You are on page 1of 15

CHAPTER

2.1.4.

ECHINOCOCCOSIS/HYDATIDOSIS

SUMMARY
Diagnosis of echinococcosis in dogs or other susceptible carnivores relies on the demonstration of adult cestodes of the Echinococcus genus or their eggs in their faeces or small intestine. Recently, coproantigen and copro-DNA assays have proven useful for safe, fast and accurate diagnosis. In intermediate hosts, diagnosis depends on detection of the larval cyst form that can infect almost any organ, particularly the liver and lungs. Identification of the agent: At present, five species of the genus Echinococcus are regarded as taxonomically valid. These are E. granulosus, E. multilocularis, E. oligarthrus, E. vogeli and E. shiquicus. Echinococcus oligarthrus and E. vogeli occur less frequently than the first two species. Until recently E. shiquicus had been discovered only in a specific region of the People’s Republic of China. These five species are morphologically distinct in both adult and larval stages. A number of intraspecific variants have been described for E. granulosus, which exhibit morphological and biological characteristics, and these can reliably be differentiated by DNA analysis. Some of the E. granulosa genotypes have been recommended for elevation to species status. Larval forms of Echinococcus can usually be visually detected in organs. Special care has to be taken for a specific diagnosis of E. granulosus in instances where Taenia hydatigena in sheep is also a problem. Histological examination may confirm the diagnosis after formalin-fixed material is processed by conventional staining methods. The presence of a periodic-acid-Schiff positive, acellular laminated layer with or without an internal cellular, nucleated germinal membrane can be regarded as a specific characteristic of metacestodes of Echinococcus. The identification of larval E. multilocularis in rodents and other hosts is possible by macroscopic or microscopic examination and by DNA detection using the polymerase chain reaction (PCR). The small intestine is required at necropsy for the detection of adult Echinococcus spp. in wild or in domestic carnivores. The technique of carrying out surveys with the use of arecoline has been generally adopted for determining the prevalence of E. granulosus in dogs. Handling infected material presents a risk to the operator of contracting a potentially fatal disease. Significant progress is being made in the development of immunological tests for the diagnosis of intestinal Echinococcus infections by use of coproantigen detection. The technique has been used successfully in surveys of E. granulosus in dogs and is currently used in surveys for E. multilocularis in populations of dogs, foxes, and cats. Coproantigen detection is possible in faecal samples collected from dead or living animals or from the environment. PCR/DNA methods for the detection of E. multilocularis and more recently E. granulosus in definitive hosts have now been established in specialised laboratories as diagnostic techniques. Serological tests: Antibodies directed against oncosphere, cyst fluid and protoscolex antigens can be detected in the serum of infected dogs and sheep, but this approach is presently of limited practical use as it does not distinguish between current and previous infections. Cross-reactivity between Echinococcus and Taenia species also may occur. Requirements for vaccines and diagnostic biologicals: Progress has been made in the development of an effective vaccine against infection with the larval stage of E. granulosus in sheep and cattle.

OIE Terrestrial Manual 2008

175

4–31.Echinococcosis/Hydatidosis A. Further studies are needed to define the full range of genetic diversity (32.4. There were four morphologically distinct species in this genus until recently when Echinococcus shiquicus was added to the previously known species: E. INTRODUCTION Species under genus Echinococcus are small tapeworms of carnivores with larval (metacestode) stages known as hydatids proliferating asexually in various mammals including humans. Useful characteristics for identification of Echinococcus species.g. multilocularis E. Gravid segment Posterior to middle Anterior to middle Near to middle Posterior to middle Sac-like Sac-like Tubular Sac-like Anterior to middle Anterior to middle Posterior to middle Near to upper edge Anterior to middle 2.0–23. oligarthus.0–45. testes Position of genital pore Near to middle a.9 3 43. . E.0–17. 50). granulosus and alveolar echinococcosis. 43.0–57. Human cystic echinococcosis.0 25–80 16–35 15–46 50–67 12–20 Gravid uterus Branching laterally Unilocular cysts in viscera Metacestode Multilocular cysts in viscera Polycystic cysts in muscles Polycystic cysts in viscera Unilocular cysts in viscera o Echinococcus granulosus The parasite is transmitted between the domestic dog and a number of domestic ungulate species. Sylvatic definitive and intermediate hosts also occur.Chapter 2. oligarthus E.1.3–1.0 28. the Qinghai-tibet plateau region of western Sichuan. caused by E. granulosus E.2–4. are important public health threats in many parts of the world (56). 37.2–2.9–5. Discovered in the Shiqu County. vogeli are confined to Central and South America.0–60. E. multilocularis occurs in wide areas of the Northern Hemisphere.0–11. granulosus. Source: Xiao et al. wolf/cervid. vogeli E.0 16. Recently other species and genotypes of Echinoccocus have been proposed (51).7 2–3 20. multilocularis. granulosus. e. 58).0 20. A number of interspecific and intraspecific variants have been described for E.0 17. Mature segment b.0 1. Table 1.0 1. shiquicus is morphologically distinct both in adult and larval stages from other species.0–31.0 2.9–34. The dog/sheep cycle is most important.5 2–6 24. shiquicus is found in the People’s Republic of China and E.0 3. oligarthrus and E. Echinococcus granulosus has a global distribution. granulosus exhibit characteristic features that would justify the recognition as separate species according to some authors. The adult varies between 2 and 11 mm in length and usually possesses from two to seven segments. the People’s Republic of China (57. (58) E. averaging from 176 OIE Terrestrial Manual 2008 . caused by E. Some genotypes of E. E.0–47. segments Length of large hooks (µm) Length of small hooks (µm) No. shiquicus Distribution Cosmopolitan Holoarctic region Neotropical region Neotropical region Tibet plateau Definitive Host Intermediate Host Dogs Ungulates Foxes Microtine rodents Wild felids Neotropical rodents Bush dog Neotropical rodents Tibetan fox Plateau pika Adult: Body length (mm) No. All five species are infective to humans causing various forms of echinococcosis.5 3 49. multilocularis.0 30. E. vogeli. and E. E.0 2–7 25.0–49.

