You are on page 1of 78

5096 PORTADA REVISTA CIENTIFICA.

pdf 1 10/22/11 10:23 AM


UNIVERSIDAD
CIENTFICA DEL SUR
DIRECTORIO
Ing. Jos Carlos Dextre Chacn
Presidente del Directorio
RECTOR
Dr. Agustn Iza Stoll
AUTORIDADES
Mg. Roland Leidinger Aylln
Vicerrector Acadmico y Gerente General
Dr. Jos Amiel Prez
Vicerrector de Investigacin
MBA. Rafael Su-Nobrega Arima
Gerente Pregrado
MA. Tulio Pita Chvarri
Gerente Postgrado
MBA. Jaime Tamashiro Tamashiro
Director Central de Administracin y Finanzas
Dr. Agustn Iza Stoll
Decano de la Facultad de Medicina Humana
Ing. Jorge Ponce Urquiza
Decano de la Facultad de Ingeniera Econmica y de Negocios
Dr. Rodolfo Valdivia Maibach
Decano de la Facultad de Estomatologa
Dra. Luzmila Troncoso Corso
Decana de la Facultad de Nutricin y Diettica
Dr. Manuel Rosemberg Barrn
Decano de la Facultad de Medicina Veterinaria y Zootecnia
Ing. Jos Carlos Dextre Chacn
Decano de la Facultad de Ingeniera de Sistemas Empresariales
Dra. Sonia Valle Rubio
Decana de la Facultad de Biologa Marina y Econegocios
Ing. Jorge Chvez Salas
Decano de la Facultad de Administracin de Turismo Sostenible y
Hotelera
Ing. Juan Guerrero Barrantes
Decano de la Facultad de Ingeniera y Gestin Ambiental
Dra. Josefna Takahashi Sato
Decana de la Facultad de Negocios Agro-Forestales
Dra. Laurietz Seda Ramrez
Decana de la Facultad de Artes Escnicas y Literatura
Ing. Zandra Rivera Chvez
Directora de la Facultad de Ingeniera de Sistemas Empresariales
Mg. Larissa Blsamo Fasce
Directora de la Carrera de Psicologa
Mg. Humberto Espinosa Ariza
Director de la Carrera de Administracin de Negocios
Internacionales
Mg. Nilda Escobedo Rojas
Directora de la Carrera de Marketing y Administracin
Mg. Jenny Canales Pea
Directora de la Carrera de Comunicacin y Publicidad
Abg. Mariano Castro Snchez-Moreno
Director de la Carrera de Derecho
Arq. Ignacio Pacheco Daz
Director de la Carrera de Arquitectura y Urbanismo Ambiental
Lic. Gustavo Lujn Zumaeta
Director de Propuesta Educativa
Lic. Mariza Ros Olivera
Directora de Servicios Acadmicos
Dr. Emilio Guija Poma
Director del Instituto de Investigacin
Sr. Percy Encinas Carranza
Director del Centro Cultural y el Fondo Editorial
UNIVERSIDAD CIENTFICA DEL SUR
www.cientifca.edu.pe/fondoeditorial
610-6400 anexo: 528
fondoeditorial@ucsur.edu.pe
Un intenso anlisis de los mecanismos y argumentaciones
del racismo a travs del discurso de Clemente Palma.
La Razn Racial
Clemente Palma y el racismo a fnes del siglo XIX
Por Rubn Quiroz vila
CIENTFICA
CIENTFICA Vol 8 N 1, enero-abril 2011
Director
Dr. Jos Amiel Prez
Universidad Cientfca del Sur
Vicerrector de Investigacin
jamiel@ucsur.edu.pe
Comit Editorial
Dr. Felipe Antonio San Martn Howard
Universidad Nacional Mayor de San Marcos
Presidente del Consejo de
Gestin de la Investigacin
fsanmartinh@unmsm.edu.pe
Dr. Emilio Guija Poma
Universidad Cientfca del Sur
Director del Instituto de Investigacin
eguijap@hotmail.com
Dr. scar Valiente Castillo
Universidad San Antonio Abad del Cusco
Decano de la Facultad de Medicina
osvacal18@yahoo.es
Dr. Javier Enciso
Universidad Cientfca del Sur
Vicerrectorado de Investigacin
Jenciso333@yahoo.com.mx
Asesora de diseo: Erika Kohatsu
Asistente de prensa: Rodrigo Salazar
Diseo y diagramacin: Carlos Alberto Amiel Olcese
Revista arbitrada
CIENTIFCA, revista de ciencias de la Universidad
Cientfca del Sur, publica tres nmeros al ao.
La revista est dirigida a investigadores, cientfcos,
docentes y estudiantes universitarios.
La Universidad Cientfca del Sur no se solidariza necesariamente
con las opiniones expresadasen los artculos publicados en esta
edicin de CIENTFICA. Se autoriza la reproduccin de los textos
siempre que se cite la fuente.
revistacientifca@ucsur.edu.pe
Fondo Editorial. Universidad Cientfca del Sur.
Carretera Antigua Panamericana Sur km 19 - Villa El Salvador
Tel. 610 6400 anexo 528
Tiraje: 600 ejemplares
Hecho el depsito legal en la Biblioteca Nacional del Per.
N 2008-15522 / ISSN: 1997-100X
31
35
25 Amrico Castro L., Jos Jurez E., Norma Ramos C., Silvia Surez C., Fernando Retuerto P.
10 20
10
CIENTFICA
CONTENIDO
Revista Cientfca Vol N1 enero-abril 2011.
COMIT CIENTFICO
EdITOrIal
arTCUlOS OrIGINalES
AsociAcin entre el polimorfismo trp64Arg en el gen del receptor 3-
adrenrgico, la dislipidemia, el mal control metablico glucmico y el sobrepeso
u obesidad, en diabticos tipo 2 de la provincia de sullana, piura (per)
efecto de la BUDDLEJA INCANA sobre lA produccin de il-2 y ifn- en
clulas mononucleares perifricas de humanos
elucidacin estructural del aceite esencial de RUTA GRAVEOLENS L. ruda,
cultivada en el per. actividad antioxidante y bioensayo de citotoxicidad
arTCUlOS dE rEvISIN
falsabilidad, contrastabilidad y corroboracin
Eduardo Flores J., Patrocinio Flores J., Martha Garca M., Mximo Eduardo Flores G.
Nathaly Enciso B., Jos Amiel P., Emilio Guija P., scar Retegui A., Alejandro Fukusaki Y., Javier Enciso G.
las inditas LECCIONES DE PSIQUIATRA Y PSICOLOGA de hermilio valdizn, y su
significado
Ramn Len
9
8
AssociAtion between the polymorphism trp64Arg in the ss3- drenergic receptor gene, dislipidemiA, bAd
metAbolic control of glycemiA And overweight or obesity, in diAbetic type 2 pAtients of sullAnA - piurA (peru)
BUDDLEJA INCANA EFFECT ON THE PRODUCTION OF IL-2 AND IFN- IN HUMAN PERIPHERAL MONONUCLEAR CELLS
structurAl elucidAtion of the essentiAl oil of rutA grAveolens l. rudA, grown in peru. AntioxidAnt And
cytotoxicity bioAssAy Activity
fAlsifiAbility, testAbility And corroborAtion
Jos Eduardo Rosales Trabuco
the unpublished "lessons of psychiAtry And psychology" from hermilio vAldizAn And its meAning.
70
60
58
54
41
ISSN 1997-700X
CarTaS al EdITOr
urethral prolapse in a male english bulldog: management and surgical
correction
organismos vivos modificados ovm
Michelle Freundt Coello , Michael Martnez-Bratton
Josefna Takahashi, Ph.D.
TESIS
fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores
del centro geritrico naval, callao, per 2010
Mara Luisa Tello Garca
Sala CaBIESES
la enfermedad y los dioses, extracto de la obra LA SALUD Y
LOS DIOSES del dr. fernando cabieses (ao 2007)
Dr. Fernando Cabieses
NOTaS
INFOrMaCIN para lOS aUTOrES
HELICOBACTER PYLORI y el mtodo cientfico
Jos Amiel Prez
74
71
helicobActer pylori And the scientific method
physicAl frAilty, cognitive deteriorAtion And AssociAted fActors in elderly from geriAtric nAvy center,
cAllAo, peru 2010
living modified orgAnisms
Dr. Pedro Mendoza Arana
Universidad Nacional Mayor de San Marcos
Facultad de Medicina Humana
Dra. Josefna Takahashi
Universidad Cientfca del Sur
Facultad de Negocios Agroforestales
Dr. Ricardo Caballero Merino
Hospiten Rambla - Espaa
Jefe de Servicios de Obstetricia y Ginecologa
Prof. Ramss Salas
Universidad Nacional Federico Villarreal
Facultad de Ciencias Naturales y Matemticas
Dr. James Graham
Universidad de Illinois en Chicago EE.UU.
Departamento de Farmacognosis. Facultad de Farmacia
Psic. Csar Merino Soto
Universidad Cientfca del Sur
Facultad de Psicologa
Dr. Pedro San Martn Howard
Hospital Nacional Dos de Mayo
Jefe del Departamento de Pediatra
Ing. scar Paiba
Universidad Cientfca del Sur
Facultad de Ingeniera de Sistemas Empresariales
Dra. Nancy Lozano
Universidad Nacional Mayor de San Marcos
Facultad de Farmacia y Bioqumica
Ing. Juan Guerrero Barrantes
Universidad Cientfca del Sur
Facultad de Ingeniera y Gestin Ambiental
Ing. Domnico Guida
Universidad de Salerno - Italia
Departamento de Ingeniera Mecnica
Ing. Jos Dvila
Universidad Cientfca del Sur
Facultad de Ingeniera de Sistemas Empresariales
COMIT
CIENTFICO
CIENTFICA SE ENCUENTRA EN EL
SISTEMA REGIONAL DE INFORMACIN
Imagen de fondo de la portada:

Micrografa de la dermis de un ratn
tratado con DMBA. Se observa
colagnesis, angiognesis, clulas
con fenotipo fbroblastoide. H/E. 40X
5096 PORTADA REVISTA CIENTIFICA.pdf 1 10/22/11 10:23 AM
EDITORIAL
Dr. Jos Amiel Prez
Director
El mtodo cientfco y sus cultores
D
urante muchos siglos, el conocimiento cientfco se ha perfeccionado
incesantemente. En esta tarea han participado inquietos hombres de ciencia,
cultores del mtodo, flsofos, telogos y tambin, por qu no, falsos profetas del
conocimiento verdico.
Se ha afrmado que la aplicacin del mtodo de la investigacin cientfca defne y
precisa el concepto de conocimiento cientfco. Son muchas las opiniones acerca
del qu y cmo del proceso que conduce a la ciencia; pero s podemos decir con
seguridad que la ciencia y su mtodo de ninguna manera se sustenta en dogmas
permanentes. Est en evolucin constante.
En el siglo pasado, un flsofo destacado, Karl Popper, refut los procedimientos de
contrastacin cientfca de tipo verifcacionista. Seal, como lo observa el profesor
Jos Eduardo Rosales Trabuco en esta misma edicin, que una hiptesis no debe
intentar ser confrmada o comprobada positivamente, ya que por su naturaleza no lo
requiere, sino por el contrario debe intentarse demostrar que es falsa Teora de la
Falsacin para evidenciar su vigencia, al resistir estos intentos.
Son contribuciones recientes al mtodo cientfco, las crticas diversas y constantes
a su rigor y exigencia para satisfacer los conceptos de causalidad, objetividad,
repetitividad, etc. Han adquirido mayor aceptacin los estudios observacionales, los
casos nicos (clnicos, por ejemplo), los estudios con pocas muestras que nos alejan
de las estadsticas y aquellas otras situaciones no contempladas, en el camino que
va desde el problema y su solucin, la hiptesis, hasta su comprobacin, evaluacin
y, fnalmente, su insercin en el cuerpo de conocimientos cientfcos.
Es, pues, digno de estudio, cualquier fenmeno que el hombre sea capaz de vislumbrar,
an cuando antes hubiera pasado desapercibido. Un formidable cultor de este tipo
de observacin inusual fue el Dr. Fernando Cabieses, quien posea un instintivo
mecanismo de anlisis distinto al usado frecuentemente, que fue caracterstico
de nuestro primer Rector, Rector Fundador de la Universidad Cientfca del Sur. l
siempre nos sorprenda con observaciones y conclusiones inusitadas, que despus
de escuchrselas entendamos que, adems de sorprendentes, eran increblemente
ajustadas a la realidad.
Justo homenaje le ha brindado nuestra Universidad al denominar a su Facultad de
Medicina Fernando Cabieses Molina, en sentida ceremonia realizada el da 20 de abril
del presente, que nos permiti exaltar su notable personalidad, no solo su memoria,
ya que en nuestro recuerdo vive permanentemente.
10 Cientfca 8 (1), 2011
ASOCIACIN ENTRE EL POLIMORfISMO TRP64ARG EN EL
GEN DEL RECEPTOR 3-ADRENRGICO, LA DISLIPIDEMIA,
EL MAL METABLICO GLUCMICO y EL SOBREPESO U
OBESIDAD, EN DIABTICOS TIPO 2 DE LA PROvINCIA DE
SULLANA PIURA (PER)
ASSOCIATION BETwEEN THE POLyMORPHISM TRP64ARG IN THE SS3- DRENERGIC RECEPTOR
GENE, DISLIPIDEMIA, BAD METABOLIC CONTROL OF GLyCEMIA AND OVERwEIGHT OR OBESITy, IN
DIABETIC TyPE 2 PATIENTS OF SULLANA - PIURA (PERU)
1
universidad nacional mayor de san marcos, departamento de bioqumica facultad de farmacia y bioqumica.
2
universidad nacional mayor de san marcos, asesor estudio bioestadstica.
3
instituto bien de salud.
4
ipcna, traductor del ingls, egresado.
arTCUlOS
OrIGINalES
rESUMEN
Una mutacin en el gen del receptor 3-
adrenrgico (Trp64Arg) se ha asociado con
diabetes tipo 2 en individuos de diferentes
grupos tnicos. Desde entonces, diversos
genes candidatos mutados han sido
reportados asociados a diabetes tipo 2 en
peruanos y en otras nacionalidades.
Se investig la frecuencia del polimorfsmo
Trp64Arg en el gen del receptor 3-
adrenrgico, parmetros bioqumicos y
medidas antropomtricas de 72 sujetos
diabticos tipo 2, y de 21 controles, de ambos
gneros, con edades entre 30 y 70 aos, de
la provincia de Sullana (norte del Per), por
ser de alta prevalencia en diabetes tipo 2.
El estudio de laboratorio se realiz en el Instituto
Peruano de Biologa Molecular (IPBM), en el
Laboratorio de Biologa Molecular de la Facultad
de Medicina Veterinaria y en la Facultad de
Farmacia y Bioqumica de la UNMSM.
Del anlisis de los resultados, utilizando el
programa SPSS v. 15, se encontr que las
frecuencias de los genotipos del gen del
receptor 3-adrenrgico en la poblacin
de estudio fue de 61.1% (44) Trp64Trp;
27.8% (20) Trp64Arg y 11.1% (8) Arg64Arg
para diabticos; y 57.1% (12) Trp64Trp;
14.3% (3) Trp64Arg y 28.6% (6) Arg64Arg
para controles. Asimismo, se hallaron las
siguientes frecuencias allicas en el gen
receptor 3-adrenrgico en diabticos y
controles: para el alelo Trp, 75% y 64.3%, y
para Arg, 25.0% y 35.7%, respectivamente;
de lo que se deduce que la frecuencia allica
de la mutacin (Arg) fue un poco menor, pero
estadsticamente no signifcativa (p = 0.088).
Los diabticos se encontraron con mal control
metablico glucmico e hiperglicemia. Al
aplicar el test t de Student en diabticos
y controles se pudo observar que solo
la hemoglobina glicosilada (Hb-G) tuvo
signifcancia estadstica (p = 0.039), que podra
estar asociada al polimorfsmo Trp64Arg.
En el anlisis de los genotipos vs IMC
(ndice de masa corporal), dislipidemia y
control metablico glucmico en controles
se encontr diferencia signifcativa para el
parmetro IMC en los diferentes genotipos,
pero no en diabticos tipo 2.
Eduardo Flores J.
1
, Patrocinio Flores J.
2
, Martha Garca M.
3
, Mximo Eduardo Flores G.
4
10 Cientfca 8 (1), 2011 11 Cientfca 8 (1), 2011
Asociacin entre el polimorfsmo Trp64Arg en el gen del receptor 3-adrenrgico, la dislipidemia, el mal control
metablico glucmico y el sobrepeso u obesidad, en diabticos tipo 2 de la provincia de Sullana, Piura (Per)
Del anlisis del riesgo odds ratio se hall que,
en el total de sujetos de estudio (diabticos
ms controles) el genotipo Trp64Arg alcanz
cierto grado de factor de riesgo a sobrepeso,
dislipidemia, y mal control metablico
glucmico, y que el genotipo Arg64Arg es un
factor de riesgo de sobrepeso y de padecer
diabetes, pero en todos los casos no tuvo
diferencia estadstica signifcativa.
Se concluye que el polimorfsmo en estudio
es importante, pero no es el nico ni el
mayor factor determinante para desarrollar
diabetes tipo 2.
Palabras clave: gen del receptor 3-
adrenrgico, polimorfsmo Trp64Arg, diabetes
tipo 2 (DMNID), control metablico glucmico,
dislipidemias.
aBSTraCT

A mutation in the 3-adrenergic receptor
gene (Trp64Arg) has been reported to be
associated with type 2 Diabetes (non-insulin-
dependent diabetes mellitus, NIDDM) in
subjects of different ethnic groups. Since
that, several mutations of candidate genes
have been reported associated with Diabetes
type 2 in Peruvians and subjects from other
nationalities.
It was investigated the frequency of polymorphism
Trp64Arg in the 3-adrenergic receptor
gene, biochemical and anthropometric
measurements of 72 subjects affected with
type 2 diabetic and 21 non-diabetic subjects
as control group, (both genders, aged
between 30 and 70 years) all of them of the
province of Sullana (North of Per), a city
with high prevalence of Type 2 Dia-betes.
The laboratory study was conducted in:
Peruvian Institute of Molecular Biology
(IPBM), the Laboratory of Molecular Biology
of Faculty of Veterinary Medicine and Faculty
of Pharmacy and Biochemistry Universidad
Nacional Mayor de San Marcos.
The analysis of the results was performed
using the SPSS v.15 and we found the
frequencies of genotypes of 3-adrenergic
receptor gene was: 61.1% (44) Trp64Trp,
27.8% (20) Trp64Arg and 11.1% (8) Arg64Arg
for diabetics, and: 57.1% (12) Trp64Trp,
14.3% (3) Trp64Arg and 28.6% (6) Arg64Arg
in the control group. Furthermore, we found
the following allelic frequencies in the 3-
adrenergic receptor gene in both diabetic and
control patients for the Trp allele was 75%
and 64.3% and 25.0% and 35.7% for the Arg
allele, which suggests that the allele frequency
of the mutation in Arg was slightly lower but
not statistically signifcant (p = 0.088).
Diabetics were found with bad glycemic
metabolic control and hyperglycemia.
Applying the t-Student test in diabetic and
control groups, it was observed that only
the glycosylated Hemoglobin (Hb-G) had
statistical signifcance (p = 0.039), probably
associated to the Trp64Arg polymorphism.
In the analysis of genotype versus BMI
(Body Mass Index), dyslipidemia and
glycemic metabolic control in control
subjects, it was signifcant difference for
the BMI parameter in different genotypes,
but not in type 2 Diabetes.
In the risk analysis (Odds ratios), we found
that in all the subjects (diabetic and control
groups), the Trp64Arg genotype reached
certain degree of risk factor for overweight,
dyslipidemia, and bad glycemic metabolic
control; and the Arg64Arg genotype is a risk
factor related with overweight and diabetes,
but without signifcant statistical difference.
We conclude that the polymorphism under
this study is important, but neither the only,
or the most decisive factor to develop type
2 Diabetes.
Keywords: 3-adrenergic receptor gene,
Trp64Arg polymorphism, type 2 Diabetes
(NIDDM), metabolic glycemic control,
dyslipidemia.
INTrOdUCCIN

La diabetes mellitus es uno de los
desrdenes crnicos endocrinolgicos ms
importantes del siglo XXI (1,2,3), resultado
de la predisposicin gentica y la presencia
de factores desencadenantes tales como el
estilo de vida o el medio ambiente, que afecta
alrededor de 200 millones de habitantes
en el mundo (4,5,6), de los cuales el 90%
corresponde a diabetes tipo 2 (diabetes
mellitus no insulino dependiente - DMNID),
caracterizndose por presentar resistencia a
la insulina y disfuncin de las clulas beta
del pncreas. Se encuentra en un 7% en la
poblacin urbana peruana y existe una alta
incidencia entre los naturales de la provincia
de Sullana (Piura) (7,8,9).
El receptor 3-adrenrgico es una glicoprotena
expresada en la membrana de clulas,
predominantemente de tejido adiposo y
participa en el metabolismo de lpidos; su
estimulacin produce un aumento en la liplisis
y la termognesis del tejido graso marrn
12 Cientfca 8 (1), 2011
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
SEduardo Flores J., Patrocinio Flores J., Martha Garca M., Mximo Eduardo Flores G.
(11), por lo que alteraciones moleculares de
este receptor pueden conducir a: obesidad,
resistencia a la insulina o a diabetes de tipo 2
(12,13). Los estudios del factor gentico juegan
un importante rol como punto de partida en la
predisposicin a enfermedades crnicas y
puede dilucidar mejor las frecuencias gnicas
asociadas a factores ambientales en diabetes
de tipo 2 (14,15).
Se han realizado diversos estudios buscando
la posible contribucin del polimorfsmo
Trp64Arg en los desrdenes metablicos, los
mismos que conllevan a obesidad y diabetes
de tipo 2 (DMNID). Clment y col. (17,18)
notifcaron que la presencia del polimorfsmo
Trp64Arg en pacientes obesos y en sujetos
normales franceses puede contribuir al
incremento de la ganancia de peso; una
similar conclusin tuvo el estudio de Widen
y col. (19) en nativos fnlandeses, quienes
asociaron el polimorfsmo Trp64Arg con
obesidad abdominal, adems de su posible
contribucin al inicio temprano de diabetes
tipo 2. Walston y col. (20) encontraron la
presencia de este polimorfsmo en nativos
pima, quienes se caracterizan por ser
una poblacin susceptible a diabetes de
tipo 2, corroborando la relacin de este
polimorfsmo con la alteracin del balance
energtico en tejido adiposo visceral.
Asimismo, se ha demostrado que la variante
homocigota Arg64Arg del receptor 3-adrenrgico
puede infuir en la menor secrecin de insulina
como respuesta a la glucosa, la cual
puede conducir a Diabetes de tipo 2. Estos
hallazgos obtenidos por Walston y col. (21) se
ven apoyados por la investigacin realizada
en la poblacin japonesa por Oizumi y col.
(22), quienes reportan que este genotipo
Arg64Arg est asociado a obesidad y a
diabetes tipo 2 (21,22).
La PCR y el RFLP son tcnicas muy tiles en
investigaciones biomdicas y se utilizan con
buenos resultados en investigaciones de
determinacin de polimorfsmos allicos (15)
asociados a enfermedades relacionadas con
la herencia. Asimismo, es necesario realizar
los estudios en poblaciones homogneas,
como los realizados en los indios pima, que
han permitido demostrar que la resistencia a
la insulina o la hiperinsulinemia se heredan
en forma autosmica (24).
Por estas razones, como no es posible realizar
estudios genticos en grandes poblaciones,
hemos elegido la provincia de Sullana, Piura
(Per), por ser parte de una de las regiones
con mayor prevalencia de diabetes tipo 2 en
el pas, en donde no solo hay que buscar la
mutacin en un gen, el polimorfsmo gentico
Trp64Arg, que se correlaciona con diabetes
tipo 2 (3,10,24,25,26), sino tambin asociarlo
con los llamados factores de riesgo (historia
familiar, edad, peso al nacer, obesidad,
distribucin central de la grasa corporal,
ejercicio, hipertrigliceridemia, disminucin del
colesterol HDL, hiperglucemia y mal control
del metabolismo glucmico) (16,23,27).
Tambin se conoce que gran parte de
la poblacin de Sullana consume dietas
hipercalricas, ricas en carbohidratos y grasas
(arroz, yuca, pltanos, camote, pan, maz,
papa, chicha de maz), adems del consumo
de carnes (de chancho, bovinos y ovinos), y
se observa un porcentaje importante de sus
pobladores con sobrepeso y obesidad, y
un incremento en la distribucin de la grasa
corporal que puede permitirnos determinar
el grado de predisposicin gentica o mayor
riesgo de desarrollo de diabetes tipo 2.
MaTErIalES Y MTOdOS
La medicin de los parmetros bioqumicos
y medidas antropomtricas de 72 sujetos
diabticos tipo 2, y de 21 controles, fue
llevada a cabo determinando el perfl
lipdico para estimar la dislipidemia y
la hemoglobina glicosilada para control
metablico glucmico, con tcnicas de
bioqumica clnica referenciales: colesterol
por el mtodo de Trinder; HDL colesterol con
reactivo precipitante (dextrn + magnesio);
LDL colesterol con reactivo precipitante
(polivinilo en polietilen glicol); triglicridos y
lipemia con mtodos colorimtricos.
La hemoglobina glicosilada por mtodo
de intercambio inico. El ndice de masa
corporal (IMC) se calcul segn frmula de
Quetelet (peso en kg entre el cuadrado de la
talla en metros).
El estudio de frecuencia del polimorfsmo
Trp64Arg en el gen del receptor 3-
adrenrgico, consta de las siguientes etapas:
Extraccin y purifcacin de ADN genmico
Condiciones de la PCR RFLP
Reaccin en Cadena de la Polimerasa (PCR)
Digestin con enzimas de restriccin (RFLP)
Las muestras de sangre fueron obtenidas en
ayunas. Las personas con diabetes tipo 2
motivo del estudio, tenan diagnstico clnico
de diabetes tipo 2 y en su mayora tenan
tratamiento mdico: aproximadamente un
90% viene siendo tratada con hipoglicemiantes
orales, un 2% haba pasado a insulinoterapia
12 Cientfca 8 (1), 2011 13 Cientfca 8 (1), 2011
Asociacin entre el polimorfsmo Trp64Arg en el gen del receptor 3-adrenrgico, la dislipidemia, el mal control
metablico glucmico y el sobrepeso u obesidad, en diabticos tipo 2 de la provincia de Sullana, Piura (Per)
y, aproximadamente, un 8% se controlaba
con productos vegetales como yacn,
hercampuri, hojas de guanbana, etc. Se
les anotaba sus datos personales e historial
de enfermedad, se les pesaba y tallaba
para luego extraerles, de la vena ceflica,
baslica o media del antebrazo, una muestra
sangunea de 15 ml, la que era colocada en
dos tubos: 6 ml con anticoagulante EDTA
para extraccin y purifcacin de ADN y 9
ml con anticoagulante heparina para las
determinaciones bioqumicas: glucemia,
hemoglobina glicosilada, perfl lipdico.
Anlisis de los polimorfsmos Trp64Arg
del gen del receptor 3-adrenrgico por
PCR RFLP
93 sujetos participaron en el estudio; 72
diabticos tipo 2 y 21 controles con edades
comprendidas entre 35 y 70 aos de edad,
aleatorizados de la poblacin de la ciudad
de Sullana. El estudio se llev a cabo en a)
El Instituto Peruano de Biologa Molecular
(IPBM), para la obtencin y purifcacin
del ADN a partir de los leucocitos de
las muestras sanguneas obtenidas con
EDTA, utilizando un kit de reactivos; b)
El laboratorio de Biologa Molecular de la
Facultad de Medicina de Veterinaria de la
UNMSM, para la deteccin del polimorfsmo
Trp64Arg, mediante las tcnicas moleculares
de amplifcacin del ADN por reaccin en
cadena de la polimerasa (PCR), seguida de
la digestin del amplifcado por la enzima
de restriccin MvaI, segn la tcnica de
restriccin de fragmentos polimrfcos de
longitud (RFLP).
Extraccin y purifcacin de ADN genmico
Para el aislamiento del ADN genmico de
sangre total se utiliz el Kit Miniprep (AxyPrep)
para ADN genmico de sangre total, de
AXYGEN scientifc, mtodo que se basa en
la efciente liberacin del ADN genmico
de la sangre entera anticoagulada por una
lisis especial de clulas y precipitacin de
hemo/protenas con buffer AP1, unido a la
adsorcin selectiva de ADN genmico por una
columna especial AxyPrep. El ADN genmico
purifcado es eludo con un tris buffer bajo
de sal que contiene 0.5 mM de EDTA, que
aumenta la solubilidad del ADN y ayuda a
proteger al ADN de alto peso molecular de la
subsecuente degradacin de nucleasas.
El ADN genmico de la sangre es aislado
directamente de los glbulos blancos
(WBC) componente de la sangre total, sin la
necesidad de remover los glbulos rojos de
la sangre (RBCs) previamente.
Este kit puede tambin ser usado para
extraer ADN de sangre seca, ADN viral,
ARN viral y ADN mitocondrial, y podra
tambin ser efciente en la copurifcacin
del ADN genmico. El buffer AP1 destruye
efcientemente cualquier bacteria y virus
presente en la muestra de sangre, de tal
modo que reduce el riesgo potencial de
estos agentes infecciosos.
La concentracin de ADN promedio obtenida fue
de 30 a 40 ng/l, y de 5 a 10 l de solucin de
ADN por muestra de 3 a 5 ml de sangre total,
requirindose para realizar cada reaccin
de 20 a 100 ng. Algunas pocas muestras
presentaron insufciente concentracin de
ADN, la cual podra deberse a defciencias
en la extraccin y/o conservacin de las
muestras de sangre, que permitiran la lisis
y activacin de nucleasas que destruyen
el ADN. Otra razn sera la inadecuada
manipulacin de la muestra en la etapa de
extraccin del ADN.
La extraccin y purifcacin de ADN es una
etapa muy importante, ya que de la pureza
e integridad del ADN dependen la calidad
de la RFLP y la validacin de los resultados
del polimorfsmo. La cuantifcacin de los
cidos nuclecos se llev a cabo en un
espectrofotmetro, tomando las medidas
de absorbancia a longitudes de onda 260
y 280 nm. Para el And, la concentracin
fue calculada respecto a la medida A260
correspondiente a 50 g. La relacin de
las medidas a A260/A280 muestra una
estimacin de la pureza del cido nucleco
extrado, de forma que se considera un alto
grado de pureza cuando esta relacin se
encuentra entre 1.7-1.9
Condiciones de la PCR RFLP
Una vez obtenido el ADN genmico, se
prosigui con la amplifcacin por reaccin
en cadena de la polimerasa (PCR) de un
segmento de 210 pb que contiene el codn
64 del gen del receptor 3-adrenrgico.
Reaccin en cadena de la polimerasa (PCR)
La PCR fue llevada a cabo en un volumen
de 20 microlitros que contenan 50
nanogramos de ADN genmico (se amplifc
el segmento de 210 pb que contiene el
codn 64 del receptor 3-adrenrgico),
10 picomoles de cada primer BSTNUP (5-
CGCCCAATACCGCCAACAC-3) y BSTNDOWN
(5CCACCAGGAGTCCCATCACC), 200 uM de
dNTP, 1.5 mM de cloruro de magnesio, 10
mM. TRIS-HC1 (pH: 9.0); 50 mM ClK; y 0,5
unidades de Taq DNA polimerasa.
14 Cientfca 8 (1), 2011
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
SEduardo Flores J., Patrocinio Flores J., Martha Garca M., Mximo Eduardo Flores G.
Anlisis de los fragmentos de restriccin:
Anlisis de los alelos
La visualizacin de los fragmentos de ADN
digeridos se realiz mediante electroforesis
en geles horizontales de agarosa al 4% y
tincin con bromuro de etidio.
rESUlTadOS
Como resultado de la digestin, se obtienen
los fragmentos de 99, 62, 30, 12 y 7 pb para
homocigotos Trp64Trp; de 161, 99, 62, 30,
12 y 7 pb para heterocigotos Trp64Arg; y de
161, 30, 12 y 7 para homocigotos Arg64Arg
De una poblacin de 235 personas que
asistieron para esta evaluacin, estudiamos
a 93 sujetos, 72 diabticos tipo 2, y 21
controles de ambos gneros, con edades
entre 30 y 70 aos de la ciudad de Sullana,
Piura (Per). Determinamos la frecuencia del
polimorfsmo Trp64Arg en el gen del receptor
3-adrenrgico, parmetros bioqumicos
y medidas antropomtricas de diabticos
tipo 2 y controles. Para el anlisis de los
resultados, se utiliz el programa Statistical
Package for the Social Sciences (SPSS) v
15. Los resultados fueron evaluados con
estadstica descriptiva y asociacin.
La prueba Chi cuadrado (Chi-Square Test),
apoy la prueba de equilibrio de Hardy-
Weinberg, y se calcul el ratio ODDS a fn de
apreciar en los sujetos de estudio, la infuencia
del polimorfsmo Trp64Trp y Arg64Arg en la
prevalencia de esta enfermedad.
Segn el principio de equilibrio de
Hardy-Weinberg
El clculo se hace, por ejemplo para
el caso de diabticos
Frecuencia del alelo
Trp = (44*2+20) / 72*(2) = 0.75
Por otro lado, en las tablas de distribucin
chi cuadrado, encontramos que para un
grado de libertad y para un nivel de
signifcancia = 0.0 5, el valor es 3.8415 (valor
crtico) que corresponde a una p = 0.04 (a una
cola). Comparar el valor chi cuadrado (X2),
calculado u observado con el valor crtico
4.8395 > 3.8415, permite rechazar la hiptesis
de que la poblacin tiene proporciones
de HardyWeinberg. No hay signifcancia
estadstica por lo que no es compatible con
el equilibrio de Hardy-Weinberg. (p: 2pq: q)
Las reacciones de PCR se llevaron a cabo
en el termociclador Applied Biosystems
2720 thermal cycler en las siguientes
condiciones:
94 C (desnaturalizacin inicial), 3 min.
94 C (desnaturalizacin), 30 seg.
63 C (hibridacin), 30 seg.
72 C (sntesis), 30 seg.
72 C (sntesis fnal), 4 min.
Los iniciadores primers permiten amplifcar
un fragmento del gen del receptor 3-
adrenrgico que incluye un sitio de restriccin
para la enzima MvaI. 10 microlitros del
producto amplifcado de 210 pb (amplicn)
se analizaron mediante electroforesis en
geles de agarosa al 2%, teidos con bromuro
de etidio y visualizados en un trasiluminador
de luz ultravioleta a 260 nm. Se utiliz un
voltaje de 80 V 100 miliamperios por 2 hrs.
(95,96)
PRODUCTO DE PCR 210 pb
Mval
Fragmentos Fragmentos
99, 62, 30,
12 y 7 pb
161, 30, 12
y 7 pb
Alelo Trp 64 Alelo Arg 64
figura 1. esquema de la deteccin del polimorfismo
trp64Arg del gen del receptor 3- Adrenrgico. el
anlisis de los resultados se desarroll utilizando
el programa spss v 15.
Digestin con enzimas de restriccin
(RFLP)
Una vez verifcado el amplicn se tomaron
10 microlitros y se someti a digestin
con 5 unidades de la enzima de restriccin
MvaI (obtenida de Micrococcus varians,
Cod. FERMENTAS: ER0551), una enzima
restrictiva especfca para la secuencia
TTCGAA.
Electroforesis en gel de agarosa
Luego los fragmentos fueron separados por
electroforesis a travs de un gel de agarosa
al 2.5 % y visualizados con revelador de
bromuro de etidio. Se tom la foto con el
equipo nuevo.
14 Cientfca 8 (1), 2011 15 Cientfca 8 (1), 2011
Asociacin entre el polimorfsmo Trp64Arg en el gen del receptor 3-adrenrgico, la dislipidemia, el mal control
metablico glucmico y el sobrepeso u obesidad, en diabticos tipo 2 de la provincia de Sullana, Piura (Per)
Medidas del riesgo entre genotipos en
diabticos
Se aprecia que el genotipo Trp64Arg no
es un factor de riesgo (OR = 0.563< 1) a
diabetes tipo 2 y adems no es signifcativo
(P=0,04>0,05)
Se aprecia que el genotipo Trp64Arg es un
factor de riesgo (OR= 1.150> 1) a diabetes
tipo 2, pero no signifcativo (P=0.802)
En el estudio de casos y controles en una
poblacin de 235 personas que asistieron
para esta evaluacin, se estudi a 93
sujetos, que reunieron las condiciones
para ser incluidos: 72 diabticos tipo
dos, y 21 controles de ambos gneros,
con edades entre 30 y 70 aos de la
ciudad de Sullana, Piura (Per). Se les
determin la frecuencia del polimorfsmo
Trp64Arg en el gen del receptor 3-
adrenrgico, parmetros bioqumicos y
medidas antropomtricas de diabticos
tipo 2 y controles, y se aplic la estadstica
descriptiva y de comparacin de los
genotipos con las variables bioqumicas e
IMC en la poblacin de estudio.
En relacin al anlisis y discusin de los
resultados de la estadstica descriptiva de
los genotipos y parmetros bioqumicos e
IMC en la poblacin de estudio (diabticos
y controles), se pudo observar que las
frecuencias de los genotipos del gen
del receptor 3-adrenrgico halladas
en la poblacin de estudio, fueron las
siguientes: de 72 (100%) diabticos: 20
(27.8%) Trp64Arg, 8 (11.1%) Arg64Arg,
y Trp64Trp 44 (61.1%), y de los 21
(100%) sujetos control: 3 (14.3%)
Trp64Arg, 6 (28.6%) Arg64Arg y 12
(57.1%) Trp64Trp (Figura 2).
figura 2. porcentaje de frecuencias de genotipos
3-AR en los grupos de control y diabticos.
Asimismo, se hallaron las siguientes
frecuencias allicas en el gen receptor 3-
adrenrgico en diabticos y controles, para
el alelo Trp: 0.75 (75.0%) y 0.64 (64.3%)
y para Arg: 0.25 (25.0%) y 036 (35.7%),
respectivamente (Figura 3).

