You are on page 1of 50

Transcription and RNA Processing

The Central Dogma
For the phenotypic expression of any gene, information contained in DNA is first transcribed into an RNA from where it is translated into the amino-acid sequence of the corresponding protein. Phenotypes are the manifestation of the activity/function of proteins and catalytic RNAs.

DNA

Transcription

RNA Pol + factors

RNA

Translation

Ribosomes, tRNAaa + other factors

Protein

Function Enzyme, structural element, hormone, regulatory, etc

Phenotype

The assumptions of the central dogma are sound, but there are exceptions!

The Revised Central Dogma
DNA
REVERSE TRANSCRIPTION

Ribozymes

FUNCTION

Interactions

FUNCTION

Exceptions to the Central Dogma
1. Information contained in RNA can be copied into DNA by reverse transcriptases and telomerase. EXAMPLES: retroviruses, mobile introns. 2. After transcription, nucleotides can be added to, deleted from, or modified in some mRNAs by processes known as RNA editing. EXAMPLES: addition and deletion of Us in the mitochondria of trypanosomes, conversion of Cs to Us in plant mitochondria by deamination. 3. Not all genes are expressed phenotypically through proteins. EXAMPLES: the RNAs of mobile introns are nucleases, the LSU ribosomal RNA has peptide synthetase activity. Such RNAs are classified as ribozymes.

Ribozymes favor the concept that a more primitive RNA-based ancestral form of life may have preceded the DNA-, RNA-, protein-based life as we know it now.

Transcription
The first step of the expression of a gene (DNA) is to transcribe the information contained in the nucleotide sequence from one strand (template or antisense strand) into an RNA. The product of this transaction is a transcript. If a gene carries information for the assembly of a protein, the transcript is a messenger RNA (mRNA).

Translation
The information in mRNAs is decoded by ribosomes and translated by alignment of three-nucleotide codons with corresponding tRNAs that deliver the corresponding amino acids.

The messenger: a general view of transcription and Coding strand of DNA translation
Template strand of DNA

mRNA

5’

U

U

U

U

U

3’

RNA synthesis. RNA processing: cleavage of precursor transcripts and modification of bases.Transcription and RNA Processing Topics 1. RNA editing. 5. RNA structure. elongation and termination. Videos . 3. 4. 6. RNA and protein splicing. Transcription: initiation. 2.

1 5’ 3’ .RNA precursors Base O Ribonucleoside triphosphate RNA polynucleotide chain Fig. 2.

RNA Structure Primary structure: order of the nucleotides read 5’ Æ 3’ 5’ ACUCAUCGGCACGUCAUGCUGAUAUCCGGCUUGACACU 3’ Secondary structure: regions of base pairing (double-stranded helical regions) Tertiary structure: folding of the entire RNA chain Only non-covalent hydrogen bonding is involved in secondary and tertiary structure formation Stem-loop Fig 2.2 Pseudoknot .

Tertiary structure of a transfer RNA 5’ 3’ .

coli 16S rRNA 1.Structure of E. Highly conserved 5’ 3’ . Compact 3-D folding 3. ~1500 nucleotides long 2.

cofactor in protein complexes 4S 23S 16S 5S <5S rRNA 3 unknown and growing Small RNAs S = Sedimentation coefficient (Swedberg units). related to size and shape of molecule. . guide RNAs. tRNA and formation of peptide bond between amino acids Diverse roles: primers. coli ) RNA Function Size 620S Stability T½ Few minutes longer than one generation longer than one generation variable No.Kinds of RNA found in a typical bacterium (E. binding of mRNA. of different kinds ~4000 variable <27 “Messenger” – contains information for mRNA assembly of amino-acid sequence of protein by ribosomes and tRNA tRNA “Transfer” – codon recognition in partnership with ribosome and transfer of amino acid into polypeptide “Ribosomal” – component of ribosome. RNA processing and degradation. gene regulation.

RNAs and DNAs can be separated by size in sucrose gradients by centrifugation and by gel-electrophoresis 16S 23S 30S Start – 30S Precursor 23S 16S Separation by Electrophoresis 5S + .