wild cats. and between 17 and 31 µm in the second row. granulosus in domestic cycles include. Individual bladders may reach up to 30 cm in diameter and occur most frequently in liver and lungs. dog/sheep in the Mediterranean region. The hooks are described in more detail in the next section and compared with those of E. which results in infiltration of tissues.9 µm. vogeli vary between 19. This zoonotic parasite is found in the Northern Hemisphere. The genital pore is situated posterior to the middle in both the mature and gravid segments. multilocularis. Africa (Ethiopia.45 µm) for large and small hooks. The gravid uterus is sac-like. however.9 µm OIE Terrestrial Manual 2008 177 . Infection with this stage is commonly referred to as alveolar echinococcosis. . granulosus except the dog/horse (G4) and the Finnish cervid (G10) strains have been found to infect humans. Brazil.g. The strain specificities of E. 27). oligarthrus.4 and 31. there have only been a few reports of human disease. and the genital pore is anterior to the midline in both mature and gravid segments. The parasite appears not to mature in dogs. There is no clear evidence for distinct strains or genotypes of E. all genotypes of E. Chile. The last (gravid) segment is usually more than half the length of the entire worm. The gravid uterus has well-developed sacculations. and the genital pore normally opens posterior to the middle in both mature and gravid segments. dog/swine in Poland.9 and 5. The rostellar hooks of the protoscolex vary in length between 25. the larval mass often contains a semisolid rather than a fluid matrix. South Africa and Switzerland. vogeli. and dog or wolf/reindeer in sub-Arctic regions of Norway. granulosus. dog/cattle in Belgium.6 and 29. The gravid uterus has no lateral sacculations and is characterised by being relatively long and tubular in form. and usually has three segments.2 and 4. V. Nepal. Oceania and the United Kingdom. South America (Argentina. the People’s Republic of China. Mongolia. may serve as definitive hosts while pigs.Chapter 2.Echinococcosis/Hydatidosis three to four segments. o Echinococcus multilocularis The parasite is transmitted primarily between wild definitive hosts (e. To date. Central Asia (Kazakhstan. 59). Dasyprocta sp.0 µm and the smaller hooks of the inner row between 20. ferrilata. although communicating chambers also occur. Coyotes. Russia. F. and normally possesses three segments. Ireland and the United Kingdom. There are rostellar hooks of various sizes on the protoscolex in two rows. usually not exceeding a few millimetres in diameter. raccoon dogs. Cuniculus paca) as intermediate hosts. but may develop in other internal organs. and its life cycle is mainly maintained in wildlife (25). The larval stage is a fluid-filled bladder or hydatid cyst that is unilocular. The genital pore is anterior to the middle in mature segments and approximately at the middle in gravid segments.4 µm) and between 22. The single cyst may reach a diameter of approximately 5 cm.2 and 2. The penultimate segment is characteristically mature. domestic dogs and cats (20.1.g.5 mm in length.1 and 43. The adult varies between 1.9 µm (average 33. Kyrgyzstan and Uzbekistan). horses. jaguarundi) and large rodents (e. Vulpes vulpes. Peru and Uruguay).9 and 37.5 mm in length and usually possesses from two to six segments. but the domestic dog is susceptible. Those of E. oligarthrus vary in length between 25. the penultimate of which is mature. as are large rodents (e. The adult varies between 3.9 and 37. though regional variations at the continental scale have been described (56).4. o Echinococcus vogeli The parasite typically uses the South American bush dog (Speothus venaticus) as a wild definitive host. wolves. V. Alopex lagopus. The penultimate segment is mature. o Echinococcus oligarthrus The parasite typically uses neptropical wild felids as definitive hosts (e. the Middle East and Levant regions.. Growth is expansive. Finland and Alaska. The adult varies between 2. Predilection sites are internal organs and muscles. This strain has recently been identified in human cases in Argentina. To date.5 µm (average 25. the People’s Republic of China and Iran (3. dog/horse in Belgium. the penultimate of which is mature. It proliferates by exogenous budding.g. The gravid uterus is sac-like. The hooks of E. compared with the other segments. 19. corsac.0 µm. primates and humans can be infected as intermediate hosts (25). Kenya and Sudan). with an average of four to five. The infection with this stage is referred to as cystic echinococcosis. Germany.9 and 34. the larger hooks of the first row vary in size between 24. Felis concolor. respectively. The metacestode is similar to that of E. It has been reported that the two species can be distinguished by comparing differences in the dimensions and proportions of the rostellar hooks on the protoscolex. Unlike E. The metacestode is a multivesicular structure consisting of conglomerates of small vesicles.g. which are sac-like. On the rostellum.9 mm in length. Canis latrans) and small arvicolid rodents (voles and lemmings). The status of dog/camel strains requires further elucidation. and endogenous daughter cysts may be produced. 44. The sylvatic cycle involves foxes and many species of wild rodents. The size of the hooks varies between 25 to 49 µm in the first row. The metacestode is polycystic and fluid-filled with a tendency to become septate and multichambered. Cuniculus paca) as intermediate hosts.

When undertaking surveillance work with E.5–2 g is mixed with water or 0.4 and 36. it is vitally important that data are stratified and reported according to the age of animals slaughtered.1. which must be minimised by appropriate procedures. The metacestode is found in the liver and is essentially a unilocular minicyst containing fully developed brood capsules. that for Echinococcus sp. The diagnosis of echinococcosis in dogs or other carnivores requires the demonstration of the adult cestodes of Echinococcus spp.27 sp. Gr. A detailed description of echinococcosis in humans and animals can be found in the WHO/OIE Manual on echinococcosis (56).) and centrifuged at 1000 g for 5–10 minutes. The adult stage is morphologically similar to E. however. compared with 30:70 for E. Echinococcus vogeli is a zoonotic agent with approximately 100 human cases reported in South America.) or sucrose solution (1. the intermediate host. The remaining procedure follows the concentration method used for faecal sample examination. granulosus by its shorter length. Sediment is mixed with either zinc sulphate 33% (1. although sodium hypochlorite may destroy a proportion of eggs (8).5 µm (average 33. which can occur in almost any organ. b) Diagnosis of larval echinococcosis o Necropsy Whereas surveillance for E.6 µm) for the large and small hooks. but particularly in the liver and lungs. branchless gravid uterus and anterior position of genital pore in the gravid segment.4. a strobila consisting of only two segments (a gravid segment directly attaching to a premature segment) is unique to this species (56). Identification of the agent In the intermediate host. 45). A faecal sample of 0. The mixture is stirred vigorously and sieved through a 100-µm mesh. It is differentiated from E. the gravid segment is connected to a mature segment.3 to 1. fewer segments. The test tube is filled to the top and a cover-glass is placed on the tube. a) Diagnosis of Echinococcus eggs in environmental samples o Faecal samples (22. however. The decontamination of laboratories can be achieved at reduced humidity (40%) combined with increased room temperature (30°C) for at least 48 hours. vogeli. It is easily distinguishable from E. Contaminated material must be destroyed by heat. The suspension is centrifuged at 1000 g for 5 minutes and the supernatant is discarded. Chemical disinfection is not reliable. oligarthrus divides the hook 50:50. upper position of genital pore in the premature segment and fewer eggs in the gravid segment. 49) This is a concentration method in which a saturated solution is used to separate Echinococcus eggs from faeces. in their faeces or the small intestine or the detection of specific coproantigens or coproDNA. is very effective. Infective material can be decontaminated by freezing at –80°C (core temperature) for 48 hours. Gr. granulosus in domestic animals may take place in licensed slaughter houses. B.Echinococcosis/Hydatidosis (average 41.3% Tween 20 in 1% formalin (42) in a 10–15-ml test tube and centrifuged (1000 g for 10 minutes) once or twice until the supernatant is clear. The infection caused by the larval stage of this species is commonly referred to as polycystic echinococcosis.7 mm. granulosus having no daughter cysts appearing within the fertile cyst (56). hot water. Investigators carrying out these procedures are exposed to the risk of infection and severe disease. multilocularis but differs by its smaller hooks.05% Tween 80. The adult measures 1. In most species of Echinococcus. granulosus in intermediate hosts. respectively. o Soil samples (35) A 20-g soil sample is placed in a 50-ml conical tube to which is added 40 ml of 0. . or –70°C for 4 days or by heating to 70°C for 12 hours (41. Also the hook-guard for E. disposable gloves and an apron must be worn. Prevalence 178 OIE Terrestrial Manual 2008 . The coverglass is examined microscopically 2–16 hours later. in wildlife must be done by field surveys. diagnosis depends on the detection of the larval cyst form.Chapter 2.64 µm) and between 30.18 sp. oligovesicular forms have also been observed. DIAGNOSTIC TECHNIQUES 1. Specimens should be preserved by removal of tissue and fixation in 4% formal saline or kept cool at +4°C and deep-frozen at –20°C for subsequent examination. o Echinococcus shiquicus The parasite was found in the Tibetan fox (Vulpes ferrilata) its definitive host and the plateau pika (Ochotona curzoniae). Face masks. at temperature of 85°C or above.

