI fermentas GmbH. Performance Optimized Polymer 6. Applied Biosystems Weiterstadt Primer . MBI fermentas GmbH. PCR Grade. Macherey-Nagel. Art.Sigma-Aldrich Chemie GmbH.1. 740 615. Karlsruhe Tris-Puffer (Tris-(hydroxymethyl)-aminomethan). MBI fermentas GmbH. Düren. Schweiz Nujol Mineral Oil. Applied Biosystems. Karlsruhe Rotiphenol® 500. GIBCO BRL . Biosprings. Weiterstadt CONCERT Rapid PCR Purification System. Buchs SG. Carl Roth GmbH. Leon-Rot AmpliTaq Gold™ DNA Polymerase. Leon-Rot. St. Karlsruhe Vektor-DNA pUC18. Leon-Rot T4-Ligase. Leon-Rot Hinf I. Hamburg Alu I. Carl Roth GmbH. München 10. Weiterstadt POP-6 TM. Sigma-Aldrich Chemie GmbH.-Nr. St.4 Kits BigDyeTM Terminator Cycle Sequencing 3.Anhang N-Laurylsarkosin. MBI fermentas GmbH. Weiterstadt Dde I. Leon-Rot Hind III. St. St. Abgene Germany. Applied Biosystems. Carl Roth GmbH. Leon-Rot Exonuclease I (EXO I). Karlsruhe Invisorb® Spin PCRapid Kit. Carl Roth GmbH. Frankfurt AluI.

Anhang 10. Einwegartikel und Schutzkleidung 0.-Bez. Sarstedt. Weiterstadt ZORRO® Chirurgische Gesichtsmaske. Gilson® Medical Electronics S.. Kimberley-Clark® Overall Schutzkleidung sowie Überschuhe. REF/ 72. 50ml Sarstedt-Röhre. dalloz safety™. Molecular Bio Products™ inc. Applied Biosystems. Karlsruhe Schutzvisier Pulsafe®. EURONDA®.5 ml eppendorf Tubes. Schwalbach 15ml. San Diego. Weiterstadt 0. UK Septa for 0. Hamburg 0. Sarstedt AG. Du Pont Tyvek Rotiprotect Stretch Vinylhandschuhe. Frankreich 100 kDa Centricon Filter Unit.5 ml Sample Tubes. Clearways visor.5ml Micro Tubes Reagiergefäße. 20P. Nümbrecht 10il Gilson Long Tips DL 10. flat cap. Art.5 ml Safe-Lock PCR-Tubes.A.690 1. Nümbrecht ART® 1000E. Sarstedt AG. Nümbrecht 2ml Safe-seal Reagiergefäße.5 Gefäße.. 100E. USA Kimwipes® Lite und Lite 100. eppendorf. Millipore GmbH. CV83P’EU und Clearways CB14 Browguard. USA 1.3. Molecular Bio Products™ . Applied Biosystems. Tyvek Pro-Tech®.5ml PCR Tubes. Italien 243 . Carl Roth GmbH.5 ml Sample Tubes. San Diego. Sarstedt AG. 10 REACH Einwegpipettenspitzen.

alte DNA base pair(s). x z.u. DNA. Restriktions-Fragment-Längen-Polymorphismus rounds per minute.h. cm ddNTPs d. M mM min ml np(s) PCR pH pmol RFLP rpm RT TBE s.o. DNS dNTPs EDTA et al. EtBr g xg h Hg Ht Kap.B.a. U/min UV V vgl. Nukleotidposition(en) polymerase chain reaction. s s. STR s. Protonenaktivitätsexponent Picomol restriction fragment length polymorphism. Basenpaar(e) beziehungsweise Zentimeter Didesoxinukleotidtriphosphate das heißt desoxiribonucleic acid. unter anderen Umdrehungen pro Minute Ultraviolett Volt vergleiche mal zum Beispiel 244 . Desoxiribonukleinsäure Desoxinukleotidtriphosphate Ethylendiamintetraacetat et alii Ethidiumbromid Gramm Zentrifugalbeschleunigung Stunde(n) Haplogruppe Haplotyp Kapitel molar millimolar Minute(n) Milliliter Nucleotide position(s). Polymerase Kettenreaktion Pondus Hydrogeni. Promille Prozent Eingetragene Marke Marke Grad Celsius Microliter ancient DNA. u.Anhang 10.4 Abkürzungsverzeichnis ‰ % ® ™ °C il aDNA bp bzw. U/min Raumtemperatur Tris-Borat-EDTA-Puffer siehe auch Sekunde(n) siehe oben short tandem repeat siehe unten unter anderem.a.

Anderson et al. Die Bezeichnung der Klonsequenzen entspricht folgendem Prinzip: z. übereinstimmende Positionen dagegen mit einem Punkt gekennzeichnet werden. Direktsequenzierungen sind in überlappenden Fragmenten geordnet unter der CRS angegeben. Jedes Alignment wird von der Cambridge Reference Sequence (CRS.B. Die jeweiligen Sequenzen der Klone bzw.B. Genbank accession number J01415) angeführt. ASP2_A_I/1_1 Probenkürzel_Extraktion A_HVR I Fragment I /PCR-Nummer(mit UNG)_Klonnummer Die Bezeichnung der Direktsequenzierungen entspricht folgendem Prinzip: z.Anhang 10. Darüber befindet sich die Angabe zur Nukleotidposition. 1981.5 Alignments der Sequenzen der neolithischen Individuen Nachfolgend sind die Alignments der Sequenzen der neolithischen Individuen in alphabetischer Reihenfolge aufgeführt. wobei nur abweichende Positionen ausgeschrieben. SCHWE5_B_III/1rev Probenkürzel_Extraktion B_ HVR I Fragment III /PCR-Nummer_verwendeter Primer Die Bezeichnung der abweichenden Nukleotide erfolgt nach dem IUB-code: IUB Bedeutung a a c c g g t t m a oder c r a oder g w a oder t s c oder g y c oder t k g oder t v a oder c oder g h a oder c oder t d a oder g oder t b c oder g oder t n a oder c oder g oder t 245 .

J01415
ASP2_A_I/1_1
ASP2_A_I/1_2
ASP2_A_I/1_3
ASP2_A_I/1_4
ASP2_A_I/1_5
ASP2_A_I/1_6
ASP2_A_I/1_7
ASP2_A_I/1_8
ASP2_A_I/1_9
ASP2_A_I/1_10
ASP2_A_I/1_11
ASP2_B_I/1UNG_1
ASP2_B_I/1UNG_2
ASP2_B_I/1UNG_3
ASP2_B_I/1UNG_4
ASP2_B_I/1UNG_5
ASP2_B_I/1UNG_6
ASP2_B_I/1UNG_7
ASP2_B_I/1UNG_8
ASP2_B_I/1UNG_9
ASP2_A_II/1UNG_1
ASP2_A_II/1UNG_2
ASP2_A_II/1UNG_3
ASP2_A_II/1UNG_4
ASP2_A_II/1UNG_5
ASP2_A_II/1UNG_6
ASP2_A_II/1UNG_7
ASP2_A_II/1UNG_8
ASP2_B_II/1_1
ASP2_B_II/1_2
ASP2_B_II/1_3
ASP2_B_II/1_4
ASP2_B_II/1_5
ASP2_B_II/1_6
ASP2_B_II/1_7
ASP2_B_II/1_8
ASP2_B_II/1_9
ASP2_A_III/1UNG_1
ASP2_A_III/1UNG_2
ASP2_A_III/1UNG_3
ASP2_A_III/1UNG_4
ASP2_A_III/1UNG_5
ASP2_A_III/1UNG_6
ASP2_A_III/1UNG_7
ASP2_A_III/1UNG_8
ASP2_A_III/1UNG_9
ASP2_A_III/1UNG_10
ASP2_B_III/1_1
ASP2_B_III/1_2
ASP2_B_III/1_3
ASP2_B_III/1_4
ASP2_B_III/1_5
ASP2_B_III/1_6
ASP2_B_III/1_7
ASP2_B_III/1_8
ASP2_B_III/1_9
ASP2_B_III/1_10
ASP2_B_III/1_11
ASP2_B_III/1_12
ASP2_A_IV/1UNG_1
ASP2_A_IV/1UNG_2
ASP2_A_IV/1UNG_3
ASP2_A_IV/1UNG_4
ASP2_A_IV/1UNG_5
ASP2_A_IV/1UNG_6
ASP2_A_IV/1UNG_7
ASP2_A_IV/1UNG_8
ASP2_A_IV/1UNG_9
ASP2_A_IV/1UNG_10
ASP2_A_IV/1UNG_11
ASP2_B_IV/1_1
ASP2_B_IV/1_2
ASP2_B_IV/1_3
ASP2_B_IV/1_4
ASP2_B_IV/1_5
ASP2_B_IV/1_6
ASP2_B_IV/1_7
ASP2_B_IV/1_8
ASP2_B_IV/1_9

16000

16010

16020

16030

16040

16050

16060

16070

16080

16090

16100

16110

16120

16130

16140

16150

16160

16170

16180

16190

16200

T A AGA T T CT A A T T T A A A CT AT T CT CT GT T CT T T CA T GGGGA A GCA GA T T T GGGT A CCA CCCA AGT A T T GA CT CA CCCA T CA A CA A CCGCT A T GT A T T T CGT A CA T T A CT GCCA GCCA CCA T GA A T A T T GT ACGGT A CCA T A A A T A CT T GA CCA CCT GT A GT A CA T A A A A A CCCAA T CCA CA T CA A A A CCCCCT CCCCA T GCT T A CA A
. . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . T. . T. . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . Y. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anhang

246

J01415
ASP2_A_I/1_1
ASP2_A_I/1_2
ASP2_A_I/1_3
ASP2_A_I/1_4
ASP2_A_I/1_5
ASP2_A_I/1_6
ASP2_A_I/1_7
ASP2_A_I/1_8
ASP2_A_I/1_9
ASP2_A_I/1_10
ASP2_A_I/1_11
ASP2_B_I/1UNG_1
ASP2_B_I/1UNG_2
ASP2_B_I/1UNG_3
ASP2_B_I/1UNG_4
ASP2_B_I/1UNG_5
ASP2_B_I/1UNG_6
ASP2_B_I/1UNG_7
ASP2_B_I/1UNG_8
ASP2_B_I/1UNG_9
ASP2_A_II/1UNG_1
ASP2_A_II/1UNG_2
ASP2_A_II/1UNG_3
ASP2_A_II/1UNG_4
ASP2_A_II/1UNG_5
ASP2_A_II/1UNG_6
ASP2_A_II/1UNG_7
ASP2_A_II/1UNG_8
ASP2_B_II/1_1
ASP2_B_II/1_2
ASP2_B_II/1_3
ASP2_B_II/1_4
ASP2_B_II/1_5
ASP2_B_II/1_6
ASP2_B_II/1_7
ASP2_B_II/1_8
ASP2_B_II/1_9
ASP2_A_III/1UNG_1
ASP2_A_III/1UNG_2
ASP2_A_III/1UNG_3
ASP2_A_III/1UNG_4
ASP2_A_III/1UNG_5
ASP2_A_III/1UNG_6
ASP2_A_III/1UNG_7
ASP2_A_III/1UNG_8
ASP2_A_III/1UNG_9
ASP2_A_III/1UNG_10
ASP2_B_III/1_1
ASP2_B_III/1_2
ASP2_B_III/1_3
ASP2_B_III/1_4
ASP2_B_III/1_5
ASP2_B_III/1_6
ASP2_B_III/1_7
ASP2_B_III/1_8
ASP2_B_III/1_9
ASP2_B_III/1_10
ASP2_B_III/1_11
ASP2_B_III/1_12
ASP2_A_IV/1UNG_1
ASP2_A_IV/1UNG_2
ASP2_A_IV/1UNG_3
ASP2_A_IV/1UNG_4
ASP2_A_IV/1UNG_5
ASP2_A_IV/1UNG_6
ASP2_A_IV/1UNG_7
ASP2_A_IV/1UNG_8
ASP2_A_IV/1UNG_9
ASP2_A_IV/1UNG_10
ASP2_A_IV/1UNG_11
ASP2_B_IV/1_1
ASP2_B_IV/1_2
ASP2_B_IV/1_3
ASP2_B_IV/1_4
ASP2_B_IV/1_5
ASP2_B_IV/1_6
ASP2_B_IV/1_7
ASP2_B_IV/1_8
ASP2_B_IV/1_9

16210

16220

16230

16240

16250

16260

16270

16280

16290

16300

16310

16320

16330

16340

16350

16360

16370

16380

16390

16400

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. T. .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . T.
. . . .
. . . .
. T. .
. T. .
. . . .
. . . .
. . . .
. . . .
. . . .
T TT.
T TT.
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
CT .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. T. .
. . . .
. . . .
. . . .
. . . .
T. . .
T. . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
T. . .
. . . .
. . . .
. . T.
. . . .
. . . .

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . T.
. TT.
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
T. . .
. . T.
. . T.
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. G.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
T. .
T. .
T. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
T. .
T. .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .
. . .
. . .
. . .
. . .
T. .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
TTT.
T. T.
T. T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
AA.
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. T.
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
A. .
. . .
. . .
. . .
. . .
. A.
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
TT.

GCAA GT A CA GCAA T CA A CCCT CA A CT A T CA CA CA T CAA CT GCA A CT CCA A A GCCA CCCCT CA CCCA CT A GGA T A CCA A CAA A CCT A CCCA CCCT T A ACA GT A CA T A GT A CA T A AA GCCA T T T A CCGT A CA T A GCA CA T T ACA GT CA A AT CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CA GA T A GGGGT CCCT T GA CCACCA T CCT

Anhang

247

J01415
BRU4_A_I/1_1
BRU4_A_I/1_2
BRU4_A_I/1_3
BRU4_A_I/1_4
BRU4_A_I/1_5
BRU4_A_I/1_6
BRU4_A_I/1_7
BRU4_A_I/1_8
BRU4_A_I/1_9
BRU4_A_I/1_10
BRU4_A_I/1_11
BRU4_A_I/1_12
BRU4_B_I/1_1
BRU4_B_I/1_2
BRU4_B_I/1_3
BRU4_B_I/1_4
BRU4_B_I/1_5
BRU4_B_I/1_6
BRU4_B_I/1_7
BRU4_B_I/1_8
BRU4_B_I/1_9
BRU4_B_I/1_10
BRU4_A_II/1_1
BRU4_A_II/1_2
BRU4_A_II/1_3
BRU4_A_II/1_4
BRU4_A_II/1_5
BRU4_A_II/1_6
BRU4_A_II/1_7
BRU4_A_II/1_8
BRU4_A_II/1_9
BRU4_A_II/1_10
BRU4_A_II/1_11
BRU4_A_II/1_12
BRU4_B_II/1_1
BRU4_B_II/1_2
BRU4_B_II/1_3
BRU4_B_II/1_4
BRU4_B_II/1_5
BRU4_B_II/1_6
BRU4_B_II/1_7
BRU4_B_II/1_8
BRU4_B_II/1_9
BRU4_A_III/1_1
BRU4_A_III/1_2
BRU4_A_III/1_3
BRU4_A_III/1_4
BRU4_A_III/1_5
BRU4_A_III/1_6
BRU4_A_III/1_7
BRU4_A_III/1_8
BRU4_A_III/1_9
BRU4_A_III/1_10
BRU4_A_III/1_11
BRU4_B_III/1_1
BRU4_B_III/1_2
BRU4_B_III/1_3
BRU4_B_III/1_4
BRU4_B_III/1_5
BRU4_B_III/1_6
BRU4_B_III/1_7
BRU4_B_III/1_8
BRU4_B_III/1_9
BRU4_B_III/1_10
BRU4_B_III/1_11
BRU4_B_III/1_12
BRU4_A_IV/1_1
BRU4_A_IV/1_2
BRU4_A_IV/1_3
BRU4_A_IV/1_4
BRU4_A_IV/1_5
BRU4_A_IV/1_6
BRU4_A_IV/1_7
BRU4_A_IV/1_8
BRU4_A_IV/1_9
BRU4_A_IV/1_10
BRU4_A_IV/1_11
BRU4_A_IV/1_12
BRU4_B_IV/1_1
BRU4_B_IV/1_2
BRU4_B_IV/1_3
BRU4_B_IV/1_4
BRU4_B_IV/1_5
BRU4_B_IV/1_6
BRU4_B_IV/1_7
BRU4_B_IV/1_8

16000

16010

16020

16030

16040

16050

16060

16070

16080

16090

16100

16110

16120

16130

16140

16150

16160

16170

16180

16190

16200

T A A GA T T CT AA T T T A A ACT AT T CT CT GT T CT T T CA T GGGGAA GCAGA T T T GGGT A CCA CCCAA GT AT T GACT CA CCCA T CA A CAA CCGCT A T GT A T T T CGT A CAT T A CT GCCA GCCA CCA T GA A T AT T GT A CGGT ACCA T A A AT A CT T GACCA CCT GT A GT A CAT A A AA A CCCA AT CCA CA T CA A AA CCCCCT CCCC- - - A T GCT T A C
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . CC- . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . CCC. . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . C. . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . T . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anhang

