Professional Documents
Culture Documents
Thesis submitted to the University of Agricultural Sciences, Dharwad in partial fulfilment of the requirements for the Degree of
By REVATHY CHARAGONDA
DEPARTMENT OF BIOTECHNOLOGY COLLEGE OF AGRICULTURE, DHARWAD UNIVERSITY OF AGRICULTURAL SCIENCES, DHARWAD-580 005 APRIL, 2008
ADVISORY COMMITTEE
DHARWAD APRIL 2008 (I. S. KATAGERI ) MAJOR ADVISOR
Approved by : Chairman :
I. S. KATAGERI ______________________
CONTENTS
Sl. No. Chapter Particulars CERTIFICATE ACKNOWLEDGEMENT LIST OF TABLES LIST OF FIGURES LIST OF PLATES INTRODUCTION REVIEW OF LITERATURE 2.1 Discovery of RNA interference 2.2 Mechanism of post transcriptional gene silencing 2.3 RNAi and functional genomics 2.4 Applications of RNAi for crop improvement 2.5 Disease resistance by RNAi 2.6 RNAi for male sterility in plants 2.7 RNAi and gene therapy 2.8 Constraints of RNAi 2.9 Designing constructs for PTGS MATERIAL AND METHODS 3.1 Material used 3.2 Amplification of partial -cadinene gene 3.3 PCR based cloning 3.4 Cloning into generic ihp vector 3.5 Subcloning into plant transformation vector pCAMBIA1305.1 3.6 Mobilizing recombinant clones into Agrobacterium LBA4404 3.7 Transgenic cotton development 3.8 Transgene expression analysis EXPERIMENTAL RESULTS 4.1 PCR amplification of -cadinene gene from cotton 4.2 PCR based cloning and sequence analysis 4.3 Cloning into generic ihp vector 4.4 Cloning into plant transformation vector pCAMBIA1305.1 4.5 Mobilizing recombinant clones into Agrobacterium 4.6 Transgenic cotton development 4.7 Plant transformation studies DISCUSSION 5.1 Construction of gene cassette for plant transformation 5.2 Plant transformation studies and PCR analysis 5.3 Expression studies SUMMARY AND CONCLUSIONS REFERENCES ABSTRACT
1. 2.
3.
4.
5.
6. 7. 8.
LIST OF TABLES
Table No. Title
1.
Landmarks in PTGS
2.
3.
4.
Homology of the 600 bp dCS trigger sequence to various isoforms of -cadinene synthase gene from cotton
LIST OF FIGURES
Figure No.
Title
1.
Model of PTGS/RNAi
2.
3.
Construct maps of pTZ57R/T carrying partial -cadinene sense and antisense gene
4.
5.
Nucleotide and aminoacid blast result of 600 bp partial -cadinene synthase gene
6.
7.
8.
Vector map of pCAMBIA1305.1 Map of pCAMBIA1305.1 carrying ihp (sense and antisense) inserts
9.
LIST OF PLATES
Figure No. Title
1.
2.
PCR and Restriction confimation of pTZR/T clones containing partial d-cadinene gene
3.
4.
5.
6.
1 INTRODUCTION
Cotton has been cultivated for its fiber for >7,000 years. Despite the availability of synthetic alternatives, it continues to serve as the most important source of fiber for textiles. Cotton is grown in >80 countries and is a cash crop for >20 million farmers in developing countries in Asia and Africa, where malnutrition and starvation are rampant. An attribute of cotton not widely recognized is that for every 1 kg of fiber, the plant produces ~1.65 kg of seed. This makes cotton the third largest field crop in terms of edible oilseed tonnage in the world. In addition to 21% oil, cottonseed is a source of relatively high-quality protein (23%). However, the ability to use this nutrient-rich resource for food is hampered by the presence of toxic gossypol that is unique to the tribe Gossypieae. This cardio and hepatotoxic terpenoid present in the glands, renders cottonseed unsafe for human and monogastric animal consumption (Risco and Chase., 1997). Unfortunately, this toxicity subjugates this abundant agricultural resource to the ranks of a feed for ruminant animals either as whole seeds or as meal after oil extraction. In fact, the 44 million metric tons (MT) of cottonseed (9.4 million MT of available protein) produced each year could provide the total protein requirements of half a billion people for 1 year (50 g/day rate) if the seed were safe for human consumption. Thus, gossypol-free cottonseed would significantly contribute to human nutrition and health, particularly in developing countries (Hedin et al., 1992), and would help to meet the requirements of the predicted 50% increase in the world population in the next 50 years. Gossypol and related terpenoids are present throughout the cotton plant in the glands of foliage, floral organs, and bolls, as well as in the roots. In addition, these terpenoids are induced in response to microbial infections. These compounds protect the plant from both insects and pathogens (Stipanovic et al., 1999). After the discovery of a glandless mutant, several breeding programs were launched in the U.S., Africa, and Asia to transfer the glandless trait into commercial varieties to produce gossypol-free cottonseed. These programs provided cottonseed that could be fed to monogastric animals that use feed more efficiently and was even deemed safe for human consumption. Cottonseed compared favorably as a source of protein compared to other traditional food sources in several human nutrition studies (Lusas and Jividen., 1987). However, these glandless cotton varieties were a commercial failure. Under field conditions, glandless plants were extraordinarily susceptible to attack by a host of insect pests, because they constitutively lacked protective terpenoids (Jenkins et al., 1966) and were, therefore, rejected by farmers. Thus, the potential of cottonseed in contributing to human nutrition remains unfulfilled. Gossypol and other sesquiterpenoids are derived from (+) - ()-cadinene. The enzyme -cadinene synthase catalyzes the first committed step involving the cyclization of farnesyl diphosphate to (+) - ()-cadinene (Rathore et al., 2006). Thus, tissue-specific RNAi of -cadinene synthase expression to disrupt terpenoid biosynthesis offers a possible mechanism to eliminate gossypol from the seed while retaining a full complement of this and related terpenoids in the rest of the plant for maintaining its defensive capabilities against insects and diseases. Gene silencing in plants and animals can be induced by delivery of dsRNA into their cells. In animals, this has been mainly by transient delivery, such as by injection, of dsRNA (Baulcomge, 2004). In plants, stable transformation with transgenes that encode hairpin (hp) RNA has been the method of choice. The ds or hpRNA induces a two step, sequence specific RNA degradation mechanism involving a nuclease called DICER and a nuclease complex called RISC. In the first step the ds or hpRNA is degraded into 21 nt fragments by DICER. In the second step, one of the strands of a siRNA is used to guide the RISC complex to complementary ssRNA which RISC then cleaves. Thus the sequence delivered as ds or hpRNA determines which ssRNAs are destroyed. This early directed RNA degradation mechanism has found wide usage in medical, animal, insect and plant research. Gene silencing has emerged as a powerful tool to protect against viruses, generate valuable traits (Baulcombe, 1996), and to determine the functions of genes identified by genome sequencing (Chory et al., 2000). It has also become a key tool in the rush to develop new therapeutics, both as a therapeutic agent in itself and as a research tool to identify and validate gene targets for new therapeutics (Arenz and Schppers, 2003).
A major challenge in the post genome era of plant biology is to determine the functions of all the genes in plant genome (Helliwell and Waterhouse, 2002). A straight forward approach to this problem is to reduce or knock out expression of a gene with the hope of seeing a phenotype that is suggestive of its function. Insertional mutagenesis is a useful tool for this type of study, but is limited by gene redundancy, lethal knock outs, non tagged mutants and the inability to target the inserted element to a specific gene. RNA interference of plant genes, using constructs encoding self complementary hairpin RNA, largely overcome these problems (Smith et al., 2000). RNAi has been used very effectively in Caenorhabditis elegans functional genomics and resources are currently being developed for the application of RNAi to high-throughput plant functional genomics (Fire et al., 1998). Initially, gene silencing was a puzzling phenomenon but great studies have been made in elucidating the basic biology of the complex mechanism. Today, the phenomenon of RNA silencing is used to describe all siRNA mediated gene silencing pathway that are evolutionarily conserved in most eukaryotic organisms. The phenomenon has been referred to as Post Transcriptional Gene Silencing (PTGS) in plants, RNA interference (RNAi) in nematode, flies and mammals and quelling in fungi and is increasingly viewed as an adaptive immune system of plants against viruses (Voinnet, 2001). The term RNAi indicates name given to a gene silencing process induced by double stranded RNA (dsRNA) and is widely used strategy for functional genomics, the primary advantage being its ability to knock down the specific target gene. The implication of the RNAi in science has lead to christening RNAi as Technology of the year (Couzin et al., 2002). Post transcriptional silencing of -cadinene synthase genes was envisaged as a way to activate silencing mechanism in cotton, there by blocking the cadinene type sesquiterpenes pathway and abolishing gossypol production in the transformants. With this background, following objectives were set for the current study. 1. Development of PTGS construct for silencing -cadinene synthase gene to prevent the expression of gossypol in cotton 2. Genetic transformation using PTGS construct with sense and antisense genes to prevent the production of gossypol in cotton
2 REVIEW OF LITERATURE
Plants enlist a complex array of physical and chemical defenses to protect themselves against diseases. Cotton plants (Gossypium spp) have numerous inducible defense mechanisms that are important for their ability to respond to changing biotic threats, including the synthesis of volatile terpenes (Pare and Tumlinson, 1997), phytoalexins, tannins, tyloses, pathogenesis related proteins, as well as lignifications, and the release of active oxygen species (Bell, 1981). In cotton (Gossypium hirsutum) the enzyme (+)-cadinene synthase (CDNS) catalyzes the first committed step in the biosynthesis of cadinene type sesquiterpens such as gossypol, that provides constitutive and inducible protection against pests and diseases. However, the presence of gossypol renders cottonseed unsafe for human and monogastric animal consumption. Thus gossypol free cottonseed would significantly contribute to human nutrition and health. Plant breeders frequently seek to improve crops by down-regulating expression of genes encoding undesirable traits. They have done this traditionally by selecting within natural variation inherent in a species after needing to use unadapted germplasm as the source of the required trait expression. This is a slow and costly process requiring several generations and considerable effort to construct elite lines with the desired phenotype. Alternatively, new variation for trait expression can often be generated through the use of chemical mutagens or ionizing radiation. In this case, large mutagenized populations have to be created and screened, and desirable selections may then have to undergo extensive backcrossing to remove random mutations not associated with the trait and deleterious to agronomic preference. A further limitation in using induced mutation approaches is that they cannot control gene expression in a tissue specific manner if the genes involved have constitutive expression. Post transcriptional gene silencing (PTGS) a sequence-specific RNA degradation mechanisms inherent in eukaryotes, has been successfully used to silence gene expression and produce desirable traits in crop plants. PTGS has been induced in plants either through the use of antisense or cosupression constructs (Kooter et al., 1999). One major advantage of this approach is the ability to avoid any undesirable effects of global silencing of the target gene by confining the gene suppression to a specific tissue or organ through the use of appropriate tissue-specific promoters to drive the gene-silencing constructs. However, the relatively low frequency of PTGS achieved with antisense and co-suppression (Hamilton et al.,1998) requires that large populations of transgenic plants are produced in order to obtain an acceptable number of transgenic lines exhibiting sufficient degrees of target gene suppression. This can present a major limitation, particularly in species that have low transformation and regeneration frequencies. RNA-mediated interference (RNAi) is an evolutionarily conserved gene silencing mechanism that recognizes double-stranded RNA (dsRNA) as a signal to trigger the sequence-specific degradation of homologous mRNA. Arguably the most important advance in biology has been the discovery that RNA molecules can regulate the expression of both endogenous and exogenous genes. The literature on post transcriptional gene silencing/RNA interference (RNAi) is reviewed here. The mechanism of down regulation of gene expression by sense transgene would involve an antisense like process (Grierson et al., 1991). The PTGS could be initiated both by sense and antisense transgenes and both might follow similar biochemical mechanism (Francesco et al., 2001). In some cases, the silencing phenomenon has been correlated with methylation in the promoter sequences, which controlled the expression of the specific transgenes (Matzke and Matzke, 1991). By contrast, other studies indicated that the suppressed genes were transcribed and the silencing event occured post-transcriptionally through the reduction of steady-state mRNA levels (Mol et al., 1994). Co-suppression of the endogenous gene occurred at a higher frequency in transgene carrying a small inverted repeat in the 5' UTR than in those harboring only the sense transgene without the inverted repeat (Metzlaff et al., 1997). Detailed analysis of RNA content has revealed the presence of discrete RNA degradation intermediates (Eldik et al., 1998). The antisense transcripts have been described in prokaryotes, as well as in a variety of eukaryotes (Kumar and Carmichael, 1998), where, they invariably play a negative role. The
biological activity of antisense RNA can be exerted at all levels of gene expression: transcriptional RNA processing and transport and RNA stability and translation (Brossollet and Vaquero, 1998). Antisense transcripts might be involved in different biological functions, such as the control of development or adaptation to different stresses. The observation in mammals and other eukaryotes indicate that naturally transcribed antisense RNA has to fulfill two major functions. First, it can code for small protein or for a peptide. Indeed, peptides are known to be commonly used as signal molecules in mammals and to be found also in plants. These antisense transcripts encode a product, referred as overlapping transcripts. Second, the antisense RNA can regulate the expression of the sense transcripts depending on their location in cell, which could be the nucleus as well as the cytoplasm. Antisense transcripts have also been found in other transposon systems, such as the micropia retrotransposon of Drosophila and TOC1 from chlamydomonas (Day and Bejarano., 1991; Lankenau et al., 1994). High level of sense transcript correlated with low level of antisense RNAs and vice versa, suggesting that, the antisense transcript might regulate the expression of genes. Antisense mediated gene silencing (ASGS) and PTGS with sense transgenics are remarkably similar in mechanistic terms. Both forms of silencing are involved in production of 20-25nt long degraded RNA (siRNA) (Serio et al., 2001; Groot et al., 2004). However, PTGS works only when both sense and antisense RNAs are simultaneously present in the plant cell. RNA silencing by PTGS is a newly discovered mechanism of gene regulation in eukaryotes. It is in some way, similar to classical humoral immunity, which protects eukaryotes against viruses and transposons. Post-transcriptional gene silencing (PTGS) of small sense and antisense RNAs and aberrant transcripts of endogenous sense and truncated homologous transgene were demonstrated by YuanHuai et al. (2004). PTGS greatly reduces mRNA accumulation in plant, but doesnt affect transcription. Significant accumulation of sense and antisense siRNAs was observed in various PTGS systems in plants (Hamilton and Baulcombe, 1999). The accumulation of both sense and antisense siRNAs suggests that dsRNA is produced prior to RNA degradation. Comparative effect of sense, antisense, dsRNA and siRNAs was first studied by Klahre et al. (2002). Their results suggest that siRNAs themselves or intermediates induced by siRNAs could comprise silencing signals and that these signals induce self-amplifying siRNAs. Only dsRNA molecules showed the highest level of gene silencing as compared to single stranded RNA molecules. Transformation of plants with hpRNA constructs gives stable silencing that is inherited from generation to generation, thereby enabling the continued study of a phenotype (Waterhouse and Wang., 2001). In experiments in which genes have been targeted with intron-containing hpRNA constructs, silencing causes measurable effects (70100%) in the resulting plants (Wesley et al., 2001; Helliwell et al., 2002). Fire et al. (1998), first demonstrated that injection of sense, antisense and dsRNA molecules to C. elegans induces gene silencing. After injection into adult animals, purified single strands have at most a modest effect, whereas double-stranded mixtures cause potent and specific interference. The effects of this interference were evident in both the injected animals and their progeny. Only a few molecules of injected dsRNA were required per affected cell, arguing against stochiometric interference with endogenous mRNA and suggesting that there could be a catalytic or amplification component in the interference process. The initiation of RNAi in the dsRNA triggered silencing of a second transcript that has no homology to the initial dsRNA trigger, but shares upstream sequence similar to the first transcript (Sijen et al., 2001). Transitive RNAi appears to occur when siRNA molecules synthesized new dsRNA, mediated by an RNA dependent RNA polymerase (RdRP), in the 5'-3' direction on the antisense strand. The newly synthesized dsRNA leads to the production of more siRNA and triggers further gene silencing (Han and Grierson, 2002).
