You are on page 1of 18

Módulo 8. SISTEMA DE MEMBRANAS INTERNAS.

SÍNTESIS DE PROTEÍNAS
RETÍCULO ENDOPLÁSMICO Y RIBOSOMAS Una de las características más destacadas de la célula de los eucariotes es un laberinto de membranas internas paralelas que rodean al núcleo y que se extienden a distintas partes del citoplasma. Este complejo de membranas ocupa una buena parte del volumen total del citoplasma en algunas variedades celulares y constan de una serie de láminas estrechamente empacadas y plegadas en forma aplanada, de manera que dan origen a diversos compartimientos dentro del citoplasma. Las cavidades formadas por las láminas de las membranas se denominan cisternas (una palabra derivada del latín que significa reservorio). El componente principal de este complejo membranoso es el retículo endoplásmico (RE). En la mayor parte de las células las cisternas del RE parecen estar interconectadas. El RE se continúa con la membrana externa de la envoltura nuclear, de manera que el compartimiento formado entre las dos membranas de la envoltura nuclear está conectado con las cisternas del RE. Las membranas de otros organelos no se conectan físicamente con el RE y parecen formar compartimientos independientes dentro del citoplasma.

Este conjunto de membranas entre las que sobresale el RE recibe el nombre de sistema endomembranoso, o sistema de membranas internas, que incluye además a la envoltura nuclear y a la membrana plasmática, al aparato de Golgi, a los lisosomas, peroxisomas y a las vacuolas de las células vegetales. El sistema endomembranoso consta de una serie de membranas funcionalmente distintas, que se comunican unas con otras. Algunas se conectan físicamente; otras mediante vesículas de transporte que se separan de una membrana y se fusionan con otra. Muchos de los compartimientos membranosos surgen del RE y después avanzan hacia la superficie celular o a otros organelos mediante el complejo de

una molécula elaborada en el lumen del RE que está destinada a ser excretada de la célula se desplaza mediante vesículas de transporte a través de otros compartimientos en el sistema y luego pasa por la membrana plasmática hacia el exterior de la célula por medio de una vesícula secretora. llamada secuencia de señal o . como las células del hígado. que tiene ribosomas en su superficie y por lo tanto en las microfotografías electrónicas ostenta un aspecto rugoso. Los fosfolípidos de los componentes del sistema interno de membranas son transportados a través de vesículas de transporte. en tanto que otras enzimas del RE se localizan en las cisternas. Los fosfolípidos son sintetizados en la cara externa (citosólica). sólo la fosfatidilcolina pasa a la cara interna de la membrana. En algunos casos las membranas sirven de soporte para los sistemas enzimáticos. que constituyen el ámbito físico donde ocurre la síntesis de las proteínas. por ejemplo. No todas las proteínas se sintetizan en la superficie de las membranas del RER. y el RE liso (REL). por lo que la superficie externa de su membrana tiene una apariencia lisa. las proteínas son transferidas a otras membranas mediante pequeñas vesículas de transporte (pequeños sacos limitados por membranas) que se separan del RER y luego se insertan en la membrana correspondiente. El RER juega un papel central en la síntesis de las proteínas de sus propias membranas y en la síntesis de proteínas de otras membranas. Así. Algunas líneas celulares. Los compartimientos de las endomembranas pueden considerarse como contrapartes del exterior de la célula. al igual que en una fábrica hay diferentes áreas para hacer distintas partes de un producto en particular.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 2 Golgi. Retículo Endoplásmico Rugoso (RER) La superficie externa de la membrana externa (citoplásmica) del RER está tapizada de partículas oscuras. ya que estos organelos poseen su propio ADN. Las proteínas secretadas. gracias a un translocador fosfolipídico específico (una “flipasa”). El RE contiene una gran variedad de enzimas que catalizan muchos tipos de reacciones químicas. desde una bacteria hasta las complejas células vegetales y animales. las mitocondrias y cloroplastos. De hecho. que carece de ribosomas. Muchas de las proteínas que la célula exporta (como las enzimas digestivas o las hormonas proteicas) o aquellas destinadas a otros organelos o a la propia membrana plasmática se forman en los ribosomas unidos a la membrana del RER. pero los que corresponden a las membranas de cloroplastos. Los ribosomas se presentan en todos los tipos de células. Hay dos tipos de RE: el RE rugoso (RER). Si bien se sintetizan tanto fosfatidilcolina como el resto de los fosfolípidos. contienen una secuencia de aminoácidos. no hay diferencias aparentes entre partículas de uno y otro sitio. Secuencias de Señal y Ribosomas Enlazados por Membranas Aunque los ribosomas pueden encontrarse libres en el citoplasma o estar unidos a la membrana de RER. Después. En el REL se sintetizan casi todos los lípidos requeridos para la formación de las membranas. En otras células del cuerpo el REL llega a ser un componente menor. que procesan gran parte del colesterol y lípidos del organismo y sirven como uno de los principales sitios de desintoxicación contienen grandes cantidades de REL. incluidos los fosfolípidos y el colesterol . peroxisomas o mitocondrias necesitan que proteínas transportadoras (“carriers”) específicas (“proteínas intercambiadoras de fosfolípidos) los trasladen desde el REL hasta la membrana correspondiente. Retículo Endoplásmico Liso (REL) El REL es el principal sitio de metabolismo de los fosfolípidos. muchas de ellas se sintetizan en los ribosomas que se encuentran libres en el citoplasma o dentro de los organelos transductores de energía. es la proteína la que la que determina si el ribosoma donde se sintetiza debe estar libre o unido a la membrana. los ribosomas. Realiza también una función importante al localizar enzimas desintoxicantes que degradan sustancias químicas como carcinógenos (moléculas que causan cáncer) y los conviertan en moléculas solubles fácilmente excretables por el organismo. esteroles y ácidos grasos . Las dos superficies de la membrana (interna y externa) cuentan con distintos grupos de enzimas y representan regiones celulares con diferentes capacidades de síntesis.