1! . Direction of RNA synthesis: 5’ → 3’ Direction of reading of template DNA strand: 3’ → 5’ Do you remember the principles of nucleic-acid synthesis? Ch.Transcription: RNA polymerase (RNAP) catalyzed synthesis of RNA on a DNA template RNA polymerases do NOT require a primer for the initiation of RNA synthesis.

catalysis. .159 10.Subunits of the E. Restores denatured enzyme to fully functional form.263 Gene Function rpoA rpoB rpoC rpoZ rpoD Assembly of RNAP. Directs enzyme to corresponding promoters. binding of some regulatory proteins.237 70. Catalysis of chain initiation and elongation. Binding to DNA template. coli holo RNAP and their Functions Subunit alpha (α) beta (β) beta’ (β’) omega (ω) sigma (σ70) Size aa Da 329 1342 1407 91 613 36.616 155.511 150.

What do promoters look like? . bind) the RNA polymerase core enzyme for the initiation of transcription at specific transcription start sites that are part of the promoter sequence in the DNA. Promoters are relatively short nucleotide sequences in the DNA (genome) that are recognized by sigma (σ) proteins (factors). located in the DNA upstream of the coding region of one gene or a group of functionally related genes. Sigma factors bound to promoters “recruit” (interact.Important Features of Transcription in Prokaryotes Transcription starts at promoters.

which.6 . is the first base of the RNA (transcription start point). Fig 2. in this case.Typical structure of Bacterial “Housekeeping-Gene” σ70 Promoters with –10 and –35 Regions Coding-strand consensus sequences Coding 5’ Template 3’ RNA (A/G)NNNNN -- DNA Question: What do the negative numbers mean? Number of bases upstream (5’) of a designated place.

Active site of RNA polymerase and binding of σ70 σ1 – σ4 are domains of σ70 proteins Promoter contacts Active site channel β’ pincer ̶ 35 ̶ 10 β pincer RNA exit channel Secondary channel for nucleoside triphosphate entry Core RNA polymerase Crabclaw structure Holoenzyme .

2.Transcription starts at promoters and ends at terminators Proteins called σ factors bind to core RNAP and direct it to DNA nucleotide sequences called promoters. Fig.7 . No primer is required for transcript initiation and no helicase is required for the unwinding of the DNA. The RNA and the polymerase dissociate and are released from the DNA. Transcription continues until the polymerase with its transcription bubble reaches a transcription termination (t ) site. and transcription starts at a T or C in the template strand. σ is released. A transcription bubble is generated. RNA synthesis proceeds for ~8 – 9 nt along the template. The two strands of the DNA are separated by σ.

Transcription Cycle σ binding Termination Closed complex (RPC) Transcription elongation complex (TEC) σ release and elongation Open complex (RPO) Promoter recognition DNA isomerization Escape Initiation Abort .

Not all σ70 promoters are created equal UP element Extended ̶ 10 .

Nudler 2003. Microbiol. Borukhov and E. Inhibition of σ-DNA binding Down arrows indicate contact points with core RNAP proteins Electrostatic interactions Direct hydrogen bonds Indirect hydrogen bonds potential hydrophobic (van der Waal’s) contacts.Evolutionarily Conserved Regions and Functional domains of Bacterial σ70 Factors σ70 factors initiate the transcription of “housekeeping” genes (named after the 70 kDa housekeeping σ factor of E. From S. Curr. Opinion. coli ). Shown below is the linear arrangement of the σ70-like factor of Thermus aquaticus (~43 kDa). 6: 93-100 .

Modified from K. Murakami and S. RNA channel Nascent RNA Coding-strand Template-strand . 13: 31-39. Curr. A.S.RNAP Holoenzyme Open Initiation Complex Part of β has been removed to expose the interior of the holoenzyme initiation complex. Opinion Structural Biol. Darst 2003.

