POLSKIE TOWARZYSTWO MIKROBIOLOGÓW POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology

I am pleased to inform you that Polish Journal of Microbiology has been selected for coverage in Thomson Scientific products and customers information services. Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM is included in: Science Citation Index Expanded (ISI) and Journal Citation Reports (JCR)/Science Edition. Stanis³awa Tylewska-Wierzbanowska Editor in Chief

2011

Polish Journal of Microbiology
formerly Acta Microbiologica Polonica

2011, Vol. 60, No 1

CONTENTS
MINIREWIEV New antibacterial therapeutics and strategies
KUREK A., GRUDNIAK A.M., KRACZKIEWICZ-DOWJAT A., WOLSKA K.I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

3

ORIGINAL PAPERS Clonning, expression and identification by immunohistochemistry of humanized single-chain variable fragment antibody against Hepatitis C virus core protein
LUN Y.-Z., CHENG J., ZHONG Y.-W., YU Z.-G., WANG Q., WANG F., FENG J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

13

The occurrence and comparative phenotypic characteristics of Staphylococcus spp. from healthy and diseased, household and shelter dogs, based on routine biochemical diagnostic methods
KASPROWICZ A., BIA£ECKA A., BIA£ECKA J., GODZISZ I., BARABASZ W., JAWORSKA O., MA£ACHOWA N., MIÊDZOBRODZKI J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

19 27 35 43 51 59

Comparison of different PCR methods for detection of Brucella spp. in human blood samples
AL-AJLAN H.H., IBRAHIM A.S.S., AL-SALAMAH A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Antibiofilm activity of selected plant essential oils and their major components
BUDZYÑSKA A., WIÊCKOWSKA-SZAKIEL M., SADOWSKA B., KALEMBA D., RÓ¯ALSKA B. . . . . . . . . . . . . . . . . . . . .

Competitiveness of Rhizobium leguminosarum bv. trifolii strains in mixed inoculation of clover (Trifolium pratense)
WIELBO J., MAREK-KOZACZUK M., KIDAJ D., SKORUPSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Selection and adaptation of Saccharomyces cerevisae to increased ethanol tolerance and production
FIEDUREK J., SKOWRONEK M., GROMADA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Cytotoxicity of the Aspergillus fungi isolated from hospital environment
GNIADEK A., MACURA A.B., GÓRKIEWICZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Production and partial charcterization of high molecular weight extracellular "-amylase from Thermoactinomyces vulgaris isolated from Egyptian soil
ABOU DOBARA M.I., EL-SAYED A.K., EL-FALLAL A.A., OMAR N.F. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

65 73

Halomonas sp. nov., an EPA-producing mesophilic marine isolate from the Indian Ocean
SALUNKHE D., TIWARI N., WALUJKAR S., BHADEKAR R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

SHORT COMMUNICATIONS Yersinia species in the dunnock (Prunella modularis) in sub-alpine habitats of the western Carpathians
KISKOVÁ J., HREHOVÁ Z., JANIGA M., LUKÁÒ M., HAAS M., JURÈOVIÈOVÁ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

79 85

First report of Serratia plymuthica causing onion bulb rot in Poland
KOWALSKA B., SMOLIÑSKA U., OSKIERA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

INSTRUCTIONS TO AUTHORS AND FULL TEXT ARTICLES (IN PDF FORM) AVAILABLE AT: www.microbiology.pl/pjm

Polish Journal of Microbiology 2011, Vol. 60, No 1, 3–12
MINIREVIEW

New Antibacterial Therapeutics and Strategies
ANNA KUREK, ANNA M. GRUDNIAK, ANNA KRACZKIEWICZ-DOWJAT and KRYSTYNA I. WOLSKA*

Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology University of Warsaw, Warsaw, Poland Received 13 January 2011, accepted January 2011
Abstract Studies on new antibacterial therapeutics and strategies are currently being conducted in many microbiological, pharmaceutical and biochemical laboratories. The antibacterial activity of plant-derived compounds as well as silver and gold nanoparticles is the subject of this minireview. The application of photodynamic therapy is also discussed. K e y w o r d s: nanoparticles, new antimicrobials, phototherapy, plant compounds

Introduction The growing antibiotic resistance of pathogenic bacterial species is a serious problem for public health. It can be assumed, that although the bulk of traditional antibiotics can still manage drug-resistant bacteria, many commonly used antibiotics are no longer effective (Levy, 1998; Wright, 2010). This situation is aggravated by a decline in the development of new antibiotics, so recently few substances have appeared in the market (Donadio et al., 2010; Högberg et al., 2010). In view of above, the growing interest in the studies aimed at developing new antibacterial therapeutics and strategies is very important not only from medical point of view but also for agriculture and animal breeding (Myles, 2003). The list of such therapeutics is long with stress on the use of bacteriophages as antibacterial agents (Chibani-Chennoufi et al., 2004; Górski et al., 2009). Many papers cover this problem so it will not be the subject of our publication. The present article describes the antibacterial potency and application of plant-derived compounds, nanoparticles and also the very promising photodynamic therapy. Plant-derived compounds Plant-derived compounds of therapeutic value are mostly the secondary plant metabolites (Cowan, 1999). Antibacterial phytochemicals are divided in several

categories, this article describe two of them – terpenes and phenolics including polyphenols. As a matter of fact, these compounds cannot be considered a new group of antimicrobials because people have applied plants and plant extract for medical purposes for centuries (Rios and Recio, 2005). Terpenes. Terpenes, also referred to as isoprenoids, are based on an isoprene structure with general chemical formula C10H16 and are biosynthesized from the same basic units, isopentenyl diphosphate, IPP, and its isomer dimethylallyl diphophate, DMAPP (Fig. 1A). Their derivatives containing additional elements, usually oxygen, are called terpenoids. These compounds have a lot of biological functions and are applied as pharmaceuticals, fragrances, colorants. Terpenes constitute a very diverse group of compounds isolated not only from higher plants but also from microorganisms (Sacchettini and Poulter, 1997). Successful approaches in engineering Escherichia coli towards biosynthesis of functional isoprenoids were recently described (Harada and Misawa, 2009). Of special interest are two pentacyclic triterpenoids oleanolic acid (OA) and ursolic acid (UA) and their derivatives containing sugar moieties – glucosides and glucuronides. The chemical formulas of OA/UA are presented in Figure 1B. The antibacterial activity of these compounds was recently reviewed (Wolska et al., 2010a). The data described in many papers are contrasting and indicate either a strong or weak

* Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland; phone: (+48) 22 55-41-302; fax: (+48) 22 55 41 402; e-mail: izabelaw@biol.uw.edu.pl

Many publications describe the antibacterial potential of diterpenoids. rifampicin or ethanbutol against Mycobacterium tuberculosis. 2010). also display antimicrobial activity (Ahmed et al. Amaral et al. 2009). Antibacterial activity of diterpenoids isolated from hairy roots of Salvia sclarea L was also studied. oleanolic acid cyclodextrins inhibited insoluble glucan synthesis by Streptococcus mutans (Kozai et al. of which the most abundant compound was totarol.4 Kurek A. 1998. It has been shown that both acids affected peptidoglycan metabolism in Listeria monocytogenes (Kurek et al. in case of $-lactams this phenomenon was due to the probable alternation of cell surface hydrophobicity and cell envelopes permeability (Walencka et al. A relatively small number of studies has been performed to investigate the basis of OA/UA antibacterial activity. The simple phenol.g. while quinones contain two carbonyl groups.. 1993. The third pentacyclic triterpenoid with similar chemical structure – betulic acid (BA) is inactive against a large number of Gram-positive and Gram-negative bacteria. It was demonstrated that six diterpenoids isolated from the bark of Podocarpus nagi. 1992).. such as monoterpenes and sesquiterpenes and their derivatives. 2008. Habtermariam et al. This result illustrates the strong structurefunction influence of the antibacterial potential of terpenes (Fontanay et al. caffeic acid isolated from perennial thorny shrub. coli heat-labile enterotoxin inhibitor (Chen et al. Chemical formula of IPP and DMAPP (A) and OA and UA (B) antibacterial effect of OA and UA which likely results from the method of compound purification and the bacterial strain used. Naturally occurring diterpenoids with a dehydroabietane skeleton are highly bioactive (Savluchinske-Feio et al. 1 Fig.. Tannins are polymeric phenolic substances and coumarins are phenolic compounds made of fused benzene and pyrone rings (Cowan.. Both diterpenoids showed synergy with several classes of antibiotics. 2007).. 2010). exhibited potent bactericidal activity against Gram-positive bacteria: Propionobacterium acnes... tuberculosis (Copp and Pearce. flavones and their derivatives – flavanoids and flavanols are phenolic structures containing one carbonyl group. epidermidis but not for the Gram-negative species. Phenolics and polyphenols constitute a very large group of chemical compounds. S. It was also demonstrated that diterpenes inhibited the growth of M. The chemical formulas of exemplary phenolic compounds are shown in Figure 2. 2006) e. Salvipisione and aethiopinone expressed staphylococcal anti-biofilm activity. The results showed that abietane diterpenoids: salvisipone. et al.... 1. Paliurus spina-christi was .. 1993). the reduction in the number of live biofilm cells and changes of biofilm morphology were observed. coli and Pseudomonas aeruginosa (KuŸma et al. Wansi et al. Simple phenols consist of a single substituted phenolic ring. glycyrrhizin acted as a potent E. 1999) and oleane-type triterpenoid. Recently Ge and coworkers (2010) proved the synergistic interactions of OA in combination with isoniazid. coli and inhibited biofilm formation in several bacterial species. 1-oxoaethopinone and ferrugiol were bacteriostatic as well as bacteriocidal for cultures of S. 2010).. Other terpenes or terpenoids. aureus and S. isopimaric acid extracted from immature cones of Pinus nigra inhibited the growth of multidrug-resistant and methicillinresistant Staphylococcus aureus – MRSA (Smith et al. 2007). In turn Ren and coworkers (2005) using microaaray techniques demonstrated that UA caused differential gene expression in E. 1999). mutans and Staphylococcus aureus (Kubo et al... aethopinone. 2005). 2007) and recently the Chinese group showed that diterpenes isolated from the genus Scutellaria possessed the substantial antimicrobial and antiviral activities (Shang et al. Phenolics and polyphenols. E.

Peptostreptococcus micros and Lactobacillus acidophilus creates the possibility of propolis application in the treatment of oral cavity diseases (Koru et al.. also displays substantial antimicrobial activity. 2006). S. Potent antibacterial activity is attributed to the anthraquinones. 2009). 2006. aureus. in turn hypericin and hyperforin isolated from Hypericium perforatum (St. 2006). 2010). Nakayama et al. cholerae toxin and glucosyltransferases in S. Recently it was shown that the antibacterial activity of anthraquinone derivatives from Heterophyllaea postulata against S. mutans. are placed among the most attractive plant derivatives enriching the current therapy options (Cazarolli et al....... also called proanthocyanidins (derived from flavonoid monomers). Nakahara et al. enzymes and . epidermidis. This activity is based on their high chemical reactivity inactivating the chemical compounds. It should be also mentioned that quinones are strong poisons for bacterial type II topoisomerases – gyrase and TopoIV (Pommier et al. Sakanaka et al. Koo and Cho. e. Chemical formulas of exemplary phenolic compounds with antibacterial activity.. Chrysin... (Borris.. Catechin (A). 2.. 2008). electrochemical techniques along with biochemical and medical knowledge were successfully combined to design and develop therapeutically efficient derivatives (Hillard et al. 1987). Its activity against certain oral pathogens. Saddiqe et al. aureus involved an increase in the level of superoxide anion and singlet molecular oxygen (Comini et al. Other groups demonstrated that more highly oxidized phenols were also more active probably due to their ability to oxidize of sulfhydryl groups in proteins (Urs and Dunleavy. coli (Suresh Babu et al. including the antibacterial activity. These compounds are characterized by strong antiperoxidation properties which may be responsible for the inactivation of microbial adhesions. Flavones and their derivatives.. the subgroup of flavonoids present in the oolong green teas which beneficial effect on human health is well known (Cabrera et al. Among the various health beneficial activities of tannins their antimicrobial activity is often referred to.. 2004). flavonoids and flavonols. Streptococcus sobrinus. the simple phenolic species showed lower activity that their calixarene analogues (Mourer et al. 1992. mainly proteins. Surfaceexposed bacterial adhesins. S. was also reported (Borris. 2007).. 1996. V. Vijaya et al. John’s wort) were active against Gram-positive species – S. aureus. Mason and Wasserman. 1995). 1999.. 2006. Recently novel C(7) modified chrysin was synthesized. another flavonoid abundant in propolis. The antimycobacterial activity of quinones was also described (Copp and Pearce. Inactivation of specific bacterial enzymes. Corynebacterium pseudodiphtericum and P.. 2009). Antraquinone (B). Dryden et al. such as Peptostreptococcus anaerobius. It was demonstrated that anthraquinone isolated from Cassia italica is bacteriostatic for Bacillus antracis.g. 1993). preferentially against Gram-positive species. Tannin (C) effective against Gram-positive bacterial species (Brantner et al. 2007. Tannins are divided in two groups – hydrolysable (derivatives of gallic acid) and condensed. 2006. Enterococcus faecalis and Micrococcus luteus (Uzel et al. 1994). These compounds are active against food-borne pathogenic bacteria and therefore exert the beneficial effect in gastrointestinal diseases (Friedman. faecalis and Bacillus subtilis (Males et al. mutans and Shigella spp. 2000).. 1975. The biological assays indicated that this compound is a potent inhibitor of beta-ketoacyl-acyl carrier protein synthetase (FabH) in E. cell wall polypeptides and membrane bound enzymes are their probable targets (Cowan. Koyama. This modification was deliberately designed in order to enhance the anti- bacterial effect. E. 2010).. 1996. Because the redoxpotential of these compounds was so essential to their activity. 2005). 2008). A number of papers are concerned with the antibacterial activity of quinones. 2010).1 New antibacterial therapeutics and strategies 5 Fig. 2007). aeruginosa (Kazumi et al. 1996. Of special interest are catechins. p-guanidinethyl and its simple parent phenols were active against S. due to their extremely large amount of biological properties. It was shown that catechins inhibited in vitro the growth of several bacterial species such as Vibrio cholerae. 1996). Li et al. These compounds can form complexes with cell wall and also disrupt bacterial envelopes (Tsuchiya et al..

. 2009. 2006). both hydrolysable tannins and proanthocyanidines suppressed the oxacillin-resistance of MRSA (Hatano et al. mutans (de la Iglesia et al. including arygria and the deposition of silver in liver are rather scarce (Tomi et al. 2005).. zinc. fungi. is scarce and generally it can be concluded that this property has not been evaluated systematically (Borges et al.. especially proanthocyanins. 1994). yeasts and viruses was also reported (Narayanan and Sakthivel. The antibacterial effect of AgNPs depends on their size. Klebsiella sp.. 2010).. coli. the process is known as “green synthesis”. 2009) and Bacillus licheniformis (Vaidyanathan et al. (2008) and Gade et al. For the latter it was documented that condensed tannin (sainfoin) inhibited the growth and protease activity of Butyrivibrio fibrisolvens A38 and Streptococcus bovis. et al. suggesting shape-dependent interaction at least with Gram-negative bacteria (Pal et al. Production of ROS is one of the primary mechanisms of nanoparticle toxicity. Reports pointing to silver toxicity. actinomycetes.6 Kurek A. (Rai et al. E. respectively Fusarium accuminatum and Aspergillus niger. tellurium platinum. and Pseudomonas sp.. for the production of AgNPs. inhibit the growth of uropathogenic E. The antioxidation activity of tannins is based on their ability to scavenge free radicals.9 times higher antibacterial potential (Ingle et al. (2008) described the synthesis of gold nanowires using an extract of Rhodopseudomonas capsulata. it may result in oxidative stress. 1998). coli compared with spherical and rod-shaped nanoparticles. Their network forms are called nanowires. coli (Gurunathan et al.. It was proved that Ag+ was active against various bacterial species e. Gurunathan et al. (2008) reported the use of fungi. 2004. E. AgNPs have an advantage over ionic silver because they show reduced toxicity and 1. Wangoo et al. Silver in ionic form has been known for centuries to cure venereal diseases. Cechinel Filho et al. 2008). however more friendly techniques have also been developed (Baker et al.. 3. The model of bacterium – nanoparticle interactions presented by Neal (2008) is based on contact-mediated membrane lipid peroxidation by arising reactive oxygen species. aureus. Chopra. 2005. 2009). Bacteria and fungi can also be explored for AgNPs production. It Fig. hygiene and personal care purposes and also in water-treatment (Edwards-Jones. 2008). Landsdown.. Tannins. The morphological changes of these species implicated the cell wall as a target of tannin toxicity (Jones et al. 1 cell envelope transport proteins (Okuda. The conventional methods of NPs preparation involves the use of highly toxic chemical agents. In turn He et al. 2005). including free radicals. 2007). bone and perianal abscesses. to chelate metals and to inhibit of prooxidative enzymes and lipid peroxidation (Koleckar et al. 2005). uranitnie and other nanoparticles by bacteria.g.4–1. Sharma and coworkers (2009) described the production of silver nanoparticles (AgNPs) by plant extract containing proteins able to reduce Ag cations. 2005. Several studies demonstrated that bacterial membranes constituted the main target of AgNPs antibacterial activity. S. 2007).. inflammation.. 2009).. 2009. 2010).. Copper. 2007). so they can be used in food processing to increase the storage time of certain foods (Chung et al.. NPs are characterized by a very large surface area to volume ratio (Rai et al. Contact was facilitated by electrostatic forces between nanoparticles and negatively charged cell envelopes. magnesium but especially silver and gold NPs display antibacterial activity and are used for various healthcare. nanoparticles caused their disruption probably due to the production of reactive oxygen species (ROS). 2008). S. The number of publications dealing with antimicrobial activity of yet another group of phenolics. Their biosynthesis was achieved through reduction of Ag+ ions by Klebsiella pneumoniae (Shahverdi et al. eye diseases and burns. In turn. Different shapes of silver and gold nanoparticles are shown in Figure 3. 2007). 2009). Recently the biological systems for nanoparticles synthesis were elaborated.. coli (Cimolai and Cimolai... Ingle et al. It was well documented that tannins inhibited the growth of aquatic and foodborne bacteria. Smaller-sized particles show stronger antibacterial activity due to their higher surface area to volume ratio (Morones et al. thitania. and consequent damage not only of membranes but also of DNA and proteins (Singh et al. cummarins. 2010) as well as ruminal bacteria. Silver and gold nanoparticles Nanoparticles (NPs) are defined as the clusters of atoms of size ranged from 1 to 100 nm. Different types of silver and gold nanoparticles should be noted that recently microbial synthesis of selenium. It was also proved that the truncated triangular AgNPs displayed stronger bacteriocidal action against E.. Scanning and transmission electron . 2008)..

2007). Morones et al.. 2006). 2004. 2007). 2007. They are also utilized to coat medical devices such as catheters. 2010). 2009). 1997). Vibrio cholera (Morones et al. 2008. IbpB and 30S ribosomal subunit) (Lok et al. accurate and sensitive detection of Staphylococcus sp. microbial adhesion to various surfaces (Monteiro et al. epidermidis were inhibited in more than 95% (Kalishwaralal et al. The antibacterial activity of AgNPs was well proven basing on in vitro experiments. Synergistic antimicrobial activity of AgNPs with penicillin G. 2007). together with copper. Sucrose and soluble and waxy corn starch can also serve as stabilizers (Valodkar et al. MetQ) and heat shock proteins. leading to a dissipation of the proton motive force as shown by proteomic data and biochemical studies. The role of AuNPs was to facilitate the attachment of conjugated antibiotic to bacterium and therefore penetrating of cell wall. coli was inhibited at low concentration of AgNPs whereas the growth-inhibitory effect of S. 2009).. both non-toxic and possessing antimicrobial properties (Dastjerdi and Montazer. 2007). Jain and Pradeep. den- tures or surgical masks (Li et al. aeruginosa and S. 2009)... 2005) and B. OmpC. erythromycin. 2010). 2009). amoxicillin.. AuNPs are very useful for detection and diagnosis of bacteria even in complex media like blood (Kaittanis et al. 2010).. aureus has also been demonstrated (Castellano et al. In this case the majority of papers describes their application as a tool to deliver other antimicrobials or as a factor enhancing photodynamic destruction of bacteria (Pissuwan et al. 2009)... AuNPs conjugates with vancomycin proved to be 50-fold more active that the free antibiotic against Enterococcus faecium and E. Pal et al. Short exposure of E. 2008).g. aeruginosa (Morones et al. e. . 2005).. P. They are used in wounds and ulcers healing.. AgNPs may target the bacterial membrane... this being mainly based on the detection of bacterial DNA by change of color (Elghanian et al.. They have been used for fast. AuNPs were very suitable for delivering drugs. coli (Sondi and Salopek-Sondi.. It was also shown that AgNPs prevent the formation of bacterial biofilms.. usually in the form of dressings and creams (Cortivo et al. 2007. E. 2010).. Rosemary et al. AuNPs enhanced the absorption of light due to their plasmon resonance (Pitsillides et al. (Storhoff et al.g. (IbpA. Biofilm formation was inhibited due to the ability of AgNPs to prevent the initial step in biofilm development i.. However it should be stressed that there is no consensus concerning the efficacy of AuNPsantibiotic conjugates compared with the same dosage of free antibiotic.. AuNPs were also used as stabilizers for various antimicrobial photosensitizers. coli irradiated with X-rays (Simon-Deckers et al. AgNPs are characterized by so many medical and technological applications that they are considered as new antibacterial agents revolutionizing applied medicine. OmpF. This property made these nanoparticles especially useful in controlling biofilms within the oral cavity (Allaker. 2005) as well in the production of textiles. Veigas et al. faecalis (Gu. 2005). aureus irradiated with strong laser light (Zharov et al.e.. e. 2007). aureus elimination was observed when toluidine blue O-AuNPs conjugates and methylene blue-AuNPs conjugates were used in photodynamic therapy compared to dyes alone (Gil-Tomás et al. subtilis (Yoon et al. aureus and E.. coli cells to AgNPs resulted in alterations in the expression of several envelope proteins (OmpA. Yoon et al.. Kim and coworkers (2007) demonstrated that E. Four-fold increase of S. AgNPs interaction with membrane sulfur-containing proteins was also proven (Rai et al. is commonly used to inhibit bacterial and fungal growth in chicken farms and in post harvested cleaning of oysters (Singh et al... P. 2010) and in the production of antimicrobial nanopaints (Kumar et al. 2003) which could cause local hyperthermic effect leading to the efficient destruction of E.1 New antibacterial therapeutics and strategies 7 microscopy images confirmed the formation of pits in the E.. Wang et al. 2007). 2010). biofilms formed by P. coli was observed (Shahverdi et al... 2006). Grace and Pandian. clindamycin and vancomycin against S.. The antibacterial activity of AgNPs is enhanced by their decomposition and the release of Ag ions within bacterial cell (Feng et al. 2004) and M.. 2009). 2007. The efficient antibacterial activity of AgNPs impregnated with bacterial cellulose against E.. Jun et al. OppA. Morones et al.. 2007) was reported. 2010... AgNPs and other nanoparticles can be used in water filtration and disinfection (Li et al. tuberculosis (Baptista et al. coli what was not observed for gentamycin (Burygin et al. 2006). 2000. 2006. The AuNPs-ciprofloxacin and aminoglycosidic antibiotics conjugates were also described (Tom et al.. 2009). aureus was mild. 2005. Gold nanoparticles (AuNPs) also can be used as antimicrobial agents. Perni et al. aeruginosa exposed to near-infrared laser (Norman et al. 2007. Silver. (2006) found that AuNPs enhanced the efficacy of ciprofloxacin against E.. 2006). coli cell wall and the accumulation of silver in bacterial membranes which increases permeability and therefore results in cell death (Sondi and SalopekSondi. Membrane disruption allowed the passage of AgNPs into cytoplasm causing subsequent damage of DNA and other phosphorus containing compounds and impairing the respiratory chain and cell division. 2008).. coli and S.. 2008) or S. Activity against MRSA (Panacek et al. AuNPs were also applied to improve the sensitivity of bacterial detection methods based on flow cytometry and fluorescence (Zaharov et al. 2003).. including antibiotics..

also fullerenes which are stable chemical molecules composed of 60 carbon atoms arranged in a soccer ball- shaped structure are proved to be the efficient photosensitizers (Krokosz. mainly to cure infected wounds (Wainwright. including bacteria. Positively charged (cationic) photosensitizers such as methylene blue and crystal violet act as broad-spectrum antimicrobials. In turn violacein extracted from Chromobacterium violaceum displayed a potent antileishamanial activity (Leon et al. 2010. Already in the beginning of the last century proflavine. Photosensitizers are usually dyes such as methylene blue (Gad et al.. 1997). Photodynamic therapy is used mainly in the treatment of local infections. aeruginosa – pyocyanin. Recently it was shown that the tiazol dye. actively eliminated many bacterial species. 1998.g.. exerted a strong inhibitory effect on S. 2010). The majority of studies are held in vitro but the results of preclinical and clinical trial have also been reported. 1996) which are life-threat danger in hospitals... It should be stressed that photodynamic therapy can be applied in the eradication of antibioticresistant pathogens e.. 2005). and are applied in photodynamic antimicrobial therapy (PACT). 2010). Photosensitizers can be activated by visible light to generate cytotoxic radicals. 2005). The pigment produced by P. et al.. ribosomes and nucleic acids and thus impairing many cellular functions (for review see Wainwright. Conclusions The huge and constantly growing amount of papers describing new antibacterial therapeutics reflects an urgent need to find efficient antimicrobials which can be an alternative to antibiotics. 2010). 2007) efforts have been made to synthesize derivatives with less toxicity and better water solubility (e. stomach and skin tumors (Maisch et al. 2005). 1995). superoxide radicals and singlet oxygen ½ O2 which are the reactive oxygen species (ROS). Wainwright. In practice photosensitizers are usually activated by red light and the preferable source of light is low-power lasers (Ryskova et al. iodocyanine green (Unno et al. 2007) and oral microbial related diseases such as periodontitis (Liu et al. The stabilization of various photosensitizers by AuNPs was described in the previous chapter. aureus. coli was less pronounced (Lakatoš. Beside dyes.. Many dyes can serve as photosensitizers. Ryskova et al. Studies on the antibacterial activity of silver and gold nanoparticles are more advanced and also comprise their synergism with commonly used antibiotics and the application of AuNPs in stabilizing photosensitizers used in photodynamic therapy... 2010). It was clinically studied for leishmaniasis (Dai et al. 2001). 2007). Recently it was shown that two water soluble photosensitizers: methylene blue and neutral red enclosed in liposomes gave a stronger antibacterial effect than their free forms (Nisnevitch et al. aeruginosa (Minnock et al. 2006). 2010b). 1 The antimicrobial effect of natural and synthetic dyes has been known for many decades. crystal violet and brilliant green were used against bacterial infections. causing the damage of the outer membrane. 1981). cell wall.. ..8 Natural and synthetic dyes and photodynamic therapy Kurek A.. Plants and their extracts have been used even in ancient times for medical purposes. Recently. The list of dyes with antibacterial properties included also pigments synthesized by microorganisms (Wolska et al. Trials aimed at resolving the mechanism of their action are also performed. As it was shown that many plant compounds exert a cytotoxic effect (Zhang et al. 2009). 2008. 2005). 2004).g.. It should be also noted that photodynamic therapy was applied and found to be efficient in treating lung. studies are focused on the activity of purified compounds.g.. This is because anionic photosensitizers are not able to penetrate the lipopolysaccharide outer membrane of Gram-negative bacteria.. Gentian (crystal) violet was shown to be very efficient in the eradication of MRSA from skin lesions (Saji et al. 2002) and P.The latter is of special interest because it can be used for the therapy of oral plaque biofilms (Wood et al. 2009). crystal violet (Saji et al. 1995). sometimes called photomicrobial agents. Acknowledgment This study was partially supported by Ministry of Science and Higher Education grant NN302 027937. Considering the enormous scientific effort put in elaborating new antibacterial compounds and strategies. which is a very proficient new antibacterial strategy. alternative possibilities to cope with bacterial diseases can emerge in the near future. Its efficacy was proved in healing cutaneous infections e.. especially Gram-positive aerobes (Baron and Rove... Farina et al. which can enhance the possibility of their therapeutic application. porphyrins (Hamblin et al. thioflavin T.. poor-healing wounds caused by Mycobacterium marinum (Rallis and Koumantaki-Mathioudaki. Liu. the effect on E. VRE (Soncin et al. acriflavine... MRSA (Griffiths et al. 2006). 2008) and erytrosine (Wood et al. 2010). while the negatively charged (anionic) compounds lack efficacy against Gram-negative species (Demidova et al. ROS are highly toxic to various type of cells. due to its unique redox properties. Preoperative use of iodine still remains a common practice.

Hsiang. antiviral and antifungal activities of tea flavonoids and teas. J.N. Wu. Rev. P.N. Roleira. I. Ther. Chen J. Edwards-Jones V. 49: 2329–2335.A. Dryden G.. D. J. 59: 587–590. Cabrera.G.J. B. Kutter. J. Cortivo R. Vindigni. 2010.. 2005. M. 52: 1433–1434. Antimicrob.A. Chibani-Chennoufi S. Wong. Dent. Richards and R. Sarker and H. Ethnopharmacol. T.G. The use of nanoparticles to control oral biofilm formation. Cabrera C. X. Robson. J. Huang and M. 48: 2173–2178. N. Crit. WeberD¹browska. Górski A. 2005. Bioener. 4: 114–122. antitoxin. Opin. T. F. Narband. L. In vitro and in vivo bacteriolytic activities of Escherichia coli phages: implications for phage therapy.D. Deng. Photochem. £obocka. Mat. 20: 814–830. 51: 116–134. Y. E.-Y.J. 2004. Damazio. Bogatyrev and N. N. Núòez Montoya. Cimolai. Agents Chemother.A. 1998. Clin. Sidoti. oleanolic and ursolic acids. Overwiew of antibacterial. Chang. Mirkin. Street. Zanatta. Biodivers.1 Literature New antibacterial therapeutics and strategies 9 Ahmed A. Zahra.J. 2009. 2010. 1996. Donadio S. Yu. Mater. Borysowski. Effect of selected monoterpenes on methane oxidation. denitrification.J. S.G. Shah. Pradhan.. Hamblin. Antibiot.Q. Milagro. 2008. 12: 564–582. Q.M. Smith. Coll.A. P. 6: 313–327. Appl. Letkiewicz.A. Rove. Bruttin.. 2009. V. Meyre-Silva and R.. Food Sci. Agents Chemother.M. R. Abatangelo. C. Nutr. Ž. Wei.H. W. 22: 165–170. Mucic. J. 2010. Duval.-C. Environ. rifampicin or ethambutol against Mycobacterium tuberculosis. 17: 3739–3746. Antibiotic action of pyocyanin. Med. Synthesis and antibacterial properties of silver nanoparticles. Prod. personal care and healthcare. Letsinger and C. Microbiol.A. Plant product as antimicrobial agents. Pinton and B. Campión. Fontanay S.J. and T. and M. Rev. Pinza and G. P. Flavonoids: prospective drug candidates. Photobiol. Beneficial effect of green tea – a review. Cui. On the enhanced antibacterial activity of antibiotics mixed with gold nanoparticles. Grare. N. 2007. P. R. Y. Iacobellis.P. Polyphenols and gastrointestinal diseases. M. Jabes. Healthy properties of proanthocyanidins. Allaker R. Chemical and pharmacological aspects of the genus Calophyllum. and A. G. The cranberry and urinary tract. Food Res. Chem. A. Nutr. J.. Biomed. 51: 29–38. F.-Y. and M. Donate. S.K. D. Microbiol. Clin. Chem. Nair. Rai. Cazarolli L. Tannins and human health: a review. J.R. de la Iglesia R. 1999. M. 120: 272–276. A. 2007. 2010.. Pizzolatti and F. J. Mol. S. Wang. Nanomedicine 5: 641–656. 2010. Burygin G. Antibiotic discovery in the twenty-first century: current trends and future perspectives. 8: 1429–1440.Z. Alberton. Reinbenspiesand and T.-C. Castellano J. Wound J. Martinez.-L. J. Med. Wu. B. Silva. S. R. Nanosci. Friedman M. Ethnopharmacol. Comparative evaluation of silver-containing antimicrobial dressings and drugs.L. T. Brantner A. Payne.-S.H. W.L. Song. Ko. Cowan M.. T. Effect of cell-photosensitizer binding and cell density on microbial photoinactivation. C. Synthesis and antiulcer activity of new derivatives of glycyrrhetic. Effect of growth phase and extracellular slime on photodynamic inactivation of Gram-positive pathogenic bacteria. M. Curr. A. Pharmacology 53: 22–32. J. Chem. 2004. Antimicrobial. Chung K. G.I. T. Borris R. Tubby. 2006.. Matter 52: 662–668. Boqué and J.J. F. Natural product growth inhibitors of Mycobacterium tuberculosis. Gil-Thomás J. A.N. 1996. Albesa and J. Dekker. Eur. Int. Baker C. M. Uriarte. L.R. Maleš.I.. Dis. Ekins S. 49: 147–152.N. Liu. S.W..E. 2005.. H.. N. Koziol-Montewka. A review on the application of inorganic nano-structured materials in the modification of textiles: focus on anti-microbial properties. M. Khlebtsov. Huang and Y. M. Antibacterial activity of anthra- quinone derivatives from Heterophyllaea postulate (Rubiaceae). Lett Appl. L. R.L. J. C. 1993. 38: 421–464. Baptista P.C.R. Mini Rev. 64: 520–525. L. 26: 767–776. Mayer. Farina C. Kim and J. Lett. 2007. Gad F. Agents Chemother. Ge F. Shantrokha. Zeng. Giménez. J. F. Neiro. Bonde. 89: 1175–1186. Wright. Nutr. A. Antimicrobial activity of Paliurus spina-christi Mill. Photodynamic therapy for localized infections – state of art. Franco. Prod. N. Amaral J. Gold-nanoparticle-probe-based assay for rapid and direct detection of Mycobacterium tuberculosis DNA in clinical samples. 4: 794–801. S..T. Identification of Escherichia coli enterotoxin inhibitors from traditional medical herbs in silico. 56: 1276–1280. B. and aerobic metabolism by bacteria in pure culture. Copp B. New sesquiterpene "-methylene lactones from the Egyptian plant Jasonia candicans.G. X. T. 2: 1–5... Cechinel Filho V.P. Dai T. 59: 567–72.A.. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Maffiolo. Pepelnjak and A. J. Dastjerdi R. Hasan and M. B. 2007. Demidova T. Nanoscale Res. 1998. Hamblin. 5: 244–249. P. M. J. 2009. Pochan and S.R. X. S. Natural products research: perspectives from a major pharmaceutical company. Chopra I.J. Am. Sosio and D. 79: 5–18. Guo. Dykman.Y. Gade A. Wilson and C. Jin and L. Paluch-Oles. Ursolic. Montazer. J. Brussow. J Ethnopharmacol. Mabry. Kim. Microbiol. Comini L.R. Res. Chem. A mechanistic study of the antibacterial effect of silver ions on Escherichia coli and Staphyloccocus aureus. Microbiol. Science 277: 1078–1081. Figueiredo. J. 2007. Ye. J. S. Finance and R. Folador. Photodyn. 2000.P. Artacho and R. (Tokyo) 63: 423–430. Mihazes. 2006. Monciardini. Interfaces. Santana and E. Williams. Colloids Surf. R.. M.. 1997. J. Duran and M. Argüello. 52: 119–122.P. Shafii. 1981. Biol. Páez. A. 2007. Fan. Nanoscale particle therapies for wounds and ulcers. 2009. Li and C. Microbiol.. Chem. Pifferi.R. A. Lethal photosensitisation of Staphylococcus aureus using toluidine blue O-tioproningold nanoparticle conjugate.A.. G. in vitro and in vivo analyses. J. Infect.I. V. M. Nat. 2008.C. Khlebtstov. Storhoff. Antimicrob.. L. J. Med.N. Rep. The benefits of silver in hygiene. and J. C.J. Chen. L.C. 12: 887–916. Nanotechnol.I. 2008. 1998.E. Agents Chemother. 25: 79–99.. Zavan. 2010. oleanolic and betulic acids: Antibacterial spectra and selectivity indexes. 6: 170–188. 2006.J. Nat. Knowles. J.. Lin. Miêdzybrodzki. A. Song and C. Mahmoud.W. M..V.. Parkin. Mannari..R. Borges F. 24: 278–297. Ingle. McClain. S.L. G. Biofactors 36: 159–168. Y.K. Ethnopharmacol. Doria and R. Marcato.. 121: 372–378. Gastroenterol. I. Wu. Baron S. E. F. Curr. 2009. Antoliæ. Photodiag. Pearce. Chem. 2010. Simple coumarins and analogues in medical chemistry: occurrence. Pakstis. Y. Feng Q.H. J. Explotation of Aspergillus niger for synthesis of silver nanoparticles.Q. 48: 2558–2569. Antimicrob. P. Hamblin. Scott. In vitro synergistic interactions of oleanolic acid in combination with isoniazid. Elghanian R.S. Cimolai N. S. (Christ’s thorn). H. G. Clin.-H. Antimicrob.P. J. The increasing use of silver-based products as antimicrobial agents: a useful development or a case for concern? J. synthesis and biological activity. Ho. Fortuna.. Zimecki .

Toksoy. with an emphasis on quinones and related compounds. Koyama J.. Sun. Y. Y. Drug Discov. Gu. L. J. Wolska. 1992. 2007. Yu.. Filby. Tolkoff. Ingle A. Muir and K. Xu. Luo. Synthesis of C(7) modified chrysin derivatives designing to inhibit beta-ketoacyl-acyl carrier protein synthetase III (FabH) as antibiotics. Mini Rev. Prod. Rev. Mahendra. S. He S.) 21: 2612–2628. 10: 90–94. Colloids Surf. Gray and P. J. The challenge of antibiotics resistance. Ganz and M. K. Rai. T. K.M. Wren and M. S. 2008.. Biotech.M. Li Q. R. Hamblin M. Rehakova. Biochem. Trends Pharmacol.R. P.O. Y. Grudniak. 500: 177–185. Chemother. 2008. C. K. Effects of tannins and related polyphenols on methicillin-resistant Staphylococcus aureus.H. KuŸma £. A. 2009. Nat. Water Res. Prot. 2009.B. Tam. D. Li. Klicka. Killing of methicillin-resistant Staphylococcus aureus in vitro using aluminium disulphonated phthalocyanine. Hatano T. Miranda. Condensed and hydrolysable tannins as antioxidants influencing the health.. purification and characterization of silver nanoparticles using Escherichia coli. D. Ahmadi. Chemother. 2001.C.V. H. 2007. S. C. Lee. M. Res.C.N..I. Antimicrob. Eur. Colloids Sur. Jones G. . P. L. Inada.A. Kusuda. A. Environ. B. E. Antibacterial efficacy of aminoglycosidic antibiotics protected gold nanoparticles – A brief study. R. Zhao and H.F. a light-activated antimicrobial agent.Q.C. Zhu and C. Kaliswaralal. Ró¿alski. Heddini and O. 1: 113–125. Chem Commun. Bacteriophage therapy for the treatment of infections. Med. Drug.O. and K. K. Biotechnol. Leung. J-F. Bioeng.. Silver nanoparticle-embeded antimicrobial paints based on vegetable oil. Jahodar and L.. A. Biotechnol. Nagasaka. Himejima. Dermatol. Phytomedicine 14: 31–35.. 24: 476–480. Guo and N.A.. Biosynthesis.. 1993. Jeong and M. Colloids Surf. D. £. S. Ogawa. Deepak and S. 49: 2822–2827. Liga.H. Nanomedicine 3: 95–101. Goulart.. Ajayan and G.. Liu P. Phytochemistry 66: 2047–2055. 2009. S. T. Hudecová. 4: 141–144.L.H. 2008 . Ch-M.H. J. D. 5: 916–924.O. Song and E. 42: 4591–4602. Interfaces 74: 328–335. 2008. Zhong-yi. J.A.K.. Gurunathan. Zhu. 2010. A. 60: 1374–1378. and N. Kalishwaralal K. G.R. Microbiol. M. Nantechnol. M. Eom. Liu. Curr. H. Wang. Yuan-Yuan. Perez. Lakatoš B.K. Jain P. Yang. New effect and applications of thioflavins.. 2006. Santra and J. W. Am. Waterman. L. Baysallar. Investig. Chi-Ming Che. 2009. Gurunathan S. Microbiol.J. A. C. 2009. Curr.G. E. M. Kubo I.. D. Agents Chemother. Electrochemical parameters and techniques in drug development. E. Pierrat. Effects of sainfoin (Onobrychis viciifolia Scop. W. J. 17: 6264–6269. Wysokiñska. Chiu and Ch-M. S. Cheng. Kozai K... 7: 236–241. Antimicrobial activity of diterpenoids from hairy roots of Salvia sclarea L. Ró¿alska and H.A. 53: 91–96.R. Kuk. Amatore. 2007.J. 97: 1143–1146. J. 48: 449–450. Koru O. K.. J. Eur. Li H.L. A new antibacterial sesquiterpene from Premna oligotricha. 278: 46–53.. Z. J. D.H. Preparation and characterization of antibacterial silver-containing nanofibers for wound dressing applications.. 62: 58–63. 1994. 2005.M. Presentation of vancomycin on nanoparticles to enhance antimicrobial activities. V. Hillard E. Ho. 1999.. H. Sci. Mycosynthesis of silver nanoparticles using the fungus Fusarium acuminatum and its activity against some human pathogenic bacteria. Noor Ali. Curr. Anti-infective quinone derivatives of recent patents. B. Biological synthesis of gold nanowires using extact of Rhodopseudomonas capsulata. 1998. Adv.D.G. Shi.J. M. Levy S. Prog. Durán. BarathManiKanth. J. Pandian. J. C. John. Kim. The global need for effective antibiotics: challenges and recent advances.: salvipisone as a potential anti-biofilm agent active against antibiotic resistant Staphylococci.A. S. 2005. M.H.Y. 2008. Vaccines and photodynamic therapies for oral microbial-related diseases. Y. 2007..M. Tong. Suzuki. R.J. Emerging nanotechnology based strategies for the identification of microbial pathogenesis.. Q. Appl. J. Kim. 2003. S. Asp. Tunca. Sorkun. Lyon. A. and L. B.H. An anthraquinone derivative from Cassia italica. Ferreira.) condensed tannins on growth and proteolysis by four strains of ruminal bacteria. Nat. and T. Opin. Okada and N. A. Shiota. Kazumi M. Pharmacological effect of green tea on the gastrointestinal system. 2006. 2010. Chem. Helicobacter pylori accumulates photoactive porphyrins and is killed by visible light. 2010. Viveiros.10 Kurek A. Wilson. P. Tanyuksel and B.S. B Biointerfaces 79: 340–344. A. S. 2005. Kurek A. Jaouen. Anaerobe 13: 140–145. Eng. 8: 436–447. Chem. 2004. Park. Antibacterial activity of totarol and its potentiation. Antimicrob. Nano Lett. Tsuchiya and T. Ethnopharmacol.B. Hosp. Drug Deliv.L. Infect. Harada H. Zhang. Yu.S. Krokosz A. Vareèka. Antimicrob. J. Biol.W. Mater. Post.H. Acikel. Phytochemistry 36: 761–763. T. Metab. 90: 59–63. 4: 52–54.J. Antiinfect. Y. Newton. Walencka. Leuven. De Souza and N. 33: 17–34. Y. 297: 63–70. 55: 1436–1440. Shao-feng. Silver nanoparticles impede the biofilm formation by Pseudomonas aeruginosa and Staphylococcus epidermidis. Sci. Hwang. A. Samluk and K. Koleckar V. Akhtar and S. de Abreu. 31: 509–515. Li and P. Probl. Kuca. Drugs 10: 766–774. S. Liu J. W. McAllister.W. et al. In vitro antimicrobial activity of propolis samples from different geographical origins against certain oral pathogens. Appl. F.. 2010. Pandian. Pradeep. Proteomic analysis of the mode of antimicrobial action of silver nanoparticles. Antimicrobial effect of silver nanoparticles. Habtermariam S. 3: 1261–1263. 2006. D. Q. Kim. Chen. A. Huang. Curr. Brunet. M. Vemula. Grace N. Yoshida. N. (Camb. Leon L. Sci.. 2005. Misawa. Antleishmanial activity of the violacein extracted from Chromobacterium violaceum. Hariharan and S. Kim J. Park. Anton. Cho. Fullerenes in biology (in Polish). Malik. 1994. Nat. 2007. A Physicochem. J. Li Y. E. Jun J. Bioorg. Centr. Salih. Q-Y.I. Med.A. He. 40: 873–876. A. Szwed. Muroi and M. US-China Med. Vaidyanathan. Alvarez.. and C. Opletal.. Gade. 2010. Högberg L. Hammed. Kwong-Hang. Koo M. K. Oleanolic acid and ursolic acid affect peptidoglycan metabolism in Listeria monocytogenes.. Recent Pat. 1 and G. Landsdown A. Kaliòková. Venkataraman. K. Lok Ch-M. Oleanolic and ursolic acids: Research perspectives. W-Y. B.. 2006.H. Ozkok Tuylu. P. Cho. P. 56: 140–143. Novel approaches and achievements in biosynthesis of functional isoprenoids in Escherichia coli. Kumar A.. Sonnichsen and M. J.W. F. L. Ho. P. J. Griffiths M. 2007. Kaittanis C. B. C. Pharmacol. 100: 92–94. Potential of silver nanoparticlecoated polyurethane foam as an antibacterial water filter. Z. Akca. Uskudar Guculu. Kubikova. S. 5: 143–150. Jun. Microbios 97: 179–188. Cars. Antimicrobial effect of surgical masks coated with nanoparticles. M.H. Pandian. Antimicrobial nanomaterials for water disinfection and microbial control: potential applications and implications. Lee. C. D. Gu H. 62: 408–423. D. Prod. Silver in health care: antibacterial effect and safety in use. M. Effect of oleanolic acid-cyclodextrin inclusion compounds on dental carries by in vitro experiment in rat-carries model.Y. 84: 1021–1031. 1997.. 2008.