En algunos casos la secuencia de señal es eliminada de la proteína por una peptidasa de señal (localizada en el interior de la membrana del RER) cuando pasa a través de la membrana del RER. compuesto de 2 moléculas de Nacetilglucosamina. que se asocian a la cadena lateral de una de las moléculas de asparagina que forman parte de la proteína que entra al RER. que suele localizarse en la primera parte del polipéptido fabricado por el ribosoma. Las proteínas secretoras no son las únicas que contienen secuencias de señal y que se sintetizan en los ribosomas del RER. La mayoría de las proteínas que se sintetizan en el RER son glicosiladas . que se activa cuando el ribosoma se une a la membrana. que es empujada a través del poro del RER hacia la cisterna. las cuales hacen que algunas proteínas se inserten sólo parcialmente en la membrana del RER. en donde finalmente será empacada en vesículas de transporte para su modificación y secreción. 9 manosas y 3 glucosas. la cual se le une y dirige el ribosoma hacia una proteína que se encuentra fija en la membrana del RER ( receptor de la PRS) y vecina a uno de los poros que existen en el RER. Por el contrario. Es el caso de las proteínas que forman parte de la membrana del propio RER.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 3 péptido señal. por lo que es lo primero que emerge del ribosoma. será sintetizada completamente por los ribosomas libres en el citoplasma. La unión del oligosacárido a la proteína es catalizada por la oligosacariltransferasa. estas proteínas se "atoran" en la membrana. enzima que se encuentra en la cara interna de la membrana del . pero cuando emerge totalmente del ribosoma es reconocida por un complejo de moléculas llamado partícula de reconocimiento de señal (PRS) . La secuencia de señal habitualmente se encuentra en el extremo amino de la cadena polipeptídica. como consecuencia de la adición de un oligosacárido preformado. una de las cuales contendría un sitio para la unión de la secuencia de señal y otro para la unión con el receptor ubicado en la membrana del RER. en otros casos contribuye a la formación de la estructura y función de la proteína y permanece intacta. La PRS está constituida por una molécula de ARN asociada a 6 cadenas polipeptídicas. Mientras se sintetiza la secuencia de señal el ribosoma permanece en el citosol. dejando una porción en la cisterna del RE y otra en el citoplasma. Parece haber señales de alto de transferencia. Algunas proteínas que son parte integrante de la membrana plasmática o que se encuentran en otras partes del sistema endomembranoso también tienen secuencias de señal. si un ARNm codifica a una proteína secretora. también se une al inicio a un ribosoma libre en el citoplasma. Si una proteína carece de la secuencia de señal. Una vez ubicado el ribosoma en el RER se reinicia la síntesis de la cadena polipeptídica.

Muchas de las proteínas secretadas por las células. permitiendo al aparato de Golgi dirigir la proteína hacia diferentes partes de la célula. El aparato de Golgi de las células vegetales también produce una gran variedad de polisacáridos extracelulares utilizados como componentes de la pared celular. que pueden distenderse en ciertas partes y forma vesículas o sacos que se llenan con productos celulares. Después que estas proteínas son sintetizadas por ribosomas unidos al RER se transportan al aparato de Golgi mediante vesículas de transporte formadas en la membrana del RER. En muchas células el aparato de Golgi consta de haces de membrana en forma de platos. luego las proteínas pasan a través de la o las cisternas medias del organelo (también por medio de vesículas de transporte de membrana) y finalmente salen de la cisterna trans del Golgi también en vesículas. los carbohidratos y otras moléculas que se agregan a las proteínas se utilizan como señales de distribución. En algunas células animales el aparato de Golgi se localiza a un lado del núcleo. que en las células vegetales es producida en el exterior de la membrana plasmática. Las proteínas que no están en condiciones son degradadas en el . a excepción de la celulosa. quien descubrió la manera en que podía teñirse específicamente este organelo. en la mayoría de las proteínas destinadas a exportarse las 3 glucosas y una manosa son eliminadas. Estas vesículas se fusionan con la membrana del aparato que está más cerca del núcleo (cisterna cis del Golgi).BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 4 RE (esto explicaría por qué las proteínas citosólicas no son glicosiladas). según las señales complejas que forman parte de la secuencia de aminoácidos de cada cadena polipeptídica. las proteínas glicosiladas en el RE se modifican en diversas formas. Un aspecto importante de señalar es que las proteínas no salen del RER si no están perfectamente plegadas y ensambladas. así como las que se integran a la membrana plasmática y las que son dirigidas a otros organelos del sistema endomembranoso. pasan a través del aparato de Golgi. En algunos casos. modificador y distribuidor de proteínas. Mientras se movilizan a través del aparato de Golgi. Durante su estadía terminal en el RER. en otras células vegetales o animales se encuentran varios aparatos de Golgi. APARATO DE GOLGI: UNA PLANTA PROCESADORA Y EMPACADORA DE PROTEÍNAS El aparato de Golgi fue descripto por vez primera en 1898 por el microscopista italiano Camillo Golgi. El aparato de Golgi funciona sobre todo como un aparato procesador. que constan de pilas separadas de membranas dispersas en la célula.

como los macrófagos y neutrófilos (dos tipos de glóbulos blancos sanguíneos). Parte de las moléculas contenidas en este endosoma son recicladas hacia la membrana o el citosol y el resto siguen su ruta. si son erróneamente empacadas en una vesícula y dirigidas al Golgi. donde son destruidas. El pH del compartimiento lisosomal es logrado por el bombeo de protones por medio de una ATPasa de la membrana. incluyendo lípidos. la señal es reconocida y son enviadas de retorno desde el aparato de Golgi al RER. siendo los más conocidos los anticuerpos (proteínas denominadas colectivamente inmunoglobulinas). glicosidasas. Se sintetizan en el RER y son luego modificadas en el aparato de Golgi.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 5 propio RER. LISOSOMAS En el citoplasma de las células animales se hallan dispersos pequeños sacos de enzimas digestivas denominados lisosomas. Esta región es reconocida por receptores Fc específicos que se hallan en la superficie de los macrófagos y neutrófilos. Otro aspecto interesante es que las proteínas residentes del RER llevan una corta señal que las identifica. que de esta manera inducen la formación de pseudopodios que engloban la bacteria. lipasas. fosfatasas. En estos casos el proceso es mediado por receptores. formando un fagosoma. Las enzimas de estos organelos degradan moléculas complejas. carbohidratos y ácidos nucleicos. En los lisosomas se identifican cerca de 40 enzimas diferentes. La fusión de este fagosoma con un endosoma adulto generará un lisosoma. para evitar ser degradadas por las proteasas del lumen. que funciona así como un órgano de control de calidad. que de acuerdo al tamaño de las partículas ingeridas puede ser dividida en pinocitosis (vesículas <150 nm) y en fagocitosis (partículas >250 nm) y la autofagia. una bacteria) y la recubren. se fusionan con una vesícula proveniente del Golgi que contiene hidrolasas y se forma así un endosoma adulto. que finalmente se transformará en un lisosoma. nucleasas). sulfatasas. fosfolipasas. Las proteínas que integran la membrana lisosomal son altamente glicosiladas. La fagocitosis es un proceso menos frecuente y generalmente ocurre en células especializadas. que se unen a la superficie del organismo infeccioso (por ej. todas hidrolasas que son activas a pH 5 (proteasas. Existen tres caminos de degradación en los lisosomas: la endocitosis. . en donde se identifican y distribuyen en los lisosomas mediante señales únicas de carbohidratos que se unen a las proteínas. originados dentro y fuera de la célula. proteínas. La pinocitosis es un proceso regular de la mayoría de las células: mediante una invaginación de la membrana celular se produce finalmente una pequeña vesícula conteniendo solutos y líquido extracelular. dejando una parte de la molécula libre (la sección Fc). que constituye un endosoma joven.