2.1
The discovery of RNA interference (Guo and Kemphues., 1995; Fire et al., 1998) was unusual in the post modern era of molecular biology in that, like immunoglobulin gene rearrangement, for example, it was almost entirely unanticipated. Beyond the action of RNA interference and RNA silencing at the translational level of gene expression, RNA mediated phenomena are now known to direct the transcription-level. Silencing of some genes, and
even the editing down of an organisms genome by selective excision events in certain cases (Selker, 2003; Yao et al., 2003). Prior to the discovery of RNAi, scientists applied various methods such as insertion of T-DNA elements and transposons, treatment with mutagens or irradiation and antisense RNA suppression to generate loss-of-function mutations. Apart from being time-consuming, the above methods did not always work satisfactorily. For instance, transposons and T-DNA elements were found to occasionally insert randomly in the genome resulting in highly variable gene expression. Furthermore, in many instances the particular phenotype or a trait could not be correlated with the function of a gene of interest. It is against this backdrop that the RNAi phenomenon was discovered. The antisense process doesnt always result in a loss of function of a targeted gene, which led concerned scientists to continue the search for other methods of gene silencing. Fire et al. (1998) took the antisense silencing approach a step further in C. elegans with simultaneous introduction of both the sense and antisense strands of the targeted mRNA, resulting in a ten fold higher potency in silencing of the targeted mRNA. This experiment laid the foundation for many scientists to look into the complex process of RNAi. RNA silencing is a novel mechanism of gene regulation, that limits the transcript level by either suppressing transcription [transcriptional gene silencing (TGS)] or by activating a sequence-specific RNA degradation process [post transcriptional gene silencing (PTGS)]/RNA interference (RNAi), mechanistic connection between TGS and PTGS does exist. Transcriptional gene silencing is an emerging field while PTGS is under going enhancement in its information content. Three phenotypically different but mechanistically similar forms of gene silencing, cosuppression or PTGS in plants (Jorgensen, 2003), quelling in fungi (Cogoni et al., 1996) and RNAi in the animal kingdom (Fire et al., 1998) have been described. More recently, miRNA formation (Pasquinelli, 2002; Bartel, 2004), promoter methylation (Matzke et al., 2001; Wesley et al., 2001), heterochromatinization (Schramke and Allshire, 2003) etc., have been revealed as other facets of naturally occurring RNAi processes in eukaryotic cells. The evolutionary functions of RNAi and its related processes are designed for the protection of genome against invading mobile elements like viruses and transposons as well as for orchestrated functioning of developmental programs in eukaryotes. For the past few years, the primary focus of the studies on miRNA has been to catalogue the complete mRNA inventory in a host of model organisms, using both cloning and bioinformatics (Bartel, 2004) and search for the natural targets of these endogenous regulators. David Baulcombes group developed tools for functional genomics in plants, through development of potato virus X (PVX), as an effective vector for high throughput virusinduced gene silencing (Liu et al., 2003). The Ambrose laboratory reported the first case of micro RNA (miRNA) in an attempt to silence heterochronic gene lin-4 of C. elegans (Lee et al., 1993), and the Fire and Mello laboratories described the gene silencing effect of double-stranded RNA (dsRNA) in C. elegans by injecting dsRNA that corresponds to unc22, responsible for body morphology (Fire et al., 1998).
Table 1. Landmarks in PTGS Events/Phenomenon First reported resistance against TMV in transgenic tobacco using CP gene Silencing phenomenon correlated with promoter methylation Gene silencing induced by co-suppression in plants Sense strand could down regulate endogenous gene expression Replicase mediated resistance against TMV Discovery of miRNAs in C. elegans Plant RdRp doesnt require primers to synthesize RNA in vitro Cloning of QDE1 gene in animals homologous to plant RdRp First transgenic tomato expressing coat protein of TYLCV First evidence that sense RNA could instigate gene silencing in C. elegans RNA silencing was first reported in animals using antisense mRNA in C. elegans VIGS demonstrated in plants Transmission of PTGS signals through grafting in plants RNA silencing is induced locally and spreads systemically Gene silencing effect of dsRNA in C. elegans Spreading of siRNA both in 5 and 3 along the target Use of PVX as VIGS vector Use of TRV as VIGS vector Cell-to-Cell movement of silencing signal in plants Heterologous gene silencing described References Powel-Abel et al., 1986 Matzke et al., 1989 Nepoli et al., 1990 Nepoli et al., 1990 Golemboski et al., 1990 Lee et al., 1993 Schiebel et al., 1993 Lindbo et al., 1993 Kunik et al., 1994 Guo and Kemphues, 1995 Guo and Kemphues, 1995 Kumagai et al., 1995 Palauqui et al., 1997 Voinnet et al., 1997 Fire et al., 1998 Voinnet et al., 1998 Ruiz et al., 1998 Ratcliff et al., 1999 Voinnet et al., 1998 Hamilton et al., 1999
Table 1. Contd Events/Phenomenon An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals Selective reduction of dormant maternal mRNAs in mouse oocytes by RNA interference RNA interference is mediated by 21-and 22-nucleotide RNAs Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA Single-stranded antisense siRNAs guide target RNA cleavage in RNAi Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages RISC is a 5' phosphomonoester-producing RNA endonuclease Argonaute2 Is the catalytic engine of mammalian RNAi A brief history of RNAi: the silence of the genes RNAi in combination with a ribozyme and TAR decoy for treatment of HIV infection in hematopoietic cell gene therapy References Hammond., et al., 2000 Zamore., et al., 2000 Fagard., et al., 2000 Svoboda., et al., 2000 Elbashir., et al., 2001 Elbashir., et al., 2001 Svoboda., et al., 2001 Martinez., et al., 2002 Lee., et al., 2002 Anderson., et al., 2003 Banerjea., et al., 2003 Martinez., et al., 2004 Liu., et al., 2004 Sen., et al., 2006 Li., et al., 2006
The dsRNA alone cannot degrade mRNA, but requires the assistance of two enzymes namely, Dicer and RISC. Dicer, which was first discovered by Bernstein et al. (2001) in Drosophila, is a complex enzyme belonging to the RNase III family. It has four different domains with different functions. They are: (a) N-terminal helicase, (b) dual RNase III motifs, (c) C-terminal dsRNA binding domain, (d) PAZ (Piwi/Argonaute/Zwille) domain (Kuznetsov, 2003; Arenz and Schepers, 2003). The PAZ domain is believed to physically interact with the corresponding PAZ domain of the RISC complex. The dual RNase III motifs perform the actual cleavage of the dsRNA, hence the characteristic 5 phosphate and 3 hydroxyl residues on the resulting siRNAs. ARGONAUTE1 (AGO1) of Arabidopsis thaliana mediates the cleavage of miRNA-targeted mRNAs and it has been also implicated in PTGS of transgenics and maintenance of chromatin structure (Vaucheret, 2006). Experiments involving human DICER showed that the cleavage mechanism of the enzyme is ATPindependent (Kuznetsov, 2003). However, ATPase activity could also be involved during the release of siRNA from the enzyme. The helicase domain is also believed to take part in the process. The DICER protein functions in two different pathways in silencing a gene by recognizing distinct types of precursor dsRNA. In the first pathway, DICER cleaves long and perfect dsRNA structures originated mainly from the protein-coding region to generate double stranded siRNAs, which guide the subsequent endonucleolytic cleavage of homologous RNAs with perfect base pairing interaction (Elbashir et al., 2001). In the second pathway, DICER can dice imperfect RNA duplexes predominantly derived from the regions between protein coding genes into short RNAs, which are subsequently recruited into a micro RNAribonucleoprotein complex (miRNP) to further regulate translational inhibition or other PTGS effects (Hutvagner et al., 2001; Voinnet, 2002). Accordingly DICER processes precursors dsRNAs to generate both siRNAs and miRNAs. Recently, four types of dicers involved in small interfering RNA biogenesis have been reported in Arabidopsis (Xie et al., 2004 and 2005), they are DCL1 (miRNA), DCL2 (viral RNA), DCL-3 (endogenous siRNA) and DCL-4 (exogenous siRNA) (Fig. 1). RISC is the component of the RNAi machinery that uses siRNAs to track down and degrade the target mRNAs. First discovered in Drosophila, by Hammond et al. (2000), RISC consists of both protein and RNA. The protein component of the complex has ribonuclease activity with the ability to cleave RNA. In addition to ribonuclease activity, RISC also contains a PAZ domain involved in regulation of RNA interference (RNAi). Additional RISC components include two RNA binding proteins, vasa intronic and dFMR protein (Arenz and Schepers, 2003). There are still other components of RISC yet to be identified. For example, it remains unclear as to how the siRNA incorporates within the complex. Recent biochemical studies in Drosophila suggested that the DCR-2/R2D2 complex also facilitates incorporation of siRNA into the RISC complex (Liu et al., 2006). RISC utilizes the siRNA and search for the complementary target mRNA. The biochemical and informatics efforts reached a single conclusion that the sequence and structure of a siRNA determines which of its two strands participates in the RNA silencing pathway. Consequently, some siRNAs appear inactive in vivo, as the wrong strand has entered the RNAi pathway (Schwarz et al., 2003). The orientation of DCR-2/R2D2 complex proteins on the siRNA duplex reflects which strand is incorporated into RISC (Tomari et al., 2004). Each siRNA dissociates from the DICER active site soon after it is produced, its thermodynamics evaluated by the RNA silencing machinery and then, one strand is selectively loaded onto RISC and other is destroyed. The degradation process is initiated once the successful location and cleavage of the complementary mRNA occurs by the siRNARISC complex. Studies are beginning to reflect that the siRNAs are transported through the phloem (Lucas et al., 2001) and the regulation of RNA trafficking plays an important role in plant development in addition to its role in PTGS (Vance and Vaucheret, 2001). In case of translational repression pathway, small RNAs direct RISC to bind to target mRNA and repress its translation process, rather than cleavage. Animal miRNAs typically, but not always, mediate translational repression rather than cleavage. In contrast, most plant miRNAs direct target RNA cleavage. The multiple candidate sites in 3 UTR sequences is useful predictor for an mRNA being regulated by miRNA. The complete pairing of 3' half of a siRNA or miRNAs to target RNA is not required for translational repression (Doench et al., 2003). Translational repression occurs at some stage after translational initiation, because the
distribution of ribosomes along the length of the repressed mRNA under going active translation (Vauchert, 2006). Inspite of all these findings, still many more questions are still left answered. The more we explore RNA silencing, the more these pathways reveal their remarkable complexity. Short RNAs associated with transgene RNA silencing are heterogeneous in both size and function (Hamilton and Baulcombe, 1999). Thus, these RNAs are not a single class of ~25nt, but instead are two distinct species with 21-22nt and 25nt in size. The 21-22nt siRNA represents the siRNA that guides the RISC ribonuclease to the target of RNA silencing (Elbashir et al., 2001; Aigner, 2006). However, it is unlikely that the two classes of siRNA have the same function because they accumulate differently in locally and systematically silenced tissue. The long siRNA molecule that is directly involved in systemic silencing, RNA directed DNA methylation and RNA silencing processes such as amplification and transitivity (Sijen et al., 2001; Vaistij et al., 2002) may also depend on the long siRNAs. The term, small interfering RNA (siRNA) was coined due to their use as a targeting sequence by RISC, aimed at mRNA for degradation, first isolated by Hamilton and Baulcombe (1999). The siRNAs are composed of 21-25bp with a 5' phosphate and 3' hydroxyl groups with 2-3bases of overhangs. Lipardi et al., (2001) found that the 3' hydroxyl group is required in order to direct RNAi in vitro. While, DICER may incorporate siRNAs into RISC following their synthesis, they dont require event to occur in vivo.
2.3
RNAi has several advantages over insertional mutagenesis for functional genomics, the prime advantage being an ability to specifically target the chosen gene (Guo et al., 2003). Down regulation of endogenous genes via PTGS using sense or antisense constructs is a crucial tool to assess gene function in transgenic plants. One drawback of these studies is that constitutive gene silencing often entails pleiotropic effects on growth and development of transgenic plants, which complicate the interpretation of the phenotype and might mask true gene function. Effective gene silencing by PTGS of two highly related target genes as compared to conventional antisense fragments was observed by Hofgen et al. (1994) and Papenbrock et al. (2000).