Segn el principio de equilibrio de
Hardy-Weinberg (HW), nuestra poblacin de
estudio no se encontraba en equilibrio: (p:
2pq: q), probablemente por pertenecer los
participantes del estudio a una localidad con
alto parentesco entre ellos, que desvirta la
condicin del azar. Esto qued confrmado
en la prueba del chi cuadrado utilizando el
programa SPSS v 15, por el cual se hace el
anlisis a dos colas que confrma el resultado
del principio de HW (p = 0.08 > p= 0.05).
Los promedios obtenidos para glucemia
y Hb-G en diabticos y controles fueron:
210.7104 mg/dl, 9.62.8 % y 82.110.4 mg/dl,
7.31.6 %, respectivamente, producindose un
incremento por diferencia de medias de 128.6
mg/dl (61%) y el 2.3 % (16.6%) de glucemia
y Hb-G, respectivamente, en diabticos con
respecto a los controles, con valor estadstico
signifcativo (p < 0.05), al ser comparados
con la prueba t de Student para muestras
independientes (diabticos y controles), lo
que signifca tambin que los diabticos se
encontraban en un mal control metablico
glucmico (hemoglobina glicosilada > 8%).
El ndice de Masa Corporal (IMC) se hall
en diabticos y controles en 24.73.5 y
26.23.8, respectivamente. Resultando en
1.5 (1.3%) aumentado en los controles con
respecto a los diabticos, sin signifcancia
estadstica (p= 0.18), pero indica que los
controles se encuentran en la condicin de
preobesos (IMC: 25,00 - 27,49), mientras
que los diabticos han perdido peso con
respecto al inicio de su enfermedad y hoy
figurA 3. porcentaje de frecuencias allicas e
controles y diabticos
P
O
R
C
E
N
T
A
J
E
S
P
O
R
C
E
N
T
A
J
E
S
0%
20%
40%
60%
80%
0%
20%
40%
60%
80%
57%
61%
14%
28%
29%
11%
35,7%
38,6%
64,3%
71,4%
DM2 Control Diabtico
DM2 Control Diabtico
P
O
R
C
E
N
T
A
J
E
S
P
O
R
C
E
N
T
A
J
E
S
0%
20%
40%
60%
80%
0%
20%
40%
60%
80%
57%
61%
14%
28%
29%
11%
35,7%
38,6%
64,3%
71,4%
DM2 Control Diabtico
DM2 Control Diabtico
16 Cientfca 8 (1), 2011
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
SEduardo Flores J., Patrocinio Flores J., Martha Garca M., Mximo Eduardo Flores G.
contrarias, cociente de probabilidades
relativas, oportunidad relativa. En los
estudios de casos y controles, dado que la
incidencia es desconocida, el mtodo de
estimacin del riesgo relativo es diferente y
se estima calculando el OR, que corresponde
al cociente de dos odds o chances.
En el caso de los estudios epidemiolgicos,
usualmente se dispone de dos grupos,
uno de ellos utilizado como referencia o
de comparacin con el cual se efecta el
contraste. Su valor suele ser semejante al de
Riesgo Relativo (RR). Se considera que hay
riesgo cuando el OR es igual o mayor que 1
y tiene signifcancia estadstica cuando los
intervalos de confanza al 95% (IC 95%) no
pasan por la unidad (uno).
De los resultados para medir el factor de
riesgo entre los genotipos, se hall que en
el total de sujetos de estudio (diabticos
ms controles) el genotipo Trp64Arg es un
factor de riesgo de sobrepeso, dislipidemia,
y mal control metablico glucmico.
Asimismo, el genotipo Arg64Arg es un
factor de riesgo de sobrepeso y a padecer
diabetes, pero en ambos casos no se hall
signifcancia estadstica.
Por otro lado, las causas que desencadenan
la diabetes tipo 2 son desconocidas, aunque
al parecer se trata de la combinacin
de factores genticos, nutricionales y
ambientales. En la diabetes tipo 2 se sugiere
que infuyen genes de susceptibilidad para
padecer la enfermedad.
El gen de la insulina, el gen receptor de la
insulina y los transportadores de glucosa
no son polimrfcos, los otros s. Algunos
autores, producto de sus estudios sobre
el polimorfsmo Trp64Arg del gen receptor
3-adrenrgico, han concluido que existe
controversia entre la asociacin de la variante
Trp64Arg del gen 3-adrenoreceptor y la
obesidad visceral.
La naturaleza de muchos estudios, el
efecto modesto de la variante y el gnero
o diferencias tnicas entre los grupos
contribuyen a las discrepancias en las
investigaciones. Tchernof A. afrma que la
mutacin Trp64Arg no solo contribuye a
la ganancia de peso e inicio temprano de
diabetes, sino que tambin est asociado
con susceptibilidad a diabetes. Fujisawa
y Festa, en su estudio concluye que el
impacto del polimorfsmo Trp64Arg puede
ser clnicamente importante durante el
embarazo. El genotipo Trp64Arg fue ms
frecuente en mujeres con tolerancia a la
estn en normopeso (IMC< 25,00). Esto
probablemente se debe a que la mayora de
diabticos del estudio estn descontrolados
metablicamente y pierden protenas por la
orina, con lo cual pierden masa; adems,
no tienen un tratamiento de diabetes
conveniente, no asisten a los programas de
diabetes del Ministerio de Salud, a excepcin
de menos de una decena de ellos y, dada
su condicin econmica precaria, no les
alcanza para comprar sus antidiabticos y
recurren a algn tratamiento con productos
herbales solamente.
dISCUSIN

Los valores promedios de lpidos sricos en
diabticos y controles no tuvo signifcancia
estadstica. Como se observa, las dos
poblaciones, diabticos y controles, se
encontraban en dislipidemia (triglicridos
mayor a 150 mg/dl y HDL-C < 40 mg/dl),
lo que correlaciona con el IMC hallado.
Es fcil observar que en la dieta diaria de
la poblacin, diabticos y no diabticos,
con escasas excepciones, se consumen
raciones hipercalricas, abundantes en
carbohidratos.Se podra decir que cerca del
70 o el 80 % de una racin, sea en desayuno,
almuerzo o cena, es arroz, pltanos, yucas,
camote o pan.
En el anlisis de los resultados de la
asociacin entre genotipos vs parmetros
bioqumicos: En poblacin total de
estudio (diabticos y controles), se pudo
observar: que solo el caso del parmetro
que mide el control metablico glucmico
(hemoglobina glicosilada Hb-G) tuvo
signifcancia estadstica (p = 0.039), que
podra estar asociado al polimorfsmo
Trp64Arg. En los dems parmetros no se
hall signifcancia estadstica.
En el anlisis de los genotipos: Arg64Arg,
Trp64Arg, y Trp64Trp vs IMC, Dislipidemia y
Control Metablico glucmico en diabticos
tipo dos, no se encontr diferencias
signifcativas. En controles se encontr
diferencias signifcativas para el parmetro
IMC en los diferentes genotipos.
En lo que se refere a la discusin de los
resultados de las medidas del riesgo entre
genotipos en diabticos, se aplic el Odds
ratio que es la tercera de las mediciones
relativas del efecto. Ha sido traducida al
castellano con mltiples nombres como razn
de chances, razn de productos cruzados,
razn de disparidad, razn de predominio,
proporcin de desigualdades, razn de
oposiciones, oposicin de probabilidades
16 Cientfca 8 (1), 2011 17 Cientfca 8 (1), 2011
Asociacin entre el polimorfsmo Trp64Arg en el gen del receptor 3-adrenrgico, la dislipidemia, el mal control
metablico glucmico y el sobrepeso u obesidad, en diabticos tipo 2 de la provincia de Sullana, Piura (Per)
glucosa normal. Adems el polimorfsmo
Trp64Arg fue asociado con el incremento de
peso durante el embarazo.
Sakane y Naori S, sealan que el polimorfsmo
Trp64Arg puede predecir difcultades en la
prdida de peso, para bajar el ratio cintura
cadera, en la mejora del control de la glucosa,
la resistencia a la insulina en pacientes con
diabetes tipo 2 y obesos diabticos tipo
2. Segn Tchernof A, las mujeres obesas
mayores portadoras de la variante del
gen Trp64Arg 3-adrenoreceptor tienen
afectada la capacidad para perder grasa
visceral en respuesta a una restriccin
calrica prolongada. A pesar de las
diferencias genticas en la prdida adiposa
intraabdominal, la mejora en la eliminacin
de la glucosa fue similar en ambos grupos.
Para Ongphiphadhanakul, los datos sugieren
que la mutacin Trp64Arg del gen receptor
3-adrenrgico es comn en Tailandia y
parece ejercer efecto sobre la grasa corporal
pero no en el total de la grasa corporal, en
los hombres.
Silver, en su estudio: Trp64Arg 3-
adrenrgico receptor and obesity in Mexican
Americans concluye que la variante Trp64Arg
del gen del receptor 3-adrenrgico es un
gen susceptible por varias caractersticas
del sndrome de resistencia a la insulina
en mexicoamericanos. Desde efectos
modestos, diseo del estudio (seleccin de
sujetos, antecedentes genticos, anlisis
estadstico), pueden infuenciar mientras que
los rasgos estn asociados con las variantes
y si o no el efecto es o no detectable en
heterocigotos.
Comparando los resultados de la presente
investigacin con los obtenidos en otros
estudios, tenemos que el presente estudio
coincide con los resultados de el polimorfsmo
Trp64Arg del gen receptor 3-adrenrgico
que est asociado con la obesidad en las
mujeres coreanas de mediana edad, pero no
se puede sugerir una asociacin prominente
del polimorfsmo Trp64Arg del gen receptor
3-adrenrgico con la prevalencia de la
obesidad abdominal o con la dislipidemia en
mujeres coreanas de mediana edad.
Xiang, en su estudio Effects of Trp64Arg
mutation in the 3-adrenergic receptor gene
on body fat, plasma glucose level, lipid profle,
insulin secretion and action in Chinese
concluye, que el polimorfsmo Trp64Arg del
gen receptor 3-adrenrgico contribuye a la
variacin de la grasa corporal total en sujetos
chinos con Diabetes tipo 2.
Overen van-Dybiez, en su estudio 3-
adrenrgico receptor gene polymorphism
and type two diabetes in a Caucasian
population, concluye que los resultados
sugieren que la mutacin Trp64Arg no es
un mayor determinante de desrdenes
metablicos (obesidad, diabetes tipo 2) y
complicaciones crnicas de diabetes tipo 2
en una poblacin holandesa.
Coincide en la primera parte con el estudio
de Corella Gender specifc associations of
the Trp64Arg mutation in the 3-adrenergic
receptor gene with obesity-related phenotypes
in a Mediterranean population: interaction with
a common liporotein lipase gene variation,
que concluye que la mutacin Trp64Arg fue
asociada con BMI y lpidos en hombres.
En mujeres, una adicional interaccin gen-
gen con el polimorfsmo LPL-Hind III puede
explicar los resultados. Los resultados del
presente estudio diferen de otros estudios,
como el de Arri, segn el cual la frecuencia
de genotipos Trp/Trp, Trp/Arg, y Arg/Arg
en los pacientes fueron 63.0%, 33.3% y
3.7% respectivamente, que no diferan
signifcativamente de los 227 sujetos del
grupo control (67.0%, 31.3%, y 1.8%,
respectivamente).
No hubo diferencias en el ndice de masa
corporal (BMI) o la distribucin de la grasa
en el abdomen entre cada genotipo de los
pacientes, aunque la frecuencia del alelo
Arg64 tenda a aumentar con el BMI en los
sujetos control con edad por encima de los
60 aos. Ello sugiere que la mutacin est
involucrada en la ganancia de peso.
El estudio de Nobuyuki, concluye que
sujetos con la variante Trp64Arg no diferan
de los sujetos sin la variante en el ndice de
Masa Corporal, glucosa en plasma, insulina
en plasma, o historia familiar de diabetes u
obesidad.
En el estudio de Fujisawa se investig la
asociacin de Trp64 Arg con DMNID entre
japoneses y otros grupos tnicos. Las
frecuencias allicas de la mutacin (Arg) fueron
ligeramente altas pero no signifcativas en
DMNID en controles: 70 de 342 alelos (20.5%)
vs 40 de 248 (16.1%), respectivamente p>0.2.
Sin embargo, cuando estos datos se
coordinaron con los de los indios pima
y fnlandeses, el genotipo Arg64Arg fue
signifcativamente asociado con DMNID al
ser comparados con los otros genotipos.
18 Cientfca 8 (1), 2011
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
SEduardo Flores J., Patrocinio Flores J., Martha Garca M., Mximo Eduardo Flores G.
rEFErENCIaS BIBlIOGrFICaS
1. Islas A, Lifshitz G. Diabetes mellitus. Mxico D. F.: Editorial Interamericana; 1993.
2. Takashi K, Himoka M, Ysumichi M, Kazuyuki T. A subtype of diabetes mellitus associated
with a mutation of mitochondrial DNA. The New England Journal of Medicine 1994; 330(14):
962-968.
3. Pinies A, Vsquez A. Prediccin y prevencin de la diabetes mellitus no dependiente de la
insulina. Endocrinologa 1996; 43,(4):111-115.
4. Asociacin de Medicina Interna de Mxico A. C. Temas de medicina interna. Diabetes
mellitus. Mxico D. F.: Editorial Interamericana. McGrawHill; 1998.
5. Instituto Peruano de Seguridad Social. Boletn teraputico del centro nacional de
informacin sobre medicamentos txicos 1993; 2(17).
6. Hilary K. Organizacin Mundial de la Salud OMS. Ofcial responsable para diabetes.
Publicacin OMS, Ginebra.1995.
7. Zubiate M. Diabetes mellitus. 1995, p. 12-14.
8. GuerraGarca R, Zubiate M. Epidemiologa de la diabetes mellitus en el Per. En: Diabetes
Mellitus en el Per. 1995, p. 23-40.
9. Pealoza J. Diabetes mellitus en el Per. 1995, Cap. 3, p. 23-40.
CONClUSIONES

1. Las frecuencias de los genotipos del gen
del receptor 3-adrenrgico halladas en
la poblacin de estudio fueron: 61.1%
(44) Trp64Trp, 27.8% (20) Trp64Arg y
11.1% (8) Arg64Arg para diabticos; y:
57.1% (12) Trp64Trp, 14.3% (3) Trp64Arg
y 28.6% (6) Arg64Arg para controles.
Asimismo, se hallaron las siguientes
frecuencias allicas en el gen receptor
3-adrenrgico en diabticos y controles:
para el alelo Trp, 75% y 64.3%, y para
Arg, 25.0% y 35.7%, respectivamente.

Se deduce que la frecuencia allica de la
mutacin (Arg) fue un poco menor pero
no signifcativa (p = 0.088) en diabticos
que en sujetos controles.
2. Los diabticos se encontraron con
mal control metablico glucmico e
hiperglicemia. Al aplicar el test t de
Student en diabticos y controles se
pudo observar que solo la hemoglobina
glicosilada (Hb-G) tuvo signifcancia
estadstica (p = 0.039), y podra estar
asociada al polimorfsmo Trp64Arg.
3. En el anlisis de los genotipos vs IMC,
dislipidemia y control metablico glucmico
en controles se hallaron diferencias
signifcativas para el parmetro IMC en los
diferentes genotipos, pero no en diabticos
tipo 2.
4. En el anlisis de riesgo odds ratio, se
hall que en el total de sujetos de estudio
(diabticos ms controles) el genotipo
Trp64Arg alcanz cierto grado de factor
de riesgo a sobrepeso, dislipidemia y
a mal control metablico glucmico, y
que el genotipo Arg64Arg es un factor
de riesgo de sobrepeso de padecer
diabetes, pero en todos los casos no
tuvo estadstica signifcativa.
De lo que se concluye que el polimorfsmo
de estudio es importante, pero no es un
nico ni mayor factor determinante para
desarrollar diabetes tipo 2.
aGradECIMIENTO

A los doctores Ral Rosadio Alcntara
y Abelardo Lenn Maturrano Hernndez,
del Laboratorio de Biologa Molecular de
la Facultad de Medicina Veterinaria de la
Universidad Nacional Mayor de San Marcos,
por su valioso apoyo.
A los M. C. Gersimo lvarez Ato y Espec.
Endoc. Anselmo Crdova, del Hospital Base
Sullana, por su apoyo.
Al doctor Mario Monteghirfo Gomero, del
Instituto Peruano de Biologa Molecular (IPBM),
por el apoyo en la obtencin del ADN.
18 Cientfca 8 (1), 2011 19 Cientfca 8 (1), 2011
Asociacin entre el polimorfsmo Trp64Arg en el gen del receptor 3-adrenrgico, la dislipidemia, el mal control
metablico glucmico y el sobrepeso u obesidad, en diabticos tipo 2 de la provincia de Sullana, Piura (Per)
recepcin: 17/02/2011
AceptAcin: 22/03/2011
eduardo flores
correspondencia: efloresj57@yahoo.com
10. Erikson J, Franssilakallunki A, Solarinta C, Widen E, Schalin C, et al. Early metabolic
defects in persons at increased risk for non-insulindependent diabetes mellitus. New
Engl. J. Med. 1989; 321: 337-43.
11. Rissanen J, Kuopusjarvi M, Pihlajamaki J. The Trp64Arg Polymorphism of the 3adrenergic
Receptor gene Diabetes Care.1997; 20(8): 1319-23.
12. Halaas, J, Gajiwala, K, Maffei, M, Cohen S, Chait B, Rabinowitz D, et al. Weight-reducing
effects of the plasma protein encoded by the obese gene Science 1995; 269(5223): 543-46
13. Cirino G. Involvement of 3-adrenergic receptor activation via cyclic GMP-but not-
dependent mechanisms in human corpus cavernosum function. Proc. Nati Acad Sci USA.
2003; 100 (9):5531-6.
14. Ango H. Estandarizacin de la Reaccin en Cadena de la Polimerasa (PCR) para la deteccin
de Brucella spp en biopsias de medula sea. Tesis de Magster en Microbiologa. 1996.
Facultad de Farmacia y Bioqumica. UNMSM. Lima - Per.
15. Murray G, Grannerd, Meyes P, Rodwell V. Bioqumica de Harper. 12 edicin. Mxico
D.F.: Editorial Manual Moderno, 1992.
16. Caldern R, Velasco-Pealoza J. Diabetes mellitus en el Per. Revista mdica IPSS 1996;
4(2): p. 11-14.
17. Clement K, Vaisse Ch, Manning B, Basdevant A, Guy-grand B, Ruiz J, et al. Genetic
variations in the 3-adrenergic receptor and an increased capacity to gain weight in
patients with morbid obesity. N. England J. Med. 1995; 333: 352-4.
18. Arner P. The 3-adrenergic receptor a cause and cure of obesity. N. Engl. J. Med. 1995; 333:382 3.
19. Widen E, Lehto M, Kanninen T, Walston J, Shuldine R, Groop C. Association of a
polymorphism in the 3-adrenergic receptor gene with features of the insulin resistance
syndrome in Finns. N. England. J. Med. 1995; 333: 348-51.
20. Walston J, Silver k, Bogardus C. Time of onset of noninsulin dependent diabetes mellitus and
genetic variation in the 3-adrenergic receptor gene N. Engl. J. Med. 1995; 333: 3437.
21. Walston J, Silver k, Hilfker H, Andersen R, Seibert M, Beamer B, et al. Insulin response to
glucose is lower in individuals homozygous for the Arg64Arg variant of the 3-adrenergic
receptor gene J. Clin. Endocrinol. Metab. 2000; 85: 4019-22.
22. Oizumi T, Daimon M, Saitoh T, Kameda Y, Yamaguchi H, Ohnuma H, et al. Genotype
Arg/Arg but not Trp/Arg of the Trp64Arg Polymorfsm of the 3-Adrenergic Receptor is
Associated with Type Diabetes and Obesity in a Large Japanese Sample. Diabetes Care.
2001; 24:1579-83.
23. Lillioja S, Mott D, Spraul M, Ferraro R, Foley J, Ravussin E, et al. Insulin Resistance and
Insulin Secretory Dysfunction as Precursors of NonInsulin - Dependent Diabetes Mellitus:
Prospective Studies of Pima Indians. N. Engl J Med. 1993; 329 (27):1988-92
24. Froguel P, Vaxillaire M. Close linkage of glucokynase locus on chromosome 7 p to early
Onset Non Insulin Locus - Dependent Diabetes Mellitus. Nature 1992, 356:1624. (Erratum
Nature 1992, 357: 607).
25. Gulli E, Ferramini L, Stern S, Haffner S, De Inonas R. The metabolic profle of NIDDM is
fully stablished in glucose tolerant of spring of two Mexican American NIDDM parents.
Diabetes. 1992; 41: 1575-87.
26. Halaas J, Gajiwala K, Maffei M, Cohen S, Chait B, Rabinowitz D, et al. Weight-reducing
effects of the plasma protein encoded by the obese gene. Science 1995; 269(5223): 543-6.
27. Granner K, Obrien M. Molecular physiology and genetics of NIDDM. Diabetes Care. 1992;
5: 369-88.
20 Cientfca 8 (1), 2011
* Universidad Cientfca del Sur. Lima. Per. Laboratorio de Cultivo Celular.
2
Universidad Cientfca del Sur. Laboratorio de Investigacin.
EfECTO DE LA Buddleja incana SOBRE LA PRODUCCIN DE IL-2 y
IfN- EN CLULAS MONONUCLEARES PERIfRICAS DE HUMANOS
BUDDLEJA INCANA EFFECT ON THE PRODUCTION OF IL-2 AND IFN- IN HUMAN PERIPHERAL
MONONUCLEAR CELLS
Nathaly Enciso Benavides
1
, Jos Amiel Prez
1
, Emilio Guija Poma
2
, Oscar Retegui Arvalo
2
,
Alejandro Fukusaki Yoshizawa
2
, Javier Enciso Gutirrez *
rESUMEN
La IL-2 y el IFN- son citoquinas Th1
producidas principalmente por linfocitos, y
juegan un rol importante en la infamacin
y en la inmunidad antitumoral. La Buddleja
incana es una planta andina de uso ancestral
en medicina popular, que ha sido estudiada
por nuestro grupo, y ha demostrado efectos
inhibitorios de la infamacin aguda y
crnica. El objetivo de este trabajo fue
evaluar un posible efecto inmunomodulador
de la infamacin por los extractos acuoso y
metanlico de B. incana.
Con este fn, clulas monocticas circulantes
de humanos adultos sanos fueron obtenidas
a partir de sangre perifrica y, mediante
tcnica de Ficoll Hipaque, fueron separadas
por gradiente de densidad, cultivadas en
medio RPMI-1640 adicionado con un 10%
de suero fetal bovino (SFB) en frascos de 25
ml y, una vez que se alcanz una confuencia
de 70% de la superfcie del frasco de cultivo,
se procedi a disociar las clulas mediante
tripsina al 0,25%. A partir de este cultivo
de primer pasaje, se sembraron 2x10 (5)
clulas/pocito en microplacas ELISPOT
(Cell Science, Inc, USA) de 96 pocitos,
mantenidas por 48 horas en RPMI-1640
con un 10% de SFB, a 37C de temperatura
y en un ambiente con un 5% de CO
2
. Se
evalu un extracto acuoso de B. incana en
dosis de 769, 254, 154, 77 y 7,7 g/ml, y
otro extracto metanlico en dosis de 760l/
ml. Se utiliz ftohemaglutinina (PHA) como
control positivo y como blanco el medio de
cultivo solamente; cada dosis fue sembrada
en repeticiones de seis pocitos.
Los resultados muestran que el extracto
acuoso estimula una moderada produccin
de IL-2 dosis dependiente, siendo mayor
a 769 g/ml, y de IFN- a dosis de 769 y
254g/ml, pero en cualquier caso menor
que el control PHA; mientras que el extracto
metanlico estimul muy ligeramente IL-2
y no estimul IFN-. Se concluye que el
extracto acuoso de B. incana tiene un
moderado efecto estimulante de IL-2 y
IFN- que podra contribuir con su actividad
aninfamatoria y eventualmente antitumoral,
junto a otros mecanismos biolgicos an
desconocidos.
Palabras clave: Buddleja incana, IL-2,
IFN-, infamacin.
aBSTraCT
The IL-2 and IFN- are Th1 cytokines
produced mainly by lymphocytes and play an
important role in infammation and anti-tumor
immunity. The Buddleja incana is an ancestral
Andean plant used in folk medicine since the
Incas, has been studied by our group having
demonstrated inhibitory effects of chronic and
acute infammation. The aim of this study was
to evaluate any immunomodulatory effect of
infammation of the aqueous and methanol
extracts of B. incana.
To this end human circulating mononuclear
cells healthy adults were obtained from
peripheral blood by Ficoll Hipaque technique
were separated by density gradient, cultured
in RPMI-1640 supplemented with 10% fetal
bovine serum (FBS) in bottles 25 mL, once
they reached a confuence of 70% of the
surface of culture dish, we proceeded to
separate the cells by 0.25% trypsin. From
this primary cultures of frst passage were
seeded 2x105 cells / hole dug in ELISPOT
microplates (Cell Science, Inc, USA) of 96
wells held for 48 hours in RPMI-1640 with
10% FBS, at 37 C and in an atmosphere with
5% CO
2
. We evaluated an aqueous extract of
B. incana in doses of 769, 254.154, 77 and
20 Cientfca 8 (1), 2011 21 Cientfca 8 (1), 2011
Efecto de la Buddleja incana sobre la produccin de IL-2 y IFN- en clulas mononucleares perifricas de humanos
7.7 mg /mL and a dose of methanol extract
760L/mL, we used phytohemagglutinin
(PHA) as positive control and target only the
culture medium, each dose was planted in
replications of six wells.
The results show that the aqueous extract
stimulates a moderate production of IL-2
dose-dependent being greater than 769 mg
/ mL, and IFN- at doses of 769 and 254g/
mL, but in any case less than the PHA control,
whereas that the methanolic extract slightly
stimulated IL-2 and IFN- did not stimulate.
We conclude that the aqueous extract of B.
incana has a moderate stimulatory effect of
IL-2 and IFN-
could contribute to its anti infammatory activity
and anti tumoral eventually, along with other
biological mechanisms remain unknown.
Keywords: Buddleja incana, IL-2, IFN-,
infammation.
INTrOdUCCIN
La infamacin crnica es responsable de
aproximadamente el 20% de los casos de
cncer en humanos (1). Se ha demostrado
que la infamacin con predominio de clulas
Th1 especfcas del tumor puede prevenir en
lugar de promover el cncer (2,3).
Dentro de las citoquinas Th1 involucradas
estn el Interfern gama (IFN-) y la
Interleucina-2 (IL-2), producidas por
linfocitos T-CD4+ (LT/CD4), que ayudan a
expandir la poblacin de linfocitos T-CD8
citotxicos (LTc/CD8) que pueden destruir
clulas tumorales a travs de las molculas
efectoras granzyme y perforina (4); as
mismo, interferen la proliferacin de estas
clulas y las inducen a producir sustancias
que atraen clulas del sistema inmune (5,6).
Experimentos realizados en ratones han
demostrado que clulas T supresoras de
LT-CD4+ inhiben la inmunidad antitumoral y
que la eliminacin de tales clulas supresoras
mejora la respuesta inmune antitumoral (7,8).
La Buddleja incana es una planta medicinal
andina que ha demostrado tener efecto anti-
infamatorio agudo en afecciones cutneas (9)
y gastrointestinales (10), as como inhibicin
de la proliferacin de clulas normales (11)
y tumorales (12) in vitro. Adems, in vivo ha
evidenciado accin antinfamatoria crnica
en ratones (13). Estas actividades biolgicas
pueden atribuirse en parte a su alto contenido
de polifenoles y favonoides (11); sin embargo,
no se conoce si esta planta interviene
favorablemente sobre el sistema inmune de
manera que los efectos mostrados sobre la
infamacin y proliferacin celular puedan
explicarse, adems, por alguna actividad
inmunomoduladora que coadyuve a dichos
efectos.
Con el objetivo de dilucidar los mecanismos
de accin de la Buddleja incana sobre la
infamacin y, posiblemente sobre algunos
tipos de cncer, nos propusimos determinar
si esta planta tena alguna accin sobre las
citoquinas IL-2 y IFN- del grupo Th1 en
clulas mononucleares perifricas humanas,
mediante la tcnica ELISPOT.
MaTErIal Y MTOdOS
Obtencin de extractos
La Buddleja incana fue obtenida el mes de
marzo de 2006 en Cerro de Pasco, Per,
y su identifcacin botnica se realiz en el
Museo de Historia Natural de la Universidad
Nacional Mayor de San Marcos. Hojas y tallos
fueron secados al medio ambiente y a estufa
a 40C por 48 horas, luego colocados en una
campana desecadora y molidos en un molino
Wiley. El material molido se pas a travs
de un tamiz, se coloc en dos frascos de
vidrio donde se le adicion agua o metanol,
respectivamente. El producto obtenido fue de
2.003 g equivalente al 20,3% de la muestra de
la planta para el extracto acuoso y el 16.4%
para el extracto metanlico.

