You are on page 1of 6

536

MEDICINA - VolumenISSN 71 - N 0025-7680 6, 2011 MEDICINA (Buenos Aires) 2011; 71: 536-541

ARTCULO ORIGINAL

LINFOMAS PLASMOBLSTICOS DEL TRACTO GASTROINTESTINAL EN PACIENTES CON SIDA


ALEJANDRO AVILS-SALAS1, 5, ROBERTO HERRERA-GOEPFERT1, DIANA AGUILAR-LEN2, MYRNA CANDELARIA-HERNNDEZ3, ERASMO MARTNEZ-CORDERO4, MARCELO CORTI6
1

Departamento de Patologa, Instituto Nacional de Cancerologa, Mxico, 2Departamento de Patologa, Instituto Nacional de Ciencias Mdicas y Nutricin, Mxico, 3Departamento de Hematologa, Instituto Nacional de Cancerologa, Mxico, 4 Instituto Nacional de Enfermedades Respiratorias, Mxico, 5Facultad de Medicina, Universidad Nacional Autnoma de Mxico, 6Hospital de Enfermedades Infecciosas Francisco Javier Muiz, Buenos Aires, Argentina

Resumen Los pacientes con infeccin por el virus de inmunodeficiencia humana (HIV) tienen 200 veces ms riesgo de desarrollar un linfoma no Hodgkin (LNH) con respecto a la poblacin general. El linfoma plasmoblstico (LP) representa menos del 3% de todos los LNH asociados con el HIV. El objetivo de este estudio es informar las caractersticas clnico-patolgicas de 5 pacientes con enfermedad HIV/sida y LP del tracto gastrointestinal. Se revisaron de forma retrospectiva los casos de LP del tracto gastrointestinal diagnosticados en el Instituto Nacional de Cancerologa de la Ciudad de Mxico en el periodo comprendido entre los aos 2000 al 2009. Se analizaron las caractersticas clnico-patolgicas y se realizaron cortes de bloques de tejidos embebidos en parafina para reacciones de inmunohistoqumica. La presencia del virus de Epstein Barr (VEB) se examin por reaccin en cadena de la polimerasa (PCR) in situ. De los cinco pacientes, cuatro fueron hombres y una mujer, con una mediana de edad de 29 aos. Tres tumores se localizaron en la regin anorrectal, uno en colon ascendente y el restante en el estmago. Histolgicamente, todos los tumores se caracterizaron por una proliferacin difusa de clulas grandes de aspecto plasmoblstico. Las clulas neoplsicas fueron CD 138/MUM-1 positivas y CD 20 / PAX-5 negativas. En cuatro pacientes se detect el genoma del VEB en las clulas neoplsicas mediante PCR in situ. La mediana de seguimiento fue 18 meses; tres pacientes estaban vivos con enfermedad y dos sobreviven sin evidencias de la neoplasia. El diagnstico precoz de LP como una entidad clnico-patolgica es importante para establecer el tratamiento correcto y mejorar el pronstico de estos pacientes. Palabras clave: linfoma plasmoblstico, HIV, tracto gastrointestinal, VEB Abstract Plasmablastic lymphoma of the gastrointestinal tract in AIDS patients. The risk of developing non-Hodgkin lymphoma (NHL) is 200 times higher in HIV-positive patients than otherwise healthy persons. Plasmablastic lymphoma (PL) represents < 3% of all NHL associated with HIV infection. The aim of this study was to review the clinical-pathologic features of PL of the gastrointestinal tract in 5 patients with HIV/ aids disease. We performed a retrospective study of PL of the gastrointestinal tract diagnosed at the National Institute of Cancer at Mexico City, from 2000 to 2009. Clinical and pathological information was obtained and immunohistochemical studies were performed in paraffin-embedded tissue sections. The presence of Epstein-Barr Virus (EBV) was examined by in situ polymerase chain reaction (PCR). Four male and 1 female were included with a median of age of 29 years. Three tumors involved the ano-rectal area, one tumor the ascendant colon and one tumor the stomach. All tumors were histologically characterized by a monotonous proliferation of large lymphoid cell with plasmablastic features. Tumor cells were CD 138 / MUM-1positive and CD 20 / PAX-5 negative in all cases. EVB genome was detected by in situ PCR in 4 cases. The median of follow-up was 18 months, and revealed that three patients are alive with neoplasm disease and two patients are still alive with no evidence of the neoplasm. Recognition of this entity by pathologists and clinicians is important in order to establish the correct diagnosis and the early treatment of these patients. Key words: plasmablastic lymphoma, HIV, gastrointestinal tract, Epstein-Barr virus