248

J01415
BRU4_A_I/1_1
BRU4_A_I/1_2
BRU4_A_I/1_3
BRU4_A_I/1_4
BRU4_A_I/1_5
BRU4_A_I/1_6
BRU4_A_I/1_7
BRU4_A_I/1_8
BRU4_A_I/1_9
BRU4_A_I/1_10
BRU4_A_I/1_11
BRU4_A_I/1_12
BRU4_B_I/1_1
BRU4_B_I/1_2
BRU4_B_I/1_3
BRU4_B_I/1_4
BRU4_B_I/1_5
BRU4_B_I/1_6
BRU4_B_I/1_7
BRU4_B_I/1_8
BRU4_B_I/1_9
BRU4_B_I/1_10
BRU4_A_II/1_1
BRU4_A_II/1_2
BRU4_A_II/1_3
BRU4_A_II/1_4
BRU4_A_II/1_5
BRU4_A_II/1_6
BRU4_A_II/1_7
BRU4_A_II/1_8
BRU4_A_II/1_9
BRU4_A_II/1_10
BRU4_A_II/1_11
BRU4_A_II/1_12
BRU4_B_II/1_1
BRU4_B_II/1_2
BRU4_B_II/1_3
BRU4_B_II/1_4
BRU4_B_II/1_5
BRU4_B_II/1_6
BRU4_B_II/1_7
BRU4_B_II/1_8
BRU4_B_II/1_9
BRU4_A_III/1_1
BRU4_A_III/1_2
BRU4_A_III/1_3
BRU4_A_III/1_4
BRU4_A_III/1_5
BRU4_A_III/1_6
BRU4_A_III/1_7
BRU4_A_III/1_8
BRU4_A_III/1_9
BRU4_A_III/1_10
BRU4_A_III/1_11
BRU4_B_III/1_1
BRU4_B_III/1_2
BRU4_B_III/1_3
BRU4_B_III/1_4
BRU4_B_III/1_5
BRU4_B_III/1_6
BRU4_B_III/1_7
BRU4_B_III/1_8
BRU4_B_III/1_9
BRU4_B_III/1_10
BRU4_B_III/1_11
BRU4_B_III/1_12
BRU4_A_IV/1_1
BRU4_A_IV/1_2
BRU4_A_IV/1_3
BRU4_A_IV/1_4
BRU4_A_IV/1_5
BRU4_A_IV/1_6
BRU4_A_IV/1_7
BRU4_A_IV/1_8
BRU4_A_IV/1_9
BRU4_A_IV/1_10
BRU4_A_IV/1_11
BRU4_A_IV/1_12
BRU4_B_IV/1_1
BRU4_B_IV/1_2
BRU4_B_IV/1_3
BRU4_B_IV/1_4
BRU4_B_IV/1_5
BRU4_B_IV/1_6
BRU4_B_IV/1_7
BRU4_B_IV/1_8

16210

16220

16230

16240

16250

16260

16270

16280

16290

16300

16310

16320

16330

16340

16350

16360

16370

16380

16390

16400

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
T.
T.
T.
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
G.
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

T.
T.
T.
T.
T.
T.
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

T.
T.
T.
T.
T.
T.
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
G.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
TT.
TT.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .

. .
C.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
C.
C.
C.
C.
C.
C.
C.
C.
C.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. C.
. C.
. C.
. C.
. C.
. . .
. C.
. C.
. C.
. C.
. C.
. C.
A C.
. C.
. C.
. C.
. C.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. C.
. C.
. C.
. C.
. C.
. C.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
C.
C.
C.
. .
. .
. .
. .
. .
. .
. .
C.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

A A GCA AGT A CA GCA A T CA A CCCT CA A CT A T CA CACA T CA A CT GCAA CT CCA AA GCCA CCCCT CA CCCA CT A GGA T ACCA ACA A ACCT A CCCA CCCT T AA CAGT ACA T AGT A CA T AA A GCCA T T T A CCGT A CA T A GCA CA T T A CA GT CA A AT CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CAGA T AGGGGT CCCT T GA CCA CCA T CCT

Anhang

249

J01415
CHE4_A_I/1UNG_1
CHE4_A_I/1UNG_2
CHE4_A_I/1UNG_3
CHE4_A_I/1UNG_4
CHE4_A_I/1UNG_5
CHE4_A_I/1UNG_6
CHE4_A_I/1UNG_7
CHE4_B_I/1_1
CHE4_B_I/1_2
CHE4_B_I/1_3
CHE4_B_I/1_4
CHE4_B_I/1_5
CHE4_B_I/1_6
CHE4_B_I/1_7
CHE4_B_I/1_8
CHE4_B_I/1_9
CHE4_B_I/1_10
CHE4_B_I/1_11
CHE4_A_II/1UNG_1
CHE4_A_II/1UNG_2
CHE4_A_II/1UNG_3
CHE4_A_II/1UNG_4
CHE4_A_II/1UNG_5
CHE4_A_II/1UNG_6
CHE4_A_II/1UNG_7
CHE4_B_II/1_1
CHE4_B_II/1_2
CHE4_B_II/1_3
CHE4_B_II/1_4
CHE4_B_II/1_5
CHE4_B_II/1_6
CHE4_B_II/1_7
CHE4_B_II/1_8
CHE4_B_II/1_9
CHE4_B_II/1_10
CHE4_B_II/1_11
CHE4_B_II/1_12
CHE4_A_III/1UNG_1
CHE4_A_III/1UNG_2
CHE4_A_III/1UNG_3
CHE4_A_III/1UNG_4
CHE4_A_III/1UNG_5
CHE4_A_III/1UNG_6
CHE4_A_III/1UNG_7
CHE4_A_III/1UNG_8
CHE4_B_III/1_1
CHE4_B_III/1_2
CHE4_B_III/1_3
CHE4_B_III/1_4
CHE4_B_III/1_5
CHE4_B_III/1_6
CHE4_B_III/1_7
CHE4_B_III/1_8
CHE4_B_III/1_9
CHE4_B_III/1_10
CHE4_B_III/1_11
CHE4_B_III/1_12
CHE4_A_IV/1UNG_1
CHE4_A_IV/1UNG_2
CHE4_A_IV/1UNG_3
CHE4_A_IV/1UNG_4
CHE4_A_IV/1UNG_5
CHE4_A_IV/1UNG_6
CHE4_A_IV/1UNG_7
CHE4_A_IV/1UNG_8
CHE4_B_IV/1_1
CHE4_B_IV/1_2
CHE4_B_IV/1_3
CHE4_B_IV/1_4
CHE4_B_IV/1_5
CHE4_B_IV/1_6
CHE4_B_IV/1_7
CHE4_B_IV/1_8
CHE4_B_IV/1_9
CHE4_B_IV/1_10
CHE4_B_IV/1_11
CHE4_B_IV/1_12

16000

16010

16020

16030

16040

16050

16060

16070

16080

16090

16100

16110

16120

16130

16140

16150

16160

16170

16180

16190

16200

T A A GA T T CT A A T T T A A A CT A T T CT CT GT T CT T T CA T GGGGA A GCAGA T T T GGGT A CCACCCA A GT A T T GA CT CA CCCA T CA A CA A CCGCT A T GT A T T T CGT A CA T T ACT GCCAGCCA CCAT GA A T A T T GT A CGGT ACCA T A A A T A CT T GA CCA CCT GT A GT A CA T AA A A A CCCAA T CCA CAT CA A A A CCCCCT CCCCA T GCT T A CAA
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anhang

250

J01415
CHE4_A_I/1UNG_1
CHE4_A_I/1UNG_2
CHE4_A_I/1UNG_3
CHE4_A_I/1UNG_4
CHE4_A_I/1UNG_5
CHE4_A_I/1UNG_6
CHE4_A_I/1UNG_7
CHE4_B_I/1_1
CHE4_B_I/1_2
CHE4_B_I/1_3
CHE4_B_I/1_4
CHE4_B_I/1_5
CHE4_B_I/1_6
CHE4_B_I/1_7
CHE4_B_I/1_8
CHE4_B_I/1_9
CHE4_B_I/1_10
CHE4_B_I/1_11
CHE4_A_II/1UNG_1
CHE4_A_II/1UNG_2
CHE4_A_II/1UNG_3
CHE4_A_II/1UNG_4
CHE4_A_II/1UNG_5
CHE4_A_II/1UNG_6
CHE4_A_II/1UNG_7
CHE4_B_II/1_1
CHE4_B_II/1_2
CHE4_B_II/1_3
CHE4_B_II/1_4
CHE4_B_II/1_5
CHE4_B_II/1_6
CHE4_B_II/1_7
CHE4_B_II/1_8
CHE4_B_II/1_9
CHE4_B_II/1_10
CHE4_B_II/1_11
CHE4_B_II/1_12
CHE4_A_III/1UNG_1
CHE4_A_III/1UNG_2
CHE4_A_III/1UNG_3
CHE4_A_III/1UNG_4
CHE4_A_III/1UNG_5
CHE4_A_III/1UNG_6
CHE4_A_III/1UNG_7
CHE4_A_III/1UNG_8
CHE4_B_III/1_1
CHE4_B_III/1_2
CHE4_B_III/1_3
CHE4_B_III/1_4
CHE4_B_III/1_5
CHE4_B_III/1_6
CHE4_B_III/1_7
CHE4_B_III/1_8
CHE4_B_III/1_9
CHE4_B_III/1_10
CHE4_B_III/1_11
CHE4_B_III/1_12
CHE4_A_IV/1UNG_1
CHE4_A_IV/1UNG_2
CHE4_A_IV/1UNG_3
CHE4_A_IV/1UNG_4
CHE4_A_IV/1UNG_5
CHE4_A_IV/1UNG_6
CHE4_A_IV/1UNG_7
CHE4_A_IV/1UNG_8
CHE4_B_IV/1_1
CHE4_B_IV/1_2
CHE4_B_IV/1_3
CHE4_B_IV/1_4
CHE4_B_IV/1_5
CHE4_B_IV/1_6
CHE4_B_IV/1_7
CHE4_B_IV/1_8
CHE4_B_IV/1_9
CHE4_B_IV/1_10
CHE4_B_IV/1_11
CHE4_B_IV/1_12

16210

16220

16230

16240

16250

16260

16270

16280

16290

16300

16310

16320

16330

16340

16350

16360

16370

16380

16390

16400

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
T. .
T. .
. . .
. . .
. . .
. . .
. . .
. . .
. T.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .

T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
. .
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
G.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .
. . .
. . .
. . .
. . .
. . .

GCA A GT ACAGCA A T CA A CCCT CA A CT A T CA CA CA T CAA CT GCA A CT CCA A A GCCA CCCCT CA CCCA CT A GGA T A CCA A CA A A CCT A CCCACCCT T A A CA GT A CA T AGT A CA T AA A GCCA T T T A CCGT ACA T A GCA CA T T A CA GT CA A A T CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CA GA T A GGGGT CCCT T GA CCA CCA T CCT

