You are on page 1of 36

Nome

Srie / Ano

Ensino

Turma

3
Disciplina Professor Natureza Cdigo / Tipo Trimestre / Ano

EM
Data

Biologia
Tema

Juliano Roteiro de Estudos de Frias


Orientaes Gerais:

2/2012

Faa uma reviso cuidadosa de alguns conceitos importantes sobre o ncleo celular (captulo 08), sobre as divises celulares (captulo 08) e da gentica (captulos 22 e 23) Orientaes para o estudo: Organize o seu tempo; estude um pouco em vrios dias e no tudo de uma vez s. Procure reler os captulos do livro, os slides e as suas anotaes de aula. Elabore resumos e mapas esquemticos para organizar as ideias. (Re)faa os exerccios do livro e as suas provas, procurando compreender onde voc errou anteriormente.

Testes:
1. (Uel 2011) Em 1953, James Watson e Francis Crick elucidaram a estrutura tridimensional da dupla hlice de DNA e postularam que o pareamento especfico de bases nitrogenadas sugere um possvel mecanismo de cpia para o material gentico. Baseado neste postulado, o processo de duplicao do DNA considerado como sendo semiconservativo porque: a) A dupla-hlice original permanece intacta e uma nova dupla-hlice formada. b) Os dois filamentos da dupla-hlice original se separam e cada um serve como molde para uma nova fita. c) Ambos os filamentos da dupla-hlice original se fragmentam e servem como moldes para sntese de novos fragmentos. d) Um dos filamentos da dupla-hlice original serve de cpia para as duas fitas de DNA. e) Os filamentos da dupla-hlice original permutam as suas fitas para servirem de cpias de DNA.

2. (Unicamp 2011) Considere um indivduo heterozigoto para trs genes. Os alelos dominantes A e B esto no mesmo cromossomo. O gene C tem segregao independente dos outros dois genes. Se no houver crossing-over durante a meiose, a frequncia esperada de gametas com gentipo abc produzidos por esse indivduo de a) 1/2. b) 1/4. c) 1/6.

d) 1/8. 3. (Uff 2011) Aps o anncio histrico da criao de vida artificial no laboratrio do geneticista Craig Venter, o mesmo responsvel pela decodificao do genoma humano em 2001-, o presidente dos EUA, Barack Obama, pediu a seus conselheiros especializados em biotecnologia para analisarem as consequncias e as implicaes da nova tcnica.
(O Globo on line, 22/05/2010)

A experincia de Venter ainda no explica como a vida comeou, mas refora novamente que, sob determinadas condies, fragmentos qumicos so unidos para formar a principal molcula responsvel pelo cdigo gentico da vida. Para a sntese de uma molcula de DNA em laboratrio, a partir de uma fita molde de DNA, alm do primer, deve-se utilizar a) nucleotdeos de Timina, Citosina, Guanina e Adenina; DNA e RNA polimerase. b) nucleotdeos de Timina, Citosina, Guanina e Uracila; e DNA polimerase. c) nucleotdeos de Timina, Citosina, Guanina e Adenina; e DNA polimerase. d) nucleotdeos de Timina, Citosina, Guanina e Uracila; e RNA polimerase. e) nucleotdeos de Timina, Citosina, Guanina, Uracila e Adenina; e DNA polimerase. 4. (Ufla 2010) Em relao aos processos de diviso celular, mitose e meiose, analise as proposies abaixo e, a seguir, assinale a alternativa CORRETA. I A orientao ao acaso dos cromossomos homlogos, para os polos opostos da clula, ocorre na metfase II da meiose. II Na anfase da mitose, ocorre a segregao cromatdica. III A duplicao do DNA ocorre no perodo S da interfase nas clulas que sofrero mitose ou meiose. IV A permuta gentica (crossing-over) ocorre no paquteno da prfase I da meiose. a) Apenas as proposies I, III e IV esto corretas. b) Apenas as proposies I, II e III esto corretas. c) Apenas as proposies I, II e IV esto corretas. d) Apenas as proposies II, III e IV esto corretas. 5. (Pucrj 2010) Como consequncia de uma mutao hipottica em uma molcula de RNA mensageiro, podemos esperar que ocorram diversas mudanas, exceo de alteraes: a) na transcrio reversa desse RNA para DNA. b) na autoduplicao do DNA que o originou. c) na traduo dessa molcula de RNA. d) moleculares em protenas estruturais originadas desse RNA. e) funcionais em protenas enzimticas originadas desse RNA. 6. (Ufrgs 2010) A cor da pelagem em coelhos causada por quatro alelos diferentes do gene c: os alelos selvagem, chinchila, himalaia e albino. O alelo tipo selvagem totalmente dominante em relao aos demais; o alelo chinchila apresenta dominncia incompleta em relao ao alelo albino e codominncia em relao ao alelo himalaia. O alelo himalaia, por sua vez, totalmente dominante em relao ao alelo albino.
2

De acordo com essas informaes, quantos diferentes fentipos podem ser encontrados para a pelagem de coelhos? a) 2. b) 3. c) 4. d) 5. e) 6. 7. (Udesc 2009) Assinale a alternativa correta relacionada lei de segregao independente estabelecida por Gregor Mendel. a) Gametas parentais so aqueles que apresentam as novas combinaes gnicas resultantes da permutao. Gametas recombinantes so os que apresentam as combinaes gnicas noresultantes da permutao. b) Os filhos de um homem de olhos castanho-claros (AaB e de uma mulher, podero apresentar para a mesma caracterstica fentipo castanho-claro, castanho-escuro, castanho-mdio, azul e verde . c) A proporo genotpica 9:3:3:1. d) A herana da cor dos olhos na espcie humana explicada pela primeira Lei de Mendel. e) A cor da pelagem dos ces e da plumagem dos periquitos uma situao de herana quantitativa. 8. (Uel 2009) Na cultura do pepino, as caractersticas de frutos de cor verde brilhante e textura rugosa so expressas por alelos dominantes em relao a frutos de cor verde fosco e textura lisa. Os genes so autossmicos e ligados com uma distncia de 30 u.m. (unidade de mapa de ligao). Considere o cruzamento entre as plantas duplo heterozigotas em arranjo cis para esses genes com plantas duplo homozigotas de cor verde fosca e textura lisa. Com base nas informaes e nos conhecimentos sobre o tema, considere as afirmativas a seguir, com as propores esperadas destes cruzamentos. I - 15% dos frutos sero de cor verde fosco e textura rugosa. II - 25% dos frutos sero de cor verde fosco e textura lisa. III - 25% dos frutos de cor verde brilhante e textura lisa. IV - 35% dos frutos sero de cor verde brilhante e textura rugosa. Assinale a alternativa CORRETA. a) Somente as afirmativas I e IV so corretas. b) Somente as afirmativas II e III so corretas. c) Somente as afirmativas III e IV so corretas. d) Somente as afirmativas I, II e III so corretas. e) Somente as afirmativas I, II e IV so corretas. 9. (Fatec 2009) Em 1993, Kary Mullis, um geneticista ao servio da Cetus, uma empresa de Biotecnologia da Califrnia, recebeu o prmio Nobel da Qumica pelo desenvolvimento de um mtodo que permite sintetizar, em poucas horas e in vitro, uma grande quantidade de um determinado fragmento de DNA. Esta tcnica faz parte integrante da moderna biotecnologia molecular, tendo trazido um enorme progresso para vrias reas, como o diagnstico de doenas e medicina forense.

