Parasitol Res (2009) 105:1283–1286 DOI 10.

1007/s00436-009-1551-5

ORIGINAL PAPER

Genetic variability of Blastocystis sp. isolates obtained from cancer and HIV/AIDS patients
T. C. Tan & S. C. Ong & K. G. Suresh

Received: 18 June 2009 / Accepted: 22 June 2009 / Published online: 15 July 2009 # Springer-Verlag 2009

Abstract This represents the first study to determine the genetic diversity of Blastocystis sp. among cancer and HIV/ AIDS patients. Forty Blastocystis sp. isolates obtained from 20 cancer and 20 HIV/AIDS patients were genotyped by PCR using seven pairs of known sequenced-tagged site primers. Out of the 40 isolates, 38 were identified as one of the known genotypes and two isolates were negative with all the STS primers. Blastocystis sp. subtype 3 which is reported to be associated with disease was found to be predominant among the study subjects.

Introduction Blastocystis sp. is a highly polymorphic organism with various morphological forms being reported in the literature including vacuolar, granular, amoeboid, cyst, avacuolar, and multivacuolar forms (Stenzel and Boreham 1996; Tan et al. 2002). Despite the unresolved controversy over its pathogenicity, Blastocystis sp. remains one of the most common intestinal parasites in humans (Stenzel and Boreham 1996). Prevalence of up to 10% and 50% was reported from developed and developing countries, respectively (Stenzel and Boreham 1996). Studies have shown the extensive genetic diversity of the organism in both humans and animals (Yoshikawa et al. 1996, 2004; Böhm-Gloning et al. 1997; Clark 1997; Abe 2004; Noël et al. 2005). Due to its low host specificity, a consensus has been reached to name the organism as Blastocystis sp. subtype 1 to 10 (ST1 to ST10) (Stensvold
T. C. Tan : S. C. Ong : K. G. Suresh (*) Department of Parasitology, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia e-mail: suresh@um.edu.my

et al. 2007). Molecular epidemiological studies in various countries such as Japan, the Philippines, China, Pakistan, Thailand, Germany, Bangladesh, and UK, Turkey, France, and Spain revealed a worldwide distribution of the genotypes (Clark 1997; Böhm-Gloning et al. 1997; Yoshikawa et al. 2004; Yan et al. 2006; Li et al. 2007; Rivera 2008; Ozyurt et al. 2008; Souppart et al. 2009; Domínguez-Márquez et al. 2009). Blastocystis hominis has increasingly been implicated for diarrheal illness in immunocompromised individuals (Tan et al. 2002). Prevalence studies of Blastocystis in immunocompromised individuals have been confined to HIV/AIDS patients and there is general lack of information on the prevalence of the organism in other immunocompromised individuals such as cancer patients. The purpose of this study is to determine the prevalence of Blastocystis sp. in both cancer and HIV/AIDS patients so as to determine whether a particular genotype is predominant. This represents the first study to determine the genetic diversity of Blastocystis sp. among cancer and HIV/AIDS individuals in Malaysia by PCR with the seven pairs of sequenced-tagged site (STS) primers reported by Yoshikawa et al. (2004).

Materials and methods Sample collection and culture of Blastocystis sp. isolates A total of 311 cancer patients and 247 HIV-infected individuals attended to local hospitals were examined for Blastocystis sp. infection. The parasites were isolated from patients’ fecal sample by in vitro cultivation at 37°C using Jones’ medium (Jones 1946) supplemented with 10% horse serum (Tan et al. 2008). Subsequently, after isolation, the