Anhang

251

............. . .. . .. ...... ... ................. . .. .... . . ..... . . ... .. . ... .. ... ... ..... ..... .. . ... ........ ... .. .... ... . . . .. ..... ... .. ..... . ... ... ...... . ..... ....... .............. ... . . .. . . . ..... . ... .. ... .......... ........ ... . ... ......... . ... .... .. . ..... ... .. . ......... . .. ... ... ...... .. .... .. .. ....... ..... ........ .... . ..... . . . ... ... ..... ... ..... . .. . .. . .. . .... .. .. .. . . ... . ... ... ... ....... ... . . ....... . .... . . ....... . ... ... ..... ........ ...... ........... ...... ....... ........ . .. . ......... ... ... ......... . .. .... . . .. ... ..... ... .... ...... ... ....... . ... . .. ... . .. .. ......... ...... ... .. .. .............. . ... .. .... . . . . ...... .... ...... .... ... ......... ... ........... ... .. ... . . ... ... . ..... ... . C. .. ............... .. ....... . . ..... .. .... ... . . ... .................. .. ....... .......... . . .... . . ... .. . ... .............. .. ................. ...... ........ .. . .... ... ............ ... ............ . .. .... ....... .. .. .......... ... . .. .. . .... ... . . ... ..... ........... . .. ......... ... .... .............. .......... .. . ..... ..... .... .... .. .. ... .. ..... .... ........ ..... ....... ...... .... ...... .. . ... .. ..... .. ....... . . ..... .. . . . ... ....... . .... .. .......... . .. ... .... ...... ... ............ .. ............... ... ............ .......... ..... . .. .. ...... .. . ..... .... ....... . . ....... ... . . ..... .... .. ...... .. ...... . C. .. ... . ........... ... . ... .. . .... ..... . ........ ........ .... . . ... .. ... . ... T .... . .... . . ... ............. .. ...... . ... .............. .... ... .. .. ...... . ... .... . ............... ... ........ .. .. . .. .... . ....... ..... . .. .. .... A... . ... ........ ... . .. . .. . ..... .. .. .. . .. ............. . . . ... ... ...... ...... . ... ... .... ......... .. ... .... .. ........ . .. .. .... .... .... . ...... .. ... . .. .... ..... . .. . .. . . ... .. .. .. .... . ........ . .. ........ . . .. ............... ... .... . ......... . . ...... .. ...... ....... .. ....... A . ...... ..... ... ..... .... ............ ...... C... ..... .... .... ... . ....... . ........ .. ... ............. .......... . ......... .... .. . .. .. .. ... ....... .... . . . . .. ...... ..... .. ... .......... .. .. . .. ............. ... .. . .. .......... ................... .. .... ............ . . . ... ...... .... . .... ............ . .... . . ........ ........ . .... ..... .. . . .. ... ........ . ...... . .. .. .. .... .. ... .. ......... ..... ........ .. . .. .. .. .. . .. . . . ......... .. .. ............ . . .. ......... ... .. .. ... . .... .... . .. . . . . . ...... ........ .. ...... .. . . . ...... .. ..... ... .. ... ... . .. ..... . . ..... . .. . .... . .. .. ..... . . . .. ....... . .... .... .... . ...... .... ..... . .... . .... ..... ........ .. ... .. .. .. ... .. . . .. . ... . ... ...... .. .. .. ...... .. ...... ... . . ..... ... .. .... ............... . ... .. . ....... .. ...... .......... .. ...... . .. .. . .. .. . .. .. ... .... .. ..... .. . .... ...... ... ....... . ... ...... ...... . ......... ... ...... ............. ....... .... . .. ... ........ ... ............... ... .... .. . .... ... . .. . ..... .... ...... ... .. ........ .......... .... ..... .. .... .... . . ... ..... ... . ..... ......... ... . . .. ........ . ... . ... .... ........ ..... . . ... ....... .. ... .... . . ... ... . . ....... . . .. ........... .. . .... ..... ... . .. .... ... . ...... . . .... . ... ...... ... . . ... .. ... . .. .... ....... .... . .. . . .. ....... . ...... .. . ..... . ......... . T. . .......... .. ... ... ... .. ... ....... ....... ..- Anhang 252 .. . ... .... .... . . ..... .. . ...... ... . . . . ........ . .. ........... .. .. ..... .... ... .... .. .... .. ... .. ... ....... .. .. . .... .. .. . ...... ....... ...... . ... ......... . ........... . .. .... .. .......... .. .. A ...... .. .. ... .. .... ...J01415 DEB1_A_I/1_1 DEB1_A_I/1_2 DEB1_A_I/1_3 DEB1_A_I/1_4 DEB1_A_I/1_5 DEB1_A_I/1_6 DEB1_A_I/1_7 DEB1_A_I/1_8 DEB1_A_I/1_9 DEB1_A_I/1_10 DEB1_A_I/1_11 DEB1_B_I/1_1 DEB1_B_I/1_2 DEB1_B_I/1_3 DEB1_B_I/1_4 DEB1_B_I/1_5 DEB1_B_I/1_6 DEB1_B_I/1_7 DEB1_B_I/1_8 DEB1_B_I/1_9 DEB1_B_I/1_10 DEB1_A_II/1UNG_1 DEB1_A_II/1UNG_2 DEB1_A_II/1UNG_3 DEB1_A_II/1UNG_4 DEB1_A_II/1UNG_5 DEB1_A_II/1UNG_6 DEB1_A_II/1UNG_7 DEB1_A_II/1UNG_8 DEB1_A_II/1UNG_9 DEB1_A_II/1UNG_10 DEB1_B_II/1_1 DEB1_B_II/1_2 DEB1_B_II/1_3 DEB1_B_II/1_4 DEB1_B_II/1_5 DEB1_B_II/1_6 DEB1_B_II/1_7 DEB1_B_II/1_8 DEB1_B_II/1_9 DEB1_B_II/1_10 DEB1_B_II/1_11 DEB1_A_III/1UNG_1 DEB1_A_III/1UNG_2 DEB1_A_III/1UNG_3 DEB1_A_III/1UNG_4 DEB1_A_III/1UNG_5 DEB1_A_III/1UNG_6 DEB1_A_III/1UNG_7 DEB1_A_III/1UNG_8 DEB1_A_III/1UNG_9 DEB1_A_III/1UNG_10 DEB1_A_III/1UNG_11 DEB1_A_III/1UNG_12 DEB1_B_III/1_1 DEB1_B_III/1_2 DEB1_B_III/1_3 DEB1_B_III/1_4 DEB1_B_III/1_5 DEB1_B_III/1_6 DEB1_B_III/1_7 DEB1_B_III/1_8 DEB1_B_III/1_9 DEB1_B_III/1_10 DEB1_B_III/1_11 DEB1_A_IV/1UNG_1 DEB1_A_IV/1UNG_2 DEB1_A_IV/1UNG_3 DEB1_A_IV/1UNG_4 DEB1_A_IV/1UNG_5 DEB1_A_IV/1UNG_6 DEB1_A_IV/1UNG_7 DEB1_A_IV/1UNG_8 DEB1_A_IV/1UNG_9 DEB1_A_IV/1UNG_10 DEB1_A_IV/1UNG_11 DEB1_B_IV/1_1 DEB1_B_IV/1_2 DEB1_B_IV/1_3 DEB1_B_IV/1_4 DEB1_B_IV/1_5 DEB1_B_IV/1_6 DEB1_B_IV/1_7 DEB1_B_IV/1_8 DEB1_B_IV/1_9 DEB1_B_IV/1_10 DEB1_B_IV/1_11 DEB1_B_IV/1_12 16000 16010 16020 16030 16040 16050 16060 16070 16080 16090 16100 16110 16120 16130 16140 16150 16160 16170 16180 16190 16200 T A A GA T T CT A A T T T A A A CT AT T CT CT GT T CT T T CA T GGGGA A GCA GA T T T GGGT A CCA CCCA AGT A T T GA CT CA CCCA T CA A CA A CCGCT A T GT A T T T CGT A CA T T A CT GCCA GCCA CCA T GA A T A T T GT ACGGT A CCA T A A A T A CT T GA CCA CCT GT A GT A CA T A A A A A CCCA A T CCA CA T CA A A A CCCCCT CCCCA T GCT T A CA A ........ ... .. . ... . ... . C. .......... .... ...... ..... ............ . .. . . . T T .... ... ..... . . ... A .... .. . .. ..... .. .... ..... ..... . . .. ..... . . . ...... . ... .. ...... ... ....... .. . .. . ......... .. . . .. .. ...... . .. .......... . ... ........... . .. .......... .... ....... .. ........ .. ..... ........ ... . . .. ......... ....... . .......... ..... ....... ..... . .... . .. . . .... ........ . .... ... . .. . .. .......... ..... .... .. ... .. .. .... . . ...... . . .. . ..... . . ........... ..... .......... . ...... ... .. .. . ... ... ... . ... T . .. .... ..... .. ..... ... ... .... . ..... . ...... ...... .. .... ... .... . .... ...... ... .. .. .. . . . . ... .... .............. . . .... ........ . . ... ...... .............. ...... . . C..... . .. ..... ..... . . ........... ...... ......... .. ........ .... ... ... ..... A .. .. . .. .... .. .. . ......................... . ............. . .. .... ............. ................... . ...... ..... .... . . ....... .. ......... .. .. . .. . .. ... ..... . .... .. ........ . ...... ..... ... . . . ... ..... ..... .. .. . ..... ..... . .... ..... .. .. .. .. ..... . . .. ........ . ....... . ... . ......... .... ... .... .. ...... ........ ... ........ . .. . . .. ........ ....... .. ... ... .. ... . ... .. .. ........ .. ............ ... .. .. ... . . . . ... .. ..... .. . . ......... . . .. .. . .......... A ... ... .. ............. .. ......... ............... .. .................. .... ........ ...... ... . .... . .. . ........ . .. . .. ..... .... C.. ..... ..... .. ....... . ................. ............ ..... ..... ... .... . .. . .. . . .... . ... .......... ... . . .. . ..... .. . .. .. ............ C.. ....... . ..... ..... .. ... .... ... . ..... . ......... . . .. . ..... ...... . .. ..... ...... ... .... . ...... ... .. .. ..... ... ... ..... ... .... ... . ......... . .... ... ..... ....... ..... ....... ... .. ... .. ... . .. ..... .. . ...... . . ... . . ..... . .......... ..... ........... . ..... . . .... .. ...... .. .... ... . ......... . . ..... . .. .... .. . ........... ... . .. . .... .. ... .. .... T T . .... . ... .... ..... . .. ... ..... .. .... .. . ... ....... .... . A .. ... ...... . . .. ... ... ....... ....... .. ....... .. .. .. . .. .. ...... ....... .... .. . ..... .... ... .... .. ..... .... .... .. .. . . ...... . .. .... ...... . ... .. .. . ... .... .... ... . ....... . .. .. ... . .. ....... ........ ...... ... ... ... ..... ... ... . . . ...... ..... .. ........ . ................ T .. .... ...... .. . .......... ... ............ ........ ... .. ......... ............. . ...... ..... .. ... . . ....... .... . . . .. ... ..... .. . ... ..... ...... ......... .. .. ... .... ... ..... .. ... ..... ..... C. . .. . .. ... .. ... ..... .. . .... .. . .... .. . . ............ .. . ... ... . . ..... . .. .. ..... . ...... ......... .... . . . ..... .. . .... .. . .... .. .... ........ . .. ...... . ........ .. ......... .. . ..... .... .................. .... .. .. .. .. ........ ..... ............ ..... . ... ... ..... ... ...... . ........ ... ....... ... .. . ... . .. .... . .. .. ... . .... .... ...... . ....... .... .. . .. . . ...... ....... .. ... .. ...... . ... .. . . ........ .. ... ... .. ..... . . ... . ... . .... ...... .. .... .... . A .. .. ........... . . ..... ..... . ... . .. ..... ........ . .... ... .................. . .. ...... ..... . . ... ... ... . ...... .... ... ..... . ... .... . ....... . ..... ..... .. ....... .. ... .. .. ... . . .... . ... .. ..... . .... T .... . .. .. ..... .... .. ..... . .. .... .. . .. .... ..... ...... . .. .... . ...... ...... .. .. .... ... ... ....... .. ..... .. . ...... .... .... . .. . ... ... . . ..... .... ........ .. ............. ... .. ..... .. . . .. .... ... ... . ... ... ...... .... ...... ....... .. . .. ..... .. .... .... .... .. . ... . .. . .... . . ... . ...... . ..... . ..... .. ............ ... ........ .. ..... .... . .. .. ...... .. ... ....... ............ .. .. . .. ... ...... .. . ......... .. . .... ... .. ........... ....... . ...... ... . .. . . ... ... . .......... .. . .......... ... .. . ............ .... .. .......... . ... ... ... ..... ... ... ......... ....... . . ....... . .. ..... ...... .. . ... .. .... .... . ........ .. ........ ....... ...... ........... ... . .. ..... ... . ..... .. . . .. .... .................. . . ............... ... ..... . . .... . .... ... . ....... ..... .. ... . .. ......... . ... ........ ... ... ... . . .... .. ..... ...... A ... . ... ....... . . . .. ....... ..... ..... ..... .. .. . ... ..... .. .. .. ... .. .. ..... . ............ . . .. ... .. ......... . .. ... .. . ...... .... .... C.... .. A ........... .. ....... . .. .. . ...... . ... ........ .... . ................ ..... .... .... ..... ......... ... ... . .. .... . .. . ..... .. . . . ......... .... .. ....... ...... .. . ...... . .. .. . . . ... .... . ..... . .... .... . .. . .. .. .. . T .... ... ..... . .. ... ... ...... ...... ....... ..... . ........ .. .. .......... . .......... .. . .. . .. ........... .. . .... .. .. .. .... ...... ..... .. ....... . . .... ..... ... ... . .... ... .. .... .. . . ... . .. . ........ ... ..... . . .... ... .. .. ........ . .. . .............. ...... .. .. ..... . ... . . ..... . . ............. ........... .. ... .. . .... .......... ..... . .. .. ... ... .. ... .. ...... .... . ... ...... ...... A . .. ...... ... ... . .... . ... .. . .. A .. .. . .......... . .... . . . .. . . ... . ... . . . ... .... . ....... .. ..... ........... .. ..... .... . .... ............ ... ...... ... . .. ... .............. ... . . ... ... . .... .. .... . ... ....... ... .. .. . . ... ....... .. ... ..... . ...... .... ... . . ..... .... .. .. ..... . .... .. .... .......... ... . ... . . .. .. .. ..... ....... ..... ....... . ........ ......... ... ... .... .. . .. .......... .. .. .. . . ... . .... .... .... . ...... .. . ..... . ..... .. ..... ..... ... .. C.. .... . . . ....... . .. . .. .... ... .. . ... ....... .. .. .. .. ...... .. ..... . .................... ... .... ... . ...... .. ........ .. . . . ....... ......... ...... ...... . A ..... . . ...... . ....... .. . .. .. ... .. ......... .. .... ..... . ...... ... ..... ... . . .. .. .. ..... . . . ....... ... . ... . ......... .. .. . . .. A ......... ... .... .. . . ... .. . .. ........ .... .......... .......... A . .... .. . . . ............... ....... ... ..... . . ... .. .. . ... ... .... .... ........ .. ... . ...... ........... .... .. .. . . .......... .... ..... .. ........ .. . ... . . .... . .......... .... ... . ...... .. . . .. ... ...... ..... .. . ...... . ...... . ...... ... ........... .. . ..... . .. .. .. ............ ........ . . . . ... ... A . . . ..... ... ... T .. . . .... . . ...... . .. . .. . . .. . ........ ... ..... ... ........ . ..... . ...... ........ ...... ... .... . .. .. . .. .. . ............ . . .. .... ... .. . ... ..... .... .... . .. . .. . .. .............. . ..... .... . ..... . ........... ........ . ..... ... .... .. . ................ .. . ... ........... ........... .. . ................. . .... . ... ...... .. .. .. ....... ..... ............. . ... ..... ....... .. . .. ... .. . . .. .... .. .. ... .. . . .. . ... .. . ....... . .. .... .. ... .. ....... . ... ...... ........ ... . . ......... ..... . .... .... .. ... ... . . ... .... . ... . ... ... . .... .. .. . .. . ... . .. ... ........ .... .... ....... ...... . .... . . . . A......... . .... ... . ........ ... ... .... ... ..... . . ... .... ...... .. . .. .... .......... .... .... . .. . ... . ...... .... ... .. ... .. ..... ... ... ... ...... ..... .. . . .. . . . ... . ... .... . .. . ..... .. .......... . ....... ... ... .. . . ....... . . ..... . ... ..... . ....... .. . .......... .. ........ .... ....... .. ....... .. .... ... .... ..... .. ..... ... ... .... .... . .. ................. .. ... A... .. ...... . ........ . ........ .... . ............. ..... A.. ... . ... . .. ....... .. .. .......... ... . . . ... ...... ... ... .... .... . .... .. . .......... . . ............. . .. .. .... .. ... ....... . .. .... .. ..... ....... .. . . ..... .... ........ .. ....... ... . .... . .. .... ... ..... .... . . ...... ................ ...... ........ . .... ... .. ..... ...... .... . ... .. . . .. ... .. .. . ......... .... . ..... . A .... . ... .. .... ... .. ... . .......... ... . ... ... .. . .. ....... ...... ...... .... . . ... ...... .. .. ....... . . ......... ... ...... ........ ...... . ... ..... .. ....... . .... .. . . .... ... .... .. ............... . ... . . ..... ... ... ..... .. .... . .. . ......... . . .... . ...... .. ... .. ........ ... ................ . .. . ... ............... . . .. ............ . .. . .... ...... ... ... ............. . ...... ...... ......... . ..... ............ .......... .. .. ...... . . . .. ... . . .. .. ....... . .. . . ... ....... . . . . ... ............... .. .. . ..... .. .... .... .... ...... ...... .. . ...... .. .. . ......... ........... ....... ...... ...... . .. . . ... . .. ... .. ............ .. ..... .... . . ... .... .. ...... ....... .. ..... ........... ... .. . ........ ....... . ......... . .. . . ........ .................. .. ....... .... .. . ... ......... ..... .. ....... ... ... . ........... .... .. ...... ... . .................. ............ .... ............ ... ... . ... . .. ....... ..... . ... . ... . T . . . ...... .... .. .. ......... .. . . .. ....... .... ... . .... ... ..... .. . ..... .. . .... ... . ... ..... . ... ... .. . . .... .. .... .............. .. ........ .. .. .. ... ... .... . .. ......... .......... .... .. ........ .. ............ ........... .... . . . .. ..... ... . .... A. ...... .... .. ..... . ............. .. . . .. .. .. ............ . A ... .. ............... ......... ..... ...... ..... ..... . . .. .... . ........... ... . .... ....... .......... .. ..... ... . ... ....... ... ........ .. . ......... ... . . ........ . ...... .... ... .. ... .. . . .... . . . .............. .... .. ..... . ..... .. . ... ... .. ... .. . ..... .... .... ... .. ...... .. ........... ... ..... ... . . ....... ..... ... .. .. . ..... . ... . .. ......... .. ... ... ..... . ... ... ....... ....... . .... ........... .. ... .. .. . . ...... .. . .... ..... ... . ........ .. ....... .. . ......... . ... ..... .......... . ... .. ... . ..... .. A... ... . ..... . . .... .. ...... . . .. .... ........ ..... . .... . .... .. .... .. .......... ..... ....... .......... . . . .... .............. ..... ..... .... . ............................. ........ .. ...... .. ..... ....... .. ...... . ... ... . . .. . .. . . .... .. . .. . ............... .. ...... . ... ... .. . .. . ...... .. .. .. ....... .. .... . .......... ..... . . . ........ ........ ... . .............. . . ... .. . . . . ...... ... . .... ...... . ... . ..... A . .... .......... . .............. .... .... ... . . ... ... .... .. .. . .. ........ .. .. .. .... . ... . .. ...... ... .... .. . . ......... . ....... C... . . ....... . .......... .. .... . ... ....... . . ..... ..... . . .... . .... .... ........ .. ... .. .. .. .. ... .... ...... . .... .. ... ... .. .. . .. .. ...... . .. . .... .. ...... ... . .. . ... . . ... .. .. ........ ........ . ....... ... . .. ........ . ......... ...... ....................... .. .. .. ........ .......... . ..... .... ..... .... .... ... .. .. .. . .. .... ..... ... .... ........ . ...... ... . . ... . ....... ... ......... ..... ....... ... ................ . ... . ........ . . ..... . . . ....... ........ ..... .. ......... . ..... ............. ... . .... ............ . C.. .... . . . . . .. ...... .. ...... .. ... . .. . . .. .. .. ... ...... C.. .. ...... .. . . . . . .... . .. . .... ... .... ..... .... ...... . . .... .. ....... . . ........ .... .. ...... .. .. .... .... .. ..... .. ... .... ... ....... ... ... .. .. .. .. . .. ....... .. ....... .... ................ .... ... . C. ......... . . ... ... .... ......... ............. . .. ...... . . .. . ... . .... ................... . .. ........... .. .... ... ... ....... . ... ..... .. .. ........... ..... .. .. ... . ... .. .. ......... ............. .... .............. .. . . ..... ..... . .... . . ..... ................. ......... ... ... .... ..... .. .. .... .. ... ... .. . . .. ........ .... . ... .... ... . . .. . .... .............. . ....... ....... . ....... ... .. .... . ... . . .... .... . ........ ... . . .. . .. . .. ... ... ... .... ... ........ .. . .......... . ... . ..... ........ .... .. . . . .. .......... . .... ............ .. . . . .. . .... .. ... .... . ... ..... ...... .... ... ........... ...... . . . ..... .. ..... ...... ... . .... ... ... ............ ... ... ...... ..... ... . ... . . ..... ..... . ... . .. ......... . . . T.......... . ..... .. ....... ........ .. . . ..... .. . ..... .. ..... . ... . .... .. ... . . . . . ... ... .. ....... .. . ......... .. ... . ... ..... ..... ... . . ....... . .... ... . .. ... . ... ..... .... .. ... ... .. . ...... .... . . .......... ... . . ..... . .. ...... ... . A . . ... .... . .. ... .. . . ..... . .... .. .. ........ . .. . . .. ...... ... .. .. .. ... .............. . .. . ... .... ..... . . ..... . .. ... ..... .. ... ............ .. ............... . .... . T....... ......... .. .... ........... . ...... . .. A.. ......... .. . .. ........ ... ..... .. .... ....... . . .. .. . .... ... .... ......... ..... ...... .. . . ........ ........ .. . .. ... ...... .. .. ... .. ... ....... ....... . ... . .. .. .. .. .. ...... .... .... ......... . . ......... . ...... ... ........ .. ... ........ ..... ....... ... . .... ... ... . . ... .... ......... .... . . . T ........... ...... ... ....... .. .. ..... .. .. ... .... ..... C.. .. .. . .. ..... .... . .. ... . .... . . .... .... .... ... ... . ... .... . ...... ........ .. ...... ........... .. ................. .. .... ...... .. . ..... ... ... .. ... ..... . ... ..... .... ... ..... .... ...... . . . .. . . .. . .. ............. ... . . . ... .... ... . .. . .. ...... . ... .... .... ... ..... ........ .............. .... .. ........ .... .... .... ... . .. A ........ . .... ..... ....... . ..... .. .. .... .... ...... ..... C.. . ... ... .... . ... ............. ... C.. .... ... .. ...... . . . .. .. ......... ... ... ..... ... ......... .. ... .... . . . .. .... . .... .... ... . .. ......... . ....... . ................ . . ... . .. . . . ........ .. . .. ..... ... .. .... .. ............. .. . ... ........ .. ......... ...... .... .... ... . .. .... ...... .... ... ... .... ..... ....... ...... .. .... ...... . .............. . .. . . ....... .... ... C. . .. . ..... ........ ..... . ............ ..... .. ............... .. . . . . . .... ... . .... . . .. ... . . ..... . ................ .. .......... . .. .. ............ . .. ... ..... C... ... . . A . .... ... .. ...... .............. .. . ... .... . ... .... .. .. ............ ....... .. .. .. . . ......... .. . .. .......... ..... ..... . ... ... .. .. . .. ..... .. . .. .. ..... .... .... . . . . ... ...... ... ...... .... .. .. ... .... .... . . .. ..... C............... . ... .. . . ...... . ... . ... ..... ... .. ....... . . ..... .... ........ ........ .... .. . . .... .. .. . .... .............. ........ . .. .... . .... .. .... ... .. . .. .. ...... .... ........ . .. ...... . .. . . . ........... ... . .... .... C.... ...... .. ..... ... . . . ... ...... .. .... ... ........ . ... .. .................. .. .. ....... . ... .. .......... ... . ........... ... .. .. .. .. .. . ... . ... ..... ..... .. . . .... ... . . .... ....... .. ...... .. . .. .... . . .... . ... ... ... .... . ....... . ..... ..... A .. ........ ........ .. . ... . .. . .. .. .... . ........... .. .. ... ...... ... .. ....... ....... . T. . ........ ........ ... ..... ......... . . ... . . . A ..... ... . ... .... ................ . . C. ...... . ... . ........ ...... ... ... A... . ... .. .. . ... ... .. . ....... ... .. .......... ...... ... ... ..... . . ........ ... . .................... .... ....... . .. ........ . .. .. ... .......... ........ .. . .. .... ...... .... . ... . ................ . . .. . ... ... . ........ . ........ ..... . .. . .. .. . .... ..... ........ ... ............... .. ... . . .. ... ............ ..... .. .. . . .......... .. .. .. .... ... .. ................ ... .. ....... ... .. .... .. . ....... .. .... . ...... .. . . ........ . .. .. .... ..... . .... .. .... .... .......... ... .. .. .. ...... ........ .... .... ..... ..... .. .... ........ . ........ . .. . .. .. .. ........ ...... ..... . ... . A ... . ... ...... . . .. ... . .. ..... . ....... ....... ... . ... ......... ... . ..... .... . ..... . ..... . . . ....... .... . .... ..... . ...... .... ... .. .... ........... .. .... . .... ....... .. .... .. . .. .. .... ... .. . ...... ...... ... ... . ........ . ....... .. ... .......... .... ..... .. . .... ... C.. ......... . .. ............. . .... ...... .. .. .... ... ..... ... .. . . ........ . A... .. . ....... ... ....... ..... .. . .. .. .. ........... ..... . ... . T.. ... . ................. ............. .. .. ........ .. .... .... ... ... .... .... ........ ........ . ....... .... ......... . ......... .. .. . .. . ... . . .......... . ... . . ... ........ .... . .. .. .. . .. ... . ..... . .. . ... . ... ...... ....... . A........ . ..... ......... ... .... .. ......... ........ ..... .. .. .. . . . . ... ...... .. . ......... .............. ..... ... . ........ .. ........... .. ....... . .