Com base em seus conhecimentos sobre a molcula de DNA e sua duplicao, assinale a alternativa correta. a) O processo de duplicao do DNA conhecido como semiconservativo, pois a "molcula-me" do DNA, que serve de modelo, origina uma molcula de DNA, com duas novas cadeias de nucleotdeos. b) As cadeias do DNA so separadas pelo rompimento das pontes de hidrognio que fazem a ligao entre as bases, num processo catalisado por enzimas. c) As pontes de hidrognio que unem ambas as fitas do DNA se formam entre as bases nitrogenadas, representadas pelas letras A, C, G e U. d) Quando as pontes de hidrognio em uma molcula de DNA so quebradas obtm-se riboses livres. e) A polimerase do DNA uma enzima que atua na produo de nucleotdeos. 10. (Ufpa 2008) O perodo que precede a mitose denominado de intrfase. Nessa fase ocorre a duplicao do DNA, evento que garante a transmisso das informaes existentes na clula original para cada uma das clulas-filhas. A duplicao do DNA origina a formao de pares de a) cromtides-irms presas uma outra pelo centrmero. b) cromossomos homlogos ligados pelos quiasmas. c) nuclolos portadores de genes alelos. d) cromossomos duplos, cada um com uma cromtide. e) cromatinas diploides dispersas no nuclolo. 11. (Uece 2008) Suponha que determinada planta produza flores brancas, vermelhas, rseas e cremes. A cor branca condicionada por um alelo (a) que inibe a produo do pigmento creme sem, contudo, inibir a produo do pigmento vermelho; porm interage com o alelo que o produz (alelo para vermelho) para expressar a cor rsea. O alelo (A) dominante para condicionar a produo de pigmentos. Um outro par de alelos condiciona a produo de pigmentos e, quando recessivo, condiciona a cor creme; quando dominante condiciona a cor vermelha. A razo fenotpica de flores brancas e de flores cremes que esperada, de um cruzamento do duplo heterozigoto AaCc X AaCc , respectivamente:

a) b) c) d)

1/16 e 3/16 3/16 e 1/16 3/16 e 3/16 1/16 e 1/16


4

12. (G1 - uftpr 2008) Na espcie humana existem vrias caractersticas cuja herana provm de um par de alelos com relao de dominncia completa. Na forma do lobo da orelha o alelo dominante responsvel pelo lobo solto e o alelo recessivo pelo lobo preso. A capacidade de enrolar a lngua tambm determinada por um par de alelos situados em outros cromossomos autossmicos, onde o alelo dominante determina essa capacidade. A probabilidade de nascer um descendente com o lobo da orelha preso e a capacidade de enrolar a lngua de um casal onde ambos so heterozigotos para as duas caractersticas : a) 12/16 b) 9/16 c) 4/16 d) 3/16 e) 1/16 13. (Pucsp 2008) No ciclo de vida de uma samambaia ocorre meiose na produo de esporos e mitose na produo de gametas. Suponha que a clula-me dos esporos, presente na gerao duradoura do ciclo de vida dessa planta, seja heterozigota para dois pares de genes, AaBb, que se segregam independentemente. Considerando que um esporo formado pela planta apresenta constituio gentica AB e que a partir desse esporo se completar o ciclo de vida, espera-se encontrar constituio gentica a) ab nas clulas da gerao esporoftica. b) AB nas clulas da gerao gametoftica. c) ab em um anterozoide (gameta masculino). d) AB em um zigoto. e) ab em uma oosfera (gameta feminino). 14. (Uel 2008) Ana possui olhos amendoados e clios compridos e um charmoso "furinho" no queixo, que deixam o seu rosto bastante atraente. Estas caractersticas fenotpicas so as mesmas da sua me. J o seu pai tem olhos arredondados, clios curtos e no tem "furinho" no queixo. Ana est grvida e o pai da criana possui olhos arredondados, clios curtos e com um "furinho" no queixo. Estas caractersticas so controladas por genes com segregao independente. Os alelos dominantes: A controla o formato de olhos amendoados, C os clios compridos e F a ausncia do "furinho". Qual o gentipo da Ana e a probabilidade de que ela tenha uma filha com olhos arredondados, clios compridos e "furinho" no queixo? a) Gentipo da Ana AA CC ff e a probabilidade do filho desejado 3/4. b) Gentipo da Ana Aa Cc ff e a probabilidade do filho desejado 1/4. c) Gentipo da Ana Aa CC ff e a probabilidade do fi.lho desejado 1/4. d) Gentipo da Ana AA Cc ff e a probabilidade do filho desejado 3/4. e) Gentipo da Ana Aa Cc ff e a probabilidade do filho desejado 1/16.

15. (Uel 2008) Um agricultor familiar, que contra o uso de transgnicos, conserva a tradio de seus pais de cultivar e produzir sementes de uma variedade antiga de milho com endosperma branco. O vizinho deste agricultor plantou sementes de um hbrido de milho com locos homozigticos para endosperma amarelo e para transgnico (que confere resistncia a uma praga). As lavouras de milho destes dois agricultores floresceram juntas e houve uma elevada taxa de cruzamento entre elas. Na
5

poca da colheita, o agricultor familiar ficou decepcionado ao verificar a presena de sementes com endospermas amarelos e brancos nas espigas da variedade antiga, evidenciando a contaminao com o hbrido transgnico. O agricultor resolveu plantar as sementes destas espigas contaminadas em dois lotes, sendo as sementes amarelas no Lote I e as brancas no Lote II, suficientemente isoladas entre si e de outros lotes de milho. Quais seriam as frequncias esperadas de sementes brancas e no portadoras do gene transgnico produzidas em cada lote, considerando que a cor amarela da semente de milho dominante e condicionada pelo gene Y (yellow)? Assinale a alternativa correta. a) Frequncia 1 no Lote I e 1/16 no Lote II. b) Frequncia 9/16 no Lote I e 3/16 no Lote II. c) Frequncia 1/16 no Lote I e 1 no Lote II. d) Frequncia 1/16 no Lote I e 9/16 no Lote II. e) Frequncia 3/16 no Lote I e 9/16 no Lote II. 16. (Uece 2007) Sabe-se que em porquinhos da ndia o padro "pelos lisos" domina sobre o padro "pelos arrepiados", enquanto a cor negra domina sobre a cor branca, estando os genes determinantes destas caractersticas situados em pares de cromossomos homlogos diferentes. Cruzando-se porquinhos com padro liso e de colorao negra, ambos heterozigotos para os dois 'loci', pode-se afirmar, corretamente, que a razo fenotpica de porquinhos arrepiados e brancos de a) 9:16 b) 3:8 c) 3:16 d) 1:16 17. (Pucsp 2007) De acordo com a segunda lei de Mendel, o cruzamento AaBbCc aabbcc ter chance de produzir descendentes com gentipo AaBbCc igual a a) 1/2 b) 1/4 c) 1/8 d) 1/16 e) 1/64 18. (Ufu 2007) Considere as informaes a seguir. A incompatibilidade entre os grupos sanguneos humanos deve-se a reaes imunolgicas entre anticorpos presentes no plasma sanguneo (aglutininas) e glicoprotenas presentes nas superfcies dos eritrcitos (aglutinognios). Assim, o sistema ABO apresenta dois tipos de aglutinognios denominados A e B e, dois tipos de aglutininas, anti-A e anti-B. Analise o quadro que se segue.

Marque a alternativa que o preenche corretamente o quadro anteiror. a) I - A; II - B; III - anti-A; IV - anti-B; V - ausente. b) I - B; II - A; III - anti-B; IV - anti-A; V - anti-A e anti-B. c) I - A; II - B; III - anti-B; IV - anti-A; V - anti-A e anti-B. d) I - A; II - B; III - anti-A; IV - anti-B; V - anti-A e anti-B. 19. (Unesp 2007) Em um acidente de carro, trs jovens sofreram graves ferimentos e foram levados a um hospital, onde foi constatada a necessidade de transfuso de sangue devido a forte hemorragia nos trs acidentados. O hospital possua em seu estoque 1 litro de sangue do tipo AB, 4 litros do tipo B, 6 litros do tipo A e 10 litros do tipo O. Ao se fazer a tipagem sangunea dos jovens, verificou-se que o sangue de Carlos era do tipo O, o de Roberto do tipo AB e o de Marcos do tipo A. Considerando apenas o sistema ABO, os jovens para os quais havia maior e menor disponibilidade de sangue em estoque eram, respectivamente, a) Carlos e Marcos. b) Marcos e Roberto. c) Marcos e Carlos. d) Roberto e Carlos. e) Roberto e Marcos. 20. (Ufpel 2007) Os quatro fentipos do sistema sanguneo ABO so determinados por trs alelos mltiplos denominados IA, IB e i. Os alelos IA e IB so dominantes em relao ao alelo i, sendo a relao de dominncia escrita da seguinte forma: IA = IB > i.
AMABIS, J.M.; MARTHO, G.R. "Conceitos de Biologia". V.3. So Paulo: Ed. Moderna, 2001.

