You are on page 1of 15

Rapid senescence in sockeye salmon (Oncorhynchus nerka

)

Leslie Jensen

This work partially fulfills the course requirements for
University of Washington course FISH495

  1 
Abstract:

Sockeye salmon (Oncorhynchus nerka), along with all other Pacific salmon, exhibit rapid

senescence after reaching reproductive maturity, making them an interesting study organism. For

this study, tissue samples were collected from pre-senescent and senescent sockeye salmon

spawning at two different sites in southwestern Alaska, which had significantly different rates of

senescence. In order to examine physiological mechanisms involved in senescence, RNA levels

of adrenocorticotropic hormone (ACTH), corticotropin-releasing hormone (CRH), and heat

shock proteins (HSC71) were quantified. In addition, heat shock protein (HSP70) was quantified.

CRH levels showed a significant negative relationship with reproductive lifespan (days after

beginning reproductive behavior until death by senescence) (p = 0.0036). This relationship

between CRH and senescence suggests that there may also be a relationship between cortisol

levels and rates of senescence. HSP70 levels were also observed to be associated with

senescence, with average levels increasing for each group of senescent sockeye salmon.

  2 
Introduction:

Senescence is often hypothesized to be correlated with the slow accumulation of

mutations and the degeneration of cells due to free radical attack on somatic cells (e.g.

Harman, 1956; Busuttil et al., 2004). This results in the body gradually "wearing out" until the

organism finally dies of “old age” or senescence. However, many species do not show a gradual

rate of physical decline over their lifetime, as seen in humans and other mammals. Instead,

semelparous species exhibit rapid senescence, in which the organism shows no signs of aging

until after the onset of reproductive behavior. Shortly following sexual maturation, the body ages

rapidly, resulting in death soon after reproductive behavior begins. Pacific salmon are prime

examples of this life-strategy, with signs of senescence only visibly during the short period (days

to weeks) between the onset of reproductive behavior and death.

Pacific salmon migrate to the ocean after rearing in freshwater, where they do most of

their growth, and then return to their natal streams to spawn for one season before they die.

During migration to freshwater and their spawning grounds, Pacific salmon cease eating and

begin the process of sexual maturation, which they complete before reaching their spawning

grounds. Individuals may wait to enter natal streams until others decide to enter, and then large

groups will migrate together to reproduce in high densities (Burgner, 1991). Salmon do not begin

to show signs of senescence during this waiting period, but will quickly lose coloration and

damage fins once entering their spawning site and/or exhibiting reproductive behaviors. The

individuals that arrive to the spawning grounds generally show the slowest rate of senescence,

giving them a longer period to guard their nest site (called a redd) from later breeders, while later

spawners show increased rapidity of senescence (Hendry et al., 2003). Therefore, the arrival date

to the spawning grounds is strongly correlated to longevity of an individual. Additionally, the

  3 
rate of senescence varies between streams and drainages. Although senescence patterns and

mode of death are strongly associated with the depletion of energy stores (Dickhoff, 1989), the

rate of senescence tends to be slower for smaller individuals, which have lower total energy

stores after migration (McPhee and Quinn, 1998). The depletion of stored energy is a possible

explanation for observed phenotypic changes, including: loss of mating coloration, wounds and

frayed fins (a byproduct of aggressive and reproductive behaviors), skin infections, loss of

aggression, and loss of strength. This is then closely followed by death of the individual.

The physiological mechanisms that control rapid senescence in salmon are not fully

understood. It is likely, however, that processes in other species with gradual senescence may be

similar to changes that occur in sockeye salmon. Heat shock proteins in the HSP70 gene family

are known to assist in protein folding as well as for repair or degradation of denatured proteins.