2.4
Since its discovery, RNA silencing has been widely implemented as a research tool for a number of potentially commercial applications in crop improvement by controlling unwanted traits or metabolic pathway (Senior, 1998). One of the first commercial product was a tomato and with a longer shelf life as a result of silencing of gene responsible for softening of ripen fruit (Schuch et al., 1989). RNAi technology has also been used in several other plants to improve their nutritional quality for example caffeine content in coffee plants has been markedly reduced by RNAi mediated suppression of caffeine synthase gene (Ogita et al., 2004). In another work, RNAi has been used to generate dominant high lysine maize variant by knocking out the 22 kDa maize zein protein, a protein that is poor in lysine content (Zlus and Galili, 2004). RNA interference of soybean isoflavane synthase (IFS) genes led to silencing in tissues distal to the transformation site and enhanced its susceptibility to Phytophthora sojae (Subramanian et al., 2005). Approximately 50% of the transformed roots showed >95% silencing of isoflavone accumulation. An exhaustive and gene-specific gene silencing was successfully induced to modulate flower color (Fukusaki et al., 2004), by altering chalcone synthase (CHS) activity, a key enzyme for anthocyanin biosynthesis, using coding region and 3 UTR of CHS-mRNA. Naturally occurring, hpRNA-mediated silencing of a rice gene [low glutelin content 1 (Lgc1)] has been reported [Kusaba et al., 2003]. Glutelin is a major seed storage protein; the low glutelin content of the resulting rice lines is beneficial for patients with kidney diseases who must reduce their protein intake. Lgc1 is a dominant mutation that results in the reduction of glutelin content in the rice grain. Lgc1 homozygotes have a deletion of ~3.5 Kb between two highly similar glutelin genes, forming a tail-to-tail inverted repeat, which results in a dsRNA, inducing gene silencing. This has been confirmed by producing transgenic plants containing the inverted repeat and by detecting siRNAs belonging to that region in natural
mutants and in transgenic plants [Kusaba et al., 2003]. The trait was stable for 20 generations demonstrating the stability of dsRNA in transgenic plants. The efficacy of this approach has been demonstrated by silencing two key enzymes in the fatty acid biosynthesis pathway in cotton: ghSAD-1 and ghFAD2-1. RNAi mediated down regulation of ghSAD-1 elevated the stearic acid content in cotton seeds (44% compared with a normal level of 2%), and silencing ghFAD2-1 increased the oleic acid content (77% compared with a normal level of 15%) [Liu et al., 2002]. RNAi has also shown promise in the development of hypoallergenic grasses. The major cause of hay fever and seasonal allergic asthma, which affects ~25% of the population in temperate climates, is ryegrass pollen (Loliumspp.). The main allergens are the pollen proteins Lol p1 and Lol p2: 90% of allergy sufferers are sensitive to these proteins. Levels of Lol p1 and Lol p2 can be down regulated by expressing antisense cDNA sequences under the control of a maize pollen-specific promoter [Petrovska et al., 2005]. Analysis of these transgenic grasses is also providing information about the function of the allergens in pollen, which is so far unclear. A somewhat different approach was adopted to improve productivity of oilseed rape (Brassica napus). This species produces a bright-yellow canopy of flowers that can absorb nearly 60% of photo synthetically active radiation, resulting in reduced yield. A plant with reduced (or no) petals was achieved using an hp construct targeted at the BPI gene family (MADS-box floral organ identity genes) under the control of a chimeric, petal-specific promoter derived from Arabidopsis [Byzova, et al., 2004]. The resultant plants produced male fertile flowers in which the petals were converted into sepals (Arabidopsis) or into sepaloid petals (B. napus). The first real breakthrough for RNAi-mediated metabolic engineering came in 2004 when RNAi was used to silence enzymes in the codeine reductase (COR) gene family in the opium poppy (Papaver somniferum) [Allen et al.,2004]. This was achieved using an hpRNA construct containing sequences from multiple cDNAs of genes in the pathway. A precursor, the non narcotic alkaloid (S)-reticuline, which occurs upstream of codeine in the pathway, accumulated at the expense of morphine, codeine, opium and thebaine in transgenic plants. The researchers involved in this study were the first to report metabolic engineering of the opium poppy using RNAi and the first to interfere with multiple steps in a complex biochemical pathway. The earliest example of PTGS involved the re-introduction of the full coding region of the target gene in either the normal (sense) or reverse (antisense) orientation. The antisensemediated PTGS was used in rapeseed to down-regulate the expression levels of the 9desaturate enzyme that converts stearic acid to oleic acid, resulting in an increase in stearic acid from 2% to about 33% (Knutzon et al., 1992). Similarly, sense-mediated PTGS (cosuppression) targeted against the 12-desaturase that converts oleic acid to linolenic acid has resulted in the development of soybean, rapeseed and mustard oil with very high oleic acid (Liu et al., 2002; Stoutjesdijk et al., 2002). However, these antisense and cosuppression strategies have proven to be variable and unpredictable in their effectiveness and generally require the production and screening of large number of lines to isolate those exhibiting sufficient degree of gene suppression. The PTGS technology has also been successful in genetic modification of the fatty acid composition of oil in other crops (Stoutjesdijk et al., 2002; Liu et al., 2002). The alterations to fatty acid composition of seed oil achieved using PTGS enables the development of a range of fatty acids that better match current end-use requirements.These results suggested that hpRNA has the potential to be the most efficient in systemically silencing the endogenous gene than sense and antisense strategies.
Table 2. Use of RNAi in metabolic engineering of plants TRAIT Reduced or absent petals Reduced ethylene sensitivity Reduced caffeine production Non-narcotic alkaloid production Maize quality Increased carotenoid and flavonoid content Flower colour Enzymatic browning Allergy Increased stearic acid and oleic acid content of seed oil TARGET GENE BP1 gene 1-Aminocyclo propane-1carboxylate oxidase CaMxMt 1 gene Codeine reductase (COR) gen Starch branching enzyme DET1 gene CHI gene Polyphenyl oxidase gene Lol p1 and Lol p2 ghSAD-1 and ghFAD2-1 genes HOST PLANT Oilseed rape Tomato Coffee bean plant Opium poppy Maize Tomato Tobacco Potato Ryegrass (Lolium spp.) Cotton POTENTIAL BENEFIT Improved photosynthesis Longer shelf life (slower ripening Decaffeinated coffee Ogita., et al.,2004 Allen., et al., 2004 Up to 50% increase in amylose content Consumer health benefits Extended storage life Hypo-allergic ryegrass Useful for cooking applications without the need for hydrogenation Phytoremediation of soils Chai., et al., 2005 Davuluri., et al., 2005 Nishihara., et al., 2005 Welsley., et al., 2001 Petrovska., et al., 2005 Liu., et al.,2002 Reference Byzova., et al., 2004
ACR2 gene
Arabidopsis thaliana
2.5
The effects of gene silencing in plants were first used in efforts to develop resistance to diseases, particularly those caused by viruses, although the mechanism was not clear at the time. This pathogen-derived resistance (PDR) was achieved by transforming plants with genes, or sequences, derived from the pathogen, with the aim of blocking a specific step in the life or infection cycle of the pathogen. Many of the strategies used for PDR were shown to be mediated by RNA, rather than protein, and led directly to the identification of PTGS a phenomenon that is believed to be a form of anti-viral defence [Voinnet et al., 2001; Goldbach et al., 2003]. An important finding, first recognized in plants, was that once triggered, the silencing spreads throughout the organism by virtue of a gene silencing signal [Voinnet et al.,1998], thus providing systemic rather than localized resistance. The effectiveness of RNAi technology for generating virus resistance in plants was first demonstrated in 1998. Complete immunity was reported to Potato virus Y in potato plants harbouring vectors for the simultaneous expression of both the sense and antisense transcripts of the viral helpercomponent proteinase (HCPro) gene [Waterhouse et al.,1998]. Immunity has since been shown for several other viruses The technology works against a diverse array of RNA viruses. However, plant viruses have evolved counter-silencing strategies by encoding proteins that can overcome this resistance. These suppressors of gene silencing are often involved in viral pathogenicity and mediate synergism among plant viruses a phenomenon whereby two viruses, each providing an essential factor for the synergism, induce a more severe disease than either on their own. Simultaneous silencing of diverse plant viruses can be achieved by designing hairpin structures that target distinct viruses in a single construct. Efforts to control single-stranded DNA viruses, specifically the Gemini viruses, by RNAi have been reported. The non-coding intergenic region of the Gemini virus Mungbean yellow mosaic India virus (MYMIV) was expressed as an hp construct under the control of the 35S promoter and used to biolistically inoculate MYMIVinfected black gram (Vigna mungo) plants. Plants treated with the construct showed a complete recovery from infection that lasted until senescence. This work showed that phyto pathogenic DNA viruses can potentially be controlled by RNAi and that promoter sequences (which are not usually transcribed but can possibly be covered by fortuitous read-through) make a suitable target for silencing [Pooggin et al., 2003]. The coding sequences of Gemini viruses, particularly the Rep protein (a rolling-circle initiator protein essential for viral DNA replication), have been used as a target for pathogen-mediated resistance [Bendahmane and Gronenborn, 1997; Sangare et al., 1999.]. The potential for silencing geminiviruses by RNAi using a transient protoplast assay has also been shown [Vanitharani, et al., 2003.]. Protoplasts were cotransfected with a siRNA designed to the Rep coding sequence of African cassava mosaic virus (ACMV) and the genomic DNA of ACMV resulting in a 91% reduction in Rep transcript and 66% reduction in viral DNA. This siRNA was able to silence a closely related strain of ACMV but not a more distantly related virus. Subsequently the complete Rep gene of ACMV was transformed, in sense orientation, into cassava (Manihot esculenta). Again resistance was shown following challenge with infectious clones of ACMV and viral DNA levels were reduced by 98%. Despite the presence of virus these plants remained symptom less. In addition, the ACMV Rep transgene provided good protection against several distantly related geminiviruses, showing the potential of RNAi for developing broad-spectrum resistance, something that has not been possible using other means. However, attempts to obtain RNAi-mediated resistance against a second Gemini virus, Tomato yellow leaf curl Sardinia virus, also by targeting Rep sequences, resulted in either no or limited resistance [Noris, et al.2004]. This suggests that RNAi-mediated resistance might not work against all Gemini viruses. The reason for this might be the differential expression of RNAi against viruses. In plants with RNAi mediated resistance to the coat protein of Beet necrotic yellow vein virus (BNYVV), resistance levels are variable between tissues, levels of resistance in leaves being higher than in roots [Andika, et al.,2005]. A recent study shows that Gemini viruses use different strategies to overcome RNA silencing. A better understanding of suppression of RNA silencing by these viruses might thus be needed for the effective use of RNA silencing-mediated resistance [Bisaro, 2006].
Table 3. Use of RNAi for virus resistance in plants NAME OF VIRUS FAMILY REGION TARGETED RESULTS SYSTEM USED GENOME Reference
Potato virus Y Mungbean yellow mosaic India virus (MYMIV) African cassava mosaic virus (ACMV) Tomato yellow leaf curl Sardinia virus Pepper mild mottle virus (PMMoV) Tobacco etch virus (TEV
HC-Pro Bidirectional promoter Replication-associated protein gene Replication-associated protein gene Arbitrary sequence
Immunity Recovery from infection Reduced virus accumulation Poor resistance Block in viral infectivity No viral-specific symptoms appeared Recovery from infection Tolerance Inhibition of TMV replication
Waterhouse., et al., 1998 Pooggin., et al., 2003 Vanitharani., et al., 2003 Noris., et al., 2004 Tenllado., et al., 2003
Potyviridae
Arbitrary sequence
Tobacco
RNA
Alfalfa mosaic virus (AMV Beet necrotic yellow veinvirus (BNYVV) Tobacco mosaic virus (TMV
RNAi has similarly been used to provide protection against phytopathogenic bacteria. Agro bacterium tumefaciens causes crown gall disease that affects many perennial fruit, nut and ornamental crops. There are two genes that play an important role in this disease: iaaM, encoding a tryptophan monooxygenase that converts tryptophan to the auxin precursor indoleacetamide [Depicker, et al., 1978], and ipt, encoding a product catalysing the condensation of AMP and isopentenyl pyrophosphate to form the cytokinin zeatin [Lichtenstein, et al.,1984]. Expression of both of these oncogenes is required for wild-type tumour formation [Ooms, et al.,1981]. Transgenic Arabidopsis thaliana and Lycopersicon esculentum transformed with RNAi constructs targeting iaaM and ipt showed resistance to crown gall disease. RNA silencing plays an important role in establishing crown gall disease, and plants deficient in silencing are hyper-susceptible to A. tumefaciens [Dunoyer, et al., 2005]. Successful infection relies on a potent anti-silencing state established in tumours whereby siRNA synthesis is specifically inhibited. RNAi has also been used effectively to target nematode genes important for pathogenicity on plants. Expression of silencing constructs against these genes in transgenic plants might provide protection against phytopathogenic nematodes [Bakhetia, et al., 2005].
2.6
Reproduction in plants, particularly male gametogenesis, is an area of intense investigation in plant developmental biology; there is significant commercial interest in controlling crop fertility [Goldberg, et al., 1993; Gorman and McCormick, 1997]. Manipulation of pollen development is crucial for F1 hybrid seed production. Numerous genes have been identified in a diverse range of plant species that show another-specific expression. The manipulation of some of these using transgenic technologies has been used to interfere with male fertility. RNAi has been used to generate male sterility. hpRNA constructs targeting TAZ1, an another-specific zinc-finger protein involved in tapetum development, result in the production of transgenic petunia that have generalized degeneration of the tapetum and extensive microspore abortion, which is initiated soon after their release from pollen tetrads. The few pollen grains that are retained show reduced flavonoloccumulation, defects in pollen wall formation and poor germination [Kapoor, et al., 2002]. Recently, hpRNAi was used to identify the function of the rice gene OsGEN-L. OsGEN-L is a member of the RAD2/XPG nuclease gene family. Most of the OsGEN-LRNAi plants had low fertility, and some were male-sterile. Sterility in this case resulted from a defect in early microspore development [Moritoh, et al.2005]. Another way of using RNAi to create male sterility is to silence anther-specific promoters using hairpin structures directed against promoter sequences. The maize gene MS45 is expressed exclusively in the tapetal layer of anthers during microspore development and mutation results in a male-sterile phenotype. A high frequency of male-sterile plants were obtained by constitutively expressing an inverted repeat construct containing fragments of the Ms45 promoter [Cigan, et al.2005]. The ability to restore male fertility is an important issue for hybrid seed production, particularly in species such as oilseed rape, maize and sunflower where the crop is grown from the second generation seed of hybrid plants. In the case of cytoplasmic male sterility, this is achieved by restorer lines. For engineered sterility using the Barnase gene, male fertility is restored by crossing with a second transgenic line carrying the Barstar gene; a specific cytoplasmic inhibitor of Barnase [Mariani, et al.,1990]. Male fertility is restored after hpRNAi-mediated silencing of the Ms45 promoter by expressing the Ms45 gene under a heterologous promoter [Cigan, et al., 2005]. An alternative approach would be to use an inducible promoter to drive the expression of the silencing construct. This approach has been exploited previously to control the expression of a cytotoxic gene used for creating male sterility in maize [Greenland, et al.,1998], allowing induction of male sterility only when required, with no need for restorer lines.