Los linfomas afectan entre el 5% y el 10% de los pacientes infectados por el virus de la inmunodeficiencia

Recibido: 19-V-2011

Aceptado: 26-X-2011

Direccin postal: Dr. Alejandro Avils Salas, Departamento de Patologa, Instituto Nacional de Cancerologa, Av. San Fernando 22, Seccin XVI, Tlalpan. CP 14080, Mxico, D.F. Fax: (52-55) 56 28 04 21 e-mail: alejandroaviles2001@yahoo.com

humana (HIV), siendo la segunda neoplasia en frecuencia en esta poblacin, despus del sarcoma de Kaposi (SK). El riesgo de desarrollar un linfoma no Hodgkin (LNH) es 200 veces mayor en pacientes HIV positivos en comparacin con la poblacin general1. Los linfomas observados son predominantemente de estirpe B, incluyendo: linfoma difuso de clulas grandes (LDCG), linfoma de Burkitt (LB), linfoma primario de serosas (LPS) y linfoma plasmoblstico (LP)2.

LINFOMAS PLASMOBLSTICOS GASTROINTESTINALES EN SIDA

537

El virus de Epstein Barr (VEB) se ha relacionado con la patogenia del LDCG y del LP3; por otro lado, el virus herpes tipo 8 asociado a sarcoma de Kaposi (VHSK) se ha asociado con el desarrollo del SK, del LPS, del LP y de la enfermedad de Castleman difusa de clulas plasmticas (ECDCP)4, 5. El LP representa aproximadamente el 2.6% de todos los LNH asociados con la infeccin por HIV 6 y tiene una fuerte predileccin por la cavidad oral; sin embargo, tambin se han diagnosticado casos en otras localizaciones incluyendo: estmago, pulmn, ganglios linfticos, regin anorrectal y senos paranasales7-13. El objetivo de este estudio es describir las caractersticas clnico-patolgicas de 5 pacientes con enfermedad HIV/sida y LP del tracto gastrointestinal.

cerraron y se colocaron en el termociclador (Hybaid Ashford, UK). La amplificacin comprendi desnaturalizacin a 95 oC por 1 min, alineamiento a 60 oC por 1 min y extensin a 72 oC por 1 min por 35 ciclos. Los productos de PCR se detectaron con anticuerpos contra digoxigenina conjugados a fosfatasa alcalina 1:500 (Boehringer Mannheim). El cromgeno fue 5-bromo-indol 4-cloro-3-3 indol toluidina fosfato y nitroazul de tetrazolio 1:50 (Boehringer Mannheim). Los cortes fueron contrastados con Fast Red para evitar cualquier interferencia con la seal azul generada por el ADN del VEB. Cada caso se corri con su propio control negativo, adems se incluyeron controles positivos y negativos.