algunas moléculas presentes en el citosol podrían seguir un camino de degradación que no implica su incorporación a vesículas: en este caso ingresarían directamente a los lisosomas o se adherirían a organelos destinados a convertirse en autofagosomas. a la lesión de las células del cartílago provocada por enzimas liberadas de los lisosomas. Uno puede pensar que este drama intracelular es insignificante (excepto. Scientific American 284 (1): 56-61. Alfred L. donde las proteasas degradan a las proteínas hasta péptidos pequeños que luego son liberados y salen por el otro extremo 1. Una célula típica en el cuerpo cuenta con alrededor de 30. en parte. Hay un conjunto de enzimas especializadas destinadas a “etiquetar” a las proteínas destinadas a ser destruidas uniéndoles moléculas de ubiquitina (varias unidades) en un proceso denominado “ubiquitinación”. mediante el proceso de reconocimiento que efectúan las proteínas de la “tapa” del proteasoma. que deja a las víctimas a merced de los proteasomas. para la infortunada proteína). Estas proteínas son las que están destinadas a unirse a las proteínas condenadas a ser digeridas y que luego las dirigen hacia su destrucción en el interior del cilindro. Pero científicos de muchos laboratorios están ahora encontrando que tales “mataderos” moleculares resultan participantes esenciales en los caminos metabólicos que regulan un enorme repertorio de procesos celulares. quizás. ¿Cómo hacen los proteasomas para conocer cuáles proteínas celulares deben ser degradadas? Las proteasomas actúan únicamente sobre proteínas que han sido previamente marcadas para su destrucción mediante la unión covalente de una proteína denominada ubiquitina (una pequeña proteína de sólo 76 aminoácidos). se relacionan con la existencia de lisosomas "con fugas". Algunas formas de daño tisular. A este sistema de "autodestrucción" se atribuye el rápido deterioro que sufren muchas células después de la muerte. que luego de fusionarse con un endosoma adulto se convierten en lisosomas. Ver “La Cámara Celular de la Muerte” (“The Cellular Chamber of Doom”. Wade Harper. PROTEASOMAS La mayoría de las proteínas que se degradan en el citosol de las células eucarióticas lo hacen a través de grandes complejos de enzimas proteolíticas denominados proteasomas. al igual que acontecimiento propios del envejecimiento. Si bien no está confirmado. January 2001). Cada extremo del complejo está tapado por otro gran complejo proteico que tiene al menos diez tipos de subunidades proteicas. mecanismo por el cual algunos organelos (por ej.000 proteasomas. Un proteasoma consta de un cilindro central formado por proteasas cuyos sitios activos se supone que quedan ubicados hacia el interior de la cámara. Cuando ellos funcionan mal −ya sea que se extralimiten engullendo proteínas importantes o fallando en destruir aquellas que están dañadas o impropiamente formadas− pueden ocasionar la aparición de enfermedades. Stephen J. Elledge & J. 1 . las mitocondrias del hígado. que degradan a la célula en su conjunto. Se cree que la artritis reumatoide se debe. Goldberg.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 6 El tercer tipo de degradación es la autofagia. la membrana lisosómica se rompe y libera hacia el citoplasma enzimas digestivas. Cuando una célula muere. que tienen una vida media de diez días) son envueltos en un trozo de membrana del RE para constituir cuerpos denominados autofagosomas.

En las vacuolas también se almacenan. la vacuola puede funcionar como eficiente compartimiento homeostático. pero limitada exclusivamente a la degradación de las proteínas que la célula ha decidido desechar. contienen una gran variedad de enzimas encargados de diversas reacciones metabólicas: en algunas. Una célula necesita miles de proteínas diferentes en cualquier instante. como mecanismo de defensa. como en la degradación de lípidos. Las células vegetales contienen dos tipos principales de microcuerpos. Estas proteínas deben sintetizarse en . contiene una enzima. las vacuolas por lo común son estructuras de mayor tamaño. regulando por ej. Más de la mitad del volumen de una célula vegetal la ocupa una gran vacuola central que contiene nutrientes. Aunque a veces los términos “vacuola” y “vesícula” suelen usarse como sinónimos. sobre todo en los protistas unicelulares. que utiliza el peróxido de hidrógeno para oxidar otros sustratos. que es una sustancia tóxica para la célula. su inclusión en este módulo obedece a que desempeñan una función similar a la de los lisosomas. Las vacuolas desempeñan otras muchas funciones y de hecho se encuentran en algunas células animales. Una variedad de peroxisoma se encuentra en las hojas e interviene en la fotosíntesis en el proceso denominado fotorrespiración y el otro tipo de microcuerpo es el llamado glioxisoma. Casi todos los protozoarios presentan vacuolas de alimentos o vacuolas digestivas que contienen nutrientes en digestión. incluidos fenoles. el pH celular: si el pH del citosol tiende a disminuir. denominados vacuolas. grandes sacos limitados por una membrana sencilla. MICROCUERPOS Los microcuerpos son organelos delimitados por una membrana . Finalmente. se produce un flujo de protones hacia el interior de la vacuola. algunos compuestos nocivos para los depredadores. microcuerpo en donde ocurren estas reacciones. se produce peróxido de hidrógeno (H2O2). en células de plantas y hongos. Muchas de las funciones que realizan los lisosomas en células animales las efectúan. los cuales hacen que la vacuola parezca casi "vacía" cuando se la observa con el microscopio electrónico. tales productos se agregan y forman pequeños cristales dentro de la vacuola. VACUOLAS Aunque se han identificado lisosomas en la mayor parte de las células animales. formaldehido y alcohol: R’H2 + H2O2 → R’ + 2 H2O Los peroxisomas de las células de hígado y riñón tienen gran importancia en la desintoxicación de algunos compuestos como etanol (componente de las bebidas alcohólicas).BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 7 Si bien los proteasomas no forman parte del sistema de endomembranas. SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la mayoría de las rutas informativas. su presencia en las células vegetales es motivo de controversia. almacenados en la semilla de las plantas. sales. producidas en ocasiones por la fusión de varias vesículas. como las proteínas de reserva en las semillas. pigmentos y productos de desecho. en azúcares . Este contiene enzimas que convierten los lípidos. Las células animales carecen de glioxisomas y por tanto no pueden convertir lípidos en azúcares. la catalasa. También pueden tener vacuolas contráctiles que desalojan el exceso de agua de la célula. En las células vegetales la vacuola también sirve de compartimiento para almacenar compuestos inorgánicos y hasta macromoléculas. Las plantas carecen de un sistema para desalojar los productos de desecho tóxico. RH2 + O2 → R + H2O2 El peroxisoma. Estos azúcares son los que utilizan las plantas jóvenes como fuente de energía y como un componente para sintetizar otros compuestos.