2.7
The most obvious clinical uses of RNAi are for diseases in which selective depletion of one or few specific proteins would be expected to slow or halt the disease process in the affected cell. In cancer there are two general abnormalities they exhibit disregulation of the
cell cycle resulting in uncontrolled growth and resistant to death as a result of abnormalities in one or more proteins that mediate apoptosis (Nam and Parang, 2003). The goal of RNAi approaches for cancer therapy are therefore to knock out the expression of the cell cycle gene or an anti apoptic gene. The other most promising application of RNAi in the treatment of infectious disease. Pathogens of major importance around the globe, which has been targeted, are HIV, influenza, herpes virus, hepatitis virus B and C, polio and west Nile virus. Cardiovascular disease is a leading cause of death worldwide. It may be possible to use RNAi technologies to intervene in the process of arterioscleroses is up regulation of cell adhesion molecules in vascular cells, which plays an essential role in recruitment of macrophage to the site of damage. The production of cell adhesion molecules can be suppressed in culture cells (Jarad et al., 2002) thus providing a promising approach to overcome this disease. The siRNA directed against specific respiratory disease (RSV) mRNA has resulted in 30-50 times decrease in the level of mRNA (Bilko and Barik, 2001). Unlike classical antisense technology, ds RNA act as a powerful gene silencer, which influences their therapeutic potential. As an ideal therapeutics, RNAi, acts selectively in long term and systematically modulate gene target at a distance from inoculated area. A major constraint in its use is still its delivery problem. The improvement of in-vivo nucleic acid delivery technologies is the most important obstacle to overcome by the scientists in future.
2.8
CONSTRAINTS OF RNAi
The specificity of RNAi is determined by the sequence similarity of the target gene with siRNA generated by silencing constructs. A possible limitation of the technology is the off-target effects of siRNA that might silence nontarget genes [Malik, et al., 2006]. Transcript profiling has been widely used in plant research and yet no off-target effects of RNAi in plants have been reported. Indeed, a system that was developed to identify possible off-target effects in plants found no off-target effects when used to investigate the silencing of salicylic acid-binding protein 2 (SABP2) gene [Kumar, et al.,2006]. Most of the reports of off-target effects of siRNA are of translational repression of non-target genes resulting from partial homology of siRNA to the 30 un-translated regions of genes in animals [Lin, et al., 2005; Birmingham, et al., 2006]. A possible reason for the absence of such effects in plants is that miRNA in plants cause silencing because of their homology with coding sequences that result in cleavage of mRNA [Bartel, 2004]. The development of RNAi-based therapeutics for clinical applications will require improvements to be made in siRNA stability and delivery in vivo, while minimizing off-target and non-specific effects. Several approaches have been used to avoid off-target effects, including chemical modification of 20-O-methyl ribosyl at position 2 in the guide strand, which reduces the silencing of most off-target transcripts [Jackson, et al., 2006]. Recent results show that these modified siRNAs are compatible with intracellular siRNA machinery and are useful for reducing undesirable, sequence-related off-target effects [Elmen, et al., 2005]. However, the use of synthetic siRNAs in plants is still limited to experimental applications and is not useful in the hp strategy, which is widely used in plants for generating siRNAs. Nevertheless, the possibility of off-target effects in plants cannot be ruled out and therefore needs careful attention. Caution is warranted in interpreting gene function and phenotype information resulting from RNAi experiments. RNAi data should be validated using the theoretical and practical tools available to predict and identify the potential off-target effects of siRNAs in plants.
2.9
Double strand RNA (dsRNA) has been shown to be an effective trigger of gene silencing in vertebrate, invertebrates and plant systems (Waterhouse et al., 2001). Using an intron as a spacer fragment in the gene constructs to create an inverted repeat of a gene leading to the production of hpRNA increases the frequency of silencing (Wesley et al., 2001; Smith et al., 2000). The silenced plants produced with a particular construct tend to have differing degrees of silencing ranging from 75 to 100% silencing of the target gene. The hpRNA constructs are efficiently used to get silenced plants for every gene that is targeted, irrespective of whether a viral gene, transgene or endogene (Wesley et al., 2001). With ihp constructs, the efficiency averaged about 90%, and an arm of 400-800 nt appeared to be
stable and effective. These results suggest that ihp constructs will be effective in a wide range of circumstances. The construct producing dsRNA of tomato ACC oxidase, containing DNA fragment with 1002 bp with seven nucleotide long synthesized linker fragments showed highest silencing effect than other linkers, indicating that short linker was more efficient in PTGS (Xiong et al., 2005). To study the effectiveness of gene silencing, Wagner et al. (2005) tried different constructs carrying cinnamyl alcohol dehydrogenase (CAD) gene. Quantitative CAD measurement demonstrated that the construct containing an inverted-repeat of the CAD cDNA was most efficient in triggering gene silencing in Pinus radiata. A major limitation to using hpRNA mediated silencing for high throughput applications is the number of cloning steps needed to produce hpRNA constructs. A high throughput cloning system to generate hpRNA constructs were developed by Helliwell et al. (2002) based on Cre/lox recombination system. In a high throughput application, it is desirable to have the highest possible efficiency of usable clones to reduce the number of bacterial colonies that need to be screened following recombination. These constructs were efficiently used to target two Arabidopsis genes, FLC (flowering locus C) and PDS (Phytoene desaturase). Silencing of PDS gave a range of phenotypes from bleaching of cotyledons to complete bleaching of plant (Helliwell et al., 2002). The replacement of gene fragments by promoter-derived sequences further increased the extent of gene silencing, indicating that non-transcribed genomic region may be more efficient gene silencing element than gene transcripts (Yan et al., 2006). The choice of gene fragment plays a crucial role in target specific gene silencing. The gene fragments ranging from 50bp to 1000bp were used to successfully silence genes (Helliwell et al., 2002). Two factors can influence the choice of length of the fragment, shorter the fragment the less effective silencing will be achieved, but very long hp increases the chance of recombination. The effectiveness of silencing also appears to be gene dependent and could reflect accessibility of target mRNA or the relative abundance of the target mRNA. Hence, fragment length of between 400 and 800bp as a suitable size to maximize the efficiency of silencing.
3.1
MATERIAL USED
Developing cotton ovules 45 days after post anthesis were collected from cotton fields in the A.R.S., Dharwad, Karnataka.
3.1.1
RNA isolation
TM
The total RNA was extracted from cotton ovules using Eppendorf Perfect RNA , Eukaryotic Mini RNA Isolation kit. Diethylpyrocarbonate (DEPC) 0.1 percent, beta merceptoethanol (14.3M), and absolute ethanol (96-100 per cent) were from Himedia. All the solutions and glassware were treated with 0.1 percent DEPC water. The total RNA was isolated from infected and non-infected leaves of groundnut using TM Eppendorf Perfect RNA , Eukaryotic Mini RNA Isolation kit. Accordingly, three ovules devoid of fibres (500 mg) was ground in liquid nitrogen and about 100 mg of the ground material was taken in a tube containing 350l lysis solution and homogenized. The homogenized sample was transferred to a 1.5 ml microcentifuge tube and spun at 15,700 rcf for five minutes. The supernatant was transferred to a fresh 1.5 ml tube, to which 350 l of 70 per cent ethanol was added and mixed by gentle inversions. To this mix, 200 l of Perfect Binding Matrix Solution was added and mixed gently, the lysate/ Binding Matrix mixture was pepited into a Perfect RNA Binding Matrix Spin Column and centrifuged at 15,700 rcf for 30 seconds. Two successive washes with 700l wash solution 1 and 500l wash solution 2 were given by centrifugation for 30 seconds at 15,700 rcf, before eluting RNA from the column with RNase free water. About 50l of RNA preparation was collected and stored at -200C.
3.1.2
Agarose (0.48g) was added to 40ml MOPS buffer and melted in micro oven. After cooling, 720l of 37 percent formaldehyde and 2.5l of ethidium bromide from 10X stock were added and poured into electrophoresis tray for solidification (Appendix I).
3.1.3
One volume of 5X loading dye was mixed with 4 volumes of isolated RNA sample, and incubated at 65C for 5minutes. The electrophoresis unit with tank buffer was run at 45V for 30 minutes prior to loading. Electrophoresis was continued after loading chilled samples at 50V for 5 minutes. The RNA bands in the gel were visualised on a UV-transilluminator and documented using a gel documentation system (Herolab).
3.2
Primers for -cadinene gene (sense) with XhoI and ApaI sites CADXF CADAR 5 CTCGAGATGCCGAGAACGACCTCTACA 3 5 GGGCCCACTTTTGTCAACATCTTTCTACCA 3
Primers for -cadinene gene (antisense) with BamHI and KpnI sites CADBF CADKR 5 GGATCC ATGCCGAGAACGACCTCTACA 3 5 GGTACC ACTTTTGTCAACATCTTTCTACCA 3
3.2.2
Primer concentrations viz., 1 pM, 2.5 pM, 5 pM and 10 pM were used to optimize amplification. Based on the results, 5 pM of cad primers, which gave single intense amplicon, were used for large scale amplification.
3.2.5
PCR amplification
The following PCR amplification conditions were employed for amplification of partial -cadinene gene. Stage I II Step Initial denaturation Denaturation Annealing Extension III Final extension Hold Temperature (C) 94 94 50 72 72 4 Duration (min) 5 1 1 1 20 1 39 No. of cycles 1
3.2.6 Electrophoresis
About 20 l of the reaction mixture from each tube mixed with 3 l of loading dye and were loaded onto 1 per cent agarose gel along side 100bp DNA ladder as molecular weight marker. Electrophoresis was done at 50 V for initial 30 min and then 70 V for 1 hr. The buffer used was 1x TAE (Appendix II) at pH=8.0. The DNA bands in the gel were visualised on a UV-transilluminator and documented using a gel documentation system (Herolab).
3.3
Cloning of the partial -cadinene gene with both sets of primers was done by using InstT/A cloning kit (MBI, Fermantas) following the procedure recommended.
Ref: www.fermentas.com
3.3.2.3 Transformation into E. coli DH5 About 100 l of competent cells and 10l of ligation mixture were taken in a chilled microcentrifuge, mixed gently, and chilled on ice for 30 min. Heat shock was given by shifting the chilled mixture to 42C water bath for exactly 2 min, followed by chilling in ice for 5 minutes. To this 900 l of Luria broth (Appendix V) was added and incubated at 37C at 200 rpm for 45 minutes to allow bacteria to recover and express the antibiotic marker encoded by the plasmid. The cells were pelleted at 13,000 rpm for 1 min. The pellet was dissolved in the remaining 100l of supernatant after discarding 900l of supernatant. The dissolved pellet was spread on Luria agar plates having Amp50, X-gal, and IPTG, and incubated for 10-12 hours at 37C. The recombinant clones were identified by blue/white assay. The white colonies having recombinant were picked up and streaked on plates having Luria agar with Amp100, Xgal, IPTG and reincubated at 37C overnight, for multiplication.
3.3.4
Sequencing of clones
The partial -cadinene amplicon cloned in pTZ57R/T was sequenced using M13F/R primers, at Bangalore Genei Private Ltd., Bangalore. The sequences were subjected to analysis using BLAST algorithm available at http://www.ncbi.nim.nih.gov.
3.4
The generic ihp vector is derived from pRT100, a cloning vector carrying plant expression T-DNA cassette. The generic ihp vector has a functional catalase (CAT) intron from castor, downstream to CaMV 35S promoter. The presence of multiple cloning sites on either side of the introns helps in cloning inserts directionally.
3.4.1
For cloning of partial -cadinene gene into generic ihp vector (Source: Dr. Dineshkumar, DOR, Hyderabad), the Vector DNA was isolated using the alkaline lysis protocol of Brimbion and Dolly (1979) with certain modifications as described earlier at section 3.3.3. Plasmids DNA were quantified by agarose gel electrophoresis as described earlier at section 3.2.6. 3.4.1.1 Preparation of generic ihp vector and inserts for antisense cloning Sequential digestion of generic ihp vector was done separately with two restriction enzymes Kpn I and BamHI (Appendix VII) for cloning in antisense orientation. The linearized vector was eluted and was extracted using eppendorf gel cleanup kit as per the protocol given in users manual. For cloning partial -cadinene gene in antisense orientation, PCR amplification was done with respective gene specific primers having Kpn I and BamHI restriction sites in forward and reverse primers respectively, to help antisense cloning. The specific amplicon from above PCR reactions was digested with Kpn I and BamHI restriction enzymes and purified using eppendorf PCR purification kit as per users manual and quantified using standard DNA markers. 3.4.1.2 Preparation of generic ihp vector and inserts for both sense and antisense cloning to get ihp insert
The recombinant ihp plasmid clones having antisense insert of partial -cadinene gene was digested separately with two restriction enzymes ApaI and XhoI (Appendix VIII) for cloning in sense orientation. The linearized vector was eluted and extracted using eppendorf gel cleanup kit as per the protocol given in users manual. For cloning partial -cadinene gene in sense orientation, recombinant ihp vector containing antisense insert was taken. PCR amplification was done with respective gene specific primers having ApaI and XhoI restriction sites in forward and reverse primer respectively, to help sense cloning. The specific amplicon from above PCR reactions was digested with ApaI and XhoI and purified using eppendorf PCR purification kit as per users manual and quantified using standard DNA markers.
3.4.2
The ligation reaction, preparation of competent cells, transformation of E. coli DH5 and confirmation of clones were done as described earlier in 3.3.3. The ligation mixture composition is as follows Components Generic ihp vector Insert T4 DNA ligase (5U) T4 ligase buffer (10X) Deionised water Total Sense 2 l 4 l 2 l 2 l 10 l 20 l Sense+ Antisense 2 l 4 l 2 l 2 l 10 l 20 l
3.5
described earlier at section 3.3.3. Plasmids DNA were quantified by agarose gel electrophoresis as described earlier at sectin 3.2.6.
3.5.2
Plant expression vector pCAMBIA1305.1 is a promoterless vector used for cloning inserts along with regulatory elements for expression studies. It was digested with PstI restriction enzyme (Appendix IX) for cloning entire expression cassette with insert. The linearized vector was eluted and extracted using eppendorf gel cleanup kit as per the protocol given in users manual. For cloning entire expression cassette of ihp, (sense and antisense) recombinant plasmid was digested with PstI and the released expression cassette was gel eluted and purified using Eppendorf gel cleanup kit, as per users manual and quantified using standard DNA marker.