The presence of protoscoleces within brood-capsules or in hydatid sand is also diagnostic for the genus. palpation or incision should be done. because under normal conditions of faecal examination. . and the worms are counted with the aid of a hand lens or stereoscopic microscope. the supernatant is then decanted. It is an inexpensive method for determining the prevalence in a population and the best way to determine worm burden (15). The washed intestinal contents and scrapings are placed on a black tray. granulosus or E. the eggs of Echinococcus cannot be differentiated from those of Taenia spp. and it is sometimes difficult to differentiate between these two parasites when they occur in the liver. Eggs of E. These pieces are transferred to a glass bottle containing 1 litre physiological saline (0.9% NaCl) solution. All material is boiled and washed by sieving to eliminate most of the particulate material and to make it noninfectious. granulosus and E. c) Diagnosis of adult parasites in carnivores o Necropsy Necropsy is invariably employed in studies of echinococcosis in wildlife and is useful if domestic dogs are humanely culled. The presence of a periodicacid-Schiff (PAS) positive acellular laminated layer. The glass bottle is shaken vigorously for a few seconds and the pieces of intestine are removed. For accurate counts. multilocularis can now be identified and differentiated from other taeniid eggs by polymerase chain reaction (PCR). Worms adhering to the intestinal wall may be observed and counted by means of a hand lens (for E. ii) iii) iv) OIE Terrestrial Manual 2008 179 . Carcasses or intestines of definitive hosts for examination should be deep frozen at between –70°C and –80°C for 3–7 days before necropsy to kill any eggs. It should be emphasised that it is necessary to isolate and identify the adult Echinococcus. but in large animals.9% saline at 37°C for examination. 21) This technique can be regarded as the ‘gold standard’ for assessing the sensitivity and specificity of other techniques. The eggs of E. 16. sheep and goats may be infected with larval Taenia hydatigena. The superficial mucosal layer is stripped by exerting pressure between thumb and forefinger to dislodge attached helminths. Formalin does not kill eggs. such as sheep and cattle.1. multilocularis is usually done on DNA derived from protoscoleces or larval tissue material that is frozen. In wild animals. i) The small intestine is incised longitudinally and cut into 20 cm long segments or into 5 pieces of approximately the same length.Chapter 2. and the intestinal wall is scraped with a spatula. Formalin-fixed material can be stained by conventional histological techniques. Methods for quantitative determination of E. such as ruminants and rodents. several other larval cestodes should be considered for differential diagnosis. nucleated germinal membrane can be regarded as a specific characteristic of the metacestodes of Echinococcus spp.4. This procedure is repeated 2–6 times until the supernatant is cleared of coloured particles. multilocularis in the mid/posterior sections. Pigs. This is because older animals may be heavily infected even when animals have very few larvae. Necropsy is considered to be the most reliable form of diagnosis for E. The small intestine is removed as soon as possible after death. refrigerated or preserved in 90% ethanol.Echinococcosis/Hydatidosis rates are strongly age dependent (53) and reports from abattoirs that may slaughter only young animals will substantially under-represent the true situation.9% saline at 37°C for 30 minutes to release the parasites. it should be examined quickly. multilocularis in definitive hosts. multilocularis in definitive host’s intestine. Echinococcus granulosus is usually found in the first third of the small intestine of dogs and E. multilocularis are resistant to freezing to –50°C. and tied at both ends. as the parasite can be digested within 24 hours. granulosus and E. opened up and immersed in 0. underlying a connective tissue layer. o Sedimentation and counting technique (SCT. The fresh intestine is divided into several sections and immersed in 0. vogeli). and with or without an internal cellular. The glass bottle is left for 15 minutes for sedimentation to occur. Genotyping of E. The contents are washed into another container for detailed examination. If the material is not frozen or formalin fixed (4–10%). Larvae can be observed in many organs. cattle. The sediment fraction is examined in small portions of about 5–10 ml in rectangular plastic or Petri dishes with a counting grid (9 × 9 cm) in transmission light under a stereomicroscope at a magnification of ×120. the unfixed intestine is best divided into four or six sections. The glass bottle is refilled with physiological saline solution.

1. The hole is covered with a high-grade steel mesh (mesh size 500 µm) fixed into the remaining plastic ring with a hot soldering iron. again. 12. however. lachrymal. . In animals. Its action results in sweating.0% hydrochloric acid solution for a few seconds. The alcohol is removed by xylol (10 minutes) and cleared with methyl salicylate or creosote. the vessel is closed with the lid and filed with water. and glacial acetic acid [5 ml]) is added and the worms are left for a further 12 hours. Thus. Five mucosal scrapings from proximal. aluminium chloride [0. Echinococcus multilocularis is usually found in the second half of the small intestine. 17) Deep mucosal scrapings are taken at nearly equal distances from the small intestine using microscope slides (75 × 25 × 1 mm). Dehydration is accomplished by serial passage in ascending concentrations of alcohol (41. The accompanying purgation carries the worms out with the faeces. the total worm burden is calculated from the count of one subsample. ‘Shaking in a vessel’ technique (SVT. 70. Silicone is applied to seal the edges of the steel mesh. middle and posterior thirds of the small intestine (total 15) are recommended. Arecoline is a parasympathomimetic agent. it must be administered by the oral route. if higher numbers are present. The vessel is closed again. The half-filled vessel is opened and the intestines are removed. with two changes in 100%. For analysis. Preserving specimens o i) ii) o i) ii) iii) iv) v) vi) vii) o Intact worms are fragile and for morphological studies are best handled in normal saline with a Pasteur pipette. Adherent materials are transferred to a square plastic Petri dish. 15–25% of dogs may not purge. After removal of the fluid. Recently. For prolonged storage. d) Arecoline surveys and surveillance Arecoline has been used to perform surveys of tapeworm infections in dog populations. Its use as a control agent has now been superseded by praziquantel. a 0. which has a plastic screw-on lid with a central hole 6–7 cm in diameter is used. 15) A plastic vessel (1 litre). Three slides are placed in one plastic dish and examined. 85. Excess stain is removed by immersion in 0. multilocularis. granulosus. and the process is repeated until the decanted water is clear. and 100%) for at least 15 minutes in each.Chapter 2. As it has side-effects. the entire sediment fraction is checked.9% NaCl solution is added to the sediment to prevent the parasites from shrinking. pancreatic.0 g].5–1. and thereby making it relax its hold on the intestinal wall.. cold 5–10% formalin (5°C) or FAA fixative (95% ethanol [80 ml]. but not death. some methods have been developed with the aim of simplifying and improving epidemiological investigations in final host populations and of allowing diagnosis in living animals. Prior to mounting in any suitable medium such as balsam. the materials are placed into small glass Petri dishes and scanned along engraved lines using the stereomicroscope as above. They are washed free of other material and left for approximately 30 minutes for all movement to cease. Products containing arecoline are no longer available as an anthelmintic. the specimens should be returned to the xylol for a few minutes. For staining. calcium chloride [4. the water is decanted. The remaining sediment is filled into a 1 litre plastic jug and stored at 4°C. and stimulation of salivary. Persons involved in such examinations should receive serological screening for anti-Echinococcus serum-antibodies at least once a year (56). It is particularly suitable for baseline surveys of E. picolyte. Arecoline also has a direct action on the worm itself. and 70% ethanol [100 ml]) for 12–24 hours.0 g]. infirm and pregnant animals should be excluded from treatment. The vessel is inverted and shaken.4. The liver is the principal site of detoxification. but can be obtained from chemical supply companies. These methods include the detection of coproantigens and PCR DNA detection (see below). Intestinal scraping technique (IST. the worms are washed in water for 15 minutes and transferred to Mayer’s paracarmine (carminic acid [1. The intestines are stripped between the thumb and forefinger to dislodge parasites stuck to the mucosa into the vessel. 95. by causing paralysis. It increases intestinal tonus and the mobility of smooth muscle. arecoline purgation has been useful. refilled and shaken one last time draining as much water from it as possible. 37– 40% formaldehyde [10 ml]. and this effect is responsible for purgation. A dose of 4 mg/kg should 180 OIE Terrestrial Manual 2008 . and intestinal glands. Scrapings are squashed between slides and examined under a stereoscopic light microscope (×120). old. etc. Vessel is refilled with water.5 g]. The longitudinally opened small intestine is transferred to the vessel with all its contents.Echinococcosis/Hydatidosis v) If up to 100 worms are found. Arecoline may also be used to purge dogs infected with E. 50. the recovered tapeworms are identified morphologically. gastric.