2. grown in Jones’ medium was harvested by centrifugation at 500×g for 5 min and washed with sterile phosphatebuffered saline (PBS) (pH 7.5 mg Proteinase K/ml (Fermentas. The PCR amplification for each primer pair was repeated thrice for each isolate. USA) and incubated at 55°C overnight. annealing at 57°C for 30 s and extending at 72°C for 1 min. SB155. and 0.5 mM MgCl2. isolates obtained from cancer and HIV/AIDS patients Types of patient Total number of isolates Subtype classification (% in parentheses) 1 Cancer HIV/AIDS 20 20 3 (15) 2 (10) 2 1 (5) 1 (5) 3 11 (55) 9 (45) 4 5 (25) 6 (30) 5 0 0 6 0 0 7 0 0 Unknown 0 2 (10) . pH 8. 20 mM (NH4)2SO4. Two to five microliters of DNA preparations were used to amplify the genomic sequences in a 25-μl reaction containing 0. Eppendorf. and SB337) to identify genotypes of Blastocystis sp. SB332. The concentrations of each DNA preparation were measured by a spectrophotometer (Eppendorf.01% Tween 20).5% agarose gels (Promega. Genotyping by PCR with the STS primers PCR was performed using seven pairs of STS primers (SB83.3 M sodium acetate. and 1 U Taq DNA Polymerase (recombinant) (Fermentas). Blastocystis sp.2 (final concentration). followed by 30 cycles including denaturing at 94°C for 30 s. Preparation of genomic DNA Twenty Blastocystis sp. (2004) (Table 1). and 2 vol of ice-cold ethanol.1284 Table 1 Subtype classification with the sequenced-tagged site (STS) primer sets use in this study Subtype 1 2 3 4 5 6 7 STS primer set SB83 SB155 SB227 SB332 SB340 SB336 SB337 Product size (bp) 351 650 526 338 704 317 487 Parasitol Res (2009) 105:1283–1286 Sequences of forward (F) and reverse (R) primers (5′–3′) F: GAAGGACTCTCTGACGATGA R: GTCCAAATGAAAGGCAGC F: ATCAGCCTACAATCTCCTC R: ATCGCCACTTCTCCAAT F: TAGGATTTGGTGTTTGGAGA R: TTAGAAGTGAAGGAGATGGAAG F: GCATCCAGACTACTATCAACATT R: CCATTTTCAGACAACCACTTA F: TGTTCTTGTGTCTTCTCAGCTC R: TTCTTTCACACTCCCGTCAT F: GTGGGTAGAGGAAGGAAAACA R: AGAACAAGTCGATGAAGTGAGAT F: GTCTTTCCCTGTCTATTCTGCA R: AATTCGGTCTGCTTCTTCTG GenBank accession no. pH 8. Gels were stained with ethidium bromide and photographed using ultra-violet gel documentation system (Uvitec. the DNA pellet was resuspended in 20–50 μl Tris–EDTA (TE) buffer containing 10 mM Tris and 1 mM EDTA. The primers used in this study are those used by Yoshikawa et al. 25 mM EDTA. pH 8. SB227. Following washing in 70% icecold ethanol. pH 8. 100 mM NaCl.2 mM of the four dNTPs. pH 5. The parasite cell pellets were then lysed in lysis buffer (20 mM Tris–HCl buffer. Germany). isolates were randomly selected from each group for genotyping analysis. Germany).0. AF166086 AF166087 AF166088 AF166091 AY048752 AY048751 AY048750 parasites were maintained in Jones’ medium by consecutive subculture every 3 to 4 days. 1× PCR buffer (75 mM Tris–HCl. and an additional cycle with a 10-min chain elongation at 72°C (thermocycler Eppendorf. 25 pmol of each primer. Table 2 Subtype classification of 40 Blastocystis sp. SB336. SB340.0) containing 1% SDS and 0.4) for six times. USA) and Tris–borate–EDTA buffer. Germany) using 50-μ l cuvettes (Uvette. Genomic DNA was extracted with phenol/chloroform/ isoamyl alcohol. PCR conditions consisted of one cycle of initial denaturing at 94°C for 3 min. The amplification products were electrophoresed in 1. UK).0. Nucleic acids were precipitated with 0.8.