Com base no texto e em seus conhecimentos sobre a herana do sistema sanguneo ABO, analise as seguintes afirmativas. I. Os alelos IA e IB apresentam co-dominncia, pois ambos se expressam na condio heterozigtica e produzem, respectivamente, os aglutinognios A e B. II. O alelo i determina a ausncia de aglutinina no sangue, portanto o gentipo ii corresponde ao sangue tipo "O", sem aglutinina anti-A e anti-B. III. Um homem com o sangue tipo "B" poder ter filhos com o sangue tipo "A", desde que seja heterozigoto, e somente com uma mulher com sangue do tipo "A" (homozigota ou heterozigota). IV. Um casal pode ter filhos com os quatro tipos sanguneos, desde que um dos cnjuges tenha o sangue do tipo "A" e o outro do tipo "B" e que ambos sejam heterozigotos.

Esto corretas apenas as afirmativas a) II e III.


7

b) c) d) e)

I e IV. I e III. II e IV. III e IV.

21. (Fatec 2007) Considere os seguintes dados: - menino de tipo sanguneo A, Rh-; - me de tipo sanguneo B, Rh-; - pai sem aglutininas do sistema ABO no sangue, mas possuidor do antgeno Rh. A probabilidade de os pais desse menino terem mais um filho com o mesmo fentipo de seu irmo, levando em conta o sexo, o grupo sanguneo e o fator Rh de a) 1/16 b) 1/12 c) 1/8 d) 1/4 e) 1/2 22. (Ufpel 2007) Um dos principais problemas em cirurgias de emergncia - a falta de sangue compatvel com o da vtima para transfuses - pode estar prestes a ser resolvido. Uma equipe internacional de pesquisadores descobriu uma maneira de converter sangue dos tipos A, B e AB, que hoje podem ser doados apenas com restrio, no tipo O. Os cientistas descreveram o uso de novas enzimas que "limpam" esses tipos sanguneos de seus antgenos, tornando-os viveis para qualquer tipo de transfuso. Esta possibilidade liberaria os hospitais da dependncia do tipo O. "O Estado de S. Paulo"
(http://www.universia.com.br/noticia/materia_clipping.jsp?not=36754, acessado em 20/04/2007).

Com base no texto e em seus conhecimentos, desconsiderando o fator RH, correto afirmar que, atravs da nova tecnologia, a) uma pessoa com sangue tipo "O" poderia receber sangue de qualquer outro grupo sanguneo, pois os sangues tipo "A", "B" e "AB" no apresentariam aglutinognios "A" e "B" nas hemcias; no ocorreriam, portanto, reaes de aglutinao. b) uma pessoa com sangue tipo "O" poderia receber sangue de qualquer outro grupo sanguneo, pois os sangues tipo "A", "B" e "AB" no apresentariam aglutininas anti-A e anti-B no plasma; no ocorreriam, portanto, reaes de aglutinao. c) uma pessoa com sangue tipo "A" poderia receber sangue, alm do tipo "O" e "A", dos tipos "B" e "AB", pois os anticorpos anti-A e anti-B, presentes nas hemcias do sangue desses grupos sanguneos, seriam neutralizados. d) uma pessoa com sangue tipo "B" poderia receber sangue, alm do tipo "O" e "B", dos tipos "A" e "AB", pois os aglutinognios "A" e "B", presentes no plasma do sangue desses grupos sanguneos, seriam neutralizados. e) todos os grupos sanguneos seriam doadores universais, pois seriam eliminados os aglutinognios anti-A e anti-B das hemcias e as aglutininas A e B do plasma; no ocorreriam mais reaes de aglutinao. 23. (Fuvest 2007) Em ces labradores, dois genes, cada um com dois alelos (B/b e E/e), condicionam as trs pelagens tpicas da raa: preta, marrom e dourada. A pelagem dourada condicionada pela
8

presena do alelo recessivo e em homozigose no gentipo. Os ces portadores de pelo menos um alelo dominante E sero pretos, se tiverem pelo menos um alelo dominante B; ou marrons, se forem homozigticos bb. O cruzamento de um macho dourado com uma fmea marrom produziu descendentes pretos, marrons e dourados. O gentipo do macho a) Ee BB. b) Ee Bb. c) ee bb. d) ee BB. e) ee Bb. 24. (Ufrgs 2007) Em uma espcie de peixes de aqurio, aparecem trs padres distintos de colorao na nadadeira dorsal: negra, rajada e amarela. Esses padres so resultantes das combinaes de trs diferentes alelos de um mesmo loco. No quadro a seguir, esto representados trs cruzamentos entre peixes com padres de colorao distintos para nadadeiras e suas respectivas geraes F1 e F2. Se um macho da F1 do cruzamento 3 cruza com uma fmea da F1 do cruzamento 1, quais as propores de colorao das nadadeiras dorsais esperadas para os descendentes? a) 50% de indivduos com nadadeiras negras e 50% de indivduos com nadadeiras rajadas. b) 75% de indivduos com nadadeiras negras e 25% de indivduos com nadadeiras amarelas. c) 75% de indivduos com nadadeiras negras e 25% de indivduos com nadadeiras rajadas. d) 50% de indivduos com nadadeiras negras e 50% de indivduos com nadadeiras amarelas. e) 100% de indivduos com nadadeiras negras. 25. (Uel 2007) Em uma populao de organismos diploides, foram encontrados quatro alelos diferentes para um determinado locus gnico, denominados S1, S2, S3 e S4. A figura a seguir mostra, esquerda, as diferenas na sequncia de DNA que caracterizam cada um desses alelos e, direita, o par de cromossomos homlogos (metafsicos) onde esse gene encontrado. Diante dessas informaes, se um nico indivduo desta populao for escolhido ao acaso, qual combinao alelo/posio cromossmica poderia ser encontrada no par de cromossomos metafsicos deste indivduo?

26. (G1 - cftce 2006) Em relao diviso celular, CORRETO afirmar


9

que: a) no tem nenhuma associao com o processo reprodutivo dos seres vivos. b) trata-se apenas da separao de uma clula em duas metades. c) associa-se intimamente distribuio dos cromossomos nas clulas-filhas. d) um processo mais simples, quando ocorre em clulas eucariticas. e) um processo mais simples em clulas procariticas devido maior quantidade de cromossomos. 27. (Fuvest 2006) Um indivduo heterozigtico em dois locos: AaBb. Um espermatcito desse indivduo sofre meiose. Simultaneamente, uma clula sangunea do mesmo indivduo entra em diviso mittica. Ao final da interfase que precede a meiose e a mitose, cada uma dessas clulas ter, respectivamente, a seguinte constituio gentica: a) AaBb e AaBb. b) AaBb e AAaaBBbb. c) AAaaBBbb e AaBb. d) AAaaBBbb e AAaaBBbb. e) AB e AaBb. 28. Dissertativa - (Ufpb 2006) No esquema a seguir, a clula I representa uma clula diploide com um par de cromossomos homlogos, e as setas indicam os eventos caractersticos de ciclos celulares: fase S da interfase e as divises celulares, mitose e meiose. De acordo com os eventos caractersticos da fase S do ciclo celular e das divises celulares representadas na figura, assinale a alternativa que indica a forma como o espao vazio da(s) clula(s) preenchido por cromossomos:

10

29. (Unesp 2006) O grfico representa as mudanas (quantitativas) no contedo do DNA nuclear durante eventos envolvendo diviso celular e fecundao em camundongos.