A pesar de esta gran complejidad. las bases deberían estar combinadas en grupos de a tres. con lo que la secuencia inicial de la proteína sería isoleucina-arginina-treonina. U. El primero fue tratar de responder a la pregunta ¿en qué lugar se sintetizan las proteínas?. Cuando se suman los 20.0000 ribosomas. proceso llevado a cabo por enzimas específicas denominadas aminoacil-ARNtsintetasas. en el que empieza un nuevo codón cada tres residuos nucleotídicos. . más del triple de las necesarias. Cada triplete de bases o codón representa a un aminoácido o indica el final de la cadena. uniéndose a una forma de ARN termoestable. C y G). la traducción del tercer marco (UCC-GGA-CUU) daría la secuencia serina-glicina-leucina. las proteínas se fabrican a velocidades vertiginosas. En las células eucarióticas la síntesis proteica requiere la participación de más de 70 proteínas ribosómicas diferentes. El tercer descubrimiento importante tuvo lugar cuando Francis Crick se preguntó de qué modo se traduce el código de cuatro letras representado por las cuatro bases. Una cadena polipeptídica completa de 100 residuos se sintetiza en una célula de Escherichia coli a 37ºC en aproximadamente 5 segundos. los ribosomas. De este modo han de cooperar casi 300 macromoléculas diferentes para sintetizar un polipéptido. La síntesis consume hasta el 90% de la energía química utilizada por la célula en todas las reacciones biosintéticas. sino que son contiguos. el ARNt (ácido ribonucleico de transferencia). CCG al segundo y GAC al tercero. La respuesta se obtuvo al comprobar que el ARNt traduce la secuencia nucleotídica de un ARNm a la secuencia de aminoácidos de un polipéptido. una docena o más de enzimas auxiliares y otros factores específicos para el inicio. que al ser traducido generaría la secuencia de aminoácidos asparagina-prolina-aspártico. ser transportadas a la localización celular adecuada y degradarse cuando ya ha pasado la necesidad de su presencia. quizás unas 100 enzimas adicionales para la modificación de las diferentes clases de proteínas y 40 o más clases de ARN. el segundo CGG y el tercero ACU.000 factores proteicos y enzimas relacionadas y los 200. obviamente. es obvio que hace falta una combinación de ellas para poder expresar a los veinte diferentes aminoácidos que forman parte de las proteínas. Las 4 bases agrupadas de a dos sólo pueden dar 16 combinaciones diferentes (4 2).000 ARNt presentes en una célula bacteriana típica (con un volumen de 100 nm3) ellos representan más del 35% del peso celular seco. Obviamente. En este esquema existen tres marcos de lectura posibles para cualquier secuencia de bases que contenga el ARNm (y. por lo que la secuencia de una proteína está definida por una secuencia lineal de codones contiguos. formando el complejo aminoacil-ARNt. elongación y terminación de polipéptidos. El primer codón de la secuencia establece el marco de lectura. el ADN): AAUCCGGACUUACGUUAACGGUACAGUAC (primer marco) AAUCCGGACUUACGUUAACGGUACAGUAC (segundo marco) AAUCCGGACUUACGUUAACGGUACAGUAC (tercer marco) De acuerdo al primer marco de lectura AAU corresponde al primer aminoácido. El segundo descubrimiento trascendente fue el descubrir que los aminoácidos eran activados en presencia de ATP antes de incorporarse al polipéptido que estaba por sintetizarse . cantidad insuficiente para los 20 aminoácidos proteicos. Experiencias con aminoácidos radioactivos determinaron que se realizaba en una fracción celular de naturaleza ribonucleoproteica. Dado que existen tan sólo cuatro bases diferentes en el ARNm (A. 20 o más enzimas para activar los aminoácidos precursores. El proceso global de síntesis de proteínas guiada por el ARNm es conocido como traducción. los 100. el segundo marco de lectura indica que el primer aminoácido es AUC.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 8 respuesta a las necesidades celulares del momento. Por otra parte los codones no están separados. lo que ofrece 64 posibilidades (4 3). SÍNTESIS PROTEICA Y CÓDIGO GENÉTICO Tres descubrimientos importantes en la década del ‘50 prepararon el escenario para el conocimiento que actualmente se posee del proceso de síntesis de proteínas.