multilocularis (11. has been developed and has shown particular promise as coproantigens can be detected shortly after infection (10–14 days) and the level declines rapidly following expulsion of the worms. though genus specificity remains intact. foxes and wolves have been screened successfully for coproantigen ELISAs and. Personnel should wear whole body coveralls. This has the advantage of detection of prepatent infections. multilocularis worm infestations are also detectable in red foxes and domestic dogs (13. Echinococcus coproantigens are also stable in fox or dog faeces left at 20°C for 1 week and in frozen dog faeces. 44). when mean worm burdens are >50–100. granulosus (~80%). containing 0.or monoclonal-antibody-based ELISAs for coproantigens exhibit high sensitivity and specificity to E. The sensitivity and specificity of the test have been estimated at 70% and 98%. 9) The faecal sample (collected per rectum or from the ground) is mixed with an equal volume of phosphate buffered saline (PBS).Chapter 2. Dogs. e) Coproantigen tests An alternative to arecoline testing. 18). Coproantigen testing has also been successfully used to evaluate he efficacy of deworming wild foxes infected with E. Dogs that are purged successfully may produce at least two motions. More importantly. Investigators carrying out these procedures are exposed to risk of infection and severe disease. it reduces the biohazardous risk of exposure of personnel to potentially infective eggs during purgation or necropsy (26). importantly. α-Dglucose. 46). the sensitivity for E. based on a faecal antigen-detection antibody sandwich enzyme-linked immunosorbent assay (ELISA). the area of ground used to tether dogs should be sprayed with kerosene and flamed. The exact nature of Echinococcus antigens released in faeces for coproantigen detection has not been fully characterised. multilocularis infection may be reduced. 8. Further studies may show that the coproantigen test may be more cost-effective than arecoline testing during routine surveillance of E. Fox faecal samples should be taken at post-mortem from the rectum rather than from the small intestine. When the capture ELISA uses either anti-ES or anti-somatic proglottid antibodies to E. Coproantigen testing by ELISA offers a specific practical alternative. Walking and abdominal massage of recalcitrant cases or enema for constipated dogs may avoid the use of a second dose (2 mg/kg). the sensitivity of the E. The kerosene prevents foaming and reduces the smell. in a capped 5 ml OIE Terrestrial Manual 2008 181 . respectively (2. This can be divided into several samples and each examined separately. disposable gloves and a face mask. which is most useful for base-line epidemiological studies on the comparative rates of infection with Taeniidae in dogs. 8. Coveralls should be boil washed after use. However.1. boots. they should remain tethered for 2 hours after purgation and given access to drinking water. After arecoline testing. o i) Coproantigen test procedure (Echinococcus granulosus) (2. specificity is around 98% and overall sensitivity approximately 70%. multilocularis coproantigen ELISA is below that of the mucosal smear method at necropsy (11). and therefore are not related to egg antigen(s) (13. covered with a thin layer of 1 ml of kerosene (paraffin) and boiled for 5 minutes.4. The purge should be boiled as soon as possible after collection. 44). 9.Echinococcosis/Hydatidosis result in purgation in under 30 minutes. Both qualitative and quantitative results can be obtained from arecoline testing. but the mucus that follows may be productive. dingoes. necropsy is time-consuming. . and boots disinfected in 10% sodium hypochlorite solution. the mucus sample (about 4 ml) is diluted with 100 ml of tap water. β-galactose and N-acetyl-β-glucosamine residues (8. 13). granulosus in the dog population (6). sensitivity approaches 100% (2. proglottides and worms after the first purge. 5. When testing for genus-specific Echinococcus coproantigens (against necropsy as a gold standard). coproantigen levels return to the preinfection baseline within 5 days of anthelminthic treatment of infected dogs (13). multilocularis infection of foxes. Coproantigens can be detected prior to release of eggs by Echinococcus worms. ELISAs for specific coproantigen have now been developed that have sufficient specificity and sensitivity to replace arecoline testing for detecting Echinococcus in dogs and other definitive hosts (8).3% Tween 20 (PBST). 12. however. Dogs may continue to pass eggs. the first will be formed faeces and can be ignored (or collected for laboratory tests as described later). granulosus. For detection of E. pH 7. Preferably. which should be given only sparingly. their stability in 5% formal saline after boiling and susceptibility to periodate treatment suggest involvement of large (>150 KDa) of carbohydrate antigen(s) with α-D-mannose. Furthermore. but this method is not recommended as the worms will be difficult to detect. 13). Polyclonal. for low worm burdens (<50). even though they were developed for E. which proved to be a successful combination of eliminating the source of infection (24). E.2. therefore. However. multilocularis using praziquantel-laced bait.