Resultados
Se incluyeron en la evaluacin cinco pacientes con diagnstico de LP del tracto gastrointestinal, cuatro hombres y una mujer, con una mediana de edad al momento del diagnstico de la neoplasia de 29 aos (intervalo de 24 a 37 aos). Todos los pacientes fueron HIV positivos; tres haban adquirido la infeccin a travs de relaciones homosexuales no protegidas, uno por relaciones bisexuales y la restante a partir de relaciones heterosexuales. En tres pacientes el diagnstico de infeccin por HIV se haba realizado en un lapso de 12 meses previos al diagnstico del linfoma. Solo un paciente haba recibido terapia antirretroviral de gran actividad (TARGA) previa al diagnstico de la neoplasia. La carga viral solo se determin en tres pacientes con una mediana de 403 000 copias (rango 58 000 a 600 000 copias); la mediana de linfocitos T CD4+ al momento del diagnstico del LP fue de 194 clulas/l (rango 111 a 400 clulas/l). Los sntomas referidos con mayor frecuencia estuvieron en relacin con la localizacin del tumor e incluyeron: tumor anorrectal (3), proctorragia (2), aumento de permetro abdominal (2), plenitud posprandial (1), nuseas (1), vmitos (1), prdida de peso (1) y fiebre (1). Tres tumores se localizaron en la regin anorrectal, uno en colon ascendente y uno ms en estmago (Tabla 1). A todos los pacientes se les practic hemograma completo, qumica sangunea, tomografa axial computarizada (TAC) de cerebro, trax, abdomen y pelvis y biopsia de mdula sea. El 60% de los pacientes tuvieron niveles de LDH por encima del valor de referencia, con una mediana de 242 UI/l (rango 132 a 428 UI/l). El 80% de los pacientes tuvieron cifras de b2mG por encima del valor de referencia, con una mediana de 4.1 mg/l (rango 2.5-6.7 mg/l). De acuerdo con los criterios de estadificacin de Lugano, tres pacientes se encontraban en estadio IV, un paciente en estadio III y uno ms en estadio II de la neoplasia. Respecto al tratamiento, a un paciente con tumor localizado en la regin anorrectal se le practic reseccin anterior baja y posteriormente quimioterapia con EPOCH (etopsido, doxorrubicina, vincristina, ciclofosfamida y prednisona); actualmente se encuentra vivo sin vestigios de enfermedad neoplsica luego de 28 meses de seguimiento. El resto de los

Materiales y mtodos
Se realiz un estudio retrospectivo, descriptivo y observacional. Se revis el archivo de patologa quirrgica del Instituto Nacional de Cancerologa de Mxico en el perodo comprendido de enero del 2000 a diciembre del 2009. Se incluyeron aquellos casos que contaron con material para el diagnstico histopatolgico: laminillas teidas con tcnica de hematoxilinaeosina (HE) y bloques de parafina, adems de la informacin clnica. Los linfomas se diagnosticaron de acuerdo a la ltima clasificacin de la OMS14. Los pacientes se estadificaron en base a los criterios de Lugano. En todos ellos se determin el nivel del recuento de linfocitos T CD4+ y los valores de la lacticodeshidrogenasa (LDH) al momento del diagnstico de la neoplasia. En todos los casos se seleccion un bloque de tejido fijado en formol amortiguado al 10% y embebido en parafina. Se realizaron cortes de 2 m y se colocaron en laminillas cargas. Todas las pruebas se corrieron en el equipo automatizado Benchmark ULTRA, utilizando anticuerpos contra: CD20 (L26; 1:300 Dako), CD3 (Policlonal; 1:80 Dako), CD56 (BC56C04; 1:50 Biocare), CD138 (MI15; 1:200 Dako), MUM-1(MUM-1p; 1:200 Dako), PAX-5 (Cell marque), kappa (A8B5; 1:500 Dako), lambda (N10/2; 1:2000 Dako) y LMP-1 (CS1-4; 1:50 Dako), con el sistema de deteccin ultraView Universal DAB. La deteccin del genoma del VEB se efectu utilizando la tcnica de reaccin en cadena de la polimerasa (PCR) in situ. En todos los casos se realizaron cortes de 2 m y se colocaron en laminillas cargadas, posteriormente se desparafinaron por 18 horas a 65 oC, y de forma secuencial se hidrataron pasando por xileno, etanol absoluto, 75%, 50%, 25% y agua. Las clulas se permeabilizaron con HCl 0.02 M y se incubaron a temperatura ambiente por 10 min. Las protenas fueron agotadas por la incubacin con 1 mg/l proteinasa K (Gibco, Paisley, UK) durante 30 min a 37 oC. La proteinasa fue inactivada por ebullicin en horno de microondas por 15 min, e inmediatamente se colocaron las laminillas en cido actico al 20% por 15 s para inactivar la fosfatasa alcalina endgena. La PCR se realiz mediante incubacin de las secciones con buffer de reaccin 1X (GibcoBRL) 1.5 U de Taq polimerasa, 2 mmol/l de MgCl2 40 mmol/l, dNTPs, 0.2 mmol dUTP marcado con digoxigenina (Boehringer Mannheim Lewes UK) y 60 pg de cada uno de los iniciadores de secuencia de EBV. Las secuencias de los iniciadores utilizadas fueron 5 TTGACGTCATGCCAAGGCA 3 sentido y 5AGCAGTGGCCAGCTCATATG 3 antisentido. Las laminillas se