Transcription Elongation Complex (TEC) The RNA polymerase adds from 30 to 100 nucleotides per second to the growing RNA molecule (6000 maximum per min). .

which have exonuclease activity. The true function of RNAP pausing and backtracking is somewhat enigmatic. into the secondary channel and degrade the RNA until it is rearranged (properly paired with the DNA template?) in the active site channel so that elongation can be resumed. . GreA/GreB insert their N-termini. The 3’ end of the RNA is pushed into the secondary channel.RNA Polymerase Backtracking The formation of a secondary structure (stem-loop or hairpin) at the 3’ end of a growing transcript can cause backtracking of the RNA polymerase.

coli has SEVEN different σ factors Streptomyces coelicolor has MORE THAN SIXTY different σ factors Each type of σ factor recognizes its own unique class of promoter sequences See next page .The number of different σ factors varies greatly among organisms Mycoplasma genitalium has only ONE σ factor E.

Regulates the fec genes for iron dicitrate transport. glnF) rpoH rpoS rpoE rpoF fecI Function Principal sigma factor (housekeeping gene transcription). Gene expression in stationary phase cells. Expression of flagellar operons. Heat-shock gene transcription. .The Seven Sigma Factors of E. coli and their Functions Sigma factor σ70 (σD) σN (σ54) σH (σ32) σS (σ38) σE (σ24) σF (σ28) σFecI Gene rpoD rpoN (ntrA. Periplasmic stress response proteins. Nitrogen-regulated gene transcription.

coli Promoters CONSENSUS SEQUENCE Sigma σ70 (σD) σH (σ32) σE (σ24) σF (σ28) σFecI (σ18) σS (σ38) −35 region TTGACA CTTGAA GAACTT CTAAA GAAAAT TTGACA −25 region σN (σ54) CTGGCAC Spacer (b) 16 – 18 13 – 15 15 – 17 15 15 14 – 18 Spacer (b) 6 −10 region TATAAT CCCCATNT TCTGA GCCCATAA TGTCCT CTAYACTT −12 region TTGCA .Consensus Sequences of E.

termination and antitermination of transcription. and attenuation of transcription. where they are progressively removed backward by GreA and GreB until a proper pairing of the RNA with the DNA template is restored. . When this happens.Watch for signals along the track! Transcription is not a smoothly flowing process: pausing occurs frequently at sites that allow the formation of hairpin structures in the RNA. Pausing is an important feature involved in the regulation of gene expression through coordination of the synthesis of mRNA with its simultaneous translation. and several nucleotides at the 3’ OH end are pushed into the secondary channel. the polymerase backtracks along the template. When hairpins structures form in the portion of the RNA that is located in the exit channel of the polymerase they cause temporary displacement of the 3’ OH from the polymerization active site of the RNA polymerase.

GC-rich inverted repeat Fig. Factor-dependent termination. Factor independent termination and 2.18 MORE Run of at least 4 As in the template strand . 2. Factor-independent transcription termination occurs at sites in the DNA that include a region of two-fold symmetry followed by a stretch of at least four As in the template strand.Transcription Termination There are two kinds of transcription termination: 1.

2.18 MORE . RNA Dissociation of nascent RNA and RNA polymerase from template strand RNA 3’ end Fig.Factor-independent transcription termination Folding of the transcript (RNA) in the active site channel breaks hydrogen bonding to the template DNA strand and causes the release of the RNA and the core RNA polymerase.

.Factor-independent transcription termination How did scientist figure out this mechanism of termination? Mutations that disrupt base pairing in the hairpin loop structure of RNA (two-fold symmetry in DNA) or shorten the run of adjacent Us (As in the DNA template) cause continuation of transcription beyond terminator sites.

that is recognized and bound by a protein.Factor-dependent Transcription Termination Features of factor-dependent transcription-termination sites in DNA: a site specifying a sequence in the RNA. Specifies factor-binding sequence in RNA (EXAMLE:rut ) DNA Any transcription-pause site in DNA DNA Polysomes In prokaryotes. for example rut. . IMPORTANT: Factor-dependent transcription occurs preferentially when the translation of a nascent mRNA is stalled. translation is coupled to transcription. for example Rho (ρ) that chases the RNA polymerase and releases it and the transcript from the DNA template at transcription pausing sites (usually a G:C-rich sequence).

