You are on page 1of 198

MASTER UNIVERSITARIO DI II LIVELLO MONITORAGGIO E VALUTAZIONE DEL RISCHIO AMBIENTALE, MUTAGENO, CANCEROGENO E TERATOGENO

Fisiologia cellulare e molecolare applicata al monitoraggio delle risposte biologiche

Prof. V. Cardile

Il corso si prefigge: introdurre alla conoscenza delle tecniche utilizzate nel laboratorio di colture cellulari e tissutali rivolgendo particolare attenzione alla definizione delle condizioni necessarie per preservare in vitro la vitalit e le funzioni delle cellule eucariote; ottenere dati utili per il laboratorio di oncologia sperimentale per ridurre la crescita tumorale e linvasione metastatica.

la cellula
... lunit fondamentale della materia vivente

Le cellule
sono le unit costitutive delle piante e degli animali sono prodotte dalla suddivisione di preesistenti cellule sono le pi piccole unit che svolgono tutte le funzioni fisiologiche vitali mantengono la propria omeostasi
La tendenza dei sistemi fisiologici a stabilizzare le condizioni interne

Le funzioni tessutali, di organo, di apparato e di organismo

riflettono
le azioni coordinate di molte cellule

La cellula lunit fondamentale di tutti i viventi Tutti gli organismi sono formati da cellule (gli organismi unicellulari sono formati da una sola cellula, gli organismi pluricellulari sono formati dallunione di pi cellule specializzate per compiere diverse funzioni)

Ogni cellula deriva da una cellula preesistente (ogni cellula in grado di produrre cellule uguali a se stessa attraverso la riproduzione)

LIVELLI DI ORGANIZZAZIONE DEI VIVENTI


Atomi Molecole Strutture/Organuli Cellula Tessuto Organo Sistema Organismo Ossigeno DNA Nucleo Cardiomiocita Muscolo cardiaco Cuore S. circolatorio Zebra

Livelli di organizzazione
Cellula lunit fondamentale in biologia costituita da organelli, i quali a loro volta sono un insieme di molecole. Tessuto gruppi di cellule che svolgono una specifica funzione (es. tessuto muscolare cardiaco). Organo gruppi di cellule o tessuti che svolgono una funzione globale (cuore). Apparati gruppi di cellule, tessuti e organi che svolgono una specifica funzione principale (es. sistema cardio-vascolare). Organismo una o pi cellule caratterizzate da un unico corredo di cromosomi (DNA).

LA CELLULA
costituita da:

MEMBRANA PLASMATICA

MATERIALE NUCLEARE
Mitocondri

CITOPLASMA
(citosol + organuli)

Ribosomi

Apparato di Golgi

Reticolo endoplasmatico (liscio e rugoso)

Lisosomi e vacuoli

Cloroplasti

Citoscheletro

principali costituenti chimici della cellula

carboidrati lipidi ioni

proteine

acidi nucleici

proteine
le proteine sono costituite da catene di aminoacidi (polipeptidi)

STRUTTURA PRIMARIA Sequenza lineare di amminoacidi connessi da legami peptidici. STRUTTURA SECONDARIA Foglio ripiegato o spirale prodotto dalla tensione degli atomi di CO e NH.

STRUTTURA TERZIARIA Struttura tridimensionale prodotta da collegamenti tra i radicali ai lati degli amminoacidi. Vengono creati i siti attivi.

Pi catene polipeptidiche producono una QUARTA STRUTTURA tridimensionale, grazie alla presenza di tasche, in cui avvengono specifiche reazioni chimiche.

aminoacidi

questi sono i 20 aminoacidi che si trovano nellorganismo umano e che costituiscono le proteine

Gli aminoacidi (o amminoacidi) sono composti organici che contengono contemporaneamente uno o pi gruppi amminici -NH2 e uno o pi gruppi carbossilici -COOH. Sono i componenti essenziali delle proteine; hanno grande importanza nella costituzione biochimica dei tessuti dell'organismo umano e, di conseguenza, nell'alimentazione. Si formano alla fine del processo di digestione delle proteine grazie ai fermenti pepsina, tripsina ed erepsina. Gli otto aminoacidi essenziali che l'organismo non pu sintetizzare, e che deve ricevere dalla digestione, sono triptofano, fenilalanina, lisina, treonina, valina, leucina, isoleucina e metionina. Per i bambini risultano aminoacidi essenziali anche arginina e istidina. L'organismo sintetizza anche altri aminoacidi che si dicono aminoacidi non essenziali. Gli aminoacidi non servono solo nell'anabolismo muscolare; alcuni di essi vengono anche utilizzati a fini energetici. Il processo per il quale alcuni aminoacidi vengono trasformati in glucosio (gluconeogenesi), poi usato come fonte energetica, dipende dall'intensit del lavoro e dalla durata.