Os intervalos C-D, L-M e P-Q correspondem, respectivamente, a fases em que ocorrem a a) replicao, meiose II e mitose. b) meiose I, meiose II e replicao. c) mitose, meiose I e fecundao. d) mitose, meiose I e meiose II. e) mitose, meiose II e fecundao. 30. (Pucpr 2006) Durante o processo de diviso celular por mitose, em que uma clula-me origina duas clulas-filhas iguais, ocorrem os eventos listados a seguir: I. Incio da condensao cromossmica. II. Diviso dos centrmeros e separao das cromtides dos cromossomos. III. Citocinese. IV. Os cromossomos ficam posicionados no plano equatorial da clula. Qual a sequncia correta de tais eventos para que a mitose tenha sucesso? a) I, II, IV e III. b) I, II, III e IV. c) I, IV, II e III. d) III, II, I e IV. e) II, I, III e IV. 31. (Ufpe 2006) Analise as proposies (colocando V ou F) aps observar cuidadosamente a ilustrao do ciclo celular definido para indivduos (2n) de uma determinada espcie biolgica. ( ) Os perodos: de crescimento celular ps-diviso; de duplicao do material gentico; e de complementao do crescimento celular pr-diviso, esto indicados, respectivamente, em (1), (2) e (3). ( ) Uma clula 2n = 46, com uma quantidade 2c de DNA, dever ter 4c de DNA em (3), (4 ) e (5). ( ) Uma clula 2n do homem, na fase (6), dever apresentar o dobro da quantidade de DNA apenas ao
11

final da citocinese. ( ) uma clula 2n = 46, ao sofrer mitose, ter em (1) e em (7) uma igual quantidade de DNA. ( ) na fase ilustrada em (5), os cromossomos atingem o grau mximo de condensao e a clula apresenta o dobro da quantidade de DNA observada em (1). 32. (Ufrgs 2006) Um geneticista mediu a quantidade de DNA de uma amostragem de clulas de determinada planta diploide, obtendo os seguintes resultados:

Considere as afirmaes a seguir sobre os dados contidos na tabela, assinalando-as com V (verdadeiro) ou F (falso) conforme elas estejam ou no de acordo com esses dados. ( ( ( ( ( ) A clula nmero 1 pode ser uma clula somtica. ) A clula nmero 2 pode ser uma clula em G2. ) A clula nmero 3 pode ser uma clula em S. ) A clula nmero 1 pode ser uma clula em G1. ) A clula nmero 2 pode ser uma clula em meiose II.

A sequncia correta de preenchimento dos parnteses, de cima para baixo, a) V - F - V - F - F. b) F - F - V - F - V. c) F - V - F - F - V. d) V - V - F - V - F. e) V - F - F - V - V. 33. (Uel 2006) Analise o grfico a seguir.

Com base no grfico e nos conhecimentos sobre a meiose, correto afirmar:


12

a) A linha horizontal contnua (no-tracejad representa a variao no nmero de cromossomos durante a meiose. b) A permuta entre os cromossomos homlogos deve ocorrer aps o tempo 2 e antes do tempo 5. c) A separao dos cromossomos homlogos ocorre entre o tempo 10 e o tempo 11. d) A linha horizontal tracejada corresponde variao na quantidade de DNA durante a meiose. e) A replicao do DNA, que ocorre durante a fase S da interfase, tem incio no tempo 0. 34. (Ufrgs 2006) Assinale a alternativa que preenche corretamente as lacunas do texto a seguir, na ordem em que aparecem. De acordo com a hiptese de segregao de fatores proposta por Mendel, a produo de uma gerao F3 a partir da autofertilizao da gerao F2 resultante do cruzamento de ervilhas parentais homozigotas amarelas (AA) e verdes (aa) produziria ............... de ervilhas amarelas e ............... de ervilhas verdes. a) 3/8 - 5/8 b) 4/8 - 4/8 c) 5/8 - 3/8 d) 6/8 - 2/8 e) 7/8 - 1/8 35. Dissertativa - (Ufmg 2006) O tabagismo um importante fator de alteraes patolgicas no pulmo - como o cncer e o enfisema pulmonar. Substncias presentes no cigarro podem lesar esse rgo comprometendo seu funcionamento. Duas enzimas - elastase e a alfa-1-antitripsina so essenciais para manter a integridade do pulmo. Analise os esquemas da figura1. a) CITE o mecanismo gentico que favorece o aparecimento de indivduos deficientes para a sntese da enzima alfa-1-antitripsina. b) Foram descritos vrios alelos responsveis por diferentes variantes enzimticas, como, por exemplo, M (mais frequente) seguido de S e Z. Analise a tabela da figura 2. I) DETERMINE a probabilidade de casais heterozigotos para o alelo M terem descendentes com gentipo favorvel ao desenvolvimento de enfisema pulmonar. EXPLICITE o seu raciocnio. II) Suponha que h um mtodo para deteco desses alelos na populao. RESPONDA: Como os dados obtidos por esse mtodo poderiam ser utilizados pelo Ministrio da Sade em programas de preveno? c) comum fumantes sentirem falta de ar ao praticarem atividades fsicas. Considerando essa informao, I) CITE a estrutura pulmonar lesada nesses fumantes. II) EXPLIQUE o processo fisiolgico que provoca a falta de ar nesses indivduos.
13

36. (Ufrgs 2006) Leandro, preocupado com a possiblidade de vir a ser calvo, consultou um amigo que estava estudando gentica. Contou que, embora seus pais no fossem calvos, sua av materna era. Na famlia do av materno, no havia histrico de calvcie. Seu amigo explicou que a calvcie uma caracterstica influenciada pelo sexo e que se expressa nos homens em homo e heterozigose e nas mulheres, somente em homozigose. Assim concluiu que a chance de Leandro vir a ser calvo era de 50%. Essa concluso baseia-se no fato de a) sua me ser heterozigota. b) seu av paterno ser calvo. c) sua av paterna ser heterozigota. d) seu pai ser heterozigoto. e) sua av materna ser heterozigota. 37. (Ufmg 2006) Analise esta tabela, em que esto relacionadas caractersticas das geraes F1 e F2, resultantes dos cruzamentos de linhagens puras de trs organismos diferentes:

Considerando-se as informaes contidas nesta tabela e outros conhecimentos sobre o assunto, INCORRETO afirmar que a) os pares de genes que determinam o "tipo" e a "cor" da asa nas moscas esto localizados em cromossomas no-homlogos. b) as caractersticas "tipo de semente" e "cor de plumagem" so determinadas, cada uma delas, por um nico par de gene. c) as plantas da F2 com "sementes rugosas", quando autofecundadas, originam apenas descendentes com sementes rugosas. d) o gene que determina "plumagem azulada" dominante sobre os genes que determinam "plumagem preta" ou "plumagem branca". 38. Dissertativa - (Ufrrj 2006) Uma planta que produz rabanetes redondos foi cruzada com outra que produzia rabanetes alongados, resultando no surgimento de 100% de plantas que produziam rabanetes ovais. O cruzamento das plantas que produziam rabanetes ovais entre si gerou 30 plantas que produziam rabanetes redondos, 62 plantas que produziam rabanetes ovais e 34 plantas que produziam rabanetes redondos.
14

Qual o tipo de herana ligada determinao da forma dos rabanetes produzidos por essa espcie de planta? Demonstre os cruzamentos citados e os respectivos gentipos dos indivduos envolvidos. 39. (Pucrs 2006) Qual dos heredogramas a seguir ilustra uma condio biologicamente IMPOSSVEL?

40. Dissertativa - (Ufal 2006) No heredograma a seguir, os indivduos 6, 12 e 16 apresentam um tipo de surdez hereditria, com herana autossmica recessiva. Identifique os indivduos seguramente heterozigticos, justificando sua escolha.

41. (Fatec 2006) Na espcie humana, a habilidade para o uso da mo direita condicionada pelo gene dominante E, sendo a habilidade para o uso da mo esquerda devida a seu alelo recessivo e. A sensibilidade feniltiocarbamida (PTC) condicionada pelo gene dominante I, e a insensibilidade a essa substncia devida a seu alelo recessivo i. Esses dois pares de alelos apresentam segregao independente. Um homem canhoto e sensvel ao PTC, cujo pai era insensvel, casa-se com uma mulher destra, sensvel, cuja me era canhota e insensvel. A probabilidade de esse casal vir a ter uma criana canhota e sensvel ao PTC de a) 3/4. b) 3/8. c) 1/4. d) 3/16. e) 1/8.

15

42. (Ufjf 2006) Em bovinos, a pelagem colorida determinada pelo alelo H, enquanto o alelo h determina a pelagem branca. Outro gene determina a pigmentao da pelagem na cor vermelha (b) ou preta (B). O cruzamento entre um touro de pelagem preta (HhBb) com uma vaca de pelagem preta (HhBb) produzir uma prole com: a) 100% de animais com pelagem preta, pois o gene para a cor dominante. b) 100% de animais com pelagem branca, pois o gene para a cor episttico. c) 12 animais com pelagem branca : 1 com pelagem vermelha : 3 com pelagem preta. d) 4 animais com pelagem branca : 3 com pelagem vermelha : 9 com pelagem preta. e) 9 animais com pelagem preta : 7 com pelagem vermelha. 43. (Pucmg 2006) Em ces da raa Labrador Retriever, a cor da pelagem determinada por um tipo de interao gnica episttica de acordo com o esquema a seguir.