. . . . . . .. . . . . . ..- . . . T. . . . . . . .. .. . .. . . . . . . . . . . . . . . . . . . - . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . .. . . . . . . . . . . . - . . . . . . .. . . T. . . . . . .. . . . . . . . .. T. . . . . . . . . . . . . . . . . . . T. . . . . . . .. . . . . . . . . .. . . . . .. . . . . . .. . . . . . . . . . . . . . . . . . .. . . . . . . . . .- . . . . .- . . . . . . . . . . . T.. . . . . . . .. . . . . . . . T. .. . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . . . . .. . . . . T. . . . . T. . . . . . . . . . . . .. . . . . . . . . . . .. . . . . ... . . . . . . . . . . . . . . T. . . . . . - . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . - . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . T.. . .. .. . T. . . .. . . . . . . . . . . . . . . . ... . . . . . . .. . . . . . T. . .. . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . .. . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . . . . T. . . . . .. . . . T.. . . . . . . . . . . . . . . . . .. .. . . . . . . . . . - . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . ... . . . . . . . . . . . . . T. . . . . . . . .. . . . . . . . . . . . . . . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . .- T. . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . .. - . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . - . . - . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . - . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . T. .. - . . . T.. . . .. . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . - . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . .. . . . . - . . - . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . T. . . .- . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . .. . . .. . . .. . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . .. . . . . . . . . . T. . . . . . . . . . . .. . . . . . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . T. . . . . . ... . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . - . . . . . . . . . . - . . . . . . . . . . . . . . . . . . .. . .. . . . . .. . . . .. . . . . .- . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . .. . . . - . .. . T. .. . . . T. . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . .. . . . T. . . . .. . . . . . . . . . . . . . . .. . . . . . . T. . . . . . . . . . . . - T. . . . . . . . . . ... . . T. . . . . T. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . .. . . . .. . . . . . . . . . . . . . . . . . . .. . . TT. . . . T. . . .. . . . . . . . . .. . . . . . . . . . . . . . . . . . .. .. . . . . T. . A. .. . . . . . . . . .. . . . . . . . . . . . . . . . . . T. . . . ... . T. .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . .. . . . . . . . T. . . . .. . . . . . . . . . . . . . - . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . - . . . . . . . . . . T. . .. . . . . . . . . T. . - . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . T. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . - . . . . . . . . . . . . - . . . T. . . . . . . . . . . . . . . . . . . . . . . . T.. T. . . .. . . . . . .. . . . . . . . . . . . . .. . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . .- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . T. . . .. . . - . . . . . .. .. . . . .. . . . . . . . . . . . . . . . . . . . T. .. . . . . . . . . . . . .. . . . . . . .- . . . . . .. . . . . . . . . . . . T. . . . . .. . . . .. . . . . . . . .. . .. . . . . . . . . - . . - . . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . ... . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . T. . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . - . . - . . . . . . . . . . . . . . . . . . . - . . . T. . . . - . . . . . . . . . . . . . . . . .. . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . .. . . . . . . . . . . .. . . . . . . . . .. . . . . .. .. . . . . . . . . . . . . . .- . . . . . . . . . . . . . . . . . .. .. . .- . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. .. . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . .- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . .. .. . . . . . .- . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. - . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . - . . . . . G. .. . . . . . . . . . . . T. . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . - . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . - . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . .. . . . . . . . . .. . . .. . . .. . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . .. . . . . . . . . . . . . . . . T. . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . T. . . . . . . . . . . T. . . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . .. . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . T. . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . .. T. .. . . . . - . . . . . . . . . . . . . . . - . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . .. T. . . . . . . . . . . . .. . . . . . . . . . . . - . . . . T. . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. . T.. . . . . . . . . . . . . . . . T. . . . .. . . . . . . . . . . . . . . . . . . . . .. .. . . . . . . T. . . . . . . . .. . . . . . . . . . . . . . . . . . . T. . . . . .. . . . . . . . . . . . . . . . . . . . - . . . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T T.- . . . . . . . . .. T. . . - . . .. . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - .. T.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . .. . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. - . . . . . . . . . . . . . T. . . . . . . .. . . . . .. . . . . . . . . . . . T. . T. . .. .. . . . . . . . . . . . . . . . . . . . . . . .. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . GCA A GT A CA GCAA T CA A CCCT CA A CT A T CA CA CA T CAA CT GCA A CT CCA A A GCCA CCCCT CA CCCA CT A GGA T A CCA A CA A A CCT A CCCA CCCT T A ACA GT A CA T A GT A CA T A AA GCCA T T T A CCGT A CA T A GCA CA T T ACA GT CA A AT CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CA GA T A GGGGT CCCT T GA CCACCA T CCT Anhang 253 . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . ... . .. . . . . . .. . . . . . . . . . . . . . . . .. .. . . . . . . . . .. T.. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . .. . . . . . . . . . . . .. . . T. . . . .. . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . .. . . . . . . . T. . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . T. . . . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . - . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . .J01415 DEB1_A_I/1_1 DEB1_A_I/1_2 DEB1_A_I/1_3 DEB1_A_I/1_4 DEB1_A_I/1_5 DEB1_A_I/1_6 DEB1_A_I/1_7 DEB1_A_I/1_8 DEB1_A_I/1_9 DEB1_A_I/1_10 DEB1_A_I/1_11 DEB1_B_I/1_1 DEB1_B_I/1_2 DEB1_B_I/1_3 DEB1_B_I/1_4 DEB1_B_I/1_5 DEB1_B_I/1_6 DEB1_B_I/1_7 DEB1_B_I/1_8 DEB1_B_I/1_9 DEB1_B_I/1_10 DEB1_A_II/1UNG_1 DEB1_A_II/1UNG_2 DEB1_A_II/1UNG_3 DEB1_A_II/1UNG_4 DEB1_A_II/1UNG_5 DEB1_A_II/1UNG_6 DEB1_A_II/1UNG_7 DEB1_A_II/1UNG_8 DEB1_A_II/1UNG_9 DEB1_A_II/1UNG_10 DEB1_B_II/1_1 DEB1_B_II/1_2 DEB1_B_II/1_3 DEB1_B_II/1_4 DEB1_B_II/1_5 DEB1_B_II/1_6 DEB1_B_II/1_7 DEB1_B_II/1_8 DEB1_B_II/1_9 DEB1_B_II/1_10 DEB1_B_II/1_11 DEB1_A_III/1UNG_1 DEB1_A_III/1UNG_2 DEB1_A_III/1UNG_3 DEB1_A_III/1UNG_4 DEB1_A_III/1UNG_5 DEB1_A_III/1UNG_6 DEB1_A_III/1UNG_7 DEB1_A_III/1UNG_8 DEB1_A_III/1UNG_9 DEB1_A_III/1UNG_10 DEB1_A_III/1UNG_11 DEB1_A_III/1UNG_12 DEB1_B_III/1_1 DEB1_B_III/1_2 DEB1_B_III/1_3 DEB1_B_III/1_4 DEB1_B_III/1_5 DEB1_B_III/1_6 DEB1_B_III/1_7 DEB1_B_III/1_8 DEB1_B_III/1_9 DEB1_B_III/1_10 DEB1_B_III/1_11 DEB1_A_IV/1UNG_1 DEB1_A_IV/1UNG_2 DEB1_A_IV/1UNG_3 DEB1_A_IV/1UNG_4 DEB1_A_IV/1UNG_5 DEB1_A_IV/1UNG_6 DEB1_A_IV/1UNG_7 DEB1_A_IV/1UNG_8 DEB1_A_IV/1UNG_9 DEB1_A_IV/1UNG_10 DEB1_A_IV/1UNG_11 DEB1_B_IV/1_1 DEB1_B_IV/1_2 DEB1_B_IV/1_3 DEB1_B_IV/1_4 DEB1_B_IV/1_5 DEB1_B_IV/1_6 DEB1_B_IV/1_7 DEB1_B_IV/1_8 DEB1_B_IV/1_9 DEB1_B_IV/1_10 DEB1_B_IV/1_11 DEB1_B_IV/1_12 16210 16220 16230 16240 16250 16260 16270 16280 16290 16300 16310 16320 16330 16340 16350 16360 16370 16380 16390 16400 . . . . . . . . . T. . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . .. . . T. . . . . . . . . .. . . .. . . . . . . . . . - . .. . . . . . . . . T. . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . TT.. . .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . - . . . . . . . . T. T. . . . . . . . . .. . . . . . . . - . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . T.. . . . . . . . . . . . . T. . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . T. . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . T. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . T. . . . . . . .. . . . . . .. . . C. . . . . . . . . . . . . . . . . . . .. .. . . . .. . .