H. J. S. Tanaka. Poulter. Sakthivel. 2005. Synthesis and biological evaluation. J. W. Sci. 2000. Curr. Pasmore and T. Int. R. 27: 76–83. Koumantaki-Mathioudaki. 27: 1712–1720. The bacterial effect of silver nanoparticles. He. Photochem.C. 2005. Parkin and M. Biol. E. Jia.R. Fabris. A review of the antibacterial activity of Hypericum perforatum L. Biosci.. Camacho and J. Sacchettini J. L. 1995. 36: 396–402. Soncin M. Approaches to selectivity in the Zn (II)phthalocyanide-photosensitized inactivation of wild-type and . J. MacLaren and T. Isopimaric acid from Pinus nigra shows activity against multidrugresistant and EMRSA strains of Staphylococcus aureus. R. 2010. Wood. Targeted photothermal lysis of pathogenic bacteria. Pseudomonas aeruginosa. Morones J. H.M. C. H. Nistri and G. 59: 968–973. Kim and T. Fontanay. Takamiya. 49: 1542–1552. Environ. Chem. C. Hashimoto. B. Novel biologically active natural and unnatural products. S.B. 56: 592–594.. Sakanaka S. Grare.. and C. Fan. Adv. Expert Opin. Chem. Appl. 17: 5496–5509.. Ethnopharmacol. Silver nanoparticles: green synthesis and their antimicrobial activities. Phytochemistry 26: 2197–2202. Williamson. Nanotechnology in medicine and antibacterial effect of silver nanoparticles.I. Selective cell targeting with light-absorbing microparticles with nanoparticles.. R. 43: 8423–8429. Ramirez. F. Soviæ. R. J. 1992. Biotechnol. J. Nakonechny and Y. 2009. Rios J. 2006. Elechigerra. Finance and J. Leo. J. Res. and shape-dependent toxicological impact of metal oxide nanoparticles and carbon nanotubes towards bacteria. Size-. Griffith. Lett. D. Photobiol. Hayama and H. Schofield. 2003.. 2006. H.K. E.. Okuda T.K. J.D. N. 3: 115–122. characterization and their antibacterial activity. Joe. 84: 4023–4032.. Dibama. Recio. Cortie. 100: 80–84. Photodynamic antimicrobial chemotherapy by liposome-encapsulated water-soluble photosensitizers. 2008.P. Vernon. perforatum and H. M. Cortie. Preventive effect of green tea polyphenols against dental caries in conventional rats. composition-. Use of cationic water-soluble zinc phthalocyanine to photoinactivate both Gram-negative and Gram-positive bacteria. p-Guanidinoethyl calixarene and parent phenol derivatives exhibiting antibacterial activities..H. Chrzanowski. Investigations of the antibacterial properties of ciprofloxacin SiO2. 32: 159–64. 28: 207–213. S. L. Myles D. Song.A. Biophys. and B.1 New antibacterial therapeutics and strategies 11 Maisch T. Biochem.S. Lin. Rai M. Does the antibacterial activity of silver nanoparticles depend on the shape of the nanoparticle? A study of the Gram-negative bacterium Escherichia coli. Naeem and A. Menguy. Biotech. Opin. 2009.E. Chim. Dei. 2010. Digest J. M. 2010. Biotech. Smith E. 2010. X. M. 2003. Mason T.. Biological synthesis of metal nanoparticles by microbes. M. K. R. Gibbons. Inactivation of red beet beta-glucan synthetase by native and oxidized phenolic compounds. perforatum subsp. Agents Chemother. Acta Pharm. P. 2007.. D. Colloid Interface Sci. and E. Gigante and J.L. 2007. Phys.T. A. E.S.K. Regnouf-de-Vains. Systematics and health effects of chemically distinct tannins in medical plants. K. Environ. A. Murphy and T. Singh M. and M. Biomaterials 30: 89–93. Monteiro D. M. 2008.S. 2009. Tak and J. Shang X.C. N. M. Q.J. What can be inferred from bacterium – nanoparticle interactions about the potential consequences of environmental exposure to nanoparticles? Exotoxicobiology 7: 362–371. Gole. Zloh and S.C. Yamamoto.. Zhang and Z. Nitzan. Nanomat. Carriere.P.. 2006. Rosemary M.) Gaudin. Synthesis and effect of silver nanoparticles on the antibacterial activity of different antibiotics against Staphylococcus aureus and Escherichia coli. Sharma V. Maimoona. Shimura. K. Hamada. J. Osomo. Eur.. Yngard and Y. R. Bosi. 19: 538–542. J.R. Creating isoprenoid diversity. B. Y. Nisnevitch M. 5: 400–406. Photodynamic antimicrobial therapy. Wilson. Piccirillo.M. Gouget and M.R. 8: 2965–2978. 2005. Pratten. Technol. Bedzyk. Saddiqe Z. X Wei. 2008. Ryskova L. and N. M. Li. Photoinactivation of bacteria. Appl. 2010. Pharmacother. 1987. P. Bioorg. Nanomedicine 3: 168–171. Savluchinske-Feio S. Gonzalez Barrios. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs.L. Brown. 156: 1–13. Prokopovich. 128: 279–313.W. Phytother. Prasada and I. Shahverdi A. Colloid Sci. Bioorg.. Environ. 2005. Barros Barbosa. Biofactors 13: 147–151. Antimicrob. Nakahara K. The growing importance of materials that prevent microbial adhesion: antimicrobial effect of medical devices containing silver. Anderson and C. Biostruct. J. Pizurova. Curto. Zhang...I. C. Nanotechnology 16: 2346–2353. subsp.. Adv. Loo. Duval.H. Ogura. Med. T.J. Pommier Y. Perni S. Aizawa. Pilepiæ and M. Microbiol. Kawabata.R.. A. 28: 421–433.. C.. Efficacy of gentian-violet in the eradication of methicillin-resistant Staphylococcus aureus from skin lesions. 110: 16248–16243. Trends Biotechnol. H.R. Kolar.L.. Simon-Deckers A.. Comparative phytochemical and antimicrobial investigations of Hypericium perforatum L. Silver nanoparticles as a new generation of antimicrobials.. A. 56: 359–367. Ohkumi. Marchand. T. Busetti. Ooshima and S. Pal S. Roseiro. J. Plazibat. Photodynamic effect of novel XF porfyrin derivatives on prokaryotic and eukaryotic cells. Neal A. Science 277: 1788–1789. A. Prucek. Abels. 2006. K. Microbiol. Affinity of polyphenols for lipid bilayers. RuvolloFilho. 2009. 72: 430–436. Pissuwan D. Mourer M. G. Singh. Nano. Adv. E.R. Silver colloid nanoparticles: synthesis. Agents 34: 103–110. Eldridge. Lehn and C. C. 2009. A. J. A. R. Treatment of Mycobacterium marinum cutaneous infections. Zhang and C. C. Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid. Ren D. Szeimies.A. Inhibitory effect of oolong tea polyphenols on glucosyltransfrases of mutant streptococci. Langmuir 22: 10125–10129. Uchiyama. Antimicrobial activity of resin acid derivatives.L. N. Environ.. 14: 627–633. 2010. 71: 4022–4034. 1997. Panacek A.P.. Biotechnol. L. Branter. Kumazawa. Stowe. Antimicrob. The antimicrobial properties of light-activated polymers containing methylene blue and gold nanoparticles. Infect. 131: 511–521. B.M. Saji M. T. Kajiyaand S. Buchta and R. J. Appl. with gold nanorods.B. Vecerova and N. A. SaboAltwood. Howard Parish and S. A. Phytochemistry 66: 2012–2031. Ethnopharmacol. 2007. Centr.B. N.B. Yadav and A Gade. Valenzuela and M. The genus Scutellaria an ethnopharmacological and phytochemical review. I.K. V.. Mayne-L’hermite. R. I. angustifolium (DC. 2002. Zuo.F. N. K. M. Lin.R. Pradeep.. Gorup. Kvitek. 2009. 1993. Reynaud. Hosp. Chem. Appl. Males Z. 8: 302–306. P. D. J. S. Ethnopharmacol. 2009. Roncucci.E.. Pitsillides C. Minaian. Gambhir.C. Rallis E.M. E. Fakhimi. S.. C. Wasserman. M. Biol.M. Taguchi. Slezak. Biol. Microbiol. 2005.C. 2005. S. Narayanan K. 31: 225–228. HerlinBoime. Shahverdi and S..J. J. Norman R. 1996. 145: 83–96.M. S. Medical plants and antimicrobial activity. de Camargo and D. Minnock A... Microbiol. Ono. Functionalised gold nanoparticles for controlling pathogenic bacteria. Nakayama T.

O. and J. Tuchin. Suri. Grudniak. 2004. Yamamoto. Hwang.. J. Surg. Mikrobiol.. Baskaran and T. 2010. V. Inuzuka. Chem. Phytopathology 65: 686–690. Sagara and M. Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis. Lucas. Liang. Wandji and N. Baptista. polyphenon 60 (Camellia sinensis) and Euphorbia hirta on Shigella spp. 57: 680–684.D. Wansi J.. Aberer. Eur. 2010. P. S. Cytometry A 71: 191–206. 50: 27–34. Toze. Salopek-Sondi. Photochem. Mohan and S.. sojensis. Res. S. J. Chim. J. O. 35: 205–207. Urs N. coli as a model for Gramnegative bacteria. Morphology and antibacterial activity of carbohydrate-stabilized silver nanoparticles. Tom R. Centr. et al.R. and M. M. Wainwright M. Chemother. Ró¿alska. A. KuŸma and B. Eur. Machado. B. T. Zharov V. J. 13: 589–594.M. “Safe” photoantimicrobials for skin and soft-tissue infections. Salih.N. S. Gopalram. Photothermal nanotherapeutics for selective killing of bacteria targeted with gold nanoparticles. Reddy. R. Yan. Zhang..H. M. 1 antibiotic-resistant Staphylococcus aureus. 2010 a. T. Pradeep. J. Biol. Fiecek. Ndjakou. Synthesis and biological evaluation of novel C(7) modified chrysin analogues as antibacterial agents. 2007. Hara Kishore.G. Silver nanoparticles as antimicrobial agent: a case study on E. U.M.P.. Sci. Perdigao. M.. Biol.R. Suryanarayanan. Engineering nanomaterial surfaces for biomedical applications. J. Zharov V. A silver man. Robinson. KraczkiewiczDowjat and A.. A. 49: 115–118. M.T. Biotechnol. Bioorg. Indocyanine green fluorescence angiography for intraoperative assessment of blond flow: a feasibility study. Bao.I. – a cell culture study. Antimicrob. J. Pandian and S. 90: 619–627. O. Susceptibility constants of Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Wangoo N.P. K.. F. Sewland. 16: 221–224. Environm.M.M. Grudniak. E. I. Smeltzer. Antimicrobial and antioxidant effects of phenolic constituents from Klainedoxa gaboniensis. J. Wood S. S. Vijaya K. 73: 545–551.-H. B Biointerfaces 75: 335–341. Du. Antibacterial effect of teaflavin. Antimicrob. N. Tot. D.S. A. Enhanced silver nanoparticle synthesis by optimization of nitrate reductase activity. Planta Med. Antibacterial activity of oleanolic and ursolic acids and their derivatives. Sato. Wright G. D.H. 2010. Devine and R. 2004. V. 2004. Ramström and M. 2006.D. Med. 2008. Carbohydr. Vasc.. . 2006. Ethnopharmacol. 5: 543–553. 345: 1767–1773. 22: 883–887. 1996 Comparative study on the antibacterial activity of photochemical flavanones against meticillin-resistant Staphylococcus aureus. Couto. Colooids Sur. S. K. 73: 1596–1599. Gurunathan. and B. Bhasin. 2006. Pohnerkar. Murthy and J.R. D. 2008. Galitovskaya and M. M.. 2004. Chemical composition and antimicrobial activities of four different Anatolian propolis samples. Kranke and W.K. 2007.. J. Exp. Müller. 48: 1124–1129. Galanzha and W. 234: 1128–1139. Acta 610: 142–148. Sci. Kraczkiewicz-Dowjat and A. Suresh Babu K. Hu. Wang X. Enhancement of the bactericidal activity of peroxidase system by phenolic compounds (Xanthomonas phaseoli var.12 Kurek A. Tanaka. Sondi J. 40: 105–114.V. Hari Babu. Miyazaki. Fuijwara. Yoon K-Y. D. 1975. J. A. Ró¿alski. Boro and C. Res. Y. Srinvas. Liu. Ethnopharmacol.I. Planta Med. Zhang Y. Antibacterial ligands and triterpenoids from Rostellularia procumbens.. Lancet 363: 532 Tsuchiya H. P. Vaidyanathan R. Unno N. C. Tanigaki. Nanotechnology 21: 415101. L. Storhoff J. Nalini. Homogenous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticles probes. Suzuki. 2010 b. Wainwright M. Facile synthesis and functionalization of water-soluble gold nanoparticles for bioprobe... Dunleavy.T. I. Gençay and B. A. Garimella.R. Microbiol. Salvipisone and aethiopinone from Salvia sclarea hairy roots modulate staphylococcal antibiotics resistance and express anti-biofilm activity. Langmuir 20: 1909–1914. Photothermal flow cytometry in vitro for detection and imaging of individual moving cells.. Antibiotic resistance in the environment: a link to the clinic? Curr. Wysokiñska. Ró¿alska.. Med. Dyes Pigments 76: 582–589. Walencka E. S. A. Colloid Interface 275: 177–182. Various functions of selected bacterial pigments (in Polish).A. 2010. J. D. Int. Chiozem. Kurek. Lett. B. 160: 189–195. Agents 36: 14–18. S. Valodkar M. 2008. Anal. K. 1995. 2007. Erythrosine is a potential photosensitizer for the photodynamic therapy of oral plaque biofilms.P.. G.. Kalishwaralal. 2009..V. Devkota. Sorkun..D. M. 373: 572–575.S. Biol. V. A. Photobiol. Ohyama. J.V. Endovasc.P. Veigas B.E. Ciprofloxacin-protected gold nanoprticles. Zhang and Y. M. 2010.I. Microbiol. Nishiyama. Uzel A. Dyes in the development of drugs and pharmaceuticals.R. 1: 815–819. E. K. Tcho. 2007. Post. D. Deepak. Pharm. Onçag. F. Biophys. Y.L. K. Mercer. J. S. Wolska K. Cogülu. Byeon. soybeans). Viveiros and P. K. Opin. 2005. Bao and U. Ananthan and R. K. L.J. Metcalf. Rao.D. Tomi N. J. Kurek. Thakore. Wolska K. S. 2010. Bhadoria. Park and J. Chen. Iinuma. B. Portugal.S. Nat.

1991) and elicits a rapid Antibody response after the onset of the disease. Thus. horseradish peroxidase. Beijing 100015. e-mail: lunyz@163. However. An estimated 170 million people are infected with HCV worldwide (Armstrong. antibody responses to HCV core protein may be considered to confer protection against HCV infection regardless of viral subtypes. 1999. ZENG-GUO YU1. 2000). HCV core protein is highly conserved among the various HCV genotypes (Houghton et al... After five rounds of panning 60 phage clones specific to core protein were obtained and one selected clone was sequenced. Phage display technology offers a means of cloning human anti-HCV antibodies coding gene of a defined specificity that may have potential therapeutic use (Canaan-Haden et al. phage display. using HCV core protein as the immobilized antigen and proceeding immunohistochemistry. 2. We now utilize a semi-synthetic human single-chain Fv antibody library and solid-phase bound hepatitis C virus core protein to screen out the phage display antibody that recognizes the HCV core protein (Zhong et al. the production periodicity of McAb made by hybridoma technique is relatively long.com . MAb. 2003.. monoclonal antibody. accepted 14 January 2011 Abstract Expression of single-chain variable fragment (scFv) antibodies on the surface of bacteriophage is widely used to prepare antibodies with pre-defined specificities. QI WANG2. Large et al. In addition. clinical testing has shown that murine monoclonal antibodies may evoke human anti-mouse antibody response. It was found that the specifically detected antigen consists of 774bp and is capable of encoding 257 amino acids in the patients but not in healthy persons. single-chain variable fragment antibody Abbreviations: HRP. 2001). Tanaka et al.. HCV. Stoll-Keller et al. JUN CHENG2.. Hepatitis C virus. YAN-WEI ZHONG2. No 1. 13–17 ORIGINAL PAPER Cloning. core protein. Dalian 116622. scFv antibody against HCV core protein. 1999). HCV is a member of the Flaviviridae family and has been recognized as the major causative agent of chronic liver disease. 2009). Vol.. The presence of serum HCV core protein is associated with active HCV viremia..Polish Journal of Microbiology 2011. The monoclonal antibodies (McAb) of HCV core protein could passively conduce to prevent HCV infection. 2000. Medical College Dalian University. FANG WANG and JIE FENG1 1 Liaoning Provincial University Key Laboratory of Biophysics. *. 1995). cirrhosis and hepatocellular carcinoma (Di Bisceglie. China 2 Institute of Infectious Diseases. thereby playing a key role in the induction and maintenance of chronic HCV infection and liver damage (Kittlesen et al. A phage antibody library containing the gene for scFv antibody against Hepatitis C virus core protein was panned with core protein immobilized on microtiter plate wells. It has recently been suggested that HCV core protein suppresses the antiviral cytotoxic T-lymphocyte response by interacting with the C1q complement receptor. 2000). revised 17 December 2010. single-chain variable fragment. In addition. scFv. Expression and Identification by Immunohistochemistry of Humanized Single-Chain Variable Fragment Antibody against Hepatitis C Virus Core Protein YONG-ZHI LUN1. K e y w o r d s: Hepatitis C virus. including chronic active hepatitis. * Corresponding author: Yong-Zhi Lun. Beijing Ditan Hospital. Introduction Hepatitis C virus (HCV) was first described in 1989 as the putative viral agent of non-A non-B hepatitis. and its detection is now used for clinical evaluations (Dickson et al.. China Received 29 April 2010. 60. HCV core protein scFv antibody.

5. After pelleting the cells were resuspended in 200 ml of 2× TY broth containing 100 mg/ml ampicillin and 25 mg/ml kanamycin (2× TY-AMP-KAN). and stained with DAB and hydrogen peroxide.-Z. A human scFv antibody phage library in which the genes encoding VL and VH were amplified by PCR with degenerate primers and connected with a glycine linker [(Gly4Ser)3]. Aliquots (20 µl) of each clone were transferred to 400 µl of 2×TY-AMP and further cultured until A600 reached 0. resuspended in 50 ml of 2× TY broth containing 100 mg/ml ampicillin (2× TY-AMP). the plates were incubated in 2% BSA in PBS for 2 hrs at 37°C (blocking). The phage-containing elutate was immediately neutralized with 0. Restriction digestion and subsequent 1% agarose gel electrophoresis confirmed the identity of the recombinant pCANTAB5E-scFv vector. To rescue phagemids from the library.0 mol/l Tris-HCl pH 7. M13K07 phage was employed as helper (Pharmacia). and 30 phage clones were picked up randomly from well-isolated colonies on the top-agar plates.m. Each clone was grown in 400 µl of 2× TY-AMP-GLU at 37°C overnight. were examined. After the run the gel was blotted onto a PVDF membrane (Millipore). DNA sequencing. The phage was used to infect 10 ml of log-phase E.5. M13K07 phage served as negative control. The plates were rotated gently for 10 mins. Immunohistochemistry. The bacteria were inoculated with M13K07 phage (1×1010 PFU) and incubated for 30 mins at 37°C without shaking. A recombinant HCV core protein from Virostat (USA) was employed. The reaction was stopped with H2SO4 and A450 was read. To collect samples for ELISA the supernatants after centrifugation at 12. for 1 min at 4°C were saved. Western blot analysis.05% Tween 20-PBS and a tetramethylbenzidine solution was added for 10 mins at 37°C. Phage particles were purified and concentrated using polyethylene glycol and resuspended in 2 ml of distilled water. Identification of phage clones. The washing was repeated and the purified phage in 2% BSA (1 ml) was added. and shaken for 12 hrs at 37°C. The culture supernatant was diluted 1:1 with 2× SDS loading buffer.5% hydrogen peroxide at room temperature for 50 mins.1% Tween 20 and 20 times with PBS. After blocking for 2 hrs at 37°C 50 µl aliquots of culture supernatants and 50 µl of 2% BSA were added per well for 1 hr at 37°C. and shaken until A 600 reached 0. heated at 100oC for 10 mins. incubated with an antiE-tag MAb for 1. Denmark) were coated with 1 ml of HCV core protein (80 µg/ml) per well in a coating buffer (50 mmol/l carbonate/bicarbonate pH 9.m.000 r.5 hr and with a secondary HRP-goat anti-mouse IgG antibody for another 1 hr. To express the scFv antibody in soluble E-tagged form the selected clone was subcloned into the pCANTAB5E expression vector. The panning (amplification-adsorption-elution) was repeated 5 times. Delta surface plates (Nalge Nunclon International. coli XL1-Blue was transformed with pCANTAB5E-scFv and induced with IPTG for 20 hrs. Expression of soluble HCV core protein scFv antibody in E. The bound phage particles were eluted from the plates with 1 ml of 100 mmol/l triethylamine per plate. et al. Plasmid DNA was prepared from the culture of a selected positive clone using Wizard Plus Minipreps DNA Purification System (Promega) and sequenced in an ABI3700 automated DNA sequencer (Perkin Elmer). ELISA.05% Tween 20 in PBS a 1/5000 dilution of horseradish peroxidase (HRP)-labeled anti-M13 secondary antibody was added for 1 hr at 37°C. left undisturbed for 90 mins at 37°C. 5 ml of 2× TY broth containing 100 mg/ml ampicillin and 1% glucose (2× TY-AMP-GLU) was inoculated with 10 µl of Escherichia coli TG1 taken from the library stock and grown for 3 hrs at 37°C.14 Experimental Materials and Methods Lun Y. and washed 20 times with PBS with 0. The plates were washed and loaded with the secondary antibody as described above. The blot was blocked with 5% non-fat dry milk for 2 hrs. The bacteria were spun down. After adding a helper phage the cultures were incubated at 30°C overnight. and kept in 5% .p. After washing with 0.5 ml of 1. coli. The colonies were picked up into 2 ml of TYE-AMP-GLU per colony with 30% (v/v) glycerol and stored at –20°C. After deactivating endogenous hyperoxidase the slices were submersed in a methanol solution (should be defined) with 0. Wells of 96-well-plates were coated overnight with 8 µg HCV core protein per well in the coating buffer. Phagemids rescue. The culture was centrifuged at 10. Competent E. 1 Materials.000 r. Paraffin-embedded liver tissue slices from patients with positive anti-HCV antibodies and HCV-RNA. The plates were washed with 0. After blocking 100 µl aliquots of diluted (1:50) culture supernatants were added per well for 1 hr at 37°C. and the supernatant was subjected to SDS-PAGE and Western blot analysis.p. briefly centrifuged again.4 and stored at 4°C. coli TG1 plated on TYE-AMP-GLU plates and grown overnight at 37°C. After washing with Tris-borate-saline (TBS). was purchased from Novagen (USA). Screening of HCV core protein scFv antibody clones. Wells of 96-wellplates were coated overnight with 8 µg HCV core protein in 100 µl of coating buffer per well. washed with PBS 3 times. and 20 µl of the supernatant was used for SDS-PAGE.6) overnight at 4°C.

a-f: positive clones’ culture supernatant with scFv antibody against HCV core protein.TRTKRF AMS YYADSVKG L chain CQGDSL. g: helper M13K07 instead of phage antibodies..3 % CoCl2. A sheep HRP-anti-M13 antibody diluted 1:200 was dropped on tissue preparations and left to react for 40 min at 37°C. The preparations were washed 3 times with PBS. Then the slices were incubated with the scFv antibody diluted 1:100 for 1 hr at 37°C and overnight at 4°C. Six of these showed a low cross-reaction with BSA (Fig. The binding activities of the phage antibodies from six clones infected by bound phage particles to coated 8 µg HCV core protein and 20 µg bovine serum albumin. coli XL1-Blue transformed by expression vector.6). coli XL1-Blue transformed with pCANTAB5E-HCV core protein-scFv (lane a) and supernate protein from induced E. 1). Negative controls consisted of PBS instead of the scFv antibody and liver tissue preparations from healthy persons.5 ml 0. Fig. Results Identification of HCV core protein scFv-positive clones. Japan) Fig. .GKNNRPS RSYYAS NSPDSSG. b: DNA fragment with HCV core protein scFv gene. coli XL1-Blue transformed with pCANTAB5E-HCV core protein-scFv (lane b).WGQGALVTVSR YLQMNSLRAEDT -AVYYCAR GIPDRFSGSSSGN. Supernate protein from non-induced E. After five rounds of panning (amplificationabsorption-elution) 60 clones were picked up and tested for HCV core protein scFv antibody by ELISA. 13. Twenty of these were found positive. a few drops of a DAB solution (9 mg DAB. 1. 2. used as negative. and 15 ml 30% hydrogen peroxide) were added.5 ml 0. After 10 min at room temperature the preparations were washed with PBS 3 times and 1% haematin was used to stain the cell nucleus. Western blot analysis of the supernate protein derived from induced and non-induced E. 1. After a standard dehydratation procedure the preparations were observed under microscope. 2).FGGGTKLTVLG TASLTITGAQAEDEADYYC BSA overnight at 4°C.1 ScFv antibody against HCV core protein Table I The complementarity-determining regions (CDRs) and framework regions (FRs) of deduced amino acids sequence of ScFv against HCV core protein CDR1 CDR2 CDR3 FR1 EVQLVESGGGLVRPGGSLRLSCAAS FR2 WVRQAPGKGLEWVS WYQQKPGQAPVLVIY FR3 FR4 15 H chain GFTFSSY. M: DNA Marker DL2000 (Takara Co. 3.AISGSGGST. Identification of positive clones. The digestion with NcoI and NotI and subsequent gel electrophoresis proved the presence of a 774 bp insert corresponding to the scFv antibody gene (Fig.SELTQDPAVSNHVV VALGQTVRIT RFTISRDNSKNTL. Fig.01 M Tris-HCl (pH7. Restriction map of plasmid DNA carrying HCV core protein scFv gene prepared from a single positive clone by NcoI/NotI digestion. One positive clone with the highest reaction with HCV core protein and the lowest reaction one with BSA was chosen for a confirmatory test with restriction digestion. a.

The mature HCV protein is located in the cytoplasm of infected cells.. Second. Immunostaining of HCV core protein of liver tissue sections. 1997). Phage libraries are a powerful tool for the selection of antibodies of important and useful specificities. 2003). and probably plays a pivotal role in the pathogenesis of HCV infection (Lai and Ware.. et al. coli. 1996). The HCV core protein is highly antigenic. 4). 4. Noticeable. Sequencing of HCV core protein ScFv gene. 1998. some of which are buried in a small hydrophobic core in the nuclear magnetic resonance structure of the peptide in solution. so that it is possible to obtain a high affinity antibody from this selection. particularly for humanized scFv antibodies (Marks et al. which may provide novel targeting vehicle for diagnosis and treatment of diseases.-Z. First. B: Immunohistochemistry of HCV core protein of liver tissue from patients with chronic hepatitis C. soluble scFv antibodies are currently generated by advanced recombinant phage antibody technique. HCV core protein was mainly located in the cytomembrane of the hepatocytes. In contrast. induces specific cellular and humoral responses. It can mimic the maturation process of human antibody in vivo. A negative control consisting of E. These results indicated that the soluble form of human HCV core protein scFv antibody was successfully expressed in this system. 1 Discussion B Fig. self-made anti-HCV core protein single chain antibodies used as primary antibody. . Lamarre and Talbot. The corresponding amino acid sequence was deduced and complementarity-determining regions and framework regions were located according to the Kabat database (Table I). 3). it is the only method to get specific antibody by passing the immunization step. If an antibody library of human origin is used. Expression of HCV core protein scFv in E. the selected antibody is most suitable to human administration and is potentially applicable to clinical diagnosis and treatment of both infectious disease and cancer. The availability of an anti-HCV core protein humanized scFv antibody allowed the development of an ELISA to detect HCV core antigen in peripheral blood of patients with HCV (Aoyagi et al. 2000. A: Immunohistochemistry of HCV core protein of liver tissue from health person. where it polymerizes in the presence of genomic RNA to form viral capsids (Reed and Rice. in close vicinity to the perinuclear membranes and the endoplasmic reticulum.. coli infected with empty vector did not show any specific protein.. It has many advantages.16 A Lun Y. Rondon and Marasco. The major neutralizing epitope of HCV core protein lies within the first 45 aa of the protein. a MAb against the recombinant HCV core protein prepared from hybridomas is of murine origin and hence immunogenic if used systemically in humans (Songsivilai et al. 1999). Finally. In order to overcome the disadvantages of an intact MAb applied in vivo and to offer an antibody with a stable genetic source. No AF271150).. its background in immunohistological study is very low. Hoogenboom et al. The nucleotide sequence of the selected clone was determined and submitted to GenBank (Acc. Immunostaining of HCV core protein of different sections from liver tissues of healthy persons and patients with chronic hepatitis C. Immunostaining of sections of liver tissues from and 17 patients with chronic hepatitis C and healthy persons gave positive results in the former but not latter group (Fig. 1991. coli and confirmed by Western blot analysis (Fig. The HCV core protein scFv antibody was expressed in E. Nelson et al. the recognized epitope (29–37: QIVGGVYLL) has an unusual preponderance of hydrophobic residues. core protein was detected in the cytoplasm of some liver cells (arrowhead pointing).. suggesting that the antibody may induce a structural rearrangement upon recognition (Menez et al. 1997. the major antigenic segment of core recognized both by murine and human antibodies. a scFv antibody consisting of antigen-binding domains of heavy and light chain regions of immunoglobin connected by a flexible peptide linker is a small-size molecule compared with the full-length antibody. 1997). 2000). as it contains no Fc fragment.

Rice. Characterization of phagedisplayed recombinant anti-idiotypic antibody fragments against coronavirus neutralizing monoclonal antibodies.. H.A. development.. Di Bisceglie A. Microbiol. Armstrong G. Orito. 37: 1802–1808. C.G. Curr. Germany. 10: 175–182.. Screening and characterization of human phage antibody to hepatitis C core antigen (in Chinese). Overview of hepatitis C virus genome stucture. Reed K. Hufton. Bonnert. K.D. 2000.C. Development of a simple and highly sensitive enzyme immunoassay for hepatitis C virus core antigen. C. Investig. Immunol.J. Clin. Immunotechnology 4: 1–20. Tanaka E. Crystal structure of a hydrophobic immunodominant antigenic site on hepatitis C virus core protein complexed to monoclonal antibody 19D9D6. Microbiol.R. Fafi-Kremer.K. Hepatology 14: 381. M. H. Hoogenboom and T. and protein properties. Hepatology 31: 1014–1018. The role of hepatitis C virus-specific cytotoxic lymphocytes in chronic hepatitis C.H.J. Stoll-Keller F. Han.. Ayala and M. 158: 1473–1481. we succeeded in cloning the HCV core protein scFv gene by means of the phage display library technique. M. Marasco.Q. coli. J. Intracellular antibodies (intrabodies) for gene therapy of infectious disease. Biotechniques 19: 606–612..S. J. Talbot. 2000. J. Yao. Houghton M. Bossus and B. Aoyagi. Quantification of serum HCV core antigen by a fluorescent enzyme immunoassay in liver transplant recipients with recurrent hepatitis C: clinical and virologic implications. 1996. and control of viral disease.. J. Rondon U. Rice. Natural history of hepatitis C: its impact on clinical management. Immunol. Development of hepatitis C virus vaccines: challenges and progress.. The hepatitis C viruses. and C.. Purification and application of a single-chain Fv antibody fragment specific to hepatitis B virus surface antigen. 1991. Hahn. 1998.L. Biol. and P. de Bruine and S. 2001. Epidemiol.P. 1997. Kittlesen D. J. Expert Rev.H. 32: 725–726. 1999.E. 68: 1512. Shi. Mol. Cheng and S.M. Kittlesen and Y. C. Muller. Interaction between complement receptor gC1qR and hepatitis C virus core protein inhibits T-lymphocyte proliferation.1 ScFv antibody against HCV core protein 17 In this study. Vaccines 8: 333–345.. Chianese-Bullock and Z. Literature Aoyagi K.. 106: 1239–1249.E. Davis. 1995. Ohue and K. and C. . Canaan-Haden L.R.A. T. Nelson D. polyprotein processing. 1991. Anti-body phage display technology and its applications. Annu.E. Transplantation. Songsivilai S. 2000. Molecular biology of the hepatitis C virus: implications for diagnosis. A.M. Immunol. 1999. Barth and S. Top. Marousis and G. Clin. Springer-Verlag KG Berlin. Ohue and K. Microbiol. 2000. Int. Dickson R. J.. Mizokami and E. 2003. Commentary: modeling the epidemiology of hepatitis C and its complications. Dharakul and R.L. Asian Pac J Allergy Immunol. Fernandez-de-Cossio. Evaluation of a new enzyme immunoassay for hepatitis C virus (HCV) ore antigen with clinical sensitivity approximating that of genomic amplification of HCV RNA. Suppression of host immune response by the core protein of hepatitis C virus: possible implications for hepatitis C virus persistence. Zhong Y. Rev. Hagedorn C. Hepatology 32: 388.. Hoogenboom H.R. and W. Weiner and J. 242: 55–84. 2000. Immunol. Molecular cloning and expression of hepatitis C virus core protein and production of monoclonal antibodies to the recombinant protein. These results illustrate the feasibility of using the antibody-engineering technology that may prove useful in the future for diagnostics and therapy of hepatitis C infection.J. 1999. 2003. Large M. M. D. J. Lamarre A. 162: 931–938. 1997. 51: 257–283. 14: 31–41. 170: 1917–1924. The cloned gene was sequenced and expressed in E. 2009. A. J. Viral. Immunol. 222: 581–597. Menez R. Marks J. Iida.M.. 1997. Byimmunization human antibodies from V-gene libraries displayed on phage.P.. Zhonghua Gan Zang Bing Za Zhi 9: 217–219. Kunkitti.

18 Lun Y.-Z. 1 . et al.

19–26 ORIGINAL PAPER The Occurrence and Comparative Phenotypic Characteristics of Staphylococcus spp. K e y w o r d s: Staphylococcus spp. colonization differs considerably for animals living in the two tested habitats. and Biotechnol. A total number of 104 isolates representing different staphylococcal species were isolated and identified using routine biochemical methods applied in diagnostic laboratories. and “Alvet” Veterinary Clinic.. perineum. intermedius was the most frequent species isolated from healthy dogs. S. ear. from dogs. 5 and JACEK MIÊDZOBRODZKI4* for Microbiological Research and Autovaccines Ltd. but was rarely isolated from the ears... No 1. Bacteria that constitute this genus. Kraków. were examined. of Microbiol. Kim et al. 1998). e-mail: jacek.. 7. Poland of Microbiology. either healthy or with infected skin lesions. ANNA BIA£ECKA1. Poland. Overall. WIES£AW BARABASZ2. NATALIA MA£ACHOWA4. fax: +48-12-664-6902. revised 30 November 2010. In each case bacterial swabs were collected from the nasal mucosa. accepted 6 December 2010 Abstract To determine the staphylococcal colonization pattern in healthy and diseased dogs. Household and Shelter Dogs. living in two particular environments. In 1976 Hajek described a new staphylococcal coagulase-positive species Staphylococcus intermedius which colonized predominantly the skin and the mucosal membrane of the nasal vestibule in dogs (Hajek. Kraków. a number of microbiological samples were taken. Poland 4 Department of Microbiology. intermedius strains (Nagase et al. In our study. Gronostajowa Str. USA 2 Department 1 Centre Received 9 September 2010. Jagiellonian University. Król. Faculty of Biochem. Among 17 isolated staphylococcal species. OLGA JAWORSKA3. from Healthy and Diseased. lumbo-sacralis triangle.. the lumbo-sacralis triangle and perineum. twenty dogs. colonize a number of domestic animals. The pattern of Staphylococcus sp. aureus MRSA and MSSA isolates were detected only in infected skin lesion samples from animals that dwelled in the animal shelter. intermedius was found to be a predominant causative agent in canine skin infections. 2001.. Kraków Society for Animal Care. 1987). MT. phenotyping. 1984. phone: +48-12-664-6371. Usually occurring in healthy individuals. JOANNA BIA£ECKA1. National Institute of Health. These two ecological niches were proposed to be the source for colonization of other areas in healthy dogs by S.edu. Agricultural University of Kraków.. Kraków. As could be expected. Devriese and DePelsmaecker proved in their research that S. and from the infection sites if such were present. Usually they belong to the normal skin flora of these animals commonly present on skin and mucosal membranes (Stepanovic et al. intermedius in its carrier-state. Hamilton. 1988. we demonstrated that S. irritation and infectious * Corresponding author: J.. Poland 5 Laboratory of Human Bacterial Pathogenesis. Miêdzobrodzki. intermedius strains were predominantly isolated from nostrils and the rectum region of healthy dogs (Devriese and DePelsmaecker. 2005).miedzobrodzki@uj. It comprised 40. 1976). Vol. Later studies revealed that S.pl . Staphylococcus intermedius was the most common species isolated from both healthy or diseased dogs living either in animal shelter or household environments. 30-387 Kraków. Biophys. biochemical methods Introduction Staphylococcus species are considered to be one of the most widespread bacteria found in nature. In particular. Kraków. Faculty of Biochemistry. Based on Routine Biochemical Diagnostic Methods ANDRZEJ KASPROWICZ1. Dept.. Dermatitis or inflammation of the skin is caused by the diverseness of allergens. inhabits mainly the mucosal membrane of the nasal vestibule. intermedius can cause a variety of infections in dogs and cats (Biberstein et al. 60. diagnostic. Poland 3 Rescue Animal Shelter. S. 2002). IZABELA GODZISZ2. under favorable conditions S. including dogs and cats. Hauschild and Wojcik. It was also found in the samples taken from the skin.3% of all isolated strains and was identified as a resident of the physiological bacterial flora of healthy dogs (Cox et al. Biophysics and Biotechnology Jagiellonian University.Polish Journal of Microbiology 2011. 2007).

. there were no immunological changes. 1. moist and wrinkled skin regions. Characeistics of all examined dogs were caused by hypersensitivity. 2009.. et al. It consisted of 20 mongrels. The examined group of dogs was heterogeneous. Bearing this in mind. 2002. no skin lesions were observed. The lesions were not only always exuding with pus or serum-pus.. Guardabassi et al. Five out of 7 sheltered dogs. 2009). also from the infection site (Fig. (ii) characteristic of the isolated bacterial strain by standard phenotypic methods. Kizerwetter-Œwida et al. living either in a rescue shelter or households.. the nasal vestibule. The dogs living in an animal shelter had been staying there for a few weeks up to 3 years. either flesh or deep skin infections can be observed. Swabs were taken from each dog from both the left and right ear. Commonly in both cases. or systematic diseases (Hendricks et al. pseudintermedius) can be distinguished almost only by genetic methods. Bacterial samples isolated from 20 healthy and diseased dogs were examined. Infective skin lesions usually show up in warm. Bacterial strain isolation. 12 had skin lesions and the remaining 8 had none. In the 8 remaining dogs. Samples were taken from skin lesions found in sick dogs as well as from healthy dogs without skin changes. There were no spontaneous bacterial infections either. 1 factors. intermedius is the main causative agent. Different reservoir sites for staphylococcal strains in dogs .. where there appear to be propitious conditions for bacterial colonization and progression of pyoderma (Allaker et al. In pyoderma. but also painful and strongly pruritic. understood as autoaggression. A similar time range was for the dogs living in household environments. disparity and potential relationship between the different colonization patterns of the staphylococcal species characteristic for healthy and diseased dogs. It occurs fairly often among dogs. The samples were collected by a veterinarian. All the isolated samples/strains were described in the following manner: (i) classification of the etiological agent causing from skin infections. Devriese et al. S. and may have had pus complications. 2. intermedius species among the veterinary society. Notwithstanding the growing responsibility and microbiological awareness among dog owners and the increasing interest for the S. Although based on the fact that some staphylococcal species (S. 2008).. as well as from the back. intermedius and S. and 7 out of 13 household dogs demonstrated skin lesions. and in the case of the diseased dogs. Experimental Materials and Methods Fig. These lesions Fig. Among the 20 dogs. The material used for research was derived from skin lesions caused by flea allergy dermatitis. 1993. knowledge of the bacterial flora composition of the dogs skin would be extremely useful in the epidemiological study of a variety of a skin infections that occur in dogs. However. 2009). and perineum. such as lupus or pemphigus. The main goal of this project was to determine the similarity. 2004). as shown in Figure 1. Pyoderma is a type of dermatitis. Commonly the diagnostics of bacterial strains isolated from dogs are based on phenotypic methods and these type of methods were considered in this study (Miêdzobrodzki et al. 2)..20 Kasprowicz A. the further introduction of genetic based techniques in routine veterinary diagnostics is essential (Bannoehr et al. both male and female that weighed from 5 to 45 kg. this species still has not been adequately studied.