Chapter 2. KPL Labs) is added and the plate is left in the dark for 20 minutes at room temperature (22–24°C). This is shaken vigorously and centrifuged at 2000 g for 20 minutes at room temperature.1. Standards can also be obtained from the OIE Reference Laboratories (see Table given in Part 3 of this Terrestrial Manual).5 µg/ml of the biotinylated monoclonal antibody in 0. Coproantigen test procedure (Echinococcus multilocularis) (39.6) and are left overnight at 4°C. diluted 1/1000 in 0. The wells are rinsed as in step iii.4. ix) x) The plates are shaken immediately and placed in a 37°C incubator for 30 minutes. Greiner.1 M citric phosphate buffer with 10 µl of H2O2) is added. pH 9. 42) o Sandwich ELISA using a monoclonal antibody EmA9 raised against adult E.4) containing 0. granulosus proglottid extract (2) in 0. and the plate is incubated for 1 hour at room temperature. iv) v) vi) vii) viii) The plates are washed five times and 100 µl/well of substrate solution (20 mg of phenylenediamine (Wako) in 50 ml of 0.-granulosus proglottid extract peroxidase conjugate (2) in PBST is prepared and 100 µl per well is added to all wells. The optical densities (OD) of the plates are read at 490 nm. A supernatant fraction is used for the coproantigen detection assay.5 g of each faecal sample is placed in a centrifuge tube and a 1% formalin solution containing 0. The plates are washed four times and streptavidine-biotinylated horseradish peroxidase complex (Amersham Life Science).6 (100 µl per well). This is followed by the addition of 50 µl per well of faecal sample supernatants is added (in duplicate wells). . 100 µl per well of tetramethyl benzidene substrate (TMB. The plate is covered and incubated overnight at 4°C. or against a reference standard control positive using absorbance units equivalence. The wells are rinsed three times in PBST with 1 minute between washes.05 M NaHCO3/Na2CO3 buffer (pH 9.5% casein in PBST is added to each well and the plates are incubated for 1 hour. the faecal solution is centrifuged at 1200 g for 10 minutes at room temperature. An optimal dilution concentration of around 1 µg/ml of an IgG rabbit anti-E. The colour turns from blue to yellow if positive. i) ii) iii) 0. multilocularis somatic antigen (28). ix) x) Absorbance of wells is read at 630 nm. The wells are rinsed as in step iii. the positive to negative threshold is taken as 3 standard deviations above the mean absorbance value of control negatives. The plates are again washed four times and 0. The plate is incubated for 1 hour at room temperature (22–24°C).05 M bicarbonate/carbonate buffer. ii) A 96-well ELISA microtitre plate (Immulon #4. and blocked using 100 µl/well 1% bovine serum albumin (BSA) in PBS for 1 hour at room temperature (22–24 C). Laboratories should establish their own end-point criteria using standard positive and negative samples.5% cCasein in PBST is added to each well and the plates are incubated for 1 hour. Faecal supernatants can be tested immediately or stored at –20°C or lower. The PBST is discarded and 50 µl of neat fetal calf serum is added to all wells. Flat-bottomed microtitre plates (Immulon 600.3% Tween 20 is added to a total volume of 15 ml. Supernatants that appear very dark or viscous are still acceptable for use. 182 OIE Terrestrial Manual 2008 . Usually. The plates are washed three times (with the wash disinfected with 10% bleach) and 50 µl of faecal supernatant is added to each well and the plates are incubated for 2 hours. Thermo Electron Corporation) is coated with optimal concentration (typically 5 µg per ml) of a protein A purified IgG fraction of rabbit anti-E. 100 µl of the same buffer is added to each well.5% BSA/0. The plates are washed three times with 250 µl/well PBS (pH 7.5% BSA/0. iii) iv) v) vi) vii) viii) Next. The reaction is stopped by adding 50 µl/well of 4 N H2SO4. After adequate mixing. multilocularis excretory/secretory (ES) products in 0. The plate is incubated at room temperature for 1 hour with clingfilm seal covering the plate. Germany) are coated with 50 µl/well of 1 µg/ml rabbit IgG directed against adult E. The enzyme-substrate reaction is stopped by adding 100 µl of 1 M phosphoric acid (H3PO4) to each well.Echinococcosis/Hydatidosis disposable tube. The cut-off value is calculated as the mean OD value plus 3 standard deviations of samples from uninfected animals.05% Tween 20 (PBST). but the contents are discarded into a 10% bleach (hypochlorite) solution.

granulosus coproantigen detection (45). . In 2008. PCR is a technically demanding and expensive technique. modified from ref. foxes) using the coproantigen test and confirm with the PCR DNA test. multilocularis infection is required to investigate intermittent shedding and duration of shedding of parasite DNA. 54 Target. used in two-tube nested PCR Outer primers: (P60 forward) TTA-AGA-TAT-ATG-TGG-TAC-AGG-ATT-AGA-TAC-CC (P375 reverse) AAC-CGA-GGG-TGA-CGG-GCG-GTG-TGT-ACC Inner primers: (Pnest forward) ACA-ATA-CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (Pnest reverse) ATA-TTT-TGT-AAG-GTT-GTT-CTA 14 Mitochondrial 12S RNA gene. multilocularis eggs present in faeces (4. Recently PCR has been developed for the detection of copro-DNA for E. multilocularis generally occurs in regions where E. comments U1 sRNA gene: may yield non-specific products when used with metacestode material containing host DNA (unpublished observation) Table 2 cont. In Europe. 32). In other regions. including parts of the Near East (Turkey and Iran). is laborious. Table 2 presents the different PCR primers used for identification of copro-DNA from faeces in definitive hosts of genus Echinococcus. 4 Target. multilocularis infections in definitive hosts may be achieved by specific detection of PCR-amplified DNA from E. (36. transmission of E. a latex agglutination test and immunochromatography in-house kit using EmA9 became available for coproantigen detection (23. Central Asia. It is currently used mainly for confirmatory testing of coproantigen-positive samples or for identification of taenid eggs recovered from faeces.g. DNA isolation from the faeces. Russia and the People’s Republic of China.1. however.4. comments Mitochondrial 12S RNA gene. 41). Further evaluation of E. Differential diagnosis of E. these two species may occur together (10). it is suggested to concentrate the taeniid eggs by sequential sieving and an in-between concentration method step.Echinococcosis/Hydatidosis This procedure was also used in a sandwich ELISA for E. DNA isolation from these eggs can be achieved using a simplified protocol of the alkaline lysis method combined with a commercial kit with no need for organosolvent extractions (30). granulosus is not endemic or appears very infrequently. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34]) Primer designation: primer sequences (5’–3’) E. f) DNA recognition methods Definitive hosts: Copro-DNA has proven to be of value for the diagnosis of Echinococcosis in animal definitive hosts. 55) As PCR is generally used as a confirmatory test. granulosus and for genotypic differentiation. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34]) Primer designation: primer sequences (5’–3’) Outer primers: (Em-1) Ref.Chapter 2. multilocularis GTG-AGG-CGA-TGT-GTG-GTG-ATG-GAG-AGA-AGG CAA-GTG-GTC-AGG-GGC-AGT-AG Mitochondrial 12S RNA gene. 14 for use in single PCR OIE Terrestrial Manual 2008 183 . modified from ref. In practice. 14 for use in one-tube nested PCR Ref. Table 2. granulosus and E. it is recommended to screen definitive hosts (e.