. . ... . .. ...... ................. . ..... ... . ......... ............ ...... . . ... .. ..... ..... ....... ..... .. ............... .......... ...... ... . .... ...... ..... .. .. . ..... ...... .. . ... .... .... ..... .. ....... ..... ... ....... .. ..... .. . . .. ... ... ....... ... .. .. ... .... ..... . ... ... . . ..... .. ...... ....... .. .......... .... ..... .... .. ......... .... . .......... . . . .. .... ...... .. . . . . ........ ..... . ........ .. .... . .. .............. ...... . ... . . . ... ..... .... ...... .. .............. . . . .... . ..... .... .......... .. . ... .. . .. ............ ... .. ..... .. ........ ...... .......... . ...... ......... .... ........ .. . ..... ... . ................... .. ...... ...... ... . ................. .. .... ... ....... .... ....... .......... . ........... ...... .... ...................... . .. .. C............ ..... ......... ....... ... .. .. . ..... ... ..... ... .... ...... .. ... .. . . ......... .. . . ... .............. ......... .. ......... .. ... ... . ..... ....... . . . ........ .. ....... ............. ... .. .. ............ ....... .. ... . ...... .... ... . ..... . ...... ... .... .. ................... . .... ... . ............. .... ... . .. ... ... . .. ...... ..... .. .. .. ... ..... ........ .. . . .... ... . .. . ... .. ... .... ......... ..... ... ... ......... .... ... ....... . .. .. . ...... ...... ....... . ... ......... ... .. . .... . .... ........... .... .......... .... . ...... .. ....... ..... . . . .. .. .... . .... ..... .... . . .... ..... ....... ........... .. ...... . ......... ..... ........ .. . .......... .... ........... ............ ........ . ........... .... ...... . . ...... . ......... . .. ............... .. ..... . ..... ..... .... .. ...... ..... ............. ...... .. . ..... .. . .. ... .... ... .. .. .... ..... .. . . ..... . ..... . ... .... . .... .. .. ..... ....... .................... .. . TT. ...... . . .... .... ........... . . . .. .. . .... . ...... .... .. . .... . ... .. ..... .... .. .......... ... ................. .... ..... .. .... ... . . ... ...... .. . . ........ ..... .. . ..... ... ...... .. .. ..... ... ..... ............ .... .. ............. ..... ........... .. ... .. ....... .. . .. ........ ....... ....... .... ......... . T.... ....... ........ .... ...... ..... ...... ... .. ..... ..... ..... ... ........ . ... . .. .. . .. ... ......... .... . ....... ...... ............. ....... .... . . . .. .. ... ....... .... ... .. .. ... . ...... ..... ........ .. .... . ... . ................ .... .... . ......... . ....... .. . .... ...... ..... . ... . ............ .... . ...... ........... . ... .... ............... . ..... ... .. .. .. . ... ...................... .... . . ...... . .. .. ... .. . . ...... .......... .... ... .......... . . ... .... . ............ .......... C................. .. ....... . ... . .... ...... ... .. .... ...... . . ... ..... .. .. .......... ............... ...... .. ...... .... . . ... ....... ........ ..... ... .. ... . .. . . . .. ........ ...... . . ......... . .. .. ... .... .. ...... . . . . . ..... .. . . . ... ... .... .... . ....... . ............. ...... ........ . .............. ......... . ........ ...... .... . ............ ....... .... . .. . . ......... .. . . .......... ... . ... . .......... . ... ... ... . .... . .. . ... ..... ......... .... ..... .... . . ..... ..... . .. . ..... ............ ............. ... ... ..... ........ . ...... ...... .... ........ .... .... ..... . ..... . .... ..... .......... ..... . .. .... .............. .... ........ .. ... ..... . ......... ... ... .. ... . ... .. ...... ...... ......... . .. ........ ..... .. .... ... .............. ...... . .... .. ... .. ..... T ... ............. . ...... .... .......... ... .. ... . . .......... T. ... ...... . . . . ......... . .... .. . .......... .... . . . . .... . ..... ... .... ..... . ... .............. ... .. .. ...... ..... ... .. . .. ..... ... ... ..... .... . . ... .. ... ... ... . .... . . .. .... . ... . ..... .... ...... ..... .. .... ........... .. ... . ... ...... . .. ................ ... ......... ...... . .. .... . . ... .... . ...... ... . ... ........ ...... .... .. .. .............. . . . ...... . .. .......... ........... . .... . ........ ... ..... .. .... .... .. .. ..... . . ...... ... ...... .. .... ...... ... .... .. .. ....... .......... .. ... .. .... ... .... ... ... ...... . . .. .... C..... ... ........ .. .... ....... .. .. . ...... . ...... . .. ................... . . .......... ... ............ .. .. .. .. .. . .............. ... ... .. .. . ... ..... . .. ... .... ........ . .. .......... . ..... .......... ... ......... ......... . . . .. ........... ... .. .... ..... ... .. .. .. T... ...... .. . .... .... ....... ... . ........ .... . ........ ... ......... .. ... . ....................... ...... ........ ..... ......... . .............. .. .. .. .............. .... . .... .. .. T... . ... .... .... .. ......... .. .. ............... ....... ... ....... ... .. ........ ... ..... . .... .... . .... .. . C.. .... ... ... . A .. . ..... .... ......... .... ....... . ... .. . .. ... ....... .... ... . ...... .......... . . .. . ...... ... .. .. ...... ...... ......... ........... . . .. .. ..... .. . .... . ... ...... . . .. . ...... ........... .... .... ..... ... .. . .. . .. ....... .. .. ........ .. ... . ... .. .. . .. ... ........ .. ....... .. .... . . .... .... ..... . . . ..... ... . ............ .... .. ........... ... .. ...... ... .. ...... ... . ..... . ..... .. ...... ..... . ... .. ...... ........ ... .............. .... ... ... .. ..... ... .. . .. .. .......... .... ....... . . ........... ......... ... ..................... ... .... .... ............... . . . .... ......... . .. ........ .... ..... ........ ........ ..... ....... TT..... ........ ....... . .... ... .. .... . ..... ... ...... . .... . .. .... .. .. ......... .. ... ... ... . ......... .... ..... .... .. ...... .. . .. .... .... . ... . ... ..... . ... ....... . .. ... ...... ..... .. ..... ... ....... .......... ... ...... ................. . . ...... ...... . ..... .. .. ........ ...... . ... .. ... .... .. . .... .... .... ......... ..... . .. ....... ....... .... .. . .... ......... ... ..... . ..... ......... . ... ..... . . ........ ...... .... . .. .. ......... . ........ .... .... . ..... ........ ....... ...... ....... . ... ..... ... .. ... .. .... . .. .................. .. .... .......... ..... .. . ............ .. .... .......... .. ............... .... T.... ... ........... ..... . . ........... ..... . ....... ..... ...... ... .... . .... .... .. ......... ... .... ....... .. . ... ... ........ .. .... ........ ... . ....... ............ ... . . ...... ........... ... ...... . ...... . ...... . . .. .. ........ .. .. ...... . ... .. . .. ....... C...... ....... . ... .... . .... . ... ................. .......... . . ... .... . ...... . . ... ... ... ... ... .. . . . ... . ....... ... .. ..... . . .. .. .. ... ..... ... .. ................ .. ... .... .... ... .......... ..... .. .. .. . . ....... .. . . .. . ... . .. .. ......... .. ... ..... . . .... ...... ..... .. .. ............ . .. ...... .. . .. ............. ............... .. . .. .... .... .. . .. ..... .. .. . ....... .... . .... .. ....... ...... .. .......... C. .... .. .... . .. .... . . ..... .... ..... .... ... ....... ..... ....... . ... . . . . .. ... . . .... .... ..... ... ...... .. . ...... .... .. ....... ... ... ..J01415 DEB2_A_I/1_1 DEB2_A_I/1_2 DEB2_A_I/1_3 DEB2_A_I/1_4 DEB2_A_I/1_5 DEB2_A_I/1_6 DEB2_A_I/1_7 DEB2_A_I/1_8 DEB2_A_I/1_9 DEB2_A_I/1_10 DEB2_A_I/1_11 DEB2_A_I/1_12 DEB2_B_I/1_1 DEB2_B_I/1_2 DEB2_B_I/1_3 DEB2_B_I/1_4 DEB2_B_I/1_5 DEB2_B_I/1_6 DEB2_B_I/1_7 DEB2_B_I/1_8 DEB2_B_I/1_9 DEB2_B_I/1_10 DEB2_B_I/1_11 DEB2_A_II/1UNG_1 DEB2_A_II/1UNG_2 DEB2_A_II/1UNG_3 DEB2_A_II/1UNG_4 DEB2_A_II/1UNG_5 DEB2_A_II/1UNG_6 DEB2_A_II/1UNG_7 DEB2_A_II/1UNG_8 DEB2_A_II/1UNG_9 DEB2_A_II/1UNG_10 DEB2_A_II/1UNG_11 DEB2_A_II/1UNG_12 DEB2_A_II/2_1 DEB2_A_II/2_2 DEB2_A_II/2_3 DEB2_A_II/2_4 DEB2_A_II/2_5 DEB2_B_II/1_1 DEB2_B_II/1_2 DEB2_B_II/1_3 DEB2_B_II/1_4 DEB2_B_II/1_5 DEB2_B_II/1_6 DEB2_B_II/1_7 DEB2_B_II/1_8 DEB2_B_II/1_9 DEB2_B_II/1_10 DEB2_B_II/1_11 DEB2_B_II/1_12 DEB2_A_III/1UNG_1 DEB2_A_III/1UNG_2 DEB2_A_III/1UNG_3 DEB2_A_III/1UNG_4 DEB2_A_III/1UNG_5 DEB2_A_III/1UNG_6 DEB2_A_III/1UNG_7 DEB2_A_III/1UNG_8 DEB2_A_III/1UNG_9 DEB2_A_III/1UNG_10 DEB2_A_III/1UNG_11 DEB2_A_III/1UNG_12 DEB2_A_III/2_1 DEB2_A_III/2_2 DEB2_A_III/2_3 DEB2_A_III/2_4 DEB2_A_III/2_5 DEB2_A_III/2_6 DEB2_A_III/2_7 DEB2_B_III/1_1 DEB2_B_III/1_2 DEB2_B_III/1_3 DEB2_B_III/1_4 DEB2_B_III/1_5 DEB2_B_III/1_6 DEB2_B_III/1_7 DEB2_B_III/1_8 DEB2_B_III/1_9 DEB2_B_III/1_10 DEB2_B_III/1_11 DEB2_B_III/1_12 DEB2_A_IV/1UNG_1 DEB2_A_IV/1UNG_2 DEB2_A_IV/1UNG_3 DEB2_A_IV/1UNG_4 DEB2_A_IV/1UNG_5 DEB2_A_IV/1UNG_6 DEB2_A_IV/1UNG_7 DEB2_A_IV/1UNG_8 DEB2_A_IV/1UNG_9 DEB2_A_IV/1UNG_10 DEB2_A_IV/1UNG_11 DEB2_A_IV/1UNG_12 DEB2_A_IV/2_1 DEB2_A_IV/2_2 DEB2_A_IV/2_3 DEB2_A_IV/2_4 DEB2_A_IV/2_5 DEB2_A_IV/2_6 DEB2_A_IV/2_7 DEB2_A_IV/2_8 DEB2_B_IV/1_1 DEB2_B_IV/1_2 DEB2_B_IV/1_3 DEB2_B_IV/1_4 DEB2_B_IV/1_5 DEB2_B_IV/1_6 DEB2_B_IV/1_7 DEB2_B_IV/1_8 DEB2_B_IV/1_9 DEB2_B_IV/1_10 DEB2_B_IV/1_11 16000 16010 16020 16030 16040 16050 16060 16070 16080 16090 16100 16110 16120 16130 16140 16150 16160 16170 16180 16190 16200 T A A GA T T CT A A T T T A A A CT A T T CT CT GT T CT T T CAT GGGGA AGCA GA T T T GGGT A CCA CCCA A GT A T T GA CT CA CCCAT CA A CA ACCGCT A T GT A T T T CGT A CA T T A CT GCCAGCCA CCAT GA A T A T T GT A CGGT A CCA T A AA T A CT T GA CCA CCT GT A GT A CA T A A A A ACCCA A T CCA CA T CAA A A CCCCCT CCCCA T GCT T A CAA ...... . ... ......... . .. . ..... .. .. . ..... ......... . ........... ... .... .. .... .. .. . ... .... .. .. .. A .. ....... .. .... ....... .... ..... .. ...... ... .... ....... ........ ........ . ....... .. . ....... ... . ......... .... . ... .. . . .. ... ... .. . ...... ... . . . . ..... .... .... .... . . ......... ....... .............. ....... .................. . .. .. ..... ... .. ........... ...... ..... ... .. . ... .. . . .. ...... ... .. ..... ...... .. . ......... ..... .... ...... . .... .. ...... .... . ... . . ... . . . . ........ .. ... ..... . . . . ........ . ........ ..... .. ... ........ ...... .... ..... . . ... . ... ........ . ....... . .... ...... ..... ......... . .. . ........... ........ .. .. .. .. . ... ...... . ........ .......... ........ ........ ...... .. ....... . .. . ......... . .... .... .. .. .... ...... .... ....... ..... ...... .... .. ... A.. ........... . . . ..... .... .. . .. ....... .... . ... . . ...... .............. ......... .... . .......... . ..... . ... . .. .... ..... .. ..... .. ............. . ................... .. .... ..... . ................ ... . .. .... . ....... .......... .... .... ... .. ...... . . ..... ..... . ............ .... ....... . .. ... .... ............. . . .. . . ....... . .... .... ....... .... ..... .. ... . .. ....... ..... .... . ........ ........ .. .. .. ... .. . .. ..... ... ......... ...... ........... .. .... ....... .... ........ ........ . . .. ... . ......... .... ....... .... . .... . .... TT.. .. ... . .. ... ... ............ .. .. .. .... . . .... ............. ..... ..... ........................ ..... .. . ........... .... .. . . . ... T. ....... . .... ......... ........ ........... .. . . .... . ....... .... .. .. .. . . . .. .. ........ ... ....... ... . ..... .. . ....... .... .. ....... ........ ........ . .......... .... ....... .... . ... ....................... .... ..... .. .. . .. ... ..... .. .. ..... ..... ... ... .. . . ......... ....... ... ....... .. .. ............................... .. .. ....... ..... ... ..... ... . . . ........ .......... . ... ... ..... .. .. . .... ... ........... ....... . .... ... . .......... ..... .............. ...... ........ . ... .... .. ......... .... ...... . ......... . . . ....... .......... . .... . .... ....... . ........ .. .. ......... ... ... .... . ...... .. ... .... ... . . .... . ........ .............. ... . ...... . ... ... .. . ......... ......... ... .. . . ............. . .......... ... .. ...... ............... . . .... ............... . . ... .. ....... .. .... ........... .. ..... ... ............. .. . . ...... . ....... ..... .... . ....... . .. ........... . ..... . .......... .... .... .. . .. .. . .......... .... ...... . ....... ... ......... ... . ......... .... .............. .......... . ......... .... ...... ...... ..... ... .. T.. . . .. ....... . .............. .... . .. .. ...... ... ..... ........... . .... . . . ..... .... ... ...... ... ....... .. T. .. ...... ... ...... ..... .... . ... .. . ........... ............. .. T. . .. .... . ............ ..... . ..... ... .. .. ....... . ..... .. . .. ... .. . . ... ... .. ......... . .. ... . ..... ... ... ............... .. ....... ...................... ...... ...... ... ...... ....... ........ .... ... ..... .. .. ....... ........ . .... . ....... . ...... C..... ............. ...... ... . .. . ... .... .. . ..... .. ... ... ............... ... ... ..... .. .. .. . .. .... ..... . . ... ............. ... ..... ...... .. .. .... .... . ........... .. .. . . ... .... ..... ... T ....... ...... ... ... .. . . ................. . ... .. . . ... ... . .. .. .. .................... ... .... ....... ... . .... . .. . . ...... ........ . ... T. . ........... ... . . .. . . . .. ... . ...... . ..... .......... . .. .. ... . ...... . ... . . ... .. .. ........ .... . ........ ........ . .... .... ... ... .... ....... ....... ... ..................... ...... . . ... .. .. ............. .. . .. . ....... .... . ... ....... . ........ .............. ...... . . ...... .. . ...... . ... .... ............. . .. .... ... ... ... ....... . ... . ........ ...... . G. .... ... A.... . ....... .... . . . ............... ... ..... ... ......... . .... ...... . .. .. . ... .... .. .. .. .. . ............... . .... .. .. ............ . .. ...... .. ..... .... ..... ............. ..... ... ... ........ . ....... ........ .... ... ........... . ............. .... .......... . . . .. ..... ....... ..... .... ............. ....... ....... ... ............ .... . . ...... ......... .... .......... . ..... . ....... .......... . .. ... ... .... .... ..... ... .... . .... ........ . . ... ...... ... .. ..... ... .... . .... ...... . .... ... .. ... . .... T T ... .. . .... .. ...... . ..... .. ... . .. . .... . ... T... . . .... .................. . .. ........ .. . ... .. ..... . . .. ........ ... ... . . . ...... ... ........ ... ...... . ...... . . ......... . ..... ... .... ........ . . . . .... T... ......... . ... .............. ...... . .... ... . .. .. ... ........ .. .... ....... .... ...... ....... ... .................. ............ ........ .. ......... .... ...... .. .......... ...... ... ....... .. .. . ... ....... ... ............... ........ ...... . ..... . ..................... ... . ..................... ... .. . .......... . ...... .. .. ....... . . . ............ .. .... .... .. ..... TT. ... ....... ... .. ......... ... ... ............ .. ... A... ... . ........ ... ..... .. . .. . . ... .... ..... . . ............... .. .. . . .... . ..... .... . . ... .. .. .. ........ .. .. .. . . T. ... ... .... .. . .......... ........... .. .. ........... . . ... ........... ........ ......... .. .... ... .... .. ...... ... . .............. ........... ..... . ... ... . .......... ..... ... ... ... .... . ........ . .. ........... ... ....... .. . .. . .. ........ .............................. . .. .. .................. ... ..... ...... ... ..... ...... .... ....... ........... . ... .... ... . . . ...... ...... .... .... ..... ...... ...... ............. .... ...... .... .... .... . ....... ........... ... ....... .. .... ...... . ...... .... .......... ..... ... ........ .............. .. .. . . A................ ..... .... ... ..... .. .. .... .. ... .......... ... .............. . .. .... .... ..... .... ... ... . ..... .... ...... .. ... ... .. . . .. . T..... ..... ..... ..... .... . ... . .. ........ ..... . ..... .... . ....... .. ... ... ... .. ... N..... ... . .. . .... .. .... ....... ..... ...... .......... ........ . ....... ... ...... T. .... . . ... . ....... .... .... ......... ... ..... . .. ..... . . ... . . ... .. ...... ... . ... . . . ..... ..... ..... . ...... .... .... . ........ ............... .. ... ...... . ........ . .. .. ........ . ........ .. .......... . ... . . . ... ...... .... ....... ........ . ..... ..... ......... ...... .... .... .... ........ . . .... .. ... ..... .... ...... .... ......... ... . .... .... .. .. ............... . .. .... .. ........ .. .... .... ..... .............. ............ . ..... . . .. . .. .... .... .. ............. .. .. ....... .... ....... ............ ......... . ... ............. . .... .. ....... ...... .. ..... ............ . ... ... . ....... .. .... . . ......... . ... ... .. . . ............. ........ ..... ..... .. ...... ........ ........ .. ..... . ...... ... .. . .... . ... . .... . ............. ....... .. ............ .. ............... .. . ....... ......... .. . . .... ...... . ..... .. . .. .. ............ ............. T...... . . ..... ... . .... ...... ..... ........ . ........... .. ........... ... .... ..... ......... ................ .......... .. .... ..... .. ................... .. C. . .. ........... .. ...... ... .... . .. .. ....... ... .. ... ..... ... . ....... . ....... ... ....... ...... . ............... . ... .... .... .. .. ... . .. .. .... ... ............. .. .......... ...... .. .. . .... ..... ........ .... .......... .. ...... ..... .. . . . .......... ...... . . ... .... ... .. .... . ...... .. ..... ... . . .... ... ...... . ... .. .... .. .. ...... . ............ .. ........... . .. ........ TT.. . .. . .. .. . ......... . ... ... ... ......... ... .. .. ... .. . ... .. ............. ..... . ....... .... . .. ........... ....... . . . . ......... .... . . . .. .. ........ . . .......... . . . .. .. ... .. .. ..... . . . . . ...... ... ..... ...... . .. T... . .. .. .... . . .... . . . .. . ..... ..... . . .. .. ...... .......... ... ........ . ........ .... ... . .......... . .... .. .............. . ..... .. ... .. .. .... . .. .......... .... .. . .... .. ....... ........... .. .... ... ..... .... . . .... .. . . . C..... .......... ... ... .................... . .. . . ... ... ... ... .... . .. .... ... ......... ..... ..... .. .. .. ... ... .. . ...... .. .. ..... .. ....... . ... ... ..... . .... .... . ........ ......... ..... .. .. ........ ... ....... ......... .... . . . .... ... .... ... ...... .... ... ... .. . ..... ... .. .. ....... .. ............ ...... ..... ... .... ........... . . ....... ..... .... ............. . ... ..... .. ........... .. ..... . .. .. .. . ......... . .... ........ . .. ... .... .. ...... .... .. .. .. . ..... .... .... ..... .... ................. .... ....... ...... .... . ............. .... ... ..... .. . .. ..... .. . .. ... ....... ...... ... ........ ......... .. ............ .. . . . ... .. .. ........ ..... ....... ... .. . .... ... ... ............ ..... . .... ... . ....... ... .. .. ....... ... T...... ...... .... ........ .. . . .. .. ......... .. . .. ....... .. ... . ...... . ..... ..... . ....... ....... .... . .. ..... . ....... .... ........... .. . .... . .... ...... . ...... ..... ...... ... ........... .. .. ........ .... ....... . . ...... . .. ... ...... ... ..... . ... ........ .. ........... ... ... . ............ ... . ..... .. .... . . ..... ........ ........ . T. .... .. .. ... . ... ......... ... .. .... ... ...... . ..... .. ... .. .. .. ... ... .. .. ... . ... .. ..... .... . . . .... ..... ................ . .. ...... ..... ........... . ....... . .. ........ . . .. ... ... ... . .. ........ .... .. .. ... ... .. .... ..... . .. . . ...... ..... .... . . ..... ....... ........ ......... .. ... . .... . .. ... ..... ... .. .... .. . . ... . .. . ... . ........ ............ ... . .. ... .... ... ...... . .. ............... ... ...... ....... ..... .. ........ . ............... . ....... . .. .......... .. ....... ....... ... .. .... ... .. ... ......... .. .. ... ..... .. ...... . . ..... .. . ..... ....... .......... .. .. .... ... . ...... ....... . .... ....... .. . ........ ....... . ................ .... .. ......... A............. ... ..... ... ............ ..... ..... ..... ...... . .. ... ... ....... ..... ....... ... . ..... . . ...... .. ... . ...... ........ ... . ........ ... .. . ... ..... ..... ... .... ...... ......... .... ... ........ ..... .... ........ ..... . T..... .......... ............ .. ........ ... . .. ... . ......... T... .. .. ......... .. .. ...... ........... . ............ . .. ... .......... ... ..... . ..... ... .......... . ...... .... ... ......... .... .... ....... . . ... . .......... ..... ..... . .... .. .... ..... ... .. . .. ... .... .. ........ .. ... ......... ...... .. ....... . ... ..... .......... . . . ... ... ...... ... ... .. .. .. .......... . .......... ........ ... ........... ... .. .... .. . ..... ....... ..... .. . . ........ . ... ... . . ... . .... .... ... . ... C.... . ..... ... ... ................. ... .... . ... .. .... .... ... ..... .. ... .. . ... ..... .... .. ... ..... . . .... ... ...... ... ......... .. .... ............ .. ............ ... ...... ........ .. ....... ... .. ............. ........ .............. .. .. .. .... .. C....... ..... ..... . .. .......... .. ..... . .. ...... .. . . ...... .. .. .. . ....... .......... ....... . .... T.... .. . .. .... ... . ........ ........... .. .. .. ... ..... ............ ..... ......... ........ .................. . ... . . .... ..... . .. .... ..... ... .. .. ... . ....... ... . .... . ... . .. .. .......... .... .. .... .. . . .......... ... .................. . ........ . . . . ..... .. .. . . . . .. . .... ...... .... .... .. ... . ..... ... ..... .... .... ....... . ........ . .... .. ............... ... . .. .. . ... .. . . ... ... .. .. . ...... . ....... . . .... ... ... .... .. .... .. ... . .. . ...... .... ..... .... ............. . ... ................. ............. .. . ..... ........ .............. .. .... . . . ........ ... .......... .... ... . .. ...... ... . .. .......... .. ...... . .. ...... .. ............ .. ..... .. ... ... ... .. . . ..... ........ ... .. . .. .................. . ... .. ... . . ... . ..... ....... .......... ... ... .. ..... ... ..................... .. ... . . ... .. . .... .... .... ... ... .. .... .. ..... ... .. ...... ... ............... . ..... . ... . ... ........... ..... .... ...... . . ... . .... ... ........ .......... . .... ... .... ....... ....... . G. ...... . ... ...... ..... .... ...... .. . ... . ..... ..... ....... . ..... .............. ... ... .. ... .. .. ......... .. . . . ................. ... ....... .. .... .. . ..... ........ .. .... ..... ... ....... ......... ...... . ....... .. .. .. .......... ........... .. ..... . .. ... .. ........... ................. ...... .... . ... .. ........ .... .. .... .... ....... . .... ......... ..... ... ...... ....... ..... .... .. ......... .... ...... . . ...... . ... ........ .... .. .. . ... ... .... ...... ..... ........ T... ............. .... ..... .. .. . ... .. .. .. .. .... . .. ........ .... ....... . ...... .. .. ..... . ....... .. . ... ......... ... .. .. .. .. .. .. .... ...... . .. ....... .. ........ .... ........ ..... .. .. .. . C... ..... . ......... .. .. ... ... . .... .... .. ... ...... . ...... .. ....... ..... .. . .. ........... ......... .. .......... . ............ .... ..... . . ... ...... .. . ........ ......... ...... ... ........ . . ... . ..... ...... A.... .... .... .. ...... ........ .. ....... .. ... ..... ............ ..... ... . . ... ........ ....... . . ..... .. .... . .. ............ . .... ........ . ... . . . ... .. ..... . ......... . ... ..... .. ...... ... .. . .... .. ......... .... ..... . ............... ..... ............. ...... ... .... ........ ... . ...... ............ . . ... ... ... TT..... .... .......... .. .. .. .......... ... .... T..... ....... . ...... . .. .. . . .... .. .... ... ... ............. ... ...... ............... . ......... .. .......... . ...... .. ....... . ....... . . . ... ... ....... ...... .... ...... .. ... ........ ................. .. .. . ..... ............. .... . .. .. ... . . ... ... ..... ........ ... ... . .. ..... .. . .. .. .. ... .... ....... . . . ... ... .. . ...... ... . ...... ...... . ..... ... ... ... .... ..... .......... ... ....... . . ... . .. .. ........ ........ . . ... ... ... .... . . ........ ..... .. ... ........... .. .. ...... .... .. . ... . ...................... ......... T ... .... ..... .......... ... .... ... .... . ........ .... .. . ...... ..... . .. .. . ......... .. ...... .. . .... ... .... ... . ... . ........... . ..... ...... .... ... .. .... .............. ............. ..... .. ......... ... .. .. .. . ....... ........... ...... .. .. . . ..... . ........ . .... ......... T .. .... . .. .......... .. T. .. .. .................... . ..... . .... .. .. ....... .......... ..... ..... . .. ........ ........ . .... . ... .. .. TT. ..... ..... . . ...... .... ... . . .......... .. ............ .. . ..... ....... .. . . ..... ............ ....... .. ........ ... ... ... . . ........ . ... .... ..... .. ............. . ....... .. ..... ......... ... ..... ... ... ... .... ............ .. ...... ...... ..... .. .. A.. .. ....... T...... .. ....... ........ ....... ....... ... .. ... ... . .......... ............. . ..... ....... ... . ...... .. ...... ....... ... ....... ...... . . . .. ..... ... ..... ... .. . ........ ..... ... .. ....... .. ....... .... ... .......... ...... . ... . ............ .. .. . ............. . .... .. ............... . ...... ... . ....... ... ... . ........ .... . . ....... .. . ... ...... .... ............ . ........ . ... . ..... .. ..... .. ... ..... ... ....... .. . . .................. . .......... ... ......... .. ... ...... ....... . . ... .. ........ ... .... .. .......... .. ... .. .. . ........ . .... ...... A...... . ..... ... .. .... . ............................. ...- Anhang 254 ..... .............. . ... . . ....... ..... . .. ........... . ......... ... .. .... . ........... . . ......... . ....... ... .... .. ........ .. ......... . ......... ..... ... ...... ..... ... . .. .... . .. .... ...... . ..... .................... ... .... .... .. ...... .. ... ....... ... ... ...... .. ... .... ... ... ... . .... .... . . . . .. .. .... . . ...... .... . ....... ........ ... . ........ . . ....... ...... . .. ... ..... .. ...... ..... . .. . ............. TT. ....... .. . .... . . .... . ... . ........ ....... ......... ...... ..... .......... . .. .............. .. .... .. ..... ... . . .. . . ........ . . .. .... .. ... . ... .. ... . . .... .. ... ..... . .. .... . ... ........ .... . .. .. . . .. ...... ... . ..... .... . ............ .. .. .. . .... . ....... .. .... . ... . .. ... ...... ... .. ....... . ... . .......... . ........... ...... . .. .... .. ..... . .. ........ ... . ..... ..... ... .... .... .. .. . ..... .... . ............ .. .. .............. .. . . .... ...... ... .... ........................ ... ......... ...... T.......... . ... . .. . .... ...... ... . . . .......... .... ..... ... .. ... . .. ............ ..... ..... .. . ....... ..... ... .......... ............ .... ..... .. ... .. ... A ..... .. . . .. . ... ... . . . ... .. .. ... . . .... ... . ....... .. .. . ...... .. . . . .... ...... .... . . . ... ...................... ........ ..... .. .............. ........... ... ....... .. .... .... ... . ...... .. .. . ...... ........ ... . . ... . .. . .. .... ... . . ....... ....... ......... ....... . ... ... .... ... ........ ... ...... .. .... ..... . . . ... . .. .... ....... ...... .. . . . .... . . . . ... ... .. ...... .. .... . ... . . . . ......... . . .. .. ... .. .............. .............. ......... .. .. ... .......... .. ......... .......... T...... .. . ... .... ....... . . ......... . .... T... .. .. . .. .. . ... .. .. . .. ... .. ..... .. ...... .. ............. . ....... .. . ....... .... ............ .. .. . .... ... ....... . .. . .. . ..... .. ........... . . .. ... ... ...... .. .. ...... ...... . ..... .... .... .. ..... ... . .. . . .. .... ...... .. .......... .... .... ... ............... ........ ........... .......... .......... ... . ... ...... . ... .. ..... . ... ............... ... ........ ... .... .. . . ...... . ........ ... . ...... ........ . ..... . .... . ....... .... . .. . ..... ..... ........ . ......... .. .. ... .... . . ... ...... ... ... ...... .... ... ... ... .. .. ...... ....... ... .. . . ... ..... . .. . .. ..... .. ....... . ... . .. ............... ... .. ... . ..... ... ....... ........ ..... ...... . ................ . .. .... .. .. .. .. T. . .. ........ ..... ...... ....................... . ......... .......... .... ... ....... . . ..... ... ...... ....... ... .... .... ....... .... .. ... C.. . .. .. ........... .. . ..... .......... ..... .. .............. . ... .. .. .. . . ...... ... ... ... .. ..... .... .... . ....... ... . .... . .. ... . ... ........... ....... . ... . .... . .. . .... . ..... .... . . . .... TT... ... .... ... .. .............. . ... . .... ..... ......... ... .. ..... . . ...... . . ... .. .. .... . ........ ... . . ....... .......... ....... ...... .. .......... .... ....... ...... ...... . ...... .. . . ... ....... .. . . .... . .. . . .. . . ... ... ...... ... .. ............. ........... . . ..... ... . ....... ...... . .. TT................ . . ................. . ..... ... ... ............ . .. .. . . ........ ... .... .......... ...... ..