7%) 0 1 (2. S. aureus (MRSA) S. The remaining strains belong to the coagulase-negative group.4% of all isolated strains. warneri S. gallinarum. Bacterial identification was performed by a coagulase tube test (Biomed. Dogs from the animal shelter were carriers for such staphylococcal species. and S. Animals living in the shelter carried 11 different species. ID32 STAPH (BioMerieux.1%) 5 (8. S.7%) 5 (8.2%) 3 (6.0 %) 3 (6.7%) 1 (1. Throughout the biochemical analysis.4%) 0 0 4 (6. and S. intermedius S. The PASTOREXTM STAPH-PLUS test showed that only 39 among all strains (37. epidermidis ATCC 12228 were tested alongside the canine isolates. warneri.2%) 11 28 (47. In order to confirm identification of staphylococcal species. Phenotypic characteristics of isolated strains. 2009). Microbiological samples isolated from dogs were inoculated onto Columbia blood (supplemented with 5% sheep blood).5% and 31. respectively for the animal shelter and household environment. haemolyticus S. from dogs living in the animal shelter or households. hominis. Weese et al. Table I. Coagulase-positive staphylococci produced black. simulans S.5%) 1 (1. All strains demonstrated typical colony growth on blood and Baird-Parker selective agar. S. despite of habitat. Gram staining was performed (Beveridge. intermedius. The free coagulase tube test revealed a positive reaction in 61 strains (59%). Detection of the clumping factor with rabbit plasma was performed by PASTOREXTM STAPH-PLUS test (BIO-RAD). After an incubation period of 48 h at 35°C. were isolated only from dogs living in the households. Biochemical identification. whereas no coagulation was observed in the remaining 43 (41%) strains. aureus ATCC25933 and S. In the group of 11 isolated species the most frequent. Poland). intermedius (46 strains) and S. 55. S. ears. 2007a.7%) 1 (2. chromogenes. Domicile and Staphylococcus sp. like S.. Manifestation of particular staphylococcal species in samples isolated from the nasal vestibule are shown in Table II. It accounts for 40% and 47. schleiferi S. 57 (55%) did not produce this factor. cohni S.2%) 1 (2.7%) 8 (17. Results A total of 104 staphylococcal strains were isolated from healthy and diseased dogs living in either animal shelter or households. gallinarum S. convex colonies with entire margins and clear zones with or without an opaque zone around the colonies.7%) 0 1 (1.5%) 1 (1.2%) 0 3 (6.5%) 1 (1. All isolates were evaluated for catalase activity and furazolidone resistance. aureus (11 strains) were the only two coagulase-positive staphylococcal species isolated among all the tested canine strains.7%) 0 1 (1. simulans that were not isolated from any animal living in the household environment. Nevertheless. isolated from dogs 21 (iii) correlation between a particular isolation site and a staphylococcal species. A total number of 104 isolates was received from 20 examined dogs. all colonies were screened and staphylococcal-like colonies were isolated and plated on tryptic soy agar for 24 h at 35°C. Poland) analysis was done (Sasaki et al. On the other hand. S. hominis S.7%) 0 12 Staphylococcus spp. shiny. sciuri Total number of staphylococcal species mucosal membrane of the nasal vestibule.1 Staphylococcus spp. epidermidis S. Microscopic analysis.8%) 0 3 (5. whereas 12 species were isolated from dogs living in household conditions. . Regardless of living environments. intermedius isolates were the most common.2%) 3 (6. Although the production of the clumping factor was detected in 44 (42%) strains.. To confirm the purity identification of all the 104 isolates to Gram-positive cocci. 2001). lentus S. A total of 17 different species belonging to the Staphylococcus genus were found.8%) 0 2 (4. In terms of the ID32 STAPH method. saprophyticus. Pure isolates were then used for future experiments. and for 3 (3%) strains the results were uncertain. and Table I Distribution of 104 strains of the Staphylococcus species in all examined dogs Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-45 13 household-59 strains strains 18 (40. S. equorum S. two reference strains S. aureus strains (MSSA and MRSA) were isolated only from samples obtained from the shelter. Based on the obtained results the difference between staphylococcal profiles and the various environments that they colonize was noticeable. aureus (MSSA) S.5%) have the ability to autoagglutinate. saprophyticus S. xylosus S. lugdunensis S.7%) 8 (13. intermedius was detected more often in samples taken from dogs kept in households than in the animal shelter.4%) 0 0 0 1 (2. variety. BairdParker and Candida ID agar within 2 hours of isolation.7%) 1 (2. such species as S.6% respectively. chromogenes S. 104 strains were identifiable. was S. A fact worth noticing was that 11 S. Table I presents the rate of occurrence of different staphylococcal species in swabs taken from the skin.

chromogenes Total number of staphylococcal species Table III Staphylococcal strain distribution in the perineum region Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-19 13 household-12 strains strains 4 (33.7%) 1 (8. In comparison to the samples taken from shelter animals. Table IV. simulans S. hominis S.3%) 2 (16.6%) 2 (11. intermedius (75%) and S. saprophyticus.6%) 1 (5. gallinarum. saprophyticus S.7%) 1 (8. aureus S. S. chromogenes. warneri S. xylosus S. hominis S.6%) 2 (10.3%) 6 Staphylococcus spp. and S. aureus S.7%) 0 3 (25. While. S. S. The next preferred region was the lumbo-sacralis triangle and perineum.3%) 0 0 0 0 0 7 4 (33.7%) 2 (16.0%) 2 (16.22 Kasprowicz A.3%) 0 0 0 0 7 10 (55.6%. From the lumbo-sacralis triangle region shown in Figure 2. S. intermedius. haemolyticus.7%) 2 (16. et al. regardless of their living environment. In both healthy and diseased dogs. The following species were detected in swabs taken from the perineum region of the sheltered animals: S. warneri were presented in the samples taken from the animals living at home. S.5%) 1 (5. equorum S. chromogenes. aureus strains were isolated mainly from the mucosal membrane of the nasal vestibule of dogs living in the shelter in the range of 31. S.7%).7%) 1 (8. equorum. aureus S.3%) 1 (5.3%) 8 Staphylococcus spp. sciuri or S. xylosus S. Table III.3%) 1 (8.1%) 0 0 1 (5. isolated from 12 dogs with infection sites are listed in Figure 4. S.1%) 7 1 Table IV Staphylococcal strain distribution in the lumbo-sacralis triangle region Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-8 strains 6 (75. 2 and 8 species respectively. xylosus or S. As mentioned above only two species were isolated from the lumbosacralis triangle samples from sheltered dogs: S.0%) 0 0 0 0 0 0 0 2 13 household-12 strains 2 (16. 9 species of Staphylococcus were distinguished. cohni S. gallinarum S. cohni S. aureus (25%). aureus. In 5 out of 7 dogs living in households it was the only staphylococcal species isolated from the skin lesion. hominis. S.0%) 2 (25. lugdunensis. This should be treated as a trend because the number of examined dogs was relatively low. including: methicillin-resistant . lugdunensis S. S.3%) 1 (8. intermedius S.3%) 1 (8.3%) 2 (16. Adjacent to coagulasepositive species. domestic dogs carried S.6%) 0 2 (11.3%) 1 (5. Furthermore.5%) 2 (10. The rate of occurrence of different staphylococcal species. equorum. sick or healthy carried strains of this species in the nasal vestibule.3%) 1 (8. equorum S. Over 50% of all animals. S. cohni were found only in dogs from the shelter. S. the patterns of colonization were similar.3%) 1 (8. as it is shown in Figure 3A and Figure 3B. warnerii. haemolyticus S.5%) 0 1 (5. and S. chromogenes S.6%) 1 (5.3%) 1 (8. intermedius S. it was the only staphylococcal species shared among household and shelter dogs. however was isolated more often from the sheltered dogs (75%) then from animals living in households (16. lentus. haemolyticus S.6%) 6 (31. epidermidis Total number of staphylococcal species S. schleiferi S. chromogenes S.3%) 0 0 0 0 0 0 2 (16. Table II Staphylococcal strain distribution in the nasal mucosa Living environment of examined dogs total number of bacterial strains (%) 7 sheltered dogs-19 13 household-18 strains strains 6 (31. intermedius in carrier-state. The etiological factor for skin lesions of canine origin. 7 additional Staphylococcus spp. S. intermedius was also the most prevalent species among isolates from the perineum region. epidermidis in the material from the same isolation region. S. simulans. lentus S. The above data demonstrated that S. sciuri S. intermedius S. Moreover. intermedius. were isolated. predominantly colonized nares of tested dogs. S. Table IV. haemolyticus S. Subsequently.7%) 1 (8. coagulase-negative staphylococcal species were also present in the biological material.3%) was S. S. the dogs living at home were characterized by a broad range of staphylococcal species.3%) 1 (8. The most common species found in 7 out of 12 examined animals (58. lentus S. equorum S. S. S. warneri Total number of staphylococcal species Staphylococcus spp.

chromogenes were found in skin infections. aureus (MRSA). Distribuion of S. S. S. isolated from dogs 23 Body site earlier. haemolyticus. xylosus. aureus is isolated from dogs living at the shelter. Distribution of Staphylococcus species found in infected skin lisions of 12 examined dogs . S. equorum. nevertheless it was isolated more repeatedly from animals living in households (71. only S. aureus (MRSA). S. S. These differences could be explained by distinctness in animal exposition to other Fig. S. S. whereas S. where S. Evidently. 2002). At the same time other studies show a slightly different profile of isolated strains from dog skin at carrierstate: S. lentus. 4. capitis. haemolyticus..1 Staphylococcus spp. equorum. chromogenes and S. Among the 8 species mentioned Fig. intermedius in the carrier-state at different body sites in sheltered and household dogs Body site Fig. In the recent study we took an effort to characterize the contribution of the different staphylococcal species in the colonization of dogs living in two different environments: the animal shelter and households. S. S. Our data confirm the general trend that S. cohni which appeared to be single cases. S. Among these species S. which contribute to the physiological skin flora. (Nagase et al. 3A. chromogenes. xylosus. and S. and S. by Nagase et al. Staphylococcus species are not out numbered among this flora. cohni were identified. intermedius occurred in 40% of these animals. heamolyticus. The most typical staphylococcal species isolated from canine skins are S. simulans. Distribuion of S. saprophyticus (Hauschild and Wójcik. intermedius strains are isolated at a higher rate from dogs that inhabit households. intermedius was the dominant species in each habitat. beside S. Staphylococcal species distribution in diseased dogs was also analyzed based on habitat. In skin infections of dogs living in household conditions. intermedius strains. simulans. intermedius. S. intermedius in the carrier-state at different body sites in healthy and diseased dogs S. S. S. S. S. aureus. sciuri. So far not many studies have been done to determine the staphylococcal colonization pattern based on a specific part of the body or living habitat conditions of the animals from which swabs were taken. S. S. simulans. and S.4% of all animals). Discussion Normal animal skin is colonized by numerous bacterial species. intermedius. 2007). 6 originated from animals living in the shelter and three from dogs living at home. 3B. xylosus. A greater variety of staphylococcal species were found in skin lesion samples taken from animals living in the shelter. Figure 4.

Our observations enriched by recent reports by other authors expand the knowledge to be more precise which brings focus to ecological phenomena and epidemiological pathways. The achieved data enriches our knowledge of the colonization of dogs by not only staphylococcal coagulase-postive strains like S. A carriage phenomenon and transient colonization by such strains in dogs and/or their owners facilitate the transmission of staphylococci between humans and domestic animals . The staphylococcal species isolated from healthy and diseased dogs were compared to understand the colonization although disease was not studied. These numbers grow even higher in the case of elderly persons or hospital personnel. Analysis shown in the paper is an introduction on the general elaboration of carriage phenomenon in dogs living under different environments (house/shelter) and of isolated strains from skin lesions in part of dogs in the population. Humans are colonized by MSSA or MRSA by a carriage rate of 20–40% (Shopsin et al. Furthermore. Isolates of this species were the most common. but in observation of differences in colonization and etiological factors according to dogs’ life environment. S.. S. 2008). 1994). 2003). intermedius by routine biochemical methods used in standard diagnostics.. where they can reach up to 90% (Szewczyk. The number of dogs used in the project was twenty which was not very high. 2005). seem to be an excellent example. 90% of pyoderma in dogs is caused by S. regardless of habitat and dog health conditions. pseudintermedius can be easily misclassified as S. 2009). aureus (Kloos and Musselwhite. It was a reservoir for nearly 55% of all S. 1 animals and people (Talan et al. aureus strains isolated during our research. intermedius species seem to be the only species presented in microbiological samples from infected skin lesions of dogs living in both animal shelter and household environments. that S. Dogs were taken from one acute shelter hostel and the skin lesions were clinically evaluated. intermedius but also by coagulase-negative strains. a new Staphylococcus species – S. W³adyka et al. Five out of seven of these dogs had only S. it seems that all the isolates classified in our and other projects by routine biochemical identification tests seem to be S. intermedius strains presented in the infected skin lesion. where some of them are caused by particular bacterial strains. S. There were often abrasions or wounds present on the skin. pseudintermedius was separated from the group previously considered to be S. do the carriage or the life conditions (house/shelter) effect the occurrence of disease? The less number of dogs taken in the project resulted from trouble in selection of animals. intermedius. 2000). We also reported staphylococci as etiological factors of wound infections in household or rescue shelter dogs. the final microbiological identification must require the use of genetic methods (Sasaki et al. Thus the work was to be done with high precision. 1975). Król. The idea was that the similarity in skin lesions is caused by staphylococci. intermedius species (Devriese et al. Our data show that S. The presented results are also important for understanding the epidemiology of infectious animal diseases. Dermatitis is the most common type of infectious disease found in dogs (Ackerman. 2007a. However they were used to show whether the similarity in lesions is because of same etiological factors in diseased dogs (twelve) and to recognize the staphylococcus species in healthy dogs at carrier state (eight). Throughout our study. In conclusion. healthy or diseased. which is mainly caused by S.5% of all strains isolated in these animals. Therefore.. Among this group we isolated both MSSA and MRSA strains. et al. while S. independent of the living environment of dogs. intermedius strains were accompanied by other coagulase-negative strains. followed by the lumbo-sacralis triangle region (almost 30%). Authors were interested neither in the numbers of dogs nor in possessed isolates. The main question was. So the etiological factor can be easily observed among the tested dogs and the number of dogs used were enough to give the phenomenon. aureus is one of the causative agents in skin lesions of nonpyodermal origin (Biberstein et al.. Only the dogs with skin lesions were taken for the project. It was isolated from almost 60% of all diseased animals. All the samples were taken by same veterinary doctor. A total of one hundred four bacterial strains were isolated from twenty dogs. On the other hand our data confirm. S. In the last few years. intermedius strains infection (Craig. 2005. intermedius isolates. Higher species heterogeneity was observed among bacteria in dogs from shelter and that this difference did not affect pathology. The animals from the shelter living in small closed areas and are in constant contact with other animals and moreover with the personnel.24 Kasprowicz A. the carriage in same area and the localization of dogs in environment. In the remaining two cases. pseudintermedius. The most favorable place for bacterial colonization was the mucosal membrane of nostrils.. in which bacteria from the staphylococcal genus play a crucial role.. 1989. we described the isolation of various staphylococcal strains which were constituents of the normal biocenosis of the skin of dogs.. intermedius is present in carrier-state in dogs. who are one of the main carriers of S. Dermatoses have a variety of etiological factors. aureus strains were isolated only from dogs living in the animal shelter and comprise 24. aureus or S. 1998). Bannoehr et al. Thus showing the relation between diseased to healthy dogs and house to shelter conditions. 1984).

Biberstein E.U. Jang and D. Microbiol. Weterynaria LVIII.L... Woron and S. Haesebrouck. A. M.. Nov. L. Szweda. J.. Clin. 98: 23–27. Wójcik. Microbiol. They have to be precisely analysed by a number of validated and recommended methods (Cuteri et al. Med. 2007. Nagase et al. Staphylococcus pseudintermedius versus Staphylococcus intermedius. De Graef. 27: 247–253. Environ.1 Staphylococcus spp. and multilocus sequence . Prevost. 1975.J. Wroc³aw. Snauwaert. Molecular typing of Staphylococcus aureus isolated from cows with mastitis in the east of Poland on the basis of polymorphism of genes coding protein A and coagulase. Valente. J. Zeszyty Naukowe Akademii Rolniczej.. Totsuka. Vet. Loeber and A. 1997. Med. Jakubczak et al. 1998. pulsed-field gel electrophoresis cluster. J. Syst. Dis.A. Vancanney. Literature Ackerman L. 1976. 1994. Lloyd. Sasaki et al. M. 344: 17–47. Miêdzobrodzki.. Temporal study of staphylococcal species on healthy dogs. Investigation into the basis of chloramphenicol and tetracycline resistance in Staphylococcus intermedius isolates from cases of pyoderma in dogs. Devriese L. Cleenwerck. W. Roy. W. G. R. Solyman. Transmission of multiple antimicrobial-resistant Staphylococcus intermedius between dogs affected by deep pyoderma and their owners. 2004. Noble and D. Ma³achowa et al. Monteil and Y.. Turnwald and A. M. Binek. M. Battisti A.R. 49: 747–751. Infect. Chemother.S.A.. Jacobson. Decostere and F. pp. 12: 9–13. Microbiol.S. Merletti.Takayama. Sci. J. S. Black C. Hajek V.C. K. Rzewuska and M. Appelbaum and W. Piemont. T. Histochem. Lloyd. N. H. S. I. 39: 429–433. J. Musselwhite. P. 35: 2153–2154. Itoda. M.. Frequency of superantigen-producing Staphylococcus intermedius isolates from canine pyoderma and proliferation-inducing potential of superantigens in dogs. Karasawa. In Practice 25: 418–425. J. Baele. Kloos W. Identification of predominant multilocus type. Sci.. A. Am. D.. Alpine Publications.H. Microbiol. Meth. J.J. 2009). methicillin-resistant Staphylococcus pseudintermedius. 71: 114–122. Vet. Kikuchi et al. Yamaura.M. Vet. Evol. Kizerwetter-Œwida M. pseudintermedius (Van Hoovels et al. Y. Allaker R. Molecular confirmation of transmission route of Staphylococcus intermedius in mastoid cavity infection from dog saliva.10: 199–205. Marenzoni. Leibner. Hauschild T. As it is reported the genomic similarity of strains isolated in veterinary pathology is particularly specific (Cuteri et al. 2005). 121: 302–303. Comp. J. 2009. 2007. Devriese L. Appl.S. 2002).E. Dis. 2005. 2006.. Kur. Vet. Tosti. 2005. Ma³achowa N. 1988. Beveridge T. K.A.. Loveland CO. D. Vet. K. 2007b). Vet. J. Staphylococcus pseudintermedius sp. 76: 111–118. and novel staphylococcal chromosomal cassette in clinical isolates of mecA-containing. Delabranche. and K.P.. 73: 273–7. A.J. Nowicki and J. 2007. Morikawa and M.D. Res. Empel. Microbiol. R. Sci.. Public. Sabat. Eberlein. Kur.. 1997.. Syst.. Pol. Infect. Biotech. Acknowledgements The authors thank Miss Ma³gorzata Wójcik from the Jagiellonian University for helping prepare this manuscript. Use of the gram stain in microbiology. Bemis. Microbiol. Microbiol. and A. Kikuchi K. Fitzgerald JR. Haesebrouck. 2000. 2007. B. pseudintermedius in various animals and the confirmed presence of their resistance genes places them as potentially serious pathogens (Ruscher et al. Arcioni and C. a coagulase-positive species from animals. Rec. J. Hermans. Microbiol.M. Black et al. C. 139: 333–338. Piao.. M. J. Foi. Barañska-Rybak. 30: 381–395. E. Guardabassi L.C. Staphylococcus intermedius. K. Hirsh. Cox H. 82: 1–6. 2007).. a new species isolated from animals. 2004. G..L. 2003. J. 47: 469–71. Na and J.A. Jakubczak A. N. S. Antibiotic resistance patterns and occurence of mecA gene in Staphylococcus intermedius strains of canine origin. X.. Comparison of multiple-locus variable-number tandem-repeat analysis with pulsedfield gel electrophoresis. Res. Health 52: 119–124. Vet. Newman.. Molecular diagnostic identification of Staphylococcus pseudintermedius. J. 1993.C. 2009). Immunol. Frequency of isolation of Staphylococcus intermedius from humans. Krawczyk B. intermedius (Talan et al. Sci.. H. S. J. Species distribution of coagulase-positive staphylococci in animals. Int. 2005. Vet. Chrobak. £ukaszewska and J. Hryniewicz. Kent.. J. Infect. A. The anal region as a main carrier site of Staphylococcus intermedius and Streptococcus canis in dogs. 2009. Devriese L. Pol.E. 2004) as well as recently reported infections caused by S. Staphylococcus aureus: study of genomic similirity of strains isolated in veterinary pathology using amplified fragment length polymorphism (AFLP).. Swings. Cuteri V.F. C. 2009. Res. Mahoudeau et al. Int. Król J. 2009. Samet... L. spa typing. Thus the elaboration of new procedures and diagnostic schemes for both veterinary and human bacteriology are an emerging challenge. Franco A. Vet. 1989. P. 55: 1569–1573.. 2002) with a particular share of staphylococci from poultry (Wieliczko et al. Microbiol.S. immunoblotting and restriction endonuclease digest analysis. Distribution and persistence of Staphylococcus and Micrococcus species and other aerobic bacteria on human skin. ADSRRS-fingerprinting and PCR MP techniques for studies of intraspecies genetic relatedness in Staphylococcus aureus. Diagnosis and Management of Pyoderma in the Dog. Vaneechoutte. 26: 401–408. Gniadkowski. DePelsmaecker.. Mahoudeau I. Hendricks A. 1987. Bacteriol. KrzysztoñRussjan.I. Characterization of Staphylococcus intermedius isolates from canine pyoderma and from healthy carriers by SDS-Page of exoproteins. Craig M. Baele and F. Kania. Characterization of staphylococci isolated from healthy and infected dogs (in Polish). Schueler and D.. Garrett. Recently elaborated molecular methods should be introduced to restriction analysis of the chromosomal DNA with the final aim of increasing the effectiveness in discriminating closely related strains (Krawczyk et al. J. isolated from dogs 25 (Simoons-Smit et al. Guide to Skin and Haircoat Problems in Dogs. H. T. 19: 610–615. 7–19. Species distribution and properties of staphylococci from canine dermatitis. Hidai. C.C. P. 1984. I.A. Bannoehr J. M. Lee. J. 10: 46–48.H. J. Mazzolla. Hoskins. Kim T. 2004. Vet. Clin. The dissemination of methicillin-resistant S. H. Kosowska-Shick.. Dawyndt. A need of such an investigation is additionally enhanced by single reports on human colonization by S. 2004. and M. Iurescia M. 2001.C. M. Vet. 2002. 2004. Clin. Schuberth. Microbiol. 133: 206–207. L. K. Microbiol.

43: 3095–3100.N. Y. Clin. J. Bia³ecka and A.H. Krasinski. Vukovic. Stoof. 2002. A. Differentiation of Staphylococcus aureus isolates based on phenotypical characters (in Polish). Reclassification of phenotypically identified Staphylococcus intermedius strains.S. Wakita. J. S. Wydawnictwo Naukowe PWN. 2009. 2006.. I. Microbiol. 2005. J. Tanaka. Tanaka. Piasecki. A. Kasprowicz. K.. Acta Biochim. Acabes. Kikuchi. Pol. Kamata and K. J. et al. Vet. K. A. De Beenhouwer. Microbiol. J. Dimitrijevic. Frequency of Staphylococcus intermedius as human nasopharyngeal flora. 2008. Svabic-Vlahovic. Clin.26 Kasprowicz A... J. A. Eur. Campo.M. . Med. J. B. Hiramatsu. 55: 525–536. nasal and oral flora in healthy dogs. W³adyka B.. W. T. Van Hoovels L. D. V. Wleklinski. A.J. Dis.M. Sasaki T. Staatz. Van Vaerenbergh and H. Lubke-Becker. M. A novel member of the thermolysin family. Buenviaje. J.G. Vandenbroucke-Grauls. Staphylococcus pseudintermedius necrotizing fascilitis in a dog. Slavic. 136: 197–201. P. Microbiol. Sabat. Bonar. M. Vet. K. Microbiol. Infect. Methicillin-resistant Staphylococcus pseudintermedius in a veterinary teaching hospital. E. Hiramatsu.M. Kitai and J. Wieler and B. Grzeszczuk.. Vankeerberghen.. Foster and D. Kawano. Fierman. 62: 322–327. cloning and biochemical characterization of metalloprotease from Staphylococcus pseudintermedius. M. Poma. Occurence and characteristics of staphylococci isolated from poultry (in Polish). pp 20–23. 45: 2770–2778. N. Dis. Shimizu. G. Markiewski.. Y. Sasaki. A. 58: 348–352. J. Waddington.. A. Ha.L. Szewczyk E. Mathema. Y. Martinez. 2007a. J. Biœta. K. Simoons-Smit A. Wieliczko A. 45: 1118–1125. D. Dakic. 2002.M. Kreiswirth. P. Clin. 44: 4609–4612. Med. 82: 177–185. J. Prevalence of methicillin-resistant and methicillin-susceptible Staphylococcus aureus in the community. S. T. J. Kornblum. Isolation and species distribution of staphylococci from animal and human skin. J. S.. 2008. Clin. Kamata and K.. Boel. Overturf. Prevalence of methicillinresistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Weese J. S. Postêpy Hig. Miêdzobrodzki J. Staatz and G.D. N. James. Clin. 2001. 2000. Bacteriological diagnostics (in Polish). A. Vet. M.. K. Ma³achowa. Transmission of Staphylococcus aureus between humans and domestic animals in a houshold. F. 2007b. Ruscher C. Król. Staphylococcus sciuri as a part of skin. Takahashi. Med. Can. Microbiol. Vet. Riehman and B. Starink and C. Talan D. Dubin. Soba. C. Warszawa. N. Clin. 1989. Kikuchi. 64: 245–250. Sasaki T.. Doœw. Savelkoul. M. Staroniewicz. Hryniewicz and A. Microbiol. Infect. 27: 2393–2399. 2009.. First case of Staphylococcus pseudintermedius infection in a human. A. Microbiol. E.A. Shopsin B. 1 typing for clonal characterization of Staphylococcus aureus isolates.H. Sci. Walther. Yamashita.M. Savic and M. 2000. 19: 150–152. Microbiol. B.J. A. R. Stepanovic S. R. 50: 655–656. Mazurkiewicz and Z. T. Weter. L. Nagase N. Takahashi. 182: 359–362.

S. Real-time PCR was generally found to be more sensitive and specific for detecting Brucella spp. the disease primarily affects the reproductive system with concomitant loss in productivity of animals affected (Cutler et al. while serum samples had a sensitivity of 54% and specificity of 100%. respectively. IBRAHIM* and ALI A.. Department of Botany and Microbiology. accepted 18 December 2010 Abstract For detection of Brucella species by PCR four DNA extraction methods and four targets were compared using pure culture of Brucella melitensis and the best conditions were applied in clinical samples..O. Navarro et al. Detection of Brucella spp. Furthermore in patients with persistent or relapsing brucellosis.. phone: +96 6597359415. However the diagnostic value of serological tests is unsatisfactory in the early stages of the disease due to low sensitivity. 60. Riyadh 11451. K e y w o r d s: Brucella spp. with predominance in the Middle East. 2005). 2454. The results indicated that The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and 100 CFU/ml suspended in one ml water and blood. while 60% of serum samples were found to be positive with specificity of 100%. brucellosis. It was found that the MagNA Pure LC method was the most efficient and sensitive method showing a positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and one ml water. PCR methods for detection Introduction Brucellosis is a major zoonotic disease that causes a serious health and economic problem worldwide (Elfaki et al. by conventional PCR was investigated using four different targets. rodents and marine mammals and in most host species. and the inability to distinguish between active and inactive infection due to antibody persistence after therapy (Diaz and Moriyo. ABDELNASSER S. Blood cultures (which represent the ‘gold standard’ of laboratory diagnosis) are among the most important tests used for the diagnosis of infectious * Corresponding author: A. in blood and serum samples compared to conventional PCR. About 500.Polish Journal of Microbiology 2011.5% of the results obtained by conventional blood culture methods with specificity of 100%. The causative organisms of brucellosis are Gram-negative facultative intracellular pathogens that may affect a range of different mammals including man. sheep.. 2005). Saudi Arabia. revised 15 December 2010. In spite of the growing number of countries declared Brucella-free. South America and Central Asia (Godfroid. Vol.O.000 new cases occur annually worldwide. The real-time PCR done on blood specimens confirmed 77. Faculty of Science.. AL-SALAMAH Medical Unit. goats. P. Department of Botany and Microbiology. Currently. respectively. In man. 2002). swine. 27–33 ORIGINAL PAPER Comparison of Different PCR Methods for Detection of Brucella spp. 1989. Faculty of Science King Saud University.S.. respectively. e-mail: ashebl@ksu. 2005). the diagnosis of brucellosis is based on microbiological and serological laboratory tests. 2002).sa . Sauret and Villissova. serological cross-reactions.S.edu. 2454. detection. dependance on blood culture analysis is usually impeded by the low yield of microorganisms as a result of dormancy of brucellae in the mononuclear phagocytic cells (Elfaki et al. Ibrahim. cattle. The best and optimum detection conditions were applied to the clinical samples. No 1. Furthermore real-time PCR was able to detect Brucella using DNA extracted from as low as 50 CFU/ml blood and 15 CFU/ml water. Saudi Arabia Received 2 July 2010. AL-AJLAN. King Saud University. Evaluation of conventional PCR assays on blood specimens confirmed 72% of the results obtained by conventional blood culture methods with a specificity of 95%. in Human Blood Samples HISHAM H. 2008). Riyadh 11451. the disease remains one of the main zoonotic infections throughout many parts of the world with major economical and public health implications. infection is associated with protean manifestations and characteristically recurrent febrile episodes that led to the description of this disease as undulant fever (Abdoel et al. Mediterranean countries. These results suggest that serum and blood analysis by conventional and real time PCR is a convenient and safe method for rapid and accurate diagnosis of brucellosis. P. 2002.

It was propagated on chocolate agar (Oxoid) me- dium and incubated at 37°C in a humidified atmosphere supplemented with 5% CO2. Sterile water inoculated blood samples served as a negative control. Automated Nucleic Acid Purification system (MagNA Pure LC Systems). most of these assays have used Brucella DNA of pure cultures and only a few of these primers have been used in clinical animal. 200 µM of each of dATP. The PCR reaction contained (25 µl): reaction buffer (50 mM KCl. Bogdanovich et al. One ml aliquots from bottles shown to contain Gram-negative coccobacilli bacteria were removed and stored at –80°C until use. washed twice with 5 ml of sterile distilled water then recovered by centrifugation at 5000 rpm for 5 min. Different target genes. Detection of Brucella melitensis by conventional PCR. PCR techniques and extraction procedures have been previously investigated for Brucella detection. a precise diagnostic method should be established for the control of brucellae in this population. GenomicPrep DNA Isolation Kit (Amersham Biosciences). Because of the prevalence of brucellosis in Saudi Arabia. which was obtained from the Central Veterinary laboratory (Weybridge. 2008) using four different primers pairs (TIB MOLBIOL.9% NaCl) and recovered by centrifugation at 5000 rpm for 5 min.0). All blood cultures were evaluated in the BACTEC 9600 blood culture system (Becton Dickinson Diagnostic Instrument Systems).1 ml of supernatant was removed and used for PCR.5–4 mM). 2008. dGTP. however.5× 108 CFU/ml). Saudi Arabia) including 160 blood samples obtained from patients with clinically proven or suspected systemic brucellosis infection and 40 control samples from healthy subjects without any clinical evidence or history of brucellosis.H. Four different DNA extraction kits were used to extract the genomic DNA of Brucella melitensis according to the manufacturer instructions including QIAmp kit (Qiagen). and the mixture was boiled for 10 min. The diagnosis of brucellosis was confirmed by isolation and identification of Brucella spp. 1999. 2002.5 U of puReTaq DNA polymerase (Amersham-Pharmacia). and human samples (Zerva et al. et al.2 ml cell suspension was mixed with 0.5 McFarland standard (which is approximately 1. Bacterial DNA extraction methods. All isolated strains were identified in the lab. compare different targets and PCR methods for detection of Brucella and apply it to clinical human samples Experimental Material and Methods Clinical samples and bacterial strains. 2008. Therefore the aims of the current work were to compare different DNA extraction method for DNA purification from Brucella cells. 10 µl of the reaction mixture was mixed with 2 µl of loading buffer ReddyRun (ABgene) and was run in 2 % agarose gel electrophoresed in Tris-borate-EDTA buffer (TBE) at 120 V for about 50 min and the amplified DNA bands were visualized in ethidium bromide staining and . about 0. 1. After centrifugation at 10000 rpm for 5 min. Abdoel et al. The cells were serially diluted with sterile distilled water and adjusted to a 0. dCTP. from blood culture. in addition to 10% Chelex-100 resin suspension (Bio-Rad Laboratories) where 0. contamination with skin type flora like coagulase negative staphylococcus could over grow the slow growing organisms like Brucella in addition to a serious threat to laboratory personnel (Yagupsky. Therefore.5 mM MgCl2. A total of 200 clinical blood specimens were collected from the Armed Forces Hospitals (Riyadh.. 2004). 10 mM Tris HCl. Germany). Freshly cultured Brucella melitensis was killed by the addition of 70% methanol in sterile saline (0. specific to four different targets in Brucella spp. The sensitivity of conventional PCR was investigated for detection of Brucella melitensis using a modification of previously reported methods (Navarro et al. 2001.1 ml of a 10% Chelex-100 resin suspension (Bio-Rad Laboratories). For optimization of PCR conditions different concentrations of primers (5–25 pmol) and MgCl2 (1.28 Al-Ajlan H. UK). which detect microbial growth by continuous monitoring. and dTTP and 2. However... Berlin. Following PCR reaction. pH 9. Hiniæ et al. Blood (8 to 10 ml) was inoculated into BACTEC Plus aerobic/F blood culture bottle (enriched soybean-casein digest broth) and incubated for 28 days or until the bottles were positive. Different cell dilutions were prepared and suspended in either sterile distilled water or whole blood collected in EDTA Vacutainer from healthy individual with no evidence or history of brucellosis infection. 2008) and there is no enough report about comparison of these assays. amplification at different temperature settings and cycling programs were used (Table I). other diagnostic methods are needed to overcome such limitations of conventional approaches for the diagnosis of brucellosis. (Table I). Preparation of bacterial cells suspensions.. Baddour and Alkhalifa. The reference strain used in this study was Brucella melitensis 16 M. Brain heart infusion broth (Oxoid) with 20% glycerol (Sigma) was used for the storage of bacterial strains at –80°C. to give a final cell count in the range of 25 to 105 CFU/ml. DNA-based methods such as gene probes and polymerase chain reaction (PCR) are attractive means for the confirmation of brucellosis. The inoculated whole blood samples and cells suspended in water were subsequently used for DNA extraction. primer pairs. 1 diseases including brucellosis..

Fluorescence was measured continuously during the slow temperature rise to monitor the dissociation of the LightCycler Red 640-labeled sensor probe at the F2 channel.5 56 45 1. DNA was extracted and the purified DNA was used as a template for PCR reaction. 100 bp Superladder (ABgene) was used as DNA Marker. 4 µl Reagent mix (Brucella-specific primers and hybridization probes).5 2. (mM) Taq polymerase (IU) Annealing temp Extension time (s) 1. Serial dilution of Brucella melitensis cells were suspended in either sterile water or whole blood to give a final cells count of 25 to 25000 CFU/ml. Thermocycling conditions were as follows: one cycle of initial denaturation at 95°C for 10 min. –: Negative PC Characteristic .5 2. Water was used instead of DNA as a negative control. and 6.6 µl nucleases free water and 5 µl of the tested DNA. Total DNA was extracted using different methods and the purified DNA was used as template in PCR DNA extraction Count of Brucella cells (CFU/ml blood) 800 + + + – 400 200 100 + + + + – – + + – – – – 50 25 – – – – – – – – JPF-JPR F4-R2 ISP1-ISP2 IS6501 gene encoding a 31 kDa Brucella abortus antigen 223 F-5-TGGCTCGGTTGCCAATATCAA-3 R-5-CGCGCTTGCCTTTC AGGTCTG-3 B4-B5 PCR conditions: MgCl2 conc.5. The reaction mixture for the real time contained 2 µl of 10x LightCycler-FastStart DNA master hybridization probes (Roche Diagnostics). Sterile water instead of DNA was used as a negative control. each including denaturation (95°C for 10 s). It was found that the MagNA Pure LC method was the most efficient and sensitive method as it showed positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and Table II Sensitivities of different DNA extraction methods. Four different DNA extraction methods were evaluated for whole DNA purification from Brucella melitensis.5 54 90 3 2.5. 2. The results for the approximate sensitivity of each method are shown in Tables II and III. and extension (72°C for 15 s).1 gene encoding an outer membrane protein (omp-2) 600 905 193 F-5-GGTTGTTAAAGGAGAACAGC-3 F-5-TCGAGCGCCCGCAAGGGG-3 F-5-GCGCTCAGGCTGCCGACGCAA-3 R-5-GACGATAGCGTTTC AACTTG-3 R-5-AACCATAGTGTCTCCACTAA-3 R-5-ACCAGCCATTGCGGTCGGTA-3 Detection of Brucella spp. Detection of Brucella using Real-time PCR was investigated using modified of previously reported method (Redkar et al. annealing (55°C for 8 s). 2. Detection of Brucella melitensis by Real-time PCR. 2001).5 60 60 1.4 µl MgCl2 (final concentration of 4 mM). abortus photographed under UV light.. Serial dilution of the Brucella melitensis cells was prepared in one ml blood. The sensitivity and efficacy was measured as the minimum number of CFU required to produce DNA showing a positive PCR.5 60 60 Product size (bp) Primer sequence PCR target Methods 25000 6000 MagNA Pure LC + + QIAmp silica column + + GenomicPrep Blood + + Chelex resin – – +: Positive PCR. 4 2. by different PCR methods 29 Table I Main characteristics of PCR methods used in the study sequence 16S rRNA of B. Results Sensitivity of the DNA extraction methods. followed by 55 amplification cycles (temperature transition rate of 20°C/s).

et al.30 Al-Ajlan H. Using ISP1-ISP2 and DNA extracted from serial dilutions cells suspended in blood (C) and water (D). 6: 400: CFU/ml. 1 one ml water respectively. 9: 50 CFU/ml and 10: 25 CFU/ml . The sensitivity of the real-time PCR was determined using Brucella specific probes. optimum conventional PCR and real-time PCR. Sensitivity of PCR using different targets for detection of Brucella sp. Clinical samples.000 CFU/ml. 5: 800 CFU/ml. respectively. 2: Negative control. 200 clinical blood specimens (160 patients and 40 controls) were tested for brucellosis by blood culture. 7: 200 CFU/ml. During the study period. Based on these results the MagNA Pure LC method was selected for further analysis. 3: 25. 1. none of the bacterial DNA from whole blood or water gave a positive PCR using the JPRJPF method. Based on these results the B4-B5 method was used in analysis of the clinical samples. Detection of Brucella by conventional and real time PCR. 8: 100 CFU/ml. respectively. followed by GenomicPrep Blood method and QIAmp silica column purification method respectively (Table II and III). However none of the extracted DNA using Chelex resin was able to give positive PCR reaction. Lane 1: 100 bp Marker.000 CFU/ml. The reaction was carried out using DNA extracted from serial dilution of bacterial cells suspended in blood and water. Among the 160 clinical samples tested. However.H. 2). Using F4-R2 and DNA extracted from cells suspended blood (E) and water (F). Real-time PCR was able to detect Brucella using DNA extracted from as low as 50 and 15 CFU suspended in one ml blood and water respectively (Fig. followed by ISP1-ISP2 and F4-R2. 4:6. The results presented in Table IV and V and Figure 1 indicated that the B4-B5 amplification method was the most sensitive as it could amplify DNA extracted from as low as 25 and 100 CFU/ml suspended in one ml water and blood. Detection of Brucella melitensis by conventional PCR was investigated using four different targets. 89 specimens were Fig. Using B4-B5 and DNA extracted from and DNA extracted from serial dilutions of cells suspended in Blood (A) and water (B).

Serial dilution of the Brucella melitensis cells was prepared in one ml water. 7&8: Negative control blood culture positive for Brucella and 71 were negative but 9 of them were positive for other bacteria (six coagulase negative staphylococci. Total DNA was extracted using different methods and the purified DNA was used as template in PCR DNA extraction Count of Brucella cells (CFU/ml water) 800 + + + + 400 + + + – 200 + + + – 100 + + + – 50 + – + – 25 + – – – negative staphylococcus (detection after 33 h) was positive for Brucella by conventional PCR and light cycler PCR in blood. 6:15 CFU/ml. Detection of Brucella by real time PCR Fluorescence is plotted against number of PCR cycles to monitor amplification of different cells counts Brucella suspended in blood (A) and water (B) 1: 800 CFU/ml. –: Negative PC . 5–25 CFU/ml. 4: 50 CFU/ml. 2: 200 CFU/ml. DNA was extracted from the 89 blood samples (which were found to be positive for Brucella by blood culture) and detection was carried Table IV Sensitivities of four PCR methods for detection of Brucella suspended in blood determined by amplifying the DNA extracted from different cells dilutions Methods B4-B5 ISP1-ISP2 F4-R2 JPF-JPR Count of Brucella cells (CFU/ml blood) 25000 6000 + + + + + + – – 800 + + + – 400 200 100 + + + + + – – – – – – – 50 25 – – – – – – – – Methods 25000 6000 MagNA Pure LC + + QIAmp silica column + + GenomicPrep Blood + + Chelex + + +: Positive PCR. One of the blood culture positive for coagulase Table III Sensitivities of different DNA extraction methods. one Staphylococcus aureus. 3:100 CFU/ml. and one Acinatobacter spp). 2. –: Negative PC +: Positive PCR. one Klebsiella spp. negative in serum and negative by blood culture.1 Detection of Brucella spp. by different PCR methods 31 Fig.

using DNA extracted from as low as 50 CFU /ml blood 15 CFU/ml water. In addition. Therefore four different DNA extraction methods were evaluated to purify total DNA from Brucella melitensis. F4-R2 and JPF-JPR. 2002. Although blood is known to possess substances inhibitory to PCR. It was found that 69 out of 89 blood samples were positive and 54 of the 89 serum samples (60%) were positive and none of the control samples were positive. However. This result is consistent with that previously reported by Elfeki et al. However in another study by Navarro et al. respectively. PCR offers an alternative choice over the conventionally available methods for an accurate diagnosis of brucellosis. serum and blood culture were 77. 2005). respectively. 48 of the 89 serum samples were positive and none of the control samples were positive. 100% respectively (Table VI).H. 60 and 100% with specificities of 100. F4/R2 was the most sensitive primers. 54 and 100%. serum and blood culture were 72. 100. in the clinical blood samples. The results of conventional PCR showed that 64 out of 89 blood samples and 2 of the 40 control samples (5%) were positive. The results of detection of Brucella spp. Sensitivity Specificity 0 (40) 0 (40) 0 (40) 100% 77. Bogdanovich et al.5. Discussion An accurate diagnosis of brucellosis is very important for treatment.. RT-PCR and blood culture were compared for detection of Brucella spp.32 Al-Ajlan H. –: Negative PC Table VI Detection of Brucella in blood and serum samples by conventional PCR in comparison to blood culture method Specimen Blood Culture Blood Serum Positive 89 (89) 64 (89) 48 (89) False pos. in blood and serum samples by real-time PCR in comparison to blood culture method Specimen Blood culture Blood Serum Positive 89 (89) 69 (89) 54 (89) False pos. With the aim of finding the most efficient and sensitive methods for detection of Brucella DNA in blood specimens. Real-time PCR was even more sensitive than conventional PCR as it was able to detect Brucella spp. et al. The sensitivities for blood. (2005) where PCR using primers B4-B5 was the most sensitive one for detection of Brucella spp. depending on the amplifying method (except JPF-JPR method). ISP1-ISP2. the most sensitive and efficient one being the MagNA Pure LC method showing positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood and one ml water respectively.5% 60 % 100% 100% 100% out using optimum conditions of conventional PCR and real-time PCR. The results indicated that the detection limit varied between 25 to 800 CFU/ml. The aim of this study was to optimize the DNA extraction and PCR conditions for detection of Brucella spp. 100. 1 Table V Sensitivities of four PCR methods for detection of Brucella suspended in water specimens determined by amplifying the DNA extracted from the dilution series Methods B4-B5 ISP1-ISP2 F4-R2 JPF-JPR Count of Brucella cells (CFU/ml water) 25000 6000 800 400 200 100 50 25 + + + – + + + – + + + – + + + – + + + – + + – – + – – – + – – – +: Positive PCR. respectively. an efficient and sensitive diagnostic method should be established for the control of brucellae in this population (Elfaki et al. using real-time PCR are shown in Table VII. sufficient nucleic with removal of inhibitory substances is essential for optimal detection of the microbial pathogens by PCR. the DNA purification methods used in this study (except chelex resin method) were successful in eliminating these inhibitors. The sensitivities of PCR detection in blood. and the specificities were 95. It was found that 72% . four DNA amplifying methods were evaluated using four primers pairs including B4-B5. 2004). Furthermore the sensitivity of the real-time PCR was determined using Brucella specific probes. The reaction was carried out using DNA extracted from serial dilution of bacterial cells suspended in blood and water. followed by ISP1-ISP2 and F4-R2. The detection of bacterial DNA in blood specimens by PCR usually requires sensitive DNA amplifying method with sensitive primers and optimized PCR conditions because of the presence of human DNA and inhibitors in blood (Bricker. The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and 100 CFU/ml suspended in one ml water and blood respectively. control and eradication of brucellae and due to the prevalence of brucellosis in Saudi Arabia.. and apply the optimum conditions in the clinical samples and compare it with blood culture approach. The best DNA extraction method was used to extract DNA from the clinical samples and optimum conventional PCR conditions. Sensitivity Specificity 0 (40) 2 (40) 0 (40) 100% 72% 54% 100% 95% 100% Table VII Detection of Brucella spp. (2002) for comparison of three PCR methods for detection of Brucella. 100%.

