You are on page 1of 8

Chemosphere 64 (2006) 478485 www.elsevier.

com/locate/chemosphere

An engineered plant that accumulates higher levels of heavy metals than Thlaspi caerulescens, with yields of 100 times more biomass in mine soils
nez a, Pilar Bernal b, Concepcio n Almela c, Dinoraz Ve lez c, Mar Mart d a a-Agust n , Ramo n Serrano , Juan Navarro-Avin a,* Pilar Garc o
b a Department of the Stress Biology, IBMCP, CSIC, Camino de Vera s.n., Post Code 46022 Valencia, Spain Department of Soil and Water Conservation and Organic Waste Management, Center of Edafology and Applied Biology of Segura, CSIC, Campus Universitario de Espinardo, P.O. Box 164, 30100 Espinardo, Murcia, Spain c Institute of Agrochemical and Food technology (University of Valencia-CSIC) P.O. Box 73-46100 Valencia, Spain n, Spain Department of Experimental Sciences, Area of Vegetable Physiology, ESTCE, University Jaume I Post Code 12071, Castello

Received 29 June 2005; received in revised form 21 October 2005; accepted 24 October 2005 Available online 7 December 2005

Abstract Nicotiana glauca transformed with TaPCS1 was tested for its application in phytoremediation. When plantlets were grown in mine soils containing Cu, Zn, and Pb (42, 2600, and 1500 mg kg1) the plant showed high levels of accumulation especially of Zn and Pb. Adult plants growing in mine soils containing dierent heavy metal concentrations showed a greater accumulation as well as an extension to a wider range of elements, including Cd, Ni and B. The overexpressed gene confers up to 9 and 36 times more Cd and Pb accumulation in the shoots under hydroponic conditions, and a 3- and 6-fold increase in mining soils. When the hyperaccumulator Thlaspi caerulescens was compared, the results were higher values of heavy metal and Boron accumulation, with a yield of 100 times more biomass. Thlaspi was unable to survive in mining soils containing either a level higher than 11 000 mg kg1 of Pb and 4500 mg kg1 of Zn, while engineered plants yielded an average of 0.5 kg per plant. 2005 Elsevier Ltd. All rights reserved.
Keywords: Boron; Nicotiana glauca; Phytochelatin synthase; Phytoremediation

1. Introduction An ideal plant for environmental cleanup should have a high biomass production, combined with superior capacity for pollutant tolerance, accumulation, and degradation, depending on the type of pollutant and the phytoremediation technology of choice. Transferring the genes responsible for the hyperaccumulating phenotype to higher shoot-biomass-producing plants has been suggested as a potential avenue for enhancing phytoremediation as a viable commercial technology (Pilon-Smits and Pilon, 2002).
*

Corresponding author. Tel.: +34 96 3877858; fax: +34 96 3877859. ). E-mail address: jpavinyo@upvnet.upv.es (J. Navarro-Avin o

Unlike organic contaminants, metals cannot be degraded. Instead, phytoremediation strategies for metals are based on stabilization, accumulation, and in some cases on volatilization. The phytostabilization of metals may simply involve the prevention of leaching through the upward water ow created by plant transpiration, reduced runo due to above-ground vegetation, and reduced soil erosion via the stabilization of soil by plant roots (Vassilev et al., 2004). Over recent years a special interest has emerged in the phenomenon of heavy-metal hyperaccumulation since this property may be exploited in the remediation of heavy-metal-polluted soils through phytoextraction and phytomining (Robinson et al., 1997). The concept of hyperaccumulation was originally introduced to plants

0045-6535/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.chemosphere.2005.10.044

