You are on page 1of 6

Introduccin

El cido desoxirribonucleico (DNA) es un acido nuclico que contiene instrucciones genticas usadas en el desarrollo y funcionamiento de todos los organismos vivos, y es responsable de su transmisin hereditaria. El papel principal de esta molcula es el almacenamiento a largo plazo de informacin, compuesto principalmente por muchos nucletidos conectados ente si, cada

nucletido est formado por azcar (desoxirribosa), una base nitrogenada que puede ser adenina, timina, citosina o guanina. La disposicin secuencial de estas bases nitrogenadas a lo largo de la cadena es la que codifica la informacin gentica. En los organismos vivos el ADN se presenta como una doble cadena de nucletido, en la que las dos hebras estn unidas entre s por unas conexiones denominadas puentes de hidrgeno. Durante el desarrollo de este prctico se realizar la extraccin del DNA de una muestra de saliva donde los iones salinos son atrados hacia las cargas negativas del DNA, permitiendo su disolucin y posterior extraccin de la clula, para luego ser observada bajo el microscopio ptico.

Cuestionario
1. Qu molculas forman los cidos nucledos? Las molculas que forman son: una base nitrogenada (U, T, C, G, A.), un grupo fosfato y una pentosa (azcar: que puede ser una ribosa o una desoxirribosa). 2. Qu tipo de molcula forman la cromatina nuclear eucaritica? Las molculas que forman son la unin de ADN ms protenas: que son las histonas. 3. Qu diferencias estructurales hay entre ADN y RNA? La diferencia estructural entre ambos tipos de cidos nucleicos radica en el azcar que utilizan: desoxirribosa en el caso del ADN y ribosa en el caso del ARN; adems el ARN utiliza nucletido Uracilo en de Timina que usa el ADN. 4. Qu rol cumple el detergente durante el proceso de extraccin de DNA? El detergente desorganiza las membranas, pues dispersa las grasas con lo cual se consigue la lisis celular. 5. Quin ideo el primer modelo de la estructura del ADN? Los que idearon el primer modelo de la estructura del ADN fueron Watson y Crick, basados en los estudios de difraccin de rayos X del doctor Rosalind Franklin. 6. En una muestra de ADN bacteriano el 32% de las bases totales es Adenina. En otra muestra es solo del 17% Qu proporciones relativas de las bases restantes se esperan en cada una de las muestras? Justifique la respuesta. En el primer caso hay un 32% de Adenina y el mismo de porcentaje de Timina. Y un 18% de Citosina y el mismo porcentaje de Guanina. En el segundo caso un 17% de Adenina y 17% de Timina. Hay un 33% de Citosina y un 33% de Guanina. Erwin Chagaf descubri que la cantidad de Adenina siempre es idntica a la cantidad de Timina (en el caso del ARN, de Uracilo) al igual que la Citosina y Guanina 7. La hebra de DNA que va a ser transcrita muestra la siguiente secuencia: 5 CTTAACACCCCTGACTTCGCGCCGCAT 3 Cul es la secuencia de ARN m transcrito a partir de ella? 3-GAAUUGUGGGGACUGAAGCGCGGCGUA-5

Muestra Objetivo: Ser capaces de extraer una muestra de ADN y poder observarla para luego describir su estructura. Materiales: _Azul de metileno. _Suero fisiolgico. _Saliva. Mtodo: Extraccin de ADN teido con azul de metileno Aumento: Lupa aumento X4 Observaciones; Al observar la muestra de saliva mezclada con suero fisiolgico, pudimos notar que despus de someterla al procedimiento final, empezaron a aparecer unas fibras blancas las cuales eran el resultado de la agrupacin de muchas fibras de DNA. Luego de extraer esta fibra, teirla y visualizarla bajo el microscopio notamos claramente la estructura resultante.

Conclusin

Para finalizar este informe, sobre la extraccin de ADN, esto se realiz por medio de saliva. Lo primero es recalcar lo importante para el desarrollo de la ciencia que ha llevado a cabo el proyecto del genoma humano, y todo lo que esto conlleva. La realizacin prctica se realiz con saliva y luego fue centrifugada; posterior a esto al ser extrada se poda apreciar una hebras de ADN, se vea claramente, luego de esto se extrajo una muestra e este ADN, para observarlo al microscopio pero antes se agreg azul de metileno, y posterior a esto se observ al microscopio, donde se observaron fibras, como si fueran telas muy delgadas, que se cruzaban, como si estuvieran sobre puestas unas con otras. Este prctico nos result bastante interesante, no pensamos que de nuestra saliva poda salir una hebra de ADN, la cual contiene nuestra informacin gentica, y ver despus en el microscopio estas hebras, como telas muy delgadas que es nuestro ADN.

Procedimiento

En un vaso precipitado se procedi a depositar la saliva de una compaera de grupo, luego esta saliva fue depositada a un recipiente para llevarlo a la centrifuga, estuvo por 5 minutos aprox. Luego se saco la muestra y se le agreg suero fisiolgico????, y luego se mantuvo moviendo la muestra con saliva, para nuevamente llevarla a la centrifuga. Luego de completar el proceso en la centrifuga, se observa una hebra de color blanca en el fondo del recipiente, esta es extrada y depositada en un porta objeto, una vez que se deposit, se agreg unas gotas de azul de metileno, y luego se cubri con el cubre objeto, y se observo al microscopio.

Bibliografa