Cultivo de clulas monociticas perifricas
Se extrajo sangre perifrica de un varn sano,
y por diferencial de gradiente de densidad
empleando Ficoll Hipaque se obtuvo
mononucleares que fueron cultivados en
frascos Falcon de 25 ml, empleando como
medio de cultivo RPMI-1640 (Biological,
Inc.) adicionado con un 10% de suero fetal
bovino (SFB). Se cultiv a 37C en atmsfera
de un 5% de CO2 y un 95% de humedad.
Produccin de citoquinas
La induccin de produccin de citoquinas
por el extracto acuoso de Buddleja incana
se midi en cultivo primario de clulas
mononucleares (Figura 1) de humanos
adultos sanos sin prestimulacin ni cultivos
previos. Se evaluaron dos citoquinas del tipo
Th1: Interfern-gama (IFN-), Interleucina-2
(IL-2). Se utiliz la tcnica ELISPOT y el
protocolo descrito por el fabricante del
kit (Cell Sciences, Inc, USA) empleando
microplacas de 96 pocitos. Describimos a
continuacin el protocolo ELISPOT.
22 Cientfca 8 (1), 2011
Nathaly Enciso Benavides, Jos Amiel Prez, Emilio Guija Poma, Oscar Retegui Arvalo, Alejandro Fukusaki
Yoshizawa, Javier Enciso Gutirrez
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
S
figura 1. pocito positivo de moderada intensidad
pArA il-2/ifn-. tcnicA de elispot.
figura 2. cAntidAd de clulAs formAdorAs de spot por lA produccin de il-2 y ifn- en linfocitos
humanos por efecto del extracto acuoso y metanlico de BUDDLEJA INCANA a diferentes dosis.
Se inicia incubando placas-PVDF con 100
l de etanol al 70% durante 10 minutos a
temperatura ambiente. Luego, se lavaron por
tres veces con solucin buffer fosfato (PBS),
pH 7,4. Luego, a cada pocito se le agregaron
100L del conjugado de anticuerpos de
captura y se incub por toda la noche a 4 C.
Posteriormente, se lav y agreg leche
desnatada por 2 horas, se lav la placa y se
dispens 2x104 clulas, se incub por 20
horas a 37 C y una atmsfera con un 5% de
CO
2
. Seguidamente, se vaci el contenido y
se agreg el anticuerpo de deteccin para
incubarlo a 37 C por 90 minutos; luego, se
lav tres veces con PBS-0.1% Tween-20.
Posteriormente, se agreg el conjugado
estreptavidina-fosfatasa alcalina e incub a
37 C por una hora. Finalmente, se lav e
incub en buffer BCIP/NBT para el revelado
por 5-20 minutos, monitoreando la aparicin
de las manchas (spot), y se concluyo con el
lavado con agua destilada y el secado de la
placa. Para la lectura se dej reposar una
noche a 4 C.
aNlISIS
Se estableci un punto de corte entre los
resultados positivos y negativos, cuya
exigencia fue que el nmero promedio de
puntos contado en los pozos de prueba
sea al menos el doble del que se cuentan
en los pozos control (clulas cultivadas en
medio solamente) y que haya una diferencia
de al menos cinco puntos entre el control y
los pozos de prueba (14,15). Los resultados
se expresaron en nmero de clulas que
formaron manchas (spot) indicativas de
produccin de la citoquina correspondiente.
En la Figura 1 se muestra un pocito con
reactividad positiva referencial siguiendo el
protocolo aplicado en este trabajo. Con esta
tcnica se pudo determinar el efecto del
extracto acuoso de la Buddleja incana sobre
la produccin de las citoquinas IL-2 y IFN-
mediante la tcnica ELISPOT revelndose
en la formacin de manchas (spot) de fcil
identifcacin y cuantifcacin empleando un
estereo-microscopio.
rESUlTadOS Y dISCUSIN
Mediante este mtodo se demostr que el
extracto acuoso de Buddleja incana estimula
la produccin de IL-2 y IFN- de manera
dosis dependiente, siendo mayor a dosis
de 769 g/mL; sin embargo, no supera al
control ftohemaglutinina (PHA).
N

M
E
R
O

D
E

S
P
O
T

P
O
R

1
0
0
,
0
0
0

L
I
N
F
O
C
I
T
O
S
7
9
6

g
/
m
L
P
H
A
B
L
A
N
C
O
2
5
4

g
/
m
L
1
5
4

g
/
m
L
7
7

g
/
m
L
7
,
7

g
/
m
L
7
6
9

g
/
m
L
CONTROLES EXTRACTO ACUOSO EXTRACTO
METANLICO
IL-2
IFN-
22 Cientfca 8 (1), 2011 23 Cientfca 8 (1), 2011
Efecto de la Buddleja incana sobre la produccin de IL-2 y IFN- en clulas mononucleares perifricas de humanos
En tanto que el extracto metanlico a la
mxima dosis (769g/ml) tiene bajo estmulo
de ambas citoquinas, siendo similar a la
estimulacin que produce la mnima dosis
(7,7g/ml) del extracto acuoso (Figura 2). La
produccin de estas dos citoquinas in vivo
inducidas por la B. incana puede explicar
la propiedad antinfamatoria descrita en
trabajos previos (9) y se sustentara en la
accin de terpenoides aislados en plantas
del mismo gnero Buddlejaceae (16), los
que presumiblemente se encuentran en el
extracto acuoso de la Buddleja inca.
El comportamiento bimodal de diferentes
tipos de extractos de la misma planta,
sobre la produccin de IL-2 y IFN- por
monocitos circulantes, demuestra que el
extracto acuoso estimula la produccin de
ambas citoquinas en mayor porcentaje que
el extracto metanlico, lo cual podra estar en
relacin directa al mayor efecto inmunognico
y, a su vez, al mayor efecto inhibitorio de la
proliferacin de fbroblastos normales y de
clulas tumorales que este mismo extracto
demostr en trabajos anteriores (12,14), en
tanto que la estimulacin de la proliferacin
de estos dos tipos de clulas, por parte del
extracto metanlico, no tiene relacin con la
produccin de IL-2 y IFN- lo que demuestra,
que este tipo de extracto sera poco
inmunognico pero altamente proliferativo.
Diversos trabajos explican los efectos
que ambas citoquinas han demostrado
sobre la proliferacin de clulas tumorales
mediante la activacin de macrfagos
(6,17), lo que podra ocurrir en nuestra
experiencia, por lo que podemos postular
que in vivo la Buddleja incana estimulara
selectivamente la proliferacin de
linfocitos T CD4 y, consecuentemente,
la produccin de IL-2 y IFN-, como lo
sealan revisiones recientes(18), pudiendo
estar relacionado con la tumorignesis
vinculada a la infamacin(19), mientras
que in vitro inhibe la proliferacin de
clulas tumorales y es moderadamente
inmunognico; es necesario, entonces,
demostrar si estos efectos tambin se
producen in vivo.
Se concluye en que el extracto acuoso
de la Buddleja incana produce una
estimulacin moderada de la produccin
de las citoquinas IL-2 y IFN- en clulas
mononucleares humanas.
aGradECIMIENTO
Al Concejo Nacional de Ciencia y Tecnologa
del Per, que fnanci este trabajo mediante
contrato de subvencin No. 016-2007-
CONCYTEC-OAJ.
rEFErENCIaS BIBlIOGrFICaS
1. Pikarsky E Porat MR, Stein I, Abramovitch I, Amit S, Kasem S, Gutkovich-Pyest E,
Urieli-Shoval E, Galun E and Ben-Neriah Y. NF- B functions as a tumour promoter in
infammation-associated cancer. Nature 2004. 431, 461-6.
2. Knutson KL, Disis ML. Tumor antigen-specifc T helper cells in cancer immunity and im-
munotherapy. Cancer Immunol Immunother. 2005; 54(8): 721-8.
3. Haabeth OA, Lorvik KB, Hammarstrm C, Donaldson IM, Haraldsen G, Bogen B, Corthay
A. Infammation driven by tumour-specifc Th1 cells protects against B-cell cancer. Nat
Commun. 2011; 2: 240.
4. Finn O. Cancer immunology. N. Engl. J. Med., 2008; 358: 2704-15.
5. Luo F, Song X, Zhang Y, Chu Y. Low-dose curcumin leads to the inhibition of tumor
growth via enhancing CTL-mediated antitumor immunity. Int Immunopharmacol. 2011.
6. Song MY, Yim JY, Yim JM, Kang IJ, Rho HW, Kim HS, Yhim HY, Lee NR, Song EK, Kwak
JY, Sohn MH, Yim CY. Use of curcumin to decrease nitric oxide production during the
induction of antitumor responses by IL-2. J Immunother 2011; 34(2): 149-64.
7. North RJ. Radiation-induced, immunologically mediated regression of an established
tumor as an example of successful therapeutic immunomanipulation: preferential elimi-
nation of suppressor T cells allows sustained production of effector T cells. J Exp Med
1986; 164: 1652-66.
24 Cientfca 8 (1), 2011 24 Cientfca 8 (1), 2011
Nathaly Enciso Benavides, Jos Amiel Prez, Emilio Guija Poma, Oscar Retegui Arvalo, Alejandro Fukusaki
Yoshizawa, Javier Enciso Gutirrez
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
S
8. Awwad M, North RJ. Cyclophosphamide-induced immunologically mediated regression
of a cyclophosphamide-resistant murine tumor: a consequence of eliminating precursor
L3T4+ suppressor T-cells. Cancer Res 1989; 49: 1649-54.
9. Enciso JA, Ramrez A, Arbocco A, Avendao A, Figueroa B, Jiras K, Velarde P. Inhibicin
de la infamacin subcutnea aguda en ratones Balb/c mediante extracto de la planta
Buddleja incana (Quishuar). 2006. Resmenes. XIII Encuentro Cientfco Internacional de
Invierno. 8-11 Agosto. Lima. Per.
10. Enciso JA, Sumura T. Modulacin de la infamacin gastrointestinal mediante la inhib-
icin de la COX-2 por extracto de Buddleja incana en ratas. Rev. Ac. Per. Farmacia 2005;
20: 27-35.
11. Guija E; Amiel J, Fukusaki A, Retegui O, Amiel D, Enciso JA, Valdivia E, Rodrguez R,
Neyra K, Enciso B. N. Diversos efectos sobre la proliferacin de cultivos primarios de
fbroblastos por extractos de Buddleja incana. Cientfca 2009; 6(2): 134-41.
12. Amiel Prez J; Enciso Benavides N; Fukusaki Yoshisawua A; Guija Poma E, Retegui Arvalo
O, Enciso Gutirrez JA. Efecto de la Buddleja incana sobre la proliferacin de clulas de
carcinoma hepatocelular humano (Hep-G2). Cientfca 2010; 7(3): 224-31.
13. Enciso Gutirrez JA, Guija Poma E, Amiel Prez J, Retegui Arvalo O, Fukusaki A,
Enciso Benavides N, Tomatis Korrodi M. Inhibicin de la promocin del cncer por phor-
bol12-miristato 13 acetato en piel de ratn mediante la decoccin de Buddleja incana.
I Jornada de Investigacin de la Universidad Cientfca del Sur, 13-14 de noviembre del
2009. Lima.
14. Lalvani A, Nagvenkar P, Udwadia Z, Pathan AA, Wilkinson KA, Shastri JS, Ewer K, Hill AV,
Mehta A, Rodrigues C. Enumeration of T cells specifc for RD1-encoded antigens sug-
gests a high prevalence of latent Mycobacterium tuberculosis infection in healthy urban
Indians. J Infect Dis. 2001; 183(3): 469-77.
15. Whelan KT, Pathan AA, Sander CR, Fletcher HA, Poulton I, Alder NC, Hill AV, McShane H.
Safety and immunogenicity of boosting BCG vaccinated subjects with BCG: comparison
with boosting with a new TB vaccine, MVA85A. PLoS One 2009; 4(6): 5934.
16. Houghton PJ, Mensah AY, Iessa N, Hong LY. Terpenoids in Buddleja: relevance to
chemosystematics, chemical ecology and biological activity. Phytochemistry 2003; 64(2):
385-93.
17. Brutkiewicz RR, Suzuki F. Biological activities and antitumor mechanism of an immunopoten-
tiating organogermanium compound, Ge-132 (review). In Vivo 1987; 1(4): 189-203.
18. Disis ML. Immune regulation of cancer. J. Clin. Oncol. 2010; 28: 4531-38.
19. Coussens LM, Werb Z. Infammation and cancer. Nature 2002; 420: 860-75
recepcin: 18/04/2011
AceptAcin: 30/04/2011
javier enciso
correspondencia: jenciso333@yahoo.com.mx
24 Cientfca 8 (1), 2011 25 Cientfca 8 (1), 2011
Elucidacin estructural del aceite esencial de Ruta graveolens L. (ruda), cultivada en el Per. Actividad antioxidante
y bioensayo de citotoxicidad
24 Cientfca 8 (1), 2011
ELUCIDACIN ESTRUCTURAL DEL ACEITE ESENCIAL DE Ruta
graveolens L. (RUDA), CULTIvADA EN EL PER. ACTIvIDAD
ANTIOxIDANTE y BIOENSAyO DE CITOTOxICIDAD
STRUCTURAL ELUCIDATION OF THE ESSENTIAL OIL OF RUTA GRAVEOLENS L. RUDA, GROwN IN
PERU. ANTIOxIDANT AND CyTOTOxICITy BIOASSAy ACTIVITy
Amrico Castro L.
1
, Jos Jurez E.
1
, Norma Ramos C.
1
, Silvia Surez C.
2
, Fernando Retuerto P.
3

1
Universidad Nacional Mayor de San Marcos. Instituto de Ciencias Farmacuticas y Recursos Naturales Juan de
Dios Guevara- Facultad de Farmacia y Bioqumica.
2
Universidad Nacional Mayor de San Marcos. Centro de Investigacin de Bioqumica y Nutricin Alberto Guzmn
Barrn - Facultad de Medicina.
3
Universidad Nacional Mayor de San Marcos. Instituto de Investigacin Antonio Raimondi - Facultad de Ciencias
Biolgicas.
rESUMEN
El objetivo del estudio fue realizar la
elucidacin estructural del aceite esencial
de Ruta graveolens L. (ruda) cultivada en el
Per, determinar su actividad antioxidante
y su citotoxicidad. Las plantas completas
se colectaron en la provincia de Tarma,
departamento de Junn, aislndose de ellas
1,80 kg de hojas frescas que fueron tratadas
en un sistema de arrastre con vapor de agua,
y se obtuvo un rendimiento del 0,3% v/p
de aceite esencial. La elucidacin estructural
de los componentes qumicos del aceite
esencial se realiz por cromatografa de gas/
espectrometra de masas (CG-EM), destacando
la identifcacin de los siguientes componentes:
2-octanona, 2-nonanona, nonanal, ciclohexen-
5,6-dietenil-1-metil, 2-decanona, metil nonyl ter,
2-undecanona, ciclotetradecano, 2-dodecanona
y 2-tridecanona.
La evaluacin de la actividad antioxidante in
vitro del aceite esencial se realiz utilizando
el mtodo de captacin del radical
2,2-difenilpicrilhidrazil (DPPH), con lo cual
se demostr su capacidad antioxidante
como donador de electrones o hidrgeno
al radical DPPH. El IC50 del aceite esencial,
16,13 mg/mL, es elevado comparado con el
cido ascrbico, que es de 2,4 g/ml, y la
captacin del DPPH es relativamente baja.
La citotoxicidad del aceite esencial sobre
el desarrollo embrionario de Tetrapygus
niger (erizo de mar negro), se manifest
a concentraciones de 50 y 75 l de las
siguientes maneras: vulos alterados, lisis,
retraso en el desarrollo y embriones que
no cultivaron. A concentracin de 100 l se
detuvo el desarrollo completamente.
Palabras clave: Ruta graveolens L, Tetrapygus
niger, elucidacin estructural, actividad
antioxidante, citotoxicidad.
aBSTraCT
Study objective was performing the structural
elucidation of the essential oil of Ruta
graveolens L. Ruda grown in peru, determine
its antioxidant activity and cytotoxicity testing.
The complete plants were collected in Tarma
Province Department of Junin, and provided
1.80 kg of fresh leaves that were treated in
a drag system with water vapor, obtaining
performance of 0.3% essential oil perfusion.
The structural elucidation of chemical
constituents of the essential oil, performed
by chromatography Mass Spectrometry
(GC-MS), stressing the identifcation of the
following chemical components: 2-octanona
2-nonanona, nonanal, ciclohexen-5, 6-dietenil-
1-methyl-, 2-decanona, nonyl ether, methyl
2-undecanona, ciclotetradecano, 2-dodecanona
and 2-tridecanona.
Evaluation of antioxidant activity in vitro of
essential oil was made with the radical 2,
2-difenilpicrilhidrazil (DPPH) uptake method,
demonstrating the radical DPPH antioxidant
capacity as donor of electrons or hydrogen.
The IC50 of essential oil was 16,13 mg/
mL, high compared with the value of acid
Ascorbic, 2,4 mg/ml, and capture the DPPH
is relatively low. The cytotoxicity of essential
oil on the embryonic development of
Tetrapygus niger Black Sea Urchin, showed
at concentrations of 50 and 75 laltered eggs,
lysis, delayed development and embryos
that not clivaron. To concentration of 100 l
stopped development completely.
26 Cientfca 8 (1), 2011
Amrico Castro L., Jos Jurez E., Norma Ramos C., Silvia Surez C., Fernando Retuerto P.
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
S
Keywords: Ruta graveolens L, Tetrapigus
niger, structural elucidation, antioxidant
activity, cytotoxicity.
INTrOdUCCIN
La Ruta graveolens L. (ruda) es una planta
nativa originaria del sur de Europa y Asia
Menor; se le atribuyen efectos medicinales
como: antisptico, estimulante, emenagogo,
antiespasmdico, carminativo, estomacal,
diafortico, hipotensor y sedante. En la
medicina tradicional se utiliza para dolores
reumticos, faringitis, rinitis, amenorrea y
menorragia, fatulencia y abortivo (1).
Los aceites esenciales son odorferos e
inmiscibles con el agua. Se les obtiene por
diversas tcnicas de extraccin, entre ellas
enfeurage, con solventes orgnicos, por
prensado, hidrodestilacin, por arrastre con
vapor de agua y por fuidos supercrticos.
Estn presentes en muchas especies
vegetales y se ubican en diferentes partes
de la planta.
Qumicamente, estn constituidos por
monoterpenos, sesquiterpenos y compuestos
aromticos; tienen aplicacin en la industria
de alimentos, cosmtica y farmacutica. Las
tcnicas ms usuales para determinar su anlisis
cualitativo y cuantitativo es por Cromatografa
de Gas/Espectrometra de Masas (CG/EM) .
La actividad antioxidante del aceite esencial
de la especie estudiada, fue determinada
por el mtodo de captacin del radical 2,2-
difenilpicrilhidrazil (DPPH) y su actividad
citotxica se realiz en el desarrollo
embrionario de Tetrapygus niger (erizo de
mar negro).
MaTErIal Y MTOdOS
La especie vegetal se colect en la provincia
de Tarma, del departamento de Junn,
establecindose la siguiente clasifcacin
botnica, segn el sistema de clasifcacin
de Engler & Prantl, modifcado por Melchior
en 1964:
Divisin : Angiospermas
Clase : Dicotilednea
Subclase : Arquiclamdeas
Orden : Rutales
Gnero : Ruta
Especie : Ruta graveolens
N. V. : Ruda
del 0,3% v/p, el cual se conserv en un
frasco de color mbar a temperatura de
4 C. Por el anlisis preliminar se apreci
un aceite esencial de color ligeramente
amarillo y de olor penetrante que mostr ser
miscible en ter etlico, n-hexano, alcohol
etlico absoluto e inmiscible en agua.
Anlisis por cromatografa de gas/
espectrometra de masa (CG/EM)
El anlisis se realiz en un cromatgrafo
de gas/espectrmetro de masa (CG-EM)
modelo CG: Trace / EM: Trace, provisto de
una columna capilar de silicagel fundida
de 30 metros de longitud. Las condiciones
utilizadas fueron: temperatura inicial: 40C,
10 C/min; temperatura fnal 110 C (1 min.),
temperatura del inyector 240 C y volumen
de inyeccin 5 l. La identifcacin de los
componentes qumicos del aceite se realiz
mediante comparacin computarizada de
sus espectros de masa con los de la base
de datos del equipo.
Determinacin in vitro de la actividad
antioxidante del aceite esencial
Se realiz utilizando el mtodo del radical
2,2-difenilpicrilhidrazil (DPPH), en un
espectrofotmetro UV-VIS Double Beam PC.
El 2,2-difenilpicrilhidrazil (DPPH) es un radical
libre estable que presenta un color prpura
con absorbancia a 517 nm. Las sustancias
atrapadoras de radicales libres (donadoras de
hidrgeno) reaccionan con este compuesto
y producen la desaparicin del color. La
reaccin es seguida midiendo la disminucin
de la Absorbancia a 517 nm.
Los resultados se expresan como IC50,
porcentaje de inhibicin, porcentaje de
actividad antiradicalaria o equivalentes a la
vitamina C. El DPPH se disuelve en metanol
a una concentracin de 20 g/ml. La muestra
se prepar a concentraciones de 100, 50 y 10
g/ml y se emple como sustancia atrapadora
de referencia al cido ascrbico.
Los resultados se expresan en:
Inhibicin =
A = lectura del DPPH

B = lectura del aceite esencial
1,80 kg de hojas frescas fue tratado en un
sistema de arrastre con vapor de agua,
del que se obtuvo un volumen de 3 ml
de aceite esencial con un rendimiento
Se determina el IC50 para el cido ascrbico y
para el aceite esencial de Ruta graveolens L.
A - B
A
x 100
26 Cientfca 8 (1), 2011 27 Cientfca 8 (1), 2011
Elucidacin estructural del aceite esencial de Ruta graveolens L. (ruda), cultivada en el Per. Actividad antioxidante
y bioensayo de citotoxicidad
Determinacin de la actividad citotxica
Material biolgico
- Ruta graveolens L., Tetrapygus niger
El bioensayo se realiz en 22 muestras de
erizo de mar negro (Tetrapygus niger), las que
fueron colectadas en las playas de Ancn,
ubicada a 43 km al norte de Lima y trasladadas
en agua de mar entre 10 C y 15 C.
Procesamiento de las muestras
Obtencin de gametos
Se abri cuidadosamente al erizo por la parte
dorsal, con ayuda de una tijera de diseccin,
cortando en circunferencia, para no daar
los gametos. El sexo del animal se determin
al observar el color de los gametos. Los
vulos de Tetrapygus niger van del color
rojo al granate y el esperma es cremoso y
color blanquecino. Se extrajeron los racimos
de vulos de tres erizos hembras con ayuda
de una pinza limpia, y se colocaron en una
solucin de 500 ml de agua de mar fra hasta
que se tiera a un color prpura.
Se utiliz un oxigenador para mantener
los vulos viables. Despus, se procedi a
lavarlos decantando el agua sobrenadante
con la fnalidad de eliminar el tejido celmico
y restos internos que se encontraban
adheridos a los mismos; reemplazando
el agua de mar (fltrada tres veces) y
completando la solucin a 250 ml.
Fertilizacin
Se agreg una gota de espermatozoides
con ayuda de una pipeta Pasteur, sobre
un vaso de precipitado que contena la
suspensin de vulos lavados listos para
ser fecundados. Se mezclaron suavemente
los espermatozoides y los vulos con una
pipeta Pasteur limpia. Posteriormente, se
transfri una muestra de la suspensin de
vulos y espermatozoides a una lmina
portaobjetos. Se coloc un cubreobjetos y
se observ con un microscopio compuesto
a 40X. La observacin del huevo fecundado
signifc que el procedimiento de fertilizacin
se realiz en condiciones ptimas.
Preparacin del extracto
Se extrajo 2 ml del aceite esencial y se diluyeron
con 1 ml de agua de mar fra (solucin madre).
De la solucin madre se prepararon diluciones,
de 10, 25, 50, 75, 100, 150 y 200 l.
Preparacin de las muestras en viales
Se prepararon diluciones por duplicado y
como control se utiliz el aceite esencial
y el dimetilsulfxido (DMSO). Se agreg a
cada vial 1 ml de agua de mar fra (fltrada
de dos a tres veces). Luego se tomaron
2 ml de la suspensin de huevos recin
fecundados que se aadieron a cada vial de
la batera. Se agregaron 10 L de DMSO a
todos los viales exceptuando al control sin
DMSO. Una vez preparada la batera de
viales con las muestras correspondientes,
se acondicionaron en una cmara con agua
helada a temperatura entre 10C y 15C.
Se tomaron muestras cada dos horas para
observar efectos en el desarrollo del embrin
de erizo de mar negro.
rESUlTadOS
El mtodo de destilacin por arrastre con vapor
de agua permiti obtener un rendimiento del
0,3 % v/p del aceite esencial de hojas frescas
de Ruta graveolens L. Se realiz el anlisis
preliminar del aceite observndose un lquido
ligeramente amarillo, aromtico, penetrante y
altamente voltil; miscible en alcohol absoluto,
ter etlico, n-hexano e inmiscible en agua. El
anlisis de la composicin qumica del aceite
esencial se realiz por Cromatografa de
Gases/Espectrometra de Masas (CG/EM),
lo que permiti identifcar 10 componentes
qumicos que se presentan en la fgura 1
y tabla 1. Los resultados obtenidos en la
determinacin de la actividad antioxidante
del aceite esencial por el mtodo del radical
2,2-difenilpicrilhidrazil (DPPH), utilizando
cido ascrbico como sustancia atrapadora
de referencia y un espectrofotmetro UV-
VIS Double Beam PC; se presentan en las
tablas 2,3 y 4 y fguras 2 y 3. Respecto de la
determinacin de la actividad citotxica, los
niveles de concentracin del aceite esencial
en microlitros (l) y los resultados despus de
tres horas de fecundacin.
28 Cientfca 8 (1), 2011
Amrico Castro L., Jos Jurez E., Norma Ramos C., Silvia Surez C., Fernando Retuerto P.
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
S
Concentracin
L/mL
0 0.4 -
6
12
18
24
30
0.332
0.279
0.24
0.207
0.180
17
30.15
40
48.25
55
Absorbancia
517 nm
%
Concentracin
L/mL
2,4 0,265 50
2
1,6
1,2
0,8
0
0,316
0,364
0,409
0.459
0.538
41,26
32,34
23,88
14,59
-
Absorbancia
517 nm
%
Aceite de ruda
cido Ascrbico
IC50
16,13mg/mL
2,4 g/mL
2 - octanona
2 nonanona
Nonanal
Ciclohexen 5,6-dietenil - 1 - metil
2 decanona
Metil nonyl ter
2 undecanona
Ciclotetradecano
2 - dodecanona
2 - tridecanona
1,41
1,89
1,96
2,27
2,51
2,71
3,34
3,39
3,95
5,23
Composicin qumica
Tiempo de
Retencin (T.R.)
(minutos)
tabla 1. composicin qumica del aceite esencial
de RUTA GRAVEOLENS L., determinada por
cromatografa de gases/espectrometra de
masas (cg/em).
tabla 2. porcentaje de captacin dpph del aceite
esencial
tAblA 3. porcentAje de cAptAcin dppH del cido
ascrbico
tabla 4. ic50 del aceite esencial de RUTA GRAVEOLENS L.
figura 1. cromatografa de gas del aceite esencial de RUTA GRAVEOLENS L. (ruda)
28 Cientfca 8 (1), 2011 29 Cientfca 8 (1), 2011
Elucidacin estructural del aceite esencial de Ruta graveolens L. (ruda), cultivada en el Per. Actividad antioxidante
y bioensayo de citotoxicidad
figura 2. porcentaje de captacin de dpph del aceite esencial de RUTA
GRAVEOLENS L.
dISCUSIN
La composicin qumica que presentan
los aceites esenciales est constituida
especialmente por terpenos, sesquiterpenos
y compuestos aromticos, que les conferen
actividad antioxidante. Los componentes
qumicos elucidados en el aceite esencial
de las hojas frescas de Ruta graveolens L.,
resultan ser en su mayora alifticos y de tipo
cetnico, muy similar a los obtenidos por
cromatografa de gases en el aceite esencial
de Ruta graveolens L. de Mrida, Venezuela,
que presenta como compuestos mayoritarios
a la 2-undecanona (43,0 %) y 2-nonanona
(33,5 %) (4). Componentes qumicos que
tambin han sido encontrados en el aceite de
nuestro estudio. As mismo, la composicin
qumica elucidada de esta especie tambin
result ser similar en sus componentes
mayoritarios de Ruta graveolens L. y Ruta
chalepensis L. estudiados en otros pases
como Italia, Irn y Argelia (5,6).
figurA 3. porcentaje de captacin de dpph del cido ascrbico
En nuestro pas, estudios realizados con
el extracto acuoso de las hojas de Ruta
graveolens L. demostraron que presenta
actividad mutagnica en el proceso realizado
sin activacin metablica con cepas
bacterianas (7). Asimismo, de las hojas
molidas y tratadas con hidrxido de amonio
y diclorometano se ha aislado un alcaloide
acridnico identifcado como arborinina y
dos alcaloides furoquinolnicos, uno de
los cuales posee actividad mutagnica y
fotomutagnica comprobada (8).
En cuanto a la baja actividad antioxidante
del aceite esencial de Ruta graveolens L. en
nuestro estudio, determinado por el mtodo
2,2-difenilpicrilhidrazil (DPPH), se debera a
la no presencia de compuestos terpnicos,
sesquiterpnicos y aromticos; ya que
presenta compuestos mayoritariamente
alifticos y de la serie cetnica C-8 a C-13,
adems de otros hidrocarburos de cadena
abierta y cerrada. Los resultados obtenidos
y = 22.05x - 2.866
R
2
= 0.9998
0
10
20
30
40
50
60
0 0.5 1 1.5 2 2.5 3
y = 1.5667x + 9.9
R
2
= 0.9828
0
10
20
30
40
50
60
0 5 10 15 20 25 30 35
30 Cientfca 8 (1), 2011 30 Cientfca 8 (1), 2011
Amrico Castro L., Jos Jurez E., Norma Ramos C., Silvia Surez C., Fernando Retuerto P.
A
R
T

C
U
L
O
S

O
R
I
G
I
N
A
L
E
S
rEFErENCIaS BIBlIOGrFICaS
1. Morton JF. Atlas of medicinal plants of Middle America, Bahamas to Yucatan. Vol I.
(Springfeld), Illinois: Charles C. Thomas Publisher. 1981: 378-79.
2. Dominguez X. Mtodos de investigacin fotoqumica. 3ra. edicin. Mxico D.F. Editorial
Limusa; 1985.
3. Lock de Ugaz O. Investigacin ftoqumica. Mtodos en el estudio de productos naturales.
Lima: Pontifcia Universidad Catlica del Per. Fondo Editorial; 1988.
4. Meccia G, Rojas BU. Estudio del aceite esencial de Ruta graveolens L. que crece en
el Estado MridaVenezuela. Instituto de investigaciones de la Facultad de Farmacia y
Bioanlisis (IIFFB). MridaVenezuela: Universidad de los Andes. Sector Campo de Oro;
2009.
5. De Feo V, De Simone F y Senatore F. Potential Allelochemicals from the essential oil of
Ruta graveolens. Phitochemestry 2002; 6: 573-8.
6. Dob T, Dahmane D. Volatile constituens of the essential oil of Ruta chalepensis L. Subsp.
Angustifolia (Pers.) P. Cout J Essent Oil Res. 2008; 20: 306-09.
7. Callapia M y Jaimes N. Actividad mutagnica de los extractos acuosos de Ruta
graveolens L. Ruda y Sparteum Junceum L. Retama. Trabajo de aptitud profesional
para optar al ttulo profesional de Qumico Farmacutico. 1995. Facultad de Farmacia y
Bioqumica UNMSM. Lima-Per.
8. Amiel D. Aislamiento e identifcacin de alcaloides mutagnicos de las hojas de Ruta
graveolens L. por mtodos espectroscpicos UV-IR. Tesis para optar al ttulo profesional
de Qumico Farmacutico. 1999. Facultad de Farmacia y Bioqumica UNMSM. Lima-
Per.
9. Rojas Y y Soto R. Actividad citotxica y efecto antitumoral de un extracto etanlico libre de
alcaloides solubles en ter etlico, del tallo de Abuta grandifolia (Mart.) Sandwith Abuta
en lneas celulares. Tesis para optar al ttulo profesional de Qumico Farmacutico. 2003.
Facultad de Farmacia y Bioqumica UNMSM. Lima-Per.
10. Zamora S y Stotz W. Ciclo reproductivo de Tetrapygus niger en dos localidades de la IV
Regin. Coquimbo: Universidad de Chile; 1993.
amrico castro l.
correspondencia: caslasha3@hotmail.com
recepcin: 17/03/2011
aceptacin: 22/04/2011
demuestran que su actividad antioxidante es
relativamente baja; presentando un IC50 de
16.13 mg/ml frente al cido ascrbico, que
presenta 2,4 g/ml.
Un estudio con el extracto etanlico de
Abuta grandifolia (Mart.) conteniendo
alcaloides de tipo amonio cuaternario
mostr altamente signifcativa actividad
citotxica signifcativa sobre embriones de
Tetrapygus niger (9). El estudio del ciclo
reproductivo de esta especie ha permitido
realizar trabajos de actividad citotxica en
sustancias qumicas (10).
La determinacin de la actividad citotxica
de Ruta graveolens L. en el presente
estudio demostr que, a concentraciones
del aceite esencial de 50 y 75 l, manifesta
citotoxicidad en el desarrollo embrionario in
vitro de Tetrapygus niger.
CONClUSIONES
En el aceite esencial de hojas frescas de
Ruta graveolens L., se identifcaron los
siguientes componentes qumicos: 2-octanona,
2-nonanona, nonanal, cilcohexen-5,
6-dietenil-1-metil, 2-decanona, metil nonyl ter,
2-undecanona, ciclotetradecano, 2-dodecanona
y 2-tridecanona.
La evaluacin de la actividad antioxidante in
vitro del aceite esencial manifest un IC50
de 16,13 mg/ml, siendo un valor elevado
comparado con el cido ascrbico de 2,4 g/
ml, y la captacin del 2,2difenilpicrilhidrazil
(DPPH) es relativamente baja.
El aceite esencial de Ruta graveolens L.,
mostr citotoxicidad a concentraciones de
50 y 75 l en el desarrollo embrionario de
Tetrapygus niger.
30 Cientfca 8 (1), 2011 31 Cientfca 8 (1), 2011
Falsabilidad, contrastabilidad y corroboracin
30 Cientfca 8 (1), 2011
rESUMEN
El propsito del presente artculo es ampliar
algunas nociones de la concepcin de Karl
Popper, en referencia a un anterior artculo
de mi autora aparecido en Cientfca
(Volumen 7 N 2, mayoagosto 2010). Me
abocar a dilucidar la contrastabilidad
y la corroboracin de teoras cientfcas,
empezando por aclarar la dimensin de
estos aportes, para terminar analizando
la relacin de estas dos nociones con la
eleccin de teoras cientfcas. Para cumplir
este propsito ser necesario ahondar en
el mecanismo de explicacin cientfca
que Popper propugna desde sus trabajos
iniciales, cuando enfatiza en la falsabilidad
de las teoras.
Palabras clave: Karl Popper, falsabilidad,
contrastabilidad, corroboracin.
aBSTraCT
The purpose of this article is to extend some
ideas of Karl Poppers theory, in reference
to a previous article that I wrote and was
published by Cientfca (Volumen 7 N 2,
mayoagosto 2010). I will elucidate the
testability and the corroboration of scientifc
theories, starting by clarifying the extent of
these contributions, to fnish analyzing the
relationship of these two notions with the
choice of scientifc theories. To accomplish
this target will need to get into the
fALSABILIDAD, CONTRASTABILIDAD y CORROBORACIN
FALSIFIABILITy, TESTABILITy AND CORROBORATION
Jos Eduardo Rosales Trabuco
1
arTCUlOS
dE rEvISIN
mechanism that Popper advocated since
his initials works when he emphasizes the
falsifability of theories.
Keywords: Karl Popper, Falsifability, Testability,
Corroboration.
INTrOdUCCIN
El desenvolvimiento intelectual de Karl
Raimund Popper fue cambiando de manera
constante en el afn de abarcar diversos
problemas: desde una original preocupacin
por cuestiones relativas a la metodologa
de la ciencia, hasta alcanzar dimensiones
metafsicas (1). En este sentido, es posible
dividir tentativamente este desarrollo en las
siguientes fases (2):
1
Universidad Nacional Mayor de San Marcos
a) El perodo inicial de formacin en los
problemas flosfcos (de 1919 a 1930).
b) La primera etapa lgico-matemtica, en
la que ve la metodologa de la ciencia en
clave lgica (de 1914 a 1959).
c) La segunda etapa, en la cual el aspecto
epistemolgico de sus ideas flosfcas
adopta un enfoque de epistemologa
evolucionista (de 1960 a 1994).
d) La tercera etapa, dominada por las
preocupaciones ontolgicas y de
refexiones ticas (de 1970 a 1994).
32 Cientfca 8 (1), 2011
Jos Eduardo Rosales Trabuco
A
R
T