538

MEDICINA - Volumen 71 - N 6, 2011 TABLA 1. Caractersticas demogrficas y de laboratorio de pacientes con linfomas plasmoblsticos (LP) del tracto gastrointestinal

Caso 1 2 3 4 5

Edad Sexo (aos) 28 34 24 29 37 M F M M M

Conducta sexual Bisexual Heterosexual Homosexual Homosexual Homosexual

Diagnstico previo HIV+ (meses) 36 12 4 132 3

TARGA No S No No No

CD4+ (cl./l) 111 400 194 400 130

Carga viral (copias/ml) 403 000 ND ND 600 000 58 000

M: masculino; F: femenino; ND: no determinado; TARGA: Terapia antirretroviral de gran actividad

TABLA 2. Caractersticas clnico-patolgicas de pacientes con LP del tracto gastrointestinal Caso 1 2 3 4 5 Localizacin Recto Colon ascendente Recto Recto Estmago Estadio Kanofsky IV III IV II IV (%) 80 80 70 70 90 LDH (UI/l) 146 242 332 132 428 2mG (mg/l) 3.5 4.1 4.7 2.5 6.7 Tratamiento 1.CHOP (3) 1.CHOP (8) 2. MTX IT (6) 3. RX (36 Gy) 1.RAB 2.EPOCH (8) 1.CHOP (1) 2. Cuidados paliativos 1.CHOP(1) Seguimiento Evolucin (meses) 5 50 VCE VSE

28 18 2

VSE VCE VCE

LDH: valor de referencia 119-213 UI/L; 2mG: valor de referencia 1.4-2.5 mg/lL; CHOP: ciclofosfamida, doxorrubicina, vincristina, prednisona; EPOCH: etopsido, doxorrubicina, vincristina, ciclofosfamida, prednisona; MTX IT: metotrexate intratecal; RX: radioterapia; RAB: reseccin anterior baja; VCE: vivo con enfermedad; VSE: vivo sin enfermedad.

Fig. 1. Neoplasia con patrn de crecimiento difuso, constituida por clulas grandes alternando con abundantes macrfagos con restos celulares en su citoplasma patrn en cielo estrellado (hematoxilina-eosina, 200X)

Fig. 2. Las clulas neoplsicas son grandes, el ncleo es excntrico, tienen nuclolo prominente y abundante citoplasma de aspecto plasmoblstico (hematoxilina-eosina, 200X)

pacientes recibieron como primera lnea quimioterapia con CHOP (ciclofosfamida, doxorrubicina, vincristina y prednisona). En la paciente con el tumor localizado en colon ascendente se comprob infiltracin a sistema

nervioso central, por lo cual se administr metotrexate (MTX) intratecal; as mismo, la PET-CT mostr actividad tumoral en abdomen, que se manej con radioterapia con una dosis total de 36 Gy, encontrndose actualmente

LINFOMAS PLASMOBLSTICOS GASTROINTESTINALES EN SIDA

539

Fig. 3. Las clulas neoplsicas expresan intensamente CD 138 (tcnica de inmunohistoqumica, 400X)

Fig. 4. Los ncleos de las clulas neoplsicas son positivos (tcnica de PCR in situ)