In the nematode, Caenorhabditis elegans, heat shock proteins have been shown to decrease in

expression in old age, possibly leading to increased cellular stress, decreased cell function, and

finally organismal senescence (Lund et al., 2002). Since genes that code for heat shock proteins

are highly conserved across species, I expected to find similar results when looking at gene

expression in sockeye salmon. Another set of genes of interest for this project are

adrenocorticotropic hormone (ACTH) and corticotropin-releasing hormone (CRH), which are

both in the cortisol production pathway. Cortisol is a stress hormone that induces degradation of

tissues throughout the body to provide energy for reproductive activities, but it also suppresses

the immune system, which could produce most of the symptoms of senescence in O. nerka

(Carruth et al., 2000).

This aim of this project was to explore the genetic controls mediating variations in

senescence rates. This was accomplished by comparing two sockeye salmon populations that

  4 
vary in their average rates of senescence to look at differences in gene expression during

senescence. The two sites were chosen for this study because the rates of sockeye salmon

senescence within the two populations are quite different. Hansen Creek, a tributary of Lake

Aleknagik in southwestern Alaska (Figure 1) was chosen as the first site because the salmon in

this system senesce is only 8-10 days. This has been related to the high bear predation at this site,

which has presumably caused an evolutionary shift in energy expenditure from time spent

guarding redds to investment in egg production, resulting in a shorter lifespan. In streams like

Hansen Creek, predators are able to selectively catch significant proportions of pre-senescent

sockeye salmon (usually pre-spawned or only partially-spawned), and individuals tend to show

faster rates of senescence, for the reason described above (Carlson et al., 2007). The ease of

predation at Hansen Creek is due to is shallow depth (average of 10cm) and narrow stream banks

(4m wide throughout), and the age composition is largely composed of ocean age 2 sockeye,

allowing for many of them to be small enough to swim up this shallow stream. The second site

chosen for this study is environmentally quite different from Hansen Creek, with an older cohort

of salmon. It is a series of ponds draining into Pedro Bay of Lake Iliamna in southwestern Alaska

(Figure 2). This site also has high rates of bear predation, but the fish in this system live

significantly longer after beginning reproductive behavior, on the order of 14-19 days. The

average age in these ponds are ocean age 3 or 4. These fish are larger, but live longer than

Hansen Creek fish, in contrast to the earlier described phenomenon of increased longevity with

decreased size shown by McPhee and Quinn, 1998. But some environmental conditions, such as

water temperature, might explain some of the variation in senescence rates between populations.

Lake Iliamna is the largest lake in Alaska, keeping the water temperature much lower than Lake

Aleknagik and its tributaries throughout the summer spawning periods, which may delay

  5 
senescence in Lake Iliamna sockeye salmon. Decreased temperatures have been shown to have

this effect on senescence by possibly decreasing metabolism or some other processes involved in

senescence (Yolanda et al., 2005).

Methods:

Tissue Sampling:

Sockeye salmon aggregate around the stream mouths before entering, during which time

they finish maturation and wait for more individuals to arrive at the spawning grounds. During

this time, they will become reproductively mature, but the onset of rapid senescence will not

begin until after entry into the stream and reproductive behaviors such as aggression or digging

redds has begun (Yolanda et al., 2005). In conjunction with another project in the area, 200

individuals from the mouth of Hansen Creek, as well as from the mouth of the stream draining

the ponds into Lake Iliamna, were captured and tagged with unique plastic disk tags (Floy Tag

Co., Seattle, WA). Daily observations were made of tagged individuals during the spawning

period in Hansen Creek and on every third day at the Iliamna ponds, in order to gather

information on arrival date and the number of days each individual has spent on the spawning

grounds before death by senescence. After the death of the individuals chosen for sampling, I

took length measurements from the mid-eye to hypural plate, depth measurements at the anterior

edge of the dorsal fin, and jaw measurements from the mid-eye to the tip of the snout. This

information was collected in an attempt to correct for any variations in gene expression that was

due to size differences among individuals, rather than in-stream age or level of senescence.