E. 2008. Real time multiplex PCR assay for detection of Brucella spp. Moriyo. Microbiol.L. N. Vet. conventional PCR conditions and RT-PCR for detection for detection of Brucella spp.J. Clin. Int. Dias.M. J. Microbiol. P. Hadfield and F.M. J. these assays may be important diagnostic tools to detect Brucella spp. P. 2001). Cvetniæ. 2002. 37: 3437–3342 Yugupsky P. PCR assay for diagnosis of human brucellosis. Serum is the preferred clinical specimen for diagnosis of human brucellosis by PCR. Microbiol. Alkhalifa. respectively. abortus. and Corbel. the PCR assays are safer and more rapid to perform. 90: 435–446.1 Diaz R. J.M. Microbiol. 39: 1661–1664. and free of contamination.M. Microbiol. The authors are gratefully acknowledged for this support Literature Abdoel T. 2008. 1989. B... Appl.S. Newby D. Khuong. in human blood samples.).1 Detection of Brucella spp. and hybridization probe assays. Probert W. 1996. K. J.J. Microbiol. and D.. T. B.J. Use of the BACTEC MYCO/F LYTIC medium for detection of Brucella melitensis bacteremia. Probert et al.. Ž. 2001. Ahrens and J. Mol.G. In this study it appears that the real-time PCR has greater sensitivity and specificity than conventional PCR.. S. A. J. canis. P. 1999. Yagupsky P. PCR as a diagnostic tool for brucellosis. Comparison of three different PCR methods for detection of Brucella spp. In conclusion comparison of blood culture. Novel identification and differentiation of Brucella melitensis. Clin. Navarro E. R. M. 2004. Mitka. 69: 4753–4759. In: Brucellosis: Clinical and Laboratory Aspects (Young. The real-time PCR confirmed 77. Epiz. 1996. T. Prob. 75: 375–378. Microbiol. Elfaki M. J.A.A.Y. 2004). 2003. and Infect. Therefore. Villissova. 1999. Am. 34: 147–151. 2004. Uz-Zamana. Conclusions. Evaluation of three polymerase chain reaction techniques for detection of Brucella DNA in peripheral human blood.V. B. Navarro E. Microbiol. Clin. Microbiol. 42: 1290–1293. Escribano. Navarro et al. melitensis. pp.J. J. Methods. 73–83. Board. B. 98: 1270–128.. Microbiol. Nakeeba. Evaluation of the real-time PCR for detection of Brucella spp. Pract. Fernandez and J. J.N. Smit. A. Bricker and V. 42: 2207–2208. Fernandez and J.F Roberto.J. using peripheral blood is not without difficulties.. Brodard. CRC Press. Bystrom and M. 130: 312–319. Clin. B. Tech. Schrader. J. Bourantas.. K. I. Real-time PCR detection of Brucella abortus: a comparative study of SYBR Green I. Can. FEMS Immun. Abril. J.M. Zerva et al.. Several systems of real-time PCR have been developed. Realtime detection of Brucella abortus. A. these PCRs overcome the conventional PCR by allowing quantification of the targeted copies in the specimen (Newby et al. Cardoso and H. Med. Clin.T. rapid. Compared to standard bacteriological methods. J. Microbiol. 34: 477–478. Godfroid J. 21: 277–286.T. B. by different PCR methods 33 and 54% of the positive blood culture was detected by PCR with specificity of 95% and 54% in blood and serum. 37: 1654–1655. Brucellosis – new aspects of an old disease. 2003. They are user-friendly. Bogdanovich T. Al-Hokailb and S. Microbiol. Boca Raton. Rose. The use of PCR for the detection of Brucella DNA in blood samples of certain groups of patients with brucellosis has been previously studied with sensitivity in the range of 50% to 100% (Mattar et al.A. Detection of Brucella in blood cultures.A. Hoorfar. 2002. M. Baddour M. Eds.H. Environ. and B. 2001. Thomann.. Mattar G. Cutler S. neotomae suitable for both conventional and real-time PCR systems. in the clinical blood samples indicated that PCR amplification technology is promising method for the detection of Brucella in clinical samples with high sensitivity and specificity close to that reported by conventional blood culture. 1999. Sci. 42: 2261–2263. Frey and C.. Khneisser and A. 2004. Detection of brucella DNA in sera from patients with brucellosis by polymerase chain reaction. ovis. Graves. 54: 352–357. Simple and rapid field tests for brucellosis in livestock. 2005. J.. Rapid laboratory confirmation of human brucellosis by PCR analysis of a target sequence on the 31-Kilodalton Brucella antigen DNA. Human brucellosis. Bricker B.L. Kansouzidou and N. A. Solera. 15: 43 52 Sauret J. Microbiol. Clin.L. and I. 2008. 2005. Dis.M. 15: 401–406. S. Microbiol. 5’-exonuclase.. 2002. FL. . I. Brucella melitensis and Brucella suis.. and N. Redkar R. Zerva L. Although the PCR detection of Brucella spp. Laboratory techniques in the diagnosis of human brucellosis. Legakis. Acknowledgment This work was financially supported by Deanship of Scientific Research. Commander. Whatmore and N. Diagnos. in the clinical blood samples showed excellent specificity and good sensitivity.. Lubeck...S. Solera. Makaya. Microbiol. Rev. Moreover. J. S. and B. Skurnik.. Brucellosis in Wildlife. Clin. Cell.H. abortus. Validated 5’ nuclease PCR assay for rapid identification of the genus Brucella. it presents considerable advantages. J. 2002.J.5% of the results obtained with the blood culture assays with specificity of 100%. suis.. Vet. I. King Saud University. 53: 1–7. Abdelnoor. J. Del Vecchio. Appl. Hiniæ V.

et al.H.34 Al-Ajlan H. 1 .

essential oils Introduction A frequent complication while using artificial devices in medical practice (BAI. whereas 2–4× MIC was enough to obtain 90% reduction in biomass metabolic activity (MBEC90) after just 4 h of treatment. surgical mesh was the surface most prone to persistent colonization since biofilms formed on it. was more susceptible to the action of phytochemicals than the biofilms of S. natural plant/animal products and/or their combinations with antibiotics or synthetic counterparts seems to be one of the promising solutions (Dürig et al. aureus biofilm treated with TTO.pl . biomaterial-associated infections. K e y w o r d s: biofilm eradication. Melaleuca alternifolia (TTO).uni. accepted 15 December 2010 Abstract The aim of the study was to examine the antibiofilm activity of selected essential oils (EO): Lavandula angustifolia (LEO). Among the biomaterials tested. Thus. 2010. Technical University of £ódŸ. 2009). 60. coli.. aureus and E. DANUTA KALEMBA 2 and BARBARA RÓ¯ALSKA1* 1 Institute 2 Institute of Microbiology. BEATA SADOWSKA 1. time-dependent eradication of biofilms preformed in polystyrene 96-well culture microplates was examined and expressed as minimal biofilm eradication concentration (evaluated by MTT reduction assay).. They should be considered a serious health problem requiring a rapid solution. coli biofilm which. Banacha 12/16. Ró¿alska.lodz. University of £ódŸ. usually their secondary metabolites. sesquiterpenes. It is noteworthy that an evident decrease in biofilm cells metabolic activity does not always lead to their total destruction and eradication. The biofilm mode of growth results in an increased bacterial resistance against classical antimicrobial treatment and host immune factors (Bryers.. Melissa officinalis (MEO) and some of their major constituents: linalool. the search for alternative therapies is a necessity and using. were difficult to destroy. within this group. A similar medical problem is posed by wound-associated chronic infections. Poland of General Food Chemistry. essential oils are the most important members (Gibbons. LEO. Reichling et al. Essential oils of several plants * Corresponding author: B. 2008). Vol. however. aureus. "-terpineol. which are also often characterized as having a biofilm nature. linalyl acetate. 35–41 ORIGINAL PAPER Antibiofilm Activity of Selected Plant Essential Oils and their Major Components ALEKSANDRA BUDZYÑSKA 1.. Compounds with strong bacteriostatic or bactericidal activity belong mostly to phytoalexins and. 2003. Essential oils are complex mixtures of chemical substances. 90-237 £ódŸ. A similar dose-dependent effect was observed for E. Moreover. showed stronger anti-biofilm activity than LEO and linalool or linalyl acetate. Biotechnology and Immunology. The killing rate studies of S. Dai et al. MARZENA WIÊCKOWSKA-SZAKIEL 1. Bakkali et al. James et al.. Poland. at least one of which shows antimicrobial activity. 2008. No 1. "-terpineol and terpinen-4-ol as well as MEO. Biofilms were formed by Staphylococcus aureus ATCC 29213 and Escherichia coli NCTC 8196 on the surface of medical biomaterials (urinary catheter. Institute of Microbiology. MEO and some of their constituents revealed that partial (50%) destruction of 24-h-old biofilms (MBEC50) was achieved by the concentration 4–8× MIC after 1 h. Hoiby et al. 2010). Biotechnology and Immunology. biomaterial-associated infections) are infections dependent on microbial adhesion and biofilm formation. 2008. 2010). for example. e-mail: rozab@biol.. University of £ódŸ. Higher plants evolved through developing mechanisms for avoiding the effects of microbial attack based on the production of protective substances. Department of Immunology and Infectious Biology. terpinen-4-ol. Poland Received 14 October 2010. TTO. Very often BAI are a consequence of direct biomaterial contamination during implantation but they can also be caused by haematogenous spread of bacteria from an infection site anywhere within the human body.Polish Journal of Microbiology 2011. 2008. They consist mainly of monoterpenes. both by S. TTC reduction assay was used for the evaluation of mature biofilm eradication from these surfaces. infusion tube and surgical mesh). diterpenes and other aromatic or aliphatic compounds (Kalemba and Kunicka.

Antimicrobial substances – oxacillin and ofloxacin (Sigma. Eradication of Staphylococ- cus aureus ATCC 29213 and Escherichia coli NCTC 8196 biofilms by essential oils (EO) and some of their main components was evaluated.. being effective against bacterial. antidepressive properties (Cavanagh and Wilkinson. antifungal. Tea tree oil (TTO) is an essential oil from the leaves of the Australian M. Melissa is commonly used in Europe as a tea. Cavanagh and Wilkinson. USA. All essential oils were purchased from Pollena Aroma. Then. Then. were transferred to the wells of a 96-well tissue culture microplate containing dilutions of essential oils/components and were incubated for the next 24 h at 37°C..5 cm in length). Essential oils distilled from members of the genus Lavandula have been applied both cosmetically and therapeutically for centuries with the most commonly used species being L.5 cm). angustifolia. liquid extract. The oil from the leaves is used medicinally. latifolia. 2008.5×0.9% of the original inoculum (MBC. 2006). Melissa officinalis and their major constituents were selected for the present study. 2004).3.5% Tween 20. Karpanen et al. after their washing with phosphate-buffered saline (PBS). since the epidemiological data on the incidence of infection with their participation sound serious. USA) were accepted as a reference. 2002. Staphylococcus aureus and Gram-negative enteric bacteria – Escherichia coli. Poland and the isolated compounds of EO were purchased from SAFC. 2006. Denmark). The lowest concentration of essential oils/components. The claims made for lavender oil include its antibacterial. 2002. Melissa officinalis (Melissa essential oil. 4× MIC. as previously . surgical mesh support for muscle/fascia (Tricomed. these strains were chosen because the known differences in the cell wall structures between Gram-positive and Gram-negative bacteria imply the extent of their susceptibility to various antimicrobial agents (Gibbons. minimal bactericidal concentration) was determined from broth dilution MIC tests. Hossainzadegan and Delfan. The concentration at which the A600 of the wells did not exceed the value of absorbance of the control medium was accepted as the MIC. L. phytochemicals. 1 are widely used in ethnomedicine for their antimicrobial and anti-inflammatory properties but their antibiofilm activity has not been so far studied extensively (Carson et al. and later in Mueller-Hinton Broth (MHB. viral and fungal organisms as well as having immunostimulatory activity. The following biomaterials/culture surfaces were used: short term urine drainage catheter of Nelaton type (Bicakcilar. The attention of our study was focused on the possibility of using essential oils in the fight against biofilms of two members of the “alert” pathogens group. terpinen-4-ol. 2008). in a volume of 100 µl in the wells of flat-bottomed polystyrene 96-well microplates (Nunc... TTO). There were oils of Melaleuca alternifolia (tea tree oil. The positive control was a suspension of bacteria in 200 µl of MHB/0. Chao et al. linalyl acetate. Fabian et al. Sigma) with 0. a member of the botanical family Myrtaceae. Denmark). intermedia.36 Budzyñska A. Gursoy et al. 2009.5% Tween 20 was added to each well. Wallac. 2006. via Sigma. L. Melissa essential oil (lemon balm) is also a common antibacterial and antifungal agent (Mimica-Dukic et al. It is also known that it can alleviate inflammation and may help wound healing (Carson et al.. Poland) (0. 2009). Experimental Materials and Methods Biomaterials. 2006. 100 µl of bacterial suspension with a density of 106/ml in MHB/0. Roller et al.024%) were deposited in triplicate. £ódŸ. Surface colonization and biofilm eradication. bactericidal to ≥ 99. by subculturing 100 µl (from the wells of MIC. and a negative control was the medium without bacteria..5-triphenyltetrazolium chloride) for 24 h incubation at 37°C. et al. sedative. Poland) (both 0. and topical preparation. smooth muscle relaxing.. 2009). Warnke et al.25% Glc) for 24 h at 37°C.. Essential oils derived from Melaleuca alternifolia. 2006. stoechas and L. alternifolia tree. 2008. USA.. Lavandula angustifolia. linalool. Evaluation of bacterial susceptibility to essential oils and their major constituents. 2× MIC.. Fragments of biomaterials (three pieces of each type) were incubated with bacterial suspension in tryptic soy broth (TSB) supplemented with glucose (TSB/0.5% Tween 20 (Sigma). Essential oils/ components were initially diluted in 96% ethanol (1:1 v/v). After 24 h incubation at 37°C. Fabian et al. bacteria. 2009).75–0. The tested concentrations of phytochemicals (range 6. Moreover. with minor modifications (Budzyñska et al. the absorbance at A600 (Victor 2.. MIC (minimal inhibitory concentration) of phytochemicals was determined by the standard CLSI (Clinical Laboratory Standards Institute) microdilution method. Chao et al. These were Gram-positive staphylococci. infusion tube (Polfa Lublin. MEO or lemon balm) and "-terpineol. 8× MIC) to the broth medium without any antimicrobial agents. Colonized surfaces. Lavandula angustifolia (lavender essential oil. 2008. No visible growth after subsequent 24 h incubation means MBC on condition that the concentration is not higher than the 4-fold value of MIC. Turkey). LEO). Finland) was determined.. biomaterial fragments were rinsed with PBS and transferred to a new 96-well microplate containing TSB with 1% TTC (2. 96-well polystyrene tissue culture microplates (Nunc.

coli cells. Cell suspensions of S. pale-yellow MTT (3-(4. All bacterial cells from planktonic cultures treated with EO at the concentration of 2–4 MIC. One hundred µl of the sonicate was spread onto two agar plates for overnight incubation and CFU counting. Mature (24-h old) biofilms of S. non-treated S.5-diphenyltetrazolium bromide) is reduced to purple formazan by living. To avoid interference between the phytochemical’s red-ox potency and MTT. proportional to the increase in the compound concentration. respectively. Mean A550 ± S. aureus or E. coli NCTC 8196 were exposed to the action of essential oils/components for 1. TTC is a redox indicator used to differentiate between metabolically active and inactive cells. The answer to the question whether TTO. The essential oil of Melaleuca alternifolia (TTO). aureus ATCC 29213 and E. such as linalool and linalyl acetate. Poland). The experiments performed to check whether the tested phytochemicals are bactericidal showed that MBC values did not exceed the obligatory 4 x MIC.5-dimethylthiazol-2-yl)-2. The essential oils/components concentrations causing 50% or at least 90% reduction in biomass metabolic activity (MBEC50 and MBEC90) at each time point were determined using MTT-reduction assay. they were placed in 1 ml of sterile broth medium and the remaining bacterial deposit was removed by ultrasonic disruption for 5 min. The potential effect of essential oil on bacterial cell membranes was assessed using EO-mediated SYTO 9 and propidium iodide uptake (LIVE/DEAD BacLight Bacterial Viability kit. The fragments of colonized biomaterials treated with phytochemicals. 1+. 2+. MEO are bacteriostatic or bactericidal was also provided by the experiments for EO-mediated SYTO 9/PI uptake. A solubilizer was added to dissolve the formed formazan product into a colored solution whose absorbance was quantified (550 nm (Victor 2. except for very few red cells. used at concentrations from MIC to 8× MIC was determined. –). However. Their MICs values against Staphylococcus aureus and Escherichia coli are presented in Table I. Results The minimal inhibitory concentration (MIC) of selected essential oils and their major constituents was determined using the broth microdilution method and defined as the lowest concentration able to inhibit visible microbial growth. 2007). 2005. 2× MIC or MIC) of EO at 37°C for 4 h. and a drop of each suspension was examined with a confocal scanning laser microscope for green/red fluorescence to visualize SYTO 9 and propidium iodide. since more than 99% of the bacterial inoculum was killed even by MIC or 2× MIC. the bacteria were washed with 5 ml sterile PBS and stained using the LIVE/DEAD kit. Time-dependent inhibitory concentration of phytochemicals for biofilms preformed in a polystyrene 96-well culture microplate. values were presented. 6 and 24 h co-incubation at 37°C. Finland). The presence/reduction of biofilm biomass was evaluated by comparing the color intensity of biofilm deposit on biomaterials treated and untreated with phytochemicals.D. evaluated by fluorescent confocal microscopy. Evaluation of viability of bacterial cells treated with essential oils.3. Wallac. After the incubation all the samples were washed and resuspended in PBS.5-triphenylformazan) in living cells due to the activity of various dehydrogenases. showed only green fluorescence (live with undamaged cell wall). The experiments were performed twice to confirm reproducibility of the results. as well as the essential oil of Melissa officinalis (MEO). according to arbitrarily fixed scale (4+. the fluid above the biofilm was aspirated and removed. were removed from the wells and rinsed in PBS. "-terpineol and terpinen-4-ol.5) and MBEC90 means that A550 of the sample was close to the value of the negative control (A550 = 0.. Then. 1998). aureus culture which was killed by 8× MIC of linalool – one of the components from the lavender and melissa essential oils. The data on this set of experiments are presented in Table I.2). as described earlier (Walencka et al.1 Antibiofilm activity of plant essential oils 37 described (Ró¿alska et al. 4. The experiments were performed in duplicate to confirm reproducibility of the results..0× 106 CFU/ml) were incubated with 4× MIC. The cells with LIVE/DEAD and no EO served as negative controls. Time-dependent biofilm eradication. MBEC50 means that A550 of the sample dropped below the half value of the positive control (A550 = 1. As assessed by the emission of green/red fluorescence. EO-treated cells exhibited increased uptake of propidium iodide (leaking cell wall and membrane). exhibited red fluorescence (data not shown). Invitrogen. showed stronger antibacterial activity than the essential oil of Lavandula angustifolia (LEO) and its major components. The results of the semi-quantitative method were compared with those of a standard biomass quantification method by CFU determination. aureus ATCC 29213 and E. 3+. Six areas of each of the triplicate samples were photographed with an integrated Hamamatsu digital camera (C4742–95. In the further experiments. In this assay. essential oils/compounds were shown to possess the bactericidal activity against . After the incubation. according to the manufacturer’s recommendations. coli NCTC 8196 in PBS (1. which were scored by TTC assay as (+) and (–). Molecular Probes. with shaking. the colorless compound is enzymatically reduced to red TPF (1. LEO. respiratory active cells. Nikon UK). One exception was the S. before its application.

Killing rate studies of S. aureus and E. determined by MTT-reduction assay.38 Budzyñska A. The time-dependent inhibitory concentration of phytochemicals for biofilms preformed in the polystyrene 96-well culture microplate was determined by MTT reduction assay. et al.D. A1. Time. B1). lavender oil (A2. coli biofilms formed earlier on the surface of polystyrene culture microplate wells. aureus biofilm eradication by TTO and its constituents revealed that partial (50%) destruction of 24-h-old biofilms (MBEC50) . B3 (E. All biocides were used for this pur- pose at MIC up to 8× MIC. There was only a small difference between planktonic and biofilm biocidal concentrations. or lemon balm (A3. B3). aureus). mature S. A2. B1. usually not exceeding 2–4-fold higher values. A3 (S. B2. coli) biofilms exposed to tea tree oil (A1. 1.and concentration-dependent effect of essential oils on biofilm viability. 1 Fig. A550 mean ± S. B2).

coli S.78 0.78 0. Image of infusion tube colonized by S.097 0.19 0. aureus E.78 0. % v/v % v/v % v/v % v/v 0.78 0. 1).19 0.048 0. as described earlier (Ró¿alska et al.38 0. since biofilms formed on it by both bacterial strains were more difficult to eradicate by the tested compounds. aureus E.78 >1. the use of higher concentrations (4–8× MIC) of these and other compounds (MEO. whereas 2× MIC was enough to obtain TTO MBEC90 after 4 h of treatment. coli on biomaterial surfaces. Only TTO and terpinen-4-ol used at MIC – 2× MIC caused visible biofilm eradication (TTC reduction) from the surface of urological catheter and infusion tube.19 0.38 0. TTC-reduction assay – scored according to an arbitrarily fixed scale as described in Material and Methods.19 0. aureus E. coli S. since the CFU counting method used for the measurement of biofilm survival showed its total eradication (data not shown).19 0.78 0.19 0.097 0. (Table I. aureus.19 0. Our study leads to the conclusion that essential oils and some of their major constituents are able to efficiently reduce biofilms of both S. With few exceptions.78 0.048 1. B – treated for 24 h with TTO. similarly to what was observed for planktonic cultures. coli S.19 0. linalool. coli biofilm. MBC = 8 × MIC MBEC90 – minimal biofilm eradication concentration causing ≥ 90% reduction of biomass metabolic activity. MIC – minimal inhibitory concentration MBC – minimal bactericidal concentration. The obtained visual results scored by TTC assay as (+) and (–). A similar dose. MBEC90 (24 hours)..38 0. Effective MBEC90 of LEO and its constituents was as high as 4–8× MIC. .19 0. respectively at MIC or ½ MIC. value not exceded 4 × MIC. "-terpineol. coli S. aureus E. evaluated later as greater than 90% decrease in the number of live bacteria (CFU).19 39 TTO – Tea Tree oil (Melaleuca alternifolia). LEO – lavender oil (Lavandula angustifolia) MEO – Lemon balm oil (Melissa officinalis).78 0.78 0.56 0. aureus E. coli S. However.78 0.19 0.19 1.56 0. The time-dependent activity of MEO was comparable to TTO.19 0. 2. aureus biofilms.56 >1. surgical mesh was the surface most prone to persistent colonization.19 0.1 Antibiofilm activity of plant essential oils Table I Bacteriostatic and bactericidal activity of essential oils/consituents against planktonic and biofilm cultures of Staphylococcus aureus and Escherichia coli Essential oil/component TTO "-terpineol Terpinen-4-ol LEO Linalool Linalyl acet. a satisfactory effect is strongly dependent on the surface structure and properties. measured after 4 or 24 h of compounds application on the biofilm culture was achieved by the concentration of 4–8× MIC just after 1 h.19 0. Fig. However. Modified Richard’s method was used to detect the presence or eradication of biofilm.56 0. 1998).19 0.19 0. were compared with the data from the standard biomass quantification method by bacterial dislodgement and CFU determination.097 1.and time-dependent effect was observed for E. MBC (planktonic) MBEC90 (4 hours). it was more susceptible to the action of phytochemicals than the S.048 0.19 0. however.19 0. 2.097 0. Fig.19 0. Among the medical biomaterials tested.097 0. MEO Bacteria S. aureus E. surprisingly.78 0.19 1.19 0.097 0. * – exception linalool which is not bactericidal for S. C(+) – not treated positive control.39 0.19 0. C(–) – not colonized negative control.56* 0. aureus E. LEO. the tested phytochemicals reduced the metabolic activity of bacterial cells in biofilms after 24 h exposure at concentrations close to MICs.39 0. coli MIC (planktonic). The example of TTO antibiofilm activity is presented in Fig. In all cases it was proved that indeed TTC score (–) means that the lack of metabolically active cells is equal to the lack of viable bacteria. linalyl acetate) was necessary to achieve such an effect on the surface of surgical mesh. coli S.19 0. aureus and E.19 0.56 >0. aureus biofilm: A.

1% (8× MIC). aureus biofilm was achieved not earlier than after 4 h but the concentration of TTO needed for that was only 0. 1 In the present study. linalool. Melissa officinalis (MEO) essential oils and some of their main constituents ("-terpineol. 2009. TTO activity against S. officinalis essential oil. Cavanagh and Wilkinson.. like some other authors. have defined a drug concentration resulting in ≥ 90 biomass reduction measured by MTT staining as the MBEC (minimal biofilm eradication concentration). Karpanen et al.. Three of these components linalool. coli which was eradicated within 1 h exposure to concentration 0. 3-octanone. terpinen4-ol. Similarly to our results. linalool. coli were shown. In the present study we demonstrated that essential oils. causing more than 90% reduction in biofilm metabolic activity (MBEC90) after just 4 h of exposure. especially those connected with the use of artificial medical devices. which have potent broad-spectrum microbicidal and antibiofilm activities and pose a low risk for the development of resistance.7%). 2008. However. aureus and Gram-negative E. Our results on TTO antibiofilm activity are slightly different from those published by Brady et al.8-cineole. 2008. The main constituents of MEO are citrals (geranial + neral.. aureus biofilms was reported by Kwieciñski et al. This is worth emphasizing because the biofilm resistance to classical chemotherapeutics is typically 100–1000 times higher (Bryers. we have not found a strong correlation between the amount of biofilm mass exposed to essential oils. it is worth emphasizing that in our experiments the Gram-negative bacteria were very susceptible to damage by all the essential oils used. Gibbons. Hoiby et al. limonene (2. 2010). The main chemical components of lavender oil – the second active in our experiments are a-pinene. aureus and E. This . 2009). cis-ocimene. 2006. Amalradjou et al. officinalis and L. which was done in our study. Hence. According to our knowledge. this method is only semi-quantitative and requires confirmation using a more objective evaluation method.40 Discussion Budzyñska A. For example. 2010). 2008. the concentration of TTO used was much lower – 3. 2002). It is a promising observation since plant-derived compounds have gained a general interest in the search to identify alternatives for the control of infections. shape or color of the biomaterial. caryophyllene. Lavandula angustifolia (LEO). 39. Reichling et al. 1. 2004). In our study. But. 2008). On the other hand. terpinen-4-ol and lavendulyl acetate (Roller et al. However. However.4%). terpinen-4-ol were tested for antibiofilm activity since they are also major constituents of active TTO. terpinen-4-ol seems to have the most potent activity. alternifolia well known in this respect from other studies (Brady et al. S.2%). linalyl acetate. is not equal to their total destruction and eradication from the surface of the real medical biomaterials.6%). Usually plant-derived compounds show considerable activity against Gram-positive bacteria but not against Gram-negative species or yeast. It is accepted that there are two main reasons why essential oils do not create resistant strains of bacteria: they are complex and comprise numerous compounds in variable proportions depending on the plant chemotype. The authors showed that biofilms formed by MSSA and MRSA isolates were completely eradicated following an exposure to 5% TTO for 1 h. but not antibiofilm activity. Thus. $-caryophyllene (4. total eradication of S. Both S.. angustifolia have antibiofilm potency.. Kwieciñski et al.78% (2× MIC).9%). they would have to start all over with the next set (Bakkali et al.4%) (Mimica-Dukic et al.. and germacrene D (2. $-caryophyllene oxide (1. Remarkably. It is noteworthy that the evident decrease in biofilm cells metabolic activity measured by MTT-reduction assay (biofilms in microplate wells). camphor. 2009.. We. it is also possible that they can be more active when they are in their natural proportions in the native oil. The antibacterial. the in vitro strong effects of Melaleuca alternifolia (TTO). (2006). contrary to other investigators. this effect was more time-dependent than the activity of TTO and LEO.. Among them. Our further research will be devoted to examining the activity of individual components. linalyl acetate. 2008. aureus biofilm was also eradicated in such a short time but only by 66%. limonene. the in vitro activity of the oils against the biofilm of both strains tested was equal to or only slightly lower than that against bacterial planktonic culture (Table I). even if bacteria did figure out an oil’s effective components. et al. have been earlier described. coli biofilms were eradicated efficiently by MEO. This method indeed has shown excellent applicability as it is able to detect dose-dependent and time-dependent differences in the effect of antimicrobials. linalyl acetate) on the biofilms of Grampositive S. geraniol (3... quantified with TTC staining on medical biomaterials and the metabolic activity quantified with MTT in the wells of microplate. Research on this topic is focused on natural or synthetic substances. transocimene. 2009.78%. which have evolved significant permeability barriers (Bakkali et al. However. the potent and very fast antibiofilm activity of TTO was noticed for E. not only of M.7%). but also of M. Reichling et al. (2009). citronellal (13.. antifungal and antioxidant properties of M. this is the first report concerning such activity of MEO and LEO. A great advantage of the TTC reduction method is the fact that the metabolic reduction of colorless TTC into red-colored formazan by bacteria adhering to the surface of a synthetic implant occurs regardless of the type.

Planta Med. and Delfan B. Suschke and R. 23: 444–449. U. H.A. B. E. D. J. R. 2010. Evaluation of antibiofilm activity of dentol. Pulcini. M. Averbeck. 16: 79–90. J. Bryers J. Wiltfang. Gilpin.A. Biological activities of lavender essential oil. Hoiby et al.C. 2010. Acta Med. M. M. K. Kouskoumvekaki. antiviral. and cytotoxic properties – an overview.K. Melaleuca alternifolia (Tea Tree) oil: a review of antimicrobial and other medicinal properties. M. M..P.. Wound Repair Regen. Averbeck and M. J. Eick and K. J.. B. 87: 309–317. Antimicrobial and antioxidant activities of Melissa officinalis L.. 33: 343–347. Stensen. Phytotherapy Res. 2002. Sletteng. Stewart.R. Nakaoka. J. Biotechnol. Mikrobiol. Wiêckowska-Szakiel. Med. Swogger. Fabian D. Kurup and R. Antibiofilm effect of trans-cinnamaldehyde on uropathogenic Escherichia coli. Flavour and Fragrance J.S. J. Essential oils – their antimicrobial activity against Escherichia coli and effect on intestinal cell viability. 2006. Planta Med. Complement Med. Antibiofilm properties of Satureja hortensis L. K. Rev.. Kalemba D. Ró¿alska. Hossainzadegan H. 2008. Altern.V. Gursoy. P. 184: 358–363. Walencka E. compared with conventional antibiotics.F. Urology. Iranica. Ciofu. Riley. 16: 37–44. E. M. 2004. Carson C. Antimicrob. Chem. E. (Lamiaceae) essential oil. Kunicka. Russo. Gursoy U. Doœw. Pol. Givskov. 2008. Mimica-Dukic N. J.R. Inhibition of methicillin-resistant Staphylococus aureus (MRSA) by essential oils. Essential oils of aromatic plants with antibacterial. Hammer and T. Dai T. Sestrich. S. Flægstad. Bredee and others. M. Gibbons S.. 2010. Clin. Lysostaphin as a potential therapeutic agent for staphylococcal biofilm eradication. J. Y-Y. Loughlin. T.D. Chao S. weaknesses and opportunities. O. essential oil against periodontal pathogens. Conway and P. J. M. J. Antimicrob. Int. I. Worthington.A.J. Sivananthan.. 1031–1036.H. Effects of tea tree (Melaleuca alternifolia) oil on Staphylococcus aureus in biofilms and stationary growth phase. Med. Wójcik. Biological efects of essential oils – A review. 2005. E. High in vitro antimicrobial activity of synthetic antimicrobial peptidomimetics against staphylococcal biofilms. 61: 281–281. Cavanagh. S. S.. 2008. 63: 136–145.. Karpanen T. Toxicol. Forsch Komplementmed.S.M. Microbiol. 100: 1–17. Sherry. Chemother. Roller S. Secor. Recent Patents on Anti-Infective Drug Discovery 5: 124–151.. Phytomedicine 13: 463–467. 2006. J.. Schubert. Detection of biomaterial-associated bacterial biofilm (in Polish). T. Reichling J. 2003. . our results encourage the exploration of the other essential oils and their constituents showing the most potent antibiofilm activity since the oils used in this study have superior antimicrobial activity in S. Appl. Buckle. Paddy Kearney and M.M. 2009.A. Agents 35: 322–332. Narayanan. Dürig A. Antimicrobial efficacy of chlorhexidine digluconate alone and in combination with eucalyptus oil. S.J. tea tree oil and thymol against planktonic and biofilm cultures of Staphylococcus epidermidis. J. Hendry. Svendsen and T. 2009. Doœw. Idaomar. Sokovic. Bjarnsholt. Vejborg and P. Biofilms in chronic wounds. antifungal. Flemming K.. Kwieciñski J. Bozin.D. Curr... Ró¿alska B. Kononen and V-J. 16: 301–308. P. Acil. Venkitanarayanan. Antibacterial and antifungal properties of essential oils. coli biofilms.. 2008. 73: 545–551. Bujnakova. Hryniewicz and B. J. It is well known that the growth conditions and the type of surface may affect the architecture of a biofilm which can influence the cells sensitivity to antimicrobial agents (Bryers.M. Wolcott. Mikrobiol. 2009. N. Young. 15: 275–279. Chemother. Ró¿alska. J. Med. 2006. Bakkali F. Hashmi. B.. Ró¿alska. Agric. Cakmakci.A. Antibiotic resistance of bacterial biofilm. Klingenberg. Ró¿alska. B. Chemoinformatics-assisted development of new antibiofilm compounds. Salvipisone and aethiopinone from Salvia sclarea hairy roots modulate staphylococcal antibiotic resistance and express antibiofilm activity. C. Flemming et al. and A.J. 2009. Kalemba. Sabol. Sadowska and B. B. However.. £. Schnitzler. Antibacterial essential oils in malodorous cancer patients: Clinical observations in 30 patients.. Simin. Gursoy. Uitt. Phytochemicals for bacterial resistance – strengths. P. Tunney. T. Wysokiñska. Topical antimicrobials for burn wound infections. Med. 2009. P. Sadowska. Anaerobe. 1998. Microbiol. 2009. Cavanagh H. S. 2010). Lambert. Food Chem.M.P.W. B. In vitro activity of tea-tree oil against clinical skin isolates of meticillin-resistant and -sensitive Staphylococcus aureus and coagulase-negative staphylococci growing planktonically and as biofilms. Bioeng. 2006. 2009. 15: 164–167. 50: 115–122. and N.A. 19: 50–62.. Saller. 2010. Hamblin.. Oberg and K. Toxicology in vitro 20: 1435–1445. Antimicrob. Food Chem. K. Ró¿alski. Klemm. Hoiby N. Huang. 2008. 62. M. C. R. 10: 813–29. Budzyñska A. A. Sprengel. 2009. Walencka E. The antimicrobial activity of high-necrodane and other lavender oils on methicillin-sensitive and -resistant Staphylococcus aureus (MSSA and MRSA).A. J. James G. Costerton and P. Biotechnol.V. E. 2008. Microbiol. 2007. aureus and E. R. Warnke P. Domaracka and D. and J. Medical biofilms. W.1 Antibiofilm activity of plant essential oils 41 suggests that research on given compound’s antibiofilm activity should be conducted using simultaneously at least two independent methods. Ró¿alska. Microbiol.. Sadowska. W. Literature Amalaradjou M. 74: 594–602. S. 47: 35–40. 55: 1375–1380. KuŸma and B. The optimization of methods utilized for testing the antibacterial activity of essential oils (in Polish). Rudnicka. Wilkinson. Baskaran and K. Y. Antimicrob. J. Sharma.. 2008. 54: 191–200. L. D. G.S. 46: 446–475. Molin and O. S.. Ernest and J. Brady A. D. Wiêckowska and W. Int. 52: 2485–2489. S.. Roldan.R.

1 .42 Budzyñska A. et al.

pl .. Phylobacteriaceae and Bradyrhizobiaceae. 2000). mixed inoculation. The data suggest that multi-strain model of nodule colonization is common in Rhizobium-legume symbiosis and reflects the diversity of rhizobial population living in the rhizosphere K e y w o r d s: clover growth promotion.. commonly known as rhizobia. 20-033 Lublin. Masson-Boivin et al. DOMINIKA KIDAJ and ANNA SKORUPSKA Department of Genetics and Microbiology. competitiveness. Akademicka 19 st. Poland. supplementing low nitrogen level in the soil and replacing nitrogenous fertilizer (Peoples et al. The results showed that the studied strains essentially differed in competition ability. Poland Received 10 April 2010. revised 10 January 2011. Wielbo. After releasing from infection threads bacteria surrounded by peribacteroid membranes colonize nodule tissue forming symbiosomes in which bacteria are converted into bacteroids. The most remarkable result of this study is that almost half of the total number of the sampled nodules was colonized by more than one strain. Maria Curie-Sk³odowska University Lublin.. 2000. MONIKA MAREK-KOZACZUK. 1986)... flavonoids released by plants attract bacteria to the roots and induce synthesis of bacterial Nod factors that are lipochitooligosaccharide signals that trigger several plant responses. rhizobia Introduction Biological nitrogen fixation (BNF) is a process in which atmospheric dinitrogen is reduced to forms available to plants and is provided by free-living bacteria or bacteria symbiotically associated with leguminous plants. These differences seem not to be dependent on bacterial multiplication in the vicinity of roots. 2009). which determines the ability of Rhizobium strains to dominate in the nodules of a given legume host in competition with other strains present in the root rhizosphere (Dowling and Broughton. 2001). Rhizobia belong to different taxonomic families of "-proteobacteria such as Rhizobiaceae. Rhizobium leguminosarum bv. e-mail: jerzy.umcs. trifolii (Rlt) establishes beneficial root nodule symbiosis with clover. Bacteroids localized in the symbiotic zone of mature nodules reduce atmospheric dinitrogen into forms. such as root hair curling and differentiation of plant meristems leading to the formation of root nodules. Ramos et al. Department of Genetics and Microbiology. 2000. Maria Curie-Sk³odowska University. Soil populations of Rhizobium usually consist of numerous strains. Competition for nodulation is a quantitative phenotype. Perret et al. but rather on complex physiological traits that affect competitiveness. trifolii Strains in Mixed Inoculation of Clover (Trifolium pratense) JERZY WIELBO*. Nodules are colonized by rhizobia via tubular structures known as infection threads in which rhizobia multiply. Twenty Rlt strains differentially marked with antibiotic-resistance markers were investigated in terms of their competitiveness and plant growth promotion in mixed inoculation of clover in laboratory experiments. (reviewed by Perret et al. The symbiosis between rhizobia and legumes is a multi-step process including the exchange of molecular signals between the microsymbiont and its host (reviewed by. trifolii (Rlt) induces and colonizes nodules elicited on roots of clover (Trifolium spp. 1990. 2000.). 1995.. which are easily assimilated by plants (Vasse et al. * Corresponding author: J. 43–49 ORIGINAL PAPER Competitiveness of Rhizobium leguminosarum bv. Jones et al. 2007). Significance of rhizobial symbioses in agriculture stems from providing an extra source of nitrogen for plant growth..wielbo@poczta.. and to $-proteobacteria such as the recently described Burkholderia spp. accepted 14 January 2011 Abstract Rhizobium leguminosarum bv. Spaink. 60.Polish Journal of Microbiology 2011. No 1. Initially.. Vol.lublin. Timmers et al.

1996. Clover seedlings were inoculated with 200 µl single strain suspension in water. . Duodu et al. Root nodules were surface-sterilized and the content of individual nodules was plated on TY agar medium. In both cases the bacterial suspensions contained about 1. Rhizobial growth assay. Each of 20 strains was resistant to one of the following antibiotics: rifampicin. For each experimental group 20 plants were used and two independent experiments were conducted. 5 ml Fåhraeus medium supplemented with appropriate amount of TY medium was inoculated with 50 µl of overnight culture of Rlt strains growing in TY medium. 2000). 1998. Red clover seeds (Trifolium pratense L. numerous molecular markers were developed and employed. 1998. 20 Rlt strains used in this study were obtained from nodules of clover (Trifolium pratense) cultivated in arable sandy loam soil in the region of Lublin. Plants were grown in a greenhouse under natural light supplemented with artificial light (14 h day/10 h night. clover plants were harvested and nodules were counted. 1989) with constant shaking. 200 µg/ml. Plant tests.. whereas the growth on more than one plate from a set was interpreted as mixed colonization of nodule.. TcR – tetracycline resistant strains were obtained by introducing pJBA21Tc plasmid. Poland. Stuurman et al. cv. depending on antibiotic resistance markers carried by strains in a particular mixture.. Spontaneous or acquired antibiotic resistance markers are commonly used due to feasibility of detection and a broad differentiation allowing simultaneous identification a number of strains (Sharma et al. For all tested strains the experiment was conducted in triplicate. Tetracycline resistant Rlt strains were obtained by introducing pJBA21Tc plasmid via triparental conjugation (Wielbo and Skorupska. 1994. 2009). as well as during several stages of plant colonization and nodule formation (Wilson et al. at 24/19°C). The commonly observed nodule colonization by multiple strains that differ in respect to the efficiency of plant growth promotion may have significant impact on overall symbiosis in the soil. Bacterial growth was measured by monitoring OD550. or with 200 µl mixture of four strains differently tagged with antibiotic-resistance marker (1:1:1:1 v/v)... 1991. streptomycin or trimethoprim (40 µg/ml. Dajana) were surface-sterilized. In this work.. 1998. NalR – natural nalidixic acid resistance. Detectable growth on only one plate from a set was interpreted as the presence of pure culture in the nodule. Depret and Laguerre.0×109 cfu/ml. and incubated for 2 days at 28°C. The results showed that in most cases simultaneous inoculation of plants with a mixture of rhizobial strains carrying different antibiotic resistance markers resulted in nodule colonization by more than one strain. 200 µg/ml. Colonies derived from individual nodules were used for preparation of water suspension an OD550 of 0. 2008). To investigate the competition between rhizobial strains.05 (~ 5 × 107 cfu/ml). 2001). streptomycin and trimethoprim-resistant spontaneous mutants were obtained as follow: from overnight cultures of Rlt isolates grown in liquid TY medium (Sambrook et al. Stuurman et al. trifolii strains used in this study Group I K416 Tm K411 RfR K36 StrR KO27 TcR R Group II K417 Rf K108 TmR KO17 TcR K71 StrR R Group III K38 Rf K413 NalR KO18 TcR K91 StrR R Group IV K29 Tc K87 StrR K322 NalR K810 Rf R R Group V K313 TcR K312 StrR K415 RfR K107 TmR The spontaneous mutants were isolated in the case of RfR – rifampicin resistance.. Single colonies resistant to appropriate antibiotic were isolated.44 Wielbo J. Wilson et al. StrR – streptomycin resistance and TmR – trimethoprim resistance. which was scratched from TY agar medium plate. tetracycline. Rifampicin. Cresswell et al. trifolii strains. reveal significant differentiation in competitive fitness to infect and occupy nodule of the host plant and differ in the symbiotic activities (Maier and Triplett. and then transferred onto agar slants with nitrogen-free Fåhraeus medium (Vincent.. Estimation of rhizobial competitiveness. 1970). Experimental Materials and Methods Table I Relevant characteristics of Rhizobium leguminosarum bv. 2000. Ten clover plants were randomly chosen from each experimental group inoculated with a mixture of four strains and wet masses of shoots and roots were estimated. Rhizobium leguminosarum bv. Nalidixic acid for selection of naturally resistant strains was used in the concentration of 150 µg/ml. Sessitsch et al. we investigated the competition ability of 20 Rlt strains originating from clover root nodules under laboratory conditions. germinated on TY agar medium. respectively). trimethoprim and nalidixic acid (Table I).. about 5× 109 cfu/ml of the given culture was plated on TY agar medium supplemented with rifampicin.. After 5 weeks. 2007. streptomycin. Bacteria were grown for three days at 28°C. 1 which compete with each other during the phase of vegetative growth in the soil. 20 µl of each suspension was spotted on a set of TY agar medium plates containing one of four antibiotics. Wielbo et al. The efficiency of symbiotic nitrogen fixation was estimated by weighing fresh mass of shoots and roots. et al. Rhizobial strains are genetically and metabolically diverse.