Atomo di idrogeno COOH N2H

Atomo di carbonio

COOH

N2H

Gruppo amminico H2O Radicale

R Gruppo carbossilico

H2O

Legame peptidico

in condizioni fisiologiche, le proteine assumono complesse conformazioni tridimensionali

Proteina: conformazione

La forma tridimensionale della proteina determinante per la sua funzione

Proteina: conformazione

Il sito ad alta affinit di legame degli anticorpi


Gli anticorpi, per esempio, sono proteine che possiedono una porzione di forma complementare a quella di un antigene (il bersaglio dellanticorpo)

batterio

I carboidrati, detti anche glucidi o glicidi, sono sostanze organiche costituite da carbonio, idrogeno, ossigeno. Sono molecole di aldeidi (composti organici di formula bruta CnH2nO che recano nella loro struttura il gruppo funzionale formile, indicato con CHO) o di chetoni (di formula bruta CnH2nO che recano un gruppo carbonilico C=O all'interno della catena carboniosa) alle quali sono stati aggiunti vari gruppi ossidrilici, solitamente uno per ogni atomo di carbonio che non fa parte del gruppo funzionale aldeidico o chetonico. Ogni grammo di carboidrati fornisce quattro calorie e a seconda del numero di zuccheri semplici presenti nella formula si suddividono in monosaccaridi, disaccaridi e polisaccaridi. Sono presenti in modo consistente nei tessuti dei viventi con funzione energetica attraverso il processo di respirazione, di riserva (amido, glicogeno) e di sostegno (cellulose, emicellulose ecc. dei vegetali, chitina degli Insetti). Si originano nelle piante dall'anidride carbonica dell'aria e dall'acqua del suolo tramite l'energia solare in presenza di clorofilla (fotosintesi). Sono stati identificati pi di duecento monosaccaridi formati da una sola molecola di zucchero semplice.

Carboidrati: monosaccaridi
glucosio galattosio

fruttosio

Carboidrati: disaccaridi lattosio


galattosio glucosio

saccarosio

glucosio

fruttosio

Carboidrati: polisaccaridi

glicogeno

Lipidi
Vengono identificati sulla base delle loro propriet comuni di solubilit: sono insolubili in acqua (definiti per questo idrofobi), mentre sono solubili in solventi organici non polari, come etere dietilico o acetone, alcoli e idrocarburi. Dal punto di vista strutturale, i lipidi sono costituiti prevalentemente da atomi di carbonio e di idrogeno uniti tra loro con legami covalenti scarsamente polari (caratteristica che conferisce il comportamento idrofobo) e disposti simmetricamente.

le proteine sono certamente le molecole pi versatili della cellula; ma c una cosa importante che le proteine non sanno fare: replicare se stesse

Il DNA: struttura e funzioni


Il DNA, lacido desossiribonucleico, un polimero formato da quattro tipi diversi di nucleotidi; esso ha una struttura a doppia elica molto lunga e spiralizzata, frammentata da pioli costituiti dalle complementarit di basi azotate specifiche.

La funzione principale del DNA trasportare linformazione genetica attraverso le generazioni seppur con parziali cambiamenti dovuti allo scambio di geni durante il processo di duplicazione delle cellule che lo contengono.

Acidi nucleici

I geni risiedono nella doppia elica del DNA


Coppie di basi

Scheletro zuccherofosfato

Base azotata

Zucchero a 5 atomi di C

I nucleotidi sono le unit che compongono un acido nucleico (RNA o DNA)

Molecola con propriet basiche, contenente azoto. E una componente dei nucleotidi che formano gli acidi nucleici: pu essere una purina o una pirimidina.
Una purina presenta una struttura a due anelli; esempi sono ladenina (A) e la guanina (G).

Una pirimidina presenta una struttura ad un solo anello; esempi sono la citosina (C) e la timina (T).

La duplicazione del DNA, durante la divisione cellulare, inizia da una specifica sequenza di nucleotidi detta punto dorigine della duplicazione sul quale comincia a svolgersi il doppio filamento con lo spezzamento dei legami idrogeno tra le basi azotate grazie ad enzimi come lelicasi e la topoisomerasi. Si forma una bolla di duplicazione delimitata da strutture ad Y dette forcelle di duplicazione. Su uno dei due filamenti, detto filamento stampo, scorre un ulteriore enzima, la DNApolimerasi, che sintetizza il nuovo filamento e si occupa di correggere eventuali errori (azione di proofreading). La duplicazione avviene in entrambe le direzioni per questo detta bidirezionale.

Basi azotate appaiate forcelle bolla Punto dorigine

Cambiamenti nella sequenza o nel numero dei nucleotidi nellacido nucleico di una cellula o di un organismo sono detti mutazioni genetiche. Esse possono dare origine alla sostituzione di un nucleotide con un altro (mutazione puntiforme), oppure a perdita durante la duplicazione di materiale genetico (delezione) oppure ad aggiunte di nucleotidi. Le sostituzione di nucleotidi possono dar luogo a mutazioni di senso, in cui un amminoacido viene sostituito da un altro, o a mutazioni di non senso, in cui la sintesi proteica termina in un modo prematuro. Le delezioni o le aggiunte di nucleotidi possono provocare spostamenti del sistema di lettura e la produzione di proteine nuove, che sfuggono alla correzione da parte dellenzima DNApolimerasi, ma di solito non sono funzionali.