granulosus (Eg1121a) GAA-TGC-AAG-CAG-CAG-ATG (Eg1122a) GAG-ATG-AGT-GAG-AAG-GAG-TG (Eg1f) CATTAATGTATTTTGTAAAGTTG (Eg1r) CAC-ATC-ATC-TTA-CAA-TAA-CAC-C (EgO/DNA-IM1) forward TCA-TAT-TTG-TTT-GAG-KAT-YAG-TKC reverse GTA-AAT-AAM-ACT-ATA-AAA-GAA-AYM-AC 40 47 1 Amplify a fragment of the coxI genespecific fo E. comments 184 OIE Terrestrial Manual 2008 . (JB11) Ref. yields banding pattern upon electrophoresis 48 NADH dehydrogenase subunit 1 (ND1) of mtDNA. multilocularis from E.Chapter 2. granulosus Mitochondrial 12SRNA gene. 52 Cestodes Target. granulosus and Taeniid spp. multilocularis. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34]) Primer designation: primer sequences (5’–3’) E. multilocularis and E. granulosus.1. cleavage with enzyme Cfo1 distinguish E. granulosus Table 2 cont. granulosus ‘sheep strain’ 38 Repeated sequences from E. . E. specific for E. ‘sheep strain’. granulosus ND1 (NDfor2-) AGT-TTC-GTA-AGG-GTC-CTA-ATA (NDrev2-) CCC-ACT-AAC-TAA-CTC-CCT-TTC E.4.Echinococcosis/Hydatidosis TAA-GAT-ATA-TGT-GGT-ACA-GGA-TTA-GAT-ACC-C (Em-2) GGT-GAC-GGG-CGG-TGT-TGT-A Inner primers: (Em-3) ATA-TTA-CAA-CAA-TAT-TCC-TAT-C (Em-4) ATA-TTT-TGT-AAG-GTT-GTT-CTA (EM-H15) CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (EM-H17) GTG-AGT-GAT-TCT-TGT-TAG-GGG-AAG E.

are less sensitive and specific in livestock and at present cannot replace necropsy (8. Specific antibodies against oncosphere and protoscolex antigens can be readily detected in the serum of infected dogs. degenerated or calcified lesions of E.for. useful in humans.Echinococcosis/Hydatidosis AGA-TTC-GTA-AGG-GGC-CTA-ATA (JB12) AC-CAC-TAA-CTA-ATT-CAC-TTT-C (60.4. This methodology has not reached a practical stage as it does not differentiate between current and previous infections and false positives may occur with infections of Taenia species.rev. Following ingestion of a cyst. b) Definitive hosts An extensive programme has been initiated to develop immunodiagnostic tests to control canine echinococcosis. OIE Terrestrial Manual 2008 185 . . PCR is of great value (33). multilocularis in intermediate or aberrant hosts. granulosus 52 E. multilocularis 52 Echinococcus granulosus (sheep strain) Cestodes Intermediate hosts: DNA hybridisation methods are not currently used for the detection of E. however. 52 E. dogs will be exposed at the intestinal level to various antigens during the establishment of the parasite and its development and oogenesis. multilocularis 52 E. For the identification of small. Molecular methods are. (Sequencing primer for the 267 bp amplicon of the multiplex PCR) 52 Taenia spp. important in identification of isolates or strains of E.-mod) ATG-TGG-TAC-AGG-ATT-AGA-TAC-CC (375.-mod) GGT-GAC-GGG-CGG-TGT-GTA-CC (Eg1f) CAT-TAA-TGT-ATT-TTG-TAA-AGT-TG (Eg1r) CAC-ATC-ATC-TTA-CAA-TAA-CAC-C (EM-H15) CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (EM-H17) GTG-AGT-GAT-TCT-TGT-TAG-GGG-AAG (Cest1) TGC-TGA-TTT-GTT-AAA-GTT-AGT-GAT-C (Cest2) CAT-AAA-TCA-ATG-GAA-ACA-ACA-ACA-AG (Cest4) GTT-TTT-GTG-TGT-TAC-ATT-AAT-AAG-GGT-G (Cest5) GCG-GTG-TGT-ACM-TGA-GCT-AAA-C (Cest3) YGA-YTC-TTT-TTA-GGG-GAA-GGT-GTG (Cest5) GCG-GTG-TGT-ACM-TGA-GCT-AAA-C (Cest5seq) GAT-TCT-TTT-TAG-GGG-AAG-G 52 Taenia spp. 2. granulosus for epidemiological purposes (37). 30). Serological tests a) Intermediate hosts Immunological tests. granulosus in livestock intermediate hosts.Chapter 2.1.

38.. AGULLA J. (2005).A. (1996). CRAIG P. Detection of Echinococcus multilocularis DNA in fox faeces using DNA hybridization. 169–250. CRAIG P. ROGAN M. REQUIREMENTS FOR VACCINES AND DIAGNOSTIC BIOLOGICALS 1. Parasitol. LIN R. BUISHI I. Wales.. CABRERA P. ACUTTIS A. ROGAN M. ABDUKADER M. USA. 293–301. Vaccine. & ALLAN J. Coproantigen detection for the immunodiagnosis of echinococcosis and taeniasis in dogs and humans. 571–579. GARCIA NOVAL J. CRAIG P.Echinococcosis/Hydatidosis C..S. MORAND M. 324–330. REFERENCES 1..S. 2.. PARADA L. DOUGAN G. PARIETTI S. Re-emergence of canine Echinococcus granulosus infection. Provo. PR China.... 7.L. Emerg. (1997). & HORMAECHI E.. NAKAO M.. WANG Y. ZHANG Y. (2006). CRAIG P.. Ouhelli H. Infect. 11 (4)...C.C.H. CAROL H.. look encouraging (7). M. 2. STRINGER R. 568–571. Immunodiagnosis of Echinococcus granulosus and a comparison of techniques for diagnosis of canine echinococcosis. CAMPOS-PONCE M.M. 56. it was considered that the vaccine development approach used in Taenia species such as the native host-protective antigens of T.. 5. only limited evidence has been demonstrated so far. & WEN H.. Using recombinant DNA technology. granulosus. .S. SNOWDEN R... Recent studies using recombinant protoscolex antigens. WEN H. BOUAMRA O..4. 9. BORGUES C. Parasitol. RAOUL F. (2001). (1993).Y. WANG Y. however. Definitive hosts While considerable research has been undertaken with crude antigens to protect dogs from echinococcosis. ALLAN J. ITO A.. 8. 6. The EG95 vaccine has been licensed by the University of Melbourne and AgResearch New Zealand to a commercial group in the People’s Republic of China (29). (2005). 193–199.. 223–232. CHABALGOITY J.T. & HAMBURGER J. Utah.. MORENO M. 104... MENCOS F. & CRAIG P. 106.P. CRAIG P... Copro-diagnosis of Echinococcus granulosus infection in dogs by amplification of a newly identified repeated DNA sequence. Hyg.... CRAIG P. PIARROUX R. Brigham Young University Print Services. Intermediate hosts Application of an effective vaccine to reduce hydatid infection in livestock would be likely to have a substantial impact on the rate of transmission of the disease to humans (29).. WALTERS T. an oncosphere antigen vaccine EG95 was shown to be capable of inducing a high level of protection against experimental challenge infection with E. Am. NJOROGE E..K..1.. Adv. GUILDEA Z. In: Compendium on Cystic Echinoccosis in Africa and in Middle Eastern Countries with Special Reference to Morocco.A.. Diagnosis of canine echinococcosis: comparison of coproantigen and serum antibody tests with arecoline purgation in Uruguay. 10. eds.T. Vet. Genotyping of human cystic echinococcosis in Xinjiang. & Kachani M. Canine echinococcosis in northwest Libya: assessment of coproantigen ELISA. 347–355. As E..L. 130.S. Parasitol. ABDEL HAFEZ S. BART J. many aspects of its immunological relationship with its intermediate host are similar to that occurring in Taenia species. Detection. ABBASI I. (1995). and a survey of infection with analysis of risk factors.. Med. BRETAGNE S. VUITTON D. & ZEYHLE E.. & HOUIN R. Parasitology.Chapter 2. GUILLOUN J. ovis would also be successful for E. Andersen F. 69. (1992). Basic research on canine mucosal immunology and Echinococcus infection is required for progress.. (2003). 186 OIE Terrestrial Manual 2008 .. 4. GASSER R...S. BUISHI I. CRAIG P. LIU D. Trop. Vet.. Parasitology. & PALMER S. Salmonella typhimurium as a basis for a live oral Echinococcus granulosus vaccine.B.. alveolar echinococcosis and neurocysticercosis. screening and community epidemiology of taeniid cestode zoonoses: cystic echinococcosis. Dis. ZHOU P.. Moreover. 133. granulosus belongs to the Taeniid family.. Parasitology. J. BRANZBURG A. 19.S... & PAOLILLO E. 3. granulosus eggs in sheep (31).. 460–469.