(c) if a strain was absent in all tested nodules. Competition ability of R. three of four strains used for inoculation were found in the sampled nodules. Distribution of nodules infected by one. B. The others nodules were occupied by two or three strains that were distinguished by different antibiotic markers. E). D. For Rlt strains assigned to a given group the “relative competition ratio” (RCR) was calculated as follow: (a) the number of nodules occupied by the least frequently found strain was normalized to 1. trifolii strains in the mixed inoculation of clover measured as relative competition ratio (RCR) (see Results). C. C. On the other hand. twenty Rlt strains were divided into five groups (I–V). K87 (group IV) and K415 (group V) strains can be considered competitive. K413 (group III). Clover seedlings were inoculated with individual strains or with a mixture of four strains belonging to a given group. As regards their high “relative competition value”. K38. Strains were assigned to groups randomly. (b) RCR for the three other strains were calculated by dividing the number of nodules colonized by a particular strain by the number of nodules occupied by the least frequent strain. trifolii strains. B. E). whereas in the case of groups I and IV. all four strains used for clover inoculation were recovered from the nodules.1 Competitiveness of Rhizobium leguminisarum strains 45 Fig. RCR equal 1 – number of nodules colonized by strain most rarely found in the sampled nodules of a given group (I–V). and four strains belonging to the same group differed from each other with respect to the antibiotic resistance markers they were carrying (Table I). 2. K411 (group I). it has been found that nodules occupied by only one strain comprised at average 56 ± 7% (Fig. 1A. 2 A. In the case of groups II. . D. Based on the antibiotic resistance selection of Rlt strains recovered from clover nodules. leguminosarum bv. K71 (group II). III and V. KO27 and K810 strains were not recovered from the sampled nodules and they were considered uncompetitive. the RCR was 0 (Fig. leguminosarum bv. K417. Results To study nodulation competitiveness. Two-strain nodule occupancy ranged from 28% to Fig. After 5 weeks. two or three strains in particular groups of R. 1. samples of nodules were taken and rhizobia were recovered from nodules by selection on TY medium supplemented with an appropriate antibiotic.

and three-strain nodule occupancy from 3% to 16% of nodules.3 ± 2.7 a 31.8 11.6 a 26.0 ± 12.3 a 23.8 a 8. B.6 a 32.5 ± 7.0 b 27.6 ± 9. fresh mass of total plant per nodule was lower in the mixed inoculation in comparison to the same parameter in clover inoculation by individual strains (Table II).1 b 25.4 10.7 ab 50.0 c 9.0 a 12.1 10.4 a 4.2 ± 8.9 ± 6. Nodules simultaneously colonized by all four strains were not detected.6 ± 4.9 ± 8.7 b 45.9 a 3.0 16.7 ± 10.1 ± 2. E).2 ± 2.6 ± 11.0 ± 7.7 a 56. In the case of some strains the differences in nodule number and shoot and root mass were statistically significant.4 10. In addition.3 a 29.6 ± 9.05).6 ± 2.5 ± 6.2 ± 7.8 ±1.7 ± 0.1 ± 12. for instance.9 a 68.7 ± 7.8 ± 2.0 ± 0.8 9.8 ± 9.6 ± 4.8 ± 0.1 a 18.0 a 36.3 b 5.5 ab 13.4 ± 1.0 a 35. The differences observed in the nodule colonization ability of Rlt strains might result from some physiological differences between the strains.3 ± 5.3 ± 9.0 ± 2.1 9. C.7 14. It is worth noting that plants inoculated with a mixture of four strains showed intermediary values of symbiotic parameters.8 ± 5.0 a 2.0 8.5 a 44.2 ± 1.4 a Group IV of Rlt strains 3.7 ± 6.1 ± 1.4 a Values are the mean ± standard deviation of 20 clover plants in experiment.3 a 28.8 ± 8.6 6.5 a 23.8 ± 1.6 a 7.1 a 6.1 ± 2.5 b 3.4 ± 1.2 ± 0.7 ± 10.0 a 6.9 a 39.3 12.6 a 4.6 ± 2.3 a Group II of Rlt strains 7.2 8.7 ± 3.5 a 3.2 a 31.9 a 39.2 ± 8.6 b 29.4 ± 2.2 a 36.7 ± 1.2 ± 1.2 ab 21.7 a 24.8 a 34.4 a 4.8 ± 0.4 ± 7. at least in competition experiments conducted under laboratory conditions.3 ± 2.3 ab 5.9 ± 3.2 a 13.3 a 16.5 a 10.2 13.0 b 43.4 a 25. The tested strains varied both in the number of nodules elicited and in the impact on fresh mass of clovers.9 a 5.8 ± 5. The obtained results showed that nodule colonization by more than one strain was prevalent.2 ab 41.2 ± 2.46 Wielbo J. et al.1 a 8.5 b 24.1 a Group V of Rlt strains 3.9 a 23 ± 9.9 ± 1. depending on the group of strains (I–V) used for clover inoculation (Fig. Rlt strains used in competition experiments were characterized with regard to the symbiotic properties such as nodulation ability and plant growth promotion (Table II).3 ± 0.3 ± 3. leguminosarum bv.8 ± 2.1 a 22.2 14.4 ± 1.0 ± 0.8 a 10.4 12.0 8.9 ab 30. which should minimize the effect of possible differences in the initial cell density.1 b 40.0 a Average values 6.4 ± 8.8 b 1 Group I of Rlt strains 5.5 12.8 10.1 a 44.1 b 19.0 a 12.4 16.5 a 6.9 a 3.3 ± 1.0 a 36.6 ± 0.5 a 26.4 ± 4.3 ± 0. which can reflect averaged effects of individual strains on symbiosis.6 ± 6. 40%.3 ± 7.8 ± 0.4 ± 1.5 ± 4.4 ± 0.7 7.0 a Group III of Rlt strains 5.3 12. the mixtures of strains used as inocula were prepared by mixing equal volumes of four bacterial water suspensions with the same OD550.7 13. In the competition experiment.7 ± 7.5 b 10.4 ± 11.6 ± 3.6 ± 1.4 b 44. D.5 ± 10.3 ab 12.6 a 9.7 ± 1.5 10. Means within the same column and followed by the same letter are not significantly different (P>0. trifolii strains Rlt strain number K 416 K 411 K 36 KO27 Mixed inoculation (I) K 417 K 108 KO17 K 71 Mixed inoculation (II) K 38 K 413 KO18 K 91 Mixed inoculation (III) K 29 K 87 K 322 K 810 Mixed inoculation (IV) K 313 K 312 K 415 K 107 Mixed inoculation (V) Inoculation by individual strains Inoculation by a mixture of strains No of nodules/plant Fresh mass Fresh mass Fresh mass of shoots/plant (mg) of roots/plant (mg) of plant/nodule (mg) 22.9 a 25.3 ± 10. 2 A.2 a 18. In almost all cases.9 12.1 ± 7.6 a 34.0 ± 7.6 ab 55.4 a 6. in the growth rate.3 a 34.9 17.2 a 5.8 a 33. Table II Symbiotic activity of R.4 ± 2.2 a 6.5 ± 3.5 ± 10. growth of rhizobia was .4 a 33.2 ± 7.

2001). It is possible that the number of the sampled nodules should have been greater to allow detection of nodules occupied by all four strains. 1998) or even distribution of bacteria in the soil (Lopez-Garcia et al. 1994) or gfp reporter genes (Stuurman et al. the two methods have been combined. the analysis of variance indicated that these differences were statistically insignificant (data not shown). reaching OD550 values from 0. which does not reflect native conditions. and reflects the complexity and diversity of rhizobial population in the rhizosphere... the possible differences in the initial growth of Rlt strains on plant medium at the time of inoculation could not essentially affect their competitiveness. Past studies showed mixed colonization of infection threads and nodules (Bromfield. Several studies indicate that both the legume hosts and microsymbionts affect the outcome of rhizobial competition (Kiers et al. in the case of a mixed inoculation. 1984). The results showed that Rlt strains used in the competition experiments grow weakly and only in Fåhraeus medium supplemented with 10% or 20% of TY. the limited space available in the infection threads and/or in young nodules might restrict the growth of rhizobia. Differences in growth of strains on Fåhraeus medium supplemented with 10% TY. Sachs et al... As a result.. nodule tissue colonization and survival after release into the soil. Duodu et al. and this might also explain why four strain nodule colonization was not observed..... 2010).. It was assumed that addition of some amount of TY to the plant medium allows for the growth of bacteria while simultaneously resembling the plant growth medium. In conclusion. the competition between rhizobia was commonly investigated in a two-strain competition assay under controlled conditions. It is worth noting that infection by several strains negatively affected plant growth promotion when compared to single-strain infection. 2009). 2007. Gage.. both in highly controlled experiments under laboratory conditions. Wielbo et al. Rhizobia were grown in these media for 2 days and OD550 was measured. In this assay both strains were tagged with different markers such as antibiotic resistance genes (Bromfield. 2001. Finally. and the predominance of nodules occupied by more than one strain. however.13 to 0.. 2007. Major drawback of this approach is lack of any information about the unmarked strains possibly present in the nodules. 2008.1 Competitiveness of Rhizobium leguminisarum strains 47 assayed in the medium composed of nitrogen-free Fåhraeus medium used in plant tests supplemented with 1%. The strains compete with each other on the level of root adsorption. we demonstrated the possibility of single clover nodule colonization by three different strains. 2000. as well as on medium supplemented with 20% TY were observed. In several studies. leguminosarum specific for a given legume host is composed of numerous strains characterized by great variability in genetic and metabolic traits (Lakzian et al.. 2010). Rhizobial competitiveness is a complex process dependent on genetic and overall metabolic status of bacteria (Wielbo et al. Svenning et al. Recently... . Depret and Laguerre. 2009). the entire unmarked soil population composed of numerous strains. Silva et al. lux (Cresswell et al. The drawback of this method is the extreme simplification of the model.. 2009. and clover plants were inoculated by four differently marked strains. appreciable variability in rhizobial competitiveness is observed. 2%. growth inside the infection threads. 2009). It allowed determining the differences in competitive ability of the individual strains. Sachs et al. Wielbo et al.. 2008). In the present work. 5%. the competitiveness of unmarked rhizobial strains was studied by molecular identification of particular genotypes occupying the nodules (Svenning et al. All these and other variables characterizing individual strains influence their overall competition abilities. production of/ resistance to bacteriocins (Wilson et al. 1996.. susceptibility to plant molecular signals (Mabood et al. 2005.. 2002. 2004). 10% or 20% TY medium. Nodules colonized by four strains were not found. 2007). The second most frequently used method for rhizobial competition analysis was to use a single marked strain vs. 1987). Less competitive rhizobia comprising another part of the population may be eliminated from nodule infection (Streeter. 2008. The most important finding from the presented study is that almost half of the total number of the sampled nodules was colonized by more than one strain. Rangin et al. The percent of nodules colonized by three strains was relatively low and ranged from 3 to 16% of the sampled nodules.. 2006. 2000) and occupancy of both strains was easily determined in the nodule. nonsymbiotic rhizobia constitute the fraction that lost the nodulation genes but is still able to colonize root surfaces and can play an important role in competition (Sachs et al. Discussion Local population of R. motility of bacteria (Mellor et al. Rangin et al. 1994). Expanding the competition test to clover inoculation by four strains. On the other hand.. where they constitute part of population capable of symbiotic interactions (Duodu et al. and in experiments carried out in the soil (Maier and Triplett..2 (data not shown). 2002). Maj et al. It suggests that multistrain model of nodule colonization is predominant also in the soil environment.. 1984) in a twostrain competition assay (Stuurman et al. 2008. root hair infection.

Environ.J. Rangin. leguminosarum strains investigated in the experimental competition model were greatly differentiated with respect to competitiveness for nodule occupancy. The prevalence of nodule coinfection by native soil population is yet to be determined. 34: 519–529. H.L. Lakzian A.M.E.. 179: 224–235. X. G.48 Wielbo J.Y.J. Biochem. Wielbo.. Rev. Kiers E. Favelukes and A. Ecol. . Smith.P.F. Beynon and K. Broughton. Taga and G. 74: 5653–5661. Microbiol.W. M. Molecular basis of symbiotic promiscuity. A. M. 40: 131–157.. Wilson. 1987. Skot and A. Giraud. Plant Soil 204: 35–45. 4: 216–224.. 2009. This observation is consistent with our previous studies. Microbiol.A. (Cicer) for ecological studies. and G. G. Walker. Appl. Quantification of the contribution of biological nitrogen fixation.M. Symbiotic and competitive properties of motility mutants of Rhizobium trifolii TA1. P. Toward more productive. 68: 280–300. A.B. 2000. R. de Vos and K.M. diversity and metal tolerance. Establishing nitrogen-fixing symbiosis with legumes: how many rhizobium recipes? Trends Microbiol. Masson-Boivin C. 2009). 2002. Construction of Tn5 tagged mutants of Rhizobium spp.. A possible explanation for this result might be that the concentration of several Nod factors produced by particular strains in the mixed inoculation is substantially greater than in a single strain inoculation. Rev.L. Lakshminarayana. 64: 180–201.R. 15: 191–234. Villatoro. In situ phylogenic and diversity of wild Bradyrhizobium communities. in which treatment of clover seeds with Nod factors under controlled conditions enhanced the growth of clover only when a Nod factor was applied in appropriate concentration (Maj et al. P.A. 2009. Springer-Verlag. J. 2009. Mellor H. Sambrook. Infection and invasion of roots by symbiotic nitrogen-fixing rhizobia during nodulation of temperate legumes. Davies. Molecular Cloning: a Laboratory Manual. S. Acknowledgements The research reported in this paper was funded in part by a grants of Ministry of Sciences and Higher Education of Poland nr N N304 026734 and N N301 028734. Alves and R. Turner. Measured sanctions: legume hosts detect quantitative variation in rhizobium cooperation and punish accordingly. C. and competitive nitrogen-fixing symbiotic bacteria.. J.F. a mixture of strains was not conclusive. Urquiaga. Annu.).E. Variation in preference for Rhizobium meliloti within and between Medicago sativa cultivars grown in soil. 91: 105–115.N.W. 165: 50–60. Depret G. Microbiol. Microbiol.. Svenning.J. Triplett. L.J. Giller. 1 The comparison of symbiotic efficiencies of clover inoculation by individual strains vs. Chopra (eds.L. J.L.. J. Cookson.. Plant phenology and genetic variability in root and nodule development strongly influence genetic structuring of Rhizobium leguminosarum biovar viciae populations nodulating pea. 2002. Soil Biol. 7: 1049–1058. Dowling D. 2008.H. Peoples M. Anand and K. Gudmundsson and M. A. Dilworth.. Bacteriol. E. nodule coinfection by two or three strains was commonly observed. Marek-Kozaczuk and A.. 2000) and that nodule number increase was not accompanied by increased plant growth probably due to the relatively short timeframe of the experiment.J. Kembel. J.K. 8: 1077–1086. Signal in the underground: microbial signaling and plant productivity. Competition for nodulation of legumes. Biochem. Microbiol. Vazquez.. 2010.L. our data revealed that R. and Strain Effectiveness on the Diversity of a Natural Sinorhizobium Species Community.-C. 2008. Maj D. Res. Boddey. B. Biol. In summary. 2004. Connolly and M. J. R. B. 1994. Plant Soil 318: 117–126.. Wielbo.V. New Phytol.J. Biotechnol. Fritsch and T. Rhizobium leguminosarum bv. Lopez-Garcia S. 1991. Ladha and D. Skorupska. J. Laguerre. Perret and J.S. Svenning. Environ.J. Cold Spring Harbor.J. Lau and E.T. Maniatis. Soil Biol. C. B.. T. Rousseau and R. Jones K. Pretreatment of clover seeds with Nod factors improves growth and nodulation of Trifolium pratense. 2000. The construction. Ecol. Mol.S. Microbiol. M. Plant Sci. Cleyet-Marel and G. M.G. X. Murphy. Competitiveness of native Rhizobium leguminosarum bv.E. Skorupska. 1984. et al. Brunel. Mol.. Whereas. Ramos M. Glenn and M. Nod factors stimulate nodule organogenesis (Perret et al. Use of marker genes for competition studies of Rhizobium. viciae populations in soils with increasing heavy metal contamination: abundance. Microbiol. How symbionts invade plants: the Sinorhizobium-Medicago model.C. 2006. 23: 881–885. Environ. detection and use of bioluminescent Rhizobium leguminosarum biovar trifolii strains. 1998. C. Maier R. J.. Berlin. Res. Kobayashi. and W. 2nd ed. J. 2005.W. 2007. W. 1996. 1986. Sharma P. Duodu S. Biol. Sessitsch A. J. S. Response to flavonoids as a factor influencing competitiveness and symbiotic activity of Rhizobium leguminosarum. 17: 458–466.K. 2009. 1995. 75: 4727–4735. Appl.C. Rhizobial position as a main determinant in the problem of competition for nodulation in soybean. Mabood F. Appl. significant difference in ratios of fresh mass of the entire plant to nodule number was evident when these two types of inoculations were compared (Table II). Bhuvaneswari.. Gage D. In the mixed inoculation of clover plants.. Environ.E. Perret.Denison.L. W. NY: Cold Spring Harbor Laboratory. Heidelberg. 35: 479–487.M. significant differences between the averaged data of shoots and roots masses in single strain inoculation and in the mixed inoculation have not been found. Enhancing legume N2 fixation through plant and soil management. Jung and D. Environ. Plant Soil 174: 83–101. Rev. Sachs J. 77: 656–665. Batut. Effects of Medicago truncatula Genetic Diversity. Staehelin and W.. Marek-Kozaczuk and A. and E. T. Cresswell A. Lodeiro. Literature Bromfield E. Hardarson. Molecular mechanisms of plant and microbe coexistence.R. Duodu S. Dion and V.L. Maj D. Arch. plasmid profiles. 148: 34–39. trifolii strain for nodule occupancy is manifested during infection. Symbiotic and saprophytic survival of three unmarked Rhizobium leguminosarum biovar trifolii strains introduced into the field. Crit.F. Chem. 1989. Evol.E. Brophy.. Microbiol. E. Spaink. Simms. Microbiol. 48: 1231–1236. efficient. 2008. In: Nautiyal C. Rev. Bena. Appl. J. Nature 5: 619–633. 2001... Herridge.M. Rhizobial Competition. Broughton. Microbiol.

Population genetic structure of Sinorhizobium meliloti and S. 40: 513–522. de Billy. P. 2001. M. Microbiol. Martínez-Romero. Microbiol. FEMS Microbiol.. 172: 4295–4306. Wielbo J.. Wijfjes. trifolii population recovered from clover nodules.P..C. 2010. Kan and E. J. 54: 25–288. Auriac. 13: 1204–1213. . 2000. Annu. 2007. Wilson R. Wielbo J.. 1994.R. 30: 413–417. Bacteriocin production and resistance in a field population of Rhizobium leguminosarum bv. Truchet. Ann. Handley and J. Rev. and A. in Mexico. Failure of inoculant rhizobia to overcome the dominance of indigenous strains for nodule formation. Biochem. A. Microbiol. Microbiol. C. B. I. F. Plant-Microbe Interact.1 Competitiveness of Rhizobium leguminisarum strains 49 Silva C. Ecol. Vincent J. Marek-Kozaczuk.. F..15. Skorupska. Genetic and metabolic divergence within a Rhizobium leguminosarum bv. 76: 4593– 4600.G. Correlation between ultrastructural differentiation of bacteroids and nitrogen fixation in alfalfa nodules. Beringer.M. Timmers A.M. Construction of improved vectors and cassettes containing gusA and antibiotic resistance genes for studies of transcriptional activity and bacterial localization.A. and A.C. M.M. Can. Pacios Bras. de Billy. Wielbo J. medicae isolated from nodules of Medicago spp. G. Bacteriol. viciae. F. Use of green fluorescent protein color variants expressed on stable broad-hostrange vectors to visualize rhizobia interacting with plants.H. Streeter J. Kubik-Komar and A. 88: 781–787. 2007.E. Truchet. Spaink H. E. Soil Biol. UK. A manual for the practical study of root nodule bacteria. J. Microbiol.P.. Spaink. 60: 477–489. Mol. Can. 1990. 1970. 2000. Root nodulation and infection factors produced by rhizobial bacteria. Plant-Microbe Interact..L. 2000.A. A. Saprophytic intracellular rhizobia in alfalfa nodules. Stuurman N. Vasse J. is associated with bacterial competitiveness. Marek-Kozaczuk M. Bot. Mazur A. Skorupska. Bloemberg and H. Mol. 1998. Appl. Increased metabolic potential of Rhizobium spp.L. Camut and G.. Vasse. Competition for nodule occupancy between introduced strains of Rhizobium leguminosarum bv. Soupène. S.M. 2001. International biological program handbook no. J.. H. trifolii and its influence on plant production. Oxford. J. Svenning M. Boistard and G. Leinonen. 53: 957–967. Gudmundsson. Methods 45: 197–205. Blackwell Scientific Publications Ltd. Schlaman. Kubik-Komar A. 13: 1163–11699. Fagerli and P. Skorupska. Environ. J. J.

et al. 1 .50 Wielbo J.

fermentation.. To overcome fermentation problems.. the most active strain. 2006). Hirasawa et al. Among these. 1999). S.. Hirasawa et al.. The present study was conducted to select the best ethanol-producing yeast strains from our collection. Wang  and Lin. 20-033 Lublin. and of these.. 2007). yeast strains that can endure stress imposed by high ethanol concentrations are highly desirable. sophisticated refinements of fermentation processes. Maria Curie-Sk³odowska University. Throughout the years many efforts have been made to characterize the mechanisms underlying ethanol stress tolerance. for stuck fermentations (Gibson et al.. however depends on the ability of the yeast strains used to cope with a number of stress factors occurring during the process (Van Uden. and recycling or retention by membranes (Nishiwaki and Dunn. Vol. cerevisiae ER.Polish Journal of Microbiology 2011. Those values were significantly higher in comparison with parent strain (ethanol concentration 71 g/l and productivity of 0. Department of Industrial Microbiology.. sake-making and brewing processes. Poland. 60. Thus..99 g/l/h). and an ethanol yield (% of theoretical) of 99. Akademicka 19. the stress induced by increasing amounts of ethanol. 1998. phone: +48 81 537 59 33.. including osmotic pressure imposed by the initial high sugar concentration and stress induced by fermentation end-products or sub-products such as ethanol or acetate. 2006). 2006). Saccharomyces cerevisiae and related yeast species have been extensively used in fermentation.0). Poland Received 2 August 2010. 1982. reached an ethanol concentration of 80 g/l. Fiedurek. and high temperature (45 and 52°C) stresses. ethanol tolerance.1 g/l/h. resistant to ethanol stress.  2010).pl . K e y w o r d s: adaptation to high ethanol concentration. 8 were characterized by the best ethanol yields (73.. oxidative (1 and 2% of H2O2).umcs. only a few studies that describe the creation of ethanol-tolerant S. There are. at 30°C and within 72 h.04 to 3. 1993.. accepted 20 January 2011 Abstract A total of 24 yeast strains were tested for their capacity to produce ethanol. 2010).. The present study seems to confirm the high effectiveness of selection of ethanolresistant yeast strains by adaptation to high ethanol concentrations. You et al. wine-making. cell immobilization (de Vasconcelos et al. cerevisiae mutants using adaptation and ethanol stress as the selection pressure (Brown et al. to our knowledge. 1985. 1985. Maria Curie-Sk³odowska University. No 1.94-fold in comparison with the parent strain S. 2003. Da Silva et al. was characterized by high resistance to acidic (pH 1.78%). ultimately. ethanol productivity of 1. Remize et al. aiming to increase ethanol productivity (Van Uden. were employed with a view to obtaining a large quantity of fermenting biomass as well as removing the inhibitory ethanol product. Stanley et al. cerevisiae ER-A. Alper et al.0 and 2. fax: +48 81 537 59 60. 2007). During cultivation under all stress conditions. Verbelen et al. and to optimize the conditions for alcohol production from sucrose. e-mail: janek@poczta. Viegas et al. for increased ethanol production. The most active mutant Saccharomyces cerevisiae ER-A. accumulating to toxic concentrations during ethanol fermentation... Lublin. 2004.13. to improve yeast fermentation performance by adaptation. Successful performance of alcoholic fermentations.11–81. is the major factor responsible for reduced ethanol production yields and.lublin. yeast Introduction Bio-ethanol production by yeast is a growing industry due to energy and environmental demands (Schubert. MARCIN SKOWRONEK and ANNA GROMADA Department of Industrial Microbiology. * Corresponding author: J. At an initial sucrose concentration of 150 g/l in basal medium A containing yeast extract and mineral salts. 2007). involving extractive fermentation (Jones et al. 2006. 1989. 51–58 ORIGINAL PAPER Selection and Adaptation of Saccharomyces cerevisae to Increased Ethanol Tolerance and Production JAN FIEDUREK*. revised 12 January 2011. 1999. the mutants showed a considerably increased viability ranging widely from about 1. Successful engineering of yeast transcription machinery for this purpose was also reported (Alper et al.

11 74.84 6. bactopepton.75 33. The initial ethanol concentration was set at 5.67 8.09 79.81 4.0 to 15. et al.80 2.71 Ethanol (% w/v)a 0.70 4.72 8.10 0.80 3. Fermentations were performed using a basal medium A containing: sucrose.41 4.o.20 0.35 80.40 5.0%.08 6. The strains of the yeast listed in Table I were maintained at 4°C on malt agar slants.58 1. 2% and yeast extract.00 9. 4 Distillery yeast .20 7.41 63. and subsequently counting the number of colonies formed.88 42.21 10. The adaptation of the yeast was evaluated by measuring the optical density of the culture at OD600. these clones were designated as strain ER-A and ER-M.30 71.91 8.22 28. 0. two clones were selected for further study.86 3.54 7.07 9.60 0. Viability in ethanol was determined by maintaining yeast cells of S.71 9.20 6.93 The strains were incubated in 50 ml conical flasks.71 8.15 26.88 3.61 7.48 5.34 5.05 3.13 10.00 4.78 4.67 50.52 Experimental Material and Methods Fiedurek J. (2008) with some modifications. Inoculum preparation.80 5.70 3. 1 Microorganisms and media.89 5. For inoculum preparation selected strains were cultivated on a growth medium A containing glucose.10 0.96 47. plating them on malt agar plate.00 0.84 4.10 6.60 6.80 5.60 5.0%. cerevisiae ER in malt medium supplemented with 5–15% ethanol for 48 h at 30°C.1%.70 2. 2%.09 38.20 8.41 81.81 3.25 3.87 47.64 13.48 5.63 80.35 13.60 45.20 3.94 0.80 6.03 2.00 6.64 3. 1%.31 27. The cultivation of the S.3% and KH2PO4. 15.75 6.69 1.80 3.32 32.30 81.94 19. followed by repetitive cultivations.34 4.00 3. After that.78 5.00 3. 2 Brewing yeasts. For the preparation of inoculum.87 71.25 13.04 6.78 74.78 61.81 3.0% (w/v) and it was changed gradually from 6. Adaptation for increased ethanol production.48 6. Control cultures were maintained in the same medium without ethanol.90 7.. yeast extract.87 28.53 30.06 5.60 7. Adapted cultures were grown in culture tubes (18 by 150 mm) containing 10 ml of that medium and were incubated at 30°C without agitation.90 6.80 9. (NH4)2SO4.87 73. Enrichments for increased ethanol production were carried out according to the method of Dinh et al. yeast strains were transferred from agar Table I Screening yeast strains for efficient ethanol production Sucrose concentration (%) Strain Candida shaetaceae ATCC 22–994 Candida utilis CCY 29–38–18 Kluyveromyces fragilis IPF Kluyveromyces marxianus CCY 50–2–1 1 Saccharomyces bayanus S-21 1 Saccharomyces owiformis 2 Saccharomyces carlsbergensis FD 3 Saccharomyces cerevisiae Anker Saccharomyces cerevisiae A364A Saccharomyces cerevisiae DBY 747 4 Saccharomyces cerevisiae ER 4 Saccharomyces cerevisiae GM 3 Saccharomyces cerevisiae Hammer 1 Saccharomyces cerevisiae JA 2 Saccharomyces cerevisiae PG 1 Saccharomyces cerevisiae J 1 Saccharomyces elipsoideus Sz.70 8.20 Ethanol yield (% of theoretical) 8. At the end of this period.00 1.80 7.98 35.08 9.72 13.53 6.83 6.09 4. the culture was transferred to a medium containing a higher ethanol concentration.20 6.38 4.81 14.30 61.20 3. each containing 20 ml of basal medium A containing 15% or 40% of sucrose during 72 h.10 6.10 2.67 24. cerevisiae ER strain was carried out in malt medium containing ethanol and then the culture was transferred to a fresh medium containing the same ethanol concentration.81 3.46 31.40 0. Saccharomyces fragilis II 11 Saccharomyces fragilis 11–54 Saccharomyces fragilis S-24 Saccharomyces fragilis S-25 1 Saccharomyces mellis 1 Saccharomyces muciparus CCM 21–25–1 1 Saccharomyces rouxii 15 40 15 40 15 40 Catalase activity (U) 8.16 37.29 4.40 6.30 7.49 8.00 6.78 71. a Values are averages of 3 replicate determinations with standard deviations of < ± 5% 1 Wine yeasts.00 5.96 38.80 6. 1. cerevisiae were isolated from the adapted cultures after 10 months of serial transfers into media with high concentrations of ethanol.43 1.00 4.72 5.78 7.60 11.75 5.22 8. New derivatives of S.0%. 3 Baker’s yeast.01 31.80 3.10 5.31 2.64 2. 0.07 4.20 6.

were used to measure the rate of yeast respiration at various medium pH. cerevisiae ER-A adapted to the high ethanol concentration showed better biomass accumulation in the medium containing the same ethanol concentration. Results Production of ethanol during fermentation is limited by the inability of yeast to grow at high ethanol levels. Oxygen concentration in the culture medium was measured by a polarographic dissolved oxygen sensor (Ingold. which is why a great deal of effort has been devoted to creating yeast strains that would tolerate high ethanol levels. in comparison to the cells of the parent strain (Table II). Urdorf.1 S.-tetramethylbenzidine (TMB) as chromogen. and ethanol yield were monitored on synthetic medium A. CH Industrie Nord.2%) were characterized by high catalase activity when grown on a medium with a high sucrose concentration (40%) (Table I). cerevisiae ER-A. 1984). generally showed a better adaptation to higher ethanol concentration. On the other hand. a two clones were selected from enrichment for further study. During this period about 120 subsequent transfers were performed. Illinois. those clones. cerevisiae were isolated from adapted cultures after 10 months of serial transfers. S. Fermentations with the selected strain were conducted in 300-ml Erlenmeyer flasks containing 100 ml of basal medium A (pH 5. It is worth noting. Other methodological details are given in the tables and figures. Other methodological details are given in tables and figures. 8 were characterized by the best ethanol yields (73. Fermentations were carried out for 72 h at 30°C (if not indicated otherwise) in a shaker at 90 rpm.5. This strain was used for preparation of inocula for adaptation with high concentrations of ethanol (5 to 15%) in order to select ethanol-tolerant yeast. The effects of increasing sucrose concentration from 15 to 40% on ethanol yield. Cell suspensions. catalase activity. Assays. When subjected to a stepwise increase in ethanol concentration with repetitive cultivations. Melrose Park. Overall biomass as well as ethanol yields and sucrose consumption were calculated from end-of-batch data. Switzerland). resistant to ethanol stress. Dry mass was calculated by referring to a standard curve of cell mass versus absorbance (Hughest et al. cerevisiae ER.78%). prepared as described above.5). Among the 24 strains.02 to 3-fold) reduction in biomass production. the yeast cells S. were able to grown at 15% of ethanol in the medium (data not shown).0 and 2. and analyses were carried out in duplicate. sucrose and biomass withdrawn during sampling. 1997). higher cell viability especially during “very high gravity” fermentation. cerevisiae ER-A resistant to ethanol stress.94-fold in comparison with the parent strain S. Extracellular catalase activity was measured spectrophotometrically by observing the decrease in light absorption at 525 nm during decomposition of H2O2 by the enzyme (Fiedurek and Gromada. The flasks were inoculated with 10% v/v seed culture. At the end of this period. and of these. USA) at 150 rpm for 24 h.3. A total of 24 yeast strains were tested for their capacity to produce ethanol. with fermentative tubes filled with 50% H2SO4. This strain was used for further study. 13 (54. Ethanol evaporation was prevented by rubber stoppers. Ethanol fermentations. designated as strain S. Biomass was estimated from optical density at 600 nm. The data given here are the averages of the measurements. a decrease in biomass and ethanol yield was observed. The viability of mutants during cultivation under all the mentioned stress conditions increased about 1.11–81. the increase enhanced extracellular catalase production. The increase in sucrose concentration in the medium (from 15 to 40%) caused a significant (1. The readings were expressed as percentage of the initial level of saturation (100%). and working under a wide range of temperatures (35–40°C) was used. was characterized by high resistance to acidic (pH 1. that mutant of S. as expressed by the increased (about 4-fold) viability at 20% of ethanol in comparison to its 10% . The most active mutant. probably as an effect of stress conditions. either in the absence or in the presence of ethanol. Ethanol was quantified using the Gonchar et al. oxidative (1 and 2% of H2O2) and high temperature (45 and 52oC) stresses. The fermentation parameters were corrected by ethanol. cerevisae adaptation for increased ethanol levels 53 slants into 50-ml Erlenmeyer flasks containing 10 ml of sterile liquid growth medium A.0). (2001) method in own modification using o-dianisidine instead of 3. Measurement of respiration.04 to 3. The development of such strains would have the major advantage of saving the energy involved in distilling and refining ethanol. Ethanol production.. where the peak ethanol concentration was recorded. Along with the increase in sucrose concentration from 15 to 40%. For further selection an industrial strain of Saccharomyces cerevisiae ER characterized by high ethanol tolerance. cerevisiae: ER-A and ER-M. which were cultured at 30°C on a rotary shaker (Shaker Orbit The LAB-LINE Instruments Inc. and be able to continue the fermentation to produce higher concentrations of alcohol. Fermentations were performed in 2 replicate cultures. One unit (U) of catalase activity was defined as the amount of enzyme catalysing the decomposition of 1 µmol hydrogen peroxide per min at 30°C.5. New derivatives of S. catalase activity and biomass of the yeast strains were examined.

98 Saccharomyces cerevisiae ER-A a Basal medium A 7. et al.74 39.5 showed that ethanol inhibited the respiration rate of yeast.42 2.04 11 1.64 1.64 1.11 13 0.58 0.0% Fermentation conditions: inoculation: 2 × 107 cells/ml.58 13 0 0 0.43 52.13 1.35 1.34 89.38 6.50 69.58 1.17 2. Maximal amount of bubbles formed during culture of the adapted strain ERA was defined as 100%.35 4.04 1. In the absence of added ethanol.22 Saccharomyces cerevisiae ER-A Control (none) 2. The strains were incubated in 50 ml conical flasks.25 10 5.00 2.0 47.94 Relative metabolic rate (%) was calculated by counting the number of bubbles of CO2 released from fermentative tubes during 60 min.35 0.44 1. time fermentation 72 h at 30°C in shaker 90 rpm.90 72. the oxygen concentration decreased gradually over the first 15 min to the level of about 6%.10 12 0 0 0.34 Ethanol (% w/v) a 48 h 24 h 24 h Saccharomyces cerevisiae ER (parent) Control (none) 2. each containing 20 ml of basal medium during 24 h of stress conditions.40 Relative to the wildtype (-fold) 1. in these conditions.22 Modified basal medium A 8. each containing 20 ml of basal medium A with ethanol (5–15%) during 24 h b Values are averages of 6 replicate determinations with standard deviations of < ± 5% The strains were incubated in 50 ml conical flasks.3 and 1.77 1.73 10 4.00 ER-A 93. the respiration rate of the yeast cells was markedly inhibited. b Dry matter Mixing Mixing (g/l)b (90 rpm) (180 rpm) Saccharomyces cerevisiae ER (parent) Control (none) 39.0% of with (NH4)2SO4.12 13 0.70 13 0 0 0.10 87.67 12 0.0) Low pH (1.7% after 20 min. The higher concentration (10%) of ethanol significantly reduced oxygen consumption.33 3.36 11 0 4.24 1.63 14 15 0.28 15 0 0 0. Table II Effect of ethanol concentration on biomass production Ethanol (% w/v) Dry matter (g/l)a after Relative to the parent-type (-fold) 48 h 1 slowly.33 5 21.37 77.00 99.13 with (NH4)2SO4 – 1. a Values are averages of 4 replicate determinations with standard deviations of < ± 4% Table V Effect of (NH4)2SO4 concentration on ethanol production Medium Ethanol (% w/v) Ethanol yield (% of theoretical) Dry matter (g/l) 5.38 1.35 1.36 1.34 1.19 Saccharomyces cerevisiae ER-A Control (none) 43.74 1.02 10.75 5. each containing 20 ml of basal medium A with ethanol (11–15%) during 24–48 h.43 13.48 100.90 1.13 73. Low pH media were obtained by adding 0.28 3.70 7.00 1.29 14 0.30 0.99 3.0) Oxidative stress (1% H2O2) Oxidative stress (2% H2O2) High temperature (45oC) High temperature (52oC) Ethanol (10%) Ethanol (15%) Ethanol (20%) Surviving cells (%)a Parent 81.17 90. more than half of the initial dissolved oxygen content remained Table IV Effect of externally added ethanol at concentration 0–15% on CO2 and biomass production by parent and adapted strain of Saccharomyces cerevisiae MR-A Relative metabolic rate (%)a.04 11 1. each containing 20 ml of basal medium A containing 0.23 concentration (Table III).35 12 0 4.41 0.14 100.04 6.53 14 0 0 0.85 43.25 61.24 1. reaching 10.1 M HC1. When the experiment was repeated in the presence of 5% (w/v) ethanol. The strain was incubated in 50 ml conical flasks.20 89.50 11 4.0 96.46 1.85 80.0% 7.65 1.23 12 0.30 1. and the oxygen concentration fell more Saccharomyces cerevisiae ER (parent)a Basal medium A 6. a Values are averages of 6 replicate determinations with standard deviations of < ± 6% Table III Effect of abiotic stresses on surviving cells of Saccharomyces cerevisiae ER Stress conditions Low pH (2.85 1.39 14 0 0 0.54 Fiedurek J.30 78. when higher numbers of cells survived in more drastic stress conditions.19 0.00 1.43 13.67 1.42 15 0.90 2.06 Modified basal medium A with (NH4)2SO4 – 1.10 1.93 39. Measurements of oxygen consumption at 30°C and pH 4.44 0.44 15 0 0 0.12 1.64 The strains were incubated in 50 ml conical flasks.46 5 30.53 0.87 1. a Values are averages of 6 replicate determinations with standard deviations of < ± 5% .59 26.14 1. A similar trend was also observed for oxidative (1 and 2% of H 2O2) and high temperature (45 and 52°C) stress.

1 S. the levels of oxygen concentration in media with 5% and 10% ethanol were lower by 10. at 11% of ethanol. After 20 min of respiration. in the medium after 20 min from the beginning of the experiment (Fig. adapted cells of S. Effect of ethanol concentration in the medium on the oxygen consumption of Saccharomyces cerevisiae ER strain (a) and Saccharomyces cerevisiae ER-A strain (b). cerevisiae ER-A consumed more oxygen than the parent strain in media with all the tested ethanol concentrations (Fig. 1. The adapted cells of S. Error bars represent standard deviations. and adapted cells showed insignificant activity in these conditions. The higher concentration (11%) of ethanol completely inhibited metabolic activity of the parent strain when culture was carried out in a shaker at 90 rpm. the metabolic activity of adapted cells of S. 1b). The effect of 5–15% ethanol externally added to basal medium A on CO2 production by the parent and the adapted strain of S. as compared with values for the parent strain. The values shown represent the mean of three experiments. 1a). In comparison with the parent strain. cerevisiae ER-A was exam- ined.7% and 13. Under a higher mixing rate (180 rpm). cerevisiae ER-A were characterized by an about 3-fold higher . cerevisiae ER-A showed higher resistance to inhibition by ethanol when the cells were grown with 5 and 10% (w/v) ethanol. respectively. cerevisae adaptation for increased ethanol levels 55 a) b) Fig.2%.

2000). Some researchers have analyzed phenomena associated with adaptation of yeast cells to high ethanol concentrations. Lloyd et al. therefore. 2008. cerevisiae ER-A during cultivation under acidic (pH 1. using a very simple fermentation system (shake flask). whereas salt and H2O2 may be more specific stress signals. The results presented above confirmed that an adapted strain resistant to ethanol stress generally showed better adaptation to other stress conditions.. and their survivability in lethal ethanol concentrations was considerably improved compared with the parent strain. high osmolarity.. compared with 5% for the parent. who showed that several genes were highly expressed only in the ethanol-tolerant mutant but not in the parent strain. as expressed by the increased survival of the mutant of S. The accumulation of ethanol during cultivation causes stress to yeast cells. (2010) under lethal ethanol stress conditions (12% (w/v) ethanol. However. The highest ethanol yields for the two strains were obtained on modified medium A. reduce the impact of ethanol toxicity on fermentation performance (Dinh et al. Considerably better results were achieved for mutant S. Improving ethanol tolerance in yeast should. adaptation to other stresses does not typically induce significant acid tolerance. For example. and the adapted strain showed very small this activity in these conditions (Table IV). it is expected that exposing yeast cells to a stepwise increase in the level of ethanol stress should be effective for obtaining ethanol-tolerant yeast strains. Similar viability characterized SM1 and CM1 cultures obtained by Stanley et al. 1% of (NH4)2SO4 and 1% of KH2PO4. A number of specific selection schemes have been elaborated to improve the biosynthetic capacity of production strains. et al. 1 metabolic activity than the parent strain.. which was characterized by an ethanol yield of 99. the viable population (expressed as a percentage of the initial population) of the ER. the respective values for the parental strain were 87.56 Fiedurek J. Mutants CM1 (chemically mutagenised) and SM1 (spontaneous) had increased acclimation and growth rates when cultivated in sub-lethal ethanol concentrations. understanding the process of adaptation of yeast to high ethanol concentrations is important as it may lead to the construction of yeast strains able to grow well at high ethanol concentrations. leading to a decrease in cell growth and production of target products. This is in accordance with data presented by Ogawa et al. glycerol. compared with 10. This implies that acid exposure may be treated by microorganisms as a more general stress indicator. 1997). Discussion Tolerance to high ethanol and sucrose concentrations is an important property of industrial microorganisms. It is worth noting that in the more drastic stress conditions.1%. Bearson et al.13% and an ethanol concentration of 8. the ethanol-tolerant mutant was characterized by a higher survival rate. stimulating glycolytic activity. The ability of one stress condition to provide protection against other stresses is referred to as cross-protection. cerevisiae ER-A in basal and modified medium A.. whereas yeast inoculated directly into a medium containing 10% ethanol failed to grow. salt. (2000). These results indicate that the mutant exhibits multiple stress tolerances due to elevated expression of stress-responsive genes. oxidative (1 and 2% of H2O2).0). cerevisiae W303-1A to adaptive evolution using ethanol stress as a selection pressure. 2010).0%.0 and 2.0% for the parent. cerevisiae ER-A was always higher than for the parental strain. and trehalose (Ogawa et al. Table V compares ethanol production by the parental and the mutant strain of S. Such ethanol-tolerant yeasts are highly desirable for the production of useful compounds. Stanley et al. Thus the acid tolerance of Leuconostoc oenos was examined in cells surviving at pH . A further increase in ethanol concentration in basal medium A to 12% completely inhibited metabolic activity of the parent strain. crystal violet. (2010) obtained ethanol-tolerant yeast mutants by subjecting mutagenised and non-mutagenised populations of S. 1995. respectively. and high temperature (45 and 52°C) stresses. containing 15% of sucrose. resulting in accumulation of high amounts of stress protective substances such as catalase. and oxidative stress in addition to ethanol tolerance.40%. (1993) found that yeast previously grown in the presence of 5% ethanol could grow in the medium containing 10% ethanol.98 % and 7.culture after 24 h in 20% (w/v) ethanol was 39. Those authors suggested that the increased ethanol tolerance of the mutants was due to their elevated glycerol production rates and the potential of these to increase the ratio of oxidised and reduced forms of nicotinamide adenine dinucleotide (NAD+/NADH) in an ethanol-compromised cell. Stanley et al.. and polymyxin B (Lee et al. Several studies have shown that adaptation to acid stress confers resistance to a wide range of stress conditions including heat. Ismail and Ali (1971) reported that no increase in the tolerance of yeast to a high ethanol concentration was observed after ten successive transfers to an environment containing a high ethanol concentration. Therefore. The ethanol-tolerant mutant also exhibited resistance to other stresses including heat. The viability of the adapted S. after 12 h) – 52% and 44%. Thus. 1% of yeast extract. respectively. for all the stress conditions used (Table III). cerevisiae ER-A.