Processo enzimatico per cui linformazione genetica contenuta in un filamento di DNA viene utilizzata per specificare una sequenza complementare di basi in una molecola di RNA detta messaggero. LRNA messaggero viene sintetizzato con lo stesso principio dellaccoppiamento di basi azotate che regola la duplicazione del DNA, ma il filamento unico e da unestremit procede verso laltra in un completamento delle basi azotate rispetto al filamento stampo del DNA.
RNA messaggero

DNA: filamento stampo

Successivamente alla trascrizione dellRNA messaggero, questo acido nucleico esce dal nucleo e raggiunge il citoplasma in cui si lega ai ribosomi. Il filamento di RNA per prima cosa si lega alla subunit pi piccola del ribosoma ponendo in evidenza il suo primo codone. Poi giunge lRNA di trasporto che si colloca secondo il criterio codoneanticodone portando con s il primo amminoacido (in genere la metionina): si formato il complesso dinizio (mRNA, tRNA, subunit pi piccola). Da qui giungono altri tRNA che trasportano altri amminoacidi che legandosi fra di loro creano una catena polipeptidica complementare allinformazione trasportata dal RNA messaggero.
RIBOSOMA Subunit pi grande RNA messaggero Subunit pi piccola tRNA + ammin. tRNA + ammin. tRNA + ammin. Legame peptidico

Codoneanticodone

Acido desossiribonucleico

Il segreto del DNA risiede nella sua struttura

DNA

S P N

Zucchero (desossiribosio) Gruppo fosfato Base azotata

3
S N

S N

S N

S N

nucleotide

Le 4 basi azotate del DNA

Adenina Timina Citosina Guanina

La doppia elica

Il messaggio cifrato
leccezionalmente lunga TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGATC sequenza sequenza di di basi basi azotate azotate nel nel TATCGATCGGCTATTCGCAAAGCTGCGCGACTGCGATGCGCTAGCATGC DNA GATTCGCGATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATATA DNA costituisce costituisce il il messaggio messaggio cifrato GCGCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTAGAGATAGGAT cifrato contenuto contenuto nei nei manuali CGAGATCGAGGCGAGATCATATGAGCGCGGCTATTTAGGCTTAGAGGAT manuali (cromosomi) (cromosomi) TCGGAGATTCGGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGT conservati conservati nel nel locale locale di di ATCGCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCGATC controllo controllo (nucleo) (nucleo) della della GATAGGACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGATGAGCATG fabbrica cellulare fabbrica cellulare AGATGCATGTACGACTGCATAGGCATGACTGATCGACTGCATCATGACGC ATGACTGCATGCATGACTGCATATGACGGACTCGCA leccezionalmente lunga

Dallanticodon alla catena peptidica


DNA tRNA mRNA A T G T T T G T T G C C T A A T A C A A A C A A C G G A T T A U G U U U G U U G C C U A A U A C A A A C A A C G G A U U

Met

Phe
peptide

Val

Ala

Stop

L'RNA transfer (o RNA di trasporto), abbreviato in tRNA, una piccola catena di RNA (di 74-93 nucleotidi) che trasferisce un amminoacido specifico ad una catena polipeptidica in crescita al sito ribosomiale della sintesi proteica durante la traduzione. Il tRNA ha un sito di attacco per l'amminoacido ed una regione con tre basi (nucleotidi), chiamata anticodone, che riconosce il corrispondente codone a tre basi dell'mRNA attraverso l'appaiamento di basi complementari. Ogni tipo di molecola di tRNA pu legarsi ad un solo tipo di amminoacido, ma essendo presenti nel DNA tipi diversi di codoni che specificano uno stesso amminoacido, molti tipi di tRNA con anticodoni differenti possono portare lo stesso amminoacido. La molecola di RNA transfer dunque il dispositivo "adattatore" ipotizzato da Francis Crick, che media il riconoscimento della sequenza del codone nell'mRNA e permette la sua traduzione nell'amminoacido appropriato.

il ciclo cellulare
le cellule si riproducono attraverso un processo detto mitosi prima della mitosi, lintero genoma produce una copia di se stesso tramite la replicazione del DNA

rappresenta uno stato di disagio nei confronti di tutto ci che viene imposto troppo intensamente dallesterno

abiotico

biotico

STRESS AMBIENTALI
si intendono stimoli esterni (stressogeni) provenienti dallambiente, che possono provocare danni alla salute o condurre a morte verso i quali un organismo risponde in maniera attiva.

Modello Hans Selye (Vienna 1907-Montreal 1982) Stadi della dinamica dello stress o Sindrome Generale di Adattamento
in cui l'organismo risponde agli stressor mettendo in atto meccanismi di fronteggiamento (coping) sia fisici che mentali (aumento del battito cardiaco, pressione sanguigna, ecc.). in cui il corpo tenta di combattere e contrastare gli effetti negativi dell'affaticamento prolungato, producendo risposte ormonali specifiche da varie ghiandole. in cui lorganismo entra in uno stato di esaurimento, non essendo pi in grado di mantenere attivi i meccanismi di difesa.

Fase di allarme

Fase di resistenza

Fase di collasso

La La morte morte pu pu sopravvenire sopravvenire sia sia nella nella fase fase di di allarme allarme sia sia nella nella fase fase di di esaurimento. esaurimento.

Tuttavia Tuttavia difficile difficile definire definire con con precisione precisione uno uno stato stato di di stress, stress, dato dato che che le le risposte risposte degli degli esseri esseri viventi viventi in in termini termini di di resa resa dipendono dipendono da da fattori fattori intrinseci intrinseci ed ed estrinseci estrinseci ai ai viventi viventi stessi. stessi.