prostate. mainly due to its uncertain pathogenicity and frequency of occurrence. In recent years. and Giardia duodenalis are important enteric pathogens among immunocompromised individuals such as cancer and HIV/AIDS patients. bone. subtype 2 (650 bp). Blastocystis sp. Ok et al. 2008). Cirioni et al. were examined for Blastocystis sp.4% in HIV/AIDS patients presenting with diarrhea in Jakarta. This is close to the data reported by Junod (1995) which is 15– 16%. the prevalence of Blastocystis sp. is not rare and should be looked for routinely in immunocompromised patients who have gastrointestinal complaints. while 14 (6. and 2. it is approximately two-fold lower than the prevalence reported previously by Taşova et al. brain. 2003). 2008) and associated with acute urticaria (Katsarou-Katsari et al. Blastocystis sp. Kurniawan et al. 1. 2000). (2009) reported a high prevalence of 72.7% which is comparable to the report by Koltas et al. Recent molecular studies of Blastocystis sp. 2.9%. Subtype 3 was the most prevalent followed by subtypes 4. Albrecht et al. subtype 3 (526 bp). The results for genotyping of the 40 isolates of Blastocystis sp. (1995) reported a prevalence of 38% in Germany. among cancer patients in the present study was 7. isolates is illustrated in Fig. are more prone to suffer Blastocystis-related diarrheal illness (Brites et al. 2008). 2009) have also been suggested to be responsible in causing disease in patients. 1998. subtype 1 (351 bp). The prevalence of Blastocystis sp. the effect of DNA Marker (bp) 1 2 3 4 5 6 7 8 9 1031 700 500 400 300 200 100 Fig. In that particular study. (1999) which is 10. lung. a total of 49 (19. Ghosh et al. Lanes 4 and 5. However. 1997. Discussion Parasites such as Cryptosporidium. Moreover. metronidazole appears to be effective in treating Blastocystis infection in such cases (Taşova et al. 1. 2000. subtype 1 (Yoshikawa et al.8%) of the 247 HIV/AIDS patients were coinfected with Blastocystis sp. Blastocystis sp. Singapore (Wong et al. in HIV/AIDS patients was 19. The example of PCR amplification of several Blastocystis sp. Prasad et al. A total of 24 (7. Taşova et al. Lanes 6 and 7.7%) of the pre-treatment groups were positive with Blastocystis sp. Moreover. The higher prevalence could be due to the more targeted study subjects whereby only patients showing gastrointestinal symptoms were included. DNA size markers of a 100-bp DNA ladder plus (Fermentas). subtype 3 was found to exhibit the amoeboid forms (Tan et al. radiotherapy. and the USA (Jones et al. None of the isolates was classified as subtype 5–7. 1997. 2009). This will greatly reduce the rate of morbidity and mortality. Taşova et al. (2000) which is 13%. subtype 4 (338 bp) Blastocystis sp. have put much attention in elucidating which particular subtype of the organism may potentially be the pathogenic one. 103 of the patients have not received any cancer treatment while 208 of the patients were undergoing treatment including chemotherapy. leukemia. 1999. 2000. 2000) reported two (8%) of 26 HIV-infected patients were coinfected with Blastocystis sp. Lanes 2 and 3. Blastocystis subtypes 1. Rao et al. are summarized in Table 2. Two isolates obtained from HIV/ AIDS patients showed negative PCR amplification with all seven sets of STS primers and were probably unknown subtypes. Nevertheless. There is growing evidence to suggest that immunocompromised individuals. or a combination of both. particularly patients with AIDS. 2004) and subtype 4 (Domínguez-Márquez et al. Germani et al. infection. More recently. Lanes 1.7%) were positive in the posttreatment group. 2008). cervix.7%) of the cancer patients were found to be infected with the parasite. subtype 3 was reported to be predominant in patients with chronic gastrointestinal illness in studies conducted in Malaysia (Tan et al. Indonesia. 1998.8%. Furthermore. Blastocystis sp. Blastocystis sp.Parasitol Res (2009) 105:1283–1286 1285 Results A total of 311 cancer patients with various types of cancer including nasopharyngeal. Lanes 8 and 9. (2000) investigated 206 patient suffering from hematological malignancy who presented symptoms of gastrointestinal diseases during the period of chemotherapy-induced neutropenia. in immunocompromised individuals has been rebated in recent years. etc. In the present study. has also been frequently found in immunocompromised individuals presenting with diarrhea. Since Blastocystis sp. A study in Northern India (Prasad et al. the rate of transmission could be diminished. Ten (9. and 4 were found. The present study highlights that Blastocystis sp. 2008). stomach. Meanwhile. isolates . colorectal. 3. liver. breast. subtype 2 is most likely the one that is non-pathogenic (Dogruman-Al et al. amplified by sequenced-tagged site (STS) primers. 1 Examples of polymerase chain reaction (PCR) products from isolates of Blastocystis sp. Moreover. Cyclospora cayetanensis.