Un gen no interrumpido que codifique una proteína con una masa molecular típica de 60 kDa (alrededor de 500 aminoácidos) requeriría un marco de lectura abierto de 500 o más codones. Los otros tres se identificaron como codones de terminación de cadena. Esto quizás requiere un análisis más detallado. . 2 Una vez establecido el marco de lectura. determinantes de especificidad. De donde resultó que el codón UUU codifica fenilalanina. poli(C). Aminoácido Acido Aspártico Acido Glutámico Arginina Lisina Asparagina Histidina Glutamina Serina Treonina Alanina Glicina Valina Prolina Leucina Fenilalanina Tirosina Isoleucina Metionina Triptofano Cisteína Terminación Abreviatura (3 letras) Asp Glu Arg Lys Asn His Gln Ser Thr Ala Gly Val Pro Leu Phe Tyr Ile Met Trp Cys Abreviatura (1letra) D E R K N H Q S T A G V P L F Y I M W C Codones GAC GAU GAA GAG CGA CGC CGG CGU AGA AGG AAA AAG AAC AAU CAC CAU CAA CAG UCA UCC UCG UCU AGC AGU ACA ACC ACG ACU GCA GCC GCG GCU GGA GGC GGG GGU GUA GUC GUG GUU CCA CCC CCG CCU CUA CUC CUG CUU UUA UUG UUC UUU UAC UAU AUA AUC AUU AUG UGG UGC UGU UAA UAG UGA Varios codones tienen funciones especiales. En algunos virus la misma secuencia produce dos proteínas distintas al utilizar diferentes marcos de lectura. se dice que es un marco de lectura abierto. Prolina. Los otros dos marcos de lectura posibles dentro de un gen normalmente no contienen información genética útil. por lo que las dos primeras letras de cada codón son. Treonina. pero también es el codón que codifica Metionina en posiciones internas en los péptidos . poli(G)]. poli(A). UAG y UGA) no codifican para ningún aminoácido. Con estos y otros métodos se logró asignar 61 de los 64 codones posibles a los diferentes aminoácidos. sino que son codones de terminación (“stop”). pero hay excepciones. Glutamina. Asparagina. puede comprobarse que cuando un aminoácido tiene múltiples codones.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 9 Pero aunque parecía lógico que sólo uno de los tres marcos de lectura posibles contenía probablemente la información requerida para una proteína dada 2. Histidina. Serina y Arginina están representados por 6 codones. Quizás el rasgo más notorio del código es que es degenerado. Lisina. Aspártico. Alanina y Glicina poseen 4 codones. que el poli (A) producía polilisina. los aminoácidos Leucina. El codón de inicio AUG señala el principio de las cadenas polipeptídicas. por lo tanto. en tanto que con 2 codones figuran Fenilalanina. Glutámico y Cisteína. Metionina y Triptofano se identifican por un solo codón y existen 3 codones que indican el fin de la secuencia. Si se observa con atención el cuadro. Las experiencias que permitieron conocerlo pasaron por la síntesis de oligonucléotidos monobásicos [poli(U). Isoleucina es la única que tiene 3 codones. Cuando en un marco de lectura hay un codón de terminación por cada 50 o más codones. el CCC prolina y el GGG glicina. quedaba por resolver cuáles eran las palabras codificantes de tres letras para los diferentes aminoácidos. tanto en procariotas como en eucariotas. que el poli (C) producía poliprolina y que el poli (G) producía poliglicina. en tanto que Valina. De los 64 codones posibles. tres de ellos (UAA. los codones se traducen ordenadamente sin solapamiento ni puntuación hasta que se encuentra un codón de terminación. Como puede verse en el cuadro. Tirosina. con lo que se comprobó que un poli(U) producía un polipéptido integrado exclusivamente por fenilalanina. el AAA lisina. es decir que un aminoácido puede resultar especificado por más de un codón. la diferencia generalmente se encuentra en la tercera base (en el extremo 3’).

Otro aspecto distintivo es que como mínimo cada ARNt tiene ocho bases modificadas. Los ribosomas de células eucariotas tienen tamaños ligeramente mayores. con un diámetro de 18 nm y un coeficiente de sedimentación de 70S (S = unidades Svedberg. en los cuales las dos primeras bases son iguales ( AC en Thr. una de ARNr de 23S y 34 proteínas. que es mayor en las bases púricas que en las pirimídicas). 5. tanto en Arg como en Ser hay dos codones que empiezan con AG. Hay al menos una clase de ARNt para cada aminoácido. cuyo genoma codifica de 10 a 20 proteínas. Val y Pro) están representados por cuatro codones. ESTRUCTURA DE LOS RIBOSOMAS Cada célula de Escherichia coli tiene 15. algunas bacterias y eucariotas unicelulares 3.8S y 28S) y una unidad menor 40S (con un ARNr de 18S) y en conjunto tiene alrededor de 80 distintas proteínas. pero para algunos aminoácidos se requiere más de uno y en general con 32 ARNt diferentes alcanza para reconocer todos los aminoácidos. en tanto que en Ser es de tipo piperidínico (AG C y AGU). . pero en este caso la tercera base es de tipo purínico en Arg (AG A y AGG). Con la misteriosa excepción de unas pocas variaciones encontradas en mitocondrias. El código genético es casi universal . los ARNt tienen entre 73 y 93 residuos nucleotídicos. Los cambios más comunes observados en las mitocondrias y los únicos observados en los genomas celulares tienen que ver con los codones de terminación. en tanto que la subunidad 30S contiene una molécula de ARNr de 16S y 21 proteínas. Aún cuando existen 61 codones diferentes que codifican aminoácidos. muchas de las cuales son derivados metilados de las bases 3 La mayor parte de las variaciones del código aparecen en la mitocondria. pero están igualmente constituidos por dos subunidades. Los dos ARN se aparean de forma antiparalela. Características de los ARN de transferencia (ARNt) Los ARNt son pequeños y consisten en una sola hebra de ARN plegada en una estructura tridimensional precisa (en forma de “hoja de trébol”). Los ribosomas bacterianos están formados por dos subunidades: una mayor (50S) y una menor (30S). Las escasas variantes del código refuerzan el principio de que toda la vida en este planeta ha evolucionado de un código genético único. lo que corresponde a masas moleculares de entre 24 y 31 kDa (los de las mitocondrias son algo menores). Las dos subunidades encajan de tal forma que se forma una hendidura a través de la cual pasa el ARNm a medida que el ribosoma se desplaza a lo largo del mismo durante el proceso de traducción y del que emerge la cadena polipeptídica recién formada. Gly. unidades de sedimentación donde influyen el tamaño y la forma). no existen 61 ARNt. apareándose la primera base del codón (siempre leída en dirección 5’ →‘3’) con la tercera base del anticodón. Sin embargo. de los cuales 4 responden al mismo esquema anterior: CG en Arg. los codones para los aminoácidos son idénticos en todas las especies examinadas. (b) Tres aminoácidos (Arg. dado que muchos de ellos están definidos por las dos primeras bases. la tercera base es irrelevante. se diferencian porque la tercera base es purínica o pirimídica (es decir que lo que priva es el tamaño molecular.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 10 (a) En la tabla puede verse que 5 aminoácidos (Thr. En bacterias y en el citosol de los eucariotas. UC en Ser y CU en Leu. Ala. Su diámetro es de 23 nm y están formados por una subunidad 60S (con tres ARNr: 5S. los otros dos podrían dar lugar a confusión si no se tiene en cuenta la tercera base: así. GU en Val y CC en Pro). Es decir que cuando dos aminoácidos diferentes comparten las mismas dos bases iniciales. GG en Gly. sino solamente 32.000 o más ribosomas (casi ¼ parte del peso seco de la célula) y cada ribosoma contiene un 65% de ARN y un 35% de proteínas. Ser y Leu) tienen 6 codones. GC en Ala. La subunidad 50S contiene una molécula de ARNr 5S. Los ARNt reconocen codones mediante apareamiento de bases entre el codón del ARNm y una secuencia de tres bases de ARNt denominada anticodón.