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

479

containing more than 0.1% (1000 mg kg1) of Ni in dried et al., 1976). At present, the criteria plant tissues (Jare used for hyperaccumulation vary per metal, ranging from 100 mg kg1 dry mass for Cd, to 1000 mg kg1 for Cu, Co, Cr, and Pb, to 10 000 mg kg1 for Zn and Mn. These values have to be found in any of the aerial parts of plants growing in their natural habitat, rather than under articial conditions (Reeves and Baker, 2000). These plants exhibit a shoot-to-soil metal concentration ratio, the so-called bioaccumulation factor that is higher than 1 (Baker et al., 1994). Thlaspi caerulescens a herbaceous annual or a shortlived perennial plant species, survived for 21 d in hydroponics at 3 mM Zn without any evidence of chlorosis, and meanwhile it accumulated up to 30 000 mg kg1 Zn (Brown et al., 1995). Researchers have found Cd accumulation in the leaves of T. caerulescens at levels of up to 1600 mg kg1 Cd without detecting a decrease of its dry biomass up to 50 lg extractable Cd per g of soil (Robinson et al., 1998). It has been recently discovered in hydroponic experiments that one French population of T. caerulescens (Ganges ecotype) was able to accumulate over 3000 mg kg1 of Cd in the shoots, without biomass reduction (Lombi et al., 2000). Moreover, in eld trials, this population was able to accumulate up to 500 mg kg1 of Cd in the shoot at 12 mg kg1 Cd in the soil. Since both the uptake and accumulation of contaminants in the shoot dry matter, followed by its harvest and removal (phytoextraction) are attractive as a cost-eective method of soil remediation (Salt et al., 1998), this plant species must be taken as the principal reference to evaluate of the phytoremediation capacity. Phytochelatins (PCs) have become one of the main focal points for biotechnologists in phytoextraction. Whether they are responsible for metal tolerance or not has been a matter of discussion in recent times. For example, root tips of Cd-tolerant plants of Silene vulgaris exhibit a lower rate of PC production accompanied by a lower rate of longer chain PC synthesis than those of Cd-sensitive plants S. vulgaris (De Knecht et al., 1994). Regarding their role in naturally selected plants that have increased heavy metal accumulation, some researchers believe that the investigation in tolerant S. vulgaris plants from copper mining dumps shows that PCs are not responsible for the development of the heavy metal tolerant phenotypes. This is based on the fact that Cd- and Cu-PC-complexes disappear in the roots of water cultures of S. vulgaris between 7 and 14 d after heavy metal exposure. Although the binding of heavy metal ions to PCs exists it only seems to play only a transient role in the heavy metal detoxication mechanism of this plant species (Leopold et al., 1999). Similar ndings have been reported for the hyperaccumulator T. caerulescens and the related non-accumulator T. arvense. Total PC levels found in the hyperaccumulator were generally lower with respect to the non-accumulator, despite correspondingly higher metal concentrations. However, similarly to S. vulgaris, PCs were produced by both species in response to Cd, and PC levels, showing a similar positive

correlation with Cd-concentration in leaf and root tissues (Ebbs et al., 2002). Very recently the overexpression of gene TaPCS1, encoding a phytochelatin synthase (PCS), in Nicotiana glauca selected in a contaminated environment not only increased Cd tolerance, but also lead accumulation (Gisbert et al., 2003). The growth of roots drastically improved (near 160%) and leaves showed less symptoms of necrosis in the transformed plants with respect to wild type, in the presence of 50 lM Cd and also at 0.8 mM Pb. TaPCS1 transformed plants were able to grow in mining soils, with as much as 1572 mg kg1 of Pb and 2602 mg kg1 of Zn, and twice the level of Pb was accumulated than in wild type plants. A TaPCS1 enhanced expression triggered a higher Pb transport (around 200% accumulation) to the root tissue and to the aerial parts of the plant (near 150%). This work shed light upon the participation of PCs in phytoextraction (by the overexpression of gene TaPCS1 encoding a PCS), and the key role played by these enzymes when hosted in N. glauca was demonstrated, in the accumulation of heavy metals and boron. N. glauca was chosen for its extraordinary characteristics to be used as a phytorremediator plant, examples of which are: deep roots, high biomass, easy propagation, wide geographic extension etc. Furthermore the potential of the NgTP1s (N. glauca transformed with TaPCS1) in the phytoremediation of mine soils is evaluated in reference to the hyperaccumulator T. caerulescens. 2. Materials and methods 2.1. Plant material Seeds of N. glauca. (Wild type, line 2), three dierent F3 transgenic lines (TaP12, TaP17 and TaP18) and T. caerulescens were sterilized as follows: seeds were immerged in 30% commercial bleach, plus Triton X-100 detergent 0.01% for 7 min to prevent fungal and bacterial growth, then a second wash was carried out using 70% ethanol water solution with 0.01% of Triton X-100. Finally, seeds were washed for ve consecutives repetitions with deionized water, each lasting 5 min each one to eliminate any remains of disinfectant solution. The soaked seeds were placed in sterile plastic boxes of 10 cm large with 100 ml of the germination medium Luria and Bertani (Hispanlab, S.A. Madrid, Spain) and they were incubated in a culture camera with 16 h light at 120 lmol m2 s1 photon ux density (Grolux, Sylvania, uorescent tubes, Light Manufacturing Co., Brooklyn Portland, OR, USA). Successive generations were obtained by cutting and were transferred to the greenhouse in pots containing the three dierent soils used in the experiment (M4, M15 and M3 described in Table 1). The pots were covered with lm for a few days to obtain better acclimatization conditions. Plants were grown for 6 months. Plants were irrigated only with water, on a daily basis during the rst month, and every 7 d thereafter.