Sabendo que o cruzamento (gerao Parental) entre um macho com fentipo chocolate e uma fmea de fentipo amarela gera apenas filhotes com pelagem preta (gerao F1), um criador fez as seguintes afirmaes: I. Todos os filhotes produzidos nesse cruzamento so heterozigotos, enquanto os pais so homozigotos para os dois pares de genes. II. No cruzamento da fmea parental com qualquer co de pelagem preta, no se espera a produo de descendentes com fentipo chocolate. III. No cruzamento da fmea amarela com um de seus filhotes de F1, espera-se que 50% dos descendentes apresentem pelagem amarela. IV. No cruzamento entre os filhotes de F1, espera-se que 25% dos descendentes apresentem pelagem chocolate. So afirmaes CORRETAS: a) I, II e III apenas. b) II, III e IV apenas. c) I, III e IV apenas. d) I, II, III e IV.

16

44. (Ufrgs 2006) Na cebola, a presena de um alelo dominante C determina a produo de bulbo pigmentado; em cebolas cc, a enzima que catalisa a formao de pigmento no produzida (cebolas brancas). Outro gene, herdado de forma independente, apresenta o alelo B, que impede a manifestao de gene C. Homozigotos bb no tm a manifestao da cor do bulbo impedida. Quais as propores fenotpicas esperadas do cruzamento de cebolas homozigotas coloridas com BBcc? a) 9/16 de cebolas brancas e 7/16 de cebolas coloridas. b) 12/16 de cebolas brancas e 4/16 de cebolas coloridas. c) 13/16 de cebolas brancas e 3/16 de cebolas coloridas. d) 15/16 de cebolas brancas e 1/16 de cebolas coloridas. e) 16/16 de cebolas brancas. 45. (Pucsp 2006) O gato domstico ('Felis domestica') apresenta 38 cromossomos em suas clulas somticas. No ncleo do vulo normal de uma gata so esperados: a) 19 cromossomos simples e 19 molculas de DNA. b) 19 cromossomos duplicados e 38 molculas de DNA. c) 38 cromossomos simples e 38 molculas de DNA. d) 38 cromossomos simples e 19 molculas de DNA. e) 19 cromossomos duplicados e 19 molculas de DNA. 46. (Uel 2006) Considere que um cientista esteja, em um laboratrio, tentando reproduzir "in vitro" a sntese de molculas de DNA. Com base nos conhecimentos sobre o tema, assinale a alternativa que indica, corretamente, as molculas imprescindveis que ele deve utilizar para que possa atingir o seu objetivo. a) Quatro diferentes tipos de nucleotdeos, contendo as bases nitrogenadas adenina, timina, citosina e guanina; a enzima DNA polimerase e DNA. b) Os nucleotdeos contendo as bases nitrogenadas timina, guanina, adenina e citosina; a enzima RNA polimerase; RNA mensageiro e DNA. c) As enzimas RNA e DNA polimerase; os trs tipos de RNA (mensageiro, transportador e ribossmico) e DNA. d) A enzima DNA polimerase; os vinte tipos diferentes de aminocidos, DNA e RNA. e) As enzimas RNA e DNA polimerase; vinte tipos diferentes de aminocidos; DNA e RNA. 47. (Unesp 2006) Algumas clulas de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. Posteriormente, essas clulas foram transferidas para um meio sem essa substncia. Aps 3 minutos, algumas clulas foram fixadas e radioautografadas. Esse procedimento se repetiu aps 15 e aps 90 minutos. Os esquemas representam as clulas radioautografadas nos trs momentos, revelando a distribuio do precursor radioativo nas mesmas.
17

Esses resultados ocorrem porque a) o RNA transportador leva o istopo at o nuclolo e posteriormente ao ncleo e citoplasma celular. b) a substncia, ao ser deixada em situao de desequilbrio osmtico em relao cultura sem istopo, dirige-se gradativamente para o citoplasma celular, buscando a situao de equilbrio. c) a sntese de RNA, que se intensifica aos 90 minutos, esgota toda a substncia presente no ncleo, restando apenas no citoplasma. d) a produo de RNA, que ocorre inicialmente no ncleo celular, prossegue posteriormente no citoplasma da clula. e) a sntese de RNA ocorre no ncleo, sendo que posteriormente o RNA a produzido migra para o citoplasma celular. 48. (Ufpel 2006) A unio de vrios aminocidos forma os peptdeos. Estes, aps passarem por diferentes processamentos no Retculo endoplasmtico rugoso e complexo de Golgi, formam as protenas. As protenas exercem inmeras funes no nosso organismo, como por exemplo as funes enzimticas. Para descobrir se determinado organismo produz determinada protena, faz-se a construo de uma fita de RNA mensageiro a partir dela. Isso possvel graas relao existente entre os cdons do RNA mensageiro (cada trs nucleotdeos) e os aminocidos presentes nas protenas. Cada trs nucleotdeos correspondem a um aminocido, portanto, a partir de uma sequncia de aminocidos (peptdeo), possvel obter uma sequncia de nucleotdeos (RNA mensageiros). O inverso tambm pode ocorrer. A correspondncia entre os cdons do RNA mensageiro e os aminocidos por ele determinados constitui o cdigo gentico, que est representado na tabela a seguir:

Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr (tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (cido asprtico), Glu (cido glutmico), Cys (cistena), Trp (triptofano), Arg (arginina), Gly (glicina), pare (cdon de parada). Com base no texto e em seus conhecimentos, correta a seguinte afirmao: a) O peptdeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro: GGCGGUGCGCACCGCCUUAUUCAA.
18

b) A partir da sequncia do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC, formado o seguinte peptdeo: Phe-His-Ser-Ala-Gly-Arg-His. c) A partir da sequncia do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, formado o seguinte peptdeo: Val-Val-Val-Val-Arg-Arg-Arg. d) A partir da sequncia do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, formado o seguinte peptdeo Leu-Gly-Glu-Thr-Arg-Gln-Glu. e) O peptdeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA. 49. (Unifesp 2006) Os grficos I e II representam a frequncia de plantas com flores de diferentes cores em uma plantao de cravos (I) e rosas (II).

Os padres de distribuio fenotpica so devidos a: a) I: 1 gene com dominncia; II: 1 gene com dominncia incompleta. b) I: 1 gene com dominncia incompleta; II: vrios genes com interao. c) I: 1 gene com dominncia incompleta; II: 1 gene com alelos mltiplos. d) I: 3 genes com dominncia incompleta; II: vrios genes com interao. e) I: 2 genes com interao; II: 2 genes com dominncia incompleta. 50. (Unesp 2006) Polticas de incluso que consideram cotas para negros ou afrodescendentes nas universidades pblicas foram colocadas em prtica pela primeira vez na Universidade Estadual do Rio de Janeiro (UERJ), em 2001. Propostas como essas geram polmicas e dividem opinies. H vrios argumentos contra e a favor. Os bilogos tm participado desse debate, contribuindo com os conhecimentos biolgicos referentes raa e herana da cor da pele humana, entre outros. Assinale a afirmao considerada correta do ponto de vista da biologia. a) Os critrios para se definirem duas populaes como raas diferentes so cientfica e consensualmente determinados. b) No encontramos, na histria da biologia, dvidas sobre a existncia de raas na espcie humana. c) A cor da pele humana um exemplo de herana quantitativa ou polignica, o que significa que vrios genes atuam na sua definio.
19