The mouth of Hansen Creek is only a few cm deep, causing many salmon to strand at the

mouth and die from suffocation or from predation by gulls. In order to collect pre-senescent,

  6 
baseline samples, I collected and killed 10 individuals that stranded at the mouth of Hansen

Creek and would have likely died anyways, without my intervention. This ensured that the

individual sampled was fully mature and ready to begin reproductive behavior, as well as a

member of the Hansen Creek population and not a native to one of the other nearby streams.

Immediately after the death of each fish chosen for this study, samples were collected of up to

0.5ml of liver, muscle, and brain tissues and preserved in RNAlater solution. These same tissues

were also collected from fish further upstream, that had completed spawning and exhibited

advanced signs of senescence. Whenever possible, I chose tagged individuals so that I could

know their in-stream residence time before senescence. Signs I looked for in senescent salmon

were frayed fins and wounds on their bodies’, as well as the inability to swim away from me or

hold themselves upright in shallow reaches. They were lying on their sides, vulnerable to gull

and/or bear predation, but still breathing. These same traits/qualities were also looked for in

choosing senescent fish from the Iliamna ponds, allowing for a match in the degree of

senescence, but not in time since the onset of spawning. The days to reach senescence were

calculated by the number of days since the first observation in the stream, and then the average

was calculated for both Hansen Creek and the Iliamna ponds. There will be 10 individuals

sampled for each of the 3 situations described above, with equal quantities of male and female

individuals sampled (depending upon availability of fish meeting requirements listed above).

Gene expression comparisons:

RNA was isolated from all of the brain tissues using the TRI Reagent method. The RNA

samples were then DNased using a TURBO DNA-free kit to remove any possible genomic DNA

that may have been carried over during RNA extraction. The DNased RNA was then reverse

  7 
transcribed to make cDNA and used for subsequent Quantitative real-time PCRs (RT-PCR) to

determine relative concentrations of each gene of interest. The specific genes examined were:

adrenocorticotropic hormone (ACTH), corticotropin-releasing hormone (CRH), and a heat-shock

protein-like protein (HSC71). Growth hormone (GH) and nerve growth factor were also

analyzed, but melting curves from the RT-PCRs showed two peaks for each gene, and so the

results were discarded. Primers for gonadotropin-releasing hormone (GnRH) did not amplify

anything in any of the samples, and so results for this gene were also not analyzed. Sequences for

all primers used are listed in Table 1.

The results of the RT-PCRs were corrected for variations in RNA used in the reactions by

performing another RT-PCR with primers for the 18s ribosomal gene, which has constant levels

of expression throughout the lifetime of the fish. The two senescent groups sampled were tested

for statistical differences against the pre-senescent population, using unpaired t-tests. Due to

large variations in expression levels within each group, additional factors were tested for

correlation with expression levels. The factors tested included: body size, sex, entry date to

spawning grounds, date of senescence, and in-stream life (date of senescence – entry date).

Correlations were tested for significance by performing a linear regression on the data.

Protein level comparisons:

I also compared the concentrations of HSP70 protein among sampling groups. Protein

was extracted from liver tissues using mammalian cell lytic solution, and the concentrations were

quantified using the Bradford method. Protein samples were then diluted in order to equalize

concentrations among all protein samples, and then 20.36µg of protein was loaded into each lane

of a gel. I ran the proteins on an SDS-PAGE to separate the proteins by molecular weight. The

  8 
proteins were then transferred onto a nylon membrane and a Western Blot was performed, using

an antibody that binds to HSP70 from many species. Variations among samples were quantified

using ImageJ software, correcting for any variation in total protein concentration that still

remained. Due to unequal sample sizes within each group, I ran two-tailed unpaired t-tests

between each sampling group to determine statistically significant differences.

Results:

Gene expression comparisons:

Relative expression levels were highly variable among individuals within each sampling

group, showing no significant differences among groups for any of the three genes of interest

(Figure 3).