480

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

Table 1 General characteristics of the contaminated soils (M4, M15 and M3) Characteristics pH EC (dS m1) CaCO3 (%) CEC (cmolc kg1) OM (%) Organic-C (g kg1) Total-N (g kg1) Fe (g kg1) Mn (g kg1) Cu (mg kg1)a Pb (mg kg1)a Zn (mg kg1)a Ni (mg kg1)a Cd (mg kg1)a Cr (mg kg1)a M4 7.70 2.21 28.0 10.6 0.65 3.8 0.3 53.1 1.6 42 1572 2602 <2.0 <0.2 <2.0 M15 7.86 0.15 15.0 n.d. 7.6 4.4 0.6 n.d. n.d. 35 2345 1826 27 0.3 36 M3 6.76 1.56 1.18 0.073 n.d. n.d. 322 11,426 4539 32 60 17

Dierent treatments were applied depending on the kind of material: stems and leaves were ground, soils were sieved and (milled, crushed or pounded), and roots were cut up. 2.4. Assay of metal contents Metal analysis was carried out by atomic absorption spectrometry (AAS) after wet ashing plant material at 480 C for 6 h, and then dissolved in HNO3 0.6 M. Since soils from Valencia were contaminated with a high number of heavy metals, the contaminated soil M4 was obtained from an area close to an old PbZn mine at La Union, in the province of Murcia (SE Spain; Walker et al., 2003). The M4 soil is a calcareous sandy-loam type with 19.2% clay, 14.4% silt, 66.4% sand, and a water holding capacity of 144 g kg1. The soil is a Xeric Torriorthent (USDA, 1999). It has total concentrations of Pb and Zn (1572 and 2602 mg kg1, respectively) which greatly exceed the European Union maximum permitted levels for agricultural soils (O. J. Eur. Communities, 1986). The soil was collected from the top 20 cm, air-dried for 56 d, and sieved to <4 mm for pot experiments and to <2 mm for analysis. Total heavy metals were extracted by nitric acidperchloric acid digestion (Abrisqueta and Romero, 1969). All metal concentrations, adjusted to values for oven-dried (12 h at 105 C) soil, were determined by AAS. Full details of the analytical procedures are provided (Walker et al., 2003). Metal concentrations were also carried out using a Helwett-Packard HP 4500 ICP-MS (Hernandez et al., 2000). 2.5. Determination of Pb and Cd concentration in plants Determination was carried out by means of digestion in a graphite furnace atomic absorption spectroscopy (GFAAS). The sample (0.20 g) was placed in a high pressure polytetrauoroethylene vessel. Two millilitres of 65% HNO3 and 1 ml of 35% H2O2 were added. The vessel was sealed with a screw cap and placed inside the microwave oven. Samples were irradiated at a 700 W power setting for three cycles of 1 min standing 5 min between cycles. After digestion, the vessel was cooled and the solutions were ltered and diluted with water to a nal volume of 20 ml. The matrix modier used was a mixture 0.067 mg H2PO4NH4 and 0.003 mg Mg(NO3)2 in HNO3 1% (v v1). The quantication of Pb and Cd in GFAAS was performed using calibration curve of the corresponding standards. Triplicate analyses were performed for each sample. 3. Results 3.1. The phytoremediation capability was investigated in a range of dierent conditions In order to test the NgTP1s phytoremediation capability to restore contaminated sites, dierent media: solid (three mining soils) and liquid (solution of metals), and dierent

N.d., not determined. a European Union limits (mg kg1) for agricultural soils (pH 67): Cu 50140; Pb 50300; Zn 150300; Ni 3075; Cd 13; Cr 100150.