d) O fato de a cor da pele no ser influenciada por fatores ambientais refora a hiptese da existncia de raas na espcie humana. e) A determinao da cor da pele humana segue os padres do tipo de herana qualitativa e um exemplo de co-dominncia. TEXTO PARA A PRXIMA QUESTO: Uma pequena cidade interiorana do Nordeste brasileiro chamou a ateno de pesquisadores da Universidade de So Paulo pela alta incidncia de uma doena autossmica recessiva neurodegenerativa. As pesquisas realizadas revelaram que tambm alto o nmero de casamentos consanguneos na cidade. Outro dado interessante levantado pelos pesquisadores foi que a populao da cidade acredita que a doena seja transmitida de uma gerao a outra atravs do sangue. (Pesquisa FAPESP, julho de 2005.) 51. (Unesp 2006) Em relao crena da populao sobre o processo de transmisso de caractersticas hereditrias, podemos afirmar que: a) no sculo XIX, muitos cientistas tambm acreditavam que as caractersticas genticas eram transmitidas pelo sangue. b) a populao no est to equivocada, pois os genes esto presentes apenas nas clulas sanguneas e nas clulas germinativas. c) este um exemplo claro no qual o conhecimento elaborado pelo senso comum coincide com os conhecimentos atuais dos cientistas. d) a crena da populao pode ser explicada pelo fato de o sangue do feto ser fornecido pela me. e) a crena da populao no faz o menor sentido, uma vez que clulas sanguneas no apresentam as estruturas bsicas que guardam as informaes genticas. TEXTO PARA A PRXIMA QUESTO: A histria da maioria dos municpios gachos coincide com a chegada dos primeiros portugueses, alemes, italianos e de outros povos. No entanto, atravs dos vestgios materiais encontrados nas pesquisas arqueolgicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa histria. Diante da relevncia do contexto e da vontade de valorizar o nosso povo nativo, "o ndio", foi selecionada a rea temtica CULTURA e as questes foram construdas com base na obra Os Primeiros Habitantes do Rio Grande do Sul (Custdio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN, 2004). "Nossos ancestrais, uma mistura de ndios, brancos e negros, deixaram-nos um legado que, muitas vezes, diferencia-nos. Nosso chimarro nos identifica em qualquer parte do mundo. Ainda hoje, convivemos com grupos indgenas, como os Kaingng; ainda hoje, as trs raas se mesclam em nossos descendentes." 52. (Ufsm 2006) O DNA presente nas mitocndrias tem composio e estrutura tpicas desse tipo de cido nucleico, portanto formado por I. uma cadeia de nucleotdeos em que as bases nitrogenadas interagem, formando ligaes fosfodister. II. duas cadeias polinucleotdicas paralelas e complementares entre si, atravs dos pareamentos de aminocidos.
20

III. nucleotdeos que so compostos por uma base nitrogenada, uma pentose e um radical fosfato. Est(o) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas II e III. TEXTO PARA A PRXIMA QUESTO: A histria da maioria dos municpios gachos coincide com a chegada dos primeiros portugueses, alemes, italianos e de outros povos. No entanto, atravs dos vestgios materiais encontrados nas pesquisas arqueolgicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa histria. Diante da relevncia do contexto e da vontade de valorizar o nosso povo nativo, "o ndio", foi selecionada a rea temtica CULTURA e as questes foram construdas com base na obra Os Primeiros Habitantes do Rio Grande do Sul (Custdio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN, 2004). "Da Amaznia vieram os tupis-guaranis, trazendo contribuies nossa cultura, ensinando a plantar diferentes espcies e a usar plantas frutferas e medicinais." 53. (Ufsm 2006) Variedades de milho cultivadas pelos indgenas so usadas hoje em cruzamentos, com o objetivo de melhorar a produo de gros. Considere que a caracterstica baixa estatura dominante sobre a caracterstica porte elevado e que apenas um loco gnico est envolvido na determinao da estatura das plantas. O resultado para a F1 de um cruzamento de plantas com baixa estatura X plantas com estatura elevada ser _____________, se os indivduos cruzados forem homozigotos para esse loco gnico. Assinale a alternativa que completa corretamente a lacuna. a) 100% com estatura elevada b) 100% com estatura baixa c) 1/2 com estatura elevada e 1/2 com estatura baixa d) 1/4 com estatura elevada e) 3/4 com estatura elevada 54. (Unifesp 2005) Em um cruzamento de um indivduo AA com outro aa, considerando que o alelo A dominante sobre a, a proporo fenotpica observada em F2 significa exatamente que: a) 25% da prole expressam o fentipo determinado pelo alelo dominante e 75% no o expressam. b) em 25% da prole, o fentipo recessivo mascarado pelo fentipo dominante. c) 75% da prole expressam o fentipo determinado pelo alelo A e 25% no o expressam. d) em 50% da prole, o fentipo dominante mascarado pelo fentipo recessivo. e) 50% da prole possuem um nico tipo de alelo e 50% possuem outro tipo de alelo.

21

55. Dissertativa - (Ufrn 2005) Os heredogramas a seguir representam duas famlias com doenas hereditrias distintas. A doena que acomete a famlia 1 provoca retardamento mental acentuado, enquanto que a da famlia 2 uma doena degenerativa fatal que aparece em torno dos 40 anos de idade.

Aps analisar os heredogramas, atenda s solicitaes a seguir. a) Quais os tipos de herana envolvidos na transmisso das doenas de cada famlia? Justifique sua resposta. b) Considerando que a seleo natural pode eliminar doenas genticas, explique por que a doena da famlia 2 ainda poderia ser encontrada em indivduos da gerao VI (netos da gerao IV). 56. (Ufscar 2005) Uma empresa agropecuria desenvolveu duas variedades de milho, A e B, que, quando entrecruzadas, produzem sementes que so vendidas aos agricultores. Essas sementes, quando plantadas, resultam nas plantas C, que so fenotipicamente homogneas: apresentam as mesmas caractersticas quanto altura da planta e tamanho da espiga, ao tamanho e nmero de gros por espiga, e a outras caractersticas de interesse do agricultor. Porm, quando o agricultor realiza um novo plantio com sementes produzidas pelas plantas C, no obtm os resultados desejados: as novas plantas so fenotipicamente heterogneas e no apresentam as caractersticas da planta C; tm tamanhos variados e as espigas diferem quanto a tamanho, nmero e qualidade dos gros. Para as caractersticas consideradas, os gentipos das plantas A, B e C so, respectivamente, a) heterozigoto, heterozigoto e homozigoto. b) heterozigoto, homozigoto e heterozigoto. c) homozigoto, heterozigoto e heterozigoto. d) homozigoto, homozigoto e heterozigoto. e) homozigoto, homozigoto e homozigoto. 57. (Ufrgs 2005) Suponha que em uma certa espcie diploide exista um carter relacionado com uma srie de quatro alelos (alelos mltiplos). Em um determinado indivduo da espcie referida, o nmero mximo de alelos representados relacionados ao carter em questo ser igual a a) 2. b) 4. c) 6. d) 8. e) 10.
22

58. (Ufpe 2005) A frequncia de recombinao entre os locos A e B de 10%. Em que percentual sero esperados descendentes de gentipo AB // ab, a partir de progenitores com os gentipos mostrados na figura?

a) 5% b) 90% c) 45% d) 10% e) 20% 59. (Ufrn 2005) Devido maior proximidade da linha do Equador, o Nordeste do Brasil recebe uma elevada incidncia de radiao ultravioleta (UV), o que torna a populao dessa regio mais propensa ao cncer de pele. Essa doena ocorre porque as clulas do tecido epitelial multiplicam-se com muita frequncia, ficando mais vulnerveis ao dos raios UV existentes na luz solar. Essa maior vulnerabilidade decorre da a) replicao acentuada do DNA, tornando-o mais susceptvel s mutaes. b) insero de nucleotdeos no genoma, retardando a duplicao do DNA. c) inverso de bases no DNA, prejudicando a transcrio para RNA. d) substituio de nucleotdeos no RNA, impedindo a formao de radicais livres. 60. (Pucpr 2004) Durante a meiose, o pareamento dos cromossomos homlogos importante, porque garante: a) a formao de clulas-filhas geneticamente idnticas clula-me. b) a menor variabilidade dos gametas. c) a separao dos cromossomos no homlogos. d) a duplicao do DNA, indispensvel a esse processo. e) a possibilidade de permuta gnica. 61. (Ufc 2004) Assinale a alternativa que traz, na sequncia correta, os termos que preenchem as lacunas do texto: "Os retrovrus, como o HIV, so partculas portadoras de RNA, que possuem a caracterstica especial de ter a enzima ...1... e cujo ...2... comanda a sntese de ...3... . Este ltimo, uma vez formado, passa a comandar a sntese de novas molculas de ...4..., que iro constituir o material gentico de novos retrovrus". a) 1-transcriptase reversa 2-DNA 3-RNA 4-RNA b) 1-transcriptase reversa 2-RNA 3-DNA 4-RNA c) 1-RNA polimerase 2-DNA 3-RNA 4-DNA d) 1-DNA polimerase 2-DNA 3-RNA 4-RNA e) 1-DNA ligase 2-RNA 3-DNA 4-RNA