C
U
L
O
S

D
E

R
E
V
I
S
I

N
Nuestro inters, ligado a la profundizacin de
lo entendido por contrastabilidad, se centrar
en la primera etapa lgico-matemtica. Si
bien el enfoque popperiano es considerado
opuesto al llamado empirismo lgico
(neopositivismo) y especfcamente con lo
formulado por el Crculo de Viena, podemos
enumerar algunos puntos en comn (3):
1. La idea de que la ciencia es centralmente
un conjunto de enunciados de distintos
niveles de generalidad y abstraccin,
contrastables empricamente y
organizados en las teoras cientfcas.
2. La confanza en la capacidad de la lgica
para explicar y comprender los procesos
cientfcos y su legitimidad a travs de la
reconstruccin del mtodo cientfco.
3. La creencia en el progreso cientfco y en
la racionalidad (lgica) de los procesos
de cambio terico.
4. La idea de que, ante dos o ms teoras
coexistentes en determinado momento,
slo una de ellas debera poder
sostenerse legtimamente.
Ahora bien, no podemos dejar de lado otros
puntos relevantes de la propuesta popperiana,
como el hecho de que, segn Popper, la
objetividad cientfca radica en el enfoque
crtico, es decir, la crtica intersubjetiva de
las teoras o la disposicin a la crtica mutua
mediante la cooperacin hostil pero amistosa,
en la comunidad cientfca, para lo cual es
sumamente importante que los cientfcos
defendan con tesn sus conjeturas tericas
pues solo de este modo podremos conocer
el valor real de sus planteamientos.
A todo lo anterior subyace la contrastabilidad
de las teoras cientfcas. Contrastar signifca
para Popper intentar pillar en el error a una
teora cientfca. Existen dos modos de mirar
las relaciones entre la teora y la experiencia
(los enunciados bsicos o base emprica) con
la que se contrasta: a) buscar la confrmacin
o b) buscar la refutacin. Ahora bien, las
contrastaciones cientfcas, en la concepcin
popperiana, son siempre intentos de
refutacin. La contrastacin de una teora es
ms severa cuanto mayor sea la probabilidad
de fracaso.
Se puede hacer una distincin entre las teoras
contrastables (falsables) y las no contrastables
(no falsables). Solo es contrastable una
teora que implique la afrmacin de que
ciertos acontecimientos observables no
ocurrirn. La contrastacin consiste en
comprobar si estos acontecimientos, que la
teora prohbe, realmente ocurren. En otras
palabras, toda teora contrastable debe
prohibir determinados acontecimientos;
toda teora habla de la realidad emprica en la
medida que establece lmites a esta, siendo
factible enunciarla del siguiente modo: tal y
tal cosa no pueden suceder.
De este modo, se constituye el criterio de
demarcacin entre ciencia y no ciencia en
base a la contrastabilidad, vale decir, a la
posibilidad de ser falsadas. En suma, una
teora cientfca solo puede decirnos algo
sobre el mundo emprico en tanto es capaz
de chocar con l, es decir, nicamente
cuando es contrastable.
Por otro lado, es evidente el nfasis puesto
por Popper en las teoras. As, la flosofa de la
ciencia queda planteada como una disciplina
metaterica (metacientfca) cuyo objeto de
estudio son las teoras y no las ideas ni los
hechos simples o elementales. Este giro se
fundamenta en la crtica a la concepcin que
confa en la experiencia directa e inmediata
como supremo juez, que lo diferenciar
del empirismo lgico. Esto nos permite
entender porqu Popper sostiene que todo
conocimiento est impregnado de teora y,
por consiguiente, por qu no hay lugar para
una tabula rasa en el ser humano dado que
siempre se parte de un conocimiento previo.
Cabe aclarar que cuando hablamos de
teoras cientfcas nos referimos tanto a
las pertenecientes a las ciencias naturales
como a las ciencias sociales. Segn Popper,
la ciencia natural y la social se rigen por la
actitud crtica, por un mismo mtodo, un
mtodo deductivo, y ofrecen hiptesis para
explicar fenmenos.
El mecanismo de la explicacin cientfca est
relacionado con su nocin de contrastacin;
de este modo, el mtodo de las ciencias
sociales es el mismo que el de las ciencias
naturales: ensayar posibles soluciones a
los problemas de los que parten nuestras
investigaciones, para luego contrastarlas.
Solo se acepta una hiptesis en tanto puede
ser contrastable, y la contrastacin consiste
en intentos de refutacin.
Karl Popper sostuvo que, si bien es cierto que
existen diferencias entre las ciencias naturales
y sociales, ambas siguen el mecanismo de
la explicacin causal. Ya en La lgica de
la investigacin cientfca (4) Popper haba
expresado que la explicacin cientfca de un
fenmeno, de un acontecimiento, consiste
en deducir el enunciado que lo describe a
partir de dos premisas deductivas:
32 Cientfca 8 (1), 2011 33 Cientfca 8 (1), 2011
Falsabilidad, contrastabilidad y corroboracin
1. Las hiptesis (con el carcter de leyes
universales), que son enunciados
estrictamente universales.
2. Las condiciones iniciales, que son
enunciados singulares aplicables al
acontecimiento determinado que se
quiere explicar.
La conclusin que se obtiene de estas dos
premisas es otro enunciado singular que
describe el fenmeno que se quiere explicar.
Popper entiende la explicacin cientfca o
causal bajo un modelo deductivo, donde
las hiptesis y las condiciones iniciales
conforman las premisas (el antecedente) y el
fenmeno que se quiere explicar constituye
la conclusin (el consecuente).
Para Popper, la investigacin cientfca
parte de un problema y sigue un derrotero
en busca de hallar una explicacin a cierto
fenmeno:
La propuesta va ms all al sealar que es
posible adjudicar un grado de corroboracin,
cuyas caractersticas seran:
El grado de corroboracin de una teora
es la evaluacin de los resultados de las
contrastaciones empricas a las que se
la ha sometido.
El grado de corroboracin est
estrechamente relacionado con la
contrastabilidad de una teora: una teora
ms corroborada es una teora que puede
contrastarse mejor.
Puesto que la contrastabilidad de
una teora puede medirse utilizando
el contenido de una teora, y ya que el
contenido puede medirse por medio
de la improbabilidad de una teora;
podemos concluir que el contenido y la
improbabilidad de una teora tienen una
relacin con la contrastabilidad y con el
grado de corroboracin.
El grado de corroboracin no puede
ser, de ningn modo, un grado de
probabilidad, pues est ms relacionado
con la improbabilidad de la teora: es la
teora lgicamente ms improbable la
que no solamente tiene mayor contenido
y contrastabilidad, sino que ser la mejor
contrastada siempre que no resulte
refutada.
Volviendo a la pregunta planteada lneas
arriba, ante la necesidad de elegir entre dos
teoras, Popper dir que lo racional es elegir
la que est mejor corroborada; si bien no
podemos justifcar la verdad de una teora,
podemos justifcar nuestra preferencia a
travs del grado de corroboracin.
Esto ltimo hace hincapi en la diferencia entre
verdad y corroboracin: los dos conceptos
corresponden a una evaluacin lgica entre
la teora y la experiencia; sin embargo, la
corroboracin se da respecto a un sistema
de enunciados bsicos (base emprica)
aceptados en un momento determinado.
Por ltimo, en el libro Conjeturas y
refutaciones (7), Karl Popper seal que
la preferencia entre teoras, es decir, la
eleccin de una teora T2 en desmedro de
una teora T1, se puede justifcar si sucede
lo siguiente:
T2 hace aseveraciones ms precisas que
soportan contrastaciones ms severas.
[La investigacin cientfca] no puede
empezar con observaciones o coleccionando
datos Antes de que podamos recolectar
datos debe despertarse en nosotros un
inters por datos de una cierta clase: el
problema siempre va en primer lugar
Ahora bien, un problema cientfco, por
regla general, nace de la necesidad de una
explicacin (5, p. 136).
Esta concepcin de la contrastabilidad
y explicacin cientfcas se emparenta
con la nocin de corroboracin. En la
parte fnal de La lgica de la investigacin
cientfca (4), Popper sostena que si bien
las teoras no son verifcables dado el
carcter siempre conjetural y provisional de
las hiptesis, s pueden ser corroboradas;
este ltimo concepto involucra averiguar
qu contrastaciones o qu pruebas ha
soportado una teora. Es preciso aclarar que
la introduccin del trmino corroboracin
se debe a que Popper intent que no se
relacionara su propuesta con algn intento
de adjudicar un grado de probabilidad a las
teoras cientfcas.
De lo anterior surge una interrogante:
cundo aceptamos una teora cientfca?
Popper responder, en Realismo y el objetivo
de la ciencia (6), que aceptamos una teora
cuando ha resistido a las crticas mejor
que cualquier teora rival, incluyendo las
contrastaciones ms severas que podamos
imaginar.
34 Cientfca 8 (1), 2011
Jos Eduardo Rosales Trabuco
A
R
T

C
U
L
O
S

D
E

R
E
V
I
S
I

N
rEFErENCIaS BIBlIOGrFICaS
1. Sanflix V. Ciencia y sociedad. Una crtica (moderada) del racionalismo crtico, en:
Moya E (ed.) Ciencia, sociedad y mundo abierto. Homenaje a Karl R. Popper. Granada:
Comares; 2004.
2. Martnez J. El problema del realismo en Popper: El Postscriptum a la lgica de la
investigacin cientfca, en: Moya E (ed.) Ciencia, sociedad y mundo abierto. Homenaje
a Karl R. Popper. Granada: Comares; 2004.
3. Schuster F. (comp.) Filosofa y mtodos en las ciencias sociales. Buenos Aires: Manantial;
2002.
4. Popper K. La lgica de la investigacin cientfca. Madrid: Tecnos; 1962. [Logik der
Forschung. Viena: Verlag von Julius Springer; 1934 (publicado en 1935). The Logic of
Scientifc Discovery. Londres: Hutchinson & Co; 1959]
5. Popper K. La miseria del historicismo. Madrid: Taurus; 1965. [The Poverty of Historicism.
Londres: Routledge & Kegan Paul; 1957]
6. Popper K. Post Scriptum a la lgica de la investigacin cientfca. Realismo y el objetivo
de la ciencia. Vol. I, Madrid: Tecnos; 1985. [Realism and the Aim of Science, vol. I, of The
Postscript to the Logic of Scientifc Discovery. Londres: Hutchinson; 1983]
7. Popper K. Conjeturas y refutaciones. El desarrollo del conocimiento cientfco. Buenos
Aires: Paids; 1967. [Conjetures and Refutations. The Growth of Scientifc Knowledge.
Londres: Routledge & Kegan Paul; 1965]
recepcin: 16/04/2011
aceptacin: 25/04/2011
jos rosales trabuco
correspondencia: jrosalestrabuco@gmail.com
T2 explica ms hechos y con mayor
detalle.
T2 ha pasado contrastaciones en las
que T1 ha fallado.
T2 ha sugerido nuevas contrastaciones
experimentales no consideradas antes
que se formulara y ha pasado bien estas
contrastaciones.
T2 ha conectado entre s varios
problemas hasta entonces inconexos.
En conclusin, podemos sostener en base a
todo lo expuesto que, en la concepcin de
la ciencia formulada por Karl Popper, resulta
crucial la utilizacin de conceptos como
falsabilidad, contrastabilidad y corroboracin.
La importancia de la concepcin popperiana
radica en que fue uno de los ltimos intentos
en el siglo XX por concebir de modo racional
la metodologa cientfca y de rescatar la
idea de progreso en las ciencias.
Recordemos que su planteamiento epistemolgico
fue conocido como falibilismo, ya que
consider que la falsabilidad posibilita un
genuino criterio de demarcacin entre ciencia
y pseudociencia. Adems, contrariamente
a lo que planteaban otros epistemlogos
en el siglo XX, Popper sostuvo que los
cientfcos no buscan verifcar sus teoras,
sino refutarlas; por ello, emplea a lo largo de
toda su obra el trmino contrastacin.
Finalmente, utiliza el concepto de corroboracin
en franca oposicin a una supuesta confrmacin
emprica de las hiptesis y con ello niega
incluso un criterio vinculado a la probabilidad;
paradjicamente y en contraposicin a lo
que nos dira el sentido comn, podemos
obtener mayores benefcios cognoscitivos
de hiptesis improbables dado que tienen
un mayor contenido emprico: mientras ms
arriesgamos, ms profcua es nuestra labor.
34 Cientfca 8 (1), 2011 35 Cientfca 8 (1), 2011
Falsabilidad, contrastabilidad y corroboracin
LAS INDITAS Lecciones de PsiquiatRa y PsicoLoga DE
HERMILIO vALDIzN, y SU SIGNIfICADO
Ramn Len
1
1
Profesor de la Especialidad de Psicologa de la Universidad Cientfca del Sur
Las investigaciones bibliogrfcas en las que se basa este trabajo fueron llevadas a cabo en enero y febrero del
2008, cuando el autor se encontraba en calidad de profesor visitante de la Universidad de Passau (Institut fr
Geschichte der Psychologie; director: Prof. Dr. Horst Gundlach), Alemania Federal, gracias a una beca de investi-
gacin otorgada por la Konrad-Adenauer-Stiftung, y en la biblioteca de la Universidad de Florencia (Italia), gracias a
una invitacin del profesor doctor Luciano Mecacci, prorrector de esa casa de estudios.
rESUMEN
Esta comunicacin informa acerca de
unas lecciones de psiquiatra y psicologa
preparadas por Hermilio Valdizn (1885-
1929), una importante fgura de la psiquiatra
peruana, aparentemente en los ltimos
aos de su vida. El autor comenta estas
lecciones y su signifcado en el contexto de
la produccin cientfca de Valdizn y en el
tiempo de su trabajo.
Palabras clave: Lecciones de psiquiatra y
psicologa Hermilio Valdizn
aBSTraCT
This communication deals on unpublished
lessons of psychiatry and psychology by
Hermilio Valdizn (1885-1929), an important
personality of psychiatry in Peru. The
author comments these lessons and their
signifcance in the context of Valdiznss
scientifc output and in the time of his work.
Keywords: Lessons of psychiatry and
psychology Hermilio Valdizn
En el 2009 se conmemor el 80 aniversario
de la muerte de Hermilio Valdizn (1884-
1929), gran fgura de la psiquiatra peruana.
Javier Maritegui (1928-2008), discpulo
de Honorio Delgado (1892-1969), y este,
a su vez, de Valdizn, le dedic hace
ya casi tres dcadas un amplio trabajo
biogrfco, califcndolo como el forjador del
proyecto de la psiquiatra peruana. En sus
intensas bsquedas bibliogrfcas, tanto
en bibliotecas como en archivos privados,
Maritegui encontr unas Lecciones de
psiquiatra y psicologa en la forma de copia
mecanografada, que pensaba editar. En un
par de ocasiones invit al autor de estas
lneas a revisar dicha copia.
Valdizn es una de las fguras ms
representativas de la medicina peruana del siglo
XX. Su imagen como cientfco se integra de
modo armonioso en el perfl de su personalidad,
caracterizada por su entrega al trabajo
asistencial y acadmico, as como por su intensa
y desinteresada vocacin de servicio.
Las Lecciones, transcritas por alguno de sus
alumnos (y probablemente revisadas por el
propio Valdizn) y conservadas a travs de
dcadas, ofrecen una revisin actualizada del
saber psicolgico (tratando de funciones como
la memoria, la imaginacin, el lenguaje, pero
tambin de ese vasto mundo que es el de las
emociones y sentimientos) en su relacin con
los fenmenos psicopatolgicos, y en cuya
presentacin se revela la experiencia clnica y
la perspicacia analtica del galeno peruano.
Maritegui tena el propsito de editarlas y darlas
a conocer. Lamentablemente, el 3 de agosto del
2008, falleci de manera inesperada.
Las lneas que siguen, en las que se presenta
de manera muy genrica el contenido
de esas lecciones, se han escrito como
homenaje tanto a la memoria de Hermilio
Valdizn como a la de Javier Maritegui.
Hasta su prematura muerte en 1929,
Hermilio Valdizn, el forjador del proyecto
de la psiquiatra peruana (1), continu con su
ininterrumpida actividad asistencial, as como
con su no menos infatigable labor publicista.
Pstumamente, habran de publicarse
THE UNPUBLISHED Lessons of Psychiatry and PsychoLogy FROM HERMILIO VALDIZAN
AND ITS MEANING.
36 Cientfca 8 (1), 2011
Ramn Len
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
sus Elementos de jurisprudencia mdica,
editados por Arturo Meza Cavali (2). Puede
suponerse, por tanto, que las lecciones de
psiquiatra y psicologa encontradas tambin
habran sido dadas a la imprenta en caso de
haber vivido Valdizn algunos aos ms.
El Valdizn que entrega estas lecciones era
el profesor de Psiquiatra de San Marcos,
con amplia experiencia asistencial, como lo
evidencian las menciones que aparecen a
casos tratados por l.
Valdizn era un eclctico en el mejor
sentido del trmino, con informacin slida
y actualizada, como consecuencia de su
estancia en Europa y de su permanente
dedicacin al estudio. La presencia de
Walter B. Cannon (1871-1945), el fsilogo
norteamericano que diera a la luz el
infuyente Bodily changes in pain, hunger,
fear and rage (3), entre los autores a los que
se refere en las lecciones, no solo destaca la
amplitud de sus puntos de vista y de fuentes
de informacin, sino tambin su sobriedad
interpretativa de los fenmenos psicolgicos
y psicopatolgicos, a partir de los datos
proporcionados por la fsiologa.
Valdizn conoca, asimismo, la obra de
Sigmund Freud (1856-1939) y la valoraba,
pero no estaba tan entusiasmado por ella
como su discpulo, Honorio Delgado. En
alguna de las lecciones, hace referencia a
varios casos tomados de las obras del padre
del psicoanlisis. Lo original de mucho
del pensamiento freudiano, as como la
promesa de grandes logros teraputicos,
debieron infuir en su forma de ver y entender
la doctrina psicoanaltica. Como ocurri
tambin con su maestro italiano, Sante de
Sanctis (1862-1935), quien tena respecto
del psicoanlisis una actitud de tolerancia
(4), si bien cuando tom conocimiento de la
obra capital de Freud, La interpretacin de
los sueos, en traduccin al ingls de A. A.
Brill (1874-1948) (5), la descalifc e inclusive
reclam para s haber propuesto la lgica
de los sueos antes que el propio psiquiatra
austriaco (6).
Una breve mencin al complejo de
inferioridad nos hace notar que, en modo
alguno, Valdizn se limitaba al psicoanlisis
en la as llamada psicologa profunda, sino
que tambin poda encontrar utilidad y
sentido diagnstico a las ideas del gran
antagonista de Freud, Alfred Adler (1870-
1937). La inicial simpata de Valdizn y
Delgado por la Individualpsychologie de Adler,
cuyo concepto central es el sentimiento de
inferioridad (Minderwertigkeitsgefhl), queda
demostrada en las recensiones (de la pluma
de Delgado; 7) de los trabajos de este terico,
publicadas en la Revista de Psiquiatra y
Disciplinas Conexas, animada por los dos
psiquiatras peruanos entre 1918 y 1924.
Emil Kraepelin (1856-1926) y Ernst Kretschmer
(1888-1964) son tambin mencionados en las
lecciones, revelando la cercana de Valdizn
a los planteamientos de la psiquiatra clsica
de cuo kraepeliniano. Sealemos, de
paso, que la infuencia de Kraepelin se
encontraba en su cima all por mediados
de los aos veinte: la suya era la fgura de
mayor signifcacin en la psiquiatra de su
poca, representaba un modelo de desarrollo
acadmico de la especialidad y era, junto con
Freud, el responsable del inmenso prestigio
de la psiquiatra alemana (8).
Es muy probable que, en ausencia de
traducciones al castellano de las obras
de Kraepelin y, al desconocer el alemn,
Valdizn se familiarizara con las ideas del
psiquiatra germano a travs de versiones al
italiano de sus libros (9,10), alguna de ellas
estimulada por Augusto Tamburini (1848-
1919), entusiasta difusor de la psiquiatra
alemana en su pas.
Pero los intereses de Valdizn en modo alguno
se limitaban a la materia psiquitrica. Su
inters por la psicologa puede reconocerse
con facilidad. La integracin de la psicologa
y la psiquiatra en el pensamiento y actuacin
del mdico peruano ocurre en los escritos
que venimos comentando en dos aspectos:
el primero, en el tratamiento que da a las
emociones, un captulo de la psicologa
que en ese momento recin comenzaba
a escribirse. Valdizn dedica atencin,
asimismo, a la psicologa de la expresin (lo
que hoy llamaramos conducta no verbal).
El otro aspecto es el de las referencias a
los tests como una va de conocimiento
del psiquismo normal y anormal. El test de
asociacin de palabras de Carl Gustav Jung
(1875-1961), as como el psicodiagnstico
de Rorschach, los tests de douard Toulouse
(1865-1947), importante psiquiatra francs, y
los reactivos que l mismo cre y utiliz en su
prctica asistencial, son mencionados por l.
Por su parte, las Lecciones de psiquiatra y
psicologa muestran a un Valdizn poseedor
de un amplio y actualizado conocimiento
psicolgico. Thodule Ribot (1839-1916) en
especial, pero tambin William James (1842-
1910), Carl Lange (1834-1900) y Alfred Binet
(1857-1911) eran nombres familiares para l.
Es una pena que no contemos con las
36 Cientfca 8 (1), 2011 37 Cientfca 8 (1), 2011
Las inditas Lecciones de psiquiatra y psicologa de Hermilio Valdizn, y su signifcado
puesto a la cabeza de la reforma psiquitrica,
con nombres como los de Cesare Castiglioni
(1808-1873), en Miln; Serafno Biff (1822-
1899), en Pavia; Andrea Verga (1811-1895)
y Carlo Livi (1823-1877); y, con el ms
conocido y discutido de todos ellos, Cesare
Lombroso.
No menos suceda en psicologa. Trabajos de
psiclogos italianos aparecen en versiones
en otros idiomas: Marhaba (20) seala
que La psicologa contempornea, de Villa,
fue traducido al alemn, espaol, ingls y
francs entre 1902 y 1904, encontrando eco
muy favorable; pero tambin en las revistas
italianas, de menor calidad por cierto que sus
homlogas alemanas o inglesas, aparecieron
trabajos de psiclogos no italianos. Una vez
ms, Marhaba informa que algunos trabajos
de Bechterev (1857-1927) fueron acogidos
en la Rivista Sperimentale di Freniatria.
Eran estos, aos en los que aparecan
versiones italianas de obras de importantes
fguras de la psicologa en ese entonces (26,
27, 28).
No sorprende por todo ello, la cultura
psicolgica de Valdizn. Pero hay tres
hechos ms que cabe mencionar.
De un lado, los psiquiatras europeos
de la poca posean por lo general una
considerable informacin (y hasta formacin
en algunos casos) psicolgica. Emil Kraepelin
haba pasado una parte signifcativa de su
etapa formativa al lado de Wilhelm Wundt
(tambin un mdico), el llamado padre de la
psicologa experimental. Adems de su muy
citado artculo Der psychologische Versuch
in der Psychiatrie (29), Kraepelin public
otros trabajos de corte psicolgico tanto
durante sus aos al lado de Wundt como
despus (30, 31, 32, 33).
Sigmund Freud, adems de una slida
preparacin en fsiologa al lado de Ernst
Brcke (1819-1892), estaba familiarizado
con la psicologa de su poca, a la cual
miraba con ojos particularmente crticos.
Karl Jaspers (1883-1969), el autor de la
monumental Allgemeine Psychopathologie
(34), despliega en esa obra un impresionante
saber psicolgico, describiendo y designando
por su nombre, como lo seala Berner (35),
los fenmenos psicopatolgicos. Por ltimo,
Hermann Rorschach (1884-1922), el creador
del Psychodiagnostik que lleva su nombre,
mostr asimismo sostenido inters por
temas de lo que hoy se llamara la psicologa
de los grupos marginales (36).
referencias bibliogrfcas precisas para
sus lecciones, pero suponemos que el
psiquiatra peruano tuvo a su disposicin
versiones castellanas de las obras de Ribot
(11, 12, 13), aparecidas en sellos espaoles.
El propio Wundt era difundido tambin por
editoriales ibricas (14).
Traducciones al italiano de trabajos de
algunos de estos estudiosos debieron
igualmente ser conocidas por Valdizn. As,
por ejemplo, en 1911 apareci en Italia una
versin adaptada del famoso Compendio de
psicologa, de William James (15). Ya en 1901,
sin embargo, el mencionado Tamburini haba
dirigido la versin italiana de los Principles
of psychology, de William James (16), que
apareci con el ttulo de Principi di psicologia,
traducida por G. Ferrari (17), con una segunda
edicin en 1905 y una tercera en 1909.
Obras como la de Guido Villa (1867-1948),
La psicologa contempornea, cuya segunda
edicin apareci en 1911 (18), y La misura
in psicologia sperimentale, de Aliotta (19),
muy informada acerca de los trabajos de
Mnsterberg (1863-1916), Ebbinghaus (1850-
1909), Meinong (1853-1920), Klpe (1862-
1915), Stumpf (1848-1936) y Binet, entre otros,
debieron asimismo ser lecturas del mdico
huanuqueo durante su estancia en Italia.
Eran estos aos en los cuales la psicologa
y la psiquiatra italianas mantenan estrecho
contacto con el resto de Europa: recurdese
que en 1905 se haba celebrado en Roma
el V Congreso Internacional de Psicologa,
presidido por Giussepe Sergi (1841-1936) y
organizado por Sante de Sanctis. Marhaba
concede a este evento el signifcado
de reconocimiento internacional para la
psicologa italiana (20), sealando que
asistieron ms de 400 especialistas de todo
el mundo, y que entre ellos se encontraba
nada menos que William James.
Algo lgico, pues algunos nombres italianos
brillaban en el parqu de la psicologa
internacional. Sante de Sanctis, fgura
particularmente activa y muy respetada
dentro y fuera de su pas as como mentor
de Valdizn en Italia public trabajos en
LAnne psychologique (21), Archives de
Psychologie (22) y en Psychological Review
(23). El mismo Cesare Lombroso (1836-1909),
aunque discutido, reciba mucho inters (24).
La Italia que Valdizn vivi durante los
aos en que permaneci en ella era, pues,
un pas de signifcacin en la psicologa y
la psiquiatra europeas. Ya en el siglo XIX,
de acuerdo con Plicier (25), Italia se haba
38 Cientfca 8 (1), 2011
Ramn Len
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
La separacin entre psiquiatra y psicologa
no era tan marcada en ese momento y la
interaccin era tal vez mayor que la ocurrida
en otras pocas. Ribot, fgura central de la
psicologa experimental francesa de fnes del
siglo XIX y comienzos del XX, y paradjicamente
ni psiclogo ni mdico, sino flsofo, explor
los fenmenos psicopatolgicos, proponiendo
la psicologa patolgica, que vea en la
desorganizacin patolgica un verdadero
sustituto del mtodo experimental (37), que
ejercera una gran infuencia en la psicologa
en Francia y tambin en la psiquiatra de su
poca (como en Pierre Janet, 1859-1947, y
George Dumas, 1866-1946, as como en
Henri Wallon, 1879-1963). La exigencia
de Ribot a sus discpulos, de combinar la
formacin mdica con la flosfca, result
particularmente fructfera para la disciplina
psiquitrica de aquel entonces y estableci
una tradicin en los profesores de psicologa
de La Sorbona y en el Collge de France.
Todo esto fue seguido por Valdizn. Amrica
Latina estaba muy lejos de los grandes
centros psiquitricos europeos y el Per
era un pas perifrico, pero l y Delgado
accedieron por propio esfuerzo o por
polticas de canje de la Revista de Psiquiatra
y Disciplinas Conexas, a material bibliogrfco
y hemerogrfco que los mantena al da y
que les permita observar la interaccin tan
estrecha entre la psicologa y la psiquiatra.
Pero durante su estancia europea, Valdizn
percibi de modo directo la inmensa actividad
de la psicologa y la psiquiatra europeas a
travs de Sante de Sanctis. El estmulo del
renombrado psiquiatra italiano en el mdico
peruano es el segundo hecho que determina
el amplio conocimiento psicolgico que se
verifca en sus escritos.
La voluminosa obra de De Sanctis es mltiple en
sus intereses y reveladora de la amplitud de su
horizonte intelectual, enriquecido por sus viajes
a Zurich en 1893, para estudiar el hipnotismo
con Forel (1848-1931), y a Pars, donde conoce
a Jules Falret (1824-1902), Philippe Chaslin
(1857-1923), Louis Sglas (1856-1939) y Jules
Christian (1840-1907), entre otros.
Muy infuido por Jean-Martin Charcot
(1825-1893), la gran fgura de la neurologa
francesa en el siglo XIX, en particular por
sus Leons du Mardi (38), De Sanctis estudi
el sueo normal y el que ocurre en cuadros
psicopatolgicos (39, 40), pero su principal
aporte se llev a cabo en psicologa. Ferreri
(41) seala que sus trabajos abarcaban la
psicologa experimental y general, la psicologa
educativa, la psicologa judicial y criminolgica,
la psicologa de la religin, la psicotcnica y la
psicopatologa de la edad evolutiva.
Valdizn, bajo la direccin de De Sanctis, vivi la
atmsfera de particular actividad, de intercambio
de ideas, de variadas lneas de investigacin de
la psicologa italiana de su poca.
El tercer hecho es la marcada vocacin
autodidctica de Valdizn, expresada en
sus lecturas, en sus averiguaciones en
archivos y en revistas para sus trabajos de
investigacin, tan necesarias en un pas en
el cual, como lo anota Loayza (42), all por el
900, todos eran autodidactas.
Cuando Valdizn dicta estas lecciones, la
experiencia que haba vivido en Italia distaba
ya alrededor de una dcada atrs; pero ella
(con la posibilidad cumplida de trabajar al
lado de una personalidad de la psicologa
internacional, con el acceso a bibliotecas
mucho mejor surtidas que las peruanas,
y en un medio cultural estimulante), unida
a su frrea vocacin autodidctica y de
su permanente bsqueda de los nuevos
desarrollos en materia de literatura
psiquitrica, garantizaron su amplitud de
criterio, sus puntos de vista sobrios y, por lo
general, acertados.
Como ya se dijo, de haber tenido Valdizn
los aos de vida sufcientes para dar forma
defnitiva a sus lecciones de psiquiatra y de
psicologa, ambas se habran convertido en
libros. Habran tenido as los especialistas
peruanos en psiquiatra un texto de gran
utilidad, actualizado, de amplia perspectiva,
y escrito por uno de los ms caracterizados
representantes de la especialidad en el Per.
Lamentablemente, la muerte se adelant. Solo
en 1953, es decir alrededor de un cuarto de
siglo despus, la psiquiatra peruana ofreci a la
comunidad cientfca un libro de envergadura.
Nos referimos al Curso de psiquiatra, de
Honorio Delgado (43), el discpulo dilecto
de Valdizn y su sucesor en la ctedra de
Psiquiatra en la Universidad de San Marcos.
Publicar las Lecciones de Valdizn no solo
tendra un incontestable valor histrico, pues
muchas de las afrmaciones contenidas en
ellas podran ser suscritas hoy por psiclogos
y psiquiatras. Y es que as como el cambio y el
progreso distinguen a estas dos disciplinas,
hay tambin un fundus terico constituido,
slidamente establecido y unnimemente
aceptado, que constituye una suerte de
psicologa y psiquiatra perennes, que puede
reconocerse con toda claridad en las lneas
de este trabajo indito.
38 Cientfca 8 (1), 2011 39 Cientfca 8 (1), 2011
Las inditas Lecciones de psiquiatra y psicologa de Hermilio Valdizn, y su signifcado
rEFErENCIaS BIBlIOGrFICaS
1. Maritegui J. Hermilio Valdizn. El proyecto de la psiquiatra peruana. Lima: Biblioteca de
Psiquiatra Peruana, 1981.
2. Valdizn H. Elementos de jurisprudencia mdica. Lima: Empresa Editora Excelsior,
1929.
3. Cannon WB. Bodily changes in pain, hunger, fear and rage. New York: Appleton, 1915.
4. Gaddini E. Psychoanalyse in Italien. En: Eicke, D., editor., Tiefenpsychologie Weinheim
Basilea, Beltz Verlag, 1982, 650-67.
5. Freud S. The interpretation of dreams. New York: MacMillan, 1913.
6. De Sanctis S. Linterpretazione dei sogni. Rivista di Psicologia 1914; 10: 358-375.
7. Delgado H. Recensin de Die Individualpsychologie, ihre Voraussetzungen und
Ergebnisse, en Scientia (16,36, 1914). Revista de Psiquiatra y Disciplinas Conexas,
1919-1920, 2, 220-221.
8. Peters UH. Un siglo de psiquiatra alemana. Lima: Persona, 2001.
9. Kraepelin E. Introduzione alla clinica psichiatrica. Trece lezioni del dottore Emilio Kraepelin.
Miln: Societ Editrice Libraria, 1905 [traduccin de P. Amaldi & B. Manzoni].
10. Kraepelin E. Trattato di psichiatria. Miln: F. Vallardi, traduccin de la 7ma. edicin, 1908
[traducido por G. Guidi y dirigido por A. Tamburini].
11. Ribot T. Las enfermedades de la memoria. Madrid: F, 1899 [traduccin de Ricardo
Rubio].
12. Ribot T. Las enfermedades de la voluntad. Madrid: Daniel Jorro, 1906 [traduccin de
Ricardo Rubio].
13. Ribot T. Las enfermedades de la personalidad. Madrid: Daniel Jorro, 1912 [traduccin de
Ricardo Rubio].
14. Wundt W. Compendio de psicologa. Madrid: La Espaa Moderna, 1902 [traduccin de
J. Gonzlez].
15. Tarozzi G. Compendio dei Principi di Psicologia, di William James. Miln: Societ
Editrice Libraria, 1911.
16. James W. The principles of psychology. New York: Holt, 1890.
17. James W. Principi di psicologia. Miln: Societ Editrice Libraria, 1901 [traduccin de G.
C. Ferrari, dirigida y revisada por A. Tamburini].
18. Villa G. La psicologia contemporanea. 2da. edicin. Turn: Bocca, 1911.
19. Aliotta A. La misura in psicologia sperimentale. Florencia: Tipografa Galletti e Cocci,
1905.
20. Marhaba S. Lineamenti della psicologa italiana 1870-1945. Florencia: Giunti-Barbra, 1981.
21. De Sanctis S. Types et degrs dinsuffsance mentale. LAnne psychologique 1906, 12,
70-83.
22. De Sanctis S. Le problme de la conscience dans la psychologie moderne. Ar c h i v e s
de Psychologie,1903-1904, 3, 379-388.
23. De Sanctis S. & Neyroz U. Experimental investigations concerning the depth of sleep.
Psychological Review, 1902, 9, 254-282 [traduccin de H. C. Warren].]
24. Sirotkina I. Diagnosing literary genius. A cultural history of psychiatry in Russia 1880-
1930. Baltimore (London: The Johns Hopkins University Press, 2002.)
25. Plicier Y. Histoire de la psychiatrie. Pars: Presses Universitaires de France, 1990.
26. Ribot T. Saggio su le passioni. Citt di Castello: S. Lappi, 1907 [traduccin de S. Behr].
27. Wundt W. Compendio di psicologia. Turn: Clausen, 1900 [traduccin de L. Agliardi].
40 Cientfca 8 (1), 2011 40 Cientfca 8 (1), 2011
Ramn Len
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
28. Wundt W. Elementi di psicologia. Piacenza: Societ Editrice Pontremolese, 1910.
29. Kraepelin E. Der psychologische Versuch in der Psychiatrie. Psychologische Arbeiten,1895-
1896, 1, -91.
30. Kraepelin E. Zur Psychologie des Komischen. Philosophische Studien,1883-1885 2, 128-
160 y 327-361.
31. Kraepelin E. Zur Frage der Gltigkeit des Weberschen Gesetzes bei Lichtempfndungen.
Philosophische Studien, 1883-1885, 2, 306-326.
32. Kraepelin E. Die Arbeitskurve. Philosophische Studien, 1902, 19, 459-507.
33. Kraepelin E. ber Ermdungsmessungen. Archiv fr die gesamte Psychologie, 1903, 1, 9-30.
34. Jaspers K. Allgemeine Psychopathologie. Berln: Springer, 1913.
35. Berner P. Alemania. En: Postel J. & Qutel C., coordinadores, Nueva historia de la psiqui-
atra, Mxico DF, Fondo de Cultura Econmica, 2000, 425-432.
36. Rorschach H. Einiges ber schweizerische Sekten und Sektengrnder. Schweizer Archiv
fr Neurologie und Psychiatrie 1917; 1: 254-8.
37. Reuchlin M. Historia de la psicologa. Buenos Aires: Paids, 1964.
38. Charcot JM. (1887-1889). Leons du Mardi la Salptrire. Policlinique. Pars: Bureaux
du Progrs Mdical, 1887-1889, 2 vols.
39. De Sanctis S. I sogni e il sonno nellisterismo e nellepilessia. Roma: Societ Dante
Alighieri, 1896.
40. De Sanctis S. I sogni. Studi psicologici e clinici di un alienista. Turn: Fratelli Bocca,
1899.
41. Ferreri AM. Sante De Sanctis. En: Cimino, G. & Dazzi, N., editores, La psicologia in Italia.
I protagonista e i problemi scientifci, flosofci e istituzionali (1870-1945), Miln, Edizioni
Univesitarie di Lettere, Economia, Diritto, 1998: 255-96.
42. Loayza L. Sobre el 900. Lima: Mosca Azul, 1900.
43. Delgado H. Curso de psiquiatra. Lima: Impr. Santa Mara, 1953.
recepcin: 07/02/2011
AceptAcin: 24/03/2011
ramn leon
correspondencia: rld310850@yahoo.com.mx
40 Cientfca 8 (1), 2011 41 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
40 Cientfca 8 (1), 2011
Helicobacter pylori y EL MTODO CIENTfICO
Jos Amiel Prez
1
1
Universidad Cientfca del Sur. Vicerrectorado de Investigacin
rESUMEN
El relato del descubrimiento del Helicobacter
pylori y su asociacin con la lcera pptica nos ha
permitido hacer una revisin del mtodo cientfco,
particularmente del diseo experimental y el no
experimental. Se describen y analizan teniendo
en consideracin la rigurosidad en su aplicacin.
Palabras clave: Helicobacter pylori, lcera
gstrica, y duodenal, diseo experimental,
diseo no experimental.
aBSTraCT
The story of Helicobacter pyloris discovery
and its association with peptic ulcer allowed
us (motivated us) to review the scientifc
method. Especially, what is related to
experimental an non experimental design.
The present article describes and analyzes
them, bearing in mind the thoroughness of
its application.
Keywords: Helicobacter pylori - peptic,
gastric, and duodenal ulcer - experimental
and non experimental design.
INTrOdUCCIN
La medicina es una disciplina cientfca que
va ms all de la ciencia. Motivos ticos le
impiden experimentar con el hombre; esto
signifca que los mdicos cientfcos no pueden
formular DISEOS EXPERIMENTALES, que
son los procedimientos ms rigurosos, los
que se acercan ms a la realidad. Ya hace
mucho se defna a la medicina como un arte
y una ciencia (1). Aos posteriores, aos
aurorales, vieron nacer y crecer esfuerzos
cientfcos conceptuales y metodolgicos,
orientados a la prevencin y tratamiento
que se desarrollaron paralelamente al auge
incontenible de las ciencias, para ubicar
recientemente a la medicina como una ciencia
de las evidencias, aprovechando criterios
de verifcacin que no son experimentales y
les permiten a los investigadores mdicos
acercar ms sus conocimientos al exigente
conocimiento cientfco, sin perder amplitud
ni objetividad. En esta direccin, la tecnologa
ha aportado valiosas contribuciones, como
el diagnstico por imgenes con pruebas
no invasivas, gammagrafas, ecografas,
tomografa axial computarizada, resonancia
magntica nuclear, utilizacin de molculas
marcadas, as como tambin avances
extraordinarios en ciencias conexas como
la gentica, la sntesis qumica, los cultivos
celulares, la biologa molecular y muchas
ms.
Para precisar mejor estas restricciones y
avances en la aplicacin del mtodo cientfco,
revisaremos un ejemplo, el desarrollo
histrico habido con Helicobacter pylori, que
es una parte del tema contrastacin de la
hiptesis, referido entre otros aspectos a los
diseos experimentales y no experimentales.
Todo ello con la esperanza de que el relato
y la concepcin de la experimentacin nos
inviten a refexionar acerca de la validez del
conocimiento cientfco inmerso en diversas
manifestaciones del hombre.
Helicobacter pylori
Los resultados positivos logrados con la
neutralizacin de la acidez o su inhibicin, y la
notable mejora evidenciada en el tratamiento
de la lcera pptica con ranitidina, primero,
u omeprazol y otros similares, despus (2),
as como el curso favorable de los pacientes
operados de lceras ppticas que haban
sufrido una drstica reduccin del nmero
de clulas secretoras de cido, no sugieren
necesariamente a la acidez como la causa u
origen primario de la lcera pptica.
Las frecuentes recidivas, la imposibilidad
de considerar recuperados totalmente a los
pacientes y los fracasos en los tratamientos
clsicos con anticidos justifcaban la afrmacin
de ausencia de un conocimiento causal.
heLicobacter PyLori AND THE SCIENTIFIC METHOD
42 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
Inesperada y precisamente cuando ms
se avanzaba en la supresin de la acidez,
surgi la idea de considerar a la lcera
pptica como una infeccin producida por
una bacteria, idea que surgi como una
chispa que ilumin el campo de la terapia
antiulcerosa, creando nuevos tratamientos
que hoy nos sorprenden. Increbles conceptos
desarrollados por Warren y Marshall en
Australia, que se difundieron en el mundo
entero y rpidamente fueron confrmados en
el Per gracias a los trabajos experimentales
de Alberto Ramrez Ramos, Len Bara y
Martn Solari de la Fuente.
No obstante, cientfcos de muchos otros
pases, particularmente de pases desarrollados,
no solo dudaban de estos hallazgos, sino
incluso los rechazaban, pues consideraban
que estos conceptos innovadores procedan
de un pas con escasa tradicin en
descubrimientos mdicos y con poco
desarrollo en tecnologa mdica. Poco a
poco fueron aceptndolos ante la realidad
de los hechos que se sucedieron en este
tema, como lo detallaremos seguidamente.
La observacin inicial
Robin Warren, antomo patlogo del
Hospital Real de Perth, Australia, el ao 1979,
observa por primera vez en una preparacin
de mucosa gstrica una lnea azul que antes
no haba visto. Al examinar minuciosamente
con el microscopio observ claramente
unas bacterias adheridas a la superfcie del
epitelio gstrico, hecho que comunic a uno
de sus colegas, especialista tambin, quien
no confrm bacterias en esta preparacin.
Posteriormente y por ao y medio, continu
en su tarea de investigar la presencia de
bacterias que, como en el caso anterior,
procedan de tejidos infamados.
El problema
Dos aspectos defnen el problema en este
caso:
La teora existente afrmaba, sin
excepcin alguna, que era imposible
que en el estmago se desarrollaran
bacterias por la presencia de un medio
fuertemente cido, condicionado por la
secrecin del jugo gstrico.
La imprecisin e inefciencia de la
metodologa aplicada no permita una
apreciacin ptica indudable y objetiva
de los microorganismos observados al
microscopio.
Hiptesis
Sin embargo, la observacin de Warren,
muchas veces repetida en los casos de
gastritis, lo llev a plantearse la hiptesis
siguiente:
Las bacterias observadas en las
preparaciones aludidas son los agentes
causales de la gastritis, la lcera gstrica y
la duodenal.
Comprobacin
Warren, experto en la tincin de sus
preparaciones microbiolgicas, haba observado
una lnea azul con la coloracin de Gram, pero
para una mejor identifcacin ensay con la
tincin de Wartin y Starry, que utiliza sales de
plata muy apropiadas para espiroquetas. Esta
tcnica permiti observar claramente una forma
bacteriana bien distinguida de color negro.
Adems, utiliz el microscopio electrnico
con el que apreci, en muestras de pacientes
con lcera pptica, bacterias fuertemente
adheridas a la superfcie del epitelio. Esta
vez su colega Len Matz y muchos otros
ms verifcaron la existencia del germen en
cuestin. Se haba demostrado su presencia,
pero an no la hiptesis planteada. Hasta
aqu se poda afrmar, como suele ocurrir
en muchos trabajos de investigacin, que
hay una asociacin simple, pero an no que
existe una relacin causa-efecto.
La idea de que fueran bacterias saproftas lo
llev a disear una experiencia con 20 casos
en los que los exmenes histopatolgicos
no mostraran infamacin. Los resultados,
para ser favorables, deberan sealar que no
haba presencia de bacterias.
Barry Marshall, gastroenterlogo, segua un
programa de especializacin clnica en el
mismo Hospital de Perth en el que trabajaba
Warren y deba presentar el trabajo de
investigacin anual que le era exigido. Warren
le solicit realizara 20 biopsias de pacientes
con mucosa gstrica normal, que l efectu
y con satisfaccin comprob la inexistencia
de bacterias. Marshall se interes tanto en
esta investigacin que se involucr en ella y
particip con entusiasmo y dedicacin.
Su tarea cientfca se hizo acreedora al
Premio Nobel en Fisiologa y Medicina, que
comparti con Warren, en el 2005.
Continuando su tarea, elaboraron el protocolo
de un ensayo clnico con 100 pacientes,
para realizar un estudio histopatolgico
42 Cientfca 8 (1), 2011 43 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
de las muestras obtenidas por biopsias,
pero esencialmente para intentar el cultivo
microbiolgico, que confrmara una vez ms
la existencia de bacterias en la mucosa.
Por su similitud con las bacterias del gnero
Campylobacter, utilizaron el medio de cultivo y
el perodo de incubacin (48 horas) requerido
por aquellas; sin embargo, las bacterias no se
multiplicaban en los medios de cultivo.
Un hecho fortuito vino en ayuda de los
investigadores, como suele ocurrir con aquellos
entusiastas que perseveran y estn realmente
comprometidos en la bsqueda cientfca: el
ltimo da de trabajo, antes de Semana Santa, uno
de los miembros del equipo de microbiologa dej
en la incubadora a 37
o
C una placa sembrada con
una suspensin del tejido obtenido por biopsia;
a su regreso (cinco das despus) observ,
como siempre lo haca, la placa y pudo ver unas
colonias transparentes que extendi y colore
eran las mismas bacterias que haba observado
en las preparaciones histolgicas!, las que en el
microscopio electrnico mostraban los bacilos
curvos ya conocidos y que posean cuatro fagelos
en una de sus extremidades. Se les dio el nombre
provisional de Campylobacter pylori-like.
El diseo experimental
Los estudios clnicos efectuados con 13
pacientes que padecan lcera duodenal
dieron positivo a Campylobacter-like y de 28
pacientes con lcera gstrica, 24 mostraban
la presencia de este germen, por lo que poda
concluirse que la totalidad de experiencias
para la lcera duodenal eran positivas a la
bacteria Campylobacter-like y, en una gran
mayora, en el caso de lcera gstrica.
Adicionalmente, Marshall estimula, a favor
de su objetivo, a los clnicos e investigadores
del rea de gastroenterologa y afnes,
quienes en diversas publicaciones confrman
el hallazgo de Campylobacter-like en tejido
infamado de la mucosa gstrica, lcera
duodenal y lcera gstrica, entre ellas las de
Mac Nulty y Watson (Laboratorio Skirrow),
que confrman la presencia de bacterias
espiraladas en el antro gstrico. Eldridge et
al. haban detectado anticuerpos generados
por el Campylobacter-like en pacientes
infectados y Langerberg y col., de Holanda,
informan del importante descubrimiento,
tambin fundamental para las pruebas de
diagnstico, del componente enzimtico
ureasa en estas bacterias.
En resumen y para defnir clara e
inobjetablemente esta experiencia ya se
haban cumplido los pasos siguientes:
Identifcacin, con tinciones apropiadas
y el microscopio electrnico, de bacterias
en los tejidos afectados.
El cultivo in vitro de estas bacterias
para confrmar que se trata realmente
de microorganismos vivos que se
multiplican y para que pudieran ser
utilizados en nuevas experiencias.
Diseos experimentales para comprobar
la presencia de Campylobacter pylori-
like en las zonas comprometidas, en
tejidos de pacientes con gastritis o
lcera pptica, y verifcar su ausencia en
personas sanas.
Desde 1981 se haban iniciado ya intentos
de erradicacin de la bacteria con el
uso de medicamentos antiinfecciosos y
antibiticos.
Para continuar sus investigaciones, realizan
una prueba en un paciente que presentaba
una intensa gastritis, le administran
tetraciclina, antibitico al que son sensibles
los grmenes del gnero Campylobacter
y el dolor abdominal y las nuseas
desaparecen. El estudio histolgico mostr
que el componente infamatorio agudo haba
disminuido y no se observaron las bacterias
espiraladas.
Marshall insiste en utilizar el tratamiento
con sales de bismuto y disea un ensayo
clnico longitudinal prospectivo que
consiste en tratar a un grupo de pacientes
(15) con sales de bismuto tripotasio
dicitrato bismutato y a otro (15 tambin)
con cimetidina. En ambos grupos hubo
muchas recidivas, resultado negativo que
a pesar de ello evidenci alguna diferencia
interesante. En el grupo de sales de
bismuto, el anlisis de los preparados
histolgicos obtenidos de las biopsias
respectivas revel alguna mejora, en
cambio no en el grupo de la cimetidina.
Adems, lograron muy buenos resultados con
asociaciones de amoxicilina o eritromicina y
sales de bismuto. Actualmente, el tratamiento
recomienda dos antibiticos, generalmente
amoxicilina y claritromicina, a los que se
aade inhibidores de la bomba de protones,
omeprazol o similares, con los que se obtiene
xitos aproximados al 80 o 90%.
Evaluacin
Las evidencias antes sealadas animan a
Warren y Marshall a enviar sendas cartas
a la revista Lancet, publicadas el 4 de
44 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
junio de 1983; sin embargo, en los medios
cientfcos y de salud continuaba el rechazo
o la duda, que obliga a los investigadores
a efectuar una autoevaluacin de la tarea
hasta entonces realizada. De su anlisis se
desprenda fcilmente una evidente carencia
metodolgica. Todo lo realizado a esa fecha,
resumido en los cuatro puntos antes citados,
debera cumplir los postulados de Koch, y
para ello faltaba uno:
RepRoduciR lA inflAmAcin en un AnimAl de
expeRimentAcin
Para este fn seleccionaron a un conjunto
de cerdos porque consideraban que estos
padecen infamacin gstrica y lcera pptica,
y tambin porque su tamao es adecuado
como para practicarles la endoscopa
gastroduodenal. Realizadas estas pruebas
experimentales, lamentablemente, no
tuvieron xito con ellas.
Autoadministracin de campylobacter
pylori-like
Entonces, Barry Marshall decidi, como
en su momento tambin lo hizo nuestro
mrtir Faustino Alcides Snchez Carrin,
administrarse l mismo la bacteria espiralada
que haban identifcado en la infamacin y la
lcera pptica. Para hacerlo correctamente,
prepar un diseo experimental de tipo
longitudinal prospectivo, en el que hizo lo
siguiente:
Previamente se hara una gastroscopa
para comprobar que no exista en su
mucosa gastroduodenal infamacin
alguna.
Ingerira una suspensin de la bacteria
Campylobacter-like aislada de un
paciente diagnosticado con un proceso
infamatorio gstrico.
Despus de algunos das de sentir los
sntomas propios de la infamacin
(fueron tres) tales como nuseas y
vmitos, se le practicara una segunda
gastroscopa para observar la mucosa y
efectuar una biopsia con los siguientes
fnes:
Realizar un estudio histolgico en el
que se pudiera detectar signos claros
e inequvocos de infamacin.
Identifcar en muestras de la mucosa
gstrica la presencia de las bacterias
espiraladas que ya ellos reconocan,
naturalmente con ayuda de las
tcnicas de coloracin argntica.
Marshall percibi los sntomas propios de
la gastritis a los siete das de iniciada la
prueba, y la endoscopa se realiz a los 10
das de ingeridos 30 ml de una suspensin
bacteriana de Campylobacter pylori-like.
Finalmente, efectu su tratamiento utilizando
sales de bismuto y metronidazol, con el
benefcio de la desaparicin de los sntomas
mencionados. Un nuevo y ltimo estudio
histolgico mostr que ya no existan signos
de infamacin y tampoco las bacterias
identifcadas inicialmente.
Se mostraba as que la asociacin de
la bacteria identifcada y la enfermedad
ulcerosa aparentemente correspondan a
una relacin causaefecto y que la bacteria,
entonces denominada Campylobacter pylori,
era patgena.
Importancia de la tecnologa
En estas experiencias, como en muchas otras,
debe destacarse la importante participacin de
diversos adelantos tecnolgicos, procedimientos
y equipos de reciente desarrollo que
permitieron un resultado exitoso en esta tarea
de investigacin.
Efectivamente, esta no habra sido posible
sin la aparicin de sistemas endoscpicos
avanzados que utilizan fbras pticas cuya
fexibilidad para formar curvas a nivel de
la cavidad gstrica de los pacientes, le
permite llegar al centro del estmago y
luego al duodeno. Los rayos luminosos
siguen la curvatura de las fbras, dejando
de ser rectos como ocurre en el aire y
permiten al mdico especializado observar
los tejidos internos de los pacientes,
(esfago, estmago y duodeno), adems
de tomar biopsias de las zonas afectadas,
las que extendidas en lminas se pueden
estabilizar de inmediato con formol. Antes
las muestras tenan que obtenerse un
tiempo despus (no de inmediato), a partir
de resecciones quirrgicas, o bien mucho
ms tarde, extradas de autopsias, cuando
ya haban sufrido un proceso inevitable de
digestin. Estos procedimientos tcnicos
hicieron posible el descubrimiento de H.
pylori.
Igualmente, ayudaron la observacin con
tcnicas de coloracin recientemente
logradas, para el caso mucho mejores que el
clsico proceso de tincin Gram. Tambin
el empleo de la microscopa electrnica, con
un aumento de imagen muy superior al de la
microscopa clsica.
44 Cientfca 8 (1), 2011 45 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
Este ltimo desarrollo tecnolgico permiti
observar diferencias morfolgicas en el germen
tan evidentes que propiciaron el inicio de un
movimiento a favor del cambio de ubicacin
taxonmica y consecuentemente del nombre,
de Campylobacter a Helicobacter pylori.
Otras pruebas fueron decisivas para este
cambio, entre ellas comparar la proporcin de la
base guanina en los dos gneros, Campylobacter
y Helicobacter. Aquella del germen llamado
inicialmente Campylobacter-like pylori, con un
35 a un 38% del total de las bases, se acercaba
ms al porcentaje promedio del Helicobacter y
no al de Campylobacter. Igualmente el contenido
de cidos grasos es diferente para ambos casos.
Adems, el indicador menaquinona-6, propio de
Campylobacter, no participaba de su estructura.
El artculo de Jos Mara Pajares Garca (3)
publicado en los Anales de la Real Academia
Nacional de Farmacia de Espaa (2006), en el
que nos hemos basado para aplicar el mtodo
de la ciencia, fnaliza haciendo un interesante
comentario sobre cmo la infamacin podra
evolucionar y convertirse en un carcinoma y
linfoma gstrico, considerando para ello los
factores genticos y ambientales con los que se
asocia actualmente la aparicin de tumores.
Finalmente, podemos concluir, aplicando
procedimientos rigurosos, que no se ha
demostrado experimentalmente que el
Helicobacter pylori es la causa de la lcera
pptica.
Fracas el diseo experimental efectuado con
cerdos. La nica experiencia humana solo
estaba asociada a la infamacin, no a la lcera
pptica, y por tratarse de un solo evento no es
posible aplicarle pruebas estadsticas. Tampoco
se cumple con la objetividad requerida.
Algunos mdicos clnicos (2) sostienen que la
lcera pptica es una enfermedad de causas
multifactoriales entre las que destaca claramente
el factor H. pylori; ciertos eventos como la
mejora notable del proceso infeccioso propio
de la patologa ulcerosa, al utilizar antibiticos
especfcos para este germen, lo confrmaran
como un agente causal importante.