2.2. Northern analysis Four microgram of total RNA was separated on a 1% agarose gel containing formaldehyde, transferred onto a Hybond-N nylon membrane (Amershan, Pharmacia, Arlington, USA). Blot hybridization was carried out using a TaPCS1 DNA probe that was generated by PCR using the primers 5 0 TaPCS1f211-233 ATGGAGGTGGCGTCGCTGTACCG; TaPCS1rev801-827: TAAGGGGATGGAGGCTCTTG, and labeled with 32P[dCTP] by random priming using a DNA labeling Kit (Ready_To_Go, Pharmacia Biotech, Piscataway, NJ). 2.3. Assay of plants in contaminated soil T3 seeds of transgenic lines 12, 17, and 18 and wild type were germinated in Petri dishes with a medium prepared with 6 g l1 agar, MS salts (Murashige and Skoog, 1962), and 10 g l1 sucrose at pH 5.7 buered with 0.25 g l1 MES (2-[N-mor-pholino]ethanesulfonic acid). Ten days after (when the rst leaves were developed) plantlets were transplanted to soil in pots (250 g soil for plantlets, 5 kg for adult plants) with a metal contaminated soil (M4, M15, M3), diluted 50% (v v1) for M4 and 30% for M15 and M3, with vermiculite and a control soil (peat pH adjusted to 6.0 with dolomite and vermiculite 50% v v1 for M4, and 30% v v1 for M15, M3). Plants were grown in a culture growth chamber (25 C, 17 C, day and night 16 h light). A minimum of three plants per soil were grown, 6 weeks (M4) and 6 months (M0, M15, M3). Seedlings of transgenic, and wild type lines were divided into roots and shoots, and fresh weight was determined. Having eliminated the soil, roots were washed with water, then with CaCl2HCl (pH 3.8) for 10 min, and then with deionized water. Shoots were washed with deionized water. Both shoots and roots were dried and analyzed for heavy metals. Samples were lyophilized to obtain dehydrated material.

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

481

degrees of contamination were investigated (Table 1, soils). These dierent conditions were carried out in order to test the NgTP1s under the closest conditions to those found in nature or in future phytoremediation problems. The liquid media were provided by owing water in the contaminated soils and in the control media at the same time during one month. This allows for the generation of a comparative soil-hydroponics investigation. Another important criterion to choose the media was PbCd interference. Since the gene TaPCS1 was reported to chelate Cd (Clemens et al., 1999) and it was recently reported to also bind Pb (Gisbert et al., 2003), it is critical to investigate the possible interference when both heavy metals are present in the media. These states of contamination were provided by a soil containing 11 400 mg kg1 Pb, 4500 mg kg1 Zn and 60 mg kg1 Cd, and another containing 1500 mg kg1 Pb, 2500 mg kg1 Zn and no Cd. A further criterion to check the phytoremediation faculty was the dierent state of growth of both the wild type species and dierent lines of NgTP1s: plantlets and adult plants grown during 6 months. Plantlets were studied in one soil, while adult plant experiments were determined in dierent mine soils. 3.2. Phytochelatins improve Cu, Zn and Pb accumulation in plantlets In the present work plantlets studies were completed only in the same previously investigated soils (M4). With regards to Cu and Zn, the plantlets exhibited a capacity to concentrate the metal from soil to plant, thus indicating a high phytoremediator power (Fig. 1). TaPCS1 is a determinant in order to confer a higher phytoextraction ability for all the metals analyzed, especially in the root tissue. In the shoots however, the higher increase of the accumulation provided by TaPCS1 has been found for Pb in accordance with to the previous soils and in vitro experiments. The overall Zn concentration found in the whole NgTP1 that is, aerial tissues plus root tissue, although not localized in the aerial part as is the case of the hyperaccumulators, is close to 6000 mg kg1 dry weight. This result is near to the expected concentration found in the Zn hyperaccumulators (10 000 mg kg1), yet far from the 1000 mg kg1 assigned to Pb (Vassilev et al., 2004), a quantity that is overcome in the tested plantlets. Plants are able to accumulate a total amount of 7000 mg kg1 of heavy metal, that is a 0.7% dry weight. 3.3. N. glauca and NgTP1s grow in all the mine soils tested unlike T. caerulescens The NgTP1s showed better growth under all the conditions checked and for all the lines tested than wild type lines did, including M0 soils. In fact when plants were grown in a media that contained no heavy metals at all, the average height determined for wt. (wild type) was 3.5 0.4 m versus 5.1 0.1 m for NgTP1s. In contrast the hyperaccumulator T. caerulescens showed it was unable

