Seqüenciamento de DNA

Profa. Dra. Aline Maria da Silva Instituto de Química- USP

Bibliografia: Recombinant DNA – James Watson & Michael Gilman Guia de Rotas na Tecnologia do Gene – Matthew Walker & Ralph Rapley Biologia Molecular Básica-Arnaldo Zaha

Seqüenciamento de DNA Clivagem química ou Método de MaxamGilbert (utilizado apenas em situações especiais) Método de Sanger: Terminação controlada da replicação Manual Automatizado .

Método de Sanger .

Reação da DNA Polimerase I .

2´. 3´didesoxirribonucleotídeo trifosfato (ddNTP) .

3´didesoxirribonucleotídeo trifosfato (ddNTP) interrompe a reação de polimerização da cadeia de DNA .2.

Sequenciamento método de Sanger Obtenção do molde: DNA dupla fita desnaturado Anelamento do “primer” (iniciador) ao molde Primer pode estar radioativamente marcado com 32P Extensão do “primer”: dCTP. dGTP. dTTP e dATP + DNA polimerase Terminação da síntese: adição dos ddNTPs No sequenciamento automatizado cada um dos ddNTPs está acoplado a um cromóforo fluorescente distinto Separação dos fragmentos de DNA com 1base de diferença em eletroforese Gel de poliacrilamida ou Capilar Detecção dos fragmentos após eletroforese Autorradiografia (sequenciamento manual Laser (sequenciamento automatizado) .

Sequenciamento método de Sanger Anelamento do “primer” Extensão do “primer” Terminação da síntese: adição dos ddNTPs Eletroforese em gel de poliacrilamida desnaturante Autorradiografia .

Eletroforese em gel de poliacrilamida separando fragmentos de DNA com 1 base de diferença .

Autorradiograma de um gel de sequenciamento de DNA .

Sequenciamento automatizado .

Imagem de um gel de sequenciamento com detecção por fluorescência .

Cromatograma: Sequenciamento automatizado com “dye terminators” (método da interrupção controlada da replicação com ddNTPs) .

Programa para montagem (PhredPhrapConsed) .

Estratégia de sequenciamento do genoma humano Nature 15 Feb 2001 409(6822) Whole genome shotgun .

etc) Estabelecimento de relações filogenéticas entre a sequência de interesse e sequencias similares de outros organismos Etc. enhancers..nlm. Bioinformática . Etc..Análise de Sequências de genes e de genomas Comparação da sequência obtida com sequências depositadas em Bancos de Dados de Sequências de DNA e Proteínas (www.nih..ncbi... Etc.gov) Programa BLAST Identificação de fases abertas de leitura (ORFs) na seqüência de bases no caso de seqüências codificadoras Análise de domínios proteicos na seqüência de aminoácidos deduzida a partir da seqüência de bases Identificação de regiões regulatórias (promotores.

Busca por comparação no GenBank com programa BLAST >geneX GGCACGAGGGAGAAGTTTGTGGTAGTAATAATAATAGTAATGAACAACCAATAAACGAAAATTTAAATAT ATAAAATATATTTAAAATAAAAATAAAAAATAAAACAAAACAAAACAAAACAAAAACAAAAAAAAATAAA AAGAGAAAGAAAATAAATAAAAATAAAATAATATAAATAAAAAAGAATGGAAATTGATTTAGATTCAATC ATTACAAGATTATTGGAACCAAGAACTACAAAACCAGGTAAATTAGTTGATTTAGCAGAGGAGGAAATTA GATATTTAACAGTTCAAGCCACTGAAATCTTTATAAATCAACCAATTTTATTGGAATTAGAAGCACCAAT CAAGATCTGTGGTGATATTCATGGACAATACTACGATTTACTTCGTCTCTTTGAGTACGGAGGATTCCCA CCACAAAGTAATTATCTTTTTTTAGGTGATTATGTCGATCGTGGTAAGCAATCCTTAGAGACCATTTGTT TATTGTTGGCCTATAAAATCAAATATCCAGAGAACTTTTTCATTCTTCGTGGAAATCACGAATGTGCATC CATCAATCGTATCTATGGTTTTTACGATGAATGCAAGAGAAGATACAACAGCAAATTATGGAAAGCATTT ACAGATTGCTTCAACTGTCTCCCAGTTGCAGCCATCATTGACGAGAAAATCTTTTGTATGCATGGTGGTC TCTCACCAGATCTCAAGAATATGGATCAAATTCGTAGAATCACTAGACCAACCGTTGTTCCAGATTTTGG TCTTTTATGTGATCTCTTGTGGGCTGATCCTGATAAAAACATTCAAGGTTGGGAAGATAATGACCGTGGT GTCTCCTATACTTTTGGTGCCGACGTTGTCGAATCATTCTTAAAGAAACACGATCTCGATTTAGTTTGTA GAGCTCATCAAGTTGTAGAAGATGGTTATGAATTCTTTGCTAAACGTCAATTGGTAACCCTCTTTTCCGC TCCAAATTACTTTGGTGAATTTGATAACGCTGGTGCTATGATGGGTGTCGATGAAACTTTAATGTGTTCA TTCCAAATTTTAAAACCTGCCGATAAAAAAAAACTTACAAACGATAGTAATGGTAGACCATTAACTCCTC CAAGAAATAAACAACAAAAACCAAAAAAATAAATTAAAATAACTACTTTTTTAAAAAAAAAG BLASTx no GenBank Tradução em todas as 6 fases de leitura e busca contra banco de sequência de proteínas .