Fattori intrinseci: genotipo, tessuto/organo, et, stato nutrizionale e sanitario. Fattori estrinseci: intensit, durata, rapidit di insorgenza, altre condizioni.

Variazioni fisiologiche in risposta a variazioni dellambiente esterno


1.Variazioni acute (risposte immediate reversibili che si instaurano subito dopo la variazione ambientale) 2.Variazioni croniche (acclimatazione e acclimatizzazione) (cambiamenti fisiologici reversibili che si instaurano dopo unesposizione al nuovo ambiente che si prolunghi per giorni, mesi o settimane) 3.Variazioni evolutive (cambiamenti che avvengono per modificazione delle frequenze geniche nellarco di molte generazioni in popolazioni esposti ad ambienti nuovi)

Variazioni fisiologiche che sono programmate internamente per aver luogo sia in presenza sia in assenza dellambiente esterno
1.Variazioni di sviluppo (che si svolgono in sequenza programmata, via via che lindividuo matura dal concepimento allet adulta) 2.Variazioni controllate da orologi biologici periodici (che ricorrono periodicamente sotto il controllo di un orologio biologico interno allindividuo)

Le risposte acute e croniche sono risposte fenotipiche di individui alle variazioni ambientali Le risposte evolutive comportano un cambiamento del genotipo

Gli animali che affrontano le variazioni del proprio ambiente hanno tre tipi di risposta
evitano
possiedono alcuni meccanismi per allontanarsi dal problema ambientale sia in termini spaziali (anfratti, fessure, microhabitat) sia in termini temporali (usando il torpore o producendo uova, cisti).

si conformano
vanno incontro a variazioni dellambiente interno simili ai cambianti di stato imposti dallesterno.

regolano
mantengono alcuni o tutti i componenti dellambiente interno in condizioni vicine al livello originario o normaleindipendentemente dalle condizioni esterne.

Acclimatazione: processo con cui un individuo reagisce alle variazioni ambientali secondo le proprie capacit.

Adattamento: espressione dellinsieme dei caratteri che geneticamente caratterizzano una popolazione e che si sono evoluti per innalzare la soglia di tolleranza allo stress imposto da una particolare pressione ambientale.

Esistono adattamenti di tipo diverso che rappresentano le soluzioni ai problemi posti dalla complessit dellambiente nei suoi aspetti biologici, fisici, chimici, ecologici e sociali.

Vista la casualit con cui insorgono le variazioni, gli adattamenti sono generalmente una delle tante possibili risposte, ma non necessariamente la migliore, ad un problema posto dallambiente.

I cambiamenti evolutivi sono del tutto casuali e non sempre corretto cercare una spiegazione adattativa
Quindi dapprima avviene un cambiamento, in seguito se il cambiamento vantaggioso, viene selezionato dallambiente

adattamento

ACCLIMATAZIONE
comprende modificazioni funzionali in risposta ad un determinato stress ambientale prodotto in laboratorio.

ACCLIMATIZZAZIONE
si riferisce a modificazioni fisiologiche che si producono in risposta a stress naturali.

ACCLIMATAZIONE VELOCE

ACCLIMATAZIONE A LUNGO TERMINE (da 12 giorni a 1 settimana)

il complesso dei caratteri visibili di un individuo dovuti allinterazione tra il patrimonio genetico (genotipo) e le condizioni ambientali.

Il termine adattamento spesso impropriamente utilizzato per descrivere modificazioni compensatorie a breve termine in risposta a variazioni ambientali. Queste modificazioni sono, invece, il risultato della plasticit fenotipica per cui i caratteri esistenti vengono espressi in maniera diversa e appropriati alle condizioni ambientali, in questo caso sono pi corretti i termini acclimatazione o acclimatizzazione.

ESPRESSIONE DIFFERENZIALE DEI GENI

Nelle diverse forme ambientali, i vari geni presenti sui cromosomi possono esprimere o meno il loro contenuto informativo (e quindi tradursi in una determinata proteina enzimatica strutturale). Lespressione differenziale dei geni deriva, in pratica, dalla diversa risposta del programma genetico alle diverse condizioni ed inoltre dalle possibili interazioni fra cellule dellorganismo. I vari cambiamenti che derivano dallespressione differenziale dei geni non modificano il programma genetico contenuto nelle varie cellule.

Il DNA, insieme a diverse proteine si organizza in una struttura che detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando una cellula non in divisione, la cromatina si trova sotto forma di lunghi filamenti. Durante la divisione le fibre di cromatina si condensano e si rendono visibili come strutture distinte.

Nelle cellule umane i cromosomi si possono osservare durante la divisione cellulare e distinguere per forma e dimensioni.

Il gene l'unit ereditaria fondamentale degli organismi viventi

I geni corrispondono a porzioni di codice genetico localizzate in precise posizioni allinterno della sequenza (DNA o, pi raramente, di RNA) e contengono tutte le informazioni necessarie per la produzione di una proteina. Essi sono contenuti ed organizzati allinterno dei cromosomi, presenti in tutte le cellule di un organismo. Le cellule umane contengono tutte 23 coppie di cromosomi, con la sola eccezione dei gameti, che presentano una singola copia di ciascun cromosoma. Nei procarioti il gene costituito esclusivamente da sequenze codificanti, negli eucarioti anche da sequenze non codificanti. Nel gene eucariotico la sequenza codificante si definisce esone e quella non codificante introne. Ogni gene pu presentare delle forme alternative, che differiscono leggermente fra loro nella sequenza nucleotidica e che prendono il nome di alleli.