En el extremo opuesto donde se une el aminoácido se encuentra el anticodón. Este patrón se ha confirmado en numerosos experimentos y es válido para todas las síntesis en todas las células. la secuencia de tres bases que reconoce el sitio adecuado en el ARNm. más complejas que las del “primer” código. En bacterias. hecho que confirma la idea de que ambos organelos se originaron a partir de antepasados bacterianos incorporados simbióticamente a precursores de células eucariotas.OH). el residuo aminoacídico que constituye el inicio de la cadena es la N-formil metionina y en eucariotas el aminoácido inicial es la metionina. cada uno de los 20 aminoácidos se esterifican con sus correspondientes ARNt por medio de enzimas específicas ( aminoacilARNt sintetasas). La mayoría tienen un extremo guanilato (G) en el extremo 5’y todos tienen la secuencia CCA en el extremo 3’. cada una de las cuales especifica para un aminoácido y uno o más ARNt correspondientes. En algunos casos intervienen diez o más nucleótidos específicos en el reconocimiento de un ARNt por su aminoacil-ARNt sintetasa específica. . Inicio de la síntesis polipeptídica La síntesis de polipéptidos empieza siempre en el extremo amino (NH 2) y progresa en el sentido de la síntesis hacia el extremo carboxilo (CO. En la mayoría de los casos hay una aminoacil-ARNt sintetasa para cada ARNt. que tiene lugar en el citosol. Las reglas de “codificación” del segundo código son. que es el extremo donde se unirá el aminoácido. Una aminoacil-ARNt sintetasa no sólo ha de ser específica para un único aminoácido sino también para un ARNt determinado (debe “reconocer” tanto al aminoácido como al ARNt correspondiente). Activación de los aminoácidos.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 11 principales. A la interacción entre las distintas aminoacil-ARNt sintetasas y sus correspondientes ARNt se la ha denominado “segundo código genético” para reflejar este hecho. En el ribosoma no se comprueba la identidad del aminoácido que está unido al ARNt . En mitocondrias y cloroplastos existe un mecanismo similar al descripto en bacterias. que es crítico para el mantenimiento de la precisión de la síntesis de proteínas. Por este motivo la unión del aminoácido correcto a cada ARNt es esencial para la fidelidad de la síntesis proteica en su conjunto. aparentemente. Rol de las aminoacil-ARNt sintetasas En la primera etapa de la síntesis de proteínas.

Esto se debe a que del lado 5’ del ARNm. Elongación de la cadena polipeptídica La tercera fase de la síntesis peptídica (las dos anteriores fueron la activación de los aminoácidos y el proceso de inicio de la síntesis) es la elongación. esto provoca su traslado al sitio P. Aun cuando no se produzca ningún error en la formación de la cadena. dejando el sitio A libre para la ubicación del siguiente aminoácido de la cadena. Los ribosomas tienen dos sitios en los que se fijan aminoacil-ARNt: el sitio peptidilo o sitio P y el sitio aminoacilo o sitio A. Terminación de la síntesis peptídica La cuarta fase de la síntesis peptídica está determinada por la presencia de uno de los tres codones de terminación del ARNm (UAA. La cadena polipeptídica siempre continúa unida al ARNt del último aminoácido incorporado . que contribuirán a la formación de una molécula proteica. en tanto que todos los demás ARNt que transportan los demás aminoácidos que constituyen la cadena se fijan en el sitio A. para la formación de cada enlace peptídico de la cadena polipeptídica completa se requiere al menos de la ruptura de cuatro enlaces fosfato de alta energía. añadiendo una nuevo ejemplo de ribozima. se fija la subunidad ribosómica mayor. (2) la liberación del polipéptido terminado y (3) la disociación de las dos subunidades ribosómicas. El ARNt iniciador (que trae la metionina o la N-formilmetionina. Los polisomas permiten la traducción rápida de un mensaje determinado . es decir de un polímero que es depositario final de la información originalmente contenida en el ADN. Simultáneamente el ARNt desacilado (el que estaba unido a la Nformilmetionina) se desprende del sitio P. El siguiente paso se denomina translocación y consiste en que el ribosoma se desplaza la distancia de un codón hacia el extremo 3’ terminal del ARNm. Esta reacción produce un dipeptidil-ARNt en el sitio A y un ARNt “descargado” en el sitio P. durante el primer paso de la elongación se requiere una molécula de GTP (equivalente al ATP) y finalmente se necesita otro GTP en el paso de traslocación. En el primer paso del ciclo de elongación el siguiente aminoacil-ARNt que transporta el segundo aminoácido se ubica seguidamente en el sitio A del complejo ribosómico. Una vez logrado este ensamble. La fidelidad en la síntesis de proteínas es energéticamente cara . A continuación se forma el primer enlace peptídico entre la N-formilmetionina (unida al sitio P) y el aminoácido incorporado al sitio A. UAG o UGA). Pero debe tenerse en cuenta que no se trata simplemente de la formación de un enlace peptídico cualquiera. La actividad enzimática que cataliza la formación de un enlace peptídico se ha conocido históricamente como “peptidiltransferasa” y fue atribuida a una enzima específica que no había podido ser aislada. a una distancia de unos 8 a 13 pares de bases hay una secuencia constituida por 4 a 9 residuos purínicos que se unirá con la secuencia complementaria del ARNr de la subunidad ribosómica menor. Este ARNt representa la única unión entre el polipéptido en crecimiento y la información del ARNm. preparando la iniciación de un nuevo ciclo de síntesis polipeptídica. es decir la incorporación de sucesivos aminoácidos a la cadena. lo que impide que las dos subunidades ribosómicas se combinen prematuramente. en el orden previsto por la secuencia establecida en los sucesivos codones del ARNm. que desencadenan los siguientes procesos sucesivos: (1) la hidrólisis del enlace peptidil-ARN terminal. En 1992 Noller y colaboradores demostraron que esta actividad estaba a cargo del ARNr más grande de la subunidad mayor.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 12 El inicio de la síntesis comienza con la fijación de un factor de inicio a la subunidad ribosómica menor. volviendo al citosol. A continuación tiene lugar la fijación del ARNm a la subunidad menor. para la activación de cada aminoácido (formación de aminoacilARNt) se requieren dos uniones fosfato aportadas por el ATP. de tal forma que el codón de inicio (AUG) se une en un lugar preciso. sino de la formación de un enlace peptídico entre aminoácidos específicos . según se trate de eucariotas o procariotas) se ubica en el sitio P. Por lo tanto. Debido a que el dipeptidil-ARNt está unido al sitio A. lo que puede parecer un derroche energético.