TABLA 3. Resultado de la inmunohistoqumica y PCR in situ Caso 1 2 3 4 5 CD 138 + + + + + CD 56 - - - - - MUM-1 + + + + + CD 3 - - - - - CD 20 - - - - - PAX-5 - - - - - Kappa + + - + + Lambda - - + - - LMP-1 - - + - - PCR In situ + + + + -

viva sin enfermedad neoplsica luego de 50 meses de seguimiento. La mediana de seguimiento de los pacientes fue de 18 meses (rango 2 a 50 meses). Al momento del estudio, el 60% de los pacientes se encontraban vivos con enfermedad neoplsica residual, y 40% se encontraban vivos sin vestigios de la neoplasia (Tabla 2). En el estudio histopatolgico todas las muestras de biopsias mostraron una neoplasia maligna con crecimiento difuso que infiltraba y en ocasiones ulceraba la mucosa adyacente, con patrn en cielo estrellado (Fig. 1). En todos los casos las clulas neoplsicas eran grandes, de aspecto plasmoblstico (Fig. 2) y positivas para CD 138 (Fig. 3) y MUM-1, y negativas para CD 20 y PAX-5. El 80% de los casos mostr expresin de cadenas ligeras kappa y solamente uno result positivo para la protena latente de membrana 1 (LMP-1). Los hallazgos de la inmunohistoqumica se resumen en la Tabla 3. Mediante tcnica de PCR in situ se detect el genoma del VEB en 80% de los casos, expresada a travs de una reaccin nuclear finamente granular en las clulas neoplsicas (Fig. 4).

Discusin
A partir de 1981, con la emergencia del sida se ha observado una estrecha asociacin entre la infeccin por HIV

y el mayor riesgo de desarrollar diferentes neoplasias, las cuales incluyen: SK, LNH, neoplasia intraepitelial del canal anal y cncer de cuello uterino15, 16. En los ltimos aos, con la difusin del uso de la TARGA se ha registrado una reduccin importante en la morbilidad y mortalidad por infecciones oportunistas relacionadas con el sida; sin embargo, no se ha observado un efecto importante en la incidencia de LNH1, 16. Los virus juegan un papel importante en la patognesis de los linfomas asociados al HIV, as como en alteraciones en c-myc, p53 y Bcl-617. La infeccin por el VEB es comn en el LDCG, LB y LP18. Por otro lado, el VHSK se ha implicado en la patognesis del LP, el LPS y la ECDCP19. Cofactores adicionales, tales como hormonas, predisposicin gentica y/o coinfeccin con otros agentes infecciosos al parecer son necesarios dentro del proceso patognico de estas neoplasias. Los pacientes con infeccin por HIV y LNH se presentan habitualmente con enfermedad avanzada y/o extraganglionar al momento del diagnstico y sntomas B en aproximadamente 80% de los casos. En nuestra serie, el 80% de los pacientes se diagnosticaron en estadios avanzados; 3 en estadio IV y una en estadio III de la neoplasia. El sitio ms comn de compromiso extraganglionar es el tracto gastrointestinal20, particularmente el intestino delgado21, el estmago, el recto12 y el ano. Corti et al., informaron una serie de 48 casos de