Geni e cromosomi
a

OGNI CROMOSOMA E COSTITUITO DA UNA SUCCESSIONE LINEARE DI GENI O LOCI. GENE: UNITA EREDITARIA FONDAMENTALE

b c d

LOCUS: POSIZIONE CROMOSOMA.

OCCUPATA

DA

UN

GENE

SU

UN

OGNI PAIO DI CROMOSOMI CONTIENE GLI STESSI GENI NELLO STESSO ORDINE MA NON NECESSARIAMENTE IN FORMA IDENTICA.

ALLELI: FORME DIVERSE DI UNO STESSO GENE

Con il termine espressione genica si intende il processo attraverso cui l'informazione contenuta in un gene (costituito da DNA) viene convertita in una macromolecola funzionale (tipicamente una proteina, ma anche un altro tipo di acido nucleico, come alcuni RNA che non vengono tradotti in proteine). L'espressione genica finemente regolata dalla cellula. Tutti i passaggi dell'espressione genica possono essere modulati, a partire dal passaggio della trascrizione del DNA ad RNA, fino alle modificazioni post-traduzionali della proteina prodotta. La regolazione dell'espressione genica fondamentale per la cellula, perch le permette di controllare le proprie funzioni interne ed esterne, come la differenziazione cellulare, la morfogenesi o i vari processi di adattamento alle necessit dell'organismo.

Nella cellula eucariote, un gene consiste concretamente (nella maggior parte dei casi) in una sequenza di DNA. Tale sequenza caratterizzata dalla presenza di: un promotore, che controlla l'espressione genica; esoni, regioni codificanti; introni, sequenze non codificanti, che possono avere funzione regolatoria.
Sia gli esoni che gli introni sono copiati durante un processo chiamato trascrizione, a produrre un filamento di pre-mRNA. Esso viene in seguito processato per diventare un RNA messaggero (o mRNA), in grado di dirigere la sintesi delle proteine.

Maturazione dellmRNA
splicing , sottrazione degli introni non codificanti (in molti casi si ha uno splicing alternativo, che permette alla cellula di sintetizzare pi proteine a partire da un unico gene); capping, viene aggiunto un "cappuccio" di 7-metil guanosina al residuo 5terminale della catena con un insolito legame 5,5' trifosfato (condensazione di una molecola di GTP con il trifosfato dell'estremit del trascritto e metilazione in posizione 7). Questa modificazione importante per il riconoscimento e l'aggancio appropriato dell'mRNA al ribosoma e ne impedisce la degradazione; poliadenilazione , consiste nell'aggiunta di una sequenza poliadenilica di circa 200 nucleotidi (poli(A)), all'estremit 3'-OH del pre-mRNA tramite legame covalente. Quasi tutti gli mRNA possiedono una coda poli(A) che ha lo scopo di proteggere il trascritto. Un'eccezione rappresentata dall'mRNA che codifica per le proteine istoniche.

Un microarray di DNA (comunemente conosciuto come gene chip, chip a DNA, biochip o matrici ad alta densit) costituito da un insieme di microscopiche sonde di DNA attaccate ad una superficie solida come vetro, plastica, o chip di silicio formanti un array (raggruppamento).
una tecnica che stata sviluppata negli anni '90 e oggi permette l'analisi dell'espressione genica monitorando in una sola volta gli RNA prodotti da migliaia di geni. Consiste nel fissare tutti i segmenti di DNA (detti probe) su un supporto e nel marcare invece l'acido nucleico che vogliamo identificare (detto target).

Per studiare gli mRNA, essi vengono prima estratti dalle cellule, convertiti in cDNA, con luso di un enzima chiamato transcrittasi inversa e allo stesso momento marcati con una sonda fluorescente. Quando si fa avvenire l'ibridazione fra la sonda presente sulla matrice e il cDNA target, quest'ultimo rimarr legato alla sonda e pu essere identificato semplicemente rilevando la posizione dove rimasto legato. Le principali applicazioni sono: l'analisi dei polimorfismi SNP, il confronto di popolazioni di RNA di cellule diverse e l'utilizzo per nuove metodologie di sequenziamento del DNA, nonch per lo screening di sequenze senso e antisenso nella ricerca degli oligonucleotidi usati in campo farmaceutico.

Meccanismi che regolano lespressione genica


Trascrizione, in generale viene controllata dallazione combinata di numerose proteine note come
fattori di trascrizione, che si legano a sequenze regolatorie specifiche e modulano lattivit dellRNA polimerasi. Esistono inoltre meccanismi di silenziamento dei geni, come la condensazione del DNA nella cromatina o meccanismi di metilazione tramite il legame di proteine specifiche ai gruppi metilici che bloccano la trascrizione dei geni.

Proteine che si legano al DNA, si riferisce a quelle molecole come gli ormoni che attraversano
la membrana plasmatica e si legano a specifiche molecole recettoriali presenti allinterno della cellula bersaglio. Il complesso ormone-recettore (HR) quindi in grado di penetrare nel nucleo e di legarsi al DNA in corrispondenza di un sito specifico. La proteina recettoriale appartiene ad una famiglia di proteine che si legano al DNA e che possiedono dei domini a dito di zinco (zinc-finger), i quali sono delle regioni della proteina che legano gli ioni di zinco e che si avvolgono in strutture ad ansa (dita) che possono legarsi al DNA. Il legame del complesso HR con il DNA aumenta la trascrizione di geni, il che modifica la quantit di mRNA e di conseguenza conduce allaumento della sintesi proteica.