Echinococcus granulosus coproantigens: chromatographic fractionation and characterization... Effective countermeasures against alveolar echinococcosis in red fox population of Hokkaido. (EDS) (2001).. Switzerland. Epiz. (2007) Research on targeting sources of alveolar echinococcosis in Japan. Paris.. 24.. & ROMIG T. Microbiol. & KAMIYA H..A. Current strategies against Echinococcus zoonosis in Japan.R. Int. 17. DEPLAZES P. (1980). 125. 424–429. & Shaikenov B.. MOBEDI I. Res. 33. Diagnosis of Echinococcus multilocularis infection in final hosts.M... 455–465.Echinococcosis/Hydatidosis 11. Predictive values and quality control of techniques for the diagnosis of Echinococcus multilocularis in definitive hosts. pp 265. MESLIN F. 78. 135–142.. Development and characterization of murine monoclonal antibodies to Echinococcus multilocularis adult worms and its use for the coproantigen detection.P. Immunol. 40–42. Parasitology. JENKINS D. dingoes and foxes. 95. Detection of Echinococcus multilocularis in the definitive host: coprodiagnosis by PCR as an alternative to necropsy.. Torgerson P. (2006). 404–412. SAKAI H. 273–282.. 8 (4). Parasitol. dogs. HOFER S. OKAMOTO M. 18. GANZORIG S.. raccoon dogs and cats.M. DINKEL A.. Reproductive potential of Echinococcus multilocularis in experimentally infected foxes.C. VON NICKISCH-ROSENEGK M.. KAMIYA M. 22.. & OKU Y. ECKERT J. Parasitology. 115–121. Failure to identify alveolar echinococcosis in trappers from South Dakota in spite of high prevalence of Echinococcus multilocularis in wild canids. Parasitol. & KAMIYA M.. 44. Int.. KAMIYA M. DEPLAZES P. Off. Res. OKU Y. (2005). J.. INTAS Network Project. & JOACHIM A.A. HEGGLIN D.4. & DEPLAZES P. 85. (1999).A & ECKERT J. eds. In: Echinococcosis in Central Asia: Problems and Solutions... KAPEL C. ALTHER P.X. GEMMEL M. .. (2004). Parasitol. 303–308.. 157–163. Modified Wisconsin sugar centrifugal-floatation technique for nematode eggs in bovine faeces. Japan. & PAWLOWSKI Z. TANNER I. THOMPSON R. Tech...S. WILSON M. OIE Terrestrial Manual 2008 187 . 36. 23.. ITO S. HOBBS R.J. Infect. dog and cat populations. HILDRETH M. SRIRAM S. GLOOR S. WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. (2007)..1. 20.. 86.C. Echinococcus multilocularis coproantigen detection by enzyme-linked immunosorbent assay in fox. 27. LAGAPA J.. Clin. Vet. & THOMPSON R. Switzerland and Almaty. LUCIUS R. TORGERSON P. 128. Parasitology.J. ELAYOUBI F. Kazakhstan.C.. 85. (2000). (2004). 28. DUSCHER G. FASIHI HARANDI M. GOTTSTEIN B.T. OKU Y.. Zurich. KOHNO H.. Microbiol.. 313–321. Acta Trop. ITO M.. MATHIS A. France. J. Parasitol. (1992). (2000). Detection of Echinococcus coproantigens by enzyme-linked immunosorbent assay in dogs. & OKU Y.. Comparat. WALD D. Sci. & JIMENEZ-PALACIOS S.. J. 1055–1066. Assoc. (1995). 21. Jpn J.. & ECKERT J. 120 (Pt 2). KAMIYA M. ADAMS P.. Parasitol. & SCHANTZ P..A. Jpn Vet.. 12. 37. 367–373. DEPLAZES P.S. (2003).1871–1876. Dis. Appl. THOMPSON R. Parasitol. 25. GANZORIG S. Sci. (1998).. LAGAPA J. 36 (1). Med. 26. 19. MERLI M. J... J. 427–48. ECKERT J. GOTTSTEIN B.. 16.. J... 79–86. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zurich. (2002). 30 (5–6).Chapter 2. Rev.T. KAMIYA M..M. Collaborative control initiatives targeting zoonotic agents of alveolar echinococcosis in the Northern Hemisphere. (1996). NONAKA N. ECKERT J. 25.. BILGER B. World Organization for Animal Health (OIE). Parasitol. 15. 14. MULLER U.. 245–252. (2006). & CRAIG P.B. PROSL H. Scraping or shaking – a comparison of methods for the quantitative determination of Echinococcus multilocularis in fox intestines. NONAKA N. Molecular and morphological characterization of Echinococcus granulosus of human and animal origin in Iran. MORGAN-RYAN U.. 13. & DEPLAZES P. 75–77.