3.6
The confirmed clones were further mobilized into Agrobactrium tumefaciens LBA4404 by triparental mating. The vector, pCAMBIA1305.1 is capable of replicating in both E. coli as well a Agrobacterium and have genes for hygromycin resistance in its T-DNA and is used as selectable marker in plants. The strain has chromosomal selection rifampicillin (25g/ml) and disarmed Ti-plasmid pAL4404, having gene for streptomycin resistance (100g/ml) as selectable marker. E. coli strain containing pRK2013 vector with gene for kanamycin resistance was used as a helper for mobilizing the recombinant vector into A. tumefaciens LBA4404. E. coli DH5 cells having recombinant plant transformation vector pCAMBIA1305.1 were grown overnight in Luria broth containing 50 g/ml of kanamycin at 370C. The A. 0 tumefaciens LBA4404 was grown for 16-20 hours at 28 C in Yeast Extract Mannitol Agar (Appendix X) containing Rifampicillin (25g/ml) and Streptomycin (100g/ml). The E. coli DH5 pRK2013 strain was grown overnight in LB containing kanamycin (50g/ml). The overnight grown cultures were centrifuged at 13000 rpm for 1 min. The supernatant was discarded and the pellet was washed with 0.01 MgSO4 for 2-3 times to remove traces of antibiotics. It was again centrifuged at 13,000 rpm for 1 min and pellet was dispensed in 50 l of 0.01 M MgSO4. A. tumefaciens LBA4404, E. coli DH5 (pRK2013) and E. coli containing pRK was mixed in 1:2:2 ratios separately. The mixture was spotted on plain 0 LA medium and incubated overnight at 28 C. The spotted culture was scraped and dissolved in 200 l of 0.01 M MgSO4 and spotted on YEMA medium containing streptomycin (100g/ml). Rifampicillin (25g/ml) and kanamycin (50g/ml) along with A. tumefaciens LBA4404, E. coli helper strain and E. coli with recombinant vector as negative control.
The presence of recombinant plasmid in the Agrobacterium was confirmed by PCR amplification.
3.7
Agrobacterium containing construct pCAMBIA with -cadinene synthase (sense, antisense/ihp) was used for transformation of cotton (Genotype Sahana, Gossypium hisrsutum). For development of transgenic cotton, the transformation protocol developed by Katageri et al., 2007 was followed to generate T0 plants. Seeds were delinted with sulphuric acid and soaked in HgCl2 (50 mg/l) for 30 min and kept for shaking (50 rpm) on a rotary shaker. Seeds were rinsed three times with sterile double-distilled water and germinated at 28C in the dark for 3 days and later shifted to light and dark (16/8 h) rotation to obtain healthy seedlings. Seedlings (78-day-old) grown aseptically on MS (Appendix XI) medium, were used for isolation of shoot apex. Agrobacterium tumefaciens (LBA4404) harbouring a binary vector (pCAMBIA) was grown overnight at 28C. The binary vector carries a PTGS construct with -cadinene sense and antisense genes driven by CaMV 35S promoter. Healthy shoot apices were bisected from apex to base producing two asymmetrical halves. Both the halves were inoculated with A. tumefaciens diluted (1: 20) in virulence induction medium (MS medium containing 2.0% glucose, octopine 100 mg/l and 100 mM acetosyringone) followed by vacuum infiltration for 5 min. The explants were incubated on co-cultivation medium (MS medium containing 2 mg/l of benzyl adenine) for 3 days at 22C. After 3 days of co-cultivation, shoots were transferred to shoot growth medium (MS medium containing 100 mg/l myo-inositol, 0.5 mg/l thiamine HCl, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine HCL and 2% sucrose at pH 5.7) and incubated in diffuse light at 26 2C for a 60 days. Further analyses of the plants were carried out.
3.8
3.8.1
The total DNA from cotton leaf sample was isolated by following CTAB protocol (Sambrook et al., 1989) with some modifications. Two grams of leaf sample was ground in liquid nitrogen to a fine powder and transferred quickly to 50ml centrifuge tube containing 10 ml of pre-warmed extraction buffer (0.1 M Tris base, 0.05 M EDTA, 0.1 M NaCl, 2% CTAB, 0.1% mercaptoethanol, 0.1% PVP) (Appendix XIII) was immediately added to 50 ml centrifuge tubes and kept in 65C water bath for 10-15 min with intermittent mixing. After cooling to room temperature, equal volumes of chloroform: isoamylalcohol (24:1) was added and mixed by inverting. It was centrifuged at 10,000 rpm for 10 min at 4C. The supernatant was carefully taken into fresh tube and equal volume of chilled isopropanol was added and gently mixed. It was kept at 20C for 2 hrs and then the DNA was pelleted at 15,000 rpm for 10 min. The pellet was washed with 70 per cent ethyl alcohol, air dried, dissolved in 500 l of T10E1 with 5l of RNase (10 mg/ml) and incubated at 37C for 1 hr. The DNA was further purified by adding equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) and centrifuged at 10,000 rpm for 10 min at 4C. The aqueous phase was collected and equal volume of chloroform: isoamyl alcohol (24:1) was added and again centrifuged at 15,000 rpm th for 10 min at 4C. To the supernatant 1/10 volume of 3M sodium acetate and twice the volume of chilled ethanol were added, left for 30 min at room temperature and then centrifuged. After discarding the supernatant, the pellet was washed with 70 per cent alcohol, air-dried and dissolved in 100 l of T10E1. The total DNA isolated was quantified by spectrophotometeric method as given by Sambrook and Russel (2001).
3.8.2
PCR analysis
Genomic DNA isolated from putative transgenic lines was tested for the presence of insert. PCR was performed using hptII specific primers in a 20 l PCR reaction containing 1U of Taq DNA polymerase, 2mM dNTP mix, 5 pmoles of each primer, 1x Taq assay buffer. For 0 PCR standard protocol was followed except the annealing temperature (55 C for 1 min). Vector DNA and non-transgenic plant DNA were used as positive and negative control, respectively. The following primer combination was used for hptII amplification; Forwad-5'
4 EXPERIMENTAL RESULTS
The primary aim of this investigation was to develop post-transcriptional gene silencing constructs (PTGS) of -cadinene synthase genes to prevent the expression of gossypol in cotton. The result of various experiments done is presented below. Total RNA was isolated from developing cotton ovules of 45 days after post anthesis, by using eukaryotic mini RNA isolation kit Eppendorf and cDNA was synthesized using cMaster RT-KIT Eppendorf which was later used as template for further amplification.
4.1
The PCR was carried out using gene specific primers against -cadinene cDNA, obtained from total RNA isolated (Plate 1) from developing cotton ovules of 45 days after post anthesis. The amplifications were standardized with the help of gradient PCR (Plate 1) and the specific amplicon (600bp) obtained from both sense and antisense primers were separated on 1.0 per cent agarose gel (Plate 1). The 600 bp amplicon of -cadinene genes was eluted from preparative gels. pTZ57R/T was used as cloning vector for cloning the amplified fragments. E. coli DH5 was transformed separately with molecules using 10 l of ligation mixture. Super coiled plasmid DNA of pTZ57R was used as positive control. The transformation efficacy was found to be 4 0.45 x 10 CFU/g of the recombinant molecules. The transformed cells that appeared white on Luria agar containing ampicillin (100 ppm), X-gal (32 ppm) and isopropyl -D-thiogalactoside (IPTG; 38.4 ppm) were isolated and confirmed through PCR amplification for the presence of antisense and sense inserts with gene specific primers respectively (Plate 2). The clones amplified for respective inserts were further confirmed through restriction analysis using KpnI and BamHI for antisense construct and with ApaI and XhoI restriction enzymes for sense construct, which released 600 bp (Plate 2). The recombinant clones were named as pGhCADI and pGhCADII (Fig. 3).
4.2
The partial -cadinene gene cloned in pTZ57R/T was sequenced using M13F/R primers at Bangalore Genei Pvt Ltd, Bangalore. The complete nucleotide and deduced amino acid sequences are presented in the (Fig. 4), respectively. These sequences were subjected to homology search analysis using BLASTn and BLASTp algorithms available at http:// www.ncbi.nlm.nih.gov. The homology search revealed that partial 600bp -cadinene gene showed maximum homology of 99.8% with Gossypium arboretum (U23205),and 98.8%homology with Gossypium hirsutum(AF270425)(Table 4) (Fig.5). The sequences were subjected to further analysis in BTI software of GeneTool for finding restriction sites and the sequences did not have any internal restriction sites for BamH1, Kpn I, Apa I and Xho I and Pst I (Fig. 6).
4.3
The generic ihp vector isolated in large quantities was restricted with XhoI and ApaI to facilitae directional cloning of sense fragment, and KpnI and BamHI to facilitate directional cloning of antisense fragment. To clone -cadinene gene in antisense orientation, specific primers having restriction sites KpnI and BamHI were used to amplify the gene. The linearized vector was ligated separately with amplicon at 1:3 molar concentrations and, transformed into E. coli DH5. The transformants were picked and streaked on Luria agar containing kanamycin (50 g/ml). Plasmid DNA isolated from these clones was confirmed through PCR (Plate 3) and restriction analysis (Plate 3) using KpnI and BamHI enzymes, separately and named as pGhCADIII. To clone -cadinene gene in sense orientation, specific primers having restriction sites XhoI and ApaI was used to amplify the gene. The linearized vector was ligated separately with amplicon at 1:3 molar concentrations, and transformed into E. coli DH5. The transformants were picked and streaked on Luria agar containing kanamycin (50 g/ml).
Plasmid DNA isolated from these clones were confirmed through PCR (plate 3) and restriction analysis (plate 3) using XhoI+ApaI enzymes. The clones were named as pGhCADIV. The construct map of ihp vector containing sense and antisense inserts were represented in fig 7.
4.6
Agrobacterium containing construct pCAMBIA with -cadinene synthase (sense+antisense/ihp) was used for transformation of cotton genotype Sahana. (Gossypium hisrsutum).Cotton plant transformation method developed by Katageri et al., 2007 was followed to generate T0 plants. For every 100 transgenic plants 2-5 plants survived (Plate 5).
4.7
4.7.3
Estimation of gossypol
Gossypol content was estimated in 150 mg leaf sample of both control and transgenic plants, 5-8 g/mg was found in control plants. 0.07 g/mg was found in transgenic plant. A drastic reduction of gossypol content in transgenic plant was observed compared to control plant.
Plate 1. Total RNA isolation and PCR standerdization of -cadinene gene 1a) RNA ISOLATION 1. 100 bp DNA Ladder 2-3 Totla RNA from cotton ovules 1b) PCR TEMPERATURE STANDERDISATION OF -CADINENE GENE 1. 100 bp DNA Ladder 2-11 Temperature Gradient from 470C-570C 1c) LARGE SCALE AMPLIFICATION OF -CADINENE GENE WITH ANTISENSE PRIMERS 1. 100 bp DNA Ladder
3-5 600 bp Amplification of partial -cadinene gene 1d) LARGE SCALE AMPLIFICATION OF -CADINENE GENE WITH SENSE PRIMERS 1. 100 bp DNA Ladder 2-4 600 bp Amplification of partial -cadinene gene
Plate 2. PCR and Restriction confimation of pTZR/T clones containing partial cadinene gene 2a) PCR confimation of pTZR/T clones containing partial antisense -cadinene gene 1. 2. 3. 4. DNA /Hind III digest Positive control cDNA Negetive control 600 bp amplification of partial -cadinene gene
2b) Restriction (BamHI and KpnI) confimation of pTZR/T clones containing partial antisense -cadinene gene 1. DNA /Hind III digest 2. pGhCADI restricted with BamHI and KpnI 3. Uncut pTZ57R/T vector
2c) PCR confimation of pTZR/T clones containing partial sense -cadinene gene 1. 2. 3. 4. Positive control cDNA Negetive control 600 bp amplification of partial -cadinene gene DNA /Hind III digest
2d) Restriction (ApaI and XhoI) confimation of pTZR/T clones containing partial sense -cadinene gene 1. DNA /Hind III digest 2. pGhCADII restricted with ApaI and XhoI
Plate 2. PCR and Restriction confimation of pTZR/T clones containing partial cadinene gene
Fig. 3: Construct maps of pTZ57R/T carrying partial -cadinene sense and antisense gene
ATGCCGAGAACGACCTCTACACCACATCCCTTCGATTCCGATTACTCCGAGAGCA TGGATTCAATGTTTCATGCGACGTATTCAACAAGTTTAAAGACGAGCAAGGGAATT TCAAGTCATCCGTGACAAGCGATGTTCGAGGATTGTTGGAACTTTACCAAGCTTC CTATTTGAGGGTTCATGGGGAAGATATATTGGATGAAGCAATTTCTTTCACCACCA ACCATTTAAGCCTTGCAGTAGCATCTTTGGACTATCCGTTATCCGAAGAGGTTTCA CATGCTTTGAAACAATCAATTCGAAGAGGCTTGCCAAGGGTTGAGGCAAGACACT ATCTTTCAGTATACCAAGATATTGAGTCCCATAATAAGGTTTTGTTGGAGTTTGCT AAGATCGATTTCAACATGGTACAACTTTTGCATAGGAAAGAGCTAAGTGAGATTTC TAGGTGGTGGAAGGATTTAGACTTTCAAAGAAAGTTGCCATACGCAAGAGATAGA GTGGTTGAAGGCTATTTTTGATCTCAGGATGTACTTTGAGCCCCAATATTCTCTTG GTAGAAAGATGTTGACAAAAGTGATAGCAATGGCTTCTATTGTAGA
Fig. 4: 600 bp Nucleotide sequence of partial -cadinene gene fragment
Table 4. Homology of the 600 bp dCS trigger sequence to various isoforms of -cadinene synthase gene from cotton Homology with the trigger sequence (%) 99.8 98.8 98.5 96.4 96.2 96.0 92.9 90.9 80.9
-cadinene synthase gene Cad1-C14 (XC14) Cdn1-C4 Cdn1 Cad1-C2 Cad1-C3 Cad1-C1 (XC1) Cad1-B Cdn1-D1 Cad1-A
Plant source G. arboreum G. hirsutum G. hirsutum G. arboreum G. arboreum G. arboreum G. arboreum G. hirsutum G. arboreum
Genbank accession no. U23205 AF270425 U88318 Y16432 AF174294 U23206 X95323 AY800107 X96429
Accession
Description
U23205.1
Gossypium arboreum (+)-deltacadinene synthase isozyme 1110 XC14 mRNA, complete cds 1099
1110
100%
0.0
99%
Gossypium hirsutum (+)-deltaAF453326.1 cadinene synthase mRNA, partial cds Gossypium hirsutum (+)-deltaAF270425.1 cadinene synthase (cdn1-C4) mRNA, partial cds U88318.1 Gossypium hirsutum (+)-deltacadinene synthase (cdn1) mRNA, complete cds
1099
99%
0.0
99%
1077
1077
100%
0.0
98%
1066
1066
100%
0.0
98%
Y16432.1
Gossypium arboreum mRNA for 994 (+)-delta-cadinene synthase Gossypium arboreum (+)-deltacadinene synthase isozyme 983 XC1 mRNA, complete cds 667
994
100%
0.0
96%
U23206.1
983
100%
0.0
96%
1092
100%
98%