La lcera pptica se prodicira cuando el
H.pylori se ubica en el revestimiento mucoso
del estmago y duodeno y lo daa al hacer
que los cidos estomacales que acompaan
a las enzimas digestivas lo atraviesen, lo
irriten y causen las lceras.
An no se conocen las razones por las que
H. pylori infama y causa lceras a unas
personas y a otras no.
Actualmente, se considera como agentes
causales de la gastritis aguda a ciertos
medicamentos antiinfamatorios no
esteroides (AINES), cido acetilsaliclico
(ASPIRINA) y corticoides (CORTISONA),
igualmente el alcohol, ingerir sustancias
corrosivas y, sobre todo, infecciones por
Helicobacter pylori y otras menos comunes,
como la del virus del herpes simple.
Se reconoce que una de las causas de la
lcera pptica es el Helicobacter pylori, pero
adems la producen los medicamentos ya
mencionados, AINES y corticoides. No hay
consenso en lo que se refere a alimentos
irritantes (aj, pimienta), ingerir bebidas
alcohlicas, fumar y el estrs. Para muchos
investigadores no son causa de las lceras,
pero s pueden precipitar su aparicin o
agravar sus sntomas.
El MTOdO CIENTFICO
El mtodo cientfco pretende demostrar una
relacin causa-efecto, y lo hace aplicando
un grado de rigurosidad determinado.
El dISEO ExpErIMENTal
En el que se manipulan las variables para
intentar demostrar la relacin causal.
Diseo experimental autntico
En este diseo se manipulan las variables
y, adems, se aplican tcnicas estadisticas
utilizando muestras aleatorias.
En nuestro desarrollo del mtodo cientfco
riguroso (4) hemos defnido claramente los
conceptos involucrados que comienzan con
la observacin inicial y la formulacin del
problema. Ya en la fase de contrastacin
de la hiptesis, buscamos esencialmente
precisar las variables causa y efecto de un
evento natural o formal.
La estrategia ideal para ello es disear
un modelo en el que las dos variables
fundamentales causa-efecto se hubieran
aislado completa y absolutamente, no
existiendo contaminacin ni perturbacin
alguna, seran tericamente puras. Se lograra
as el 100% de los resultados esperados
y no habra necesidad de estadsticas ni
evaluacin posterior.
Los conceptos de variables aisladas (5,6)
son ideales, lamentablemente solo tericos,
pero tiles porque marcan al investigador
la ruta a seguir, la que habr de permitirle
aproximarse al modelo terico, cuanto
ms cerca mejor; lamentablemente, la
enorme cantidad de variables, entre ellas
46 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
muchas intervenientes, tambin llamadas
de confusin, participan en toda experienca
habida o por realizar, e impiden lograr este
objetivo del modelo ideal, justamente el
incentivo que requiere el investigador para
realizar una tarea de excelencia.
Hay dos formas para intentar construir este
modelo terico:
Modifcando los elementos que
conformarn el modelo, evitando en lo
posible la participacin de las variables
de confusin, esto es, manipulando las
variables para no incluirlas.
Si no es posible evitarlas, que es
frecuente, deber minimizarse su
accin negativa aplicando estadstica,
herramienta importante que ayuda
considerablemente a este fn.
La contrastacin en las ciencias naturales
logra su apogeo con el mtodo experimental.
Una vez enunciada la hiptesis, de ella se
derivan consecuencias que resultan en
hechos con los que se disea un modelo
experimental.
En general, son requisitos necesarios para
considerar que existe una relacin causa-
efecto:
Asociacin de covariancia entre las
variables independiente y dependiente.
La variable independiente debe preceder
a la dependiente.
No debe haber otras variables que
determinen el efecto esperado.
Los dos principios bsicos antes
mencionados:
Reproduccin, y
Aleatorizacin.
Ya que no es posible separar totalmente
las variables, deben entonces minimizarse
los errores aplicando tcnicas estadsticas
y la reproduccin de la experiencia para
garantizar el criterio determinista de la
investigacin: una causa bien identifcada
produce necesariamente el efecto esperado.
Es una evidencia de la objetividad antes
enunciada que caracteriza a la ciencia y al
conocimiento cientfco.
No todas las reas de la ciencia se basan en los
mismos principios. Algunos son especfcos y
relacionados con el tema al que se referen.
Los postulados de Koch, publicados en 1890,
se utilizan en microbiologa para establecer si
una determinada bacteria es el agente causal
de una enfermedad diagnosticada. Estos
postulados son:
El agente bacteriano debe aislarse
siempre de enfermos en las condiciones
apropiadas y estar ausente en las
personas sanas.
El agente no debe aparecer en otra
enfermedad de manera fortuita o
saprofta.
El agente debe ser aislado en un cultivo
puro a partir de las lesiones producidas
en el animal de experimentacin.
Girolano Fracastoro formul, en 1546, una
hiptesis que en ese entonces no poda ser
demostrada: las enfermedades se originan
por organismos invisibles.
El holands Antonio Leeuwenhoeck (7)
desarroll el microscopio permitindole
ver por vez primera los microbios. Pasteur
en el siglo XIX, inici sus monumentales
trabajos en microbiologa. En el mismo
siglo, Roberto Koch descubri los agentes
de la tuberculosis y el clera. Confrm en
1876 al agente bacteriano que produce el
clera, el Bacillus anthracis; sus minuciosas
experiencias, dotadas de alta tecnologa para
ese entonces, culminaron con el postulado
antes referido. En los 30 aos siguientes se
haba descubierto la mayora de bacterias
que causan las principales enfermedades.
Para completar la etapa de desarrollo en el
descubrimiento de un medicamento, se debe
programar y ejecutar las etapas siguientes:
Primera etapa, del anlisis. Ensayos in
vitro: grmenes, clulas, tejidos.
Segunda etapa. Parte I, de la sntesis.
Diseos experimentales in vivo en
animales.
Segunda etapa. Parte II, de la sntesis.
Pruebas clnicas en el hombre.
Con ellas se cumple con los procedimientos
estipulados por Ren Descartes, publicados
en el siglo XVII, de intentar individualizar
primero los componentes para conocerlos
y, as separados, precisarlos bien; tambin
su forma de actuar en estas condiciones,
para luego, en un proceso de sntesis,
reincorporarlos en el medio en el que han
de desenvolverse. Finalmente, observar
su comportamiento entre estas nuevas
variables.
46 Cientfca 8 (1), 2011 47 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
Efectivamente, deben ser diferentes los
resultados que se obtienen en una experiencia
de este tipo, que podramos representar por
una ecuacin del pensamiento en la que
el primer trmino est constituido por una
variable aislada, la misma variable inicial, pero
que ahora ya es conocida e incluye a todas
las otras subvariables que la constituyen,
ms las de su entorno. Estas ltimas pueden
afectar esa respuesta obtenida, in vitro o
experimentalmente en animales, en mayor
o menor grado; por eso son necesarias las
pruebas clnicas en el hombre mismo.
Los esfuerzos realizados para obtener un
frmaco exitoso en el tratamiento del cncer
nos ilustran al respecto:
Bsqueda de un quimioterpico efcaz
Los investigadores del rea inician su tarea
tratando de reducir el amplio nmero de
variables que responden al concepto propio
de la variable independiente (VI). Para ello
eligen los conocimientos tradicionales
que la etnomedicina les proporciona, un
nmero restringido de plantas medicinales
usadas para reducir o curar tumores.
Esto es importante porque el 60% de
los quimioterpicos actualmente usados
proceden de plantas medicinales.
Otra fuente de probables productos
anticancergenos es la que aporta la
Farmacoqumica, que propone procesos
de sntesis qumica despus de comparar
estructuras moleculares de grupos funcionales
qumicos carcinognicos o inhibidores de
su proliferacin celular.
Se entiende que la VI, probable causa de
la curacin, es el frmaco que se busca y
la variable dependiente (VD) es el cncer
humano.
El trabajo de investigacin consta de dos
etapas muy defnidas, de acuerdo con el
mtodo propuesto por Descartes, que ya
hemos mencionado antes:
pRimeRA etApA, del Anlisis; y
segundA etApA, de lA sntesis.
Primera etapa. Se individualizan la variable
independiente VI, la probable causa, y
la VD, el efecto esperado, separando
sus componentes. Los extractos de las
plantas elegidas se fraccionarn e intentar
comprobarse en cada una el efecto
teraputico esperado.
Para ello, las fracciones obtenidas se someten
a un procedimiento continuo de seleccin
en el que se ensayan todas y cada una de
las fracciones y se las somete a la prueba
de inhibicin de proliferacin de las clulas
cancerosas especfcas. Aquella fraccin que
muestre la mayor inhibicin de crecimiento
celular ser seleccionada para un nuevo
fraccionamiento y as, sucesivamente, hasta
llegar a la molcula nica, el principio activo!
En el caso de los productos obtenidos por
sntesis qumica se selecciona aquel que, por
su estructura y caractersticas qumicas, exhiba
mayores probabilidades de xito curativo.
Igualmente, tratndose de la bsqueda
de un quimioterpico y para evidenciar la
VD, el efecto, se aslan clulas cancerosas
del cncer especfco cuyo tratamiento se
investiga, por ejemplo, clulas hepticas
cancerosas, hepatomas.
Esta es la prueba in vitro en la que se
confronta de la manera ms apropiada un
cultivo celular (medio de cultivo, incubacin
a 37C y 5% de CO2), la VI, probable causa
de curacin, y la VD, el efecto.
El diseo debe permitir comparar el grupo
que se investiga, el que mostrar la evidencia,
con un grupo testigo o grupo blanco. Puede
agregarse un grupo que permitir comparar
si este resultado ser ms efciente que
aquellos que ya existen al momento; es el
grupo control positivo. Los tres grupos son:

Grupo testigo
Grupo que se investiga
Grupo control positivo
Es innecesario insistir en las ventajas del
aislamiento y anlisis de las variables:
son ensayos rpidos, de variables
manipulables, fcil repeticin y bajo costo,
y con ellos pueden programarse muchas
variantes. La variable independiente aislada
(monofrmaco) constituir un producto
exento de los efectos adversos que pueden
aportar otras variables; la sustancia activa,
muy reducida, ha de permitir estudios de
las dosis ms efcaces, sin efectos txicos
observables, y tambin fabricar diferentes
tipos de productos, tabletas, jarabes,
inyectables y, adems, verifcar su actividad
teraputica.
Todo ello es insufciente: no se ha ensayado
el principio activo con el hombre, el
verdadero receptor del producto, y eso
exige un procesamiento experimental que
nos conduce a la segunda etapa.
48 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
Segunda etapa, de la sntesis. Parte I, fase
experimental en animales.
Para continuar debera estructurarse el
diseo con los actores del fenmeno
teraputico, el extracto de la planta y el
paciente que padece la enfermedad. Pero,
por motivos ticos, con el hombre no se
debe experimentar. Por tanto, en este tipo
de investigacin no se puede optar por el
nivel de mayor exigencia, el de resultados
inobjetables, contundentes, que es el diseo
experimental humano directo. Se efecta
entonces una fase intermedia, el estudio
experimental in vivo, pero en animales, los
ms cercanos al hombre, mamferos con
fsiologa prxima a la humana.
Para esta experiencia se elige un modelo que
utiliza un animal susceptible de desarrollar la
enfermedad que va a tratarse con la droga
obtenida. De los diversos tipos de cncer se
selecciona el cncer cutneo, por ejemplo; y
el animal puede ser un ratn. Como agente
carcinogentico, se usarn agentes fsicos,
qumicos, biolgicos o cualquier otro capaz
de generar la enfermedad. En nuestro
Laboratorio de Investigacin de Cultivo
Celular, de la Universidad Cientfca del Sur
utilizamos 7,12-Dimethylbenz(a)anthracine
(DMBA), sustancia qumica de reconocido
efecto carcinognico.
Para trabajar los procesos patognicos de
la infamacin se administran sustancias
irritantes como la carragenina. Para la
hipertensin arterial se usaban conejos
genticamente seleccionados, normalmente
hipertensos. Hoy da, despus de las
experiencias del ratn knockout por las
que concedieron el premio Nobel 2007
a Mario R. Capecchi, Sir Martin J. Evans
y Oliver Smithies (8), se cuenta con ms
de mil modelos animales genticamente
modifcados que presentan alteraciones
genmicas y son portadores de
enfermedades, o sus sntomas, y que los
investigadores pueden seleccionar para su
tarea de bsqueda de farmacoqumicos.
Para el caso de las plantas medicinales, el
modelo experimental recomendable ser
similar al de la experiencia anterior, en el
que siempre se cumplen las exigencias de
aleatorizacin previstas.
A B C D E
Grupo B = Ratones a los que se les aplica
agentes carcinognicos y beben agua sola.
Grupo C = Ratones a los que se les
aplican agentes carcinognicos y, beben
una solucin acuosa de la sustancia que se
investiga.
Es obvio que con esta prueba experimental
no podremos afrmar, si el resultado fuera
positivo, que la sustancia ensayada es
anticancergena; solo que es preventiva de este
tipo de cncer, porque el extracto se administra
simultneamente con el carcingeno.
Si adems de esta prueba deseamos defnir su
calidad teraputica, debemos incluir un grupo D.
Grupo D = Ratones a los que se les aplica
agentes carcinognicos y, solo despus de haber
confrmado la aparicin de las lesiones cutneas
neoplsicas, se comienza a administrar el
principio activo, ya identifcado qumicamente.
Finalmente, un grupo E:
Grupo E = Control positivo, que deber
ser un quimioterpico, el ms efectivo para
este tipo de cncer.
El blanco o grupo testigo ser preparado
de manera tal que incluya la totalidad de
componentes (variables) que participan en
el grupo a investigar menos la VI. As, para
la comparacin no habr interferencias
o desviaciones. En la experiencia que
comentamos, el grupo testigo de ratones
B beber agua de bebida similar a la que
se use para disolver la sustancia activa. Lo
mismo ser si se trata de otros disolventes.
Cuando se utiliza plantas medicinales como
antitumorales o plantas para estimular la
proliferacin de clulas madre pluripotentes,
el extracto seco obtenido se disuelve en el
solvente orgnico previamente usado en el
proceso de extraccin, al que se recomienda
adicionar 10-20% de dimetil sulfxido
DMSO. A veces los investigadores utilizan
como blanco el solvente orgnico solamente,
sin incluir el DMSO. Se ha demostrado que
esta sustancia qumica, el DMSO, es capaz
de transportar diversas sustancias a travs
de la membrana celular, que en el caso de la
clula cancerosa y en el de las clulas madre
pluripotentes permitir que las sustancias
activas penetren y lleguen al ADN, ejerciendo
all las acciones predeterminadas. La
presencia o ausencia del DMSO signifcar
una gran diferencia, ya que al modifcar el
mecanismo de accin, se habr de alterar los
resultados de un diseo cualquiera.
Grupo A = Ratones normales que beben
ad libitum agua de bebida sola.
48 Cientfca 8 (1), 2011 49 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
Tampoco debemos desdear la importancia
de una buena aleatorizacin y, por
consiguiente, ser imprescindible la eleccin
adecuada del diseo estadstico.
Segunda etapa, parte II, experimental in
vivo. Los ensayos clnicos.
Son estudios experimentales de sustancias
o productos farmacuticos en los que se
valoran efcacia farmacolgica y seguridad,
efectos adversos txicos, mutagnicos y
secundarios en el hombre.
Consideremos las cuatro fases que corresponden
a los ensayos clnico-farmacolgicos.
ENSaYOS ClNICOS dE FaSE I
En los que trata de determinarse signos
de toxicidad y/o importantes efectos
adversos en humanos adultos, sanos: 100
aproximadamente.
ENSaYOS ClNICOS dE FaSE II
Despus de aprobada la fase de seguridad,
fase I, se inicia la fase II, que consiste en la
administracin del probable medicamento a
pacientes a quienes se les ha diagnosticado,
sin duda alguna, la enfermedad a la que
se destinar el frmaco. Se compara los
resultados con los que se obtienen de
medicamentos existentes y/o placebos (la
forma farmacutica sin principio activo: el
blanco o testigo); 100 a 200 pacientes.
Se establece una relacin efcacia/toxicidad
para luego proponer la dosis ptima.
ENSaYOS ClNICOS dE FaSE III
Se verifcan los resultados anteriores con
cientos o miles de pacientes, particularmente
la efcacia farmacolgica, insistindose
tambin en buscar efectos adversos no
detectados en las fases anteriores.
Cumplidas estas tres fases, y despus que
los organismos de salud aprueben el Registro
y Autorizacin para la comercializacin y uso
del medicamento en cuestin, se desarrolla
la fase siguiente.
ENSaYOS ClNICOS dE FaSE Iv
Son los estudios de frmacovigilancia que
permiten el seguimiento del medicamento
aprobado y comercializado. Sus resultados
podran mostrar efectos secundarios an no
detectados, efectos adversos que aparecen
a largo plazo o lograr la evidencia de su
real efcacia cuando se administran durante
periodos largos, de muchos aos.
La persistencia de algunos efectos secundarios
ha sido til para el desarrollo de nuevos
productos farmacuticos. La somnolencia
que producan los antihistamnicos llev al
descubrimiento de derivados de la fenotiazina,
de anillos benznicos en su estructura qumica,
la promazina, la clorpromazina y otros ms,
que tienen notables efectos tranquilizantes,
muy tiles como antipsicticos.

El diseo cuasiexperimental
Muy apropiada, en nuestro idioma, es la
denominacin Diseo Casi-Experimental.
En l falta la distribucin aleatoria, en
consecuencia, estos diseos no estn sujetos
a todas las pruebas estadsticas aplicables a
los diseos experimentales autnticos (9).
Para las investigaciones clnicas, en las que
por razones ticas no se puede acceder
a los diseos experimentales autnticos,
se recurre a diseos con grupo testigo no
equivalente, mtodo de apareamiento que
consiste en hacer pares en los dos grupos, el
de control (grupo blanco o testigo) y el grupo
experimental. Las diferencias entre estos dos
grupos puede defnir la alternativa vlida.
figura 1. serie temporal en ms de dos oportunidades
50 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
Tambin a diseos de serie temporal con dos
grupos concordantes, que ayudan a inferir
relaciones causa y efecto ms aproximadas
que otros, constan de mediciones repetidas
tanto del grupo testigo o control como del
grupo experimental, que permitirn a largo
plazo una mejor apreciacin, por ejemplo, de
pacientes en estudio. As, una serie temporal,
en vez de medirse solo en dos oportunidades
g y h se realiza, adems, en a, b, c, d, e, f
(antes) y en i, j, k, l, m, n (despus), es decir, en
14 oportunidades que hacen posible estimar
tendencias (Figura 1).
dISEOS NO ExpErIMENTalES
Son aquellos en los que no se manipula las
variables, por lo tanto con ellos no se demuestra
una relacin causa-efecto, sino solamente
covarianza o una asociacin simple.
Los conceptos, en este caso probables, de
causa y efecto son reemplazados por los criterios
mas extensos de Variable Independiente (VI) y
Variable Dependiente (VD).
Un importante nmero de ellos corresponde
a modelos observacionales en los que
esencialmente se observan los hechos naturales.
Ocurre que muchos fenmenos requieren
de una explicacin plausible cuando no se
puede manipular a las posibles variables
causa y efecto, en algunos casos, por la
naturaleza misma de los fenmenos o de las
caractersticas y circunstancias en las que
se hallan inmersas, y en otros, por motivos
ticos. As, en la bsqueda de una relacin
causal atribuida al Helicobacter pylori, no se
debe, como se ha hecho, infectar al hombre
para demostrarla aunque se trate de una
decisin propia del investigador.
Diseos descriptivos
Son diseos observacionales cuyo objetivo
es precisar cmo es y cmo se manifesta
determinado fenmeno, precisando los
valores cualicuantitativos de una o ms
variables para, de esta manera, describir un
hecho, objeto o persona, sin la intencin de
buscar asociaciones de ningn tipo (10).
Por ejemplo:
Describir la fora y fauna del litoral de un pas,
desde una a otra longitud preestablecida.
Tienen un objetivo, no una hiptesis ya que no
hay problema a resolver; y si esta se enuncia
se le llamar hiptesis descriptiva, que no
resuelve situacin problemtica alguna ni
supone causa-efecto, ni siquiera covariacin.
No requiere de dos variables como s lo exige la
asociacin o covarianza. Pero la descripcion es
necesariamente parte importante de la ciencia.
Plan piloto y diseo exploratorio
Estos dos diseos son una primera
aproximacin al tema.
El plan piloto es un desarrollo previo al
diseo experimental que pretende precisar
determinadas caractersticas no conocidas
de las variables en estudio y tiene como fn
ajustar mejor el diseo experimental o bien
familiarizar al investigador con las tcnicas a
emplear exigidas por el diseo, ajustndolas
a equipos y materiales existentes. Son
ensayos de nmero reducido que no
cumplen las exigencias de los diseos
experimentales respecto a la utilizacin de
muestras aleatorias.
El diseo exploratorio, en cambio, es
derivado del diseo descriptivo y se
efecta cuando se requiere mayores datos
para elaborar un buen marco terico. Es
puramente observacional.
Se incluyen en este grupo los estudios ex
post facto, aquellos que se realizan despus
de que los hechos han ocurrido; estos
diseos son, en general, de dos tipos:
Transversales y longitudinales
Transversales, cuando ocurren en un
mismo tiempo, en un tiempo nico. Como
si se hiciera un corte en el tiempo y durante
l se estudiaran grupos o variables.
Longitudinales, que son los estudios que
se hacen a lo largo del tiempo para apreciar
los cambios ocurridos en determinados
perodos, de modo que permitan hacer
inferencias con respecto a las variables.
El haberse manifestado ya las supuestas
variables causa-efecto y la imposibilidad de
manipularlas no debe ser motivo que nos
impida estudiarlas e investigar la naturaleza
de los hechos con el objeto de acercarnos a
precisar sus variables, conocerlas mejor. No
nos ser posible determinar las causas, pero
s podramos hacer inferencias razonables
acerca de ellas, estableciendo su grado de
asociacin, slo su covariacin, sin llegar
al grado de relacin causal, simplemente
establecer la correlacin entre fenmenos
observados. Los diseos longitudinales
pueden clasifcarse en:
Retrospectivos, cuando las Variables
Dependiente (VD) e Independiente (VI) ya
han tenido lugar; y
50 Cientfca 8 (1), 2011 51 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
Prospectivo, cuando solo ha ocurrido la
Variable Independiente (VI).
Diseos retrospectivos
Una vez que se ha detectado la presencia o,
en su caso, medido a la variable efecto VD,
se investigan las variables que tiempo atrs
pudieran haber tenido alguna correlacin con
aquella.
Estudios sencillos, a veces muy interesantes,
son los que se realizan analizando los datos
contenidos en las historias clnicas de los
pacientes hospitalarios o de centros mdicos
diversos, para buscar relaciones elegidas
por el estudiante o investigador, tales como
sntomas, causa, evolucin, tratamiento, etc.,
para establecer relaciones probables.
Investigar relaciones retrospectivas puede
requerir conocimientos de enunciados
cientfcos o leyes que permitan orientar la
bsqueda dirigida a conformar los indicios
que han de sustentar la explicacin de la
variable dependiente, para as formular una
hiptesis consistente sobre su causa.
En un caso hipottico y contradictorio, el de
la lcera pptica, se pens en enunciados
cientfcos, dimensiones y variables que
invitaron a refexionar acerca de las causas
que la producen: estrs, acidez, alimentos
irritantes, antiinfamatorios (aines), etc.;
sin embargo, nada de esto nos condujo
a Helicobacter pylori, sorpresivamente
descubierto por observacin microscpica
primero y, luego, confrmada su relacin
infamatoria al ser inducida por ingestin del
microorganismo indicado. Desde un punto
de vista lgico sera absurdo suponer que
una bacteria pudiera correlacionarse con
la infamacin gstrica, menos an con la
lcera pptica. Los microorganismos no se
multiplican en medios con pH tan bajo.
Pero la deteccin repetida y su registro en
las historias clnicas, para un investigador
experimentado que las estuviera revisando y
analizando, sera un buen indicio de causalidad,
aunque insufciente para demostrarla.
Para establecer una relacin de causalidad
se necesita, adems de demostrar la
covariacin, verifcar que el hecho a
considerar antecede en el tiempo a la variable
dependiente, esto es, ocurre primero.
Otra manera de efectuar los estudios
retrospectivos o aprovechar las historias
clnicas es buscando regularidad en la
aparicin de ciertos fenmenos variables
independientes, como puede observarse
en el caso que estamos comentando, al
detectarse la presencia de H. Pylori cuando
los pacientes han sido diagnosticados de
gastritis o lcera pptica, y no observarlo en
personas sanas. En la fgura 2 mostramos
cmo, hipotticamente, las historias clnicas
deberan haber registrado un fenmeno en el
que A y B suman evidencias.
figura 2. diseos retrospectivos en los que los grupos a y b suman evidencias de casos y
controles
CON VD
http://www.youtube.com/watch?v=8IAayP_UnMM
CON VD
CON VD
S
I
N
V
D
S
I
N
V
D
S
I
N
V
D
S
I
N
V
D
S
I
N
V
D
A
B
Pacientes
con gastritis o
lcera pptica
Personas
sanas
Negativos a
H. pylori
Exmenes
positvos a
H.pylori
52 Cientfca 8 (1), 2011
Jos Amiel Prez
A
R
T

C
U
L
O
S

D
E

R
E
I
S
I

N
Diseo retrospectivo de casos y controles
En este diseo se comparan dos grupos,
uno que s cumple con presentar la variable
dependiente, el grupo de casos, y otro
que no la presenta, pero en el que pueden
aparecer ciertas caractersticas que podran
acercarse a expresiones causales. Es el
grupo de controles en el que, como puede
apreciarse en la fgura precedente, resulta
obvio estimar en A la presencia de H. pylori
como covariacin y descartarla en B.
Algunas veces se encuentra que VI
descartadas pueden evaluarse como posibles
variables causales.
Debe considerarse tambin la posible
presencia de variables intervinientes que
llevan a confusin al investigador: el alto
porcentaje de personas aparentemente
sanas con resultados positivos de H. pylori.
Esta situacin exige ms pruebas que las
usuales para contrastar fehacientemente la
opcin causal.
Diseos prospectivos
En este tipo de diseos lo que ha ocurrido
y se conoce es la variable independiente, y
lo que habr de evaluarse en el futuro es la
probabilidad de una variable dependiente,
el supuesto efecto que ha de obtenerse.
Supuesto porque no estn dadas las
condiciones necesarias para establecer, sin
duda alguna, que se trate de una relacin
causa-efecto, ya que no se ha manipulado
las variables para ese fn. Solo habr de
lograrse una asociacin simple, covariacin;
aunque s se trabajar en la investigacin a
realizar, con una variable independiente que
precede a la dependiente. En el Hospital
Naval del Per se dise un modelo de
tratamiento para pacientes con tuberculosis
resistente a los antibiticos.
En este modelo se cambiaba el antibitico
utilizado, internando en el Hospital al paciente
durante su tratamiento. Se seleccionaba a los
pacientes solo por la condicin de resistencia
mencionada, intentando despus disminuir la
amplia variabilidad de las condiciones de vida
de los enfermos al internarlos en un centro
hospitalario comn que les proporcione
similar estilo de vida, tipo de alimentacin y
ambiente propio. Se eliminan as variables
que pudieran modifcar negativamente los
resultados que el investigador estudiar cuali
o cuantitativamente. Se mantienen aquellas
variables que no pueden impedirse como
edad, sexo, peso, estatura, etc.
Este programa fue preparado y ejecutado
durante un perodo predeterminado, y
recibi a un nmero de pacientes que
en conjunto constituyeron una muestra
insufciente para su generalizacin. La pre-
existencia de otras variables independientes
que no fueron motivo de este estudio o que
pasaron inadvertidas durante la seleccin
de los pacientes, no hicieron posible que
su infuencia fuera realmente conocida o
determinada. Por tanto, an cuando se
obtuvo mejores porcentajes de xito con
este nuevo modelo de tratamiento, no se
pudo determinar fehacientemente que
el efecto curacin se deba a una causa
antibitica nicamente. En este estudio se
ha establecido solo que existe covariacin
y el antibitico es simplemente una variable
independiente.
Enfatizamos que nuestro concepto de
variable independiente (VI) es ms amplio
que el de causa; puede incluir a esta y es muy
apropiada para los diseos experimentales
en los que an no se ha determinado
causalidad.
Diseos evolutivos
Son diseos longitudinales en los que se
trata de determinar los cambios que ocurren
en la variable dependiente a lo largo de la
vida de un organismo, el que se constituye
en la variable independiente, y permitir
obtener algunos hechos que ayudarn a
establecer los mecanismos que subyacen
en un fenmeno biolgico o un organismo
cualquiera.
Estos diseos son importantes en la teora
de la evolucin en biologa y tambin en
psicologa evolutiva, entre otros, pues el
conocimiento del mecanismo de accin es
muy til para defnir una situacin causal,
cualquiera que fuera.
52 Cientfca 8 (1), 2011 53 Cientfca 8 (1), 2011
Helicobacter pylori y el Mtodo Cientfco
rEFErENCIaS BIBlIOGrFICaS
1. Valle Mansilla J. Medicina: Carrera cientfca o humanista? Diagnstico 2003; 42: 43-46.
2. Ramirez Ramos A. Riesgos de la administracin de los inhibidores de la bomba de
protones por tiempo prolongado. Diagnstico 2009; 48: 88-90.
3. Pajares Garca JM. Descubrimiento de la bacteria Helicobacter Pylori y su impacto en las
enfermedades gastroduodenales: Premio Nobel 2005, merecido aunque retrasado. Anales
de la Real Academia Nacional de Farmacia 2005; 72: 139-164.
4. Tamayo Caldern J y Gonzles Velasco M. Fundamentos de la investigacin cientfca.
Lima: Ediciones Muequito Normativo, 1992.
5. Hernndez F; Alvarado E y Pineda E. Metodologa de la Investigacin. Mxico D.F.: Ed.
Limeisa, 1996: 50-51,88-89.
6. Amiel Prez J. Las variables. Estructuras y mecanismos. Cientfca 2009; 6: 26-37.
7. Amiel Prez J. Metodologa de la investigacin cientfca. Lima: Ed. CONCYTEC,1993.
8. La Cadena Calero J. La tecnologa knockout, premio Nobel de Fisiologa o Medicina 2007.
Anales de la Real Academia Nacional de Farmacia 2008, 74: 65-79.
9. Calzada Benza J. Mtodos estadticos para la investigacin. 5.
a
Edicin. Lima: Ed.
Milagros, 1982; pgs. 38-40.
10. Hernndez R. Fernndez C. y Baptista P. Metodologa de la Investigacin. Mxico D.F.:
Ed. McGraw-Hill, 1996: 60-2.
recepcin: 09/02/2011
AceptAcin: 16/03/2011
jos amiel prez
jamielperez@gmail.com
54 Cientfca 8 (1), 2011
Freundt M; Martinez-Bratton M.
C
A
R
T
A
S

A
L

E
D
I
T
O
R

aBSTraCT
Urethral prolapse is a condition that is rare
in veterinary clinical practice, due partially
to the isolated amount of clinical case
reports. It is a condition mostly seen in
English Bulldogs but which also has been
diagnosed in other breeds, especially
brachiocephalic type breeds. Surgical
techniques to correct urethral protrusion,
with diverse procedures and end results,
have been documented for the purpose of
providing less surgical trauma and rapid
recuperation. This report describes a clinical
case involving a urethral prolapse in a young
intact male English Bulldog illustrating initial
clinical management and a modifed surgical
technique that allows reduction of prolapse,
less trauma, and reduced anesthetic time.
Keywords: Urethral prolapse, Urethropexy,
English Bulldog.
rESUMEN
El prolapso uretral es una condicin rara
en la prctica clnica veterinaria, debido
parcialmente a la poca cantidad de casos
clnicos reportados. Es una condicin vista
mayormente en la raza bulldog ingls, pero
que tambin puede ser diagnosticada
en otras razas, especialmente las de tipo
braquioceflicas. Las tcnicas quirrgicas
para la correccin de protrusiones uretrales,
de diversos procedimientos y resultados,
han sido documentadas con el propsito de
disminuir el trauma quirrgico y contribuir
a una rpida recuperacin. Este reporte
1
clnica veterinaria animal life. mdico veterinario. lima, per.
2
universidad cientfica del sur. bmvz. lima, per
CarTaS
al EdITOr
describe un caso clnico que involucra un
prolapso uretral en un bulldog ingls macho
intacto, ilustrndose el manejo clnico inicial
y una tcnica quirrgica modifcada, la cual
permite la reduccin adecuada del prolapso
con menor trauma y tiempo anestsico.
Palabras clave: Prolapso Uretral, Uretropexia,
Bulldog Ingls
INTrOdUCTION
The presentation of urethral prolapse in
intact male dogs is an unusual occurrence,
in part because of the small amount of
cases reported, and also because of the
appearance mostly in a small amount of
certain types of breeds.1 The presence of
urethral prolapse in breeds such as English
Bulldogs, Yorkshire Terriers, Boston Terriers,
American Pit bull terriers, and longhaired
Dachshunds amongst other breeds has
been reported, but with more frequent case
reports in male English Bulldogs (1-6).
The prolapse occurs when the distal portion
of the urethral mucosa protrudes 3-5 mm
through the external orifce of the urethra,
giving the aspect of a small congested berry-
like tissue(3). It seems that the incidence
of urethral prolapse is limited to male dogs
specifcally, since no clinical case reports
have been made regarding its occurrence
in female dogs(4). In male dogs it is mostly
seen in intact young male dogs in the midst
of growth development, usually between
the ages of 6 months and two years (7).The
URETHRAL PROLAPSE IN A MALE ENGLISH BULLDOG:
MANAGEMENT AND SURGICAL CORRECTION
PROLAPSO URETRAL EN UN BULLDOG INGLS MACHO: MANEJO y CORRECCIN QUIRRGICA
Michelle Freundt Coello
1
, Michael Martnez-Bratton
2
54 Cientfca 8 (1), 2011 55 Cientfca 8 (1), 2011
Prolapso Uretral en un Bulldog Ingls Macho: Manejo y Correccin Quirrgica.
most affected breed is English Bulldogs; of
eighteen urethral prolapse cases reported,
eleven were English Bulldogs, three Yorkshire
Terriers, two Boston Terriers, one Dachshund,
and one American Pit bull Terrier (1-6,8).
The physiopathology of urethral prolapse
is not yet known completely but has been
considered a secondary occurrence to
causes such as neoplasia, trauma, excessive
erections and/or sexual activity, calculi
obstructions, and urinary infections(1,3).
It has also been hypothesized that breeds
with brachiocephalic characteristics such
as Bulldogs and Boston Terriers that have
stenotic nares, elongated soft palate, or a
deep thoracic cavity have a predisposition
to suffering a urethral prolapse. This occurs
particularly in cases where the intra-abdominal
pressure rises, such as in vomiting or heavy
breathing due to excessive effort, causing a
defective blood fow from the pudendal vein
which affects the corpum spongiosum and
consequently the urethral mucosa tissue
(that could have been abnormally weak)
(1). The clinical signs that can be observed
in urethral prolapse are constant licking,
stranguria, preputial bleeding, hematuria,
edema, and congestion (9).
The diagnosis of urethral prolapse is based
on visual examination of the penis and
clinical history and data of the patient(3). The
presence of a mass on the tip of the penis
must be evaluated as a secondary cause,
therefore all probable causes of bleeding
such as squamous and transitional cell
tumors, lymphosarcoma, penile fracture,
prostatic disease, bladder disease, calculi
obstruction, among others, must be assessed
through specifc diagnostic methods (10).
Treatment of urethral prolapse depends on
the size of the prolapse and whether it is
episodic or not. Treatment in episodic cases
is based on anti-infamatories, chemical
castration (estrogen), limited exposure to
females or any potential sexual situation, and
an Elizabethan collar(11). In extreme cases
where the prolapse is severely congested
and nearly necrotic, the best treatment is
surgical. Currently there are several surgical
techniques described as:
Manual reduction and purse sutures (12).
Placement of hypodermic needles in
body of penis and distal urethra to
prevent urethral tissue retraction with
surgical removal of prolapsed portion
and simple interrupted sutures (13).
Stay sutures in prolapsed mucosa with
initial incision 0.5 cm caudal to prolapsed
urethra and circling the penis followed
by dissection. Incision on ventral side
of prolapse mucosa and placement of
sutures followed by incision of dorsal
side and sutures (12,14)
Longitudinal incision of penile body (8).
Single traction suture (4).
This report describes the clinical management
of a prolapsed urethra in a English Bulldog
and a modifed urethropexy technique that
reduces the amount of surgical instruments
and anesthetic time.
CaSE rEpOrT
Mateo, a seven and a half month-old intact
English Bulldog was presented to the
veterinary clinic Animal Life in Lima, Peru
with a history of preputial bleeding occurring
the day before. The owner stated that when
the dog walks small drops of blood are seen
on the ground.
The dog is very sexually active and usually
rubs himself with stuffed animals. Physical
examination revealed a 5 mm protrusion on
the tip of the penis with blood stains on the
preputial hair and when handled, the dog
shows signs of pain. The penis, testicles,
dorsal portion of the urethra and prostate
were examined, fnding no abnormalities.
The respiratory rate, cardiac rate, and
temperature were in the normal range.
Upon facial and oral inspection, the nares
were slightly stenotic and the presence of a
elongated soft palate was detected.
A CBC (complete blood count) showed a
neutrophilic regenerative left shift, while the
biochemistry exam showed no alterations.
A urine analysis revealed the presence of
leucocytes and blood traces. The initial
treatment was pain management and so the
patient was given a NSAI drug (Diclofenaco
.5 mL IM) which allowed for the insertion of a
catheter in order to eliminate the possibility
of calculi in the near portion of the urethra.
The patient was diagnosed with urethral
prolapse and since it was the frst occurrence,
the dog was hospitalized for twelve hours
with a Elizabethan collar in hopes that the
swelling would go down. After twelve hours,
the mass appeared even more congested,
almost purple, and therefore the patient was
scheduled for urethropexy surgery in the
next hours.
56 Cientfca 8 (1), 2011
Freundt M; Martinez-Bratton M.
C
A
R
T
A
S

A
L

E
D
I
T
O
R

Surgical technique
Following anesthetic induction, the surgical
area was prepared by applying a Clorhexidine
(.05%) solution followed by a povidone iodine
solution (1%). The prepuce was manually
retracted and on the base of the shaft a
Penrose drain tourniquet was place.
A lubricated number eight urinary catheter
was introduced past the bulb of the penis and
a stay suture was applied on the dorsal side
of the prolapsed mucosa; both the mucosa
and the catheter were sutured in order to
prevent tissue retraction. Once the mucosa
was fxated, a series of 5-0 monoflament
nylon sutures were added clockwise using
the initial stay suture as a reference point in
a simple discontinued pattern. An incision
was made approximately 1-2 mm distal
to the sutures, removing all exceeding
mucosa tissue. The remaining urethral tissue
was sutured to the skin and superfcial
fascia around the penile orifce using 5-0
monoflament nylon in a simple discontinued
pattern. Finally the tourniquet was removed
observing no bleeding whatsoever.
Post-operative results
Post-operatively the patient recovered
from the anesthesia without any problems
and was hospitalized for 48 hours under
strict supervision, placing a Elizabethan
collar and cleaning of the surgical wound
with Clorhexidine (.05%) every eight hours.
The patient started a preventive antibiotic
and anti-infammatory treatment with
ciprofoxacin (6 mg/kg every 12 hours) and
Carprofen (2.2 mg/kg every 24 hours). A
homeopathic product containing Valerian,
Kalium Phosphate, Argentum Nitricum, and
Lactose was utilized in order to maintain a
manageable level of tranquilization.
After the initial 48 hours the patient was sent
home with strict instructions of no stimulation
that could lead to excitement. After 72 hours
with no complications the patient was brought
back to consult with a minimal protrusion
on the ventral side of the penis. The owner
had failed to follow the instructions given
and had taken off the Elizabethan collar,
allowing the patient to lick his wound and
consequently removing two of the sutures.
The patient was again hospitalized and a
second surgical procedure was performed
with positive results; one month after the
surgery no prolapse was observed.
CONClUSION
Currently there are several modifed techniques
to correct urethral prolapse and are all valid
procedures with usually successful results. As
noted in this report, the post-operative care
given at home by the owners is as important
as the surgical technique itself, given that if
either fails, the patient will not recover. The
urethropexy technique described here is
simple, fast, and potentially effective as long
as the proper care is given after the surgery
as in any other surgical interventions, but
especially in this type of procedure where the
tissue can easily be affected by continuous
sexual stimulus. The pre-anesthetic and
anesthetic time for this procedure was
minimal (30-40 minutes) and the procedure
itself took about 10-15 minutes, reducing the
risk of death due to prolonged anesthetic
time which is important in patients that suffer
brachiocephalic syndrome. Overall the authors
suggest that this technique could be used in
both patients with frst-time prolapses, and/or
patients that suffer constant urethral prolapses.
It is important to remember also that in patients
with excessive sexual excitement, chemical
or surgical castration should be strongly
recommended. Finally it is important to outline
that reporting this pathology is necessary in
order to develop better treatments and most
important of all to gain a deeper knowledge on
the physiopathology of urethral prolapses.
56 Cientfca 8 (1), 2011 57 Cientfca 8 (1), 2011
Prolapso Uretral en un Bulldog Ingls Macho: Manejo y Correccin Quirrgica.
BIBlIOGraphY rEFErENCES
1. Osborne CA, Sanderson SL. Medical management of urethral prolapse in male dogs,
in Bonagura JD. (ed): Kirk's Current VeterinaryTherapy XII: Small Animal Practice.
Philadelphia, WB Saunders Co, 1995, pp 1027-9.
2. Risco-Lpez M, Ferrer E. Urotropexia en el manejo del prolapso uretral. Revista clnica
veterinaria 2007; 27(1).
3. Moreira C. Prolapso Uretral em Caes: relatos de caso [Tesis para el grado de MV].
Universidade Federal da Bahia. Baha, Brasil, 2006.
4. Kirsch JA, Hauptman JG, Walshaw R. A Urothropexy Techinique for Surgical Treatment
of Urethral Prolapse in the Male Dog. Journal of the American Animal Hospital Association
2002; 38(4): 381-4.
5. McDonald RK: Urethral prolapse in a Yorkshire terrier. Compendium on Continuing
Education for the Practicing Veterinarian 1989. 11(6): 682-3.
6. Kaiser S, Freidstedt R, Brunnberg L. Urethral prolapsed in a male long-haired. Dachshund.
Kleintierpraxis 2003. 38(4): 219-22.
7. Schaer M. Medicina clnica del perro y el gato. Espaa: Elsevier, 2006: 494.
8. Holanda LF, Volpato JM, Contesini EA, Poletto M, Scherer S, Mucillo M. Prolapso uretral
em um Bulldoge Ingles. Acta Scientiae Veterinariae 2007; 35(1): 109-13.
9. Johnston SD, Root MV, Schultz P. Canine and Feline theriogenology. Philadelphia:
Saunders, 2001.
10. Papazoglou L, Kazakis G. Surgical conditions of the Canine Penis and Prepuce. Compendium
on Continuing Education for the Practicing Veterinarian 2002; 24(3): 204-19.
11. Morgan RV, Bright RM, Swartout MS. Clnica de pequeos animales. Espaa: Elsevier,
2003.
12. Birchard SJ. Surgical treatment of urethral prolapse in male dogs. En: Bojrab MJ, ed.
Current techniques in small animal surgery. Baltimore: Williams & Wilkins, 1997: 475-7.
13. Fossum TW, Hedlund CS. Surgery of the urinary bladder and urethra. In: Fossum TW, ed.
Small animal surgery. St. Louis: Mosby-Year Book, 1997: 503-5.
14. Ford RB, Mazzaferro EM. Urgencias en veterinaria. Procedimientos y teraputica. Espaa:
Elsevier; 2007: 178-9.
micHAel mArtinez-brAtton
correspondencia: chemikey@hotmail.com
recepcin: 17/02/2011
AceptAcin: 24/03/2011
58 Cientfca 8 (1), 2011 58 Cientfca 8 (1), 2011
Freundt M; Martinez-Bratton M.
C
A
R
T
A
S