J. 20. NONAKA N. 60.G. 91. & DEPLAZES P. 208–209.... & KAMIYA M. LIGHTOWLERS M. Cestode vaccines: origins.P. MATSUO K. MCMANUS D. & VALDMANN H. Patent and pre-patent detection of Echinococcus granulosus genotypes in the definitive host. In: Echinococcus and Hydatid Disease. RAUSCH R. 37.. Molecular discrimination of taeniid cestodes. 41. (1998). (2006). UK. TSUKADA H. NAIDICH A. Thompson R. UK. 11.. Japan. & KAMIYA M. . Thompson R. (1995).C. & ROSENZVIT M. ITO M. UK. & HEATH D.G. GUARNERA E. Biochemistry.P. MCMANUS D.B. (2005). by coproantigen detection.. 34. In: Echinococcus and Hydatid Disease. Polymerase chain reaction for detection of patent infections of Echinococcus granulosus (‘sheep strain’) in naturally infected dogs. & Lymbery A. ROSENZVIT M.. genetic differentiation and speciation. Parasitology. (1995). Vulpes vulpes schrencki... Parasitology.. (1999). ZHANG W. 89–134. NONAKA N. 44. ZHANG L.. MORISHIMA Y.P. (2006). 193–200.. MCMANUS D. In: Echinococcus and Hydatid Disease.. J. STEFANIC S... 355–410. Parasitol.. OKA M.. An improved test system for PCR-based specific detection of Echinococcus multilocularis eggs. 44. SAKAI H. 133. & KAMIYA M. (2004). 70. SHAIKENOV B. Parasitol. J. & KAMIYA H. Vet. Int. Parasitol. Coproantigen detection in a survey of Echinococcus multilocularis infection among red foxes.. Helminthol..S. 117 (Pt 2).. GUTIERREZ A. Thompson R. KOHNO H. MATHIS A.. Wallingford. Jpn. (1995). (1996).J. J.J. OKU Y.C.H. NONAKA N.. & ECKERT J. NONAKA N.D. 188 OIE Terrestrial Manual 2008 . & Lymbery A. 347–351.P. OOI H. 5–10. & OKU Y.A.. in the genus Echinococcus Rudolphi 1801. CAB International. LYMBERY A.. J. Parasitol. 18. CAB International. 413–420. immunological and molecular diagnosis.. Res.G. 43. 46.L. DINKEL A.4. SAARMA U. (in press).J. & MCMANUS D. OKU Y.... In: Echinococcus and Hydatid Disease.. 30. OKU Y.. YOUNG J. Echinococcus multilocularis in Estonia. TSUKADA H. (1995).. CANOVA S. 185–189. Parasitol.. YAGI K. Wallingford. Japan. LIGHTOWLERS M. eds.. 33. 55.A. DEPLAZES P. & Lymbery A. MATHIS A. 39. Wallingford. Probes. CANOVA S. 118. Thompson R. (1999). Monitoring of Echinococcus multilocularis infection in red foxes in Shiretoko. 219–222. Med... (1995). Evaluation of coproantigen diagnosis for natural Echinococcus multilocularis infection in red foxes.C. Cell. in Hokkaido.R. OKU Y. Physiology and Molecular Biology of Echinococcus. SAKASHITA M.A. (2005). 31. YAGI K. DEPLAZES P. Parasitol. Int. 135–182. Vet. 45. CAB International. Dis. 457–462. 46.A. (2006). UK.W..A. & GOTTSTEIN B. LIGHTOWLERS M. S31–S37. Parasitology..A.. 36. 38. Echinococcosis/hydatidosis: Antigens. Vet. eds. CAB International.. Sci.. Copro-DNA tests for diagnosis of animal taeniid cestodes.Echinococcosis/Hydatidosis 29. MAAS D. SAKAI H. Detection of Echinococcus multilocularis coproantigens in experimentally infected dogs using murine monoclonal antibody against adult worms. Int.J.. S27–42. Wallingford. Mol. eds. Res. GUARNERA E.C..M.. A latex agglutination test for the detection of Echinococcus multilocularis coproantigen in the definitive hosts. (2006). Genetic variation and epidemiology of Echinococcus granulosus in Argentina. & Lymbery A. 639–641. 523–530. & KAMIYA M.C. 1973–1974. 92... MOKS E. & MATHIS A. Vaccination against hydatidosis using a defined recombinant antigen. KAMIYA M. 55. 35..W. RALSTON M. GAUCI C. (1996). Emerg. Life cycle patterns and geographical distribution of Echinococcus species. 47. S87–90. LAWRENCE S. (1998). Jpn J. Infect. 40.J.. Parasitol.. & BRYANT C. KAMENETZKY L. Genetic diversity..Chapter 2. 32..C. TORGERSON P. Modified sugar centrifugal flotation technique for recovering Echinococcus multilocularis eggs from soil. 42. ABE N.W. J. (2008). eds.1. 51–87. current status and future prospects..

51.S.A. NAKAO M.. 101. R. 59. Vet.. 452–457. Greece.A. Int. & MCMANUS D. M... (2002). TRACHSEL D. Thompson R.. 631–640. France.H. Parasitology... 54. 35. Pawlowski Z. WORLD HEALTH ORGANIZATION (WHO)/OFFICE INTERNATIONAL DES EPIZOOTIES (OIE) (2001).. LIMPER L. (1995).Chapter 2. CHEN X. sp... (2006). SCHANTZ P. 1–50. Res. Eckert J. & DEPLAZES P. (2007).. eds.int).. Int. 49.. (2007).. Diagnosing helminthiasis by coprological examination.J.. a new species from the Qinghai-Tibet plateau region of China: Discovery and epidemiological implications. Towards a taxonomic revision of the genus Echinococcus.. SCALA A.P.S. ROCHETTE F. Identification of taeniid eggs in the faeces from carnivores based on multiplex PCR using targets in mitochondrial DNA. 1–265. & HEATH D.D. CRAIG P. 693–701. CANU S. 58... 56. & ITO A. (2002). LI T. 52. (1999). & VANPARIJS O. NAKAO M. Parasitology. (2005). THOMPSON R. ROMBOUT Y..oie. Three genotypes of Echinococcus granulosus identified in Nepal using mitochondrial DNA markers. 50.C.M. (2003). WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. Wallingford.Echinococcosis/Hydatidosis 48. Detection of Echinococcus multilocularis in foxes in The Netherlands.. Gemmell. 18.A. XIAO N.M. 124 (Pt 6). CRAIG P.. VARCASIA A..C. Trop.H. Parasitol. Trends Parasitol. Molecular characterization of Echinococcus granulosus in sheep and goats of Peloponnesus. 258–260. OIE Terrestrial Manual 2008 189 . J. FRANCHIMONT J. KOGKOS A. & Lymbery A. 82. 49–57.. 911–920. QIU J. SCHANTZ P.P. S143–S158. Hyg. THOMPSON R. TORGERSON P. Parasitology..4. & SEIMENIS A.C. YANG W. Echinococcus shiquicus. SCHWARZENBACH G.B.. JOSHI D.. (2000)..A & MCMANUS D.R.. a taeniid cestode from Tibetan fox and plateau pika in China. Paris. Parasitol... 1135–1139.S. HEGGLIN D. LI T. OIE (World Organisation for Animal Health).. S233–236. & MATHIS A. Parasitol. Spatial and temporal aspects of urban transmission of Echinococcus multilocularis. Parasitol.. Beerse.J. 134. PIPIA A. 55. Meslin F.L. 127. GARIPPA G.. (1979). STIEGER C. Biology and systematics of Echinococcus.... Belgium. ZHANG L. Janssen Research Foundation. Soc.P. Echinococcus shiquicus n. & ITO A. XIAO N. Med.-X.1. 94.D.. CAB International. eds. CHEN X. 57. UK.. 53. YANG W. 55. * * * NB: There are OIE Reference Laboratories for Echinococcosis/Hydatidosis (see Table in Part 3 of this Terrestrial Manual or consult the OIE Web site for the most up-to-date list: www. MATHIS A. .F. VAN DER GIESSEN J. Transmission dynamics and control options for Echinococcus granulosus. THIENPONT D.P... Trans.W. & HOMAN W. QIU J. In: Echinococcus and Hydatid Disease. DEPLAZES P.