Moxley. Bearson S.R. respectively (Tables II and IV).. The acid-resistant mutant L. 1980). The maximum yield obtained was 0. G. Some data suggest that an improvement in ethanol tolerance leads to an increase in both ethanol production rate and the total amount of ethanol produced (Jiménez and Benítez. cerevisiae ER-A. M. In this respect. Harrison and R. Selection of thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. only two strains grew at 42°C. Gdañsk University of Technology. coli which are more resistant to cell lysis in the presence of ethanol (Fried and Novick 1973. Eur. Stephanopoulos. These strains were exposed several times to high concentrations of glucose and ethanol in order to select ethanol. externally added to the medium. Some mutants have been described in E. D. was found to be able to grow in acidic media and characterized by a high H +–ATPase activity at low pH. cerevisae adaptation for increased ethanol levels 57 2. Additionally. Brown S. The effect of ethanol on yeast growth and fermentation has been studied by Brown et al.C. probably as an effect of a higher mass transfer.13. a moderate fermentation activity.These authors showed complex kinetics which resulted from both an inhibition of the growth rate itself and also a reduction in cell viability. 1996). B. The ethanol tolerant strain was stable in the subsequent subcultures in the absence of stress during 6 months. The growth and viability effects had different inhibition constants. Oliver.1 g/l/h. Isolation of ethanol-tolerant mutants of yeast by continuous selection. showed an ability to grow and ferment sucrose at ethanol concentrations in the medium of 15 and 12% (w/v). Appl. J... Ethanol inhibition of yeast growth and fermentation: Differences in the magnitude and complexity of the effect. Its resistance to ethanol. at this stage of our studies. and S. (2008).0). It can be concluded from the present results that the adapted strain S. S.W. Appl. cerevisiae ER-A showed. An increase in the rate of mixing from 90 to 180 rpm correlated with a simultaneous increase in the relative fermentation rate (%) both for the parent and the adapted strain. 147: 173–180. Nevoigt.G. Biotechnol. 1982.. C. Acid stress responses in enterobacteria.. Engineering yeast transcription machinery for improved ethanol tolerance and production. Józef Kur (Department of Microbiology Chemical Faculty. (1981).W.and glucosetolerant yeast. 16: 119–122. Enhanced l-treonine production by salt tolerant mutants of E.01 g/l/h). Accumulation of a large amounts of metabolic end-products during the fermentation period. Ingram et al. J. Glucoseto-ethanol conversion yield was between 50% and 80% of the theoretical value. . This work was financially supported by Research Program BW/BiNoZ/UMCS. Baeza. J. 2006.6. The advantage gained in direct screening is to reduce in a very specific way the number of cultures isolated from the plates. 1996). Enzyme Microb. The selected strain. J. Microbiol. The ethanol yields by SSF using the selected strain were higher than those obtained using the control yeast. was significantly higher than for the parent strain.46 g/g (90% theoretical yield) in a 20-L bioreactor with cane molasses. Parra. Bearson and J. Righelato. coli was achieved (Drici-Cachon et al.. Some of these strains demonstrated the highest adaptation to both ethanol (5–7% w/v) and glucose (20% w/v). FEMS Microbiol. Fink and G. which is lower than the acid limit of growth (about pH 3. (2008) selected thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. Science 314: 1565–1568. Acknowledgements The authors wish to thank Prof. Further improvements to the isolated yeast strain and the growth conditions are necessary to utilize the strain for larger-scale fermentation. Araque E. Freer and J. which would normally require testing of productivity via shake flask cultures. better adaptation of these mutants to abiotic stresses can affect yeast growth and ethanol productivity. This is a significant contribution to make screening of ethanol-producing yeast more efficient.9 g/l and productivity of 1. 10 were obtained that adapted best to these conditions. Literature Alper H. The adapted S. and no strain grew at 45°C. Oliver. Biotechnol. ethanol was less inhibitory toward fermentation than toward growth in sake yeast. Technol. S. The studies presented above seem to confirm the high effectiveness of selection of resistant yeast strains by adaptation to high ethanol concentrations for increased ethanol production. 1997. 1988). Brown S. Rodríguez. 11: 153–155. our results obtained in ethanol production can be compared with data provided by Ortiz-Zamora et al.F. Poland) for supplying yeast strain Saccharomyces cerevisiae ER (Ethanol Red). especially in case of industrial amino acid fermentation. Lett. All the strains grew (in agar plates) at 35 and 40°C. who isolated and selected yeast strains from alcoholic fermentations of natural sources. Those values were significantly higher in comparison with the parent strain (ethanol concentration of 72. 1981. E. builds up a high osmotic strength which affects both growth and production. Foster.E.1 S. Such strains may be an important part of the technology of modern commercial wine production (Drici-Cachon et al. and an ethanol yield (% of theoretical) 99.. 2008. Microbiol. 43: 120–123. an ethanol productivity of 1. oenos. Contrary to our data. which gave reasonable ethanol yields from sucrose. which were able to grow and ferment glucose in the temperature range 35–45°C.G.W. Araque et al. cerevisiae ER-A reached an ethanol concentration of 80 g/l.

Adaptation of Saccharomyces cerevisiae cells to high ethanol concentration and changes in fatty acid composition of membrane and cell size. Takesh. Biotechnol. Biosc.. 2007. Morrell.A. C. Cavin and C. Process. J...M. Dequin. 74: 176–182. M. 1998. Nagahisa. Pharmacol. Hirasawa T. Ethanol tolerance and the effect of training in Saccharomycess cerevisiae Hansen. You K..J. Ito. Appl. Viegas C. 2003. R. Biotechnol. J.G. Drici-Cachon Z. Tolerance mechanism of the ethanol-tolerant mutant of sake yeast. Chem.L. Rosenfield and D. 1973. 69: 1499–503. Res.N. 39: 37–42. Nagahisa. Chambers. H. 8: 11–58. 17: 155–167. P. Van Uden N. 90: 313–320. P. Selection of biochemical mutants of Aspergillus niger with enhanced catalase production.J. Microbiol. Rev. 2010. Verbelen P. Havard and A. Ferm. 1985. Rogers and G. 131: 34–44. Pavlishko and A. P. 37: 139–149.J. 168: 207–227.S. and H. Isolation and selection of ethanol-resistant and osmotolerant yeasts from regional agricultural sources in Mexico. Appl. Lloyd D.P. 54: 917–922. Chem. Alcohol tolerance in Escherichia coli: a proposed common mechanism for changes induced by ethanol.J.A. Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase.N.R. Analysis of a two-stage fermentor with recycle for continuous ethanol production. Y.M. Yoshikawa. Leclaire. 1993. Appl. The stationary-phase sigma factor sS (RpoS) is required for a sustained acid tolerance response in virulent Salmonella typhimurium. Ogawa Y. Microb. Powell and K. Rep. Commun.M. Biotechnol. Inhibition of yeast growth by octanoic and decanoic acids produced during ethanolic fermentation. Biotechnol. J. Ismail A. Divies. 24: 777–784. 1971.F.A.. 1999.pone. 1989. A new oxidase-peroxidase kit for ethanol assays in alcoholic beverages. Rowlands.L. Process. 1999.R. PLoS ONE 3(7):e2623. 31: 535–69. Delvaux.B.S. Bacteriol. Uchiyama. 65: 143–149.D. Ethanol tolerance in the yeast Saccharomyces cerevisiae is dependent on cellular oleic acid content. S.. Acid tolerance in Leuconostoc oenos. Stanley. Jones T. Shimoi and K. 1980. Gibson B. Effects of growth with ethanol on fermentation and membrane fluidity of Saccharomyces cerevisiae. . Continuous ethanol production using yeast immobilized on sugar-cane stalks. Gonchar M. Sablayrolles. Eaton. P. A. Katakura.. Lett. Generation and characterisation of stable ethanol-tolerant mutants of Saccharomyces cerevisiae.. Furusawa and H.V. 1 Da Silva F. Ramírez-Lepe. Chem. Food Technol.L. Aguilar-Uscanga. 44: 785–789. Environ. Biochem. Lopes and F. Isolation and characterization of an acid-resistant mutant. Wang F. 13: 191–195.P. 47: 313–316.. Appl. Bearson and J. Microbiol. Ethanol production from lactose by extractive fermentation. C. 28: 1515–1525. J. Verstrepen and F.. Fuzzy optimization of continuous fermentations with cell recycling for ethanol production. Cortés-García. Hughest D. J. 2006. M. N. Microbiol. Fraser.. H. Shimizu and S. H.K. Ali. Yeast responses to stresses associated with industrial brewery handling. Schubert C. Ann. 114: 239–248. 2004. S. C. 2008. Dynamic modeling simulation and optimization of an extractive continuous alcoholic fermentation process.. Lawrence. J. De Schutter. Microbiol. Moye. Yeast 9: 825–833. 49: 2306–2311. 1995. K.E.M.C. Fried V. Novick.W.M. Environ. Appl. M. H. Ingram L. Biotechnol.J. Biotechnol. Nishiwaki A.I. 2007. Maugeri.O. D. Nitta. FEMS Microbiol. Biotechnol. Lin. Ortiz-Zamora O. 15: 871–876.58 Fiedurek J. I. 55: 21–28. Fiedurek J.P. 1988. de Franca. doi: 10. Eng. Lin. Hirasawa. J. Microbiol. 2008. Lee I. Can biofuels finally take center stage? Nat. J. and A. Hall. 2010.F.. Ethanol toxicity and ethanol tolerance in yeasts. Shimizu. Roustan. Biotechnol.J. B. M.J. Carlsen. Environ. 6: 1–6. 21: 357–365. 32: 775–786. Novais. Delvaux. K. Y. Folia Microbiol. J. Dinh T. Stanley D. Ind.S. Rosa. J. Biotechnol. Bioeng.. Mol. J. Smart. T. and M.C. Degn. Engin.C. James and C.0002623. Eng. Eng.. Braz. K.E. Behav. Lett. Gómez-Rodríguez and M. Identification of target genes conferring ethanol stress tolerance to Saccharomyces cerevisiae based on DNA microarray data analysis.H. J. Sa-Correia and J.A. 1984. Biotechnol. Food. Dunn.M. Tudroszen and C. J. Selection of ethanol-tolerant yeast hybrids in pH-regulated continuous culture.. Rodrigues and F. Appl.T. 2006. Knipple. Shioya. Selection of high ethanol-yielding Saccharomyces I.. J. Jiménez J. 1993. 2000.J.M. Daugulis. de Vasconcelos J. N. and A. Vreeland and L. Barre P and S. H. Microbiol. K.. Guzzo.. Technol. and I.N. et al. C. F.D. Furusawa. The effect of temperature on the kinetics of ethanol production by a thermotolerant strain of Kluyveromyces marxianus. and T. Foster. Gromada. Lett. J. S. Immobilized yeast cell systems for continuous fermentation applications. Nakakura. 1997. Organic solvents as probes for the structure and function of the membrane: effects of ethanol on the wild and ethanol resistant mutant of Escherichia coli K-12. Maidan. C. Chem.1371/journal. 1996. H. Microbiol. I. Ind.A. Sibirny. 16: 346–369. Remize F. Environ. H. Benítez. 2001.

Experimental Materials and Methods The materials comprised mould strains belonging to the Aspergillus genus. MACURA2 and MACIEJ GÓRKIEWICZ3 of Medical and Environmental Nursing. Pitt. The objective of the study was evaluation of the cytotoxicity of Aspergillus fungi isolated from hospital environment.Polish Journal of Microbiology 2011. Jagiellonian University Medical College. Aspergillus ochraceus. niger fungi. trichotecins or sterigmatocystine are toxic for various cellular structures and interfere with key processes like RNA and DNA synthesis (Ciegler and Bennet. Poland 2 Department of Mycology.5 diphenyltetrazolium bromide). To assess the ability of a given strain to produce mycotoxins. ANNA B. 2005). 2000. Poland 3 Department of Epidemiology and Population Research. aflatoxins. No 1. isolated from the environment. Kraków. 1980).. Jagiellonian University Medical College. To protect a patient from the adverse effects of mycotoxins. 31-126 Kraków. Jarvis and Miller. Kelman et al. 2009. cellular structures and processes in them (Steyn. mycotoxins differ in their specificity and influence on target cells. phone: (+48 12) 6336259. 2004). environment 1 Department Introduction There is evidence that a number of Aspergillus fungi present in hospital environment produce toxins (Burr. the presence of other moulds in the environment should be taken into account as well as their influence on mycotoxin production intensity. revised 10 January 2011. * Corresponding author: A. K e y w o r d s: Aspergillus sp.5-dimethylthiazol-2-yl) 2. 12 Micha³owskiego str. and their cytotoxicity may impair defense mechanisms in humans. e-mail: mxgniade@cyf-kr. Department of Medical and Environmental Nursing. Aspergillus flavus.pl . The ability of fungi to produce mycotoxins is hard to evaluate because there is a no possibility to analyze the mycotoxins produced in the tissues of living organisms. Aspergillus versicolor and Aspergillus ustus isolated from hospital rooms in Cracow.. fax: (+48 12) 429482.edu. Their secondary metabolites such as ochratoxin A. It should be also kept in mind that not all moulds produce mycotoxins. accepted 14 January 2011 Abstract The majority of mycotoxins produced by Aspergillus fungi are immunosuppressive agents. 2009). Vol. mainly in A. life cycle and environmental conditions (Pitt et al. not only his or her immunity status should be evaluated but also the presence of fungi in hospital environment and their cytotoxicity should be monitored (possible exposure). Ben-Ami et al. 2001. 2003. PhD. Faculty of Health Sciences Jagiellonian University Medical College. variance analysis (ANOVA) and Tukey’s difference test were used.. fumigatus. It has been documented that the fungi incubated in monocultures in laboratory setting lose their mycotoxin production potential (Fischer and Dott. Aspergillus niger. Kraków.. The cytotoxicity of all the strains was evaluated using the MTT test (3-(4. Poland. this being statistically significant (p<0. Klich et al. and their production depends on culture medium. 2000). Faculty of Health Sciences. mainly from indoor air in hospital rooms at a number of hospitals in Kraków in the years 2007–2008. 60. Chair of Microbiology.. 48 (84%) turned out to be cytotoxic. 1995. Depending on fungal species and/or strain. Jagiellonian University Medical College. 59–63 ORIGINAL PAPER Cytotoxicity of Aspergillus Fungi Isolated from Hospital Environment AGNIESZKA GNIADEK1.05). Gniadek. Out of 57 Aspergillus strains tested. The materials comprised 57 fungal strains: Aspergillus fumigatus. The least cytotoxic were A. cytotoxicity. The relationship between disease (or predisposition to it) and the level of exposure (detection of pathogenic spores) as well as symptoms and signs characteristic of experimental lesions produced by mycotoxins may contribute to establishing the noxiousness of fungi to human health. To emphasize the differences in cytotoxicity among the particular strains.. The cytyotoxicity was high (+++) in 21 strains. The objective of the study was evaluation of the cytotoxicity of fungi isolated from an environment where inpatients with impaired immunity were present. Kraków. Poland Received 18 May 2010.

Cladosporium and Aspergillus. Sigma Aldrich) and calf fetal serum (Sigma Aldrich) in the Hera Cell incubator with carbon dioxide. They belonged to the following species: A. The test is based on the reduction of yellow MTT tetrazolium salt to violet formazan. Austria) and the programme MikroWin 2000 (Mikrotek Laborsysteme GmbH. The value was expressed in terms of cm2/ml. . the mycological flora was evaluated in hospital ward environment (neonatal intensive care unit. The species of particular strains were detected on the basis of thorough macroscopic and microspocic analysis. Out of the 57 Aspergillus strains tested. Thus. A. ochraceus.f. 57 Aspergillus strains were randomly chosen for further examination. the third group – III (13 strains) A. The cytotoxicity was tested in the Department of Physiology and Toxicology. The lack of cytotoxicity was reported when the absorption value exceeded 31. The fungi were divided into groups: each group comprised different species. A.u. The highest percentage of Aspergillus was isolated in the neonatal intensive care unit: 38%. fumigatus 19/21. et al. the borderline toxic concentration was evaluated on the basis of the dilution i.977 [cm2/ml]. niger (14 strains). The total number of Aspergillus strains isolated was too high to evaluate cytotoxicity in all of them. The readings were made at the wave-length of 510 nm. The fungi were most abundant in the neonatal intensive care unit: the mean number of colonies on a single Petri dish reflected 530 c. the reaction is less intensive or does not occur. fumigatus species.× m–3. The moulds were the most abundant in this environment. The chosen strains belonged to six species: A. The strains chosen to cytotoxicity test originated from three hospital wards because it was assumed that strains from the same ward might be similar genotypically. insoluble in water. niger 8/14. was measured in square centimetres. The cytotoxicity test MTT (3-(4. The analysis comprised the evaluation of a test sample (Petri dish with the mould on Czapek medium) and a control sample (Petri dish with Czapek medium).2× 105. 1971). flavus. not damaged by mycotoxins. The SK were grown in medium containing antibiotics (penicillin and streptomycin. manufactured by Heraeus (5% CO2. As the mean toxicities were different in particular groups. So. flavus 5/5. medical intensive therapy unit. Out of all of the fungi isolated. the Tuckey’s post hoc test was used to find out between which groups the differences were significant.u. A.906 > 1. ochraceus 12/13.f. (Hanelt et al. Therefore. the fungi were divided into four groups.625> 7. The lowest number of fungi was detected in the chemotherapy ward: 29 c. ochraceus (13 strains). ustus). where the area of the Petri dish from which the moulds were extracted together with the medium. their mitochondria fail to reduce tetrazolium salt into formazan.953> 0.488 > 0. All of the absorption values below 50% of the threshold activity were considered as toxic.f. Poland. which can be measured photometrically as more or less intensive change of colour. 48 (84%) turned out to be cytotoxic. and the mean values and standard deviations were calculated. 1994). To evaluate the total cytotoxicity of the fungi. The fungi were sampled using a MAS 100 device (Merck) from the indoor air in various hospital rooms. when the SK are damaged by mycotoxins.813 [cm2/ml]. Institute of Experimental Biology at the Casimirus the Great University in Bydgoszcz.061 cm2/ml. the second group – II (14 strains) A. The value of p< 0. The mean numbers of fungi in the particular wards varied from 5 to 2370 c. Asys Hitech GmbH. Descriptive statistics were used. When the SK are infected with moulds producing mycotoxins. A. flavus (5 strains). Germany).u. A. The quantitative evaluation of cytotoxicity was performed using a microslide spectrophotometer (Elisa Digiscan reader. The cytotoxicity was considered as low (+) when the values were within the range of 31. and the fourth group – IV (9 strains) comprised the remaining strains (A.5-dimethylthiazol-2-yl) 2. versicolor 3/3..122> 0. The number of SK was 2. To show the differences of cytotoxicity of the species tested ANOVA test was used. niger. To evaluate differences among the particular groups of fungi.e. fumigatus (21 strains). A. ustus (a single strain). the mean inhibitory concentration IC50 was equal to the smallest sample (in cm2/ml) which was toxic to the SK. Results The amounts of fungi and fungal species varied from one room to another.5 diphenyltetrazolium bromide) was performed separately for each strain. veriscolor and A. the wards of chemotherapy and radiotherapy). The intensity of reaction is proportional to the amount of metabolically active SK. The reduction occurs in the presence of intact SK.× m–3 in the indoor air. A. 1994).244> 0.m–3 (Table I). 37°C.60 Gniadek A. versicolor (3 strains) and A. and high (+++) for > 0. 98% humidity).251 to 0. the reduction or the absence of the reaction gives evidence of cytotoxicity of the fungal strain tested.251>15. 1 Primarily. The dominating genera were Penicillium.061. swine kidney cells (SK) were used because they are sensitive to most mycotoxins. A.05 was assumed as the borderline of significance (Armitage. The lowest percentage of Aspergillus was detected in air-conditioned intensive therapy ward: 22%. A. The ranges of testing concentrations were prepared in ratio 1:2 and amounted from 31. intermediate (++) for the values > 3.251 [cm2/ml] (Gareis. The first group – I (21 strains) comprised fungi belonging to the A.

Just these two species were most often isolated in our study and examined for cytotoxicity.1 Cytotoxicity of Aspergillus sp. the confidence interval was calculated for each of the species tested. and water activity above 0. and a single strain A.03.5 20 260 30 Percentage of fungi A 32% 29% 38% 22% C 9% 8% 18% 17% P 31% 29% 32% 38% I 28% 34% 12% 23% Number of Aspergillus strains examined for cytotoxicity 16 20 12 9 61 Ward Radiotherapy Chemotherapy Neonatal ICU Intensive therapy Number of strains with documented cytotoxicity 12 16 12 8 ICU – intensive care unit. 1. ochraceus (p<0. The least cytotoxic was the Aspergillus niger species: its mean value 32.. Intervals of confidence 95% CI and mean value of Aspergillus cytotoxicity estimated as difference between reference level equal to 50 and measured value of IC 50 cm 2/ml. Twenty one strains tested revealed high cytotoxicity (+++).. fumigatus (11 strains).u. these are presented in Fig. The Tuckey’s post hoc test.05). Such environment is conducive to the production of secondary metabolites – mycotoxins. performed following ANOVA.97 were the highest among the fungi tested. P – Penicillium sp. 2003).8.71 and SD 27. it globally produces less mycotoxins than Stachybotrys even though the former dominates in the environment. which was intermediate in all cases. fumigatus and A. ustus. Only nine strains were not cytotoxic (16%). Such a small number of isolates resulted from the fact that this fungal species is rarely isolated indoor and is present mainly in colder regions such as mountains or polar areas. however. niger. Penicillium and Aspergillus are dominating mould species in the rooms where water activity is around 0. ochraceus (7 strains). Intermediate cytotoxicity was found in seventeen strains. niger and A. and A. mainly A. p< 0. The cytotoxicity of the other Aspergillus fungi (group IV) did not differ significantly from the three species mentioned above. (+) – low cytotoxicity. niger (six strains).. I– other fungal Table II Distribution of fungal species in relation to their cytotoxicity No 1 2 3 4 5 6 Species Aspergillus fumigatus Aspergillus niger Aspergillus ochraceus Aspergillus flavus Aspergillus veriscolor Aspergillus ustus Total N (%) 21 (37%) 14 (25%) 13 (23%) 5 (8%) 3 (5%) 1 (2%) 57 (100%) Cytotoxicity None 2 6 1 0 0 0 9 + 1 3 3 2 0 1 10 ++ 7 3 2 2 3 0 17 +++ 11 2 7 1 0 0 21 N– Total number of fungi.251 [cm2/ml] (lack of cytotoxicity) was most frequently found in A.f. Moreover. This may not be true in all the Aspergillus species. Legend: the squares at the middle represent the mean value of the estimated cytotoxicity. (++) – intermediate cytotoxicity. versicolor may contribute to 1% of its biomass when water activity is equal to one (Fog Nielsen. C – Cladosporium sp. (+++) – high cytotoxicity genicity within the particular fungal species (p = 0. A – Aspergillus sp. 2003). Table I Results of cytotoxicity tests Number Numbers of fungal colonies c. ochraceus (Table II). The Aspergillus genus is the most pathogenic to living organisms. The ANOVA test revealed differences of the patho- Fig. fumigatus is the most pathogenic Aspergillus species (Bennett.×m–3 of samples Minimum Maximum Mean Median 130 130 30 48 5 5 50 5 360 130 2370 170 39. revealed that the cytotoxicity of A. mainly A. fumigatus. The species most frequently isolated from indoor air are A. versicolor strains and to evaluate their cytotoxicity. which may be a result of too small number of fungi in the samples. the temperature is within the range of 5°C–35°C (optimum 18°–27°C). The absorption value > 31. and the vertical lines represent the size of the confidence interval of the estimated cytotoxicity.85 (Jarviss. most often A. We managed to isolate only three A. because sterigmatocystein produced by A. Ten strains revealed low cytotoxicity.05). Discussion Moulds can grow mainly in the environment in which humidity exceeds 45%. fumigatus and A. niger is significantly lower than those of A. 1. . It is reported in many papers that A.5 29 530 40 17.

On the basis of the measurements of environmental factors which appeared after the infection. Krishnan et al..62 Gniadek A. who examined the influence of cytotoxicity of various fungi (Stachybotrys chartarum. 2003).g. ochratoxin. Brakhage and O. They found out that SK fibroblasts were most sensitive to mycotoxins. In our previous study (Gniadek and Macura. Kwon-Chung and Sugui. up to necrobiosis while the damage caused by similar filtrates of A. it is a reasonable prophylactic measure to monitor mycological cleanness of the environment where immunocompromised patients are present and to evaluate the cytotoxicity of the fungi known as pathogenic. patuline.g. stimulates macrophage apoptosis and is included into pathogenesis of severe allergic rhinitis. cyclopiaze acid. The study carried out by Watanabe et al. were mutually stimulated or caused a synergic growth of cytotoxic fungi (especially S. and it could be expected that the majority of strains isolated in our study might by pathogenic to living organisms. (2004) gives evidence that a good access to oxygen stimulated A. 2010. niger and A. Literature Albrecht D. fumigatus filtrate were seriously damaged. Kniemeyer.05) were non. Albrecht et al. 1. and in the presence of other microorganisms. It is not always possible. Guthke. The macrophages treated with 1% A. Streptomyces californicus. perhaps too few to come to a conclusion. The isolated A. . fumigatus. fumigatus (Ben-Ami et al. and only two strains out od 21 were not toxic to SK. It appears that the choice of SK in our study was appropriate. The majority of the fungi Aspergillus in the environment of the rooms tested were cytotoxic and most often (p< 0. niger was lighter and that caused by A. aspergillic acid. kojic acid. the real exposure at the onset of the disease may be only estimated. 1 2009. veriscolor and Penicillium spinulosum) isolated from wet plaster bars on murine macrophages. 2004). versicolor). 2003) performed in 2001 with 21 A. 2009). The MTT test focused on in vitro influence of fungi on living cells is performed with swine. (Fischer et al. Conclusions. 2010). flavus strains isolated from the environment at social welfare homes were examined for aflatoxins B1.. e. All of the A. flavus. The conditions in the rooms in our study were conducive to fungal growth: the mean temperature was 24°C. and humidity around 40%. B2. Hardin et al. niger. This finding was confirmed by Kamei et al. fumigatus to produce toxic gliotoxins and increased the general cytotoxicity of the fungi. Variable environmental conditions may stimulate fungi to produce mycotoxins. A. niger strains were cytotoxic. (2007) investigated the influence of mycotoxins such as aflatoxin B. Therefore. 15: 11–32.. the intensity of the yellow tetrazolium salt reduction to formazan depended on the kind of toxin. 2. the immunity status of the patients should be evaluated and the presence of fungi in the environment should be monitored. A. (2002) who analyzed the virulence of A. (2005).. the stage of sporulation and the access to nutrients (Kelman et al.. only eight out of fourteen A. flavus and A. Those data are consistent with our findings because A. however. Integrative analysis of the heat shock response in Aspergillus fumigatus. sheep or lamb cell cultures. The strains were not tested using MTT. but they did not cause inflammatory reaction in the cells tested.. The examination of the environment of a patient diagnosed with a mycotoxin infection is most often performed after the initial phase of the disease and may not reflect the exposure to harmful substances present in the course of the disease (Gniadek et al.A. The indoor environment is an active ecosystem that changes in the course of time and as a result of changing temperature and humidity. 2009. flavus strains were cytotoxic in our study. (2007) cell cultures responded in different ways to treatment with various mycotoxins. e. terreus was almost undetectable. Only five strains were tested. baker’s lung as well as allergic broncho-pulmonary alveolitis (ABPA). R. aflatrem. It should be kept in mind that fungi are able to produce mycotoxins in presence of other fungi (toxic metabolites are released only in a cross-reaction with toxins secreted by other fungi). Stec et al. G1 and G2 using high performance liquid chromatography – HPLC. gliotoxin produced by A. chartarum and A. flavus strains could produce the so called “masked mycotoxins”. They have shown that some microcultures. A. Therefore. This substance inhibits T-cell activity. including their cytotoxicity testing (possible exposure). The toxin production by moulds is influenced by those factors and depends also on the fungal culture age. A. 2009. 2000). citrinine and zelarenon on various cell cultures. it appears essential to determine the kind of mycotoxins produced by highly mycotoxic fungi. 2005. In further trials carried out by Stec et al.A. however we were not sure that they were not pathogenic... terreus and their influence on murine macrophages. Such a conclusion may be confirmed by the findings of Murtoniemi et al. after prolonged growth on wet cardboard sheets. To protect patients from harmful influence of mycotoxins. but their toxicity was the lowest as compared with other species. et al. fumigatus was the most frequently highly cytotoxic (+++) as compared with other species. On the other hand. BMC Genomics. bronchial asthma and allergic alveolitis in form of farmer’s lung. maltoryzin. paspalicin or highly toxic sterigmatocystine. Aflatoxins were not detected in any of the strains tested.

1

Cytotoxicity of Aspergillus sp.

63

Armitage P. 1971. Statistical Methods in Medical Research. Blackwell Scientific Publications. Oxford. p. 189–207 Ben-Ami R., R.E. Lewis, K. Leventakos and D.P. Kontoyiannis. 2009. Aspergillus fumigatus inhibits angiogenesis through the production of gliotoxin and other secondary metabolites. Blood. 114: 5393–5399. Bennett J.W. 2009. Aspergillus: a primer for the novice. Med. Mycol. 47 (Suppl. 1): S5–12. Burr M.L. 2001. Health effects of indoor moldes. Rev. Environ. Health. 16: 97–103. Ciegler A. and J.W. Bennet. 1980. Mycotoxins and mycotoxicosis. Bioscience 30: 512–513. Fischer G. and W. Dott. 2003. Relevance of airborne fungi and their secondary metabolites for environmental, occupational and indoor hygiene. Arch. Microbiol. 179: 75–82. Fischer G., T. Müller, R. Schwalbe, R. Ostrowski and W. Dott. 2000. Species-specific profiles of mycotoxins produced in cultures and associated with conidia of airborne fungi derived from biowaste. Int. J. Hyg. Environ. Health. 203: 105–116. Fog Nielsen K. 2003. Mycotoxin production by indoor molds. Fungal Genet Biol. 39: 103–117. Gareis M. 1994. Cytotoxicity testing of samples originating from problem buildings. [In:] Fungi and Bacteria in Indoor Air Environments: Health Effects, Detection and Remediation. E. Johanning (ed.), Eastern New York Occupational Health Program, Saratoga Springs, New York, USA, Proceedings. 139–144. Gniadek A. and Macura A.B. 2003. The presence of fungi in the environment of social welfare homes and the mycotoxins threat (in Polish). Ann. Univ. Maria Sklodowska. Sect. D. Med. 58 (Suppl 13): 416–421. Gniadek A., A.B. Macura, E. Oksiejczuk, E. KrajewskaKu³ak and C. £ukaszuk. 2005. Fungi in the air of selected social welfare homes in the Ma³opolskie and Podlaskie provinces – a comparative study. Int. Biodeterior. Biodegrad. 55: 85–91. Hanelt M., M. Gareis and B. Kollarczik. 1994. Cytotoxicity of mycotoxins evaluated by the MTT-cell culture assay. Mycopathologia 128: 167–174.

Hardin B.D., B.J. Kelman and A. Saxon. 2003. Adverse human health effects associated with molds in the indoor environment. J. Occup. Environ. Med. 45: 470–478. Jarvis B.B. 2003. Analysis for mycotoxins: the chemist’s perspective. Arch. Environ. Health. 58: 479–483. Jarvis B.B. and J.D. Miller. 2005. Mycotoxins as harmful indoor air contaminants. Appl. Microbiol. Biotechnol. 66: 367–372. Kamei K., A. Watanabe, K. Nishimura and M. Miyaji. 2002. Cytotoxicity of Aspergillus fumigatus Culture Filtrate Against Macrophages. Nippon Ishinkin Gakkai Zasshi. 43: 37–41. Kelman B.J., C.A. Robbins, L.J. Swenson and B.D. Hardin. 2004. Risk from inhaled mycotoxins in indoor office and residential environments. Int. J. Toxicol. 23: 3–10. Klich M.A., S. Tang and D.W. Denning. 2009. Aflatoxin and ochratoxin production by Aspergillus species under ex vivo conditions. Mycopathologia 168: 185–191. Krishnan S., E.K. Manavathu and P.H. Chandrasekar. 2009. Aspergillus flavus: an emerging non-fumigatus Aspergillus species of significance. Mycoses. 52: 206–222. Kwon-Chung K.J. and J.A. Sugui. 2009. What do we know about the role of gliotoxin in the pathobiology of Aspergillus fumigatus? Med. Mycol. 47 (Suppl. 1): S97–103. Murtoniemi T., P. Penttinen, A. Nevalainen and M.R. Hirvonen. 2005. Effects of microbial cocultivation on inflammatory and cytotoxic potential of spores. Inhal. Toxicol. 17: 681–693. Pitt J.I. 2000. Toxigenic fungi: which are important? Med. Mycol. 38 (Suppl. 1): 17–22. Pitt J.I., J.C. Basilico, M.L. Abarca and C. López. 2000. Mycotoxins and toxigenic fungi. Med. Mycol. 38 (Suppl. 1): 41–46. Stec J., M. Szczotka and J. KuŸmak. 2007. Cytotoxicity of feedborne mycotoxins to animal cell lines in vitro using MTT assay. Bull. Vet. Inst. Pulawy 51: 679–684. Steyn P.S. 1995. Mycotoxins, general view, chemistry and structure. Toxicology Letters 82/83: 843–851. Watanabe A., K. Kamei, T. Sekine, H. Higurashi, E. Ochiai, Y. Hashimoto and K. Nishimura. 2004. Cytotoxic substances from Aspergillus fumigatus in oxygenated or poorly oxygenated environment. Mycopathologia 158: 1–7.

64

Gniadek A. et al.

1

Polish Journal of Microbiology 2011, Vol. 60, No 1, 65–71
ORIGINAL PAPER

Production and Partial Characterization of High Molecular Weight Extracellular "-amylase from Thermoactinomyces vulgaris Isolated from Egyptian Soil
M.I. ABOU DOBARA, A.K. EL-SAYED, A.A. EL-FALLAL and N.F. OMAR*

Botany Department, Faculty of Science, Mansoura University (Damietta Branch), Egypt Received 14 July 2010, revised 15 January 2011, accepted 20 January 2011
Abstract Optimizing production of "-amylase production by Thermoactinomyces vulgaris isolated from Egyptian soil was studied. The optimum incubation period, temperature and initial pH of medium for organism growth and enzyme yield were around 24 h, 55°C and 7.0, respectively. Maximum "-amylase activity was observed in a medium containing starch as carbon source. The other tested carbohydrates (cellulose, glucose, galactose, xylose, arabinose, lactose and maltose) inhibited the enzyme production. Adding tryptone as a nitrogen source exhibited a maximum activity of "-amylase. Bactopeptone and yeast extract gave also high activity comparing to the other nitrogen sources (NH4Cl, NH4NO3, NaNO3, KNO3, CH3CO2NH4). Electrophoresis profile of the produced two "-amylase isozymes indicated that the same pattern at about 135–145 kDa under different conditions. The optimum pH and temperature of the enzyme activity were 8.0 and 60°C, respectively and enzyme was stable at 50°C over 6 hours. The enzyme was significantly inhibited by the addition of metal ions (Na+, Co2+ and Ca2+) whereas Cl– seemed to act as activator. The enzyme was not affected by 0.1 mM EDTA while higher concentration (10 mM EDTA) totally inactivated the enzyme. K e y w o r d s: Thermoactinomyces vulgaris, high molecular weight "-amylase

Introduction Enzymes produced by thermophilic bacteria have been highlighted for their potential as biocatalysts in biotechnology. The importance of this was referred to the general relationship between enzyme thermostability and the thermophilicity of the host bacterium (Herbert, 1992). The "-amylase (EC 3.2.1.1) is a well-known endoamylase that hydrolyzes starch by randomly cleaving internal a- 1,4 – glucosidic linkages. The spectrum of "-amylase applications has widely used in many fields, such as starch saccharification, textile, food, brewing, distilling industries, medical and analytical chemistries (Pandey et al., 2000). Despite this, interest in new and improved "-amylase is growing vastly. Therefore, the search for thermostable Ca2+ independent "-amylase (Tonkova, 2006) is continuous. Enzymes of the thermophilic actinomycetes Thermoactinomyces species, especially their "-amylase (Ito et al., 2007), have attracted much interest because of their activity at high temperature. The advantages for using thermostable "-amylases in industrial processes include

the decreased risk of contamination, the increased diffusion rate and the decreased cost of external cooling. In addition, the stability of biocatalysts is often a limiting factor in the selection of enzymes for industrial applications due to the elevated temperature or extreme pH of many biotechnological processes. The aim of the investigations was to determine the optimum conditions for production of highly active and industrial stable "-amylase by an Egyptian isolate of the thermophilic actinomycete Thermoactinomyces vulgaris and to investigate the enzyme properties. Experimental
Materials and Methods

T. vulgaris strain. T. vulgaris strain was isolated from fertile soil samples collected from Egypt at 50°C and identified according to Bergey’s Manual of Systematic Bacteriology (Lacey and Cross, 1989). The culture was maintained on Czapek-yeast-casein (CYC) agar slants.

* Corresponding author: N.F. Omar, Botany Department, Faculty of Science, Mansoura University (Damietta Branch), New Damietta, Egypt. P.O. Box 34517; e-mail: noha_omar15@yahoo.com

The organism was grown in conical flasks containing starch-nitrate medium (Waksman. xylose.03 ± 0. Nondenaturing PAGE was carried out by omitting SDS from the method of Laemmli (1970) with 10% polyacrylamide. Results The production of "-amylase by T.1 N HCl and the colour was developed by adding 0. et al.0) containing 2% starch and then immersing in staining solution (KI 13 g/l and I2 6 g/l).09 U/ml).0–10. Amylase activity of proteins was detected according to Garcia-Gonzalez et al.1 M. Dilution of clarified solution was used to determine the intracellular protein concentration using Bradford method (1976). The stain was stable for only a few minutes. The medium (20 ml taken in 250 ml Erlenmeyer flasks) was inoculated with 1 ml of spore suspension of pure colonies of the organism and incubated at 50°C with shaking (150 rpm) for 72 hours. The amylase assay was based on the reduction in blue colour intensity resulting from starch hydrolysis (Palanivelu. and boiled for 20 minutes.0). Different carbon sources (1%) and nitrogen sources (equimolecular nitrogen amounts equivalent to the nitrogen content of the basal medium) were used for optimization of nutritional factors.8% (Fig. glucose. cellulose. One unit of enzyme activity is defined as the quantity of enzyme that caused 20% reduction of blue colour intensity of starch iodine solution at reaction incubation temperature in 1 min per ml. and incubation period (12–96 h) were tested for "-amylase production.2% I2) solution. The effect of metal salts (NaCl.4 ml of diluted enzyme. Effect of incubation period on growth and "-amylase production by T. KNO3. Enzyme activity at various temperatures and pH was studied by incubating reaction mixtures at different temperatures (30–80°C) and Tris-HCl buffer (pH 4. vulgaris strain were used for determination of intracellular protein. arabinose.66 Abou Dobara M.0 % starch. Intracellular protein content of T. 1). The reference pre-stained protein marker (Molecular weights 10 to 170 kDa. 2001).0). Fermentas) was used.0). The gel was destained with distilled water. Experiments were carried out in triplicate and the results were treated statistically and standard errors are shown. NH4NO3. The reaction mixture consisted of 0. Statistical analysis. 1 Production of "-amylase. The final enzyme solution was taken for polyacrylamide gel electrophoresis (PAGE).2 M phosphate buffer (pH 7. the cell-free enzyme supernatant was obtained by centrifugation at 8000×g for 20 min. temperature of incubation (30–60°C). NaNO3. The supernatant of culture was brought to 70% ammonium sulphate saturation in an ice bath. The optical density (OD) of the blue colour solution was determined using a Unico 7200 SERIES spectrophotometer at 690 nm.. Physicochemical properties of "-amylase.5 ml of 0.5 ml of 0. with the maximum production after 24 hours (1. The enzyme solution was dialyzed overnight at 4°C against the same buffer then concentrated over sucrose bed. CoCl2 and CaCl2) and EDTA on activity was determined by adding of different concentrations of each salt to the standard assay. vulgaris increased significantly during the growth of the organism. lactose and maltose. The nitrogen sources were included NH4Cl. SM 0671. Enzyme stability at various temperatures was also studied by pre-incubating cell-free supernatants for different time (1–6 h) at various temperatures (50°C–80°C). The reaction was stopped by adding 0.1 M. bactopeptone. vulgaris.5 ml of (2% KI in 0. The initial pH of the medium (4. On the compilation of the previous experiments. The harvested mycelia of T. yeast extract and tryptone were tested. pH 7. galactose. .1% soluble starch and 1 ml of phosphate buffer (0. "-Amylase assay. Data were statistically analyzed for variance and the least significant difference (LSD at 0. Activities were expressed as a percentage of the maximal activity. The various tested carbon sources were: starch.I. After 36 hours the activity was reduced rapidly by 72. vulgaris grown in starch-nitrate medium containing 1. 1959) as a basal medium with pH adjusted to 7. Washed pellets were dissolved in 20 ml of NaOH (1 M).5. ammonium acetate. 1. Bovine serum albumin was used as standard. Although there was Fig.0–9. A software system SPSS version 15 was used. The precipitated protein was collected by centrifugation at 3000×g at 4°C and dissolved in 1–2 pellet volumes of phosphate buffer (0. Electrophoresis and molecular weight determination. (1991) by incubating the gels at 50°C for 20 min in 0.01 level) using one-way analysis of variance (ANOVA). 0. Ammonium sulphate precipitation of the enzyme. pH 7) was incubated at 50°C for 10 minutes.

and 72 hours (B). it didn’t affect its isozymal pattern as they produced the same two "-amylase isozymes of approximate molecular weight 135–145 kDa (data not shown).76 ± 0. xylose. Fig.04 0. Arrows indicate the position of the two "-amylase isozymes of approximate size between 135–145 kDa. galactose. However.78 ± 0. increasing the pH above 7.36 ± 0.11 ± 0.02 0. a significant increase in the production after 72 hours. 2) as they produce two "-amylase isozymes with approximate molecular weight 135–145 kDa. the used carbon sources other than starch induced an extremely significant decrease in the enzyme yield (Table I). starch. At pH 10.02 0.81 ± 0.01 0. the organism could grow weakly but no activity could be detected (Fig. 3. T.06 ± 0.10 ± 0. vulgaris grown in starch-nitrate medium containing 1. vulgaris grown in starch-nitrate medium containing different carbon sources instead of starch Carbon sources (1.16) was recorded with NaNO3. 2. Below 45°C. Maximum production occurred in the pH range of 6. .02 0.86 ± 0. arabinose. ammonium acetate.43 ± 0.01 Fig.0 to 7. Although different carbon sources affected the quantity of the enzyme production.0%) (w/v) Starch Glucose Galactose Xylose Arabinose Lactose Maltose Cellulose ± standard error Amylase (U/ml) 3. glucose.01 0.20 U/ml) was recorded with tryptone and the lowest (1.0 (3.02 0.52 ± 0. NH4NO3.5 U/ml). Effect of pH on growth and "-amylase production by T. Active-PAGE of "-amylase profile of T.06 0. yeast extract and NH4Cl caused a highly significant increasing in enzyme production comparing with KNO3 of the basal medium (Table II). vulgaris grown in starch-nitrate medium containing 1.04 ± 0. bactopeptone.0 % starch ( ) denotes the final pH. KNO3.07 ± 0. 3). vulgaris grown in starch-nitrate medium containing 1.71 ± 0. the "-amylase profile. The highest production of "-amylase (93.0 % starch after 24 hours (A).76 ± 0. bactopeptone.63 ± 0. The different used nitrogen sources (NH4Cl. on active PAGE didn’t differ from that at 24 hours (Fig.08 0. 4. namely. the production of the enzyme was completely inhibited (Fig. 4). The optimum temperatures for the production of "-amylase were in the range 45°C to 55°C with non significant difference in this range.02 ± 0.05 0.0% starch. Tryptone.02 0.0 and below pH 6.03 Intracellular protein (mg/ml) 1. lactose and maltose.05 ± 0. NaNO3.02 0.86±0. cellulose. Effect of temperature on growth and "-amylase production by T.02 0.04 0.0 induced a significant decrease in the yield. yeast Table I Effect of carbon sources on growth and "-amylase production by T. vulgaris was able to grow well using different carbon sources (1% w/v).1 Extracellular "-amylase from Thermoactinomyces vulgaris 67 Fig.