lo que permite una utilización muy eficiente del ARNm. denominadas modificaciones post-traduccionales. la cadena polipeptídica naciente se pliega y modifica hasta obtener su forma biológicamente activa. No obstante. que fijan calcio). por lo que no aparecen en la proteína final.y carboxilo terminales . Son eliminados por proteasas durante la síntesis en el RER. (3) Modificación de aminoácidos. Inicialmente todos los polipéptidos empiezan con un residuo N-formilmetionina (en procariotas) o metionina (en eucariotas). con lo que la traducción comienza antes de finalizada la transcripción. ya que a medida que le ARNm se va sintetizando comienza casi de inmediato la síntesis de proteínas. treonina y tirosina pueden ser fosforilados (la caseína de la leche contiene muchos grupos fosfoserina. Los residuos C-terminales son también a menudo modificados. Un 50% de las proteínas eucarióticas tienen el extremo N-terminal acetilado. hecho que puede comenzar durante la síntesis o luego de producida ésta. Entre ellas pueden consignarse: (1) Modificaciones amino. Tales agrupamientos. representan diferentes estadios de la traducción de la señal contenida en el ARNm. Los grupos hidroxilo de serina. (2) Pérdida de secuencias señal. pero en la mayoría de los casos son eliminados por reacciones post-traducción. En bacterias el proceso es aún más eficiente. algunas proteínas no obtienen su conformación biológica activa hasta después de haber sufrido una o más reacciones de modificación o maduración. Son péptidos cortos de 15 a 30 aminoácidos que dirigen a la proteína hacia su destino final. Los grupos . denominados polisomas o polirribosomas. Plegamiento y modificación de las cadenas polipeptídicas En la quinta y última fase de la síntesis de proteínas.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 13 Tanto a partir de células procarióticas como eucarióticas se pueden aislar grandes agrupamientos de 10 a 100 ribosomas unidos a la misma molécula de ARNm. que es traducida simultáneamente por muchos ribosomas próximos unos a otros.

se sintetizan como precursores inactivos (proinsulina. La insulina.. Inc. H. BIBLIOGRAFÍA ALBERTS. (8) Formación de puentes disulfuro .o intercatenarias y se supone que ayudan a las proteínas que deben ser exportadas a mantener su estructura nativa. ¿Existe alguna diferencia en cuánto a las funciones del aparato de Golgi en células animales y vegetales? 8. Es frecuente en proteínas extracelulares. (traducido de la 2ª edición inglesa. ZIPURSKY. D.M.¿Qué es un codón y qué tipo de información contiene? ¿Y un anticodón? 15. ¿Qué función cumple la secuencia de señal o péptido señal en una proteína que comienza a ser sintetizada en el citosol? 5. B. ¿Existe alguna relación entre el retículo endoplásmico y la síntesis de proteínas y de lípidos? 4. al igual que la prolina. J.. PURVES. RAFF. tripsinógeno. Editorial Médica Panameicana (traducido de la 6ª edición inglesa. JOHNSON.L. LEHNINGER. 2ª. España. D. (6) Adición de grupos prostéticos. La Célula. Marbán Libros. 6ª.L. ORIANS & H. P.¿Qué es el código genético y con la síntesis de qué tipo de sustancias está relacionado? 13. Garland Publishing. COOPER. An Introduction to the Molecular Biology of the Cell”. D.L.L. Las laminas (proteínas de la lámina nuclear) están modificadas de esta manera. HELLER (2003) “Vida. como ocurre en la formación del colágeno. 2002. Ediciones Omega. G..¿Existe alguna relación entre el código genético y el proceso denominado “traducción”? 14. WALTER (1998) “Essential Cell Biology. Los grupos isoprenilo provienen de la biosíntesis del colesterol. S. ¿Qué son los proteasomas y qué rol cumplen? ¿En qué consiste el proceso denominado “ubiquitinación”? 10. (4) Unión de cadenas laterales glucídicas.. respectivamente) que luego deben ser hidrolizados parcialmente para convertirse en productos biológicamente activos. A. 2001). LEWIS. SADAVA. G. BERK. Edición. ¿Qué es el aparato de Golgi. S. La Ciencia de la Biología”. COX (1993) “Principios de Bioquímica”. CUESTIONARIO TEÓRICO 1. quimotripsinógeno y protocolágeno. A. Biología Celular y Molecular. Pueden ser intra. las proteasas tripsina y quimotripsina y el colágeno. cómo está formado y cuáles son sus funciones? 6. edición (traducido de la segunda edición inglesa. A. M. K. BRAY. 2000).BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 14 aspártico y glutámico pueden recibir grupos amino extras y la lisina es frecuentemente metilada o hidroxilada. (2002). ¿Qué tipo de organelos integran el sistema de membranas internas y cuál es el mecanismo de comunicación habitual entre ellas? 2.¿Existen los lisosomas en los vegetales? ¿Cuál es el papel de las vacuolas en las células vegetales? 11. entre otros ejemplos.¿El código genético es universal o es exclusivo de los organismos más evolucionados? . K. ROBERTS Y P. D. Editorial Médica Panamericana. New York & London. MATSUDAIRA. 2ª edición. 1993).. Un ejemplo de la adición covalente de un grupo prostético luego de la síntesis es el grupo hemo del citocromo c y de la hemoglobina. DARNELL. Se unen covalentemente durante o después de la síntesis a residuos asparagina (oligosacáridos unidos por enlaces N) o a residuos de treonina o serina (oligosacáridos unidos por enlaces O). LODISH. (5) Adición de grupos isoprenilo.H. ¿Qué son los lisosomas. NELSON Y M. Barcelona.W. ¿Cómo definiría al retículo endoplásmico? ¿Es una estructura única o está compuesta de más de un componente? ¿Cuáles son sus funciones? 3.¿Qué tipo de microcuerpos conoce y cuáles son las funciones que desempeñan en las células? 12.C.M. ¿Cuál es el sentido del recorrido de las vacuolas entre el retículo endoplásmico rugoso y el aparatode Golgi : RER → Golgi ó Golgi→ RER? 7.. cómo se forman y cuál es la función que desempeñan? 9. (7) Modificación proteolítica. BALTIMORE & J.