Splicing alternativo, si riferisce alle molecole di RNA che possono essere modificate cambiando
lordine con cui gli esoni sono cuciti (spliced) assieme.

Stabilit degli mRNA, che avviene quando la trascrizione di un gene produce una molecola di
mRNA molto stabile che rimane nel citoplasma per svariati giorni e che pu essere utilizzata ripetutamente per la traduzione e la sintesi di un specifica proteina.

Eventi posttraduzionali, si riferiscono ai polipeptidi di nuova sintesi che vanno incontro ad uno o
pi tipi di modificazioni covalenti (es. le proteine che vengono secreti come precursori).

Che Che cosa cosa ci ci ha ha insegnato insegnato il il Progetto Progetto Genoma Genoma Umano? Umano?
Il Il genoma genoma umano umano contiene contiene 3 3 miliardi miliardi di di coppie coppie di di basi basi e e circa circa 25000 25000 geni. geni. Il Il genoma genoma completo completo di di un un organismo organismo fornisce fornisce soltanto soltanto una una visione visione relativamente relativamente statica statica delle delle sue sue potenzialit potenzialit funzionali, funzionali, mentre mentre non non pu pu descrivere descrivere limmensa limmensa mole mole di di processi processi dinamici dinamici che che hanno hanno luogo luogo in in un un organismo organismo vivente. vivente. Al Al contrario contrario le le proteine proteine fatte fatte soltanto soltanto di di circa circa 20 20 amminoacidi amminoacidi hanno hanno una una variet variet di di propriet propriet chimiche: chimiche: sono sono ordinati ordinati in in diverse diverse proteine proteine e e per per di di pi pi queste queste si si ripiegano ripiegano dando dando origine origine a a strutture strutture tridimensionali tridimensionali che che stanno stanno alla alla base base di di migliaia migliaia di di funzioni. funzioni. In In sostanza sostanza il il DNA DNA conserva conserva le le informazioni informazioni quasi quasi invariate invariate per per migliaia migliaia di di anni anni mentre mentre le le proteine proteine fanno fanno il il resto. resto. Inoltre Inoltre se se il il DNA DNA dei dei circa circa 252 252 tipi tipi di di cellula cellula somatica somatica del del corpo corpo umano umano ha ha sostanzialmente sostanzialmente la la stessa stessa sequenza, sequenza, la la composizione composizione proteica proteica di di queste queste cellule cellule molto molto diversa diversa sia sia come come quantit quantit che che come come tipo. tipo. E E nato nato pertanto pertanto un un nuovo nuovo indirizzo indirizzo chiamato chiamato genomica genomica funzionale funzionale o o fisiologica fisiologica che che riguarda riguarda lanalisi lanalisi dellmRNA dellmRNA e e dei dei prodotti prodotti proteici proteici espressi espressi dai dai geni. geni.

emersa emersa una una visione visione dellintrigata dellintrigata rete rete di di regolazione, regolazione, che che soppianta soppianta il il dogma dogma un un gene, gene, una una proteina, proteina, una una funzione, funzione, ma ma anche anche quello quello per per cui cui linformazione linformazione fluisce fluisce dai dai geni geni alle alle proteine proteine e e non non viceversa. viceversa.

La costruzione dei caratteri si verifica attraverso una stretta collaborazione di geni e proteine influenzata da stimoli ambientali, ad esempio nei complessi di trascrizione. Perci il fenotipo non solo il prodotto passivo dellazione del genotipo, ma anche lo strumento attraverso cui questazione pu verificarsi. Pertanto la costruzione di un fenotipo si attua su tre livelli dinterazione:

1. quello delle interazioni geniche, 2. quello dato dalle interazioni fra proteine, RNA e DNA, bidirezionali e con fenomeni di retroazione nei processi di espressione genica attraverso trascrizione e traduzione,

3. quello dato da interazioni fra proteine ed altre sostanze che si verificano a livello fenotipico sia nellambito della cellula che intercellulare.

Tutti sono influenzati da processi epigenetici collegati a stimoli ambientali esogeni ed endogeni, un insieme di effetti e di vincoli che nel loro insieme costituiscono lepigenotipo.

1897 Edmund Beecher Wilson (Columbia University)

pose le basi della genetica moderna dimostrando che la localizzazione fisica delleredit era nel cosiddetto idioplasma, che oggi chiamiamo cromatina, cio il complesso di molecole di DNA e di proteine che comprende i cromosomi e descrivendo la cromatina come una sostanza attiva e dinamica nel nucleo cellulare.

1952 Alfred Hershey e Martha Chase (Carnegie Institution of Washington)

dimostrarono che il materiale ereditario non era la proteina del nucleo, ma il vettore dellinformazione erediatabile era il DNA.

1953 James D. Watson e Frances H.C. Crick (Cambridge University)

pubblicarono la struttura chimica del DNA.