Gossypium arboreum (+)-deltaAF174294.1 cadinene sythase (CAD1-C1) 617 gene, complete cds Gossypium hirsutum (+)-deltaAY800007.1 cadinene synthase (cdn1-C7) pseudogene, partial sequence X95323.1 Gossypium arboreum cad1-b gene for (+)-delta-cadinene synthase 582
886
87%
96%
705
73%
96%
579
700
74%
95%
Gossypium hirsutum (+)-deltaAY800008.1 cadinene synthase (cdn1-C8) pseudogene, partial sequence Gossypium hirsutum (+)-deltacadinene synthase (cdn1-C6) AY800006.1 pseudogene, complete sequence
579
792
87%
94%
532
893
98%
95%
Accession
Description
Max Total Query E Max score score coverage value ident 1e143 1e133 1e133
Gossypium hirsutum (+)-deltaAY800107.1 cadinene synthase (cdn1-D1) gene, complete cds X96429.1
518
626
73%
93%
Gossypium arboreum mRNA for cadinene synthase (cad1-A 484 gene) Gossypium arboreum (+)-deltacadinene synthase isozyme A 484 mRNA, complete cds Gossypium arboreum cad1-A gene 250
484
99%
81%
U27535.1
484
99%
81%
Y18484.1
447
86%
6e-63 88%
Gossypium barbadense (+)AF456410.1 delta-cadinene synthase (cad1- 185 A) gene, partial cds
306
60%
2e-43 87%
sp|Q39760|DCS2_GOSAR (+)-delta-cadinene synthase isozyme XC14... 400 gb|AAL50780.1| (+)-delta-cadinene synthase [Gossypium hirsutum] gb|AAX44033.1| (+)-delta-cadinene synthase [Gossypium hirsutum] 397 397
2e-110
gb|AAF74977.1|AF270425_1 (+)-delta-cadinene synthase [Gossypi... 397 sp|P93665|DCS1_GOSHI (+)-delta-cadinene synthase (D-cadinene ... 395
sp|Q39761|DCS1_GOSAR (+)-delta-cadinene synthase isozyme XC1 ... 389 sp|O49853|DCS4_GOSAR (+)-delta-cadinene synthase isozyme C2 (... 389 gb|AAD51718.1| (+)-delta-cadinene sythase [Gossypium arboreum] gb|AAX44034.1| (+)-delta-cadinene synthase [Gossypium hirsutum] 386 364
emb|CAD90835.1| (+)-delta-cadinene synthase [Gossypium arboreum] 354 emb|CAA77191.1| (+)-delta-cadinene synthase [Gossypium arboreum] 345 sp|Q43714|DCS3_GOSAR (+)-delta-cadinene synthase isozyme A (D... 345
Fig. 5: Nucleotide and aminoacid blast result of 600 bp partial -cadinene synthase gene
Plate 3. PCR and Restriction confirmation of ihp clones 3a) PCR confirmation of pGhCADIII clones 1. 2. 3. 4. 100 bp DNA Ladder Positive control cDNA Negetive control (ihp vector with out insert) 600 bp amplification of Partial Antisense -cadinene gene
3b) PCR confirmation of pGhCADIV clones 1. 2. 3. 4. DNA/ HindIII digest Positive control cDNA Negetive control (ihp vector with out insert) 600 bp amplification of Partial sense -cadinene gene
3c) Restriction (BamHI and KpnI) confirmation of pGhCADIII clones 1. DNA /EcoRI/Hind III Double digest 2. Positive control cDNA 3. linearized ihp Vector 4. pGhCADIII clone restricted with BamHI and KpnI 3d) Restriction analysis of generic ihp vector carrying sense and antisense inserts 1. DNA /EcoRI/Hind III Double digest 2. Positive control (600 bp amplification from cDNA) 3. Linearized ihp vector 4. pGhCADIII restricted with KpnI and BamHI 5. pGhCADIV restricted with ApaI and XhoI 6. pGhCADIII restricted with PstI 7. pGhCADIV restricted with PstI
A) pRT100 backbone
C: Generic ihp vector carrying sense and antisense partial cad inserts
CA
CA
Ref: www.cambia.org
Plate 4. PCR and Restriction analysis of pCAMBIA1305.1 carrying -cadinene synthase gene 4a) PCR confirmation of pGhCADV clones 1. 100 bp DNA Ladder 2. Positive control cDNA 3. Negetive control (pCAMBIA1305.1 vector with out insert) 4-7 600 bp amplification
4b) Restriction (PstI) analysis of pGhCADV clone 1. 1 kb DNA Ladder 2. Linearized pCAMBIB1305.1 vector 3. pGhCADV digested with PstI 4c) PCR amplification of partial -cadinene gene from Agrobacterium(LBA4404) 1. 100 bp DNA Ladder 2-5 600 bp amplification 4d) PCR amplification of cotton plant DNA with hptII primers 1. DNA /EcoRI/Hind III Double digest 4. 7. 800 bp amplification from transgenic cotton DNA Negetive control (DNA from non transgenic cotton plant)
Plate-4. PCR and Restriction analysis of pCAMBIA 1305.1 carrying -cadinene synthase gene
5 DISCUSSION
Global cotton seed production can potentially provide the protein requirement for half a billion people per year. However, it is woefully underutilized because of the presence of toxic gossypol within seed glands. Therefore, elimination of gossypol from cottonseed has been a long standing goal of geneticist. Gossypol besides its presence in roots and foliar tissues of the plant, is dominant terpene aldehyde in the storage glands of cotyledons in the developing mature cottonseed. Gossypol is toxic to non ruminant animals, and so it reduces the commercial value of seed meal used for animal feeds and must be removed from cottonseed oil prior to consumption. Gossypol engineering may provide another means of generating the trait of gossypol free seed in cultivated cotton species through the disruption of terpenoid biosynthesis especially in seeds. But this will require a greater understanding of the complex set of genes regulating the synthesis of the cotton sesquiterpenes. Silencing of multigene families appears to be more complex than can often be explained by current models of PTGS. Antisense suppression of delta cadinene genes blocking the cadinene type sesquiterpenes pathway was envisaged as a way to activate the suppression of gossypol synthase in cotton. Antisense transgene constructs have worked best when multiple copy insertions generate inverted repeats that produce hairpin transcripts that fold into double-stranded RNAs that in turn trigger PTGS (Baulcombe., 1996). Crossing plants in with sense and antisense transgenes can also result in gene silencing through the production of large amount of dsRNA (Jorgensen., 2003 ). Small 21 to 25 mers (siRNAs) generated from cleavage of the dsRNA molecules by DICER proteins then become part of a nuclease containing RNA induced silencing complex that uses these siRNAs to target sequence specific degradation dependant on the presence of near-perfect matches to the siRANs. Antisense suppression, when activated, should therefore target all expressed genes sharing at least one of these siRNA domains (Aigner., 2006). So silencing of all members of multigene families by constructs containing a single family member is highly likely, unless specific conserved domains are selected to generate the initial dsRNA. Therefore in this investigation we have made an attempt to develop PTGS construct to silence all the multigene families of (+) - cadinene synthase.
5.1
Based on the available information of nucleotide sequences of delta cadinene genes,all delta cadinene genes were multialigned and primers were designed to the most conserved region of 600bp. The purified PCR product of 600 bp from transformants were screened through blue/white assay. The white colonies were further analyzed by PCR and the clones were also confirmed by restriction analysis. In silico analysis of the cloned nucleotide sequence of cadinene synthase revealed maximum of 99.8 per cent homology at nucleotide level and 100 per cent at amino acid level with the published sequence in database. Further restriction sites analysis was done using BTI software GeneTool. For developing ihp construct delta cadinene genes were cloned into a generic ihp vector. In sense orientation using Apa I and Xho I sites and also in antisense orientation using Kpn I and Bam HI sites. The ligated products were transformed into to E. coli DH5 and the transformants were confirmed by PCR and restriction analysis. The entire expression cassette was released from generic ihp vector carrying sense and antisense using PstI sites and cloned into pCAMBIA 1305.1 a promoter less plant transformation vector. The ligated products were transferred into E. coli DH5 and transformants so obtained were mobilized into Agrobacterium tumefaciens LBA4404 by triparental mating using E. coli carrying pRK2013 as helper plasmid.
5.2
The Agrobacterium tumefaciens containing PTGS construct was used to develop transgenic cotton. Genotype independent genetic transformation protocol developed by Katageri et al., (2007) was followed using Gossypium hirsutum genotype Sahana. For every 100 transgenic plants, only 2-5 plants were survived as the PTGS construct targeted the whole plant. Percentage survival of the transgenic plants can be increased by using seed specific promoter. The transgene integration in plant genome was confirmed through PCR amplification of hptII gene. The presence of single ~800bp amplicon in transformed plants corresponding to positive control indicated the integration of transgene (T-DNA).
5.3
EXPRESSION STUDIES
Gossypol glands of control and transgenic plants were observed in leaves, under 2. stereoscopic microscope. In control plants, 60-100 glands were observed per 1cm In 2 transgenic however only 5 glands per 1cm were observed. Gossypol content was estimated both in control and transgenic plants. Per 150mg of leaf sample 5-8 g/mg of gossypol was found in control, and 0.07 g/mg was found in transgenic plant. Drastic reduction of gossypol in transgenic plant was observed compared to control plant. FUTURE LINE OF WORK As the gossypol provides constitutive and inducible protection against pest and diseases, it is advised to use Seed specific promoter for preventing the production of gossypol only in cotton seeds.
1. A 600bp DNA fragment was amplified using -cad gene specific primer from ovules, 45 days after post anthesis. 2. The amplicon was cloned in PTZ57R/T containing T-overhangs at Eco321 site and transformed into E. coli DH5. Transformants were selected on the basis of blue white assay. PCR and restriction were done for clonal confirmation. The clone was named as pGhCADI with antisense insert and pGhCADII with sense insert. The analysis of the sequence revealed maximum of 99.8% homology at nucleotide and 100% homology at aminoacid level with reported sequence in the database. 3. The pGhCADI insert was digested with Kpn1 and Bam H1 and subcloned into generic ihp vector in antisense orientation. The clone was named pGhCADIII. 4. The recombinant clone pGhCADII was digested with Apa1 and Xho 1 to facilitate sense cloning to develop hairpin construct and the clone was named pGhCADIV. 5. The expression cassette carrying insert from generic ihp vector was then subcloned into plant transformation vector pCAMBIA 1305.1 to facilitate plant transformation. The clone was named pGhCADV. 6. The recombinant clones of pGhCADV were then mobilized into Agrobacterium tumefaciens LBA4404 by tri parental mating. 7. The agrobacterium LBA4404 carrying recombinant clones were used to develop transgenic cotton and T0 transgenic plants were confirmed through PCR using hptII primers. 8. Gossypol glands were counted both in control and T0 transgenic plants under stereoscopic microscope. Very few glands were observed in transgenic plant compared to control plant.
Gossypol was estimated both in control and transgenic plants. A drastic reduction of gossypol was found in transgenic plant compared to control plant.
7. REFERENCES
Aigner, A., 2006, Gene silencing through RNA interference (RNAi) in vivo: Strategies based on the direct application of siRNAs. Biotechnology, 24:12-25. Allen, R. S., Millgate, A. G., Chitty, J. A., Thistleton, J., Miller, J. A. C., Fist, A. J., Gerlach, W. L. and Larkin, P. J., 2004, RNAi-mediated replacement of morphine with the nonnarcotic alkaloid reticuline in opium poppy. Nat. Biotechnol, 22: 1559-1566. Anderson, J., Banerjea, A. and Akkina, R., 2003, Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides, 13:303-312. Andika, I. B., Kondo, H. and Tamada, T. 2005, Evidence that RNA silencing-mediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol Plant Microbe Interact, 18: 194-204. Arenz, C. and Schepers, U., 2003, RNA Interference: from an ancient mechanism to a state of the art therapeutic application?. Naturwissenschaften, 90: 345-359. Bakhetia, M., Charlton, W., Atkinson, H. J. and McPherson, M. J., 2005, RNA interference of dual oxidase in the plant nematode Meloidogyne incognita. Mol. Plant Microbe Interact. 18: 10991106. Banerjea, A., Li, M.-J., Bauer, G., Remling, L., Lee, N.-S., Rossi, J. and Akkina, R., 2003, Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages. Mol. Ther, 8:62-71. Bartel, D. P., 2004, MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116: 281297. Baulcombe, D. C., 1996, RNA as a target and an initiator of post-transcriptional gene silencing in transgenic plants. Plant Molecular Biology, 32: 79-88. Baulcombe, D., 2004, RNA silencing in plants. Nature, 431:356-363. Bell, A. A., 1981, Biochemical mechanisms of disease resistance. Annual Review Plant Physiology, 32:21-81. Bendahmane, M. and Gronenborn, B., 1997, Engineering resistance against tomato yellow leaf curl virus (TYLCV) using antisense RNA. Plant Mol. Biol. 33: 351357. Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J., 2001, Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409:363369. Bilko,V. and Barik, S., 2001, Phenotypic silencing of cytoplasmic genes using sequence specific double stranded interfering RNA and its application in the reverse genetics of wild type negative strand RNA viruses. Biomedical Center Microbiology, 1: 34-55. Birmingham, A, Anderson, E. M., Reynolds, A., Ilsley-Tyree, D., Leake, D., Fedorov, Y., Baskerville, S., Maksimova, E., Robinson, K., Karpilow, J., Marshall, W. S., Khvorova, A, 2006, 3' UTR seed matches, but not overall identity are associated with RNAi off-targets. Nat Methods, 3:199-204. Bisaro, D. M., 2006, Silencing suppression by geminivirus proteins. Virology, 344:158-168. Brossollet, V. C. and Vaquero, C., 1998, Do natural antisense transcripts make sense in eukaryotes?. Gene, 211:1-9. Byzova, M., Verduyn, C., De Brouwer, D. and De Block, M., 2004, Transforming petals into sepaloid organs in Arabidopsis and oilseed rape: implementation of the hairpin RNAmediated gene silencing technology in an organ-specific manner. Planta, 218: 379387. Chory, J., Ecker, J. and Briggs, S., 2000, functional genomics and the virtual plant.A blue print for understanding how plants are built and how to improve them. plant physiology,123:423-425.