¿Los ribosomas que participan de la síntesis de una proteína determinada pueden participar en la síntesis de otras proteínas diferentes o son exclusivas de aquélla? 19.¿Cuál es el rol de los ARN de transferencia (ARNt)? ¿Por qué se habla de un “segundo código genético en relación a ellos? 20.¿Qué son los polisomas o polirribosomas? ¿Existen diferencias en la síntesis proteica en procariotes y eucariotes? 21.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 15 16. ¿En que consisten las “modificaciones post-traduccionales” que sufren algunas proteínas? .¿Cuántos marcos de lectura pueden existir en un ARN mensajero? ¿Son todos equivalentes en cuanto a la información codificada en ellos? 17.¿Qué es un “codón de inicio” y un “codón de terminación”? 18.

Observación de microfotografías de preparaciones que muestran compomentes del sistema de endomembranas. para esconderlos y protegerlos de los predadores. . . llevar nuevamente con agua destilada hasta obtener una suspensión estimada del 30% de levaduras. Tinción de De Fano.Colocar en un tubo de ensayo 10 ml de agua de charco. La anfiuma es una salamandra acuática de alrededor de 1 m de largo.Tomar una pequeña cantidad de una suspensión de levaduras coloreadas con rojo congo (30% de levaduras y 0. Protocolo experimental.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 16 Módulo 8. Esquematizar. Complejo de Golgi Observación de células epiteliales de estómago de Amphiuma. Los ciliados son organismos unicelulares. Aumento utilizado: 2. TRABAJO EXPERIMENTAL 1. .Observación de vacuolas digestivas en protozoarios ciliados Fundamento.Tomar del tubo dos gotas y colocarlas en un portaobjetos.Observaciones en preparaciones fijadas y coloreadas.Colocar un cubreobjeto y observar al microscopio. Haga un esquema de la observación microscópica dentro del círculo adjunto. . Calentar a baño maría durante 10 minutos para matar las levaduras. de rojo congo. .3%de colorante). Preparación de levaduras teñidas con rojo congo: A 3 g de levaduras agregarles 10 ml de agua destilada y 3 mg. La vacuola digestiva (con las levaduras en su interior) se fusionan con los lisosomas y por la acción de las enzimas hidrolíticas que se encuentran en su interior.Concentrar los ciliados centrifugando a 2000 rpm durante 5 minutos. las levaduras son digeridas Este proceso de digestión celular se pone de manifiesto por el cambio de color del colorante rojo congo. . Aumento utilizado: 3. . Si se evapora mucho el agua. En las levaduras muertas el rojo congo presenta un color rojo (por encima de pH=5) pero cuando las vacuolas digestivas se fusionan con los lisosomas. que tienen pH más ácido.Resuspender el precipitado con agitación. dejando en el tubo aproximadamente 1 ml. . La eclosión de los huevos ocurre cinco meses después de la deposición. este vira al púrpura y luego al azul a pH=3. que por intermedio del proceso de fagocitosis pueden digerir a las levaduras (hongos unicelulares). sumergiendo el extremo de un palillo en dicha suspención y mezclarla con las gotas del agua de charco hasta que adquiera un color rosa pálido.Descartar la mayor parte del sobrenadante. puede pasar etapas sobre la tierra. Como todo anfibio. pero deposita los huevos (cerca de 200) en aguas poco profundas bajo restos vegetales.

La movilidad electroforética µ es la relación de la velocidad de la molécula (v) y el potencial eléctrico (E). Un parámetro importante a considerar en la electroforesis de aminoácidos y proteínas es su punto isoleléctrico (pI). Sumergir en el buffer las tiras durante diez minutos y luego secarlas entre papeles de filtro Colocar el buffer en la cuba electroforética Extender las tiras sobre el puente de la cuba. Colorante: Amidoschwarz 10B. cellogel) o dentro de un gel (agarosa. 3. Transparentizante: metanol/ácido acético/glicerol. de acuerdo al pH del buffer de electroforesis utilizado. Equipamiento: Cuba electroforética y Fuente de poder CUBA ELECTROFORÉTICA tapa tira de papel o cellogel buffer + ánodo + fuente de poder cátodo – _ buffer Reactivos: Buffer de corrida: Veronal . 7.ELECTROFORESIS DE PROTEÍNAS SÉRICAS SOBRE TIRAS DE CELLOGEL Fundamento Si se aplica un campo eléctrico a una solución que contiene una molécula con carga neta (+ o −). Decolorante: ácido acético al 5%. ya sea sobre un soporte (papel. También es igual a la carga neta de la molécula (Z) dividida por el coeficiente friccional (f). con lo que migrará hacia el polo positivo (ánodo) y viceversa. Técnica: 1. 4. su tamaño y su forma. mayor será la movilidad de la molécula. 6. ésta migrará a una velocidad que depende del valor de su carga.veronal sódico. por el contrario. Deshidratante: metanol puro. 8. si el pH es menor que el pI la carga de la molécula será positiva. ácidos nucleicos). 3. con la superficie permeable hacia arriba Sembrar la muestra a un centímetro del borde Conectar la fuente de poder de tal modo que el polo negativo quede en el lado de la siembra y correr durante 75 minutos Desconectar la fuente de poder Secar las tiras y sumergirlas en la solución colorante durante cinco minutos Sumergir tres o cuatro veces en solución decolorante Sumergir las tiras en el deshidratante durante treinta minutos . 9. conoceremos la carga de la molécula.6. la muestra se sembrará en uno u otro polo: si la molécula tiene carga negativa se sembrará cerca del polo negativo (cátodo).BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 17 Durante el práctico los alumnos deberán observar microfotografías e identificar la ultraestructura de los distintos componentes presentes en diferentes tipos celulares. 2. pH 8. denominada electroforesis. Esta técnica. De esta manera. que es la resistencia que el gel opone al movimiento de la partícula. 5. se utiliza para separar mezclas de moléculas cargadas (proteínas. µ=v/E=Z/f En la fórmula puede verse que a mayor carga eléctrica. Cuando el pH es mayor que el pI la molécula tendrá carga negativa. ya que conociendo el pI y el pH del medio. almidón o poliacrilamida).

. Colocarlas sobre una placa de vidrio adhiriéndolas bien y dejar en estufa durante unos minutos 12.BIOLOGÍA / Módulo 8 / Sistema de Membranas Internas 18 10. Pasarlas a la solución transparentizante durante un minuto 11. Observar las bandas e interpretar los resultados.