Fig. 1. Heavy metal concentrations for wild type versus NgTP1s (N. glauca overexpressing TaPCS1) in dierent tissues. Concentrations are expressed in mg kg1. W: wild type, G: NgTP1s. Soils (M4) are expressed in initial concentration.

to survive in M3 soils, and in the soils where survive the biomass yielded for the whole plant is an average of 26 6 times and 148 4 less than the biomass obtained for the NgTP1s in the same soils (Fig. 2). As for wt. plants there is a moderate loss of weight (18 6%) while the concentration of heavy metals in the media increases up to 11 426 mg kg1 for Pb and up to 4539 mg kg1 for Zn (M3 soils). The reduction percentage of biomass was only a 4 1% for NgTP1s growing in M15 and 12.5 1% for M3, while for T. caerulescens a 82.6 2% biomass reduction in M15 is observed. However, the lost of weight is observed only for line 18 for the NgTP1s grown in M3, while lines 12 and 17 showed an increment in biomass with regards to growth in M0. Although there is no specic line showing the highest weight in all the conditions tested, a higher biomass was shown in line 1 in the M15 and M3 soils than in the media control. Coherently to the increase of tolerance provided by the overexpression of TaPCS1 leaves chlorosis is delayed by some weeks in NgTP1s with regards to wt. plants (data not shown).

482

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

Fig. 2. Biomass comparison of wild type, NgTP1s, and Thlaspi caerulescens: (A) mass is expressed in grams. W:wild type, 1: TaP12, 2: TaP17, 3: TaP18 (these are lines containing gene TaPCS1). The results are the average of three dierent plants for each line grown in dierent pots. Thlaspi caerulescens (T) was unable to survive in M3 soils, (B) Northern analysis of NgTP1s experimented in A, (C) RNA loading. Each line was loaded with 1.5 lg of RNA extracted as described in Section 2.

3.4. Phytochelatins improve heavy metal and B accumulation in plants being grown for 6 months In accordance with previous results the highest increment in heavy metal and B accumulation provided by TaPCS1 was determined for Pb and Cd (Table 2 top). TaPCS1 leads to a 24 and 3-fold increase of Cd accumulation (root and foliar tissue respectively) and to 36 and 9-fold of Pb (stem and foliar tissue) under hydroponic conditions (M0). In mining soils (M15), this proves to be 3 times for Cd and 6 times for Pb (both in stems). Accumu-

lation in the NgTP1s is higher with regards to wt. for all the elements analyzed, including a semi-metallic element such as B, as the properties of which are borderline between metals and non-metals. The accumulation of Cu is especially high and coherent to the results found in plantlets, in hydroponic media (12-fold in leaves) and in M15 (18fold in foliar tissue) as well. Perhaps the phytochelatin provided by TaPCS1 although specic for Cd and Pb is able to bind other heavy metals (or related elements). 3.5. Higher accumulation levels of heavy metals and B for NgTP1s and/or wt. Ng than for Thlaspi The heavy metals and B accumulation in the aerial tissues is particularly high in the plants growing in the control soil (M0) with regards to the total amount of heavy metal and B accumulated per plant compared to M15 and M3, especially in certain cases such as Zn, Cu or B (Fig. 3). This is more likely since water soluble metal is the easiest available form in the soil. A remarkable fact aecting phytoremediation for all the elements analyzed is that there is a signicant accumulation in the shoots, and in some cases the foliar tissue becomes the tissue with the highest level of accumulation (Zn, Cd and B). Under no other condition tested in this work for Pb does a higher ratio of accumulation leaves/roots exist, thus demonstrating that Pb is suciently transportable to be accumulated in the foliar tissue, at least in the NgTP1s. Normal foliar Zn concentrations in plants are around 100 mg kg1, where 30 mg kg1 is considered as adequate and 300 mg kg1 is considered as toxic (Mengel and Kirkby, 1987) as exhibited in all the tissues analyzed. A linear increment of accumulation from root to leaves exist for Cd (the most toxic heavy metal evaluated). This occurs with both wt. and NgTP1 plants in all the situations tested, except for NgTP1s in M15, where

Table 2 Comparison NgTP1s/wt. and NgTP1s/Thlaspi B Soil/tissue M0 r 267 s 129 l 176 M15 r s l M3 r s l Soil Mo M15 332 81 8 77 86 130 Ni Cu Zn Cd Pb