Comparisons of other factors within each group showed a strongly negative relationship

between stream-life before death by senescence and the relative expression levels of CRH

(Figure 5, p = 0.0036). This relationship could not be determined for senescent individuals from

the Iliamna Ponds because reproductive lifespan was not measured for these individuals. Other

factors explored showed no apparent relationship with expression levels of ACTH, CRH or

HSC71 in either pre-senescent or senescent sampling groups.

Protein level comparisons:

Among Hansen Creek sockeye salmon, HSP70 concentrations were significantly greater

in liver samples from senescent individuals than from pre-reproductive individuals (p<0.001).

Senescent individuals from the Iliamna Ponds also showed a significantly higher HSP70 protein

concentration (p=0.015), but to a lesser extent than the Hansen Creek senescent individuals

(Figure 5), though this was not a statistically significant difference (p=0.136).

  9 
Discussion:

Increased expression levels of CRH in individuals that show more rapid rates of

senescence suggest that CRH is actively involved in the process of senescence. Previous research

has shown that there is a relationship between CRH levels and cortisol concentrations, but due to

other regulating factors on cortisol, this relationship is not as strong as might be expected

(Westring et al., 2008). Westring et al. (2008) also showed that cortisol levels are elevated prior

to spawning and average levels remain at a relatively equal level during the spawning season.

However, this study looked for broad, monthly trends, which could have missed a spike in CRH

or cortisol levels, if this spike only occurred directly preceding the fish’s death by senescence.

The lower levels of heat shock protein (HSP70) in senescent individuals from the Iliamna

Ponds, as compared to Hansen Creek, could be a contributing factor to why the pond population

generally senesces slower after commencing spawning behavior than does the stream population.

This would be in line with the results that CRH levels were higher in individuals that had more

rapid rates of senescence, but further analysis would be needed to determine the validity of this

statement. The results of increased HSP70 expression during senescence was opposite of

previous findings that HSP70 has decreased expression during gradual senescence of

Caenorhabditis elegans (Lund et al., 2002). This suggests that HSP70 levels are associated with

the bodily changes that occur during rapid senescence in O. nerka, but this protein most likely

does not cause the changes, as it is hypothesized to do in C. elegans. I interpret the results of this

study as indicating that HSP70 expression rates increase during senescence to address the

increase in cellular demand for heat shock proteins, due to the rapid degeneration of proteins

within the body. This would suggest that the cellular machinery maintains function as the fish

  10 
ages, rather than gradually failing, as seen in previous studies (e.g. Harman, 1956; Busuttil et al.,

2004).

References:

Burgner, R.L. 1991. Life history of sockeye salmon (Oncorhynchus nerka). In Pacific salmon

life histories (ed. C. Groot & L. Margolis), pp. 3-177. Vancouver: UBC Press.

Busuttil, R.A., M. Dolle, J. Campisi, and J. Vijga. 2004. Genomic Instability, Aging, and

Cellular Senescence. Annals of the New York Academy of Sciences 1019: 245-255.

Carlson, S.M., R. Hilborn, A.P. Hendry, and T. P. Quinn. 2007. Predation by bears drives

senescence in natural populations of salmon. PLoS One

2(12):ed1286.doi:10.1371/journal.pone.0001286.

Carlson, S.M., and T.P. Quinn. 2007. Ten years of varying lake level and selection on size-at-

maturity in sockeye salmon. Ecology 88: 2620-2629.

Carruth, L.L., R.M. Dores, T.A. Maldonado, D.O. Norris, T. Ruth, and R.E. Jones. 2000.

Elevation of plasma cortisol during the spawning migration of landlocked kokanee

salmon (Oncorhynchus nerka kennerlyi). Comparitive Biochemistry and Physiology C-

Toxicology and Pharmacology 127: 123-131.

Dickhoff, W.W. 1989. Salmonids and annual fishes: death after sex. In Development,

maturation, and senescence of neuroendocrine systems: a comparative approach (ed. C.

J. Scanes & M. P. Schriebman), pp. 253-266. New York: Academic.

Harman, D. 1956. Aging: a theory based on free radical and radiation chemistry. Journal of

Gerontology 11: 298–300.