Cigan, A. M., Unger-Wallace, E. and Haug-Collet, K., 2005, Transcriptional gene silencing as a tool for uncovering gene function in maize. Plant J. 43: 929940. Cogoni, C., Irelan, J. T., Schumacher, M., Schmidhauser, T. J., Selker, E. U., and Macino, G., 1996, Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO Journal, 15: 31533163. Couzin, J., 2002, Breakthrough of the year. Small RNAs make big splash. Science, 298:22962297. Day, A. G., Bejarano, E. R., Buck, K. W., Burrell, M. and Lichtenstein, C. P., 1991, Expression of an antisense viral gene in transgenic tobacco confers resistance to the DNA virus tomato golden mosaic virus. Proceeding of National Academy of Science, 88: 67216725. Depicker, A., Montagu, M. V. and Schell, J., 1978, Homologous DNA sequences in different Ti-plasmids are essential for oncogenicity. Nature, 275: 150153. Doench, J. G., Peterson, C. P. and Sharp, P. A., 2003, siRNAs can function as miRNAs. Genes Development, 17: 438-442. Dunoyer, P., Himber, C. and Voinnet, O., 2005, DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nature Genetics, 37: 1356-1360. Dunoyer, P., Himber, C. and Voinnet, O., 2006, Induction, suppression and requirement of RNA silencing pathways in virulent Agrobacterium tumefaciens infections. Nat. Genet, 38: 258-263. Elbashir, S. M., Lendeckel, W. and Tuschl, T., 2001, RNA interference is mediated by 21-and 22-nucleotide RNAs. Genes Dev, 15:188-200. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T., 2001, Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 411:494-498. Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckerl, W. and Tuschl, T., 2001, Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO Journal, 20: 6877-6888. Eldik, V. G. J., Litiere, K., Jacobs, J. J., Van Montagu, M., De Carvalho, N. F., Frendo, P., VanMontagu, M. and Cornelissen, M., 1998, Silencing of beta-1,3-glucanase genes in tobacco correlates with an increased abundance of RNA degradation intermediates. Nucleic Acids Research, 26:5176-5181. Elmen, J., Thonberg, H., Ljungberg, K., Frieden, M., Westergaard, M., Xu, Y., Wahren, B., Liang, Z., Orum, H., Koch, T and Wahlestedt, C., 2005, Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality. Nucleic Acids Res, 33: 439447 Fagard, M., Boutet, S., Morel, J.-B., Bellini, C. and Vaucheret, H., 2000, AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc. Natl. Acad. Sci. USA, 97:11650-11654. Fire, A., Xu, S., Mary, K., Montgomery., Steven, A., Kostas., Driver, S, E. and Mello, C. C., 1998, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391: 806-811. Fortier, E. and Belote, J. M., 2000, Temperature-dependent gene silencing by an expressed inverted repeat in Drosophila. Genesis, 26:240-244. Francesco., Di Serio., Schob, H., Iglesias, A., Tarina, C., Bouldoires, E. and Meins, F., 2001, Sense- and antisense-mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs. Proceedings of National Academi of Science , 98: 65066510.
Fukusaki, E., Kawasaki, K., Kajiyama, S., An, C. I., Suzuki, K., Tanaka, Y. and Kobayashi, A., 2004, Flower color modulations of Torenia hybrida by downregulation of chalcone synthase genes with RNA interference. Journal of biotechnology, 111:229-240. Goldbach, R., Bucher, E. and Prins, M., 2003, Resistance mechanisms to plant viruses: an overview. Virus Res, 92: 207-212. Goldberg, R, B., Beals, T. P. and Sanders, P. M., 1993, Anther development: basic principles and practical applications. Plant Cell, 5: 1217-1229. Gorman, S. W. and Mc Cormick, S., 1997, Male sterility in tomato. Crit. Rev. Plant Sci, 16: 3153. Greenland, A. et al. (1998) Reversible male sterility: a novel system for production of hybrid corn. Symp. Soc. Exp. Biol, 51: 141147. Grierson, D., Fray, R. G., Hamilton, A. J., Smith, C. J. S. and Watson, C. F., 1991, Does cosuppression of sense genes in transgenic plants involve antisense RNA?. Trends in Biotechnology, 9:122123. Groot, D., Weterings, K., De Been, M., Wittink, F., Hulzink, R., Custers, J., Herpen, V. V. M., Gherpen, W. M. and Wullems, G., 2004, Silencing of the pollen-specific gene NTP303 and its family members in tobacco affects in vivo pollen tube growth and results in male sterile plants. Plant Molecular Biology, 55:715-726. Guo, H. S., Fei, J. F., Xie, Q. and Chau, N. H., 2003, A chemical regulated inducible RNAi system in plants. Plant Journal, 34: 383-392. Guo, S. and Kemphues, K. J., 1995, Par-1, a gene required for establishing polarity in C. elegans embryos encodes a putative Ser.Thr kinase that is asymmetrically distributed. Cell, 81:611620. Hamilton , A. J. and Grierson, D, 1998, Sense- and antisense-mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs Plant J, 15:737-746. Hamilton, A. J. and Baulcombe, D. C., 1999, A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286: 950-962. Hammond, S. M., Bernstein, E., Beach, D. and Hannon, G. J., 2000, An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature, 404:293-296. Hammond, S. M., Bernstein, E., Beach, D. and Hannon. G. J., 2000, An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature, 404: 293-296. Han, Y. and Grierson, D., 2002, Relationship between small antisense RNAs and aberrant RNAs associated with sense transgene mediated gene silencing in tomato. Plant Journal, 29: 509519. Hedin, P. A., Parrott, W. L. and Jenkins, J. N., 1992, Relationship of glands, cotton square terpenoid aldehydes, and other allelochemi- cals to larval growth of Heliothis virescens (Lepidoptera: NoctuiIn). J Econ Entomol, 85:359364. Helliwell, C. A., Wesley, V., Wielopolska, A. J. and Waterhouse, P. M., 2002, High-throughput vectors for efficient gene silencing in plants. Functional Plant Biology, 29: 12171225. Hofgen, R., Axelsen, K. B., Kannangara, C. G., Schuttke, I., Pohlenz, H. D., Willmitzer, L., Grimm, B. and Wettstein, V. D., 1994, A visible marker for antisense mRNA expression in plants: inhibition of chlorophyll synthesis with a glutamate-1semialdehyde aminotransferase antisense gene. Proceedings of the National Academy of Sciences of the United States of America, 91:1726-1730. Hutvagner, G., Mclachlan, J., Pasquinelli, A. E., Balint, E., Tuschl, T. and Zamore, P. D., 2001, A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 293: 834838.
Jarad, G., Wang, B., Khan, S., Devore, J., Miao, H., W, U. K., Nishimura, S. L., Wible, B. A., Konieczkowski, M., Sedor, J. R. and Schelling, J. R., 2002, Fas activation induces renal tubular epithelial cell -8 integrin expression and function in the absence of apoptosis. Journal of Biological Chemistry, 277: 47826-47833. Jenkins, J. N., Maxwell, F. G. and Lafever, H. N., 1966, The comparative preference of insects for glanded and glandless cottons. J Econ Entomol, 59: 352356 Jorgensen, R. A., 2003, Sense co-suppression in plants: Past, present and future. In RNAi: A guide to gene silencing, Cold Spring Harbor Laboratory Press, 15-22. Kapoor, S., Kobayashi, A. and Takatsuji, A., 2002, Silencing of the tapetum-specific zinc finger gene TAZ1 causes remature degeneration of tapetum and pollen abortion in petunia. Plant Cell 14: 23532367. Katageri, I. S., Vamadevaiah, H. M., Udikeri, S. S., Khadi, B. M. and Kumar, P. A., 2007, Genetic transformation of an elite Indian genotypes of Cotton (G. hirsutum). Current Science, 93: 12-25. Klahre, U., Crete, P., Leuenberger, S. A., Iglesias, V. A. and Meins, F., 2002, High molecular weight RNAs and small interfering RNAs induce systemic post-transcriptional gene silencing in plants. Proceedings of the National Academy of Sciences of the United States of America, 99:11981-11986. Knutzon, D. S., Thompson, G. A., Radke, S. E., Johnson, W. B., Knauf, V. C. and Kridl, J. C., 1992, Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proceedings of National Academy Science, 89:2624-2628. Kooter, J. M., Matzke, M. A. A. and Meyer, P., 1999, Listening to the Silent Genes: Transgene Silencing, Gene Regulation and Pathogen Control. Trends plant science.4:340-347. Kumar, D., Gustafsson, C. and Klessig, D. F., 2006, Validation of RNAi silencing specificity using synthetic genes: salicylic acid-binding protein 2 is required for innate immunity in plants. Plant J. 45: 863868. Kumar, M. and Carmichael, G. G., 1998, Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol Mol Biol Rev, 62:1415-1434. Kusaba, M., Miyahara, K., Iida, S., Fukuoka, H., Takano, T., Sassa, H., Nishimura, M and Nishio, T, 2003, Low glutelin content1: a dominant mutation that suppresses the glutelin multigene family via RNA silencing in rice. Plant Cell, 15: 14551467. Kuznetsov, V.Y., 2003, RNA Interference. An approach to produce knockout organism and cell lines. Biochemistry, 68: 1301-1317. Lankenau, S., Corces, V. G. and Lankenau, D. H., 1994, The Drosophila micropia retrotransposon encodes a testis-specific antisense RNA complementary to reverse transcriptase. Molecular Cell Biology, 14: 1764-1775. Lee, N. S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P. and Rossi, J., 2002, Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol, 20:500-505. Lee, R. C., Feinbaum, R. L. and Ambros, V., 1993, The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75:843-854. Li, M.-J., Li, H. and Rossi, J., 2006, RNAi in combination with a ribozyme and TAR decoy for treatment of HIV infection in hematopoietic cell gene therapy. Ann. N.Y. Acad. Sci, 1082:172-179. Lichtenstein, C., Klee, H., Montoya, A., Garfinkel, D., Fuller, S., Flores, C., Nester, E. and Gordon, M., 1984, Nucleotide sequence and transcript mapping of the tmr gene of the pTiA6NC octopine Ti plasmid: a bacterial gene involved in plant tumorigenesis. J. Mol. Appl. Genet. 2:354-362. Lin, X., Ruan, X., Anderson, M. G., Mc Dowell, J. A., Kroeger, P. E., Fesik, S. W. and Shen, Y., 2005, siRNA-mediated off-target gene silencing triggered by a 7 nt complementation. Nucleic Acids Res. 33: 45274535.
Lipardi, C., Wei, Q. and Paterson, B. M., 2001, RNAi as random degradative PCR: siRNA primers convert mRNA into dsRNAs that are degraded to generate new siRNAs. Cell, 107: 297-307. Liu, J., Carmell, M. A., Rivas, F.V., Marsden, C. G., Thomson, J. M., Song, J.-J., Hammond, S. M., Joshua-Tor, L. and Hannon, G. J., 2004, Argonaute2 Is the catalytic engine of mammalian RNAi. Science, 305:1437-1441. Liu, Q., Singh, S. P. and Green, A. G., 2002, High-Oleic and High-Stearic Cottonseed Oils: Nutritionally Improved Cooking Oils Developed Using Gene Silencing. Journal of the American College of Nutrition, 3: 205-211. Liu, X., Jiang, F., Kalidas, S., Smith, D. and Liu, Q., 2006, Dicer-2 and R2D2 coordinately bind siRNA to promote assembly of the siRISC complexes. RNA, 14: 789-796. Liu, Y. L., Schiff, M. and Kumar, D. S. P., 2003, Virus-induced gene silencing in tomato. Plant Journal, 31: 777-786. Lucas, W. J., Yoo, B. C. and Kragler, F., 2001, RNA as a long-distance information macromolecule in plants. Nature Review Molecular Biology, 2: 849-887. Lusas, E. W. and Jividen, G. M.,1987, Development of high-gossypol cotton plants with lowgossypol seeds using trispecies bridge crosses and in vitro culture of seed embryos. J Am Oil Chem Soc, 64:839854. Malik, I. et al. (2006) Comparison of test systems for RNAi. Biochem. Biophys. Res. Commun. 341: 245253. Mariani, C., De Beuckeleer, M., Truettner, J., Leemans, J and Goldberg, R. B., 1990, Induction of male sterility in plants by a chimaeric ribonuclease gene. Nature, 347, 737741 Martinez, J. and Tuschl, T., 2004, RISC is a 5' phosphomonoester-producing RNA endonuclease. Genes Dev, 18:975-980. Martinez, J., Patkaniowska, A., Urlaub, H., Lhrmann, R. and Tuschl, T., 2002, Singlestranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110:563-574. Matzke, M. A. and Matzke, A. J. M., 1991, Differential inactivation and methylation of a transgene in plants by 2 suppressor loci containing homologous sequences. Plant Molecular Biology, 16: 821-830. Matzke, M., Matzke, A. J. and Kooter, J. M., 2001, RNA: guiding gene silencing. Science., 293: 1080-1083. Metzlaff, M., Odell, M., Cluster, P. D. and Flavell, R. B., 1997, RNA-mediated degradation and chalcone synthase A silencing in petunia. Cell, 88: 845-854. Mol, J. N. M., Blokland, V. R., Lange, P., Stam, M. and Kooter, J. M., 1994, Posttranscriptional inhibition of gene expression: sense and antisense genes. In: Homologous Recombination and Gene Silencing in Plants (Paszkowski, J.,ed. ). Dordrecht:Kluwer, 309-334. Moritoh, S., Miki, D., Akiyama, M., Kawahara, M., Izawa, T., Maki, H. and Shimamoto, K., 2005, RNAi-mediated silencing of OsGEN-L (OsGEN-like), a new member of the RAD2/XPG nuclease family, causes male sterility by defect of microspore development in rice. Plant Cell Physiol, 46: 699-715. Nam, N. H. and Parang, K., 2003, Current targets for anticancer drug discovery. Current Drug Targets, 4:159-179. Noris, E., Lucioli, A., Tavazza, R., Caciagli, P., Accotto, G. P. and Tavazza, M., 2004, Tomato yellow leaf curl Sardinia virus can overcome transgene-mediated RNA silencing of two essential viral genes. The Journal of general virology, 85:1745-1749. Ogita, S., Uefujis, H., Morimotos, M. and Sano, H., 2004, Application of RNAi to confirm theobromine as the major intermediate for caffeine biosynthesis in coffee plants with potential for construction of decaffeinated varieties. Plant Molecular Biology, 54: 931941.