540

MEDICINA - Volumen 71 - N 6, 2011

linfomas asociados con la enfermedad debida al HIV, de los cuales 14 correspondieron a LP; once fueron hombres y tres mujeres con una mediana de 37 aos y enfermedad neoplsica avanzada. La mayora de los casos fueron de cavidad oral y tres se localizaron en la regin anal22. En la serie que se presenta, todos los pacientes excepto una fueron hombres jvenes con estadios avanzados de la enfermedad neoplsica y el 60% de estos tumores se localiz en la regin anorrectal. Las clulas del LP se caracterizan por tener citoplasma basfilo, ncleo excntrico y nuclolo central prominente. Tienen crecimiento cohesivo, son relativamente uniformes y con frecuencia muestran un patrn en cielo estrellado23. Colomo et al. describieron dos subgrupos de LP; el primero, con compromiso de la mucosa oral, constituido por una poblacin monomorfa de inmunoblastos. La gran mayora de los pacientes eran VIH+ / VEB+, aproximadamente la mitad se presentaron en la cavidad oral y slo el 13% en ganglios linfticos. El segundo subgrupo con diferenciacin plasmoctica, compuesto por inmunoblastos, plasmoblastos pero con diferenciacin a clulas plasmticas maduras, slo 33% de los pacientes fueron HIV+, el VEB fue detectado en 64% de los casos y 44% presentaron compromiso de ganglios linfticos24. Por definicin, estos tumores son CD 138, antgeno de membrana epitelial (EMA) e Ig citoplsmica positivos y CD 20 negativos. La deteccin de VEB por inmunohistoqumica utilizando LMP-1 es muy baja; por el contrario, al utilizar hibridacin in situ con EBER el porcentaje aumenta hasta el 76%3, 8, 22, 24. En los casos estudiados slo uno fue positivo por inmunohistoqumica para LMP-1; sin embargo, cuando se analiz la asociacin del VEB utilizando la tcnica de PCR in situ el 80% de los casos resultaron positivos, en forma similar a lo observado cuando se utiliza hibridacin in situ con EBER. El diagnstico diferencial debe incluir al LDCG variante morfolgica inmunoblstica, LPS, LB con diferenciacin plasmocitoide y mieloma poco diferenciado18; sin embargo, es importante tener en cuenta otros diagnsticos como carcinoma poco diferenciado y melanoma3. En general, los linfomas asociados con la infeccin por HIV tienen un comportamiento biolgico agresivo y rpidamente fatal1, 3, 22, 25-27; sin embargo, el diagnstico temprano y el tratamiento adecuado para ambas condiciones han mejorado significativamente el pronstico de estos pacientes28. En forma similar a lo que ocurre con otros linfomas agresivos, los LP deben tratarse con esquemas de quimioterapia ms TARGA. En los casos incluidos en esta serie, la terapia antirretroviral indicada por el Centro Nacional para la Prevencin y Control del HIV/sida en Mxico, incluye regmenes con Efavirenz 600 mg., 1 tableta cada 24 horas por la noche, ms Truvada (emtricitabina 200 mg / tenofovir 300 mg) 1 tableta cada 24 horas, o como esquema alternativo Kaletra (lopinavir 200 mg / ritonavir 100 mg) 2 tabletas cada 12 horas,

ms Truvada (emtricitabina 200 mg / tenofovir 300 mg) 1 tableta cada 24 horas. Desafortunadamente, al momento del diagnstico solo un paciente reciba TARGA, lo que representa un factor de mal pronstico. Por otro lado, aun cuando la gran mayora de nuestros casos se trataron con CHOP, existen otros esquemas de quimioterapia utilizados en estos pacientes tales como: EPOCH, CODOX-M/IVAC (ciclofosfamida, vincristina, doxorrubicina, metotrexate, ifosfamida, etopsido y citarabina), ACVBP (doxorrubicina, ciclofosfamida, vindesina, bleomicina y prednisona) e hiper-CVAD (ciclofosfamida, metotrexate, citarabina, vincristina, doxorrubicina y dexametasona)27, 28 Con la finalidad de reducir la toxicidad hematolgica se ha propuesto el esquema de EPOCH a dosis ajustada, utilizando: etopsido (50 mg/m2/da), doxorrubicina (10 mg/m2/da), vincristina (0.4 mg/m2/da) en infusin continua, y prednisona (60 mg/m2/da) va oral; as como ciclofosfamida, ajustando la dosis en relacin con el recuento de linfocitos T CD4+; con recuentos mayores de 100 clulas/l la dosis es de 375 mg/m2/ da y con menos de 100 clulas/l la dosis se reduce a 187 mg/m2/da, el primer ciclo. Posteriormente, la dosis de ciclofosfamida se ajusta por arriba o por debajo de 187 mg/m2 en relacin con el conteo absoluto de neutrfilos, con una dosis mxima de 750 mg/m2, 29. Finalmente, factores que han sido asociados con mal pronstico en esta poblacin incluyen: edad > 35 aos, recuentos de linfocitos CD4+ < 100 clulas/l al momento del diagnstico, pobre estado funcional, infiltracin de la mdula sea, LDH srica elevada, estadio III o IV y mala respuesta a la TARGA1, 13. En la prctica clnica, la identificacin del LP como una entidad clnico-patolgica es importante para el diagnstico temprano y tratamiento correcto de estos pacientes; as como el desarrollo de estudios que incluyan un mayor nmero de pacientes para comprender mejor la patognesis de esta neoplasia.