  11 
Hendry, A.P., Y.E. Morbey, O.K. Berk, and J.K. Wenburg. 2003. Adaptive variation in

senescence: reproductive lifespan in a wild salmon population. Proceedings of the Royal

Society 271: 259-266.

Lund, J., P. Tedesco, K. Duke, J. Wang, and S.K. Kim. 2002. Transcriptional profile of aging in

C. elegans. Current Biology 12: 1566-1573.

McPhee, M.V., and T.P. Quinn. 1998. Factors affecting the duration of nest defense and

reproductive lifespan of female sockeye salmon, Oncorhynchus nerka. Environmental

Biology of Fishes 51:369–375.

Westring, C.G., H. Ando, T. Kitahashi, R.K. Bhandari, H. Ueda, A. Urano, R.M. Dores, A.A.

Sher, and P.B. Danielson. 2008. Seasonal changes in CRF-I and urotensin I transcript

levels in masu salmon: Correlation with cortisol secretion during spawning. General and

Comparative Endocrinology 155: 126-140.

Yolanda, E.M., C.E. Brassil, and A.P. Hendry. 2005. Rapid Senescence in Pacific Salmon.

American Naturalist 166: 556–568.

  12 
Tables and Figures:

Table 1. Primers used for quantitative PCRs of cDNA produced from pre-senescent and senescent sockeye
salmon brain tissues.
Gene Forward Primer (5' -> 3') Reverse Primer (5' -> 3')
ACTH CCAAGGCTCAGACCAAGGTA AACGGTTGCAACTGGTCTTC
CRH CAGCGTCTTCTGCAAGGTAA CCGGTTACTATACGCCTGCT
NGF GTAGGCAACAAGACCAAGGC TCGGCTAAGCACACAGACAC
HSC71 AGAGTATGGCTGCCTGGACA TGGGCTTCAATTATGAGCCT
GnRH GGAATACACCGAACGGACAC GTCTCTCTGGGATATGGGCA
GH CAAGTGTCCTCTTCACGCAA TTAGACAATCGGGGATCTGC

Figure 1. Map of Hansen Creek, a tributary of Lake Aleknagik in southwestern Alaska. Adapted from
Carlson and Quinn, 2007.

  13 
Figure 2. Map of Pedro Bay Ponds of Iliamna Lake in southwestern Alaska. Black circle in upper right hand
corner indicates location of ponds.

25  CRH  2.5 
ACTH 

Rela%ve Expression 
Rela%ve Expression 

20  2 

15  1.5 

10  1 

0.5 



Pre‐Senesncent  Hansen  Ponds Senescent 
Pre‐Senescent  Hansen  Ponds 
Senescent 
Senescent  Senescent 

40 
35 
HSC71 
Rela%ve Expression 

30 
25 
20 
15 
10 


Pre‐Senescent  Hansen  Ponds 
Senescent  Senescent 

Figure 3. Corticotropin-releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and
heat-shock protein (HSC71) RNA levels in brain tissue samples from pre-senescent and senescent
groups of sockeye salmon (n=10). No significant differences among groups for any of the 3 genes.

35.0 
30.0  R² = 0.9032 
Rela%ve Expression 

25.0  P = 0.0036 

20.0 
15.0 
10.0 
5.0 
0.0 
3  4  5  6  7  8  9 
In‐stream Life (Days) 
Figure 4. Corticotropin-releasing hormone levels in brain tissue samples from senescent sockeye
salmon collected in Hansen Creek, AK, as compared to their in-stream life before senescence.

  14 
8000 
a  b  b 
7000 
6000 
Band Intensity 

5000 
4000 
3000 
2000 
1000 

Pre‐Senescent  Hansen Senescent  Ponds Senescent 
Sampling Group 
Figure 5. Relative protein levels of HSP70 in liver tissues of pre-senescent and senescent sockeye
salmon (n=10, p<0.02).

  15