Parasitol Int 57:300–306 Prasad KN. Lai R. Zenner L. Ozcel MA (1997) Cryptosporidiosis and blastocystosis in renal transplant recipients. Kimata I. Gerbod D. Med. Singh M. Scand J Gastroenterol 30:909–914 Böhm-Gloning B. Iraivan KT. Hudson NR. References Abe N (2004) Molecular and phylogenetic analysis of Blastocystis isolates from various hosts. Ozcan K. Silva N (1997) Blastocystis hominis as a potential cause of diarrhea in AIDS patients: a report of six cases in Bahia. Bastos MA. Zaman V. Central African Republic. Gómez-Muñoz MT. Delbac F. Yoshikawa H. Muñoz C. Greten H (1995) Blastocystis hominis in human immunodeficiency virus-related diarrhea. Brazil. Parasitol Res 103:685–689 Domínguez-Márquez MV. Acta Derm Venereol 88:80–81 Koltas S. Sogin ML. Ye J. Li X. Takahashi Y (1996) DNA polymorphism revealed by arbitrary primers polymerase chain reaction among Blastocystis strains isolated from humans. Taylor MB. Parasitol Res. Sekar U. Vet Parasitol 120:235–242 Albrecht H. J Health Popul Nutr 18:23–26 Rao K. Barberino MG. Steinmann P. Bone Marrow Transplant 22:1115–1117 Jones WR (1946) The experimental infection of rats with Entamoeba histolytica. Tong XM. Giacometti A. Sci 8:117–119 Kurniawan A. Am J Trop Med Hyg 59:1008–1014 Ghosh K. Braz J Infect Dis 1:91–94 Cirioni O. Takahashi Y (2004) Polymerase chain reactionbased genotype classification among human Blastocystis hominis populations isolated from different countries. Kurt O. Luo X.2009. Ok E. Singh M. Viscogliosi E (2009) Molecular epidemiology of human Blastocystis isolates in France. Nagono I. and zoonosis. Parasitol Res 102:663–670 Yan Y. Drenaggi D. Vet Parasitol 156:178–182 Souppart L. Kurt O.1016/j.1286 Parasitol Res (2009) 105:1283–1286 AIDS patients presenting with diarrhoea in Jakarta. Indonesia. Knobloch J. persistent. Tannverdi S. Capron M. and dysenteric diarrhea in adults in Bangui. Eur J Epidemiol 15:389–393 Clark CG (1997) Extensive genetic diversity in Blastocystis hominis. Vassalos CM. Walderich B (1997) Five subgroups of Blastocystis hominis isolates from symptomatic and asymptomatic patients revealed by restriction site analysis of PCR amplified 16S-like rDNA. subtype 3. J Eukaryot Microbiol 43:127–130 Yoshikawa H. Hocquet D. Wu Z. Chen SH. 105:413–421 Stensvold CR. Yassibanda S. a chicken and a reptile. Wintjens R. Delhaes L. J Assoc Physicians India 51:719–721 Rivera WL (2008) Phylogenetic analysis of Blastocystis isolates from animal and human hosts in the Philippines. Mølbak K. Yoshikawa H. Viscogliosi E. Zhang XP. Hossain MB. Vohito M. Pierce R. Parasitol Res 99:597–601 Yoshikawa H. Parasitol Res 93:22–29 obtained in the present study fall into the potentially pathogenic genotypes. Trans R Soc Trop Med Hyg. Parasitol Res 104:341–345 Junod C (1995) Blastocystis hominis: a common commensal in the colon. Soundararajan P (2003) Blastocystis hominis—an emerging cause of diarrhoea in renal transplant recipients. Uner A. Akcicek F. Tzanetou K. Ayyagari A (2000) Identification of enteric pathogens in HIV-positive patients with diarrhoea in northern India. Ann Trop Med Parasitol 40:130 Jones MS. Cirit M. Yoshikawa H. Abraham G. Scalise G (1999) Prevalence and clinical relevance of Blastocystis