1963 Francois Jacob, Jacques Monod e Andr Michael Lwoff (Istituto Pasteur)

diffusero la teoria delloperone: uno o, di solito, pi geni strutturali, un promotore, situato a monte dei geni, ovvero una sequenza di DNA che, legandosi all'RNA polimerasi, permette l'inizio della trascrizione, un operatore, un frammento di DNA, che pu essere situato a monte, a valle o anche lontano dal promotore, che regola l'espressione dei geni strutturali. L'operatore svolge questa funzione interagendo con una specifica proteina chiamata proteina repressore o proteina attivatore, a seconda che, appunto, impedisca o stimoli l'espressione. L'operone pu anche contenere un gene regolatore, che codifica appunto per la proteina regolatrice. Questo gene, tuttavia, non viene normalmente considerato parte integrante dell'operone, in quanto in alcuni casi pu essere dislocato in un punto del genoma anche molto lontano dall'operone stesso.

la rappresentazione delloperone sembrava semplice e completa; lattenzione si spost verso la ricerca di fattori proteici che controllano i geni senza cercare un ruolo per la cromatina; sembrava che il ruolo principale del nucleo cellulare fosse quello di deposito per il grande insieme di informazioni cifrate a quattro lettere. Oggi i biologi sono molto interessati al funzionamento dinamico del nucleosoma, il mattone fondamentale della cromatina che si forma quando il DNA si avvolge intorno a un nucleo formato dalle proteine degli istoni.

1997 Karolin Luger (Eidegenssische Technische Hochschule (ETH) di Zurigo

determin la struttura molecolare del nucleosoma. Il nucleosoma consiste di due coppie di quattro tipi di proteine istoniche (H2A, H2B, H3 e H4) che formano un ottamero, detto anche nucleo dellistone a otto unit, avvolto a due giri di una sequenza di DNA di 147 basi. Da allora altri ricercatori hanno determinato altre strutture cromatiniche di ordine poco pi grande, che consistono di diversi istoni. Tuttavia non siamo ancora in grado di descrivere in maniera precisa la geometria dei fili di DNA dentro la cellula, formata da milioni di istoni disposti in una matrice a portata di mano ma ancora sconosciuta.

Sappiamo che linterazione del DNA con il nucleo del nucleosoma sembra preferire sequenze ripetute di 10 o 11 basi; queste ripetizioni sembrano facilitare la piega pronunciata del DNA sullorlo del nucleosoma. 2006 Jonathan Widom (Northwestern University) e Eran Segal (Weizmann Institute, Istraele)

analizzando frammenti di DNA legati ai nucleosomi, avevano confermato e ulteriormente identificato gli schemi di disposizione dei nucleosomi sul DNA. In questi studi, la ripetizione principale sembra quella di alcuni accoppiamenti di dinucleotidi adiacenti (AA, TT e TA) pi frequenti nei punti di contatto tra la sequenza di DNA e il nucleo dellistone. Ora chiaro che il periodo naturale di 10,4 basi nella struttura elicoidale del DNA aiuta a generare la periodicit di 10-11 coppie di basi, che favorisce la deformazione del DNA sulla superficie.

Attualmente si stanno studiando le forze molecolari che agiscono durante la formazione del nucleosoma e le energie necessarie affinch una qualsiasi sequenza si adatti al nucleo istonico.

2009 Remo Rohs (University of Southern California)

studiando i dettagli della biofisica delle interazioni tra DNA e proteine, ha dimostrato che le sequenze di DNA con brevi serie ripetute di adenina (A) o della sua base complementare timina (T), formano unelica poco pi stretta e quindi pi rigida. Quando il DNA con brevi serie di A deformato dal legame DNAproteine, il restringimento delle pieghe pi piccole del DNA concentra il potenziale elettrostatico in modo da attrarre larginina, amminoacido con carica positiva. Questa attrazione sembra spiegare perch molti fattori di trascrizione, ricchi di arginina, trovano il proprio sito di legame senza leggere base per base la sequenza del DNA.

Stiamo imparando che il DNA una struttura biofisica, con importanti implicazioni per le interazioni a scala nanometrica tra DNA e proteine alla base delle reti di regolazione del genoma.

Specific examples of minor-groove shape recognition by arginines.

R Rohs et al. Nature 461, 1248-1253 (2009) doi:10.1038/nature08473

Mentre la struttura primaria della cromatina definita dalla posizione dei nucleosomi nel DNA, che a sua volta dipende dalla sequenza di basi, il livello successivo della struttura della cromatina probabilmente prodotto dalle interazioni tra nucleosomi adiacenti, controllate dalle modificazioni chimiche dellistone stesso. In particolare, H3 e H4 hanno lunghe code che interagiscono con le sequenze di DNA allesterno dei nucleosomi adiacenti. Lacetilazione di specifici amminoacidi sulle code di H3 e H4 promuove la dissociazione dei pacchetti di nucleosomi, in modo da aprire la cromatina e permettere lattivazione dei geni (perch consente ai fattori di trascrizione di accedere al DNA). La metilazione degli altri siti invece associata alla cromatina chiusa, e quindi alla soppressione dellattivit dei geni. Inoltre le regioni istoniche nel nucleo del nucleosoma subiscono modificazioni specifiche che producono varianti degli istoni, le quali a loro volta, influenzano la regolazione genica. Poco si conosce del modo in cui il DNA di ogni cellula umana lungo due metri si ripiega nei 5 micrometri del nucleo.