A
L

E
D
I
T
O
R

Con mucha preocupacin, leo que algunos
empresarios, agricultores y colegas opinan
a favor de los transgnicos (OVM), como si
la naturaleza no hubiera demostrado en ms
de una oportunidad que es ms poderosa
que el hombre.
As, por ejemplo, poco se sabe de cmo los
patgenos de plantas o animales mutan y
causan serias enfermedades en el hombre,
como es el caso de los virus que producen
el bola o el sida, o la enfermedad de
Creutzfeldt-Jakob causada por el prin que
tambin causa la enfermedad de las vacas
y bovinos (encefalopata espongiforme
bovina), constituida solo por protenas, pero
que utiliza el genoma de su husped para
replicarse y se mantiene viable a ms de 140
C por 20 minutos.
El conocimiento de las complejas relaciones
de coexistencia, sinergia o antagonismo del
hombre con los otros seres que habitan el
planeta, en respuesta a los diversos factores
de clima, temperatura, humedad, altitud,
etc., es todava muy limitado.
Los creadores de las plantas transgnicas
comercialmente disponibles solo han evaluado
el comportamiento de las plantas y sus
productos bajo ciertas condiciones de clima,
unidad de consumo, etc., en relacin directa
a su impacto en la salud humana.
Sin embargo, no han tomado en cuenta que
cada especie, especialmente en los centros
de origen y en pases mega diversos como
el Per, donde no solo coexisten un gran
nmero de sus parientes silvestres que
pertenecen a la misma familia y gnero,
como ocurre para los casos del maz, la papa
y el frejol (pariente de la soya), entre otros;
sino tambin todos los microorganismos que
causan sus enfermedades, los insectos y
plantas que actan como vectores de esos
patgenos y las plantas que actan como
sus hospederos temporales, as como, los
insectos y patgenos que atacan o afectan
directamente su desarrollo. Por ejemplo,
el maz es atacado o es anftrin de varios
miembros del grupo de los Potyviridae (maiz
drawft mosaic virus, sugar cane mosaic
virus, virus del mosaico del cardamono,
weath streak mosaic virus, johnson grass
mosaic virus, zea mosaic virus, entre otros),
transmitidos por diferentes especies de
fdos, mediante un proceso de incubacin,
reproduccin y transmisin, que vara segn
el virus y el agente vector. Es decir, las
relaciones no son simples ni mecnicas.
Se han identifcado ms de 180 miembros
pertenecientes a este grupo.
Por otro lado, los Picornaviridae, un grupo de
virus que afectan a los humanos y animales,
tienen un ARN con estructura muy similar
a los Potyviridae. En este grupo estn los
virus que producen en el hombre la hepatitis,
la polio, la encefalomiocarditis, la rinitis,
entre otros y similares, que afectan a los
animales.
Se ha demostrado que el genoma de los
potyvirus tienen capacidad de promover la
capacidad de reproduccin de otros virus,
incluyendo los que afectan a humanos.
La complejidad de los procesos de replicacin
de los patgenos en sus huspedes vectores
y huspedes principales abre muchas
interrogantes que, en la mayora de los
casos, todava no han sido evaluadas.
ORGANISMOS vIvOS MODIfICADOS OvM
Josefna Takahashi, Ph.D.
1
1
universidad cientfica del sur
LIVING MODIFIED ORGANISMS
58 Cientfca 8 (1), 2011 59 Cientfca 8 (1), 2011
Organismos Vivos Modifcados OVM
58 Cientfca 8 (1), 2011
Es decir, que si casos concretos de las
formas de replicacin, interaccin y virulencia
de estructuras genmicas originadas por la
naturaleza a travs de millones de aos,
son todava desconocidos, es aventurero
decir que se conoce lo que puede ocurrir
con los organismos creados por el hombre.
Organismos cuyos genomas son el resultado
de la mezcla, bajo condiciones de laboratorio,
de genes de grupos diferentes, como pueden
ser plantas y microorganismos o animales.
Organismos creados sin otro criterio que su
respuesta directa en la productividad o la
resistencia a un producto o patgeno. Es
decir, organismos creados para satisfacer
el inters econmico de unos pocos,
para alimentar a muchos, sin importar las
consecuencias que pueden ocasionar, a
corto, mediano y largo plazo.
As por ejemplo, decir que no se ha probado
ningn impacto en la biodiversidad es falso.
Simplemente no se han realizado estudios
de su impacto en los diversos seres del
ecosistema donde se desarrollan y menos
an en latitudes diferentes, a aquellas donde
fueron creados o probados.
En estas circunstancias es necesario recordar
el impacto de la denominada revolucin
verde, orientada a la produccin masiva
de alimentos, que domina la agricultura y
ganadera en los pases desarrollados, con
consecuencias no siempre positivas; pero
que adems, al igual que ahora, no resolvi
el problema del hambre en los pases
subdesarrollados y mucho menos cambi
el nivel socio econmico de los agricultores
pobres de estos pases.
Por eso, en la Cumbre de Ro, se afrm: la
humanidad enfrenta una crisis ambiental global
sin precedentes, producto de su propio ingenio,
afn econmico e ignorancia ecolgica.
Esto amenaza la supervivencia de la vida
en el planeta y exige que aprendamos de
nuestros errores y que adoptemos un modo
sostenible de vivir en el que se reconozca
nuestra dependencia del ecosistema del
que formamos parte. La sostenibilidad es un
concepto tico: signifca la obligacin moral
de usar los recursos del planeta de manera
que las generaciones futuras disfruten de la
misma calidad ambiental y de vida.
Esto no quiere decir que el uso de la
biotecnologa sea negativo, porque muchas
formas de esas tecnologas son de enorme
utilidad para el hombre y han sido usadas
desde tiempos inmemoriales; pero el uso de
la ingeniera gentica para producir plantas
transgnicas es un tema diferente.
Todava hay un largo camino por recorrer,
para evaluar cuidadosamente sus ventajas
e impactos, es decir, mucho por investigar
y aprender de la naturaleza, antes de
aventurarnos a aplicarlo en los campos de
nuestro pas, donde adems no es necesario.
Nuestro potencial es nuestra biodiversidad.
josefina takahashi
correspondencia: decagrofor@ucsur.edu.pe
recepcin: 25/04/2011
aceptacin: 27/04/2011
60 Cientfca 8 (1), 2011 60 Cientfca 8 (1), 2011
Josefna Takahashi.
C
A
R
T
A
S

A
L

E
D
I
T
O
R

fRAGILIDAD fSICA, DETERIORO COGNITIvO y fACTORES
ASOCIADOS EN ADULTOS MAyORES DEL CENTRO GERITRICO
NAvAL, CALLAO, PER 2010
Mara Luisa Tello Garca
1
TESIS
rESUMEN
Antecedentes. La fragilidad fsica en el adulto
mayor es considerada un problema de salud
pblica importante, con una prevalencia del
7,7% en la poblacin mayor de 60 aos en
Lima Metropolitana del ao 2008; as mismo,
el deterioro cognitivo tambin est incluido
entre las patologas ms frecuentes en la
misma muestra, con una prevalencia del
14,2%. El objetivo del presente estudio fue
determinar la asociacin entre la fragilidad
fsica y el deterioro cognitivo en personas
no hospitalizadas de la poblacin adulta
mayor de 60 aos de la Marina de Guerra
del Per.
Metodologa. Se realiz un estudio de
tipo transversal y analtico para el que se
tom una muestra de la poblacin militar
mayor de 60 aos, en actividad laboral y
en retiro, pertenecientes a la Marina de
Guerra del Per y a sus cnyuges, durante
los meses de noviembre y diciembre del
ao 2010. Para su realizacin se utiliz el
programa de Stata11 para anlisis de datos
y mediante la prueba de Chi, se investig
si exista asociacin entre fragilidad fsica
y deterioro cognitivo. Para la frecuencia
de fragilidad fsica se emple el test de Up
and Go y, para determinar la frecuencia de
deterioro cognitivo, se emplearon dos test,
el test del reloj y el test de Pfeiffer, ambos
totalmente independientes uno del otro. As
mismo, se calcul el poder estadstico de
las comparaciones bivariadas con nuestras
variables independientes.
Resultados. La muestra incluy a 311
personas, en la que se observ una frecuencia
de fragilidad fsica de 107 personas (34,4%)
y una frecuencia de deterioro cognitivo
de 101 personas (32,50%) de acuerdo al
Test del Reloj, y de 31 personas (10%) de
acuerdo al Test de Pfeiffer. El promedio de
edad de las personas evaluadas fue de 70 a
80 aos [n= 127 (40,8%)] y la mayora fueron
varones [n= 185 (59,5%)]. En relacin con el
grado militar, aproximadamente la mitad de
personas fue personal subalterno [n= 159
(51,1%)] en situacin de retiro por ms de 21
aos [n= 153 (49.2%)]. La mayora contaba
con estudios superiores [n= 272 (87,5%)].
En relacin con el peso, encontramos
una predominancia entre 51 y 70 kilos [n=
173 (55,6%)], y la talla se encontr entre
1,61 cm y 1,65 cm [n= 82 (24,6%)]. De la
muestra total, 275 personas (88,4%) eran
totalmente independientes, mientras que
solo cuatro personas (1,3%) totalmente
dependientes. Finalmente, en el anlisis
bivariado, observamos una mayor relacin
entre el sexo masculino y la fragilidad
fsica (p= 0,003); as mismo, mientras ms
aumentaba la edad de la persona, ms
asociada se encontraba con fragilidad fsica
(p= <0,001) y, consecuentemente, aquella
persona que tena mayor dependencia
result ms relacionada con dicha condicin
(p= 0,002). Adems, se demostr que tanto
el test del reloj como el test de Pfeiffer
(ambos utilizados para detectar deterioro
cognitivo independientemente una de la otra)
estuvieron asociados con fragilidad fsica
segn el test de Up and Go (p= <0,001).
1
universidad cientfica del sur. facultad de medicina.
PHySICAL FRAILTy, COGNITIVE DETERIORATION AND ASSOCIATED FACTORS IN ELDERLy FROM
GERIATRIC NAVy CENTER, CALLAO, PERU 2010
60 Cientfca 8 (1), 2011 61 Cientfca 8 (1), 2011
Fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores del Centro Geritrico Naval, Callao,
Per 2010
60 Cientfca 8 (1), 2011