6).75 6. 7. The optimum activity occurred at temperature range between 50°C and 60°C.64 6. with an optimum point of 60°C (Fig. 5. The enzyme activities are represented relative to the maximal value.87 6.81 6. Fig. An amount of 1 mM of NaCl and CaCl2 caused extremely significant decrease in enzyme Fig. et al.95 ± 0.36 ± 1.08 63.06 0.05 ± 0.73 Amylase (U /ml) 1. The "-amylase activity couldn’t be detected at pH 4. 7).53 ± 0.4 ± 2.81 ± 0.001 0.16 3.10 53.78 1. Table III Effect of various EDTA concentrations on "-amylase activity. 6.20 45. but at higher temperature the activity of the enzyme declined (Fig. The "-amylase profile had the same previous pattern of two "-amylase isozymes at about 135–145 kDa (data not shown). The enzyme activities are represented relative to the maximal value.3 U/ml) was occurred at 80°C. 5).34 ± 0. CoCl2 and CaCl2 (Fig.02 Intracellular protein (mg/ml) 6.1 0.15 1.40 6.62 ± 4. 5).17 1.59 ± 0. The enzyme was significantly influenced by the different metal salts including NaCl.66 ± 0.01 0.07 0. .68 Abou Dobara M.80 ± 0. At 90°C the enzyme lost its activity rapidly.I.12 ± 0. The enzyme was stable at 50°C retaining about 80% of its activity over 6 hours incubation period.64 6.71 6.70 0.29 ± 0.81 ± 5. Effect of temperature and pH on "-amylase activity.11 93.01 Amylase relative activity (%) 99.46 104. Physicochemical properties of "-amylase.5 1 5 10 ± standard error 1 Table II Effect of nitrogen sources on growth and "-amylase production by T. vulgaris grown in starch-nitrate medium containing different nitrogen sources instead of KNO3 Nitrogen sources Ammonium acetate Tryptone Yeast extract Bactopeptone NH4Cl NH4NO3 NaNO3 KNO3 ± standard error Final PH 6. CoCl2 induced significant inhibition of the enzyme activity.70 108.0 but it increased significantly with the increase of the pH until it reaches its optimum point at pH 8.85 ± 0.72 ± 0.54 ± 0.10 ± 0.63 21.12 0. the enzyme has a half-life of about one hour.46 ± 0. The enzyme activities are represented relative to the control activity Concentration of EDTA (mM) 0. At 60°C and 70°C. Fig. at 80°C it retained more than 20% of its activity up to 4 hours.03 0. Effect of various metal salts concentrations on "-amylase activity.46 6. However.52 18.56 ± 3. Effect of temperature on the stability of "-amylase.0 (Fig.00 ± 0 extract and tryptone) didn’t have any effect on the enzyme electrophoretic profile. The minimum level of the activity (54.86 ± 0.03 0.93 ± 0.06 ± 0.01 0. The enzyme activities are represented relative to the control activity.

The role of amino acids and vitamins in enhancing the "-amylase production in different microorganisms have been reported to be highly variable (Gupta et al.001. 2000. the production decreased gradually and reached its minimum recorded level at 96 hours. organic nitrogen sources have been preferred for the production of "-amylase.0–9.. This might be corresponding to the rapid autolysis of Thermoactinomyces species (Lacey.4% of its activity respectively. Similar effect of ammonium chloride was obtained for B.. subtilis DM-03 (Das et al. Growth expressed as intracellular protein and "-amylase production by the thermophilic actinomycete Thermoactinomyces vulgaris reached maximum values after 24 hrs.. studies on both glucoamylase and "-amylase indicate that inhibition does not occur below a critical concentration of product (Wang et al. Ammonium chloride induced a significant increase in the enzyme yield that is higher than that of the ammonium acetate.5 mM EDTA was found to decrease the activity to 53. it showed more than 20% of its activity at 50°C after being kept at 80°C for 4 hrs indicating inhibition of the enzyme catalysis .6 Uml–1). like most other inducible enzymes that are affected by substrate hydrolytic products (Bhella and Altosaar.1 Extracellular "-amylase from Thermoactinomyces vulgaris 69 activity by about 80% and 70% respectively. Other carbon sources have been found to be strongly repressive although they supported good growth.8% and 63.1 mM EDTA but it was totally inactivated by 10 mM EDTA (Table III).. Morkeberg et al. vulgaris was growth associated and this is in agreement with other investigators (Kuo and Hartman. This indicate that they have no effect on the isozymal "-amylase over expression. 1978. As the isozymal pattern was the same at 24 hrs and 72 hrs. This is due to their advantages such as cost effectiveness. On the other hand.. At reaction temperature of 60°C. vulgaris but also influence the enzyme stability in the medium.5 fold comparing to KNO3.. 2006). In spite of the relative good growth of the organism at 40°C. 2010). 1990). Among nitrogen sources. The pH change of the growth medium not only affected the growth and "-amylase secretion of T. 0. The influence of temperature on amylase production is related to the growth of the organism. However. This referred to the action of protease.. This reduced activity might be attributed to the reduced molecular flexibility of the thermophilic protein under mesophilic conditions.6% comparing with the control (96.0. Asoodeh et al. 1982). the enzyme expresses maximum activity whereas it showed less than 50% of its activity at 30°C.. the observed peaking and troughing of the production can be attributed to differential inhibition by products of substrate hydrolysis rather than the isozymes down or over expression. Although the different nitrogen sources had a variable effect on "-amylase activity. with ammonium acetate as an exception. microbial sources are used for the industrial production. Although the enzyme showed only 4% of its activity at 80°C. they did not produce different isozymal profile. 0. 2003). that is rapidly inactivated at higher temperature (Behnke et al.0 in spite of the same ability of the organism to grow. In spite of the wide distribution of "-amylase. Asoodeh et al.. 2009.01 and 0. 1971).0 to pH 6.0 in contrast to the optimum production at pH 6. 2003). The results confirms the inducibility nature of the "-amylase when different carbon sources were used and compared. where they play a dominant role in carbohydrate metabolism. 2006. Shimizu et al. The enzyme activity was not affected by 0. consistency. despite it was completely inhibited at pH 4. 2010). less time and space required for production. It was recorded that organic nitrogen sources supported maximum "-amylase production by various bacteria and fungi due to their high nutritional amino acids and vitamins content (Gupta et al. Therefore.0 could explain the complete inhibition of the enzyme activity at pH 10. In the present work. In support. "-amylase from T. However. after which. 1995). Murthy et al.8%. These results indicated that the production of extracellular "-amylase by T. 2001). Discussion "-Amylases have been isolated from diversified sources including plants. Tryptone was the best nitrogen source that increased the productivity of "-amylase by 26... the activity was reduced rapidly by 72. Ryan et al. In support. vulgaris showed a pH activity profile with a flat top which retaining more than 75% of the enzyme activity in the pH range 5. which suppresses the amylolytic activity. After 72 hrs. animals. This pH profile could be attributed to the limitation of the enzyme catalysis by protonation of the nucleophile at low pH and by deprotonation of the hydrogen donor at high pH values (Nielsen et al. The present results revealed an optimum yield of "-amylase at 45°C to 55°C. 2010). 2004. and microbes. and ease of process modification and optimization (Lonsane and Ramesh. The "-amylase production is also appeared to be subjected to catabolite repression by maltose and glucose..0. 1985. increasing of their concentration up to 10 mM of NaCl and CaCl2 resulted in retaining 60. starch is known to induce amylase production in different bacterial strains (Aiyer. the difference of the final pH of the medium from pH 10. Most raw starch degrading enzymes had optimum pH in the acidic to neutral range (Pandey et al. it increased significantly at 60 and 72 hours. Sun et al.. "-amylase activity couldn’t be detected.. 2004). 1966.

4. 1971. "-amylase in the present study was strongly inhibited by both 1 mM CaCl2 and NaCl. 2004. Shimizu-Ibuka and H. Although the molecular weights of microbial "-amylases are usually range between 50 to 60 kDa (Vihinen and Mantsala. Murthy P. Chauhan. Bacteriol. Ito. Sakai. J. Carlsen and J. Martin. Haye and A. Increasing the concentration of CaCl2 and NaCl was found to retain the enzyme activity.. 141: 2449–2454. 2010. Val326 of Thermoactinomyces vulgaris R-47 amylase II modulates the preference for alpha-(1. Holt (eds).. 501AL. Microbiol. A.T. 1–43. Morkeberg R. thermostable and calcium independent "-amylase of T. M. and processing of the amylase of Streptomyces griseus IMRU 3570: Two different amylases are derived from the same gene by an intracellular processing mechanism. Allg. Z. Ruttloff and R.. 2007. Laemmli U. where Ca2+ is an inhibitor of glucose isomerase (Tonkova. J. and T. pp. J. Induction and repression of "-amylase production in batch and continuous cultures of Aspergillus oryzae. B. in the present work. molecular weight of some "-amylases was found to rise owing to carbohydrate moieties (Gupta et al.M. Anal. V. Williams & Wilkins. vol. the present results indicated a new active highly molecular weight. 84: 1246–1249.01. and I. TVAI and TVAII with molecular weights of 71 kDa and 67. J. 2003). Gupta. 22: 511–519. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Biol. 1 Literature at 80°C rather than inactivation of the enzyme.V.K.A. Can. Biochem. Nature 227: 680–685. Technol. R.5 kDa respectively (Ohtaki et al. In: Williams S. Blackie. (2000) to be a result of competition between the exogenous cations and the protein-associated cation.A. a strain isolated from the traditional food of India. Characterization. Kuo M. 2003). Altosaar.F. Lacey J. Molecular biology and biotechnology of extremophiles. Ferment. is fairly stable at 50°C over 6 hrs and with a half-life of about one hour at both 60°C and 70°C. 1973. M. Technol. 1989). Goswami and B. Purification and some properties of the extracellular "-amylase from Aspergillus awamori. S. H. S. nov.ijbiomac. In spite of the important role of both calcium and sodium ions to retain the structure and function of "-amylases (Prakash and Jaiswal. Naidu and P.J. vulgaris. Microbiology. 2010). 1992. pp.6)-glycosidic linkages. A novel thermostable.1 mM EDTA was added to the reaction mixture. 2010). J. Liras..1016/j. vulgaris which could be of importance for the starch-processing industries. Ramesh (eds). Lagzian. Preparation and characterization of proteases from Thermoactinomyces vulgaris. Doley and A. et al.4). Sharpe and J. Bergey’s Manual of Systematic Bacteriology. Ishino. African J. Herbert R. pp.J. At different concentration of CoCl2. 66: 327–338. Enzyme Microbiol.. Production of bacterial thermostable "-amylase by solid state fermentation: a potential tool for achieving economy in enzyme production and starch hydrolysis. acidophilic "-amylase from a new thermophilic “Bacillus sp. Thermophilic archaeal amylolytic enzymes.70 Abou Dobara M. 1991. Paresh. 92:723–726.e.D. 2009. San Diego: California Academic Press. M.K.G. 1–56. Microbiol. Bhella R. 173: 2451–2458. Ferdowsicous” isolated from Ferdows hot mineral spring in Iran: Purification and biochemical characterization Int. 51:142–150. However..V. . 3: 519–522. Biochimica et Biophysica Acta 1774: 443–449. Bacteriol. Mohapatra. Process Biochem. and T. Biotechnol. Lonsane B.. But 0. doi:10.. 1989. Macromol.K. It is proposed that "-amylases belong to a new class of metallo-enzymes characterized by a prosthetic group. 31: 149. 1995.. In accordance with retaining the enzyme activity at high concentration of CaCl2 and NaCl. 72: 248–254. 2003). subtilis DM-03. 2000. Neilsen.. Srinivas. Chamanic and M.K. In conclusion. "-amylase from T. the present result revealed a highly molecular weight of two "-amylase isozymes (135–145 kDa). Thermoactinomyces sacchari sp.013 Behnke U. vol. Vigal and P. Aiyer P. Asoodeh A. Calcium independent "-amylase is suitable for the manufacture of fructose syrup.. G. the enzyme yield when using ammonium chloride was found to be 3.. Thermoactinomyces vulgaris R-47 was reported to produce two "-amylases. A. Further work is in progress to purify the "-amylase of T vulgaris and characterize the purified enzyme. Isolation of amylolytic strains of Thermoactinomyces vulgaris and production of thermophilic actinomycete amylases. 2004. Das K. and P.2010. Chem. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding.D. T. assuming that Cl– ion has a stabilizing role. 1982. Genus Thermoactinomyces Tsiklinsky 1899. 2003 Microbial "-amylases: a biotechnological perspective.K.and alpha-(1. NH4NO3 and ammonium acetate. Influence of culture and nutritional conditions on the production of amylase by the submerged culture of Aspergillus oryzae.. Lacey J. a significant inhibition in the enzyme activity was recorded... which have been shown to enhance the catalytic efficiency of the enzyme (Prakash and Jaiswal. Mukherjee. 40: 291–298. Biotechnol. Similar inhibitory effect of CaCl2 was reported to amylase of Aspergillus oryzae EI 212 (Kundu et al. Cross. Glasgow and London.S. 2010).3 fold of that using other sources of ammonium i. extracellular "-amylase from B. Garcia-Gonzalez M.. expression in Streptomyces lividans.. and M. Gen. and which plays primarily a structural role (Prakash and Jaiswal. In general. Kundu A. Appl. 1966. Bacteriol. Das and T. 2574–2585. the enzyme retained almost 100% activity when 0. 1970. Purification and biochemical characterization of thermostable. The Co2+ effect was explained by Leveque et al. Mikrobiol. Production of "-amylase under solid-state fermentation utilizing coffee waste.e. 26: 3–14. Gupta R. V. k. Baltimore. Technol. J. J. Ito K. Investigations on autolysis and thermostability of the purified protease.S. J. In: Advances in applied microbiology. 1976.M.. Kleine. 1973). 1990. Bradford M. Herbert R. 35. S. Belarbi. Leveque E. J. In support.. an alkaline-earth metal rather than a transition element. The inhibitory effect of EDTA was also documented by many studies (Gupta et al. Janecek.5 mM EDTA inhibited the enzyme activity retaining only 53% of its activity. i. alkaliphilic. Hartman. Biochem. 1985.I.E.K. Regarding to the effect of EDTA. 2006). a thermophilic actinomycete causing bagassosis. Chloride ions have been found mainly in the active site of mammalian "-amylases. H. Sharp (eds). 38: 1599–1616. Effect of C: N ratio on alpha amylase production by Bacillus licheniformis SPT 27.

Ge. Appl. Science Publishers. and P. A. Vriend. (eds. Acad.A. Techn. Recent advances in microbial raw starch degrading enzymes. Kinetics of glucoamylase hydrolysis of corn starch. Rev. Zeng. Appl. Biochem. Tonozuka..1007/s12010-009-8735-4 Ryan S. India. and wards O. Kanno. USA. V. Advances in microbial amylases.C. 421–472. Mol. Waksman S. P. T.1 Extracellular "-amylase from Thermoactinomyces vulgaris 71 Nielsen J. 24: 329–418.. G. 1959. 2006. Liu and M. 72: 5289–5296.. Biol. 1989. Z. J. "-amylase: An ideal representative of thermostable enzymes. Mutual conversion of substrate specificities of Thermoactinomyces vulgaris R-47 "-amylases TVAI and TVAII by site-directed mutagenesis. Yuan. Ohtaki A. Singh and R. M. New Hampshire.Y. Biotechnol. 2010. X. Y. Tonkova A.. 2001.P. Agric.. In: Ray R. 2006. A. 42: 1681–1688. Appl. . Mizuno.M.. Microbial starch converting enzymes of the "-Amylase family. Xia. Peng. Purification and some properties of a novel "-amylase produced by a strain of Thermoactinomyces vulgaris. Chem. and pullulan-degrading activities in Bifidobacterial strains. Iguchi. Wang J. X.. Tamura and M. C. Sinderen. Mohan. amylopectin-. Sci. Biol. Biotechnol. The determinants of "-Amylase pH-activity profiles. and Environmen. Analytical Biochemistry and separation Techniques. 2001. Shimizu M. and N. Zhao. Liu and X. Screening and identification of starch-. USA 45: 1043–1047. Microbial Biotechnology in Horticulture. 31: 135–152.F. Fitzerald and D. Soccol. 160: 988–1003. Madurai. Soccol.). Prakash O. Appl. J. Biotechnol. Sakano and S.P. Mantsala. Microbial amylolytic enzymes. 1978. M. 81: 727–729. characterization and classification of species within the Streptmyces griseus Group. Enfield. Vihinen M. 2000. DOI 10. 2003. D. Biochem. Palanivelu P. Pandey A. T. Strain specificity and production of antibiotic substances. Nigam. Hao. Sun H. Y. Carbohydrate Research 338: 1553–1558. Z. P. Jaiswal. Suckane. Microbiol. Natl. Borchert and G. and Biotechn.G. 2006. Kamitori. 2010. Protein Engineering 14: 505–512.R. Chem. Kalamani Printers. Biochem. M. Biochem. Crit. Proc. pp.W.

72 Abou Dobara M.I. et al. 1 .

1999). 1999).0 with optimum pH 7. Six mesophilic isolates (MBRI 6. Algal-derived oils require a relatively high investment in technology compared to bacterial fermentation. MBRI 12 was found to be a potential source as it produced 60% EPA. 2009). makes it evident that alternative sources of LC-PUFAS must be found (Jacobs et al. Alpha-linoleic acid.. Since omega-6 and omega-3 fatty acids are not interconvertible in the human body. phone: 020-24365713. India 2 National Center of Cell Sciences. accepted 20 January 2011 Abstract Marine samples from the Indian Ocean were used to isolate and characterize the organisms with respect to their fatty acid profiles. Besides the concern for the presence of contaminants. 2005). Ganeshkhind. Vol.producing prokaryotic genera affiliated to the Gammaproteobacteria. such as mercury and polychlorinated biphenyls. fax: 91-20-24379013. an essential omega-3 fatty acid. iv) tolerated 5 to 15% NaCl v) except MBRI 9. although bacteria contain a lower proportion of lipid (Nichols et al.0 to 9. India Received 18 May 2010. Thus bacterial sources of PUFA remove the expense * Corresponding author: R. in some fish oils. the needed omega-3 LC-PUFAs. the ratio of linoleic acid (LA)/ALA in our diet influences the ratio of omega-6/ omega-3 fatty acids LC-PUFAs. MBRI 8. was produced by these isolates in the range of 12 to 60% at 30oC. NEHA TIWARI1. They were i) Gram-negative. K e y w o r d s: Gammaproteobacteria. SANDEEP WALUJKAR2 and RAMA BHADEKAR1* of Microbial Biotechnology. 2004). Maharashtra.com . Maharashtra. iii) produced acid from glucose and maltose. Rajiv Gandhi Institute of IT and Biotechnology Bharati Vidyapeeth Deemed University. Thus a new genus of Halomonas may be included in earlier reported EPA..bhadekar@gmail. since the demand for fish oil in the aquaculture industry alone is estimated to exceed the supply by 2010 due to increase in global population (Meyers and Worm. MBRI 12 and MBRI 13) were obtained from three different water samples. Alpha-linoleic acid (ALA). Pune 411 046. e-mail: neeta. The current commercial sources of EPA and DHA are restricted to fish and algal-derived oils. ii) catalase positive. MBRI 9. Problems exist with both of these sources. University of Pune. This isolate was further identified by partial 16S rDNA sequencing and phylogenetic analysis revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequence similarity. The main reason being an increase in the consumption of vegetable oils rich in omega-6 fatty acids. 60.. Bhadekar. A key advantage of bacterial PUFA production is that only a single PUFA is produced. revised 19 January 2011. No 1. Katraj. 1997). an EPA-Producing Mesophilic Marine Isolate from the Indian Ocean DIPTI SALUNKHE1. polyunsaturated fatty acid 1 Department Introduction Long chain polyunsaturated fatty acids (LC-PUFAs) are essential components of membrane lipids of various organisms (Berge and Barnathan. can be obtained in our diet from external sources such as fish oil. MBRI 10. suggested by numerous nutritional bodies (Simopoulos et al.0 v) grew well at 30oC and were able to grow in the range of 15 to 45oC.0 to 8. Halomonas bolviensis. They are well documented for their beneficial physiological effects in human health including i) lowering of plasma cholesterol and triglycerols ii) prevention of certain cardiovascular diseases (atherosclerosis and thrombosis) and iii) reducing the risk of breast. nutraceuticals. 73–78 ORIGINAL PAPER Halomonas sp. 570 bp).. showed pH tolerance in the range of 5. EPA. Pune 411 007. To correct this imbalance. 2003). is up to 30-fold too high (Simopoulos. rather than the complex mixture yielded from fish or algal oils (Russell and Nichols. Commercial fish stocks are likely to decline in the future. it has shifted heavily towards omega-6 acids in the current western diet and by some estimate..Polish Journal of Microbiology 2011. ecosapenthaenoic acid (EPA) and docosahexaenoic acid (DHA) are the major LC-PUFAs of general nutritional importance. nov. colon and pancreatic cancer (Robert et al. 1999). 1996). Although the recommended ratio of dietary omega-6 and omega-3 fatty acids is 5:1 (Sargent.

and gelatinase) (Collee et al. 10% inoculum of all the isolates was used to inoculate MSM and incubated at 30°C in an orbital shaker (Remi. Cells were harvested after 24 hrs by centrifugation (Plastocraft. sucrose. Preparation of fatty acid methyl esters (FAMES). protease. 2003). physiologically and biochemically. 0.5 11 pH 8. Recently we have reported halotolerant organisms from different food samples (Jadhav et al. The cultures were incubated at 30°C. Table I Different sampling locations Location Latitude Longitude Depth (m) 13 9.D.01”6”N 73°56. The present work was aimed at isolation of marine organisms from the Indian Ocean and characterizing them with respect to their fatty acid profiles.2) and incubated at 30°C.58”E 2ST/LT/BOT 15°33. Hence use of organisms producing these nutraceuticals at room temperature will be efficient and reasonably priced. Isolation and characterization of microorganisms. The tubes were then cooled quickly in ice. the supernatant was discarded. Acid production was studied by using different sugars (glucose.000 rpm for 12 mins.98 MBRI 9. Experimental Material and Methods Sampling. Cells were reweighed. 1. 120 rpm for 48 hrs. However use of psychrophilic or piezophilic organisms producing EPA. The isolates were characterized morphologically. The media at different pH were inoculated with overnight grown inoculum (107 cells/ml).61 27.62 7. This is an important adaptation for countering the effects of hydrostatic pressure and low temperature on fluidity or phase of membrane lipid (Allen and Bartlett.0 g glucose.0 g protease peptone no 3. India. 30°C and 45°C for 24 hrs.producing marine isolate from the Indian Ocean. necessitates the need of low temperature and high pressure facilities (Gentile et al.02 7. grade.4 Isolates 6NT/LT/BOT 18°48”52”N 72°46’30”E 2NT/LT/BOT 15°33. catalase.72 MBRI 6 and MBRI 13 .6 N) 4 ml) was added in the tubes (Carrapiso and Garcia.0. Salinity ture (°C) vity (ms) (mg/l) 30. The isolated colonies were maintained on MSM agar slants.1 ml of each sample was spread on MSM agar plates and incubated for another 48 hrs.72 MBRI 8 4.8 31. Temperature tolerance was examined by incubating the cultures at temperatures 15°C. Cell growth was determined by measuring the absorbance at 660 nm.05 974. the cell pellet resuspended in 1.7 412.74 Salunkhe D. 120 rpm for 24 hrs and cell growth was determined by measuring the absorbance at 660 nm. lactose. 10 ml of each individual sample were inoculated in 100 ml Marine Salt Medium (MSM) (Composition per litre: 81.8 71.. to which a fresh solution of the transesterification reaction mix (methanolic HCl (0. All were of A. MSM broth supplemented with various concentrations of NaCl (ranging from 1–25%) was used to examine salt-tolerance of the isolates.0 g NaCl. All chemicals were procured from Himedia and Merck. 5.0 g MgCl2.. 2010a) as well as from wall scrapings of historical building in India (Jadhav et al. To our knowledge this is the first report of a high EPA. The tubes were capped tightly and the solutions were vortexed for 5 s to 10 s and heated in an 80°C ± 2°C water bath for 2 hrs. Each bacterial culture tube was capped and stored at 4°C. 2010b). 0. Considering the significance of PUFA in human health and limitations in using fish oils. Halophilic organisms are also known to be good sources of different bioactive compounds (Margesin and Schinner. Numerous bacterial species of marine origin producing PUFAs are particularly prevalent in high-pressure. They were novel owing to their abilities to fix atmospheric nitrogen and produce industrially important enzymes. fructose.06 g NaHCO3 and 0. 0.0–11. 1989).36 g CaCl2..026 g NaBr with pH adjusted to 7. Following centrifugation.58”E 3.05 27. 1 of preparative purification in the production of highpurity PUFA oils. Being mesophilic in nature. urease. 2002).62 TemperaConducti. In addition to their potential use as “cell factories” bacteria in particular offer the biotechnological opportunity to study the structure and regulation of the genes and enzymes responsible for PUFA production. 1997).0 g yeast extract. Water samples were collected during summer 2008 from different locations in the Indian Ocean (Table I). 9. 7. India) at 10.4 31. 10. mannitol and maltose).0 ± 0.0 g KCl.R.4 412. After 48 hrs. and recentrifuged.01”6”N 73°56.0% NaCl (w/v). India) at 120 rpm. MBRI 10 and MBRI 12 4.O.. et al. 2. 2000). 2001). microorganisms prove the best suitable alternative. They were also studied qualitatively for their ability to secrete extracellular enzymes (amylase. low temperature and deep-sea habitats (Yano et al. high PUFA producing isolates could be conveniently used for pilot scale production and for further scale-up.6 g MgSO4. Further these isolates were screened for pH tolerance in MSM broth adjusted to pH 5..

17 searching. 2.6 times volume PEG-NaCl [20% PEG (MW 6000). MBRI 8 and MBRI 13 used lactose. The genomic DNA was isolated as described by Ausubel et al. Trans-fatty acids were also not detected in these isolates. 16S rDNA sequencing.5 µl of DNA extract in a total volume of 25 µl. Interestingly. Only MBRI 11 was able to utilize sucrose as carbon source. MBRI 9. Arachinoidic acid and docosahexanoic acid were not detected in any of the isolates. 2009). MBRI 10 did not show presence of unsaturated fatty acids. 1. The thermocycling for the sequencing reactions was performed with a 9800 PCR model (Applied Biosystems). It began with an initial denaturation at 94°C for 2 min.5°C min–1 and hold for 9 mins.0 with optimum pH of 7. Linoleic acid was the only omega-6 fatty acid detected in MBRI 8. A final extension phase at 72°C for 10 min was performed.1 High EPA producing novel Halomonas sp. annealing at 55°C for 1 min and extension at 72°C for 1 min. air dried and sequenced using 96 well sequencing plate as per manufacturer’s instructions. such as EPA and DHA. are particularly effective in the adjustment of membrane fluidity due to their low melting points (Hazel.2.0. To this. monounsaturated fatty acids and polyunsaturated fatty acids were in the range of 21 to 100%. Hence several EPA producing marine organisms isolated . The sample was mixed with 0. India). respectively). 1995). All 6 MBRI isolates were characterized morphologically.5 to 16% and 12.76 µl of glass distilled PCR water.800 rpm for 28 min. vi) grew well at 30°C and v) were able to grow in the range of 15 to 45°C. iv) tolerated 5 to 15% of salt. Foster City. 1488r(5’CGGTTACCTTGTTACGA CTTCACC 3’). Analyses of the FAMES were performed with a Chemito GC 1000 equipped with a 50 m× 0.0–8. 10 µl of Hi-Di formamide was added and vortexed briefly. Thirty-five cycles of amplification consisted of denaturation at 94°C for 1 min. The isolate producing high amount of PUFA was used for identification by 16S rDNA sequencing. After 5 mins the oven was temperature-programmed from 100°C to 198oC at the rate of 1. MBRI 8. The samples were purified using standard protocols described by Applied Biosystems. At low temperatures or high pressures.0–9. Bacteria are known to alter the composition of their phospholipid fatty acids side-chains in order to maintain appropriate membrane organization and function (Suutari and Laakso. MBRI 10 and MBRI 12 could grow on citrate as carbon source.. 11 to 30% and 1 to 62% respectively.25 µl of 10 pm/µl of each oligonucleotide primers 27f (5’CCAGAGTTTGATCGT GGCTCAG3’). iii) produced acid from glucose and maltose. showed pH tolerance in the range of 5. model 9800 with 1. The PCR assay was performed using Applied Biosystems. USA. The pellet was washed with 70% ethanol. So far. (1987). 1994). MBRI 12 and MBRI 13. Fatty acid profile. the content of unsaturated fatty acids often increases with a concomitant decline in saturated fatty acids (Allen et al.24 µl of Taq DNA polymerase and 15. MBRI 10. kept on ice for 5–10 min and was sequenced in a 3730 DNA analyzer (Applied Biosystems) following manufacturer’s instructions.5 µl of 10X PCR reaction buffer (with 1. All six isolates were analysed for their fatty acids profiles (Table II). Initially denaturation accomplished at 94°C for 3 min. It was detected in the range of 1 to 6%.25 mm internal diameter cross-linked methyl silicone fusedsilica CP – SIL 88 capillary column and flame ionization detector. biochemically and physiologically. Nitrogen was used as a carrier gas.5 M NaCl] and incubated for 40 min at 37°C. MBRI 9 tolerated a wide pH range of 6.0. They i) were Gramnegative ii) produced catalase. The upper phase of hexane layer was separated and stored for gas chromatography analysis. The DNA was denatured by incubating at 95°C for 3 min. Results and Discussion Isolation and characterization. 0. Total six bacterial isolates were isolated from the three samples of Indian Ocean (Table I).5 µl of 2 mM dNTPs. 2. Nucleotide sequence accession number. EPA has mainly been reported to occur in eukaryotes and some peizophilic or psychrophilic microorganisms (Freese et al. The PCR product was purified by PEG-NaCl method. MBRI 9 and MBRI 12. Polyunsaturated fatty acids (PUFAs).0–9. The precipitate was collected by centrifugation at 3. MBRI 6. They were named as MBRI 6.0 to 60%. The results indicated that total saturated fatty acids. The isolates were grown and maintained on MSM.. annealing at 50°C for 10 sec and extension at 68°C for 4 min. Sequence was compared with the compilation of 16S rDNA genes available in the Gen Bank + EMBL+ DDBJ+ PDB library by BLASTN 2. v) except MBRI 9. The partial 16S rDNA sequence generated in this study was deposited in Gen Bank + EMBL+ DDBJ+ PDB under the accession number GU593323. Gas chromatography analysis of bacterial extracts. 75 The resultant FAMES were extracted twice by adding 2 volumes of hexane and then 1 volume of hexane by centrifugation at 5000 rpm for 15 mins. Samples were injected at 100°C in the split mode. MBRI 8. The PCR master mixture contained 2.5 M MgCl2). while omega-3 fatty acids were ALA and EPA (0. and the injector and detector were maintained at 225 and 250°C respectively. 1999). Peak areas were quantified using chromatography software (IRIS 32. MBRI 9 and MBRI 10 produced acid from fructose while MBRI 6. followed by 35 cycles of PCR consisting of denaturation at 94°C for 10 sec.

D.D.5 0.3 3. Vazhappilly and Chen (1998) have reported upto 34. N. (2009) have documented up to 1. N.2 0.D.D.7 19.D.7 N.1 N.7 83. However the recent isolation of mesophilic EPA-producing Shewanella species from a temperate estuary (Skerratt et al. 570 bp).0 N.D. 2005).D. N. 1.D.2 1.5 5. probably indicating that temperature sensitive enzymes were involved in biosynthesis. Hirota et al.4 25.1 N. N.9 0.4 were psychophilic and peizophilic from polar regions and deep sea. 14.D. 2005.9 11. Branched chain fatty acids (BCFAs) have repeatedly been reported to promote cold adaptations (Chattopadhyay and Jagannadham..7 N.9 0.9 8. 16. 1). N. as mentioned earlier..3 N.2 55.8 MBRI 8 7.3 10. Freese et al...1 N.4 8.7 0.1 0.9 12. et al. N.5 N. 1.7 2.8 2.7 N. – Not detected 1 MBRI 6 0.1 N.D. 8. the highest EPA producing isolate was identified using partial 16S rDNA sequencing. N. 2002).D.D.9 N. Our results are comparable to these observations besides the advantage of rapid cultivation and easy recovery. N.D.8 2.D.D.7 2.2 N. The sequence was deposited in EMBL+ Genbank under accession number GU593323. 4. .7 8. 7. mainly triglycerols. 0.2 4..1 4.76 Salunkhe D. 2004.3 1.2 MBRI 10 MBRI 12 MBRI 13 21.7 15. of Shewanella were reported to produce EPA up to 6.4 N.D.5 61.D. Different sp. Alteromonas.4 N.8 33.D.8 1. 1. 19. and Mortierella spp. However in some other bacteria no clear changes in BCFAs with varying growth temperature were observed (Nichols et al. 1. 9. genera Shewanella. Colwellia. 22. Ivanova et al. 100 N.D.7 N. 13. 25.6 2.8 2.8 N.D. N.2% EPA in various organisms at 30°C (Fig.D.1 N. 2001).D.D.8 61. 1997).5% at 28°C (Ivanova et al.2 0.5 N. 1.D.4 34.D. All so far known EPA-producing prokaryotes affiliate with only a few genera within two bacterial phyla: The Gammaproteobacteria (e. 34.3 11.D. 2008) suggested that EPA may not be restricted to psychrophiles and piezophiles. Also these studies contradict the notion that only barophilic or cold-adapted species are able to produce significant levels of PUFAs such as EPA.D.5 5 6.6 12. Moritella. N. Oleaginous fungi are also known to store large amounts of lipid. Thus our isolates appear novel owing to their ability to produce high EPA at 30°C.3 7.8 N.D. Typically up to 40% of the fungal dry weight may be triacylglycerol in which the acyl chains are up to 15% EPA or 55% AA (Singh and Ward.D. N. 42. N.D.0 0.2 N. N.6 6. Phylogeny. 11.D. are noteworthy for the n-3 and n-6 PUFA contents of their stored lipid.4 N.7 0. N. Table II Fatty acid profile of MBRI isolates Fatty acids C 4:0 C 6:0 C 8:0 C 10:0 C 11:0 C 12:0 C 13:0 C 14:0 C 15:0 C 16:0 C 17:0 C 18:0 Total Saturated Fatty acids C 16:1 C 18:1 C 22:1 C 17:1 Total Unsaturated Fatty Acids C 18:2 n6t C 18:2 n6c C 18:3 n6 C 20:5 n3 Total Polyunsaturated Fatty Acids N.7 2.D..9 8.7 0.D. Our results showing comparatively low levels (1 to 34%) of BCFAs in all the isolates except MBRI 10 support these observations.D.D.9 0.D.1 N.D.0 N. N. 2003. 4.1 29. Figure 1 shows the comparison of % EPA produced by our isolates with that of microalgae and mesophilic bacterial cultures.D.7 0.7 59.5 0.g.4 2.3 1. 18.8 1.7 15.6 2. N.4 2. Freese et al.D. 1.D.1 1. 2002) and from shallow seawater samples (Frolova et al.D.2% EPA in various microalgae at 25°C.. MBRI 12.D.D.D.5 N.D. BLAST analysis of partial 16S rDNA sequence revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequence similarity. However recovery of EPA from these sources is difficult along with poor yields.8 1.5 N. N.1 4. 34. 6.5 52. 21.D. N. N.5 2.1 MBRI 9 11.3 2.

MBRI 13.P.. D. Nedashkovskaya.. J.. D. Microbiol.I. A.F. Photobacterium sp. Practical Medical Microbiology. Ivanova E. Orikasa. D.G. Food.N.V. Rutters. and V.I. J. Origin and composition of organic matter in tidal flat sediments from the German Wadden Sea.V.E. Evol. Lysenko..M. D. Biotechnol. NB72 (Freese et al. Bhadekar. Evol. 53: 1471–1477. 2009). and PBDEs in n-3 polyunsaturated fatty acid-rich dietary fish oil & vegetable oil supplement. Nutritional relevance for human essential n-3 fatty acid requirement. nov. Biochem. and G. nov. V. Churchill Livingstone. Garcia. a psychrophilic hydrocarbonoclastic antarctic bacterium producing polyunsaturated fatty acids. .G. Mikhailov and D. Koster. 2.K. D. isolated from a sipuncula (Phascolosoma japonicum) Int. Biol.. Environ. K. Rrent. Adv.P. producing EPA at 30°C in the presence of high salt-concentration. 12.P. New York. Rullkoter and H. MBRI 6 . Gorhkova. V. 52: 1780–1788. We are thankful to Honorable Dr. Biosci. Fraser and B. Smith and K. 39: 820–829.M.E.. The occurrence of high levels of EPA in MBRI isolates (present work) with MBRI 12 being highest producer of EPA which could be commercially exploited.. 65: 1710–1720.V.G. NB73. O. 2004).P. V. Chlorella minutissima UTEX 2341.. Shewanella waksmanii (Ivanova et al. Nerkar and Ms. 2002.M. Shparteeva. Microbiol. Government of India. 1999. 24: 386–388. A. Ivanova. D.. Bartlett. Koster and J. 1998). Microbiol.E. J.. 2003. Int. N.1 High EPA producing novel Halomonas sp. Ann. 2004. A. nov. Acknowledgements This work is financially supported by the Department of Biotechnology. Microbiol. Gentile G. Nodasaka. A.. Freese E. 2001.M. Schepens.. 57: 444–454 Frolova G. J. SAMA2. V.. Zhukova.A. Eur. Collee J. Time trend investigation of PCBs. 2009. Shewanella pacifica sp. Shivajirao Kadam. Conclusions. 2003.C. Marmion. 2005.V. Sass. Pavel.M. Jacobs M. Medical Division of Longman Group UK Ltd. J.P. 10.. 1. (BVDU) for providing facilities to undertake this work. Giuliano and M.g Flexibacter and Psychroserpens). Principal. Therefore. Zhukova.I. O. Rajiv Gandhi Institute of IT and Biotechnology. L. Phaeodactylum tricornutum UTEX 642 (Vazhappilly and Chen. 2005). Gorshkova. Polar. Microbiology 148: 1903–1913. V.V.D. J. 1..V. Amico.A. 2009). Shewanella pacifica (Ivanova et al. This is probably the first report of Halomonas sp. 1987. Kothari. Jadhav G. New York. Our results suggest that a new genus of Halomonas may be added to earlier reported EPA producing prokaryotic genera belonging to Gammaproteobacteria. A. Int. and D. Nerkar and R.m. Novel Staphylococcus sp.V.P. 2. Eng. 1. J. 4. New Delhi. Sergeev. C. Syst. Chem. Jagannadham. Syst. Syst. 6. Moore. 77 Fig. R. H.M. a polyunsaturated fatty acid-producing bacterium isolated from sea water. Microbiol. Org. N. J. Okuyama and I. 1995. Jadhav for their assistance. 95: 1124–1133 Hazel J. Salunkhe.P. Wiley. Structure and regulation of the omega-3 polyunsaturated fatty acid synthase genes from the deep-sea bacterium Photobacterium profundum strain SS9. 2005. Aqu. 2005. Vibrio sp. and Photobacterium) and the Bacteroidetes (e. isolated from wall scrapings of a historical building in India. Evol. Gheorghe and P. Shewanella pneumatophori (Hirota et al. Gammaproteobacteria as a possible source of ecosapentanoic acid in anoxic intertidal sediments.Y.. Geochem.. Mikhail.K. J. Yakimov. Bharati Vidyapeeth Deemed University and Dr.H. 2008. D. and M. 8. 2010a. biologically active compounds and economical aspects. Nerkar and R. Bhadekar.S. Mikhailov.H. Kingston. and C. Nedashkovskaya. Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation? Annu.. Berge J. 2000. Comparison of % EPA produced by MBRI isolates (this work) with other mesophilic marine bacteria and microalgae. J. Development in lipid analysis: some new extraction techniques and in situ transesterification.. Struhl.. A.G.R. Monounsaturated but not polyunsaturated fatty acids are required for growth of the deep-sea bacterium Photobacterium profundum SS9 at high pressure and low temperature. N. R. Christen and V. Allen E. Chattopadhyay M.V. Microbiol. 11. 1989. EPA may be a potentially useful marker for these genera in environmental microbial communities (Freese et al. Ausubel F. 5. 9. J.G. Monodus subterraneus UTEX 151. 7. MBRI 12 .N. J. an eicosapentaenoic acid producing marine bacterium isolated from the intestines of Pacific mackerel (Pneumatophorus japonicus).P. Y. Duguid. GA-22. Maintenance of membrane fluidity I Antarctic bacteria. Physiol. 3. role as biomarkers. Shewanella pneumatophori sp. Literature Allen E. Rev. OCPs.P. Salunkhe. R. Carrapiso A. Shewanella waksmanii sp. 55: 2355–2359 Ivanova E. Appl. Microbiol. Rullkoter. Isolation and characterization of salt-tolerant nitrogenfixing microorganisms from food. 2010b. E.P. Barnathan.S. 60: 197–201. Current Protocols in Molecular Biology. 54: 1083–1087. Shewanella sp. Nicolau. Bowman. 57: 19–42 Hirota K. Lipid composition of novel Shewanella species isolated from far eastern seas. We are also thankful to Dr. Bonasera. Microbiology 74: 664–669. Appl. Seidman. R. Freese E.. Lipids 5(11): 1167–77. 2003). Bartlett. and D.G. Shewanella sp. N. Yumoto. 96: 49–125. 2004. Covaci.K.. H. J. 4: 33–40 Jadhav G. Fatty acids from lipids of marine organisms: molecular biodiversity. Agri.

S. Int.P. Nichols D. 1999.78 Salunkhe D. 5–13. Nature 432: 280–283. Clin. P. Blackburn.P. McMeeekin. Nichols and T. and B. J. Nutr. Oil Chem. S. Laakso.. Aust. Worm. 1999. Suutari M.. 1. Appl.D. 51: 332–333. and F. . 2001. Rapid worldwide depletion of predatory fish communities. Isolation and characterization of a )5-fatty acids elongase from the marine microalgae Pavlova salina. Crit. Simopoulos A.. R. Extremophiles 5(2): 73–83 Meyers R. Potential of halotolerant and halophilic microorganisms for biotechnology. 2002. Ward.P. Hart. Green. Biotechnol.. Food. M. Ross and T. Eicosapentaenoic acid and docosahexaenoic acid production potential of microalgae and their heterotrophic growth. 2003. 1997. 75(3): 393–397 Yano Y. et al. J.D. 2002. Microbiol.A.. McMeekin. Singh A. Variation of branched-chain fatty acids marks the normal physiological range for growth in Listeria monocytogenes. Russell N. Microbiol. 68: 2809–2813 Robert S. Essential fatty acids in health and chronic disease. Microbiol. Chen. Polyunsaturated fatty acids in marine bacteria – a dogma rewritten.S. J. Skerratt J.P. X. nov. Evol. Microbiol. Workshop on the essentiality of and recommended dietary intakes for omega-6 and omega-3 fatty acids. Singh and P. Nutr. A. and D. 1999.. Sargent J.H. T. 1996. Soc.. Nicholas. 2009. Presser. J. 1 Margesin R. Environ. Distribution of polyunsaturated fatty acids in bacteria present in intestines of deepsea fish and shallow-sea poikilothermic animals. 52: 2101–2106. Microbial fatty-acids and thermal adaptation. Rev. Bowman and P. J. 78: Suppl.. 1994. Enrichment of the rotifer Brachinous plicatilis fed an Antarctic bacterium containing polyunsaturated fatty acid. Appl. 11: 410–418. A. Leaf and N.A. Olley. and S. Mar. Jr Salem. P.. Nakayama and K.I. Nichols.A. 63: 2572–2577. J. Mansour. Microbiology 145: 767–779. 1997. S. Petrie.R. Schinner. K. Syst. P. Am. 20: 285–328 Vazhappilly R and F. J. Microbiol. 1998. Br.S. Environ. Appl. 70(3): 560S–569S. Yoshida. Microbial production of docosahexaenoic acid (DHA. Nichols D. Aquaculture 147: 115–125. 22:6) Adv. Simopoulos A. Fish oils and human diet. Am.D. Zhou.G.A. a marine species isolated from a temperate estuary which produces high levels of polyunsaturated fatty acids.P.S. and O.J. 45: 271–312. Nichols. 1997. Shewanella olleyana sp. A.