19 RNA and RNAP are released . ρ binds rut RNA polymerase reaches a pause site ρ unwinds RNA/DNA hybrid Stalled ribosome Fig 2. Rho then unwinds the RNA/DNA duplex. releasing the transcript and the RNA polymerase from the DNA.Factor-dependent transcription termination How does it work? Rho hexamer binds to rut in the nascent RNA and then chases the RNA polymerase until it reaches it at a transcriptionpause site on the DNA.

Rho appears to be an RNA/DNA helicase. The other two proteins that have termination-factor characteristics similar to those of ρ are: Tau (τ) and NusA In comparison to ρ. However.E. . if a ribosome has passed a rut site BEFORE ρ is bound. it is not clear whether or not ρ can directly access the RNA/DNA duplex within the active-site channel of a paused RNA polymerase core enzyme. moves along RNA (movement requires ATP) until it reaches the RNA polymerase at a transcription-pause site. and transcription continues past the pause-site. coli has at least three different transcription-termination factors Rho (ρ) binds at rut sequences in nascent RNA. HOWEVER. then the ribosome prevents ρ from catching up with the RNA polymerase. the RNA-binding sites and interactions of Tau and NusA with the RNA polymerase at transcription pause sites are not well characterized yet.

Antibiotics that Inhibit Transcription Rifampin is a member of the rifamycins. Two or three nucleotides are polymerized. Rifamycins bind to the β-subunit in the wall of the active-site channel of the RNAP of bacteria. mitochondria and chloroplasts. MORE Rifampin . but do not block elongation once initiation is complete. macrocyclic lactone antibiotics that inhibit transcription at the initiation stage.

. except that they also can block transcript elongation. The Streptovaricins are related compounds that have the same action as rifampin.Action of Rifampin pppApN and pppGpN are the most common products.

Inhibits transcription and replication Actinomycin D .Antibiotics that Inhibit Transcription Binds to the major groove of DNA in G/C rich regions.

Initiation? 3. Editing? . Template? 4. Ancillary enzymes? 6. Priming? 5. Termination? 7.Think about it! How does the process of RNA synthesis differ from DNA synthesis with respect to: 1. Substrates? 2.

RNA Processing RNA Modification and RNA Editing .

P. Spacer Spacer Processed RNA products Further processing and modification of bases (maturation) MATURE rRNAs and tRNAs Fig.RNA Processing: rRNA and tRNA (rRNA operon) Transcript (unprocessed precursor RNA) 16 S tRNA 23S 5S Endonucleolytic cleavages by Rnases III.20 . 2. etc.

coli and RNase B. . It is a ribozyme. subtilis Rnase M5 is similar to type II DNA topoisomerases RNase Rnase P tRNA processing Rnase P consists of an RNA dimer (same sequence.RNase rRNA processing in E. catalytic subunit) complexed with a dimer of a small protein.

21 . 2.RNA modification Structure of a mature tRNA Added by CCA transferase Determining base Dihydrouridine I IV The most common RNA modification is U Æ Ψ III U Ψ II Fig.

5 .Degradation of mRNA Some of the enzymes involved also participate in rRNA and tRNA processing Box 2.

1. ~1500 nucleotids 2. Many modified bases 3. Complexed with 21 proteins 5. Compact 3-D folding 4. Highly conserved 16S rRNA .

6 Introns in eukaryotic mRNAs .RNA processing Introns and splicing Splicing: Removal of parasitic DNA information from RNA Group II introns Group I introns Box 2.