Conflictos de inters: Los autores no tienen conflictos de inters para declarar.

Bibliografa
1. Cornejo-Jurez P, Volkow-Fernndez P, Avils-Salas A, Caldern-Flores E. AIDS and non-Hodgkins lymphoma. Experience at an oncological center in Mexico. Rev Invest Clin 2008; 60: 375-81. 2. Folk GS, Abbondanzo SL, Childers EL, Foss RD. Plasmablastic lymphoma: a clinicopathologic correlation. Ann Diagn Pathol 2006; 10: 8-12. 3. Rafaniello Raviele P, Pruneri G, Maiorano E. Plasmablastic lymphoma: a review. Oral Dis 2009; 15: 38-45. 4. Deloose ST, Smit LA, Pals FT, Kersten MJ, van Noesel CJ, Pals ST. High incidence of Kaposi sarcoma-associated herpesvirus infection in HIV-related solid immunoblastic/ plasmablastic diffuse large B-cell lymphoma. Leukemia 2005; 19: 851-5. 5. Parravicini C, Chandran B, Corbellino M, et al. Differential viral protein expression in Kaposis sarcoma-associated

LINFOMAS PLASMOBLSTICOS GASTROINTESTINALES EN SIDA herpesvirus-infected diseases. Kaposis sarcoma, primary effusion lymphoma, and multicentric Castlemans disease. Am J Pathol 2000; 156: 743-9. Carbone A. AIDS-relate non-Hodgkins lymphomas: from pathology and molecular pathogenesis to treatment. Hum Pathol 2002; 33: 392-404. Borrero JJ, Pujol E, Prez S, Merino D, Montano A, Rodrguez FJ. Plasmablastic lymphoma of the oral cavity and jaws. AIDS 2002; 16: 1979-80. Delecluse HJ, Anagnostopoulos I, Dallenbach F, et al. Plasmablastic lymphomas of the oral cavity: a new entity associated with the human immunodeficiency virus infection. Blood 1997; 89: 1413-20. Chetty R, Hlatswayo N, Muc R, Sabaratnam R, Gatter K. Plasmablastic lymphoma in HIV+ patients: an expanding spectrum. Histopathology 2003; 42: 605-9. Pruneri G, Graziadei G, Ermellino L, Baldini L, Neri A, Buffa R. Plasmablastic lymphoma of the stomach. A case report. Haematologica 1998; 83: 87-9. Lin Y, Rodrigues GD, Turner JF, Vasef MA. Plasmablastic lymphoma of the lung: report of a unique case and review of the literature. Arch Pathol Lab Med 2001; 125: 282-5. Rajagopal AS, Copson E, Addis B, Shinkfield M, Mead G. Plasmablastic lymphoma: a case of rectal disease with spinal cord compression. Leuk & Lymphoma 2006; 47: 2670-3. Lim JH, Lee MH, Lee MJ, et al. Plasmablastic lymphoma in the anal canal. Cancer Res Treat 2009; 41: 182-5. World Health Organization. Classification of Tumours of Haematopoietic and Lymphoid Tissues. International Agency for Research on Cancer: Lyon 2008. Cesarman E, Knowles DM. Kaposis sarcoma-associated herpesvirus: a lymphotropic human herpesvirus associated with Kaposis sarcoma, primary effusion lymphoma, and multicentric Castlemans disease. Semin Diagn Pathol 1997; 14: 54-66. Powles T, Matthews G, Bower M. AIDS related systemic non-Hodgkins lymphoma. Sex Transm Infect 2000; 76: 335-41. Carbone A. Emerging pathways in the development of AIDS-related lymphomas. Lancet Oncol 2003; 4: 22-9. Dong HY, Scadden DT, de Leval L, Tang Z, Isaacson PG, Harris NL. Plasmablastic lymphoma in VIH positive patients: an aggressive Epstein-Barr virus associated

541

6. 7. 8.