Ooms, G., Hooykaas, P. J. J., Moolenaar, G. and Schilperoort, R. A., 1981, Crown gall plant tumors of abnormal morphology, induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids; analysis of T-DNA functions. Gene, 14: 3350. Papenbrock, J., Pfundel, E., Mock, H. P. and Grimm, B., 2000, Decreased and increased expression of the subunit CHL I diminishes Mg chelatase activity and reduces chlorophyll synthesis in transgenic tobacco plants. Plant J, 22:155-164. Pare, P. W. and Tumlinson, J. H., 1997, Induced synthesis of plant volatiles. Nature, 385:3031. Pasquinelli, A. E., 2002, MicroRNAs: deviants no longer. Trends Genetics, 18:171-173. Petrovska, N., Wu, X., Donato, R., Wang, Z., Ong, E. K., Jones, E., Forster, J., Emmerling, M., Sidoli, A., OHehir, R. and Spangenberg, G., 2005, Transgenic ryegrasses (Lolium spp.) with down-regulation of main pollen allergens. Mol. Breed, 14: 489 501. Pooggin, M., Shivaprasad, P. V., Veluthambi, K. and Hohn, T., 2003, RNAi targeting of DNA virus in plants. Nature biotechnology, 21:131-132. Risco C. A. and Chase, C. C., 1997, in Handbook of Plant and Fungal Toxicants, edDMello JPF CRC Press, Boca Raton, FL,PP 87 98. Sangare, A., Deng, D., Fauquet, C. M. and Beachy, R. N., 1999, Resistance to African cassava mosaic virus conferred by a mutant of the putative NTP-binding domain of the Rep Gene (AC1) in Nicotiana benthamiana. Mol. Breed. 5: 95102 Schramke, V. and Allshire, R., 2003, Hairpin RNAs and Retrotransposon LTRs Effect RNAi and Chromatin-Based Gene Silencing. Science, 301: 1069-1074. Schuch, W., Bird, C. R., Ray, J., Smith, C. J., Watson, C. F., Morris, P. C., Gray, J. E., Arnold, C., Seymour, G. B. and Tucker, G. A., 1989, Control and manipulation of gene expression during tomato fruit ripening. Plant Molecular Biology, 13 : 303-311. Schwarz, D. S., Hutagner, G., Du, T., Xu, Z., Aronin, N. and Zamore, P. D., 2003, Asymmetry in the assembly of the RNAi enzyme complex. Cell, 115: 199-208. Selker, E. U., 2003, Molecular biology.a self help guide for a trim genome. Science, 300: 1517-1518. Sen, G. L. and Blau, H. M., 2006, A brief history of RNAi: the silence of the genes. FASEB J, 20:1293-1299. Senior, I. J., 1998, Uses of plant gene silencing. Biotechnology and Genetic Engineering Review, 15 : 79-119. Serio, F.D., Schob, H., Iglesias, A., Tarina, C., Bouldoires, E. and Meins, F. J., 2001, Sense and antisense mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs. Proceedings of National Academy of Science, 98:6505-6510. Sijen, T., Fleenor, J., Simmer, F., Thijssen, K. L., Parrish, S., Timmons, L., Plasterk, R. H. A. and Fire, A., 2001, On the role of RNA amplification in dsRNA-triggered gene silencing. Cell, 107: 465-476. Smith, N. A., Singh, S. P., Wang, M., Stoutjesdijk, P. A., Green, A. G. and Waterhouse, P. M., 2000, Total silencing by intron-spliced hairpin RNAs. Nature, 407: 319-320. Smith, T. M. B., Jeffrey, C., Anderson., Gregory, B., Martin and Kumar, D. S. P., 2004, Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal, 39: 734-742. Stipanovic, R. D., Bell, A. A. and Benedict, C. R., 1999, in Biologically Active Natural Products: Agrochemicals, eds Cutler HG, Cutler SJ (CRC Press, Boca Raton, FL), pp 211220 Stoutjesdijk, P., Singh, S. P., Liu, Q., Hurlstone, C., Waterhouse, P. and Green, A., 2002, hpRNAmediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing. Plant Physiology, 129: 1723-1731.
Subramanian, S., Madge, Y., Graham., Oliver, Y. U., Terrence, L. and Graham., 2005, RNA Interference of Soybean Isoflavone Synthase Genes Leads to Silencing in Tissues Distal to the Transformation Site and to Enhanced Susceptibility to Phytophthora sojae. Plant Physiology, 137:1345-1353. Svoboda, P., Stein, P. and Schultz, R. M., 2001, RNAi in mouse oocytes and preimplantation embryos: effectiveness of hairpin dsRNA. Biochem. Biophys. Res. Commun, 287:1099-1104. Svoboda, P., Stein, P., Hayashi, H. and Schultz, R. M., 2000, Selective reduction of dormant maternal mRNAs in mouse oocytes by RNA interference. Development, 127:41474156 Tomari, Z., Yamamoto, Y. and Sato, F., 2004, A Protein Sensor for siRNA Asymmetry. Plant Biology Science, 56:1377-1380. Vaistij, F. E., Jones, L. and Baulcombe, D. C., 2002, Spreading of RNA targeating and DNA methylation in RNA silencing requires transcription of the target gene and a putative RNAdependent RNA polymerase. Plant Cell, 14: 857-867. Vance, V. and Vaucheret, H., 2001, RNA silencing in plants-defense and counter defense. Science, 292:2277-2280. Vanitharani, R., Chellappan, P. and Fauquet, C. M., 2003, Short interfering RNA-mediated interference of gene expression and viral DNA accumulation in cultured plant cells. Proceedings of the National Academy of Sciences of the United States of America, 100: 9632-9636. Vaucheret, H., 2006, Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Development, 20: 759-771. Voinnet, O., 2001, RNA silencing as a plant immune system against viruses. Trends Genet, 17:449-459. Voinnet, O., 2002, RNA silencing: small RNAs as ubiquitous regulators of gene expression. Current Opinion of Plant Biology, 5: 444-451. Voinnet, O., Vain, P., Angell, S. and Baulcombe, D. C., 1998, Systemic spread of sequencespecific transgene RNA degradation in plants is initiated by localized introduction of ectopic promoterless DNA. Cell, 95: 177-187. Wagner, A., Phillips, L., Narayan, R. D., Moody, J. M. and Geddes, B., 2005, Gene silencing studies in the gymnosperm species Pinus radiata. Plant Cell Report, 24: 95-102. Waterhouse, P. M. and Helliwell, C. A., 2002, Exploring Plant Genomes By RNA-Induced Gene Silencing.Nature Reviews Genetics, 4 : 29 - 38. Waterhouse, P. M., Graham, H. W. and Wang, M. B., 1998, Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proceedings of National Academy of Science, 95: 13959-13964. Waterhouse, P. M., Wang, M. B., and Finnegan, E. J., 2001, Role of short RNAs in gene silencing. Trends in Plant Science, 6:297-301. Wesley, S. V., Helliwell, C. A., Smith, N. A., Wang, M., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S. P., Abbott, D., Stoutjesdijk, P. A., Robinson, S. P., Gleave, A. P., Green, A. G. and Waterhouse, P. M., 2001, Construct design for effective and high-throughput gene silencing in plants. Plant Journal, 27: 581-590. Xiong., Ai-Sheng., Yao., Quan-Hong., Peng., Ri-He., Li., Xian., Han., Pei-Lai., Fan., HuiQin., 2005, Different effects on ACC oxidase gene silencing triggered by RNA interference in transgenic tomato. Plant Cell Reports, 23 :639-646. Yan, H., Chretien, R., Ye, J. and Rommens, C. M., 2006, New Construct Approaches for Efficient Gene Silencing in Plants. Plant Physiology, 9: 536-545. Yao, M. C., Fuller, P. and Xi, X., 2003, Programmed DNA deletion as an RNA guided system of genome defence. Science, 300: 1581-1584.
Yuanhuai, H., Griffiths, A., Li., Hongying., Grierson, D., Han, Y. H. and Li, H.Y., 2004, The effect of endogenous mRNA levels on co-suppression in tomato. FEBS Letters, 563: 1-3. Zamore, P.D., Tuschl, T., Sharp, P.A. and Bartel, D. P., 2000, RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell, 101:25-33.
Appendix I : Formaldehyde agarose Gel (1.2 Per cent) 10X Formaldehyde agarose buffer (100 ml) 200mM 3-(N-morpholino) propanosulfonic acid (MOPS) 50mM sodium acetate 10mM EDTA Adjust pH to 7.0 with NaOH
1X Formaldehyde running buffer (1000 ml) Formaldehyde agarose gel buffer(10X) Formaldehyde (37%) RNAse free water 100 ml 20 ml 880 ml
5X RNA loading buffer (10 ml) Saturated aqueous bromophenol blue solution 500Mm EDTA Ph 8.0 Formaldehyde (37%) Glycerol(100%) Formamide(100%) 10X formaldehyde agarose gel buffer RNAse free water 16 l 80 720 l 2 ml 3084 l 4 ml 10 ml
Appendix II : Agarose Gel Electrophoresis a. Loading dye composition Loading dye (6x) : 0.25% bromophenol blue 40% (w/v) sucrose in water
c. Recipe for 1 per cent agarose gel (40 ml) Agarose 1x TAE EtBr (10 mg/ ml) - 40 ml - 2 l - 400 mg
d. 50x TAE composition Tris base Glacial acetic acid 0.5 M EDTA (pH 8.0) - 242 g - 57.1 ml - 100 ml
Appendix III :
Conversion table for the amount of a PCR fragment required per ligation reaction
100
30.0
0.018
300
10.0
0.054
500
6.0
0.090
1000
3.0
0.180
2000
1.5
0.360
3000
1.0
0.540
Appendix IV: Ligation recipe a. Ligation reaction recipe Plasmid vector pTZ57R/T DNA (0.165 g, 0.18 pmol ends) Purified PCR fragment, (Approx. 0.54 pmol ends) 10x ligation buffer PEG 4000 solution (10x) Deionized water T4 DNA ligase, 5U Total 30 l X l 3.0 l 3.0 l Y l 1.0 l 30 l
b. Control ligation reaction recipe PTZ57R/T DNA (0.165 g, 0.18 pmol ends) Purified PCR fragment (Approx. 0.54 pmol ends) 10x ligation buffer PEG 4000 solution Deionized water upto T4 DNA ligase, 5 U Total 3.0 l 4.0 l 3.0 l 3.0 l 16.0 l 1.0 l 30 l
Appendix V: Media composition a. Luria agar Ingredients Tryptone Yeast extract Sodium chloride Agar
PH
To 100 ml Luria agar 100 l of Kan50 (antibiotic) was added at 50C. To 100 ml Luria agar 100 l of Amp100 (antibiotic) was added at 50C. 200 mg of IPTG dissolved in 1 ml of sterile water, filter 0 sterilized and stored at 0 C 5 l/ plate was used. 20 mg of X-gal dissolved in 1 ml of N, N-dimethyl formamide. Stored at 00C, 40 l/plate was used
b. Recipe for 1.0 per cent agarose gel (40 ml) Agarose 1x TAE EtBr (10 mg/ ml) - 2 l - 40 ml - 400 mg
Appendix VI: Reagents for plasmid isolation STET buffer Tris-Cl (pH 8.0) NaCl EDTA (pH 8.0) Autoclaved and stored at 4C : 10 mM : 100 mM : 1.0 mM
Alkaline lysis solution I Glucose Tris-Cl (pH 8.0) EDTA (pH 8.0) Autoclaved and stored at 4C : 25 mM : 10 mM : 50 mM
SDS (10%)
Alkaline lysis solution III 5 M potassium acetate Glacial acetic acid Double distilled water Autoclaved and stored at 4C : 60 ml : 11.5 ml : 28.5 ml
Appendix VII: Restriction of PCR amplicon and generic ihp vector PCR amplicon DNA (1 g) Enzyme KpnI (10U) 10x buffer Sterile water Total : 1 l : 0.5 l : 2 l : 16.5 l : 20 l
PCR amplicon DNA (0.5 g) Enzyme BamHI (10U) 10x buffer L 1x BSA Sterile water Total : 2 l : 0.5 l : 2 l : 2 l : 13.5 l : 20 l
generic ihp DNA (0.5 g) Enzyme KpnI (10U) 10x buffer L Sterile water Total : 2 l : 0.5 l : 2 l : 15.5 l : 20 l
generic ihp DNA (0.25 g) Enzyme BamHI (10U) 10x buffer L 1x BSA Sterile water Total : 4 l : 0.5 l : 2 l : 2 l : 11.5 l : 20 l
Appendix VIII: Restriction of PCR amplicon and generic ihp vector PCR amplicon DNA (1g) : 1 l Enzyme NcoI (10U) : 0.5 l 10x buffer E : 2 l Sterile water : 16.5 l Total : 20 l PCR amplicon DNA (0.5 g) : 2 l Enzyme XhoI (10U) : 0.5 l 10x buffer E : 2 l 1x BSA : 2 l Sterile water : 13.5 l Total : 20 l generic ihp DNA (0.5 g) : 2 l Enzyme NcoI (10U) : 0.5 l 10x buffer E : 2 l Sterile water : 15.5 l Total : 20 l generic ihp DNA (0.25 g) : 4 l Enzyme XhoI (10U) : 0.5 l 10x buffer E : 2 l 1x BSA : 2 l Sterile water : 11.5 l Total : 20 l Restriction of generic ihp vector carrying inserts generic ihp (ihp) DNA (0.25 g) : 4 l Enzyme pstI(10U) : 0.5 l 10x buffer : 2 l Sterile water : 13.5 l Total : 20 l ______________________________________
: 1 l : 0.5 l : 2 l : 16.5 l
Total : 20 l
Alkaline phosphatase treatment of pCAMBIA1305.1 vector pCAMBIA DNA (1 g) Enzyme AP (10U) 10x buffer Sterile water : 1 l : 0.5 l : 2 l : 16.5 l
Total : 20 l
Appendix X: Composition of yeast extract mannitol agar (YEMA) for 100 ml D-Mannitol KH2PO4 K2HPO4 Yeast Extract MgS04. 7H2O (1 M) CaCl2 (1 M) Agar :1g : 20 mg
: 20
mg
: 100 mg : 80 l : 40 l : 1.8 g
Component Macronutrients NH4NO3 KNO3 MgSO4 . 7H2O KH2PO4 CaCl2 . 2H2O Micronutrients FeSO4 . 7H2O Na2 EDTA MnSO4 . 4H2O ZnSO4 . 7H2O H3BO3 KI Na2MoO4 . 2H2O CuSO4 . 5H2O CoCl2 . 6H2O Organics Thiamine HCl Pyridoxine HCl Nicotinic acid Glycine Myoinositol Biotin
mg/l concentration 1650.00 1900.00 370.00 170.00 440.00 27.80 60.00 22.30 8.60 6.30 0.83 0.25 0.025 0.025 10.00 1.00 1.00 10.00 100.00 0.50
Appendix XII: Extraction buffer for DNA isolation (CTAB method) For 100 ml 10% CTAB 1 M Tris base 4 M NaCl Sterile water : 20 ml : 10 ml : 35 ml : 34 ml
The solution was autoclaved and added Mercapto ethanol PVP To make the volume 100 ml : 1 ml : 0.1% (100 mg)
Appendix XIII: Reagents for gossypol estimation 95% Ethyl alcohol Whatman filterpaper no-1 40%Ethanol 80%Ethanol Diethyl ether Distilled water 1N HCL Phloroglucinol : 50 ml : : 10 ml : 100 ml : 50 ml : 50 ml : 1 ml :5g