hominis in diverse patient cohorts. Suresh GK. Su S. Nirmala V (1998) Acute GVHD involving the gastrointestinal tract and infestation with Blastocystis hominis in a patient with chronic myeloid leukaemia following allogeneic bone marrow transplantation. Singh M. Ali IK. Yunihastuti E. Papadopoulou C. Basci A. Clark CG (2007) Terminology for Blastocystis subtypes—a consensus. Paydaş S (2000) Clinical significance and frequency of Blastocystis hominis in Turkish patients with hematological malignancy. identification of species. doi:10. Edgcomb VP. Suresh KG. Haque R. in relation to human immunodeficiency virus serostatus. J Clin Microbiol 43:348–355 Ok UZ.1007/s00436009-1485-y Germani Y. Traub RJ. Wu Z. Delgado-Viscogliosi P. treatment should be considered if the symptoms persist. Yoshikawa H. Ganac RD. Utzinger J. Zhang L. Borrás R (2009) High prevalence of subtype 4 among isolates of Blastocystis hominis from symptomatic patients of a health district of Valencia (Spain). Boreham PFL (1996) Blastocystis hominis revisited. Chen G (2006) Genetic variability of Blastocystis hominis isolates in China. Trop Med Int Health 2:771–778 Brites C. Djauzi S. Thompson RC. Haznedaroglu T. Parasitol Res 102:83–90 Noël C. Demirel M (2008) A possible link between subtype 2 and asymptomatic infections of Blastocystis hominis. Sahin B. Boorom K. Ayyaril M. Baslamish F (1999) The prevalence of Blastocystis hominis in immunosuppressed patients. Clin Microbiol Rev 9:563–584 Tan KSW. Capron M. Smith HV (2008) Phenotypic and genotypic characterisation of Blastocystis hominis isolates implicates subtype 3 as a subtype with pathogenic potential. Sari IP. Yap EH (2002) Recent advances in Blastocystis hominis research: hot spot in terra incognita. Viscogliosi E (2005) Molecular phylogenies of Blastocystis isolates from different hosts: implications for genetic diversity. Nag VL. Berthelemy P. Zhou XN (2007) Crosssectional surveys and subtype classification of human Blastocystis isolates from four epidemiological settings in China. Dagci H. Stensvold CR (2008) Molecular epidemiology of Blastocystis infections in Turkey. Sanciu G. Lin RT. Parasitol Res. Ancarani F. Presse Med 24:1684–1688 Katsarou-Katsari A. Ng GC. Dufernez F. Koperski K. Stellbrink HJ. Yap EH. Smith HV (2009) Intestinal parasitic infections in HIV/ . Parasitol Res 104:85–93 Taşova Y. Tan KS.trstmh. Int J Parasitol 32:789–804 Tan TC. doi:10. Ann. Dhole TN. Boorom K (2009) Association of Blastocystis subtype 3 and 1 with patients from an Oregon community presenting with chronic gastrointestinal illness. Nephron 75:171–174 Ozyurt M. Mol Biochem Parasitol 87:79–83 Dogruman-Al F. Vakalis N (2008) Acute urticaria associated with amoeboid forms of Blastocystis sp. Karyadi T. Minssart P.017 Li LH. Paydas S. Koltaş S. Dei-Cas E. Morvan J (1998) Etiologies of acute. Ho LC. Glaziou P.02. Wawrzyniak I. Acta Med Okayama 54:133–136 Wong KH. Liao H. Study of prevalence in different populations of Paris. Nielsen HV. Tan KS (2008) Predominance of subtype 3 among Blastocystis isolates from a major hospital in Singapore. Sampaio Sa M. Cian A. Trends Parasitol 23:93–96 Stenzel DJ. Lv S. Guna R. Iseki M. Whipps CM. Dwintasari SW. Spanakos G.