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. .. . . . . . . . . . . T. . TT. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . ... . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . - ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . C. . . .. . .. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . C. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. .. . . . . . . . . . . . .. . . .. .. . . . . .. . . . . . - . . . . . . A. . . . - . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . T. . . .. . . .. . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . .. . T. T. . . . . . . . . . . . . . . . . . . . .. . . . . . . ... . . .. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . .. . . - . . . .. . . . . - . . . . . . . . . . . . . . . - . . . . . . . . . . . .. . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T C. . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . . . .. . . . . . .. . . . . . . . . . . . . . . . T. .. . - . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . N. . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . .. . . . . . .. . . . . . . . . . - . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . . C. . . . . . A. . . . . . . . . . .. .. . . . . . . . . . . - . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . T. .. . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . .. . . . C. . . . . . . .. . . . . . . . . . . . . C. . . . . . . . . ... . . . . . . T. . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . .. . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . - . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . A. . . .. . . . . . . . . .. . . . .. .. . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . T . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . ... . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . GCA A GT ACA GCA A T CA A CCCT CA A CT A T CA CA CA T CA A CT GCA A CT CCAA A GCCA CCCCT CA CCCA CT A GGA T A CCA ACA A A CCT A CCCA CCCT T A A CAGT A CA T AGT A CA T AA A GCCA T T T A CCGT ACA T A GCACA T T A CAGT CA A A T CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CA GA T AGGGGT CCCT T GA CCACCA T CCT Anhang 255 . . . . . . .. .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . .. . T. . C.. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . .. .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . .. .. . . . . . . . . . . . . . . . . . . . . .. . . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . .. . . . . . . C. . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . - . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . C.. . TT. . . . . . . . . . . . . . . .. - . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . C. . . . . - . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . .. . . . . . T. . . . .. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . T. . .. . . . . . . . . . . . . . . .. TT. .. . . . . . . . . . . . .. . .. . . . . .. .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . ... . . . . . . . . . . . .. . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . .. . . . . . T. . . . . . . . . T. . . . C. . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . - . . C. . .. . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . TT. . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . - . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - .. . . . . . . . . . .... . . . . . .. . . . . . . . . . . . . T. . . . . . . . . . . . . . . - . . . . . . . ... . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . T. . . . .. . . . . . . . . . C. . . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . TT. . . . . . .. . C. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . . .. . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . .. . . . . . . . .. . . . . . . . . . . T. . . . . . . . . . . . . . .. . . . . . . - . . . . . . . . . . C. .. . . . . . . . . . . . . . . . - . .. . . C. .. . . . . . .. . . . . . . . . .. . . . . .. . . .. T. . . . . . . T. . . . . . . . . . . . . .. . . .. . . . .. . . . .... . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . ... . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . . .. . .. . .. . . . . . .- . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . - . . . . . . . . . . C. . . . . . . . . TT. . . . . . C. . . . . . C. . . . - .. .. . . - . T. . . . . . . . . . . . . . . . . . . . . . . . T.. . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .- . . . .. . ... . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . . . - . . . . . . . . .. . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . - . . . .. . . .. . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . T . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . .. . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . .- .. . . . . . . . . .. . . . . . . . . . . .. . . . . .. . C. . . .. . . . . . . . . T. . . . . . . . . .. . . . . . . . . . . . . . . . . T. . . . . . . ... . . .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. C. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. . .. T. . . . . . T. . . . .. . . . . . ... . . . . . . . . . . . T. . . . . . . . . . .. . . . . . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . . . . . .. . . . .. . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . - . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . .. . . T. . . . . . . . . . . . . . .. . . . . . . . . . . TT. . . . . . . . . . . . . . . .. . . . . . . . . . . . - . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . C. . . . . . . . . . . . . . . . . . . . .. . . . T. . . .. . . . . .. . . . . . . . . . . . . . . - . . . . . - . . . . . . . . . .. .. . . . .. .. . . . . . . . . . .. . . . . . . . TT. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . .. . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . TT. . . .. . . . . . . . . . . . . - .. . . . . . . . . . C. . . . . . . . C. . C. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .- . T. . . . . . . . . . . . . . . . . . . . T. . . C. . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . - . . . - . . . . . . .. . . . . . . . . . .. . . . . . . T. . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TT. . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . .. . - . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . .. C. . . . . . . . . .. . . . . . . .. . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . .. .. . . . . . . . . . . . . . . . .. . . .. . . . T. . . . . . . . . . . . . . . . . . . . . . . . T. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . .. . . . . . . . . A. . . . . . . .- . . . . . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. T. . TT. . . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - .. . . . . . . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . ... ... . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . C. . C. . .. . . . . . . . . . . . . . . . . . - . . . . . . T. . . . . . . . .. . . . . . . . . . . .. . . . . . . . . . . .. . . . . . . . . . .. .. . - . . T. . . .. . .. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .. . . . - . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . C. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . .. . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . .. . . . . . . C. . . . . . . . . . . . . .. . . . . . .. .- . TT. . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . .. .. . . .. . . . . . . . . . . . . . . . . . . . . - . . ... . . . . . . . . . .. . . .. . . C. . . . . . . . . . . . . . . . . . ... . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .. . . . . . . . .. . . . . .. . . .. . . . . . . . . . . . . .. . .. . . . . . . . . . . . . . . . - . C. . . . . . . . . . . . . . . .. . . . . . . . . . .. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . - . T. . . . . . ... . . . . . . . . .. . . . . . .. . . . . .. . . . . .. .. . . . . . . . . .. . .. . . . . . . . . . . . . . . .. . . .. . . . . . . . .J01415 DEB2_A_I/1_1 DEB2_A_I/1_2 DEB2_A_I/1_3 DEB2_A_I/1_4 DEB2_A_I/1_5 DEB2_A_I/1_6 DEB2_A_I/1_7 DEB2_A_I/1_8 DEB2_A_I/1_9 DEB2_A_I/1_10 DEB2_A_I/1_11 DEB2_A_I/1_12 DEB2_B_I/1_1 DEB2_B_I/1_2 DEB2_B_I/1_3 DEB2_B_I/1_4 DEB2_B_I/1_5 DEB2_B_I/1_6 DEB2_B_I/1_7 DEB2_B_I/1_8 DEB2_B_I/1_9 DEB2_B_I/1_10 DEB2_B_I/1_11 DEB2_A_II/1UNG_1 DEB2_A_II/1UNG_2 DEB2_A_II/1UNG_3 DEB2_A_II/1UNG_4 DEB2_A_II/1UNG_5 DEB2_A_II/1UNG_6 DEB2_A_II/1UNG_7 DEB2_A_II/1UNG_8 DEB2_A_II/1UNG_9 DEB2_A_II/1UNG_10 DEB2_A_II/1UNG_11 DEB2_A_II/1UNG_12 DEB2_A_II/2_1 DEB2_A_II/2_2 DEB2_A_II/2_3 DEB2_A_II/2_4 DEB2_A_II/2_5 DEB2_B_II/1_1 DEB2_B_II/1_2 DEB2_B_II/1_3 DEB2_B_II/1_4 DEB2_B_II/1_5 DEB2_B_II/1_6 DEB2_B_II/1_7 DEB2_B_II/1_8 DEB2_B_II/1_9 DEB2_B_II/1_10 DEB2_B_II/1_11 DEB2_B_II/1_12 DEB2_A_III/1UNG_1 DEB2_A_III/1UNG_2 DEB2_A_III/1UNG_3 DEB2_A_III/1UNG_4 DEB2_A_III/1UNG_5 DEB2_A_III/1UNG_6 DEB2_A_III/1UNG_7 DEB2_A_III/1UNG_8 DEB2_A_III/1UNG_9 DEB2_A_III/1UNG_10 DEB2_A_III/1UNG_11 DEB2_A_III/1UNG_12 DEB2_A_III/2_1 DEB2_A_III/2_2 DEB2_A_III/2_3 DEB2_A_III/2_4 DEB2_A_III/2_5 DEB2_A_III/2_6 DEB2_A_III/2_7 DEB2_B_III/1_1 DEB2_B_III/1_2 DEB2_B_III/1_3 DEB2_B_III/1_4 DEB2_B_III/1_5 DEB2_B_III/1_6 DEB2_B_III/1_7 DEB2_B_III/1_8 DEB2_B_III/1_9 DEB2_B_III/1_10 DEB2_B_III/1_11 DEB2_B_III/1_12 DEB2_A_IV/1UNG_1 DEB2_A_IV/1UNG_2 DEB2_A_IV/1UNG_3 DEB2_A_IV/1UNG_4 DEB2_A_IV/1UNG_5 DEB2_A_IV/1UNG_6 DEB2_A_IV/1UNG_7 DEB2_A_IV/1UNG_8 DEB2_A_IV/1UNG_9 DEB2_A_IV/1UNG_10 DEB2_A_IV/1UNG_11 DEB2_A_IV/1UNG_12 DEB2_A_IV/2_1 DEB2_A_IV/2_2 DEB2_A_IV/2_3 DEB2_A_IV/2_4 DEB2_A_IV/2_5 DEB2_A_IV/2_6 DEB2_A_IV/2_7 DEB2_A_IV/2_8 DEB2_B_IV/1_1 DEB2_B_IV/1_2 DEB2_B_IV/1_3 DEB2_B_IV/1_4 DEB2_B_IV/1_5 DEB2_B_IV/1_6 DEB2_B_IV/1_7 DEB2_B_IV/1_8 DEB2_B_IV/1_9 DEB2_B_IV/1_10 DEB2_B_IV/1_11 16210 16220 16230 16240 16250 16260 16270 16280 16290 16300 16310 16320 16330 16340 16350 16360 16370 16380 16390 16400 . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . T.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . TT. . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . - . . . .. .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . .. T. . . . .. . . .- . . . . . . .. . . . . . . . . . . . .- . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . C. . .. . . . . . . . . . . . C. . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . .. .. . . . . . .. . . . . . . . . . - . . . C. . . . . . . . .. . . . . . . . . . . . . . . . . . . . A. . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . .. . . . . .- . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . .. . . . . .. . . . . . . . . . . . . .. . . .. . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . .. - . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . .. . . . . C. . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . ... . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T.. . . . . . . . T. . . . . . . . . . . . . . T. . . . . . . . C. . . . . . C. . . . . . .