Institute of High Mountain Biology. MARTIN LUKÁÒ. The objective of this study was to continue research of yersiniosis in lower sub-alpine habitats in the West Carpathians. 2001). 1989). between males and females and between juveniles and adult birds. They were weighed with 0.l) and as the alpine accentor is the member of the family Prunellidae. 059 56. Low and Belianske Tatras. Many species such as Yersinia enterocolitica are psychrophilic bacteria capable of persisting and growing in cold environments (Kato et al. 79–83 SHORT COMMUNICATION Yersinia Species in the Dunnock (Prunella modularis) in Sub-alpine Habitats of the Western Carpathians JANA KISKOVÁ* .. No statistically differences were observed in the prevalence of Yersinia spp.s. phone: (+421) 51-449-91-08. Bacteria were detected from cloacal and pharyngeal swabs from 97 specimens using PCR assay. (2007) specifically discussed the ecology of Yersinia spp. Tatranská Javorina 7. Niskanen et al. Gill and Reichel. Yersinia species (except Y. and Choè (from 1 000 to 1 750 m a. Adult birds were sexed by the presence of a cloacal protuberance in males (Nakamura. Novotný et al. Italy). Two types of samples were collected from each bird – pharyngeal and cloacal swabs. Slovakia Received 29 August 2010. 1989. Copan Italia. e-mail: jakiskova@gmail. Y. Yersinia enterocolitica showed the highest prevalence (47. due to their great mobility.. Yersinia enterocolitica. 1985. therefore it was chosen as experimental host species for this microbiological study. accepted 15 December 2010 Abstract The study presents the prevalence of Yersinia species in dunnok Prunella modularis from the sub-alpine zone of the Western Carpathians. Brescia. – 80%. The highest prevalence of yersiniosis was detected in April (Yersinia spp. University of Žilina.. Janiga et al. The wild-living birds. Bacterial contamination did not affect body weight or tarsus length. Babia hora. Vol. 1989). There are only a few studies on bacteria living in wild birds in the extreme environments of the subalpine and alpine vegetation levels. Dunnock Prunella modularis The genus Yersinia is a highly heterogeneous group of the family Enterobacteriaceae comprising acknowledged pathogens and a variety of strains that are widely distributed in nature in both aquatic and terrestrial ecosystems (Cover and Aber. may play a significant role as effective spreaders of Yersinia through faecal contamination of pastures and surface waters (Kaneuchi et al.l).4%) from among the determined Yersinia species. 1990). ZUZANA HREHOVÁ. revised 5 December 2010.s. Kisková. (2007) identified the composition of microflora in the digestive tract of the alpine accentor (Prunella collaris) as a typical species of alpine environments. Captured birds were identified as adults or juveniles (age ≤ 2 months). frederiksenii) were detected more frequently in pharyngeal than cloacal samples. 2003). 60. The dunnock (Prunella modularis) is a dominate bird species of the dwarf-pine ecosystem (950–1 700 m a. enterocolitica – 70%). From April 2007 to July 2009. MARIÁN JANIGA.2 g accuracy using a Pesola spring scale and standard morphometric measurements were taken. No 1.Polish Journal of Microbiology 2011. Tatranská Javorina. MARTINA HAAS and MARTINA JURÈOVIÈOVÁ Institute of High Mountain Biology.com . in relation to alpine accentors considering that the genus Yersinia may play an important role in the ecology of this bird species. Slovakia. High. Enriched * Corresponding author: J. 97 free-living dunnocks were captured with mist nets in the local mountains of the Slovakian part of the Western Carpathians – The West. Isolated bacterial cultures from cloacal and pharyngeal swabs were enriched in Tryptone-soya broth at 26–28°C for 48 hours (Nikolova et al.. K e y w o r d s: Yersinia spp. Great and Small Fatra. Samples were taken using sterile transport swabs suitable for both aerobes and anaerobes (DispoLab.

6) Cloaca N (%) 27 (27. therefore it is considered in this study as separate species. enterocolitica showed the highest total incidence (34. The differences were not statistically significant. sex. bercovieri Y.1) 2 (2. aleksici Y. strains (Wannet et al.. Table III shows the potential relation between the occurrence of Yersinia spp. A P2 statistics (STATISTICA 8. The highest prevalence of Yersinia species was detected in April (80%). 2001).9) 20 (20. enterocolitica reached a statistically significant value compared to other months (P ≤ 0.9% of pharyngeal and 27. enterocolitica and morphological features of the adult birds.1) 2 (2.1) 0 (0) 6 (6. 2001). fredericksenii) were detected more frequently in pharyngeal than cloacal swabs.2) 1 (1) 0 (0) 0 (0) 1 (1.4% individuals were Yersinia positive (28. 1979) and cultivated at 26–28°C for 48 hours (Neubauer et al. The authors designed primers Y1 and Y2 for amplification of the specific region of the 16S rRNA gene of the genus Yersinia.8% of cloacal samples). Comparison of the total prevalence of Yersinia spp. Y.1) 2 (2.3) 2 (2. Y. a total of 47. Even. (2000). pseudotuberculosis was also independently examined in all samples. The AmpliSens Yersinia pseudotuberculosis kit (Russia) was used for the identification. resp.1) 2 (2. enterocolitica. Bacterial DNA was extracted and then Yersinia species were identified among isolated bacterial cultures using the PCR method developed by Neubauer et al. (Schiemann..4) 33 (34.3) 2 (2. Seven Yersinia species were detected by comparison of PCR-product’s to the nucleotide sequences in BLAST (GenBank. 2000. in which the prevalence of bacteria decreased significantly (Table II).1) 2 (2. et al.80 Kisková J. Masaryk University. From 97 examined birds. Measurements of body weight and tarsus length were Table I Species and prevalence of pharyngeal and cloacal bacteria in Dunnocks in the Western Carpathians.0) Pharynx N (%) 28 (28. the contamination of Y.5%) samples. serovar 0:3. Brno. molareti Y. biovar 4 was obtained from the Czech collection of microorganisms. enterocolitica Y.1) 2 (2. found exclusively in pathogenic Yersinia spp. Y.1) n – number of examined birds N – number of Yersinia positive samples with relative value in the brackets . Slovakia Strain according GenBank Prevalence (n = 97) Total N (%) 46 (47. The higher prevalence of Y.6%) than in pharyngeal (16. Also other Yersinia species (except Y. enterocolitica tended to be in cloacal (20.. was observed. between males and females did not show significant differences but in females was nearly 10% higher than in males. Table II). A seasonal variation in the distribution of Yersinia spp. Primers A1 and A2 were used to amplify a 430 bp fragment of the ail gene. frederiksenii 8081 FE 80735 KM 1 PO/Y/1-3 ARCTIC-P11 ATCC 33638 N1SF35 Y 160 H279-36/86 H9-36/83 253 991 Y 388 H632-36/85 WS 52/02 10 (10. The PCR products were independently sequenced in both directions on the Genome Lab GeXP Single genetic analyzer (Beckman Coulter Inc.05.8) 16 (16.) The obtained sequences were subjected to BLAST searches in sequence database GenBank for species identification.0%) of the genus Yersinia. intermedia Y. age and season) which may influence the occurrence of bacteria.0) 2 (2. enterocolitica subsp. 1 cultures were plated on CIN agar presented as highly selective medium for Yersinia spp.05). a reference strain (CCM 5671) of Y.1) 2 (2. Table I).5) Bacteria species Yersinia spp. For the identification of Yersinia spp. Morphometric data were compared by one-way ANOVA.1) 10 (10. kristensenii Y.. Y.0) was used to test the hypothesis of independence of frequencies of selected factors (prevalence. A much lower frequency of infection in juveniles than in adult individuals was found but the difference didn’t reach the statistical significance value (P ≥ 0. Hussein et al.

3) 50 (62. a lower occurrence of yersiniosis was found in subalpine habitats compared to the alpine zone in previous study (Novotný et al. Body weight (g) Tarsus length (mm) Yersinia Number of adult individuals +/– + – + – + – + – 25 46 29 48 34 37 39 38 Mean ± SE 19.8 ± 0.7 19. it was possible to determinate more Yersinia species by using only one PCR array (Neubauer et al.8 ± 0. both sexes were pooled together and tested against Yersinia as one group. enterocolitica Yersinia spp.6) 16 (45.6) P 81 0.. This might be the reason for its successful .03 Yersinia spp.9 ± 0.1 ± 0.2 24.5) 14 (82. Y. Y. enterocolitica to grow at –2°C.8) 3 (30) 19 (59.6 24.9) 10 (40) 13 (43.3) 39 (48. Y. The authors showed that in alpine accentors there is an unusually high prevalence of yersiniosis in comparison to many other bird species.1 ± 0. In this study.2 24.7) 2 (20) 17 (53. NS Y. 2000).6 24. enterocolitica Yersinia spp.2 P NS NS NS NS NS – not significant.9 ± 0.6) 6 (24) 7 (23.5) 3 (17. the host sex and age Variable (n) Y. enterocolitica April (10) May (32) June (25) July (30) April (10) May (32) June (25) July (30) Females (45) Males (35) Females (45) Males (35) Adults (80) Juveniles (17) Adults (80) Juveniles (17) Yersinia positive Yersinia negative N (%) N (%) 7 (70) 13 (40. enterocolitica Morphological variables Body weight (g) Tarsus length (mm) Yersinia spp.1) 15 (60) 17 (56. Therefore. 2007).4) 19 (54.7 ± 0. Gill and Reichel (1989) referred to the ability of Y.3) 17 (37.8 19.6 ± 0. The authors attribute this to high adaptability of Yersinia species to cold environment. the target sequences of both primers Y1 and Y2 using in this study are presented in more members of the genus Yersinia. However.05 (Chi-square test) Table III Morphological characters of adult dunnocks examined for yersiniosis Bacteria Y.2) 22 (62. resp. When the dunnock sex and infestation by yersiniosis were considered as independent variables. pseudotuberculosis was not detected in any of pharyngeal and cloacal swabs. The presence of the ail gene associated with the pathogenic strains of Yersinia was not confirmed in any of the examined samples. PCR method is widely used to identify specimens and studying the relationship of bacteria.4) 5 (29. For example. no statistically significant difference was found in prevalence of Yersinia between males and females (Table II).1 19.8) 13 (37.4) 12 (70.7) 30 (37.9) 20 (44.1) 25 (55.3) 8 (80) 15 (46..7) 28 (62.1 Short communication Table II The prevalence of bacterial genera (species) in dunnocks according to the season years.7) 41 (51.4) 19 (76) 23 (76. enterocolitica infection and tarsus length or body weight of hosts.05 (one – way ANOVA test) considered. Recently.. No significant relationships were found between the Yersinia spp. NS NS NS NS n – number of examined birds N – number of Yersinia positive (+) or negative (–) samples with relative value in the brackets NS – not significant P > 0. P > 0.

. Ogawa. 1989. The high occurrence of Y. In July. It seems bird diet may also influence the occurrence of bacterial infection. Occurrence of Yersinia spp.. but is most likely a consequence of the increased risk of contamination during mating.C.. The low infection of juveniles during whole research period indicates that infection of juveniles by Yersinia occurs later. In this study we have confirmed that Y. 1999. when the occurrence of insects increases in the mountains. the risks of bacterial transmission during copulations in birds are expected to be high. In the next months (outside the mating period) the prevalence of bacterial infection declines gradually.P. Similar findings were reported in other species of birds (Niskanen et al. 144: 317–322. We didn’t found relationship between morphological parameters (tarsus length and body weight) and Yersinia infestation. 1985. The inoculation of nestlings by microbes may occur from the environment via ingestion of adult saliva. .. we detected about 20% fewer contamination of Yersinia in juveniles than in adult birds. Ecol. 33: 628–648 Faustino C. in migratory birds. and P. Y. On the evolution of sexually transmitted diseases in birds.. Sedlárová. 51: 805–808. Connolly. Kariu. Rigg and M. Davis. 1989.. Microbiol. The highest prevalence of all Yersinia species in the dunnock was detected in April. 1999. 49: 198–200. we confirmed that the prevalence of bacterial infections in dunnocks shows seasonal dynamics. Cover T. frederiksenii or Y.G. R. K. 33: 445–449. Ornithol. Also other species of Yersinia (no pathogenic environmental species e. 2004). Anim. The birds are exhausted after breeding and subsequent moulting may also have a significant impact on the physiological status of the individuals. Lombardo M. J. New Engl. Anim.A. Microbial colonization of the cloacae of nestling tree swallows.B. Behav. Mycoplasma gallisepticum infection dynamics in a house finch population: seasonal variation in survival. Kawasaki. Y. 1989. kristenseni ect.C. Aeromonas hydrophila and Listeria monocytogenes on high-pH beef packaged under vacuum or carbon dioxide. seagulls and swallows in Japan. Heeb. the risk of infection is higher. Cooperation and conflict among dunnocks. Environmental factors shape cloacal bacterial communities in great and blue tit nestlings. Swarthout. (1985) reported significantly higher incidence of Y. and M. M. J. Avian copulation involves cloacal contact. Dhondt and E. Lucas and Heeb. R. Aber. K.82 Kisková J. Janiga M. Dunnocks have a variable mating system from monogamy through polyandry to polygynandry (Davies. 1985) and copulation with multiple partners further increases the risk of avian infection. Kato Y.S. I. This phenomenon is probably associated with reduced body condition of birds. 2001. Kaneuchi Ch. intermedia. from food provided by the parents or from nest materials (Mills et al.K. Lucas F. M.O. We observed that the sex of birds did not influence the distribution of Yersinia spp. Microbiol. Prevalence of avian bacterial infections is known to have seasonal dynamics where social and other behaviours have been hypothesized to be a factor shaping these dynamics (Faustino et al. Berger et al.S.. In our study. 2007. which has been documented to host rich bacterial communities (Lombardo. Env..A. J.G. In this month. Lumsden. the bacterial infection may be slightly increased again. Our findings support the idea that the Yersinia species are surely a common member of bacterial microflora in dunnocks.K. Maruyama. Appl. Cooch. the dunnock breeding season begins and birds begin to mate. Appl. ducks. Food Microbiol. Mills et al. Med. T. Ornithol. therefore we assume that bacteria do not affect health and body condition of individuals. Prunella modularis.R. Fenwick and J. 1998. Jpn. Novotný et al.. Avian Biol. Vet. Janiga et al. V. Auk 116: 947–956. T. (1999) detected cloacal microorganisms in nestlings of the tree swallow (Tachycineta bicolour) two days after hatching. 2003. in the dunnock and that bacterial occurrence in birds increases with nestling age and stabilizes in adults.. Bacteria in starling nests. J. J. S.P. Avian Biol. 73: 651–669. Literature Berger S. Kubokura. 1998. Patterns of prevalence among bacterial communities of Alpine Accentors (Prunella collaris) in the Tatra Mountains. Thorpe. 148: 135–143. 2007). In early spring. 2003). Ito. Growth of the cold-tolerant pathogens Yersinia enterocolitica. For example. 29: 314–321. and R.S. et al. As our results show that distribution of yersiniosis in dunnock is seasonally dependent. in variable mating system.. Gwinner. C. A rapid and sensitive method for the detection of Yersinia enterocolitica strains from clinical samples. The dunnock is an insectivorous species and in April. Disko and H. Shibata. Yersinia enterocolitica. Res. Jennelle. the high occurrence of Yersinia contamination may be associated with changes in diet. Colonisation of nestlings by environmental microbes begins soon after hatching. A. E. Lombardo and P. J. Kanzaki and T. enterocolitica is the most common yersinia in dunnocks in comparison with other Yersinia species. Maruyama. We therefore suggest that young birds are infected by bacteria mainly during the breeding season in the following year. encounter and transmission rate. Hussein H. To conclude. Novotná. 2003. 1 expansion in high mountain environments and for its higher prevalence in alpine accentors than in dunnocks. Mills T. So.L. enterocolitica in cold months was confirmed in many studies. Kaneko and M.. Gill C.. 2005). 36: 510–516. Reichel.g. enterocolitica in birds in the spring than in the summer or autumn months. Lett. 1985. Y. Davies N. A. 2007). T. Kato et al.) were frequently found in other species of birds (Niskanen et al. M. Occurrence of Yersinia enterocolitica in wild-living birds and Japanese Serows.M. J. 6: 223–230.P.. 321: 16–24. 2004. A. 2003. 2005. when the juveniles have left the nests.

Najdenski and A.A. Microbiol.A. Microbiol. S. 23: 1–5 Nikolova S. Wannet W.B. 39: 4483–4486. Acta Ornithol. 69: 4670–4675. Tzvetkov. J. Env. Identification of Yersinia enterocolitica within the genus Yersinia. Vesselinova. Sys. Kovalèíková. A.M. Isolation of pathogenic Yersiniae from wild animals in Bulgaria. 42: 137–143 Schiemann D. J. Korkeala.E. Feèková. Fredriksson. Neubauer H.M. High incidence of Yersinia enterocolitica (Enterobacteriaceae) in Alpine Accentors Prunella collaris of the Tatra Mountains. Auk 107: 284–295.1 Short communication 83 Nakamura M. Cloacal protuberance and copulation behavior of the Alpine Accentor (Prunella collaris). Novotný M. A. J. Lukáò. M. 2000. Vet. Brunings and H. Waldenström. Appl. 2001. . B. 2007. virF-Positive Yersinia pseudotuberculosis and Yersinia enterocolitica found in migratory birds in Sweden. Reessink. Clin. Novotná and Z.. Hensel. Detection of pathogenic Yersinia enterocolitica by rapid and sensitive duplex PCR Assay. 1979. M... 25:1298.. Niskanen T. Aleksic and H. 2001. M. Y. Janiga. Microbiol. J. Synthesis of a selective agar medium for Yersinia enterocolitica. Med.J. Microbiol.. 48: 203–209. M. M. Olsen and H. H. H. Meyer. 2003. Maas. Appl. 1990.

1 .84 Kisková J. et al.

) bulbs in the field and storage houses in different places in Poland. Pectobacterium carotovorum subsp. into a Petri dish (180 mm in diameter). 2007). For each isolate three Petri dishes were included. Pseudomonas viridiflava (Gitaitis et al. The outer scale of each piece was wounded with the microbiological needle and inoculated by 20-µl aliquot of bacterial suspension of density 1. onion Onion (Allium cepa L. It is common knowledge that in Poland. 2008). Schwartz and Mohan. 85–87 SHORT COMMUNICATION First Report of Serratia plymuthica Causing Onion Bulb Rot in Poland BEATA KOWALSKA*. In the last years especially bacterial diseases of onion cause very serious problems in Poland. The liberalization of policies concerning border protection and intense trade favor transmission of pathogens from foreign countries. For the purpose of identification of agents causing disease... URSZULA SMOLIÑSKA and MICHA£ OSKIERA Institute of Horticulture. they enlarged and extended to external scales with an associated sour smell. was noted as an onion pathogen in Brasil (Beriam. Their pathogenicity was confirmed by using pathogenicity test on onion scales. 2002). Pseudomonas syringae. Also bacterium Serratia spp. These isolates were studied by using biochemical and molecular methods.Polish Journal of Microbiology 2011. 96-100 Skierniewice. El-Hendawy. Burkholderia cepacia. 2008).0–2. Nine of forty isolates expressed rot symptoms on the scales. The pathogenicity test was conducted on healthy onion bulbs cv. Since the onion harvesting period often coincides with rainy weather and during cultivation it may hail. Skierniewice. These symptoms were typical for bacterial disease – water soaked and pale brown lesions appeared on the internal scales. bacterial diseases of onion are caused by Burkholderia gladioli. 2002. accepted 20 December 2010 Abstract Specific bacterial disease symptoms were observed on onion bulbs in almost all regions in Poland.5% NaOCl for 5 min. revised 18 December 2010. 2006 and 2007. complex bacterial and fungal diseases often occur. Three onion pieces were placed. cut side down. Poland Received 6 January 2010. The bulbs were washed in sterile water and cut lengthwise into two parts. 2009. No 1. Biochemical identification of the isolates were performed by using the API 20E system (bioMerieux) which gave a bacterial code of 1207763 (Table I) * Corresponding author: B. During the summer and autumn of 2003. Institute of Horticulture. Poland.) is one of the major vegetable crops grown in Poland. Control treatment remained uninoculated. Grabowska. Enterobacter cloacae (Schroeder et al. Konstytucji 3 Maja 1/3. disease symptoms of unknown origin were observed on onion (Allium cepa L. The Petri dishes were incubated 4 days at 28°C. Pantoea ananatis (Gitaitis et al. Foreign reports conclude that bacteriosis of onion can also be caused by Pseudomonas marginalis (Kim et al. carotovorum (Sobiczewski and Schollenberger. Kowalska. K e y w o r d s: Serratia plymuthica. About forty isolates were obtained and these isolates were examined for the ability to macerate onion tissue.. Bacteria from the infected bulb tissues were isolated and purified on nutrient agar. Vol. bacterial disease.5× 108 cfu/ml. 60. storage or transportation. 1998).. washed with running water and sterilized in 70% ethanol for 30 sec and in 0. These bacteria were identified biochemically and molecularly as Serratia plymuthica. 2002).. The bulbs were peeled. These diseases may cause significant economic losses because they are difficult to control. e-mail: beatakow@iwarz. Burkholderia ambifaria and Burkholderia pyrrocinia (Jacobs et al. 2004). Bacterial soft of onion bulbs is the most frequent and it can appear during cultivation. bacteria were isolated from the symptomatic plants.pl .

86

Kowalska B. et al.
Table I Biochemical profile of tested isolates conducted using identification system API 20E
ONPG MAN AMY ADH ODC RHA ARA MEL TDA GLU URE LDC SOR SAC GEL IND INO CIT H2S OX

1

+

–

–

–

+

–

–

–

–

VP

+ +

+

+

+

+

–

+

+

+

+

–

test ONPG ADH LDC ODC CIT H2S URE TDA IND VP GEL GLU MAN INO SOR RHA SAC MEL AMY ARA OX

reactions / enzymes $-galactosidase arginine dihydrolase lysine decarboxylase ornithine decarboxylase citrate utilization H2S production urease tryptophane deaminase indole production acetoin production gelatinase fermentation / oxidation (glucose) fermentation / oxidation (mannitol) fermentation / oxidation (inositol) fermentation / oxidation (sorbitol) fermentation / oxidation (rhamnose) fermentation / oxidation (saccharose) fermentation / oxidation (melibiose) fermentation / oxidation (amygdalin) fermentation / oxidation (arabinose) cytochrome oxidase

(% identity = 59.6; T = 1.0). The numerical profile showed a correct identification of all examined strains as Serratia plymuthica. Additionally, some biochemiAJ233433.1

cal tests were conducted. The microorganisms were Gram-negative, catalase positive, oxidase negative and grew in anaerobic condition.

CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGG--CAGTG ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 420

HM596429.1 361 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTTCAGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| AY394724.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTAGTGTG

AJ233433.1

TTAATAGCACAT-TGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG |||||||||| | | | ||||||||||||||||||||||||||||||||||||||||||| 479

HM596429.1 421 TTAATAGCAC-TGTRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| AY394724.1 TTAATAGCACAT-TRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG

AJ233433.1

AGAA-TT-CGCTAGAGATAGCTTAGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC |||| || | | |||||| | || |||||||||||||||||||||||||||||||||||| 1017

HM596429.1 960 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AY394724.1 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC

Fig. 1. Homology sequence alignment of the 16S rRNA region of type strain S. plymuthica DSM 4540 acc. no. AJ233433.1, tested isolate 466 acc. no HM596429.1, strain of the nearest BLAST match S. plymuthica RVH1 acc. no AY394724.1. Sequences were retrieved from the GenBank (National Center for Biotechnology Information) database under the accession numbers indicated.

1

Short communication
Table II BLAST search results for 16S rRNA gene sequence of representative isolate 466
S. plymuthica isolate DSM 4540 – type strain 466 – tested isolate RVH1 Accession no AJ233433.1 HM596429.1 AY394724.1 Country Germany Poland Belgium Identity 98.9% 100% 99.7% Match 1449/1465 1460/1460 1456/1461

87

The identity of the isolates was confirmed by molecular techniques – 16S rRNA sequence analysis. DNA was isolated by “Genomic mini” kit according to producent’s clues (A & A Biotechnology). The 16S rDNAs were amplified by using universal primers fD1 (5’AGAGTTTGATCMTGGCTC3’) and rP2 (5’ACGGCTACCTTGTTACGACTT3’) (Weisburg et al., 1991). Additional sequensing primers were used: 800f (5’ATTAGATACCCTGGTAG3’) and 800r (5’CTACCAGGGTATCTAAT3’) (Fouad et al., 2002). The amplified PCR products, lenght 1500 bp, were separated by 1.5% agarose gel electrophoresis, then extracted and purified from gel with the DNA Fragment Purification Kit (A & A Biotechnology). DNA sequences were compared to NCBI database (www. ncbi.nlm.nih.gov) using BLAST program (Basic Local Alignment Search Tool), demonstrated that 16S rRNA gene of the studied isolates of bacteria shared high identities (99.7%) with Serratia plymuthica RVH1, NCBI GenBank database accession no. AY394724.1 (Fig. 1, Table II). The 16S rRNA sequence of the one representative isolate (466) has been deposited in the GenBank database under the accession number HM596429.1. The biochemical test data along with sequence analysis of a portion of the 16S rRNA gene confirmed all the isolates to be Serratia plymuthica. According to our knowledge, this is the first report of S. plymuthica causing a bulb rot of onion in Poland.
Acknowledgments This work was supported by grant NN 310299734

Literature
Beriam L.O. S. 2007. Palestra doencas bacterianas em hortalicas. Biologico 69: 81–84. El-Hendawy H.H. 2004. Association of pectolytic fluorescent pseudomonads with postharvest rots of onion. Phytopathol. Mediterr. 43: 369–376. Fouad A.F., J. Barry, M. Caimano, M. Clawson, Q. Zhu, Carver R., K. Hazlett and J.D. Radolf. 2002. PCR-based identification of bacteria associated with endodontic infections. J. Clin. Microbiol. 40: 3223–3231. Gitaitis R., G. MacDonald, R. Torrance, R. Hartley, D.R. Sumner, J.D. Gay and W.C. Jahnson. 1998. Bacterial streak and bulb rot of sweet onion: II. Epiphytic survival of Pseudomonas viridiflava in association with multiple weed hosts. Plant Dis. 82: 935–938. Gitaitis R., R. Walcott, S. Culpepper, H. Sanders, L. Zolobowska and D. Langston. 2002. Recovery of Pantoea ananatis, casual agent of center rot of onion, from weeds and crops in Georgia, USA. Crop Protect. 21: 983–989. Jacobs J.L., A.C. Fasi, A. Ramette., J.J. Smith, R. Hammerschmidt and G.W. Sundin. 2008. Identification and onion pathogenicity of Burkholderia cepacia complex isolates from the onion rhizosphere and onion field soil. Appl. Environ. Microbiol. 74: 3121–3129. Kim Y.K., S.D. Lee, C.S. Choi, S.B. Lee and S.Y. Lee. 2002. Soft rot of onion bulbs caused by Pseudomonas marginalis under low temperature storage. Plant Pathol. J. 18: 199–203. Schroeder B.K., L.J. du Toit and H.F. Schwartz. 2009. First report of Enterobacter cloacae causing onion bulb rot in the Columbia Basin of Washington State. Plant Dis. 93: 323. Sobiczewski P. and M. Schollenberger. 2002. Bacterial deseases of horticulture plants (in Polish). pp. 64–67; 54–57. Pañstwowe Wydawnictwo Rolnicze i Leœne. Warszawa. Schwartz H.F. and S.K. Mohan. 2008. Compendium of onion and garlic diseases and pests. APS PRESS, St. Paul, Minnesota, USA. Weisburg W.G., S.M. Barns, D.A. Pelletier and D.J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173: 697–703.

88

Kowalska B. et al.

1

read and approved the manuscript. There is no page charge for publication in PJM. .microbiology. They are usually invited.200 dpi for line art.Polish Journal of Microbiology 2011. Topics that are considered include microbiology in the area of basic biological properties of bacteria and archaea. 600 dpi for combination art (lettering and images) and 1. effective Vol. When a manuscript is returned to the authors for modification. syntax and spelling must be carefully checked before submission of the paper. otherwise it may be considered withdrawn. Receipt of each manuscript will be confirmed by e-mail to the corresponding author within five business days. but the editors may also act as reviewers. The manuscript should be accompanied by a cover letter stating the postal address. The Review Process All manuscripts are subjected to pre-screening by the Editor in Chief and can be rejected at this stage or returned for corrections before evaluation (if they do not meet the criteria given in the Instruction to Authors.pl. it should be returned to the editorial office within 3 months. After receiving the Letter of Acceptance. gov. All authors of manuscripts areresponsible for their content and it is assumed that they all have contributed substantially to the presented research. Junior scientists submitting his/her paper must have the submitted manuscript accepted by the head of the scientific unit where the research was carried out. the names (together with contact details) up to 5 potential referees which may be used at the discretion of the editor. 60 Instruction to Authors (modified. microbial ecology. public health as well as food microbiology. After passing the pre-screening stage the manuscripts are processed by one of the editors and sent to at least one qualified outside referee. 2011) Scope Polish Journal of Microbiology publishes descriptions of all aspects of basic and applied research that focuses on topics of basic research and practical value in microbiology. refer to the Cadmus digital art website. and simple eukaryotic microorganisms. Minireviews in areas of particular interests and importance in microbiology are also published. Beside the main title of the paper include in the cover letter the proposed “running title” of the manuscript (about 50 characters in length. Vol. The manuscript should be written in English. phone and fax numbers and e-mail of the corresponding author who is responsible for the all correspondence regarding the submitted paper. Halftone images (those with various densities or shades) must be prepared in tiff. but authors wishing to submit a mini-review should contact the Editor in Chief directly for further information How to Submit Manuscripts Submit via e-mail the electronic version (text and tables as a Word 7 attachment. Manuscripts may be rejected on the basis of poor English or lack of conformity to accepted standards of style before the review process. not bitmap or jpg. viruses. Correspondence is by e-mail. except to color illustrations. including spaces). industrial microbiology and bacterial biotechnology. Authors who are unsure of proper English usage should have their manuscript checked by someone proficient in both the English language and biological terminology. For instructions on creating acceptable tiff files. It will be given a PJM number which the corresponding author is asked to refer to in correspondence with the editors. J. with figures in jpg/pdf format saved individually) to the address: pjm@pzh. genetics and molecular biology. Authors may suggest. Microbiol must present reports of original research that have not been previously published and is not being considered for publication elsewhere. A manuscript of the original paper (full length paper and short communication) submitted to Pol. medical bacteriology.pl/pjm and printed in the first issue of the volume) in order to be familiar with the general form of papers published. Grammar. 60. including language quality or are out of scope of PJM). Before writing a manuscript authors are advised to consult a current issue of Polish Journal of Microbiology and carefully read the Instructions to Authors (available at www. please submit illustration at their intended publication size in tiff format (with LZW compression) at the correct resolution: 300 dpi for grayscale and color. in the cover letter. Illustrations may be supplied as PDF/jpg files for reviewing purposes only on initial submission.

some exceptions to SI units are allowed. Escherichia coli. soil.) as they will be used for indexing purposes. Because the abstract will be published separately by abstracting services. and be followed by the latter in alphabetical order. protein determination) a simple reference is sufficient. journal title abbreviations (J. follow the guidelines of the International Nomenclature Committee (up to date names available as validation list of International of the Systematic and Evolutionary Microbiology). Units of measurement should be used in SI system. Acknowledgments. figures and figure legends. Below the title of the manuscript include: full name (including first name and middle initial) of each author. Bacteriol. Abstract Limit the abstract to 250 words or fewer. Key words This section should contain description of materials (biological and others) used and sufficient technical information so that the experiments can be repeated. However. Title The introduction should provide background information to allow the reader to understand and evaluate the results of the present study and describe the purpose of the undertaken research. only use the first letter of the genus name followed by the species epithet (e. coli). For centrifugation conditions preferably give the centrifuge forces in “g” (10 000×g) rather than rpm. medium. e. etc. etc. Type every portion of the manuscript double-spaced using 12 points Times New Roman. et al. it must be complete and understandable without reference to the text. reserve extensive interpretation of the results for the “Discussion” section. Results Up to five key words or short phrases should be given and placed below the abstract. Introduction The manuscript of the full length original paper in general should not exceed 20 typed pages (up to 1800 letters per page) including tables and figures. Experimental Materials and Method The title should describe the contents of the paper in a concise but attractive for readers way. Discussion. It should be written in an impersonal form. If names of microorganisms are used. Preparation of Manuscripts Regular paper words. For commonly used materials and methods (e. commonly used media. including abstract. subsequently. 20 mg/ml not 20 mg/ml). protein products of the loci are not italicized (RepA). or each co-author’s affiliation if different. Number all pages in sequence.g. No part of the manuscript should be underlined and written using CAPITAL letters)..g. tables. broad “academic lectures” on the subject and extensive literature reviews should be avoided. Results. Do not use bolded fonts except for subtitles or italics except for microorganism names (Escherichia coli). Introduction. For names of microorganisms.g. While justified . The papers are generally printed in no more than three months after returning the corrected version and obtaining its final acceptance. Experimental: Materials and Methods. they should precede the key In the “Results” section. bacteriophages. name of the institution(s) at which the work was performed. telephone/fax number and e-mail address should be given only for the corresponding author and placed in the footnote at the bottom of the first page. Genetic loci are italicized (repA). All key words should be relevantly connected with the subject matter (avoid common terms like: bacteria. Abbreviations. plasmids. for liter use “l” not “L” (1 l not 1 L. Novel or modified procedures should be described in detail.. temperature etc. include only the results of the experiments. The full length paper should be divided into the following sections written in sequence: Title. mutants.90 Instruction to Authors 1 While the paper is accepted for publication the transfer of copyright to the Publisher becomes effective. The source of materials (media or chemicals) should be indicated if critical for the validity of experimental results. genetic loci (repA) or Latin words like: in vivo. Literature. diagrams and references are not allowed. include strain tables identifying the sources and properties of the strains. When a large number of microbial strains or mutants were used in a study.) and book titles (not titles of the chapters). but for practical reasons. Always include the space between the number and the unit (2 mM not 2 mM). then E. Street address. Species names are written in full the first time the name appears in text. Abstract.

ESR spectra etc. papers with two authors are listed alphabetically according to the last name of the first author and by the last name of the second author. 2002.. Avoid the use of graphs to present data that might be more concisely presented in the text. Plasmid Biology. In some papers the Results and Discussion can be combined into one section as mentioned above. printed conference proceedings etc. 2004. Philips (eds). Nowak.g. brackets. Snyder L. Champness. ASM Press. In: Funnel B.g. and the year of publication. paper with three or more authors appear as those with two authors and are listed chronologically. etc. Parker. In the text references should be cited by the names of the authors and the year of publication. New nucleotide sequences must be accompanied by the accession number obtained from proper databases and should be included in the text. 2000. Cousineau and A. Lambowitz. D. 2002a. E. Maniatis.Discussion” sections may be combined (e.and others. the first author’s name should be followed with et al. IR. M. B...Results” section or reiteration of the introduction. Papers with one only author are listed in chronological order (the earliest first).. Number figures (Arabic numerals) and tables (Roman numerals) in the order in which they are cited in the text. followed by . 761–783.) in the order they are cited in the text. Molecular Cloning. 1. Discussion named) are given in two separate paragraphs below the main text. are not acceptable for reproduction. When a paper has more than two authors. e. .. Examples of literature citations Books and book chapters: The “Discussion” should provide an interpretation of the obtained results in relation to previously published work and to the experimental system at hand and should not contain extensive repetition of the . and be sure to cite all figures and tables.C. Nowak et al. Literature It is the responsibility of authors to verify each reference against the original article as well as make sure that each paper cited in the text is included in the list.. Washington. and W. avoid exhaustive citations of “historical” papers except if absolutely necessary. after the year (Nowak et al. 2nd ed. a Laboratory Manual.F. and G. Explanatory footnotes are acceptable. When the paper has more than ten authors state the names of the first ten. b etc.M. Belfort M.M. Nowak and Kowalski (1999) stated that. capital letters etc. 2nd ed. While references occur that are not identified by the authors’ names and year.Results” and . Color illustration can be made only at the author’s expenses (further details are available at the Editorial Office). Please follow the punctuations. Each table must be typed on separate pages and numbered with Roman numerals (Table I. 2005).) should be submitted ready for reproduction..) and marked with the name of the first author. Fig.J. Tables. Fritsch and T.C.. Photographs need to be in good quality with proper resolution used (minimal resolution are 300 for halftones and 600 dpi for combination of photos with lettering).. D. 2004. Mobile introns: pathways and proteins. The headings should be sufficiently clear so that the data will be understandable without reference to the text. no “decorative” frames should be made. Keep the number of citations reasonable. Present the results as concisely as possible and illustrate them with tables or figures if applicable (presentation of the same results in both tables and figures is not acceptable). etc.. see examples given below. Put and not & before the last author’s name.. .1 Instruction to Authors 91 by the nature of the paper the . pp. Cold Spring Harbor. Figures should be understandable without referring to the text. 2003. Original recorder tracing (outprints) of NMR.E. ASM Press. exactly as shown. use a.J. Derbyshire. Molecular Genetics of Bacteria. Figures (graphs.E.C. The list of the papers cited (Literature) must be arranged alphabetically according to the last name of the first author and not numbered. Figures should be numbered as in the text (Arabic numerals.. Washington. 2002b).g. For citations of books. Acknowledgements Acknowledgements for financial support and for a personal assistance (with the permission of person Sambrook J. and G. V. Figure titles and legends must be listed on a separate page. Washington. The preferred graphic application is Photoshop or CorelDraw saved in tiff format (with LZW compression). e. diagrams etc. Limit illustrative materials to those that are absolutely necessary to demonstrate the original experimental findings. books chapters.. Plasmid Biology. D. ASM Press. Funnel B. as previously described (Nowak and Kowalski. they should be redrawn. Use the proper journal titles abbreviations (ISO) as indicated in the PubMed Journal Database. thesis. Phillips (eds). 1989. “Results and Discussion”). NY: Cold Spring Harbor Laboratory. each on a separate sheet (or as a separate document on a floppy disc or CD). Prepare your tables as simple as possible in Word not in Excel..

D. Dry den. 31: 1805–1812. Drewniak. Baj and D. M. Papers in press or personal communication and unpublished results should not be included in the Literature citation list. Blumenthal. Identification and distribution of insertion sequences of Paracoccus solventivorans. M. Plasmid Biology 2006. No part of the published material can be reproduced without obtaining written permission from the publisher. Post. . L. Ms Beata Mazinska).pl. More than 10 authors Roberts R. Thesis. 53: 139–144. T.M. Transfer of copyrights to the publisher becomes effective if and when the article is accepted for publication. The corresponding author will be provided with a pdf of his article by the Editorial Office. Short communications A short communication is intended for the presentation of brief observations that do not warrant a fulllength paper. The reprints will be mailed after receiving payment (conditions of payment may be obtained at secret@cls. R..J. S.92 Journal articles: Instruction to Authors 1 1 author: Eckhardt T. Baj. Poland Conference materials (exceptionally) Dziewit L.gov.A.pdf file) to the corresponding author. A. Bickle. They are usually invited. Fallen Leaf Lake. Environ. Ph. All the required formation (introduction. T. Minireviews Minireviews are published in areas of particular interest and importance. 2 authors: So³yga A. It should be printed out and after introducing necessary corrections. methods. 2003.edu. Nucleic Acids Res. results and discussion) except for the Literature must be given in single section. 3 to 10 authors: Bartosik D. A rapid method for identification of plasmid desoxyribonucleic acid in bacteria. M. 2004. Do not use sections heading in the body of the text. Each Short communication must have an abstract of no more than 100 words.pl/pjm Copyrights Submission of the manuscript implies that the research presented has not been published before (except in the form of a conference abstract or a part of PhD thesis). A nomenclature for restriction enzymes. but authors wishing to submit a minireview should contact the Editor in Chief directly for further information.. Thesis Szymanik M. Bitinaite. Authors need to be experts on the topic reviewed documented with published achievements in the field. 163. the author (especially foreign) may list them and e-mail directly to the address pjm@pzh. Papers in a language different than English – the title should be translated into English and the original language should be stated in parenthesis.K. Microbiol.microbiology. p. 2001. All articles published in Polish Journal of Microbiology are protected by copyrights which cover the exclusive rights to reproduce and distribute the article as well as the translation. Pol. Ph.S. Total length cannot exceed 8 double printed pages including illustrative material (in total no more than 3 figures and tables). Bestor. Identification of a novel family of addiction systems. J. USA. 69: 7002–7008. If the required corrections are minor. 2004. Belford. Free of charge copies are available at www. Bartosik. Abstracts of International Plasmid Biology Conference. Plasmid 1: 584–588. Dybyig and others.T. J. 47: 138–145.. Proofs The text for proof will be e-mailed (as . and D. Bacterial plasmids stability (in Polish). Entrapment vectors – how to capture a functional transposable element. Biochem. D. Warsaw University. South Lake Tahoe California. Bartosik. K. (title optional). 2006. Bartosik D. 2006. If printed copies of the article are required they can be ordered (in multiples of 20) together with return of the corrected proof. J. Appl. Warsaw. Submit it in the same way as a full-length paper. Szymanik and J. Degtyarey. returned by priority mail to the postal address of editorial office as soon as possible. 1978. Reprints Beginning 2007 the Journal has not provided free reprints. DNA methyl-transferases.D.pl (do not forget to state the paper title and given editorial number of the manuscript). homing endonucleases and their genes. They undergo the same review process as full length papers and are not printed more quickly. Microbiol. Bgagwat. Jazurek.

pl For information for foreign subscribes contact “Ars Polona” – e-mail: arspolona@arspolona. Kelly (Coventry. Che³mska 30/34. in: Polish J. 191–200 Typesetting and print: Publishing House Letter Quality.POLISH JOURNAL OF MICROBIOLOGY (founded in 1952 as Acta Microbiologica Polonica) www. Poland) Waleria Hryniewicz (Warsaw. Poland) Teresa Lagergård (Göteborg.com. France) Hanna Dam (Olsztyn. Sweden) Wanda Ma³ek (Lublin.pl.pl) Editor-in-Chief (stylewska@pzh. phone: + 48 (22) 5098661-5 also www. Poland Estera Dey (Lund. e-mail: sekret@cls. dematium in SEM (Photo M. Poland) PUBLISHER: POLISH SOCIETY OF MICROBIOLOGISTS Published quarterly with the financial support of the Ministry of Science and Higher Education SUBSCRIPTION: For information for Polish subscribers contact Secretary of Polish Society of Microbiologists. Sweden) Jaros³aw Dziadek (£ódŸ.com. UK) Wac³aw Szybalski (Madison. Wolska (Warsaw.edu. Poland) Donovan P. Poland. Bar. Microbiology 59. 00-725 Warsaw.) Grove. Poland) Zdzis³aw Markiewicz (Seattle.pl/pjm EDITOR-in-CHIEF: EDITORS: Stanis³awa TYLEWSKA-WIERZBANOWSKA Izabela SITKIEWICZ Waldemar SIUDA Anna SKORUPSKA Ilona M¥CZKA EDITORIAR OFFICE: EDITORIAL SECRETARY: Anna KRACZKIEWICZ-DOWJAT POSTAL ADDRESS: Polish Journal of Microbiology Chocimska 24 00-791 Warsaw. UK) Józef Kur (Gdañsk. Brylowska 35/38 Circulation: 300 .pl Cover illustration: Setose of C. Poland) Agata Budkowska (Paris. Poland) Geoffrey Schild (Potters.gov.arspolona. POLAND Phone / Fax: (48 22) 5421250 E-mail: Editorial Office (pjm@pzh. Poland) Katarzyna Jagusztyn-Krynicka (Warsaw. USA) Barbara Ró¿alska (£ódŸ. Wróbel).microbiology. fax: (48) 22 8412949. 01-216 Warsaw. Sweden) Krystyna I. phone: (48) 22 8413367. ZOFIA MACHOWICZ-STEFANIAK: Occurrence and characterization of Colletotrichum dematium (Fr. 3. USA) Torkel Wadström (Lund.gov.pl) CONTACT: EDITORIAL BOARD President: Andrzej PIEKAROWICZ (Warsaw.

full page 150 PLN.pl/pjm directly after the printed version appears.com.pl Advertising offer The Editorial Office of the Polish Journal of Microbiology encourages our Readers to place advertisements in our quarterly.Polish Journal of Microbiology. SCOPUS. bacterial physiology. but also minireviews. Submissions of manuscripts in various areas of microbiology are very welcome. Polish Society of Microbiologists. Price of black and white ad on inside cover: half of page = 150 PLN. environmental microbiology and biotechnology. ISSN – 1733-1331 Index – 35119 . Our journal reaches scientists working in various research and educational institutions and involved in different fields of microbiology. is a broad-based international microbiological journal covering: general microbiology. The Editorial Office and Publisher do not take any responsibility for the contents of advertisement and announcements. EMBASE/Excerpta Medica.arspolona. The papers appear usually within 3 months after final acceptance. Abstracts and full texts of the papers (as pdf-s) are available under www. clinical bacteriology.pl. Thomson Master Journals List. All the papers should be prepared according to “Instruction to Authors” which is included in the first issue of every volume and also available at www. We ensure rapid appearance of the ad. virology.pl/pjm. No part of the publication may be reproduced in any form without prior written permission of the Publisher. Polish Journal of Microbiology publishes mainly original research articles including short communications.gov. Subscription information for Polish subscribers under sekret@cls. molecular biology and genetics. After acceptance of the paper the copyrights are reserved to the Publisher. book reviews and press releases.com. Index Copernicus. Biological Abstracts. for foreign subscribers under www.microbiology. Please send file with graphical layout directly to the editorial office of the journal or contact us at pjm@pzh. Polish Journal of Microbiology is currently covered by Science Citation Index Expanded (ISI) and Journal Citation Reports (JCR)/Science Edition. founded in 1952 as Acta Microbiologica Polonica. Cambridge Scientific Abstracts. Index Medicus/MEDLINE. BIOSIS Previews.pl or arspolona@arspolona. full page = 300 PLN Price of ad inside an issue: half page = 75 PLN.edu.microbiology.pl.