30 86 373 560 256 15 163 145 34

255 542 1207 178 1819 9 78 53 71

456 185 453 224 481 64 103 98 8

2464 896 314 490 329 95 125 60 34

363 3669 905 221 604 16 252 5 27

4.5 2.4

9 2.9

5.7 21.3

3.2 0.9

4.1 0.3

16.2 10.4

Top: Percentage of improvement provided by the insertion of TaPCS1, calculated comparing dierent NgTP1s tissues, r: roots; s: stems; l: leaves. Bottom: ratio of NgTP1s accumulation regarding Thlaspi accumulation. Standard deviation is less than 10%.

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

483

Fig. 3. Metal accumulation in dierent tissues of the plants, for the dierent metals and in the dierent soils. Y-axis: metal concentrations are expressed in mg kg1. Columns indicate type of soil. (A) M0, (B) M15, (C) M3. Rows indicate type of metal. Metals, up to down:B, Ni, Cu, Zn, Cd, Pb. r: roots; s: stems; l: leaves; T: whole plant of T. caerulescens and WT: wild type.

484

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

levels of Cd were seen to be 3 fold-higher in leaves than in stems. The foliar Cd levels determined for the NgTP1s are also toxic (above 1 mg kg1). The accumulation determined for all the heavy metals and the B analyzed is higher for the NgTP1s than it is for T. caerulescens. This is particularly relevant in the cases of Cd and Pb, where a double concentration of these metals in foliar tissue was observed than in the whole plant of T. caerulescens. In fact the ratio of accumulation NgTP1s/T. caerulescens is 16 and 10 times higher in M0 and M15 respectively (Table 2 bottom). Only one case out all the situations tested in this work showed higher levels of metal and/or B accumulation for T. caerulescens in comparison to the NgTP1s and/or the wt. plant individuals, corresponding to the Zn analyzed when plants were grown in M15 soils. In this case, only a slight dierence of accumulation was seen when comparing the whole tissue of T. caerulescens versus the whole plant of NgTP1s. As for growth in M3 soils, Zn accumulation displayed the maximum number observed for any of the heavy metals and B analyzed in adult plants. Accumulation of this heavy metal in roots of both wt. and NgTP1s scales a thousand units. These results are similar and coherent to those obtained in plantlets (Fig. 1) where a 2-fold increase in Zn accumulation was shown as a result of TaPCS1 overexpression. An important aspect in terms of the phytoextraction capability is that the foliar accumulation of Zn is above toxic limits (658 23) and it is higher than the concentration determined in stem tissue. Similarly, the accumulation of B in M3 (as in the case of M0) is produced mostly in the foliar tissue, by following a pattern of increment from root to stems, and leaves (204 14 mg kg1). Cd levels exhibited a linear pattern of increment from root to leaves but unlike B, stems accumulates less than roots and leaves. Cd levels determined in the above ground tissues (27 4 mg kg1) of NgTP1s grown in M3 soil are close to a 30% accumulation of the considered Cd-hyperaccumulator. Generally speaking there is an increase in the metal accumulation according to the increment in the soil content. This is particularly signicant for Pb when comparing soil M15 (2345 mg kg1) with M3 (11 426 mg kg1), since in this case the accumulation observed in NgTP1s grown in M3 is at least 12 times higher. This result is only comparable (Fig. 3) to that observed for Zn (6-fold) and Cd (8-fold). 4. Discussion The NgTP1s investigated indicate that TaPCS1 is able to improve heavy metal accumulation, despite some reports indicating that PCs overexpression does not lead to higher heavy metal accumulation (see Section 1). Cd is accumulated in the NgTP1 tissues as expected from the studies of overexpression carried out in yeast (Clemens et al., 1999). It was previously demonstrated for rst time that this gene is also able to improve Pb accumulation (Gisbert et al., 2003). Accordingly since a PC binds Pb, and ABCtransporters of tonoplast are thought to transfer the metal-PC complex inside the vacuole (Hall, 2002), the over-