. . ... .. ........... ...... ... ... . . .. .......... .. ........ ... ..... . . ..... . .. ..... . . .. ... . . ... ... . .. ..... . ...... ... . . . . . ... A .. .. .. ......... .. .. .. . ... .... ... ..... . .. . . . . T.... .. . ... . . ... .. .. .. .. .. . . . ... . .. .. . ... ... . .. . . ... .. ... ... ....... . ..... .. .. .... . .. .. . .. .. . . .... .. ................. . .. .. . .... ... . ... .. ........ . .... .. . . .......... .. .. . . ..... ... . ... ... . . .. .... ...... ... ... .. ..... . . . . ....... . ...... ... ... . .. .... . ... ............... ... ......... .. ...... .......... . .. . . ... .. . .. . .. .. . .... ... .... . .... . ... . A ... . . .. . .... .. . .. . . .. . . .. . . A ... . ... . ... . ... .... .. .............. .. .. .......... .... .. ... .. .. ... . . ... .. ..... . ... ... .... ..... ..... . . .... . ... .. ...... .. . . . ....... ..... . .. .. ... .... ... .. ......... . .. . ..... . . ... . .. . . ..... ...... . .... . . .. ..... . . . .... . ... . . .. . . ... . . ....... . .. ..... . . . . .... ...... . . . . .... .. .. . . ......... . . . . .... .... . . . .... .... .. . ... ...... . ...... . . . ....... .. . .... ... ................ .. . .. ... ..... .. .... A .... .... .. .. .. .. . .. . . . .... ........... . .. ..... .. .. ... . ..... ......... . .... .. ... . .. .. ... . ... ... ..... . .. ..... . . . .... ... ... ... ... .... . .... .... .. .. . . . . .. ...... .. . ...... . . .. . .. ..... ... .. .... ...... ... . . .... . .. . .... . ... . . .... ... ............ ... . ... .. .. .. .. ... . ... . . . . C.... . . .. ... ... .. .. .. .. ... . ... ..... . .. ... . .. . .. . ..... . C. . ... ... ..... . ... .. . ..... ... .. ...... . . . ..... .. .. ... ...... ..... . . . ........ ...... ... ...... .. .. .. . .. ..... .. .. . . .... . .. . .. .... C........ . . . ... . .. . . ...... . ... .. .... . .... ....... . . . . . .... .. . .. .. .. . ... ..... ..... . . . .... . . . ... ... . .. . . . .... .. ..... . ..... .. ... . .... .... .. .. . . . ... .... ......... . . . ..... .... . . . . . .... ........... . ... .. . ... . ......... .. .... . ....... .. ... ... .. . . . ..... ... .. .. . . . .. ... . .. .. . ... ....... . ..... .. .. .. ... . . ....... ..... .. . ... ... . . ..... .. . . .. .. . . ........ . . .. .... ... ... .. . .. ... . . . . ..... .. .. ..... ... ...... . . .. ... .. . ..... ... . .. . .. . . ... . .. ...... ... . . . . ...... ..... .. .. .. A . .............. .. . ... ... .. .. . . . .. .. . ..... .. ..... ... . ..... ... .. . .. .. .. .. ..... . .. . . . ... .. . ... . . .. ...... .. . . ... ... . .... .... . . . . .. . .... . .. .. .... ... .. .. . .. ...... . .. ..... ..... . . ... ... . . . . ...... ... .. . .... ..... . .. .... ........... . .. .. . . . ..... ... ...... ...... .... . . . ...... .. .. . . ... .. ...... ... .... . ....... .... . ..... . ......... . ... . .......... ... . ... . .. .. ...... .. . T T . ....... .. . . ..... ... ... . ....... . . .. .... ..... . ..... .. ...... . ...... .... ... ...... .... .. .. ... . .... .. . .. ... . ... . .. .. ... ..... . ....... ...... . . . ... .. . . . . .... . ...... . .. ....... . ... .... .... . ... .. . . .. . .... ... ... . ... ... ..... .. . . .. ... .... . .. ... ....... ... . ... ......... . . .. .... . .......... . ... ..... .... . ... .. ..... ....... ... ... .. .. . . .. . . . . .. .. T .... .. .. ........ .... . .... . . .. . .. . .. .... ... . . . . .. .. ....... ..... . .. .. . ...... .. ..... .... . .. .. .... . . . ..... . .... . . .. .... . . . ... . . . .. .. .... .. . . . . . .... .. . . . . .... . . .. . .. .. . .. .... .. .. . .. ... . ... .. .. .. . ..... .. ..... .. ... ...... . . .. .... .. .... .. . .. . . ...... ...... . ... ...... ... . . A .. ... ..... ... . . ... ... . . .... ...... . . ... ..... . ...... .. . . . .. . .. .. .. ..... .... ......... ... . . . .. .. ... .. .. . ..... . .... .. . . . . . .. ..... .. . . ..... ....... ... .... ... ................. ... .. .... .. .... ... ... . .. ........ . . . .... .... . .. . . . ...... . . . .. .......... . .... .. . ... ... . .. .. ......... .. . ... ........... . ... .... . . . .. . ... .... .. .... .... . .. .. . . ... .. ..... C. .. .. .. . . .. ..... . . .. . .. . . G.. ....... . . . .... ...... ... ...... .. ... . .......... . ..... ... ...... ... .. ... ..... ... ... . ... . .. . . . .. ..... ... . ... .. .. .. . . . . .... . ....... . .. . .. . . . .. .. .. . . ....... . ... . . ...... .. .. ... C. .... .. ..... . ... . ... . . . ..... . . ... . C. .. ... ... . ...... ... . . . . .. ... .... .. . .. .. ... . ...... ... ... . ... .. .... . . ... ..... ... .. .. . ... ... C. ............ .. . .. .. . . . ... . ..... ... . . .. . ... .. ..... ... ... ...... . ... . .. . ... . ........ ... . . . ... . ..... ....... .. .. ... ..... ..... .... .. . . ... . ..... ... . . .. . .. .... ......... .............. .. .. . . . . . ....... .. ..... ........ ...... . ...... ... . . ..... . . ... . . . .... ... ..... . .... .. .. .. .. . ...... . .. .... .. . .. ......... .... .. ... ... .... ... . .. ... ............. .. ..... . . . . ... . . . ....... . . ... .. .... .......... . A . .... ... ... . ........... . .. . ... . .. . . ..... .... .. .. . . . . .... ............. . . . . ... ..... ... .......... . . .. . ... .. . ... C... .. ... .. . ... ..... . .. .. .. . . . .. . . . ............ ... ..... ... .. .... . . . A .. . .. . . .. ........ . ..... . . A . . .. ............... .. .. .. ... . . .. ............ .. . . .... . ..... . ... .. .. ..... .... ... ... ....... . . . ............ ..... .. .... ... .. . ... . .... .. .. . ... . . . . . .. . . ... . ...... .. . .. .. . ... . . . . . ........... .. ... .... ......... .. ...... . . .......... .. ... . ... .. .... .. ..... .. . . .. . .... .. . . .. . . ..... . ...... . .... . . . .. ... . ... .... .... . . .... .... ... . ..... ..... . ....... . ..... .... .. . . ...... .......... ...... .. .. ... .. ..... . ... ........... . .. .. . . ...... .. . ... ... .. .. ... .. ..... . ... .. . . .... .. ........... .. .. ..... . ... .. ... .. ... ... .. . .. . .... . ........ .. .. .... ... .. . .. ... . .. ......... . ... ......... ..... ....... . . ... . ....... . . ..... . .. .. . .... .. ... .... . . ... ... . . .... . . . .. . ... . .... . ... .. ...... .... ......... .. . ... . . .. . .. . .... . .... ... .. . ... .. .. . .. ..... .. . . . .. ........ ...... . ... . .. . . .. .. ... ... ...... ...... .. . .. . ... . .. ... .. ..... ............. .. . . ... .. . ..... ... ... ... .. . .. ....... .. . . . . .. .. .... . ..... ... . ........... .. ... ...... .. . ... .... ... ... . ...... .... . ... .... . .. ... .... . .... . ... .. . .. .. .. .. ... . .. . ... ...... ........ ... . .... ... ... . ..... .... .. .... . .. .... . .. . .. ... .. .... . ........ ..... ........ . . ... . ............ . . ....... .. . ...... .. ....... .... .... ..... .. . . . ....... .... . .... . . . . ..... ..... ..... . .. .. ....... . . . ... . .... . . T .. . . ... .... ....... . ... ... . ... . . . ... .. . . .... .... .. .... . .. . .. .. ........ .... . .. ... . . .... . ... .... .. . . ..... . ... . . . ... . . . ... .... ....... .. . . . ......... .. . . . .. ............. ........ ....... . .... .. . ....... .... ... ... ... ... . ..... . .. . .. .... . . .... . ..... . .... ....... .. ........ .... ........ .. . . .. ...... .. . ... . . .......... .. . . . .. .. ... .. .. ....... . . ... . . ..... . ... .. . . .... .... .... ..... .... . ........... ... .. . . . . .. .. ... ...... .. ... . . ...... .... . ....... ... ...... ... .. . . .. . . ... . ....... .. .... ........ . .... ... ... .. ... .. ............. ... . ....... ....... .. .... . .. . . .... . ... . .. . . .. .... . . .. .... ... . .. . .. .... ... .. . .. .. .. ... .. .. .. .. . .. . .. .. ..... .. .... ... . .. . ... . ......... .. .... ..... .... .. . ..... .. . .... .. .. ..... . .. ... . . . . . . ..... . ... .... .... .... .... . . .... . . ..... .. ...... .... . .......... .. ... ... ... . ... .. ......... . ... .. ..... .. .... . .. ... .. ..... .. . ...... ....... .. ... . ..... . . ...... .. . . . . ........ . .... . . . .. .. .. .. ......... .... . . . .. .. .. . . ...... .... . . . ... . .. . ... . T. ......... . . . .. .. .. ... .... ...... .. .. ..... . .. . ..... ... .. . .. ...... . ... .... .. ......... . .. .... . .... . .. . .. .... . . . .... .. . . .... .. . . . .. ... .. .. . . ... ..... ... .. ..... . . .. . . . .... .. .. ..... .. ... ... .. ....... . .. .. .. . ..... .. . . ..... .... . .. .. ... ...... ..... .. ... .. . .. . ... ..... . ....... . .. . . . .... ..... . ..... .... ... .... . . . . ... . .. . . .. . ..... .. . .... . . ... .. .. ..... .. . .. . . ...... .. . . .. ... ..... .... ... . . . .. .. ... .. . .. . . . .... . T .... ... ... .... .. .. ... . . . . ...... .... .. ...... .. . ..... .... . .... .... . . . ... ... . ... . ... .. . . . . . .. . .. ..... . . .... . G.. . . .. . . .... . ... . .... . .. . ... . . .. .. . ........ .. .. ... . . ...... . ..... ....... . ....... . . ... .. ... .. .. ... . .. .. ... ... . . . . . .. .. ....... . ... .. ... ... ... ... .. . . . . .. .. . .. .. . . ... ... ..... . .. .... .... .. .. .... ... . .. . .. ... .. .... .. .. ......... . ... . ............... .. . ... T . .. . . . .... ... . . . .... .... .. . ... ..... .... . . .. .. ... . .. ..... . . ...... .. ....... ... ..... .... .. .. ... . ...... ...... ..... .. ........ .... .. .... .. .. . ... ... . .. .... ... . ... .. ... . ... . ... T T .. .. ... . . ... . .. ... .. ..... .. . . .. . . . .... .. . .... .... .... ... . . .. ... ........ ... . ... . . . ..... .. ... .. .. . .. . . ... ... ..... . .. . ...... . ... .. ..... ... . .... .. .. .. ....... .. .. .. . .. ..... .. .. . ...... . . ... ..... .. ..... .... ..... ..... .. . .. . ... ... .. . .... .. . . . . ... . .. ....... ... . . . . ..... .... .. .... . ..... . .... ... ..... .. . . T . .. . . .. ... ... ... ... .. .... . . . ... ...... .. .. . ....... ...... ... .. . .. ....... . ..... .. . . .. ..... . .. . . . .. .... .... .. .... .. .. ....... .. .. ... ..... . .. . . . . .. .... . ......... ... ... ............ ...... ....... . . ........ . .. . .. .. .. . .. ... . . .. .... .. .... .. .... ......... . ... .... ....... .... ..... . ........ ....... .. .. ...... . .. ....... ... . .... .. . ..... .. .. .... ... . .. .... T T . .. . .... .. . ........ .. ... . ...... .. .. .. .... ... .. .. .. . . ..... ... ........ .. . . . .. . .. ..... . ... ........ ... . .. .. ... ... . . .. ... . .. .. .. . .. .... .. .... ........ . .. ... . . .. ... ...... .. .... .... .. ......... ... .. ... ... .. ... .. .. ....... ......... ........ ... . .. ....... .. .. . . .... .. ... . .. .. .... .. .... . . . . ... ... .. ....... .. ..... . .. A. ...... . .... .. .. . ... ...... .. . .... .. ... . ...... ... .... ... .. .. ..... . . .. . . .. . . ... ...... ... .. . . .... .. ...... ... . . ... . ....... . ... . . .. .......... ... ... .......... .... ... .. . . . ... ....... .. .. . .... . . . ..... .. . . .. . .... ........ . .... ... ........ . ....... ... .. . .. ..... ..... . . . . . . .. . .... ................ . . .... .. .. .. .. ... . . . . ... ... C..... ... .... . .... ... ....... . . ... ... ..... . .... .... ... . .... .... .. .. .... .. .... ... ....... ... .. .. ..... ..... . ...... . . .... .. .. .. . . .. ... .. . . ... . .. .. . . .. . ........ .. . . ..... ..... . .... .. ... . .. .. . .. . . .. .. .. .. .... .... ... ... .... .. . ............. ..... ..... ... .... . . . . .......... .. .. ... .. .. . ... ... ..... . . . . . . ... .. . . ........ . ... .... . ..... . .. .. .. . ... . . ... ...... .. ... . . ... . . . ..... . . .... . . . . . . .... ....... . ..... .. .. ...... .. . . ... . ... . . . ... ... .. ........ .... . .... .... .. .. .. . .. .......... .. ..... .. . .. .. T ... . . . . .. .. . . .. . ... ..... .... ... ... .. . .. ...... . .. . . ..... .... ... ... . .. . ... . . ......... . .... . ...... . ... ... ...... . .. . ... . . . . . ...... . . . .. ... ........ ... T.... .. . ...... .... ...... T . ...... ... . ... . . . ... . .. .. .. . . .. .. .... ........... ... . .. .... ...... . ..... ....... ... ... .. .... . . ... .... ......... . ..... ..... .. .... . . . . . ... ... .. .. ... ....... ... . .. .... . . ..... .. .. . . ... A ... .. . . ..... . . . . . ....... . . . ..... . .. .. .. . ....... . ...... .... . .. ... .. .. . .. ... ... ... ... . ... . . C. . .. ... .. ........ .... .... . .. . . .. .. ............. ... ... ...... . ..... . ... . . . ... . ... .... . ... .. .. . ..... .. .. . ... . . . ....... .. . . .. ... .. .... . . . ..... . ..... ... .. . .. ........ . .... . ... ...... .. .. .. . . ...... ..... ... .. .... . .. ..... . ... .. .. . ...... .. .. . ...... ..... ..... .. . . . . ....... . . .. ... .. .... .... . . .. .. . . T . . . .. . .. ..... . .. ... .. ... ... .. ... ......... .. .. ........... . .... . .... . .. .... .. . .... ...... . . .... . . ...... . ... ...... . . ... . . . .... .. .. .. . . .. .. ... .... . . .. . .. .... ... ... .. .. ........ . ..... .. .. . .. . ..... ...................... .... T. . ... ... .. . . . . . . . . . .... ... .. .. . . .. .. . . .. . . ..... ....... .... .. ...... ....... .. ... ..... ...... . . . .... .... . .. .. . ......... . . .. . ..... . . .. ... .. . . ... ... . ... .. ... .... . .... .. .. .. . . .... ........... ... .. ... . . . . ... . ... .... ... . ...... ........ . C. .. .... ..... . .. . . ... .... . ...... . .. . .. ..... . ... .. . ... .. . .... .. . ....... .. ... .. .... . .. . .. ... . .. .... . .. ...... . . .. ... . .. .. ... . .... . .. ..... . ........ . ... .... . . ..... .. . . . . ... . . T .. . . .... ... .... ... . ........ ....... . . .. . . ..... .. ... . . .. .... . .. . . ... ..... ... ... .. .. . .... . .... .. . ... .. . ... . ...... . .. .. ... . .... . .. ..... .. . . . . . ..... ... .. .. ... .... .... .. . .. ..... . .. .. .. ... ... .... .... . ... .. . .... . ..... . . .. . . ... . . ....... . ... . . . . . ... . .. . . . . ... ... ... . . . ........ .. ... .... .. ... .... . . ... . . .. ....... .. ... ........... . .. .. .. ....... .... .. . . ..... . ....... . .. . . . . .. ..... ..... . .. ... ..... ... .. . ..... . ..... ..... .. . ... ....... ...... ...... .. . .. . . . . . . . .. ... ... . . . ... . .. .. ... .. .. .. . . . ..... .. ... .... ..... . . ......... . ... .... .. . . .. . .... . ... . . .. .... . ........ . . .. . ..... .. . .. ..... .. . . ....... ...... ............ .... ... . ....... . . . . .. .. ........ . .... . .... ... .. ..... ... .. .. ... . . . ... . . ... .... .. ... .... . ... . .. .... .. ... .. .. .... .. . .... ...... . . ...... ............. ... .... .. ..... . . ..... . .... . .. . .... .. .. .... ... .. .. ... .... . . .... . . ..... .. .... . . .. .. . . .... .......... ...... .. .. ... . . . .. .. .. . . . .. . ... . .... . .... ... ... .. ... . .. ........ . .. ... .......... . ... . . ...... ..... ... . ... .. .. ... . . .. .... .. .. . . ..... ... .. .... . ... ... . .. .... .. ... . .. . ........ . .. . ....... ... .. . ..... .... . . . ..... .. ... . .. ..... .. .- Anhang 256 ....... . ...... ..... ... ........ ....... . .. . .... ... .. . . .... . ..... ....... . .. ........ . .. .. ... . . ... . ........ .. .. .. ... .. .... .. .. .... . ... .... ... . .. ..... . ... ... ... . . . ... . . ...... .. ... .. . .. .... . . . . ..... . .. .. ... . ....... T .. .. .. . . . A. . .... .. .. . . . .... ... .. ....... ... . .... .. ..... ... ... .. . ... . . .. ... . .. .. .. ... ...... ........... . ..... .... . .. ... .... ........ . ..... . ... . . . . . ... . . . .. . . ..... . .. ... . . . . . . .. .... .... . ..... .. . ... . .. . .... ... ... . ... .. . . ..... . . ... . .. . ...... .... . . ... ....... . .. .... . .. . .... ... ..... . .... . ... ....... . C. ... .. . .... .. . ... .. ... . .. . ... .. ... .. . ... . . .. ... .. ... . . . . . . .. . .. ..... ... ..... .. . . .... ... .... . ...... ... .. A . .. .. . ... .. .. ... . . ... ... . . .... ... .. ... . ........... . ........ . .... .. . . ... .. .. . . .. . . ........ .... .. .. ..... .... ... ..... ... .... . . .... .. .. . ... . . . .... .... .. ..... . . . .... .. .. .... ............... . .... . . ... . . . ... .... . .. . . .... ..... ..... . ... . . .. .... .. .. ... ... . .... . . . ... ...... . . ... ... . ........ .. ..... ... . . .. .. ... . .. .. ... ......... .... .... ..... .... . .... . . . .. ... ... ... . ... . . . ... .. .. . . .. . .. . . .... . .. . .... .. . .... . . .. ... ..... .. . .. .. . . . .. . . ... . ...... . .. .. .... .. .... .. ... . ...... . .... ... . ... .... .. . . .... . .. . . . . .. .. ..... .... . . . . ...... . . ... .. ... .. ..... . ...... . . ..... .... .... .. . .. .. ....... A ..... ... . ......... . . ..... ...... .... . ... . .. .. ...... .. ...... ..... .. . . .... . ... . . .. . ... . ............. . .. ....... . .... .. ... ..... ... ..... . . . . . ... . .. . ....... . .... . . . A . . ... . ..... . . ...... . . .. .... . ......... . .. .. . ... .. . ....... ... . . ...... . ........ .. ... . . C.. .. ... ... ..... ... . ......... . .. .. . . ........ C. ..... .. .. ... . ...... .. . .. ....... .. ... . . ...... . .. ..... .. . .. . ....... . .. .. . . ... ... . . ... . . .. . . . . ... .... ...... ... ... .... .. .. ...... . ...... . . .. . ........ .... .. .. . . .. .. ... .. ... .. .... .... ... .... . . .... . . .. . . . ...... . ... . . . . .. . .. . . .. ..... ... . . . . . . . .. ... ... ... ...... . . ......... . ... .. ... .. . ....... .... ..... . ... ..... .. . . . . . ................ .. . ....... .. .. . ... . A... . .. .... ..... .. .. .. . ........ ...... ..... . .... ..... . . . ... .. ... .. .. .. . . . ..... .. .. .. . .. . ... .. ......... . .... .... . ... .. . ... .. .......... .. . .. . .. ... ...... . . . .. . ... . .... . . .. ... ... . .. ..... .. .. . . . .. ...... . . .. ..... . .... . . .. . . .... . .. .. .. . ... . .. . . . .. . . ... . . ...... . ... .. .. .. .. . . .. . ....... . ..... . . .. . .. . ... ........ ..... ... .. ..... .... . ...... . ...... . . ......... . . . ....... ...... . .. . .. ... .. .. ...... .. . . . . .. .. .. ..... . . . . .. . .. . ... ........ . ... .... .. ... .. .. . ..... .... . .. ... ... .. . .... . ... . .. . . ..... . . .. .... .... .. .. .. ... . .. ...... .. . . .... . T.. ..... ... ......... . ........ .... ..... . ....... .. .. . .... . ... .... .. .. . .... . ......... .. ..... . .. ... . . . . .. .. ........ ...... ... . .. .. ...... . . .. . ......... ... ...... ..... .. .. .. . .... .. .... . . .. ... ... . . . ..... .. .. .. ...... . .... . .... .... ...... .. . .. . .. . ..... .. . ... .. ... . ... .. . ... . . .. . . . . ....... .. .... ....... ..... ... . .. ...... .. . .. . . .. .. ... . ...... .... ... . ... ... . . . .. . .. ........ .... . ....... .... .. ..... ..... ..... . .... A . ..... . . ..... .. ... ........ .... . . ...... .. .. . . ....... . .................... .. . . .... .. .... ... . .. ......... ..... . ..... .... A . .. . .. . . .. . . . . . . ..... . . . .. . . ... .. . . .. . . ... . ... .... .. . . . .. ... ... ........ ......... . .. . . . ...... ......... ... .. . . .. ... .. ... ... . ... ..... .. .. . ....... . . ... . .... .. .. . . . ..... .. ... .. ... ........ . .............. . .... .... .. . ...... . . ... . ... .......... .. . ... . ... . ... .. . .... .. . .. . ... .... ..... ..... ........ ........ . .... . . ... . .. . ........... . . . ... ... .. .. . . ... .... . ... . .. . . ... .. .... ... ..... . .. ........ ... .. .. .... . ...... .. .. . . .... .............. . . . .. . C.... .. . . .. ..... . . . . .... ... ..... . . ... .. ..... . .. T T T . . . ..... . . ..... .... . . ..... . .... ... ... . .... ..... ... ......... .. . ...... . ... .... ... ...... . . . ... .. . .. . .. ...... .... . ..... ... .. . . . . . . ....... .... . ... ... .... . ..... . .... . . ... .. .... .. ... . . .... .. .... ......... ....... . .. .. ....... ... .... . . . . . . . . . . . . .. . ..... . ..... . ...... .. .. . ... ... ....... .. ...... ..... . ...... ... . .. . . .. . . . .. . ... .. ..... T . . . . ....... . ........ . . . . .. . ..... .. .. .. .. .. .... . . .. ..... .. .. .. . .... . ... ... T .. .. .... . .. . .... .... . . . . .. .. .. . . .... .... .. . ...... .... .. .. . .. . . .. ..... . ... .. ..... .... ... ... ..... . ..... . ............ . ....... . .. .. . . . .... . ... .. . . . .. . . .... . .. ...... . .... ... .... . . . . . .. . .. .... .. .. .. .... . ..... G. . . . ... ..... ... ... .. .. ... .. . . . ... . .. ..... .. .... ........... ... .. ... .... .. ...... . ... .... . .. .. .. . .... .. .. ..... ..... ... . ...... ... ... .. .. .. .. . .... ..... .. . . . .... . .. .. . ... .. . . ... ... . .. ..... ... ................ . .. . ... .. ... ... .. .. . . . . . ...... .. .. . . .. . .. ... .. ..... . . . . . .. . . .... ... . .. .. .... .. .... . . .. .... ... .. . . .. ... . .. . ... . ... . .. ... ...J01415 DEB3_A_I/1_1 DEB3_A_I/1_2 DEB3_A_I/1_3 DEB3_A_I/1_4 DEB3_A_I/1_5 DEB3_A_I/1_6 DEB3_A_I/1_7 DEB3_A_I/1_8 DEB3_A_I/1_9 DEB3_A_I/1_10 DEB3_B_I/1UNG_1 DEB3_B_I/1UNG_2 DEB3_B_I/1UNG_3 DEB3_B_I/1UNG_4 DEB3_B_I/1UNG_5 DEB3_B_I/1UNG_6 DEB3_B_I/1UNG_7 DEB3_B_I/1UNG_8 DEB3_B_I/1UNG_9 DEB3_B_I/1UNG_10 DEB3_B_I/1UNG_11 DEB3_B_I/1UNG_12 DEB3_B_I/2UNG_1 DEB3_B_I/2UNG_2 DEB3_B_I/2UNG_3 DEB3_B_I/2UNG_4 DEB3_B_I/2UNG_5 DEB3_B_I/2UNG_6 DEB3_B_I/2UNG_7 DEB3_B_I/2UNG_8 DEB3_B_I/2UNG_9 DEB3_B_I/2UNG_10 DEB3_B_I/2UNG_11 DEB3_A_II/1_1 DEB3_A_II/1_2 DEB3_A_II/1_3 DEB3_A_II/1_4 DEB3_A_II/1_5 DEB3_A_II/1_6 DEB3_A_II/1_7 DEB3_A_II/1_8 DEB3_A_II/1_9 DEB3_B_II/1UNG_1 DEB3_B_II/1UNG_2 DEB3_B_II/1UNG_3 DEB3_B_II/1UNG_4 DEB3_B_II/1UNG_5 DEB3_B_II/1UNG_6 DEB3_B_II/1UNG_7 DEB3_B_II/1UNG_8 DEB3_A_III/1_1 DEB3_A_III/1_2 DEB3_A_III/1_3 DEB3_A_III/1_4 DEB3_A_III/1_5 DEB3_A_III/1_6 DEB3_A_III/1_7 DEB3_A_III/1_8 DEB3_A_III/1_9 DEB3_A_III/1_10 DEB3_A_III/1_11 DEB3_B_III/1UNG_1 DEB3_B_III/1UNG_2 DEB3_B_III/1UNG_3 DEB3_B_III/1UNG_4 DEB3_B_III/1UNG_5 DEB3_B_III/1UNG_6 DEB3_B_III/1UNG_7 DEB3_B_III/1UNG_8 DEB3_B_III/1UNG_9 DEB3_A_IV/1_1 DEB3_A_IV/1_2 DEB3_A_IV/1_3 DEB3_A_IV/1_4 DEB3_A_IV/1_5 DEB3_A_IV/1_6 DEB3_A_IV/1_7 DEB3_A_IV/1_8 DEB3_B_IV/1UNG_1 DEB3_B_IV/1UNG_2 DEB3_B_IV/1UNG_3 DEB3_B_IV/1UNG_4 DEB3_B_IV/1UNG_5 DEB3_B_IV/1UNG_6 DEB3_B_IV/1UNG_7 DEB3_B_IV/1UNG_8 DEB3_B_IV/1UNG_9 16000 16010 16020 16030 16040 16050 16060 16070 16080 16090 16100 16110 16120 16130 16140 16150 16160 16170 16180 16190 16200 T AA GA T T CT AA T T T AA ACT A T T CT CT GT T CT T T CA T GGGGA AGCA GA T T T GGGT ACCACCCA AGT A T T GACT CACCCAT CA ACAA CCGCT AT GT AT T T CGT ACAT T ACT GCCA GCCA CCAT GAA T A T T GT ACGGT A CCA T A AA T A CT T GACCA CCT GT A GT A CA T A AA AA CCCA AT CCA CA T CAA AA CCCCCT CCCCA T GCT T A CAA ... . . ... . . .... A. ..... . . ... . . . .. . ....... ... . ......... ... .... ..... .. . . ... . . .. .. .. .... ... ... . .. ... . ... . .... .. ..... ... ... ... ... . .... . .. .. .... .. . ... ... .. .. .. .. . ..... ....... . .. . .. . .. ..... . .. ... .... ... . . .. .. ... .... . .... .. ...... ... . . . ... .. . . . . . .. .... ..... . . . .. ....... . .. ..... . .. .. ... .... ..... ... . . .... . .... . ...... . . ... . . .... ..... .. .. .... . ... .. . . ............ .. .. . . ... ..... . ............. .. ... ... .. . ... .. . ....... ....... . ... ... . ....... ... . .......... . . ....... .. ... . . .. ... ........ ... . . . . T . .. .. .. . . .. .. ........ ... . .. .. . ....... . .. ... .. .. ..... ... ..... .. ... ..... .. ... .... .... .. .... ....... . ... .. .. . ..... .. .... . ..... . ...... ..... . . ... ........ ..... . . .. .... . . .. . . . ..... . . . .... .. .. ... .. T. ... .. . .. ... .. . . ...... .. C. .

.. . . . . . . . . . . . . . . . . . . .. . . .. . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . .. . - . T. . . C. . . . . . . . T. . . . . . . . T. . . . . .. - . . . . .