Removal of parasitic DNA information from proteins Removal of inteins GyrA of many prokaryotes contains an intein N-extein Intein C.6 .extein 1 284 454 738 1071 VMA1 protein of yeast Box 2.

brucei * deleted U u added U uGAUACAAAAAAACAUGACUACAUGAUAAGUAuCAuuuuAuGuuAuuuuuGGuAGuuuuuuuACAuu uGuAuCGuuuuACAuuuG*GUCCACAGCAuCCCG***CAGCACAuG**GuGuuuuAuGuuGuuuAuuGuA uuuuuGuGGuGA*AuuuAuuGuuuA**UAUUGAuUGuAuuAuA***G*GuuAUUUGCAUCGUGGUACAG AAAAGUUAUGUGAAUAUAAAAGUGUAGAACAAUGUCUUCCGuAUUUCGACAGGUUAGAuuAuG uuA*GuGuuuGuuGuAAuGAGCAuuuGuuGuCuuuA***UGuuuuGAGuAuAuGuuGCGAuGuuGuuuGu CGuuACGuuGuGCAuuuAuGCGuuuAuuAAuuGuA****GAAuuuAC***CCGuAGuuuuAAuGGuuuGuu GuGuAuAuCAuGuAuGGuuuuGG*AuuuAGGuuGuuuGuCUCCGuuG*UUAuGAuCAuuuGAGGAA*** CG*UGACAAAuuGAuGACAuuuuuuGAuuuAuG**UUGuGGuuGuCGuAuGCAuuuGGCUUUCAuGGu uuuAuuA*GGuAUUCUUGAUGAuuuuGuuuuuGGuuuuGuuGAuuuuuuGuuGuuGuuGA***UAAuAuC AuGuuuGuuuGuuAuGGAuuGuuAuGAuuuGuuAuuuGuGGGuAAUCGuuuAuuuUAuuuGCGuuuGC** *GuGGuuuGuCAuuuuuuGAuuuAuAuGAuuuA**GuuuuuA**A**UAGuuuAAGuGGuGuuuuGuCuCGu uCGuuAGGuAuGGuGuGAGAuuGUCGuuuAuuuAGuuGuuA****UGA*****GuUGuAuuuuAuGuuuuG uuAuGAuuAuuGuuuuuGuuuuAuAGGuGAuGCAuuuGA*UCGuuuAuuuuuACGuuuGuuuGAUAuGC GuAuGAGuuuGuuGAuuuGuAAGCAAuGuuuuuuuGuuGGuuuuuuuGuuuuuG*****GuuuuGuuuGuuu GuuuG**AuuAuuuAuAuuGuGAuAuuACCAuuG****AGACCAuuAuuAuGuuAuuuuAuAGuuuGuGGu GuuGuuGuuuGCCGGGuAuA*UCAuuuGC*UUGUGuuGAACACCCCAAAGGuGA***GuAuuGuuuGu uAuuA****UGuuuuuGuGuuGGuuuAuGuuCUCGuuuACGuuuGCGuuGuGCGGAuuuuuuGCA*UAUU UGuuuAuuGGAuGuuuGuuuGCGuGGuuuuuuAuuGCAuGAuuuAGuuGC***C*GuuuuAGGuAAuAuu GAuGuuGuuuuuGGAuCCGUAGAUCGuuA*GuuuuAuAuGuG**A******GGUUAUUGuAGGAUUGUU UAAAAUUGAAUAAAAA Courtesy of Dr.RNA Editing: Edited ND1 mRNA of T. Donna Koslowsky .

. 3’ UUUUUUUUU UAAAAGUAAUAAA 5’ C C Tether G Anchor A A A U C U A G A CC A AC GUIDE Modified from Catteneo (1990) ....*.....Mitochondrial RNA Editing in Trypanosomes Editing a substrate RNA by an editosome using a guide RNA Substrate mRNAs are transcribed from mtDNA maxicircles (5-6) Guide RNAs are transcribed from mtDNA minicircles (~1000) DNA 5’ ATATAAAAGCGGGAGTTA EDITOSOME A A 3’ Transcript Guide RNA UU UU Edited segment 5’ AUAUAAAAGCGGGAGUUAUUUUUAUUAUUUUUU 3’ ...

RNA Editing: Base Modifications Mitochondrial and Chloroplast RNAs Untranslated regions (UTRs) and secondary structure modifications of nuclear RNAs in eukaryotes .

C U Editing in the cox2 mRNA of maize mitochondria .