expression of YCF1 (yeast) should improve both Pb and Cd accumulation, as subsequently demonstrated (Song et al., 2003). TaPCS1 leads to a 24-fold increase of Cd accumulation (root tissue) and to a 36-fold increase of Pb (stem tissue) under hydroponic conditions, while Cd accumulation incremented 3 times and Pb did so 6 times in soils (both cases in stems). This work also shows that the NgTP1s analyzed mobilize Pb to the stem and foliar tissue, therefore indicating that Pb actually might in fact be transported to the aboveground tissues. However this transfer is inversely proportional to Pb concentration in the media: 47 9; 24 3 and 11 1 mg kg1 (M0, M15 and M3 respectively, Fig. 3). Perhaps the high accumulation of Pb in soils, and particularly so in roots, may possibly slow down, or almost completely stop the transport to the aerial tissues since Pb may accumulate in the cell wall (Marmiroli et al., 2005). The NgTP1s are able to accumulate higher concentrations of all the assayed elements than T. caerulescens is, and these results strongly suggest that these NgTP1s have signicant skills to be used in phytoremediation, specically so when the biomass yielded is more than 100-fold higher than that produced by T. caerulescens. The values of Zn found in this work for T. caerulescens are far from the reported concentrations in hydroponic cultures (see Section 1). This may happen since the presence of other elements might produce the competence, perhaps as substrates that bind the same membrane transporters, or as other enzymes participating in phytoremediation such as PCs, or because the specic conditions of the soil, i.e. pH, content of organic matter, etc. It has recently been reported that despite the adaptation of this ecotype of T. caerulescens to soils containing Cu, Zn and Pb, Cu strongly inhibits growth unlike Pb does (Walker and Bernal, 2004). It is possible that Cu and perhaps Pb compete to bind the membrane transporters. However, in the case of NgTP1s no obvious interference in the accumulation of Cd and Pb was observed, in fact the maximum values of Cd and Pb were shown in M3 soils. The evaluation of these NgTP1s as phytoremediation tools indicates that a negative point might be the fact that the leaves undergo earlier abscission when the soils have a high heavy metal presence, therefore leaves may fall to the soil, causing recontamination in a futile cycle. This phenomenon is slowed down in the cases of NgTP1s in comparison with wt. plants. Analysis of necrotic leaves falling on soils showed no relevant heavy metals accumulation (data not shown). This work shows that the use of phytoremediation as a feasible technology is a realistic present-day perspective for soil decontamination. A short-time experiment produced a large accumulation of many metals existing together in a real contaminated soil. NgTP1s plants had a slight biomass reduction, grown with no chelators, no fertilizers, no nutritive solution and with minimized watering. The natural characteristics of the NgTP1s plus the fact that they have an added trait producing higher accumulation than T. caerulescens has, and that they have more than 100 times

nez et al. / Chemosphere 64 (2006) 478485 M. Mart

485

biomass in high contaminated soils, means that these plants become a genuine alternative to the use of T. caerulescens in phytomining and/or phytoremediation, by providing a probable sustainable medium to remediate both metals and B from highly contaminated soils. Acknowledgements To the agricultural-corporation ASAJA-Alicante, and to the central service of scientic instrumentation of the University Jaume I, with the technical support of Vic was tor Escoin and Francisco Roig. Navarro-Avin o nanced by Social European Funds. This research was supported by FEDER project IFD97 1469-C04-03, for which the authors are deeply indebted. References
Abrisqueta, C., Romero, M., 1969. Humid rapid digestion of soils and organic materials. Anal. Edafol. Agrobiol. 27, 855867. Baker, A.J.M., Reeves, R.D., Hajar, A.S.M., 1994. Heavy metal accumulation and tolerance in British populations of the metallophyte Thlaspi caerulescens J. and C. Presl (Brassicaceae). New Phytol. 127, 6168. Brown, S.L., Chaney, R.L., Angle, J.S., Baker, A.J.M., 1995. Zinc and cadmium uptake by hyperaccumulator Thlaspi caerulescens grown in nutrient solution. Soil Sci. Soc. Am. J. 59, 125133. Clemens, S., Kim, E.J., Neumann, D., Schroeder, J.I., 1999. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast. Embo J. 18, 33253333. Council of the European Communities. Council directive of 12 June 1986 on the protection of the environment, and in particular of the soil, when sewage sludge is used in agriculture, O. J. Eur. Communities L181, pp. 612. De Knecht, J.A., Van Dillen, M., Koevoets, P.L.M., Schat, H., Verkleij, J.A.C., Ernst, W.H.O., 1994. Phytochelatins in cadmium-sensitive and cadmium-tolerant Silene vulgaris. Plant Physiol. 104, 255261. Ebbs, S.D., Lau, I., Ahner, B.A., Kochian, L.V., 2002. Phytochelatin synthesis is not responsible for Cd tolerance in the Zn/Cd hyperaccumulator Thlaspi caerulescens. Planta 214, 635640. Gisbert, C., Ros, R., De Haro, A., Walker, D.J., Bernal, P., Serrano, R., , J., 2003. A plant genetically modied that accumuNavarro-Avin o lates Pb is specially promising for phytoremediation. Biochem. Biophys. Res. Commun. 303, 440445. Hall, J.L., 2002. Cellular mechanisms for heavy metal detoxication and tolerance. J. Exp. Bot. 53, 111. Hernandez, F., Serrano, R., Roig-Navarro, A.F., Martinez-Bravo, Y., Lopez, F.J., 2000. Persistent organochlorines, organophosphorus