23

62. (Mackenzie 2001) Em uma determinada planta, o padro das nervuras foliares pode ser regular ou irregular. Do cruzamento entre duas plantas com nervuras irregulares, originou-se uma F1 composta por plantas com nervuras regulares e outras com nervuras irregulares. A partir desses dados, assinale a alternativa INCORRETA. a) As plantas cruzadas so heterozigotas. b) A proporo fenotpica em F1 de 3/4 de indivduos irregulares e de 1/4 de indivduos regulares. c) Todos os F1 com nervuras irregulares so heterozigotos. d) Se um indivduo F1 com nervuras regulares for cruzado com um indivduo da gerao P, surgiro indivduos regulares e irregulares na proporo 1:1. e) Os indivduos F1 de nervuras regulares s podem ser homozigotos. 63. (Ufmg 2001) Observe este heredograma:

Aps analisar esse heredograma, uma estudante concluiu que a caracterstica transmitida, na famlia representada, autossmica recessiva. Para chegar a tal concluso, essa estudante considerou todas as seguintes hipteses, EXCETO a) O indivduo I.3 tem filha normal, por isso improvvel uma herana dominante ligada ao X. b) O indivduo II.5 tambm seria afetado, se a herana fosse ligada ao Y. c) O indivduo III.2 no possui pais afetados, portanto a herana no deve ser autossmica dominante. d) Os filhos homens de I.2 seriam normais, se a herana fosse recessiva ligada ao X. 64. (Uel 2001) Sabe-se que o albinismo determinado pela ao de um gene recessivo autossmico. Considere um casal normal que teve 6 crianas todas normais. Sabendo-se que o av paterno e a av materna das crianas eram albinos, podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo), ser: a) 0% b) 25% c) 50% d) 75% e) 100% 65. (Ufrgs 2000) A Primeira Lei de Mendel ou Lei da Segregao dos Genes pode ser relacionada a uma das fases do processo meitico. Assinale a alternativa que apresenta a fase referida. a) Prfase I b) Metfase I c) Anfase I
24

d) Metfase II e) Telfase II 66. (Fuvest 2000) Uma populao experimental contm 200 indivduos AA, 200 aa e 200 Aa. Todos os indivduos AA foram cruzados com indivduos aa e os indivduos Aa foram cruzados entre si. Considerando que cada casal produziu 2 descendentes, espera-se encontrar entre os filhotes: a) AA - 50; Aa - 500; aa - 50 b) AA - 100; Aa - 400; aa - 100 c) AA - 100; Aa - 1000; aa - 100 d) AA - 200; Aa - 200; aa - 200 e) AA - 200; Aa - 800; aa - 100 67. (Uflavras 2000) A primeira Lei de Mendel refere-se a) ao efeito do ambiente para formar o fentipo. b) segregao do par de alelos durante a formao dos gametas. c) ocorrncia de fentipos diferentes em uma populao. d) ocorrncia de gentipos diferentes em uma populao. e) unio dos gametas para formar o zigoto. 68. (Ufv 2000) Os mecanismos da herana apresentam diferentes maneiras pelas quais os genes interagem entre si e com o ambiente para manifestarem seus efeitos no fentipo dos seres vivos. Com relao aos princpios bsicos da hereditariedade, assinale a alternativa CORRETA: a) Os genes co-dominantes tm menor influncia no fentipo do que os fatores ambientais. b) Na expresso gnica os efeitos do ambiente celular no so considerados. c) Os genes dominantes so independentes dos fatores ambientais para se expressarem. d) Pode ser muito difcil determinar se o fentipo resulta mais do efeito gnico do que o ambiental. e) Na presena de genes recessivos, apenas o efeito ambiental prevalece no fentipo. 69. (Cesgranrio 2000) A fenilcetonria (PKU) uma doena de origem gentica bastante conhecida, causada por uma deficincia da enzima fenilalanina hidroxilase. Pacientes acometidos desse mal, alm de no sintetizarem catecolaminas corretamente, no conseguem metabolizar a fenilalanina e, assim, apresentam uma srie de complicaes como retardo mental, epilepsia, hipopigmentao, entre outras. Considere o heredograma a seguir de uma famlia com membros acometidos (smbolos cheios) e normais (smbolos vazados). Podemos dizer, quanto presena de alelos mutantes de fenilalanina hidroxilase nos membros da famlia marcados com algarismos romanos, que: a) VIII pode ter um alelo mutado. b) VI possui dois alelos mutados. c) V necessariamente homozigoto. d) III possui apenas um alelo mutado. e) I necessariamente homozigoto.
25

70. (Ufmg 2000) Observe o esquema.

Com base nesse esquema e em conhecimentos sobre o assunto, CORRETO afirmar que a) o gene HbA dominante sobre o gene HbS. b) os indivduos HbA/HbS e HbS/HbS devem apresentar os mesmos nveis de hemoglobina anormal. c) os indivduos que produzem s hemcias anormais podem ser curados por meio de transfuso sangunea. d) um determinado gentipo pode produzir diferentes fentipos. 71. (Ufpel 2000) A presena de sardas em seres humanos uma caracterstica hereditria determinada por um par de alelos. As sardas aparecem igualmente em homens e em mulheres, podem ser transmitidas de pai para filho, ocorrem em todas as geraes, e s pessoas com sardas podem ter filhos com sardas (veja no heredograma abaixo).

Sabendo disso, possvel deduzir que a) a presena de sardas se deve a um alelo recessivo ligado ao cromossomo Y. b) a presena de sardas se deve a um alelo recessivo ligado ao cromossomo X. c) a presena de sardas se deve a um alelo dominante ligado ao sexo. d) a presena de sardas se deve a um alelo autossmico recessivo. e) a presena de sardas se deve a um alelo autossmico dominante.

26

72. (Ufal 2000) No heredograma abaixo, os smbolos escuros representam indivduos que possuem uma anomalia.

Considere as seguintes afirmativas sobre esse heredograma: I. A anomalia condicionada por um alelo dominante. II. Todos os indivduos que apresentam a anomalia so homozigticos. III. O nico indivduo que no pode ter o seu gentipo definido o I-4. correto o que se afirma APENAS em a) I b) II c) III d) I e II e) II e III TEXTO PARA A PRXIMA QUESTO: Em uma espcie de abelha, a cor dos olhos condicionada por uma srie de cinco alelos, entre os quais h a seguinte relao de dominncia: a1 > a2 > a3 > a4 >a a1 : marrom a2 : prola a3 : neve a4 : creme a : amarelo Uma rainha de olhos marrons, heterozigtica para prola, foi inseminada por espermatozoides provenientes de machos com olhos das cores marrom (20%), prola (20%), neve (20%), creme (20%) e amarelo (20%). Essa rainha produziu, em um dia, 1 250 gametas dos quais 80% foram fecundados. Todos os gametas produzidos resultaram em descendentes. 73. (Puccamp 2000) Os descendentes dessa rainha tero olhos a) somente da cor marrom. b) somente das cores marrom ou prola. c) da cor marrom se forem fmeas; da cor prola, se forem machos. d) da cor marrom ou prola, se forem fmeas, e, nos machos, as cinco cores sero possveis. e) da cor marrom ou prola, se forem machos, e, nas fmeas, as cinco cores sero possveis.
27