19.

20.

21. 22.

9. 10. 11. 1 2.

23. 24.

13. 14. 15.

25.

26. 27. 28.

16. 17. 18.

29.

extramedullary plasmacytic neoplasm. Am J Surg Pathol 2005; 29: 1633-41. Oksenhendler E, Boulanger E, Galicier L, et al. High incidence of Kaposi sarcoma-associated herpesvirus-related non-Hodgkin lymphoma in patients with HIV infection and multicentric Castleman disease. Blood 2002; 99: 2331-6. Corti M, Villafae Fioti MF, Lewi D, Schtirbu R, Narbaitz M, de Dios Soler M. Linfomas del tubo digestivo y glndulas anexas en pacientes con SIDA. Acta Gastroenterol Latinoam 2006; 36: 190-6. Cha JM, Lee J, Joo KJ, et al. A case report with plasmablastic lymphoma of the jejunum. J Korean Med 2010; 25: 496-500. Corti M, de Dios Soler M, Bare P, et al. Linfomas asociados con la infeccin por el virus de la inmunodeficiencia humana; subtipos histolgicos y asociacin con los virus de Epstein Barr y Herpes-8. Medicina (B Aires) 2010; 70: 151-8. Gujral S, Shet TM, Kane SV. Morphological spectrum of AIDS-related plasmablastic lymphomas. Indian J Pathol Microbiol 2008; 51: 121-4. Colomo L, Loong F, Rives S, et al. Diffuse large B-cell lymphomas with plasmablastic differentiation represent a heterogeneous group of disease entities. Am J Surg Pathol 2004; 28: 736-47. Carbone A, Gloghini A, Vaccher E, et al. Kaposis sarcoma associated herpesvirus/human herpesvirus type 8 positive solid lymphomas: a tissue based variant of primary effusion lymphoma. J Mol Diagn 2005; 7: 17-27. Castillo J, Pantanowitz L, Dezube BJ. HIV-associated plasmablastic lymphoma: lessons learned from 112 published cases. Am J Hematol 2008; 83: 804-9. Castillo J, Winer ES, Stachurski D, et al. Prognostic factors in chemotherapy-treated patients with HIV-associated plasmablastic lymphoma. Oncologist 2010; 15: 293-9. Riedel DJ, Gonzalez-Cuyar LF, Zhao XF, Redfield RR, Gilliam BL. Plasmablastic lymphoma of the oral cavity: a rapidly progressive lymphoma associated with HIV infection. Lancet Infect Dis 2008; 8: 261-7. Little RF, Pittaluga S, Grant N, et al. Highly effective treatment of acquired immunodeficiency syndrome-related lymphoma with dose-adjusted EPOCH: impact of antiretroviral therapy suspensin and tumor biology. Blood 2003; 101: 4653-9.

[] Cuanto es aparece. Todo el trabajo de la ciencia -que Mairena admira y venera- consiste en descubrir nuevas apariencias, es decir, nuevas apariciones del ser; de ningn modo nos suministra razn alguna esencial para distinguir entre lo real y aparente. Si el trabajo de la ciencia es infinito y nunca puede llegar a un trmino, no es porque busca una realidad que huye y se oculta tras una apariencia, sino porque lo real es una apariencia infinita, una constante e inagotable posibilidad de aparecer. Antonio Machado (1875-1939) Abel Martn. Cancionero de Juan de Mairena. Prosas varias (1943). 4ta. Edicin. Buenos Aires; Losada, 1975. p 50.