compounds and heavy elements in common whale (Balaenoptera physalus) from the western Mediterranean Sea. Mar. Pollut. Bull. 40, 426433. , T., Brooks, R.R., Lee, J., Reeves, R.D., 1976. Sebertia acuminata: a Jare hyperaccumulator of nickel from New Caledonia. Science 193, 579 580. Leopold, I., Gu nther, D., Schmidt, J., Neumann, D., 1999. Phytochelatins and heavy metal tolerance. Phytochemistry 50, 13231328. Lombi, E., Zhao, F., Dunham, S., McGrath, S., 2000. Cadmium accumulation in populations of Thlaspi caerulescens and Thlaspi goesingense. New Phytol. 145, 1120. Marmiroli, M., Antonioli, G., Maestri, E., Marmiroli, N., 2005. Evidence of the involvement of plant ligno-cellulosic structure in the sequestration of Pb: an X-ray spectroscopy-based analysis. Environ. Pollut. 134, 217227. Mengel, K., Kirkby, E.A., 1987. Principles of Plant Nutrition, fourth ed. International Potash Institute, Bern, Switzerland. Murashige, T., Skoog, F.A., 1962. Revised medium for rapid growth and bio-essays with tobacco tissue cultures. Physiol. Plant. 15, 473 497. Pilon-Smits, E., Pilon, M., 2002. Phytoremediation of metals using transgenic plants. Crit. Rev. Plant. Sci. 21, 439456. Reeves, R.D., Baker, A.J.M., 2000. Metal-accumulating plants. In: Raskin, I., Ensley, B.D. (Eds.), Phytoremediation Of Toxic Metals Using Plants To Clean Up The Environment. John Wiley and Sons, New York, pp. 193230. Robinson, B.H., Brooks, R.R., Howes, A.W., Kirkman, J.H., Gregg, P.E.H., 1997. The potential of the high biomass nickel hyperaccumulator Berkheya coddii for phytoremediation and phytomining. J. Geochem. Explor. 60, 115126. Robinson, B.H., Leblanc, A., Petit, D., Brooks, R.R., Kirkman, J.H., Gregg, P.E.H., 1998. The potential of Thlaspi caerulescens for phytoremediation of contaminated soils. Plant Soil 203, 4756. Salt, D.E., Smith, R.D., Raskin, I., 1998. Phytomediation. Ann. Rev. Plant Physiol. Plant Mol. Biol. 49, 643668. Song, W.Y., Sohn, E.J., Martinoia, E., Lee, Y.J., Yang, Y.Y., Jasinski, M., Forestier, C., Hwang, I., Lee, Y., 2003. Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nat. Biotechnol. 21, 914919. U.S.D.A. Soil Taxonomy 4. Basic system of soil classication for making and interpreting soil surveys, 2nd ed., Natural Resources Conservation Service. Vassilev, A., Schwitzguebel, J.P., Thewys, T., Van Der Lelie, D., Vangronsveld, J., 2004. The use of plants for remediation of metalcontaminated soils. TSWJ 4, 934. Walker, D.J., Bernal, M.P., 2004. The eects of copper and lead on growth and zinc accumulation of Thlaspi caerulescens J. and C. Presl: implications for phytoremediation of contaminated soils. Water Air Soil Pollut. 151, 361372. Walker, D.J., Clemente, R., Roig, A., Bernal, M.P., 2003. The eects of soil amendments on heavy metal bioavailability in two contaminated Mediterranean soils. Environ. Pollut. 122, 303312.