74. (Pucmg 1999) O cruzamento de dois indivduos, um com gentipo AaBb e outro com gentipo aabb resultou numa F1 com as seguintes propores: AaBb = 35% aabb = 35% Aabb = 15% aaBb = 15% Com esses resultados, pode-se concluir que os genes "a" e "b": a) esto em um mesmo brao do cromossomo. b) seguem as leis do diibridismo. c) constituem um caso de interao gnica. d) so pleiotrpicos. e) so epistticos. 75. (Ufrgs 1998) Os seguintes conceitos genticos foram escritos por um aluno que estava com dvidas sobre a matria e que pediu a um professor qualificado que os conferisse: I - Os genes em um mesmo cromossomo tendem a ser herdados juntos e so denominados "genes ligados". II - Quando uma caracterstica particular de um organismo governada por muitos pares de genes, que possuem efeitos similares e aditivos, ns dizemos que esta caracterstica uma caracterstica polignica. III - Quando trs ou mais alelos, para um dado "locus", esto presentes na populao, dizemos que este "locus" possui alelos mltiplos. IV - Um organismo com dois alelos idnticos para um "locus" em particular considerado homozigoto para este "locus", enquanto um organismo com dois alelos diferentes para um mesmo "locus" considerado heterozigoto para este "locus". V - A aparncia de um indivduo com respeito a uma dada caracterstica herdada chamada de fentipo. Quais afirmativas o professor diria que esto corretas? a) Apenas II, III e IV b) Apenas I, II, III e IV c) Apenas I, II, III e V d) Apenas II, III, IV e V e) I, II, III, IV e V 76. (Furg 1997) Mendel, nas primeiras experincias sobre hereditariedade, trabalhou com apenas uma caracterstica de cada vez. Posteriormente, ele acompanhou a transmisso de dois caracteres ao mesmo tempo, e os resultados levaram-no a concluir que: "fatores para dois ou mais caracteres so transmitidos para os gametas de modo totalmente independente". Esta observao foi enunciada como "2a Lei de Mendel" ou "Lei da Segregao Independente", a qual no vlida para os genes que esto em ligao gnica ou "linkage", isto , genes que esto localizados nos mesmos cromossomos. Observando as seguintes propores de gametas produzidos pelo dibrido AaBb em trs situaes distintas.
28

I - AB (25%); Ab (25%); aB (25%); ab (25%), II - AB (50%); ab (50%), III - AB (40%); Ab (10%); aB (10%); ab (40%), pode-se afirmar que: a) I e II so situaes nas quais os genes segregam-se independentemente. b) II e III so situaes nas quais ocorre segregao independente e ligao gnica sem "crossingover", respectivamente. c) I e III so situaes nas quais ocorre segregao independente e ligao gnica com "crossing-over", respectivamente. d) II uma situao na qual ocorre ligao gnica com "crossing-over". e) III uma situao na qual ocorre ligao gnica sem "crossing-over".

29

Gabarito:
Resposta da questo 1: [B] A replicao semiconservativa do DNA envolve a separao das cadeias da molcula me que serviro de molde para a produo das cadeias complementares. Nesse processo, as molculas de DNA filhas conservam, cada uma, a metade da molcula me. Resposta da questo 2: [B] O gentipo heterozigoto representado por AB/ab Cc. Dessa forma, considerando o princpio da segregao independente, sero formados quatro tipos de gametas: ABC, Abc, abC e abc. A frequncia do gameta abc , portanto, igual a . Resposta da questo 3: [C] A sntese do DNA em laboratrio exige, no mnimo, nucleotdeos de timina, citosina, guanina e adenina, alm da enzima DNA-polimerase que catalisa a unio dos nucleotdeos para a formao do polinucleotdeo de DNA. Resposta da questo 4: [D] A orientao ao acaso dos cromossomos homlogos, para os polos opostos da clula, ocorre durante a anfase I da meiose. Resposta da questo 5: [B] Uma mutao em uma molcula de RNA pode causar alteraes moleculares na protena resultante sua da traduo, que podem culminar numa alterao funcional nessa protena. Se o RNA for de uma clula que tenha uma transcriptase reversa, alteraes na transcrio reversa desse RNA tambm podero ser observadas. Apenas no podero ocorrer alteraes na autoduplicao do DNA que o originou. Resposta da questo 6: [C] Pelagens de coelho so determinadas por quatro formas allicas do mesmo gene: selvagem (C), chinchila (cch), himalaia (ch) e albino (c). A ordem de dominncia dessas variedades allicas ocorre na seguinte sequncia: C > cch > ch > c. Como os alelos ocorrem aos pares nos indivduos, h, portanto, dez tipos possveis de gentipos e quatro tipos possveis de fentipos, como vemos no quadro a seguir: Resposta da questo 7: [B]
30

Resposta da questo 8: [A] Resposta da questo 9: [B] Resposta da questo 10: [A] Resposta da questo 11: [A] Resposta da questo 12: [D] Resposta da questo 13: [B] Resposta da questo 14: [B] Resposta da questo 15: [C] Resposta da questo 16: [D] Resposta da questo 17: [C] Resposta da questo 18: [C] Resposta da questo 19: [D] Resposta da questo 20: [B] Resposta da questo 21: [A] Resposta da questo 22: [A] Resposta da questo 23: [E] Resposta da questo 24: [A]

31

Resposta da questo 25: [A] Resposta da questo 26: [C] Resposta da questo 27: [D] Resposta da questo 28: [E] Resposta da questo 29: [C] Resposta da questo 30: [C] Resposta da questo 31: V-V-F-V-V Resposta da questo 32: [D] Resposta da questo 33: [B] Resposta da questo 34: [C] Resoluo: 1. Cruzamento (parental): P: AA x aa F1: Aa x Aa F2: AA Aa Aa aa F3: AA x AA AA AA AA AA (4) Aa x Aa AA Aa Aa aa (4) Aa x Aa AA Aa Aa aa (4) aa x aa aa aa aa aa (4) Portanto, sero entre 16 possibilidades,
10 16

A_ (amarelas) e

6 16

aa (verdes) que, fracionados,


5 8

daro como resultado, para preenchimento das lacunas, respectivamente , Resposta da questo 35: a) Mutaes. b)

3 8

32

I) MZ MZ MM MZ MZ ZZ 1/4 ou 25% II) Populaes que apresenrtam porcentagens elevadas de alelos S e Z deveriam ser aconselhadas a definitivamente no fumar, pois teriam grandes possibilidades de desenvolver enfisema pulmonar. c) I) Alvolos pulmonares. II) A hematose fica prejudicada, ou seja, as trocas gasosas ocorrem de maneira ineficiente nos alvolos pulmonares. Resposta da questo 36: [A] Resposta da questo 37: [D] Resposta da questo 38: Herana sem dominncia. RR - rabanetes redondos AA - rabanetes alongados RA - rabanetes ovais RR AA 100% RA RA RA 25% RR rabanetes redondos 50% RA rabanetes ovais 25% AA rabanetes alongados Resposta da questo 39: [D] Resposta da questo 40: 1 e 2 so normais e tiveram (6) um filho surdo. 7 normal e teve filhos (12) e (16) surdos. 10, 11, 13, 14, e 15 so normais, porm o pai (6) surdo, Resposta da questo 41: [B] Resposta da questo 42: [D]
33

Resposta da questo 43: [A] Resposta da questo 44: [E] Resposta da questo 45: [A] Resposta da questo 46: [A] Resposta da questo 47: [E] Resposta da questo 48: [D] Resposta da questo 49: [B] Resposta da questo 50: [C] Resposta da questo 51: [A] Resposta da questo 52: [C] Resposta da questo 53: [B] Resposta da questo 54: [C] Resposta da questo 55: a) Famlia I - herana dominante ligada ao X. Ocorre em todas as geraes. Os homens afetados transmitem a doena para todas as filhas. Famlia II - herana dominante autossmica. Ocorre em todas as geraes. Atinge indivduos de ambos os sexos ou filhos afetados tm um genitor afetado. b) Como a doena s se manifesta a partir dos 40 anos, o indivduo pode reproduzir-se antes de a doena aparecer, transmitindo a caracterstica aos descendentes. Resposta da questo 56: [D] Resposta da questo 57: [A]

34

Resposta da questo 58: [C] Resposta da questo 59: [A] Resposta da questo 60: [E] Resposta da questo 61: [B] Resposta da questo 62: [C] Resposta da questo 63: [D] Resposta da questo 64: [B] Resposta da questo 65: [C] Resposta da questo 66: [A] Resposta da questo 67: [B] Resposta da questo 68: [D] Resposta da questo 69: [A] Resposta da questo 70: [D] Resposta da questo 71: [E] Resposta da questo 72: [B] Resposta da questo 73: [B] Resposta da questo 74: [A]

35

Resposta da questo 75: [E] Resposta da questo 76: [C]

36