Conclusin. Asociacin estadstica entre
fragilidad fsica y deterioro cognitivo. As
mismo, se ha encontrado asociacin
estadstica entre fragilidad fsica y mayor
edad de la persona, as como asociacin
estadstica entre fragilidad fsica y mayor
grado de dependencia de la persona para
presentar dicho estado.
Palabras clave: fragilidad fsica, deterioro
cognitivo, escalas geritricas.
INTrOdUCCIN
A nivel mundial se est produciendo un
envejecimiento progresivo de la poblacin
debido al aumento de la esperanza de vida
y a la disminucin de la natalidad (1), tanto
en pases desarrollados como en aquellos en
vas de desarrollo (2). En el caso de nuestro
pas, este proceso avanza rpidamente,
por lo que se estima que el ndice de
envejecimiento se duplicara en las prximas
dos dcadas (1), de una edad promedio de
61,6 aos, registrada en los aos 80, hacia
una edad promedio que bordeara los 74,9
aos para el 2025 (3). Adems, a fnales
del ao 2004, la poblacin adulta mayor
representaba el 7,55% del total; se calcula
que para el ao 2025 sera del 13,27% (1).
Actualmente, nuestra poblacin adulta mayor
representa el 8,6% del total, de la cual el
7,2% son adultos mayores de 60 a 79 aos
y el 1.4% representa a aquellos de 80 aos
a ms. En relacin con el mbito geogrfco,
la proporcin de adultos mayores en el rea
rural es de 9,6%, en el rea urbana de 8,7%
y en Lima Metropolitana de 7,7%(4).
Por otra parte, lo que se observa paralelamente
con este cambio demogrfco es una
variacin en el patrn de las enfermedades,
de manera que las crnico-degenerativas,
dentro de las cuales se encuentra el deterioro
cognitivo, adquieren gran relevancia debido
a las consecuencias econmicas, sociales
(5) y, sobre todo, a las necesidades de salud
que surgirn (1). Esto es de gran importancia
en la poblacin adulta mayor, pues la
salud depende no solo de la presencia o
ausencia de enfermedad, sino tambin de la
capacidad del sujeto y de su entorno social
para adaptarse. Por ello, la necesidad de
realizar programas de seguimiento de salud
y bsqueda de aquellos pacientes con mayor
riesgo de presentar deterioro funcional pues,
como se observa en la prctica diaria, una
vez presente, este va progresando hasta la
aparicin de diferentes patologas, entre ellas
la fragilidad fsica y el deterioro cognitivo,
que al evolucionar predisponen a nuestros
adultos mayores a sufrir sus consecuencias,
principalmente la dependencia total, lo
que acarrea mayor estancia hospitalaria,
reingresos (6-7), discapacidad (8), e incluso
puede acelerar la muerte (9-10).
De forma preventiva, si identifcamos qu tan
asociada se encuentra la fragilidad fsica con
el deterioro cognitivo, la conducta teraputica
se basara en mejorar el proceso natural del
envejecimiento y en evitar que nuestros
adultos mayores se vuelvan fsicamente ms
frgiles, pues se ha observado que tanto la
fragilidad fsica (8, 11-13) como el deterioro
cognitivo son condiciones que se pueden
evitar o retrasar mediante intervenciones
adecuadas (14).
A medida que la esperanza de vida aumenta
a nivel mundial, las patologas propias de la
vejez irn incrementando su prevalencia, as
lo demuestra Alonso en su estudio realizado
en el ao 2007, en el que se recopilan
datos sobre la transicin demogrfca de
Latinoamrica y Cuba (2).
En tal sentido, varios autores han empezado a
investigar las asociaciones de las patologas
ms frecuentes en el adulto mayor para
mejorar los diagnsticos que se realizan en la
atencin primaria y as encaminar la direccin
hacia un accionar preventivo (2, 14). Hasta el
momento lo que sealan es que el deterioro
funcional se encuentra frecuentemente
asociado al deterioro cognitivo(15-16) y
que uno acarreara al otro y viceversa,
convirtindose ambos en marcadores para
presentar fragilidad fsica (14).
En relacin con el deterioro cognitivo y su
prevalencia, encontramos varios estudios, entre
ellos: el Estudio canadiense sobre salud y
envejecimiento, que reporta una prevalencia de
deterioro cognitivo (sin demencia) del 16,8% en una
poblacin mayor de 65 aos. Este estudio de tipo
multicntrico se realiz en 36 ciudades de cinco
regiones de Canad, con una muestra de 1.800
personas de la comunidad en cada regin y 250
personas institucionalizadas, todas seleccionadas
de forma aleatoria. La deteccin de pacientes con
deterioro cognitivo se realiz mediante el examen
del Mini-Mental (15). El Estudio longitudinal
italiano sobre el envejecimiento encuentra una
prevalencia del 10,7% en una muestra aleatoria
en ocho municipalidades italianas, en la que se
incluy a 3.425 personas (de la comunidad e
institucionalizadas) de entre 65 y 84 aos. En
este estudio de tipo transversal se emple el
examen del Mini-Mental para la deteccin de
deterioro cognitivo (16). En Estados Unidos, en el
trabajo presentado por Morris donde refere que
el deterioro cognitivo representa la primera etapa
62 Cientfca 8 (1), 2011
Mara Luisa Tello Garca
T
E
S
I
S
de la enfermedad de Alzheimer, se encuentra
una prevalencia del 28% en mayores de 65
aos. Este estudio de tipo clnico, prospectivo y
psicomtrico se realiz en personas voluntarias
de la comunidad. Se incluy a 177 personas
cognitivamente sanas y a 277 con deterioro
cognitivo leve. Se realiz un seguimiento de
hasta 9 aos, y para la deteccin de deterioro
cognitivo se utiliz la escala de evaluacin clnica
de demencia (17).
En Cuba, Gmez, mediante un estudio
de tipo descriptivo-prospectivo, en el que
incluy a 286 personas mayores de 65
aos pertenecientes a 3 consultorios de
un policlnico en el municipio de Playa
de Ciudad de La Habana, encontr
una prevalencia del 9,4% mediante el
Minimental State de Folstein (5). En el caso
del Per, Varela describe para el ao 2004,
una prevalencia de deterioro cognitivo de
22,11% en su estudio de tipo descriptivo
y de corte transversal, con una muestra
de 400 pacientes, mayores de 60 aos o
ms, internados en el servicio de medicina
interna de diferentes hospitales del pas en
tres regiones naturales, en el que se us el
mtodo de muestreo por clusters. Para la
valoracin del deterioro cognitivo se emple
el test de Pfeiffer (18), pero luego, en el ao
2008, se encontr una prevalencia del 14,2%
en un nuevo estudio de tipo descriptivo,
transversal con una muestra de 246 personas
mayores de 60 aos no institucionalizadas
de Lima Metropolitana reclutadas mediante
muestreo probabilstico, en el que tambin
se emple el test de Pfeiffer (19).
Los datos obtenidos indican que el deterioro
cognitivo est presente en un considerable
porcentaje de la poblacin adulta mayor, lo
que conllev a que se estudie ms el proceso
evolutivo del deterioro cognitivo y todas sus
asociaciones con estas personas. Es as
que algunos autores sealan que el sexo
femenino presenta mayor riesgo de padecer
discapacidad mental (5); al respecto, se han
formulado varias hiptesis, entre ellas que
la disminucin de los niveles de estrgeno
que ocurre en la posmenopausia puede
incrementar el deterioro cognitivo, pues
estos suelen tener un papel protector
(20). Por otra parte, Katzman sugiere que
las personas con alto nivel de educacin
tienen menor riesgo de presentar deterioro
cognitivo, segn expresa en su concepto
de reserva neuronal, donde plantea que
aquellos individuos educados poseen
mayores sinapsis corticales que los iletrados
y estn ms capacitados para hacer frente
al deterioro causado por la prdida neuronal
caracterstica del envejecimiento (21).
La fragilidad, por su parte, es un concepto
que cada vez cobra ms importancia
en la geriatra, considerada como un
sndrome heterogneo y multifactorial en
el que numerosas caractersticas como el
metabolismo (composicin corporal), los
componentes psicolgicos (por ejemplo,
fatiga) y la funcin fsica (deterioro de la
fuerza y de la marcha), han sido referidos por
muchos investigadores como componentes
bsicos para la clasifcacin de personas
mayores frgiles (22-23). Hablando
especfcamente sobre la fragilidad fsica, se
observa que es una condicin muy frecuente
en personas de edad avanzada y se cree que
representa una disminucin de la reserva
fsiolgica asociada al envejecimiento y
que vuelve vulnerable, a quien la padece,
de sufrir efectos adversos contra la salud
(24), como son las cadas, discapacidades,
hospitalizaciones y muerte en el adulto
mayor (23-26).
A raz de estos descubrimientos, en los ltimos
15 aos el inters por la fragilidad fsica ha
ido en aumento (27). Si en los aos 60-70 se
iniciaron las bases de la evaluacin del adulto
mayor y en los 80 se demostr la utilidad de la
valoracin geritrica integral, en la dcada de
los 90 el inters se concentra en la evaluacin
de la fragilidad en todos sus aspectos (28).
As pues, la fragilidad fsica, ya es considerada
un problema de salud pblica, por lo que se
han realizado varios estudios a nivel mundial
para establecer su prevalencia (29). En
Francia, vila-Funes et al. publicaron en el
ao 2008 un estudio en el que se estim la
prevalencia de fragilidad fsica en adultos
mayores de 65 aos de Bordeaux, Dijon y
Montpellier aplicando los criterios de Fried
ligeramente modifcados, en el que obtienen
un 7% como resultado (30).
De acuerdo con Santos-Eggimann, quien
public en el ao 2009 los resultados de
un estudio extraordinario en 10 pases de
Europa, la prevalencia asciende hasta un
17% con variaciones del 5,8% para Suiza
y del 27,3% para Espaa (31). As mismo,
en Estados Unidos se han realizado varias
revisiones, como el Estudio de salud
cardiovascular en una poblacin mayor
de 65 aos, obteniendo como prevalencia
de fragilidad fsica un 4,9% en hombres y
7,3% en mujeres; otras investigaciones son
el Estudio de fracturas osteoporticas en
hombres, con una poblacin de 65 aos de
edad en promedio, en el que la prevalencia
fue del 4%, y el Estudio de iniciativa en la
salud de la mujer, con una poblacin de entre
65 y 79 aos de edad, donde la prevalencia
62 Cientfca 8 (1), 2011 63 Cientfca 8 (1), 2011
Fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores del Centro Geritrico Naval, Callao,
Per 2010
fue de un 16,3% (29). En Latinoamrica,
Alvarado realiz en el ao 2008 un estudio
en siete ciudades para evaluar la prevalencia
de fragilidad fsica en una poblacin mayor
de 60 aos, cuyo resultado oscila entre el
26,7% en la ciudad de Bridgetown y el
42,6% en Santiago de Chile (32). Para el
Per, de acuerdo con Varela, quien public
en el 2008 un estudio con una poblacin de
246 personas mayores de 60 aos en Lima
Metropolitana, la prevalencia de fragilidad
fsica llega hasta el 7,7% aplicando los
criterios de Fried (19).
METOdOlOGa
Se realiz un estudio de tipo transversal
y analtico, en el que se tom una muestra
de adultos mayores militares, en actividad
laboral y en retiro, pertenecientes a la Marina
de Guerra del Per y a sus cnyuges durante
los meses de noviembre y diciembre del ao
2010 del Centro Geritrico Naval en Callao,
Per. Se les aplic un cuestionario sobre
datos sociodemogrfcos y diferentes signos y
sntomas que ayudaron a realizar la deteccin
de fragilidad fsica, deterioro cognitivo y otras
enfermedades. Nuestra variable dependiente
fue la presencia de fragilidad fsica, mientras
que nuestras variables independientes fueron
la presencia de deterioro cognitivo y de
factores sociodemogrfcos.
Se asumi que la prevalencia de fragilidad
fsica era del 56%, segn Goicochea, en su
estudio realizado en el ao 2008 (33), con una
precisin del 5% y tomando una poblacin
infnita. De acuerdo con este dato, se invit a
un total de 592 personas escogidas de forma
aleatoria de la base de datos de la Marina de
Guerra del Per, se incluy a todas aquellas
personas mayores de 60 aos que desearon
participar y fueron capaces de responder
y realizar los tests y se excluy a aquellos
que mostraron respuestas negativas para su
participacin en el estudio, siendo en total
217 personas excluidas; as mismo, otras
32 no fueron incluidas al reportar que no
contaban con medios para trasladarse al
Centro Mdico Naval (26 personas tenan los
datos de telfono y/o direccin incorrectos,
cinco personas pertenecan al programa
de Visita Domiciliaria, y una se encontraba
hospitalizada), quedndonos fnalmente con
una muestra de 311 personas. Adems, de
las caractersticas ya mencionadas, cabe
recalcar que eran adultos mayores de 60
aos y, en su mayora, personal ya retirado.
El porcentaje de personas que se perdi
no afect a la muestra fnal y los criterios
de exclusin tampoco infuyeron sobre el
nmero de la muestra. Si se hubiese incluido
a aquellas personas que no participaron, es
probable que las frecuencias obtenidas se
hubieran incrementado.
Se utiliz una muestra aleatoria simple de la
base de datos de la Marina de Guerra del
Per, se tom a los militares en actividad
laboral y en retiro, as como esposas mayores
de 60 aos. Luego se les inform mediante
una carta personal (mensaje naval) y se les
cit por medio de una llamada telefnica.
Una vez que acudieron al Centro Geritrico
Naval, se les ley el consentimiento
informado y se procedi al llenado del
mismo, luego se empez con la recoleccin
de datos generales como sexo, edad, estado
civil, antecedentes, medicacin, grado,
aos de retiro, etc., y, fnalmente, se aplic
el test de Barthel para evaluar el estado
funcional, clasifcando a cada paciente como
independiente, dependiente leve, moderado,
grave o dependiente total.
La segunda prueba realizada fue la escala de
Edmonton, en la que el primer tem (test del reloj)
y el test de Pfeiffer se realizaron para determinar
deterioro cognitivo, un test independiente del
otro, y se clasifc como presencia de deterioro
o no presencia de deterioro. Finalmente, se
emple el ltimo tem de la escala de Edmonton
(test de Up and Go) para determinar fragilidad
fsica. Su puntuacin indic presencia de
fragilidad fsica o no presencia de fragilidad
fsica. Un residente del Centro Geritrico
Naval y una interna de medicina realizaron
la recoleccin de datos con respecto a
medidas antropomtricas, valoracin, escalas
geritricas, as como la recoleccin de datos
generales. Adems, recibieron una charla sobre
tica para proteccin de sujetos humanos en
investigacin.
La informacin se ingres y analiz en una
base de datos codifcada para hallar la
asociacin entre fragilidad fsica y deterioro
cognitivo mediante la prueba de Chi
2
. Se
consider un p signifcativo menor de 0,05.
Se utiliz el programa de Stata11 para
realizar el anlisis de datos.
rESUlTadOS
Entre los meses de noviembre y diciembre del
2010 se evaluaron a 311 pacientes mayores
de 60 aos de la poblacin de la Marina de
Guerra del Per. La frecuencia encontrada
de fragilidad fsica en nuestra poblacin fue
107 personas (34,4%), de acuerdo al test
de Up and Go, y la frecuencia de deterioro
cognitivo fue de 101 personas (32,50%) de
acuerdo al Test del Reloj, y de 31 personas
(10%) de acuerdo al Test de Pfeiffer.
64 Cientfca 8 (1), 2011
Mara Luisa Tello Garca
T
E
S
I
S
La poblacin de estudio, las caractersticas
sociodemogrfcas y los resultados se
describen en la Tabla 1.
El promedio de edad de los pacientes fue
de 70 a 80 aos [n= 127 (40,8%)], y en su
mayora varones [n= 185 (59,5%)]. Aunque
231 personas (74,3%) se encontraban
casadas, 260 personas (83,6%) reportaron
que vivan solas. En relacin con el grado
militar, casi la mitad de personas era personal
subalterno [n= 159 (51,1%)] y se encontraba
en situacin de retiro por ms de 21 aos
[n= 153 (49,2%)]. La gran mayora contaba
con estudios superiores [n= 272 (87,5%)].
Con respecto al estado de salud reportado,
poco menos de la mitad [n= 108 (34,7%)]
manifest tener una buena condicin de
salud, mientras que un pequeo porcentaje
[n= 38 (12,2%)] afrm tener un estado de
salud excelente y un menor porcentaje an
[n= 19 (6,1%)] manifest tener un estado de
salud malo. Al evaluar el nmero de cadas y
hospitalizaciones en el ltimo ao, el estudio
revel que 145 personas (46,6%) haban
sufrido de una a dos cadas, y que 140 (45%)
haban sido hospitalizadas de 1 a 2 veces o,
en el mejor de lo casos, no haban requerido
hospitalizaciones en el ltimo ao. Para el peso
y la talla, encontramos una predominancia
de peso entre 51 y 70 kilos [n= 173 (55,6%)];
la talla con mayor frecuencia se encontraba
entre 1,61 cm y 1,65 cm [n= 82 (24,6%)].
Adems, al evaluar el grado de dependencia
de las personas, hallamos que 275 personas
(88,4%) eran totalmente independientes,
mientras que solo cuatro personas (1,3%)
eran personas totalmente dependientes.
Finalmente, en el anlisis bivariado realizado
mediante la prueba de chi2, observamos
que el sexo masculino tuvo una mayor
asociacin con fragilidad fsica (p= 0,003);
as mismo, mientras ms aument la edad
de la persona ms propensa se encontraba
a presentar fragilidad fsica, (p= <0,001),
y, consecuentemente, aquella persona
que tuvo mayor dependencia era ms
propensa a dicha condicin (p= 0,002).
Adems, se demostr que tanto el test
del reloj como el test de Pfeiffer (ambos
utilizados para detectar deterioro cognitivo
independientemente uno del otro) estuvieron
asociados con fragilidad fsica segn el Ttest
de Up and Go (p= <0,001).
dISCUSIN
Con respecto a la frecuencia de fragilidad
fsica, hallamos que menos de la mitad de los
participantes presentaron dicha condicin;
con respecto a la frecuencia de deterioro
cognitivo encontramos dos valores muy
equidistantes, debido a que cuando se
emple el Test del Reloj, se incluyeron incluso
a aquellas personas con errores mnimos,
aumentando as la proporcin, mientras
que cuando se emple el Test de Pfeiffer, el
resultado mostr a las personas con estadios
ms avanzados de deterioro cognitivo.
Los resultados sobre los factores asociados
estudiados nos brindaron datos interesantes;
por ejemplo, un poco ms de la mitad de
los participantes eran varones y la edad
promedio fuctuaba entre 70 y 80 aos. Un
gran porcentaje de personas reportaron
estar casados, pero actualmente vivan
solos, casi equitativamente eran personal
subalterno y personal civil; y del total, la gran
mayora contaba con estudios superiores,
pero tena ms de 21 aos en situacin
de retiro. Encontramos una frecuencia de
1 a 2 cadas al ao e igualmente de 1 a 2
hospitalizaciones al ao. Tambin hubo un
gran porcentaje de personas que gozaban
de independencia total para las actividades
de la vida diaria. Y, como mencionamos
en nuestra hiptesis, encontramos una
asociacin estadsticamente signifcativa
entre fragilidad fsica y deterioro cognitivo.
La frecuencia obtenida por nosotros
(expresada como prevalencia) para fragilidad
fsica fue casi cinco veces ms alta que la
reportada para el Per el ao 2008 (19); a su
vez, relativamente ms alta que la encontrada
en Estados Unidos (29) y en pases
europeos (30-31). Por el contrario, a nivel
de Latinoamrica las cifras nos mantienen
dentro del promedio encontrado (32). Esto
se debe a que nuestra organizacin, y la de
Latinoamrica, en cuestin de servicios en
salud an no evolucionan hacia la prevencin
de enfermedades (34-36), situando al Per
como un pas de desarrollo intermedio a nivel
mundial cuando se habla de indicadores de
calidad de vida (1), mientras que en pases
desarrollados la prevalencia no sobrepasa
el 20% de su poblacin (29-31). Cabe
recalcar nuestra utilizacin del test de Up
and Go, que demostr su gran utilidad para
detectar riesgos de cadas y fragilidad fsica
(37-40), ya que existe relacin directa entre
trastornos del equilibrio y/o de la marcha y el
desenvolvimiento mecnico para presentar
dicha condicin (12-13, 41-43).
Con respecto al deterioro cognitivo, debemos
tener en cuenta la variedad de herramientas
utilizadas para su deteccin. En nuestro caso,
utilizamos dos mtodos diferentes incluidos
en la valoracin geritrica integral frente a
pruebas de tipo Gold Standard utilizadas
64 Cientfca 8 (1), 2011 65 Cientfca 8 (1), 2011
Fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores del Centro Geritrico Naval, Callao,
Per 2010
en la bibliografa. Por tal motivo, los valores
varan mucho entre estudios, encontrndose
en general por debajo del 30%.
A pesar de no haber utilizado pruebas
especfcas, pudimos comprobar el gran
valor predictivo del Test del Reloj y del Test
de Pfeiffer, aunque ambos se caracterizan
por ser de tipo no diagnsticas, sino de tipo
cribado. La utilidad de la primera se centra
en detectar sntomas precoces, mientras
que la segunda sirve para detectar estadios
moderados a severos, para el seguimiento
del paciente y, adems, para determinar
cronicidad. Por esta razn, la frecuencia
(tambin medida como prevalencia)
aument con el Test del Reloj al detectar
probables casos de deterioro cognitivo
leve y ms an habindose incluido a
los pacientes con errores menores. El
factor etiolgico del deterioro cognitivo en
cada paciente puede deberse a causas
secundarias y potencialmente reversibles,
entre ellas depresin, hipotiroidismo, etc. Es
muy importante que en el futuro se realicen
estudios en nuestra poblacin acerca del
impacto que origina la prevencin de estas
patologas sobre deterioro cognitivo y
fragilidad fsica.
En relacin con los datos sociodemogrfcos,
los utilizados en nuestro estudio estn
incluidos dentro de los ms estudiados
con fragilidad fsica (2). A pesar de que
nuestros resultados no tuvieron signifcancia
estadstica con respecto al estado civil
y el grado de instruccin, la bibliografa
considera que el vivir solo y el contar con un
bajo nivel de educacin est asociado a la
presencia de fragilidad fsica (44), y mientras
por una parte coincidimos con que la edad
s est asociada a fragilidad fsica (8, 19, 23,
45), por otra parte, nuestros datos reportan
que el sexo masculino era el ms propenso a
esta condicin, demostrado por el test de Up
and Go. As tambin lo demuestra Thrane en
un estudio del ao 2007, donde encuentra
asociacin entre la historia de cadas y el
sexo masculino con una participacin de
414 hombres y 560 mujeres (39). Los dems
estudios indican que defnitivamente, la
mujer es ms susceptible (24, 31, 46), y,
aunque no se cuente con el factor etiolgico,
se habla de condiciones hormonales, masa
muscular, historia diettica, entre otros (32,
47). Por otra parte, nuestros resultados de
peso y talla tampoco se vieron asociados con
fragilidad fsica, pero la literatura demuestra
que el estado de salud del adulto mayor con
respecto a estos dos parmetros s es de
gran importancia al asociar, por ejemplo, la
obesidad con un mayor riesgo de padecer
fragilidad fsica (48); por tal motivo, se han
realizado estudios que comprueban que la
disminucin de peso mejora la supervivencia
del adulto mayor (49), incluso se ha medido
la circunferencia del brazo como ndice de
estado de salud y se ha observado una
importante relacin con el estado funcional
y la sobrevivencia en el adulto mayor (50).
Estos datos, no tan homogneos con otros
estudios, pueden deberse a que la poblacin
estudiada es particular: la mayora de
varones son militares retirados, el total de
mujeres son madres, esposas o suegras de
marinos retirados, por lo cual no se pueden
extrapolar totalmente los hallazgos a la
poblacin general, pues en ningn estudio
utilizado como referencia se utiliza una
poblacin relacionada con la milicia.
Nuestros hallazgos sobre la frecuencia de
cadas y hospitalizaciones tampoco fueron
sufcientemente signifcativos a pesar de que
los resultados en otros estudios demuestran
que las cadas, consecuencia de cualquier
acontecimiento que precipite al anciano
al suelo, deterioran la independencia
funcional (47, 51) y tienen una alta relacin
signifcativa (23, 25-27), adems se ha visto
que la mortalidad disminuye en aquellos
ancianos con bajo riesgo de hospitalizacin
reciente y que los reingresos en los ancianos
desencadenan o aumentan el riesgo de
fragilidad fsica (52-53). Existe una posibilidad
de que, por el tamao de la muestra, no
se haya logrado un poder estadstico para
replicar resultados de otros estudios.
En nuestros ltimos resultados, observamos
que la fragilidad fsica se encontr asociada
al deterioro cognitivo en nuestra poblacin
(15-16, 24-25, 54); as se demuestra tambin
en muchos pases (55-57) donde concluyen
que el deterioro cognitivo es un determinante
importante del estado funcional (58).
Cuando se han evaluado pacientes con esta
condicin previa, los rendimientos en las
pruebas para determinar fragilidad fsica han
sido totalmente desfavorables (39, 59-60).
66 Cientfca 8 (1), 2011
Mara Luisa Tello Garca
T
E
S
I
S
CONClUSIONES
Hay asociacin estadstica entre fragilidad
fsica y deterioro cognitivo.
Tanto la edad como el grado de dependencia
del adulto mayor se encuentran estrechamente
relacionados con la fragilidad fsica.
Adems, tambin es posible concluir que
tanto las personas de sexo masculino como
las personas con algn grado militar se
encuentran asociadas con la fragilidad fsica.
aGradECIMIENTO
Al Dr. Fenando Runzer Colmenares por su
confanza y apoyo.
Al Dr. Christian Loret de Mola por brindar su
tiempo y conocimientos para la elaboracin
de este trabajo.
A todos los que me alentaron a continuar y
lograr una meta muy importante.
rEFErENCIaS BIBlIOGrFICaS
1. Varela L, Chvez H, Herrera A, Mndez F, Glvez M. Perfl del adulto mayor. Lima: INTRA II, 2004.
2. Alonso Galbn P, Sans Soberats FJ, Daz-Canel Navarro AM, Carrasco Garca M, Oliva T.
Envejecimiento poblacional y fragilidad en el adulto mayor. Revista Cubana de Salud Pblica 2007;
33.
3. INEI. Instituto Nacional de Estadstica e Informtica Censo 2005. Encuesta Continua. Lima. 2005.
4. INEI. Encuesta Nacional de Hogares ENAHO continua. 2004-2010.
5. Gmez Viera N, Bonnin Rodrguez BM, Gmez de Molina Iglesias MT, Ynez Fernndez B,
Gonzlez Zaldvar A. Caracterizacin clnica de pacientes con deterioro cognitivo. Revista Cubana
de Medicina 2003; 42: 12-7.
6. Hervs A, Garca de Jaln E. Situacin cognitiva como condicionante de fragilidad en el anciano:
Perspectiva desde un centro de salud. Anales del Sistema Sanitario de Navarra 2005; 28: 35-47.
7. Weiler PG, Lubben JE, Chi I. Cognitive impairment and hospital use. Am J Public Health 1991;
81(9): 1153-7.
8. Hardy SE, Dubin JA, Holford TR, Gill TM. Transitions between states of disability and independence
among older persons. Am J Epidemiol 2005; 161(6): 575-84.
9. Covinsky KE, Eng C, Lui LY, Sands LP, Yaffe K. The last 2 years of life: functional trajectories of frail
older people. J Am Geriatr Soc. 2003; 51(4): 492-8.
10. Frisoni GB, Fratiglioni L, Fastbom J, Viitanen M, Winblad B. Mortality in nondemented subjects
with cognitive impairment: the infuence of health-related factors. Am J Epidemiol. 1999; 150(10):
1031-44.
11. Gill TM, Baker DI, Gottschalk M, Peduzzi PN, Allore H, Byers A. A Program to Prevent Functional
Decline in Physically Frail, Elderly Persons Who Live at Home. New England Journal of Medicine
2002; 347(14): 1068-74.
12. Buchner DM, Wagner EH. Preventing frail health. Clin Geriatr Med. 1992; 8(1): 1-17.
13. Chandler JM, Hadley EC. Exercise to improve physiologic and functional performance in old age.
Clin Geriatr Med. 1996; 12(4): 761-84.
14. Black SA, Rush RD. Cognitive and functional decline in adults aged 75 and older. J Am Geriatr Soc.
2002; 50(12): 1978-86.
15. Graham JE, Rockwood K, Beattie BL, Eastwood R, Gauthier S, Tuokko H, et al. Prevalence and
severity of cognitive impairment with and without dementia in an elderly population. Lancet. 1997;
349(9068): 1793-6.
16. Di Carlo A, Baldereschi M, Amaducci L, Maggi S, Grigoletto F, Scarlato G, et al. Cognitive impairment
without dementia in older people: prevalence, vascular risk factors, impact on disability. The Italian
Longitudinal Study on Aging. J Am Geriatr Soc. 2000; 48(7): 775-82.
17. Morris JC, Storandt M, Miller JP, McKeel DW, Price JL, Rubin EH, et al. Mild cognitive impairment
represents early-stage Alzheimer disease. Arch Neurol. 2001; 58(3): 397-405.
66 Cientfca 8 (1), 2011 67 Cientfca 8 (1), 2011
Fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores del Centro Geritrico Naval, Callao,
Per 2010
18. Varela-Pinedo L, Chvez-Jimeno H, Herrera-Morales A, Ortiz-Saavedra P, Chigne-Verstegui O.
Valoracin geritrica integral en adultos mayores hospitalizados a nivel nacional. Diagnstico.
2004; 43(2).
19. Varela-Pinedo L, Ortiz-Saavedra PJ, Chvez-Jimeno H. Sndrome de fragilidad en adultos mayores
de la comunidad de Lima Metropolitana. Rev Soc Peru Med Interna 2008; 21(1).
20. Bayarre HD, Tello Y, Hrnndez Y, Herrera H. Prevalencia de discapacidad mental en ancianos.
Municipios Amancio Rodrguez y Jobabo 1999. Rev Cubana Salud Pblica 2002; 28(2): 100-11.
21. Katzman R. Education and the prevalence of dementia and Alzheimer's disease. Neurology 1993;
43(1): 13-20.
22. Buchman A, Boyle P, Wilson R, Tang Y, Bennett D. Frailty is Associated With Incident Alzheimers
Disease and Cognitive Decline in the Elderly. Psychosomatic Medicine 2007; 69: 483-9.
23. Fried LP, Tangen CM, Walston J, Newman AB, Hirsch C, Gottdiener J, et al. Frailty in older adults:
evidence for a phenotype. J Gerontol A Biol Sci Med Sci 2001; 56(3): M146-56.
24. Boyle P, Buchman S, Wilson R, Leurgans S, Bennett D. Physical Frailty Is Associated with Incident
Mild Cognitive Impairment in Community-Based Older Persons. The American Geriatrics Society
2010; 58: 248-55.
25. Fried LP, Ferrucci L, Darer J, Williamson JD, Anderson G. Untangling the concepts of disability,
frailty, and comorbidity: implications for improved targeting and care. J Gerontol A Biol Sci Med
Sci. 2004; 59(3): 255-63.
26. Fabrcio-Wehbe SCC, Schiaveto FV, Vendrusculo TRP, Haas VJ, Dantas RAS, Rodrigues RAP.
Cross-cultural adaptation and validity of the "Edmonton Frail Scale - EFS" in a Brazilian elderly
sample. Revista Latino-Americana de Enfermagem. 2009; 17: 1043-9.
27. Rockwood K, Hogan DB, MacKnight C. Conceptualisation and measurement of frailty in elderly
people. Drugs Aging 2000; 17(4): 295-302.
28. Lluis Ramos GE, Llibre Rodrguez JdJ. Fragilidad en el adulto mayor: Un primer acercamiento.
Revista Cubana de Medicina General Integral. 2004;20:0-.
29. Abizanda Soler P. Update on frailty. Rev. Esp. Geriatr. Gerontol. 2010; 45(2): 106-10.
30. Avila-Funes JA, Helmer C, Amieva H, Barberger-Gateau P, Le Goff M, Ritchie K, et al. Frailty among
community-dwelling elderly people in France: the three-city study. J Gerontol A Biol Sci Med Sci.
2008; 63(10): 1089-96.
31. Santos-Eggimann B, Cuenoud P, Spagnoli J, Junod J. Prevalence of frailty in middle-aged and
older community-dwelling Europeans living in 10 countries. J Gerontol A Biol Sci Med Sci. 2009;
64(6): 675-81.
32. Alvarado BE, Zunzunegui MV, Beland F, Bamvita JM. Life course social and health conditions
linked to frailty in Latin American older men and women. J Gerontol A Biol Sci Med Sci. 2008;
63(12): 1399-406.
33. Goicochea R, Chian G. Estado de salud de los adultos mayores en el servicio 15 de la cartera de
atencin primaria del hospital I Albrecht ESSALUD. Noviembre 2006 a julio 2007. Revista Salud,
Sexualidad y Sociedad 2008; 2.
34. Chigne O, Varela L. Utilizacin de los servicios de hospitalizacin por pacientes geritricos y de
menor edad en el Hospital Nacional Cayetano Heredia. Rev Med Hered. 1999; 10: 111-8.
35. 35. Varela L, Chvez H, Herrera A, Ortiz P, Chigne O. Valoracin geritrica integral en adultos
mayores hospitalizados a nivel nacional. Diagnstico 2004; 43: 57-63.
36. 36. Varela L, Chvez H, Herrera A. INTRA III. Desarrollando respuestas integradas en sistemas
de salud en una poblacin en rpido envejecimiento. Lima: Instituto de Gerontologa UPCH-OPS/
OMS; 2005.
37. Podsiadlo D, Richardson S. The timed "Up & Go": a test of basic functional mobility for frail elderly
persons. J Am Geriatr Soc. 1991; 39(2): 142-8.
38. Shumway-Cook A, Brauer S, Woollacott M. Predicting the probability for falls in community-dwelling
older adults using the Timed Up & Go Test. Phys Ther. 2000; 80(9): 896-903.
39. Thrane G, Joakimsen R, Thornquist E. The association between timed up and go test and history
of falls: The Tromso study. BMC Geriatrics 2007; 7(1): 1.
40. Bergland A, Jarnlo GB, Laake K. Predictors of falls in the elderly by location. Aging Clin Exp Res.
2003; 15(1): 43-50.
68 Cientfca 8 (1), 2011
Mara Luisa Tello Garca
T
E
S
I
S
41. Campbell AJ, Buchner DM. Unstable disability and the fuctuations of frailty. Age Ageing 1997;
26(4): 315-8.
42. Chin APMJ, Dekker JM, Feskens EJ, Schouten EG, Kromhout D. How to select a frail elderly
population? A comparison of three working defnitions. J Clin Epidemiol. 1999; 52(11): 1015-21.
43. Ostir GV, Markides KS, Black SA, Goodwin JS. Lower body functioning as a predictor of subsequent
disability among older Mexican Americans. J Gerontol A Biol Sci Med Sci 1998; 53(6) M491-5.
44. Bolletta M, Cerezuela N, Coca M, Gonzlez P, Heim S, Orozco F. Prevalencia de los determinantes
de fragilidad en los adultos mayores de Baha Blanca. Baha Blanca (Brasil): Universidad Nacional
del Sur.
45. Varela LF, Ortiz PJ, Chavez HA. Velocidad de la marcha en adultos mayores de la comunidad en
Lima, Per. Rev Med Hered. 2009; 20(3): 133-8.
46. Mitnitski AB, Mogilner AJ, MacKnight C, Rockwood K. The mortality rate as a function of accumulated
defcits in a frailty index. Mech Ageing Dev. 2002; 123(11): 1457-60.
47. Nourhashemi F, Andrieu S, Gillette-Guyonnet S, Vellas B, Albarede JL, Grandjean H. Instrumental
activities of daily living as a potential marker of frailty: a study of 7364 community-dwelling elderly
women (the EPIDOS study). J Gerontol A Biol Sci Med Sci 2001; 56(7): M448-53.
48. Castaneda-Sceppa C, Price LL, Noel SE, Bassett Midle J, Falcon LM, KL. T. Physical function and
health status in aging puerto rican adults: the Boston puerto rican health study. J Aging Health.
2010; 22(5): 653-72.
49. Bales CW, GT. B. Body mass trajectory, energy balance, and weight loss as determinants of health
and mortality in older adults. Obes Facts 2009; 2(3): 171-8.
50. Landi F, Russo A, Liperoti R, Pahor M, Tosato M, Capoluongo E, et al. Midarm muscle circumference,
physical performance and mortality: Results from the aging and longevity study in the Sirente
geographic area (ilSIRENTE study). Clinical nutrition (Edinburgh, Scotland) 2010; 29(4): 441-7.
51. Arfken CL, Lach HW, Birge SJ, Miller JP. The prevalence and correlates of fear of falling in elderly
persons living in the community. Am J Public Health. 1994; 84(4): 565-70.
52. Applegate WB, Miller ST, Graney MJ, Elam JT, Burns R, Akins DE. A randomized, controlled trial
of a geriatric assessment unit in a community rehabilitation hospital. N Engl J Med. 1990; 322(22):
1572-8.
53. Solano JJ, Gutirrez J, Galeano R. La hospitalizacin como fuente de fragilidad en el anciano. Rev
Esp Geriatr Gerontol. 1997; 32:45-52.
54. Kose N, Cuvalci S, Ekici G, Otman AS, Karakaya MG. The risk factors of fall and their correlation
with balance, depression, cognitive impairment and mobility skills in elderly nursing home residents.
Saudi Med J. 2005; 26(6): 978-81.
55. Jurschik Gimenez P, Escobar Bravo MA, Nuin Orrio C, Botigue Satorra T. [Frailty criteria in the
elderly: a pilot study.]. Aten Primaria 2010 Sep 15.
56. McMichael KA, Vander Bilt J, Lavery L, Rodriguez E, Ganguli M. Simple balance and mobility tests
can assess falls risk when cognition is impaired. Geriatr Nurs. 2008; 29(5): 311-23.
57. Hernandez SS, Coelho FG, Gobbi S, Stella F. Effects of physical activity on cognitive functions,
balance and risk of falls in elderly patients with Alzheimer's dementia. Rev Bras Fisioter. 2010;
14(1): 68-74.
58. Sauvaget C, Yamada M, Fujiwara S, Sasaki H, Mimori Y. Dementia as a predictor of functional
disability: a four-year follow-up study. Gerontology 2002; 48(4):226-33.
59. Rockwood K, Awalt E, Carver D, MacKnight C. Feasibility and measurement properties of the
functional reach and the timed up and go tests in the Canadian study of health and aging. J Gerontol
A Biol Sci Med Sci. 2000; 55(2): M70-3.
60. Nordin E, Rosendahl E, Lundin-Olsson L. Timed "Up & Go" test: reliability in older people dependent
in activities of daily living-focus on cognitive state. Phys Ther. 2006; 86(5): 646-55.
68 Cientfca 8 (1), 2011 69 Cientfca 8 (1), 2011
Fragilidad fsica, deterioro cognitivo y factores asociados en adultos mayores del Centro Geritrico Naval, Callao,
Per 2010
!" "#$"%
!# &!$'%
&( )*$!%
#" +*$"%
" $'%
*$""'
+ *$*%
&(& !($"%
+ $*%
&'* !+$'% *$!'
& +$#%
*$&)
&+ ()$+%
"& '$(%
' "$ %
#* &!$#%
*$#!& '! & $#%
"+ )#$&%
+! &$&%
*$(!"
"! !$'%
*! +)$(%
!! &!$+%
# '$ %
"# " $ %
2 &) ($(%
( &! ) $&%
4 +( ))$ %
*$)+! )" )'$'%
&# #$+%
4 4 )* )"$*%
*$ )* )"$*%
+ *$*%
&+ ($)%
*$!!'
(+ ""$'%
'# &&$&%
)' )$!%
(# &"$)%
*$#)
(! &"$ %
!& &'$)%
(& &+$&%
) $+%
* *$*%
+ $*%
&# #$+%
&(" !!$)%
& * '($"%
!! &!$+%
+ )$&%
+ *$*%
&
aNExOS
mara luisa tello garca
correspondencia: marialuisa.t.g@hotmail.com
recepcin: 30/03/2011
aceptacin: 24/04/2011
favorece la concentracin de oxgeno) o
por Valle (que favorece la temperatura),
el enfoque analtico de la climatologa
humana moderna no puede proyectarse
sobre la admirable sntesis que los Incas
aplicaron al manejo de su problema
demogrfico en relacin al clima.
Tomemos, por ejemplo, algunos aspectos
de la medicina militar. Muy temprano en
la historia, los Incas descubrieron que los
soldados que nacan y se entrenaban en
las tierras altas del Per no podan tolerar
bien el clima de los valles costeos, las
yungas. Consecuentemente, nos dicen
muchos cronistas, cuando el Inca trataba
de conquistar las tribus de la costa,
prestaba especial atencin al cambio
peridico de sus ejrcitos para conservar
la salud de sus soldados. Quizs quien
describe mejor esta poltica climatolgica
aplicada a la milicia es Garcilaso quien,
entre muchos otros detalles anecdticos,
nos cuenta que cuando Pachactec decidi
llevar a cabo la conquista de la costa que
hasta su tiempo no haba llegado ms all
de Nazca, y despus de haber consultado
al Consejo Imperial, orden que 30,000
soldados partieran inmediatamente a esta
conquista y que otros 30,000 suplentes los
apoyasen desde la sierra, con objeto de
intercambiar los ejrcitos cada dos meses.
Esto lo haca dice Garcilaso, porque los
valles estaban llenos de enfermedades y
se hacan peligrosos para los que haban
nacido en las tierras altas. En su relacin de
esta campaa, el notable cronista mestizo
insiste en varias oportunidades sobre lo
mismo: Dice, por ejemplo, que despus de
que haba pasado dos meses, orden que
se cambiase el ejrcito ...antes de que el
temple de las tierras yungas les pudiera
hacer dao... (Pginas 169-170)
LA ENFERMEDAD y LoS DIoSES, EXTRACTo DE LA
ObRA la Salud y loS dioSeS DEL DR. FERNANDo
CABIESES (Ao 2007)
Sala CaBIESES
El Imperio del Tahuantinsuyo cubra un
territorio tan extenso y tan variado que para
los Conquistadores y aun para el turista
moderno apareca como un laberinto
de climas. Esto est bien descrito por
Pedro Pizarro, sobrino de don Francisco,
uno de los cronistas ms concisos y
fidedignos. Se maravilla este escritor de
tantas diferencias de clima en el territorio
conquistado. Describe las yungas, como
se les llamaba a los valles cercanos al
ocano: valles de tierra caliente, donde
no hay lluvia sino simplemente discreta
llovizna en el Invierno. Llovizna tan discreta
que no requiere del hombre la construccin
de casas sino simplemente chozas de
caa y totora. Pizarro recalca que cuando
es invierno en las yungas, es verano en
la sierra; y que esta diferencia de clima
puede sentirse caminando nicamente
una o dos leguas. Se cambia bruscamente
de clima lluvioso, o del invierno al verano
o viceversa.
Con mente analtica y cientfica, el hombre
moderno puede explicar estas variaciones
climticas sin mayores dificultades.
Inclusive ms de un autor de imaginacin
ligera ha tratado de proyectar dentro de las
mentes de los antiguos amautas conceptos
modernos sobre la significacin biolgica
de altura sobre el nivel del mar, de la
concentracin de oxgeno, la influencia
de la temperatura, humedad, insectos
portadores de enfermedades e inclusive
de horas-luz y radioactividad ambiental.
Estas explicaciones, sin embargo, no son
congruentes con el bagaje intelectual del
Antiguo Per. Podrn servir como base
para especulaciones sobre planeamiento
correcto de las migraciones futuras dentro
del territorio peruano e inclusive en todo el
mundo. Pero, quizs con la excepcin de
las teoras avanzadas por Monge (quien
70 Cientfca 8 (1), 2011
NOTaS
71 Cientfca 8 (1), 2011
Con la fnalidad de resaltar la comprometida labor que el Dr. Fernando Cabieses realiz como
presidente fundador y rector de la Universidad Cientfca del Sur, se realiz un homenaje donde se
destac su incansable trabajo, que lo llev a romper esquemas en la formacin acadmica de los
futuros mdicos peruanos basndose siempre en su flosofa: Una medicina humanizada que se
preocupa ms por la salud que por la enfermedad y que ve al enfermo integral e integradamente,
esa es la medicina del futuro.
El merecido homenaje se realiz en el marco del cambio de nombre de la Facultad de
Medicina de la Universidad Cientfca del Sur, que ahora, en honor al Dr. Cabieses, se llamar
Facultad de Medicina Humana Dr. Fernando Cabieses.
El evento se realiz en el Campus Villa I de la Universidad Cientfca del Sur, y cont con la
presencia de la Dra. Martha Villar, directora del Programa de Medicina Complementaria de
ESSALUD; el Dr. Alfonso Basurco, presidente de la Sociedad Peruana de Neurociruga; el
Ing. Jos Dextre Chacn, presidente del Directorio de la Cientfca del Sur y el Dr. Agustn Iza
Stoll, actual rector de la Universidad Cientfca del Sur, quienes expusieron sobre los diferentes
temas que apasionaban al Dr. Fernando Cabieses, como la investigacin y alcances de la
medicina alternativa y complementaria en el sistema de salud.
Con la fnalidad de establecer un Marco de Cooperacin Docente-Asistencial, la Universidad
Cientfca del Sur (UCSUR) y el Ministerio de Salud (MINSA), frmaron un convenio que tiene
una vigencia de cuatro aos.
El acuerdo tiene por objetivo establecer un marco de cooperacin entre la Universidad y el
Ministerio de Salud para la adecuada formacin y capacitacin de profesionales, orientada a
la atencin de los problemas prioritarios de salud de la poblacin.
Este convenio marco permitir a la UCSUR suscribir convenios especfcos con establecimientos
de salud pblicos, para el desarrollo de la docencia en servicio e investigaciones. De esta
manera, se busca regular el desarrollo de las acciones de la universidad durante los estudios
de pregrado y postgrado en los servicios de salud pblicos.
UNIvERSIDAD CIENTFICA DEL SUR y MINISTERIo DEL AMBIENTE
PREMIARN A EMPRESAS ECoEFICIENTES
La Universidad Cientfca del Sur y el Ministerio del Ambiente convocan, por tercer ao
consecutivo, a las micro y pequeas (MYPES), medianas y grandes empresas del pas, as
como a los jvenes emprendedores, a demostrar sus mejores prcticas de gestin ambiental
sostenible, a travs del Premio a la Ecoefciencia Empresarial 2011.
Este evento tiene la fnalidad de reconocer la iniciativa de las empresas por tomar medidas
ecoefcientes, orientadas a producir ms con menos y de esta manera reducir la contaminacin
ambiental, ser equitativos socialmente, al tiempo de crecer sosteniblemente.
Iniciativas como sistemas integrados de gestin ambiental, reutilizacin del agua, proyectos
de manejo de residuos slidos o proyectos de reforestacin como parte de una poltica
UCSUR y MINISTERIo DE SALUD FIRMAN CoNvENIo DE CooPERACIN
UCSUR REALIz HoMENAjE EN MEMoRIA DEL DR. FERNANDo
CABIESES
72 Cientfca 8 (1), 2011
N
O
T
A
S
La Universidad Cientfca del Sur ha frmado un convenio de cooperacin acadmica, cientfca
y cultural con la Universidad Estatal Mdica de Samara - Rusia para promocionar los estudios
de pre y postgrado de la Universidad y, tambin para establecer programas conjuntos de
investigacin cientfca y de educacin, promover la difusin de los conocimientos, experiencias,
inventos cientfcos y transferencia de nuevas tecnologas de la Universidad de Samara a Per.
Dentro de este marco, ambas universidades podrn realizar las siguientes formas de
cooperacin: actividades de investigacin conjuntas en temas de inters comn, intercambio
de informacin cientfca, intercambio de profesores, investigadores y estudiantes en los
campos de cooperacin que se establezcan, programas educativos y de capacitacin
(cursos, talleres, congresos, diplomados, etc.) conjuntos.
Nuestra institucin sigue ampliando sus socios globales a travs de la Ofcina de Relaciones
Internacionales y, con ello, brindando herramientas para su desarrollo institucional.
CoNvENIo CoN UNIvERSIDAD MDICA DE SAMARA
FACULTAD DE BIoLoGA MARINA y ECoNEGoCIoS PARTICIP EN
FERIA EXPoACUCoLA 2011
La Facultad de Biologa Marina y Econegocios de la Universidad Cientfca del Sur (UCSUR),
particip en la feria EXPOACUCOLA 2011, la segunda feria internacional especializada en
acuicultura, que se realiz entre el 3, 4 y 5 de marzo. El evento tuvo lugar en las instalaciones
de la fortaleza Real Felipe en el Callao.
La UCSUR se hizo presente en este evento con un stand de exhibicin en el que present la
maqueta del proyecto Calango junto a la propuesta educativa de la facultad.
La feria es conocida como la principal exhibicin internacional de tecnologas acucolas del
Per, cuyo objetivo es impulsar un mayor crecimiento del sector a travs de la adaptacin
de tecnologas y del intercambio de informacin con profesionales en el aspecto tcnico,
logstico y de investigacin, que permitir seguir potenciando el sector de forma slida y
segura.
Con esta iniciativa, la Universidad Cientfca del Sur invita a promover el desarrollo del sector
acucola en el pas, a travs de la colaboracin en eventos de tal envergadura y la exposicin
de proyectos que fortalezcan dicho sector.
ambiental empresarial, son algunas de las medidas reconocidas a travs de este premio.
Este ao, el Premio a la Ecoefciencia Empresarial 2011, en su proceso de convocatoria y difusin,
cuenta con el apoyo de la Cooperacin Internacional de Alemania GIZ y del Centro de Ecoefciencia
y Responsabilidad Social CER. El jurado califcador estar conformado por especialistas de
instituciones como el Ministerio del Ambiente, el Ministerio de Comercio Exterior y Turismo, el
Ministerio de la Produccin, el Ministerio de Agricultura, la Universidad Cientfca del Sur, el Colegio
de Ingenieros del Per, la Confederacin Nacional de Instituciones Empresariales y la Cmara de
Comercio de Lima.
Son cinco las categoras convocadas: ecoefciencia integral, ecoefciencia en agua,
ecoefciencia en energa, ecoefciencia en recursos naturales renovables y ecoefciencia en
residuos. De esta manera, conjuntamente con el Ministerio del Ambiente, la Universidad
Cientfca del Sur demuestra su vocacin de servicio al desarrollo del pas, reconociendo la
importancia de la conservacin del ambiente por los empresarios responsables.
Para cualquier informacin acerca del Premio a la Ecoefciencia Empresarial 2011, puede visitar
las pginas: www.minam.gob.pe y www.ucsur.edu.pe o enviar sus consultas a los correos:
premioecoefciencia2011@minam.gob.pe o premioecoefciencia2011@ucsur.edu.pe
El 4 de marzo de este ao una delegacin de instituciones acadmicas de China visit
nuestra universidad. Dicha delegacin cont con tres representantes: el Dr. Li Ming, director
del Instituto de Investigacin de Energa Solar y decano de la Escuela de Energa y Ciencia
Ambiental; el Dr. Peng Zenghua, vicepresidente de la Universidad Kunming de Ciencias y
Tecnologa, y el profesor Dr. Li Ren, vicepresidente de la Universidad de Yunnan de Ciencias
y Tecnologa.
En ese primer encuentro, con moderacin del Vicerrectorado de Investigacin y con la
participacin de decanos y directores de la UCSUR, se intercambi informacin sobre
posibles proyectos conjuntos, adems de explorarse temas de investigacin en energas
renovables y el aprendizaje del chino como modo de aproximacin cultural y econmica.
Fue, por tanto, una reunin productiva y de expansin del crculo internacional de la
universidad.
La Ofcina de Relaciones Internacionales de la Universidad Cientfca del Sur contina
impulsando las redes de contacto necesarias y de trabajo con pases aliados para proyectar
aspiraciones acadmicas conjuntas.
73 Cientfca 8 (1), 2011
Notas
Un libro recientemente editado, original, analtico y muy ilustrado, que ya se est difundiendo
entre nuestros profesionales de la salud, cientfcos y periodistas es La Noticia Mdico-
Cientfca. Anotaciones para su transmisin.
Su autor, el doctor Guillermo Quiroz Jara, distinguido acadmico de nmero de la Academia
Nacional de Medicina, es un mdico que mostr siempre sus inquietudes por la expresin
escrita en los medios de comunicacin. Conjuntamente con el doctor Nelson Ral Morales
asumieron la responsabilidad de editar una revista que transmitiera conocimientos mdico-
cientfcos, y que se constituy en la base de la revista Diagnstico, prestigiada publicacin
mdica de la Fundacin Instituto Hiplito Unanue, de cuyo comit editorial son a la fecha
miembros.
El Dr. Quiroz plasma en esta obra su preocupacin, versatilidad y experiencia en el tema.
Desarrolla con amplitud y conocimiento los aspectos ms importantes de la transmisin de
los conceptos mdico-cientfcos, de sus investigaciones, su escenario, la profundizacin
farmacolgica, la utilizacin de los placebos en el diseo y ejecucin de los estudios clnicos
que permiten el nacimiento de nuevas drogas.
Igualmente, la extensin de la noticia mdica y su tratamiento por el periodismo especializado,
comentario que lo hace siempre con el espritu positivo que lo caracteriza, y destacando
los aportes favorables a la salud, el bienestar y progreso, sin dejar de analizar lo que es
inconveniente o negativo para la poblacin en general.
PUBLICACIN DE la noticia Mdico-cientfica
DELGACIN DE INSTITUCIoNES ACADMICAS DE CHINA vISITA LA
UNIvERSIDAD CIENTFICA DEL SUR
CoMENTARIoS DE LIBRoS
INFOrMaCIN
para lOS aUTOrES
74 Cientfca 8 (1), 2011
La revista Cientfca, editada por la
Universidad Cientfca del Sur, tiene como
objetivo promover el avance de la ciencia
y la tecnologa en las diversas reas del
conocimiento, ciencias formales, naturales
y tecnologa. Est orientada a investigadores
cientfcos, docentes, estudiantes universitarios
y, en general, a todos aquellos que crean y
aplican el conocimiento cientfco.
Cientfca publica trabajos originales e inditos
de carcter cientfco y tecnolgico en el campo
de las ciencias. Acepta, preferentemente,
trabajos que expresen resultados valiosos,
producto de la investigacin cientfca bsica
o aplicada; as como los de divulgacin
que, por su importancia y claridad de
exposicin, constituyan material valioso para
fnes docentes. Pueden incluirse trabajos
presentados a congresos cientfcos, pero no
publicados por sus organizadores u otros.
Tambin se aceptarn artculos de revisin
de hasta aproximadamente 12 pginas,
cartas al editor con una extensin no mayor
de 10 pginas, as como notas informativas
relacionadas con el quehacer en el rea de
la investigacin.
Los artculos propuestos para su publicacin
en la revista sern remitidos adjuntando el
currculum vitae resumido del autor, con
telfonos, correo electrnico y direccin
postal. El Comit Editor asignar el texto
propuesto a uno o dos rbitros externos o
internos para su evaluacin. Estos rbitros
remitirn su opinin dentro de los 30 das
calendario siguientes. De haber controversia,
el Comit Editor tendr facultad dirimente,
en un plazo de 15 das ms.
Los trabajos y otros artculos a publicar
sern remitidos con carta a nuestro Director,
frmada por todos los autores y coautores en
original y copia, y adems deber entregarse
el texto del artculo, incluidas tablas y
fguras, en disquete, disco compacto, USB o
remitidas por correo electrnico, de acuerdo
con las siguientes caractersticas:
1. El texto completo debe estar escrito
en formato Microsoft Word; tamao de
pgina A4; mrgenes izquierdo, derecho
y superior de 3 cm, inferior de 2 cm,
espacio 1,5; fuente Times New Roman;
estilo de fuente regular y tamao 12. Se
imprimir de manera vertical. Para todo
el texto, excepto el ttulo, deber usarse
la opcin justifcar. El ttulo deber
centrarse.
2. Los idiomas de publicacin son dos:
espaol e ingls.
3. Los nombres de los autores, con
numeracin colocada como superndice,
van despus del ttulo. Por esta
numeracin, al pie de pgina se indicar
la institucin, facultad o departamento
al que pertenecen los autores. Uno de
los autores agregar su direccin postal
o correo electrnico.
4. El ttulo del artculo se consignar en
espaol, primero, y luego en ingls.
Adems, se presentarn dos resmenes,
uno en espaol y otro en ingls (abstract)
con extensin entre 100 y 250 palabras.
Despus de cada resumen se debern
incluir entre tres y seis palabras clave
(en espaol e ingls).
5096 PORTADA REVISTA CIENTIFICA.pdf 1 10/22/11 10:23 AM
75 Cientfca 8 (1), 2011
Informacin para los Autores
5. Para los artculos originales se recomienda que
el texto desarrolle las siguientes secciones:
I. INTRODUCCIN, II. MATERIALES
Y MTODOS, III. RESULTADOS, IV.
DISCUSIN, V. AGRADECIMIENTOS y VI.
REFERENCIAS BIBLIOGRFICAS.
6. Las tablas y fguras deben ser originales.
No deben denominarse cuadros o
grfcos y, en caso de tomarse de otra
fuente se indicar claramente el libro
o artculo en el que se han publicado
inicialmente; adems, se acreditar
haber recibido autorizacin expresa
para su publicacin. Deben tener
numeracin secuencial arbiga seguida
de punto (en negritas). A continuacin,
se coloca la leyenda que explique su
signifcado. La leyenda de una tabla se
coloca en la parte superior, a diferencia
de las fguras, en las que se la ubica en
la parte inferior. Tablas y fguras debern
insertarse apropiadamente en el texto
mismo. No en un anexo.
7. Las referencias bibliogrfcas se harn
segn la Convencin de Vancouver
por orden de aparicin, con un mximo
de 20 referencias. Los libros, segn
la secuencia: autores, ttulo, nmero
de edicin, editorial, lugar de edicin,
fecha, volumen y pginas. Cuando
los libros son compilados por un
editor y contienen captulos escritos
por diversos autores se harn por:
autor(es), ttulo, editor, N de edicin
y volumen, si los hubiera; nombre del
libro, lugar de edicin, fecha y pginas.
Las menciones a revistas se harn por
autor(es), ttulo del artculo, nombre de la
revista, ao de la publicacin, volumen
y, opcionalmente, N de la revista;
y, fnalmente, pginas del artculo en
referencia. Las tesis se citarn por autor,
ttulo de la tesis, grado o ttulo profesional
al que se opta, universidad, lugar y
pginas. Las pginas web se citan como
se ha indicado para revistas en general,
pero debern incluir necesariamente la
organizacin responsable de la pgina
web, la direccin electrnica subrayada
y, entre parntesis, la fecha ms reciente
de acceso.
Se pueden incluir comentarios a pie de
pgina, pero no bibliografa. Esta ltima se
ubicar al fnal, en la seccin Referencias.
Los autores deben indicar claramente el
correo que aparecer en la revista y al
que debern dirigirse los lectores para
comentarios, consultas y observaciones.
Los artculos, de acuerdo con lo antes
indicado, sern remitidos por correo
electrnico o entregados personalmente en
USB, CD o disquete.
Los autores de los trabajos publicados son
los nicos responsables de la autenticidad
del artculo y de las opiniones expresadas
en los mismos.
CIENTFICA
Revista CIENTFICA Vol 8 N 1, enero-abril 2011
revistacientifca@ucsur.edu.pe
Fondo Editorial. Universidad Cientfca del Sur.
Carretera Antigua Panamericana Sur km 19 - Villa
El Salvador
Tel.: +511 610 6400 anexo 528
Tiraje: 600 ejemplares
Proximamente: Revista Cientfca Volumen 8 N 2
Mayo - Agosto, 2011
www.cientifca.edu.pe/fondoeditorial
Vicerrectorado de
Investigacin
5096 PORTADA REVISTA CIENTIFICA.pdf 1 10/22/11 10:23 AM
Reporte Ambiental de
Lima y Callao, 2010
Evaluacin de avances a 5 aos del informe GEO
U N I V E R S I D A D C I E N T F I C A D E L S U R
www.cientica.edu.pe/fondoeditorial
Universidad Cientfica del Sur
5096 PORTADA REVISTA CIENTIFICA.pdf 1 10/22/11 10:23 AM