Acetilazione
promossa da una classe di enzimi chiamate HATs (Histone Acetyltransferases) e prevede il trasferimento di un gruppo acetile [(CH3(C=O)-), il donatore l'acetil-coenzima A] su un residuo amminoacidico di lisina presente all'estremit N-terminale di tutti gli istoni che formano il nucleosoma. La lisina perde cos la carica positiva normalmente presente a pH cellulare sull'azoto della catena laterale e di conseguenza non pi in grado di legare con alta affinit i gruppi fosfato del DNA (che ha carica negativa). Il DNA viene quindi rilassato in quel punto permettendo ad altre proteine o enzimi di interagire con esso.

Metilazione
mediata dalla classe di enzimi istone metil-trasferasi (HMTs) e prevede il trasferimento di un gruppo metilico (-CH3) ad una lisina o un'arginina presente all'estremit N-terminale degli istoni H3 o H4. Il donatore dei gruppi metilici la S-adenosil-metionina (o SAM). Gli effetti possono essere differenti (la metilazione della lisina 9 sull'istone H3 porta alla formazione di un sito di legame per la proteina principale dell'eterocromatina (heterochromatin protein-1 o HP1), una proteina in grado di indurre impacchettamento e quindi il silenziamento; viceversa una metilazione della lisina 4 su H3 ha l'effetto opposto e promuove l'apertura cromatinica con conseguente aumento dell'espressione genica.

Levoluzione a livello molecolare o delle sequenze pu avere effetti strutturali o regolatori.


Levoluzione strutturale si riferisce alle mutazioni del DNA che hanno effetto sulla struttura delle proteine. Questi cambiamenti sono limitati alle regioni codificanti del DNA. In genere, le mutazioni della terza base dei codoni (le parole di tre basi che codificano uno specifico amminoacido) non alterano lamminoacido che entra nella sequenza proteica: sono mutazioni silenti, che non hanno effetto sulla struttura della proteina. Nelle altre posizioni del codone, invece, le mutazioni non sono silenti. Questa peculiarit del codice genetico ha consentito agli evoluzionisti molecolari di dedurre leffetto della selezione naturale sullevoluzione strutturale delle proteine confrontando il rapporto tra mutazioni silenti e non silenti, con il risultato che si avrebbe se la selezione fosse neutrale. Dedurre lazione della selezione sulle regioni regolatorie non codificanti del DNA un problema pi complesso, perch il DNA non codificante non ha un marcatore adatto come la terza base dei codoni.

Studi recenti hanno mostrato che i geni sono accompagnati da regioni di DNA senza nucleosomi, pi rigide della media e non facilmente avvolte intorno ai nuclei dei nucleosomi. Situati sia a monte sia a valle delle regioni codificanti, questi segmenti aperti di DNA consentono un accesso pi facile ai fattori di trascrizione.

In futuro i metodi per dedurre levoluzione molecolare dei siti di regolazione nel genoma dovranno affrontare tutte le complesse interazioni molecolari coinvolte.
Un errore comune lidea che i nostri fenotipi (le nostre caratteristiche morfologiche o fisiologiche misurabili) siano principalmente il prodotto o dei geni o dellambiente, la cosiddetta dicotomia natura/cultura. I biologi che studiano gli organismi e mettono in relazione il genotipo con il fenotipo devono essere consapevoli che natura, cultura e caso non possono mai essere completamente separati nello sviluppo di un dato fenotipo.

E dove avvengono queste interazioni allinterno della cellula? Nella cromatina.


Studi pubblicati nel 2010 hanno dimostrato che la cromatina molto stabile (e quindi ereditabile) e di conseguenza relativamente duratura alla scala evolutiva, ma anche molto dinamica, perch soggetta ai cambiamenti indotti dallambiente nellindividuo. Funziona da interfaccia primaria per lincontro tra geni e ambiente.

A livello molecolare come fa la cromatina a svolgere questo doppio ruolo?

Esistono diversi livelli di organizzazione della cromatina:


1.La fibra da 11 nm di diametro il primo livello, uno stadio detto "filo a collana di perle" per il suo aspetto. In questo stadio il DNA avvolto attorno ai nucleosomi, senza ulteriori ripiegamenti; 2.La fibra da 30 nm di diametro il secondo livello. In esso la cromatina assume un aspetto solenoidale grazie alle interazioni tra le code degli istoni di un nucleosoma, con quelle dei nucleosomi adiacenti, nonch grazie agli istoni H1. Questi istoni sono pi grandi di quelli che formano l'ottamero del corpo del nucleosoma e si trovano in rapporto 1:1 con esso. Ogni istone H1 possiede un corpo centrale e due code che aderiscono sia all'ottamero che ai filamenti di DNA in entrata e in uscita. La sua interazione con il DNA linker gli permette di direzionarlo in modo da contribuire al ripiegamento solenoidale. Tuttavia non sono del tutto note le sue funzioni in rapporto al superavvolgimento della cromatina. La fibra da 30 nm lo stadio in cui si trova la cromatina attiva in interfase (periodo compreso fra due divisioni cellulari), cio la cromatina che viene trascritta; 3.La fibra da 300 nm di diametro o fibra ad ansa, la cromatina si ripiega ulteriormente su se stessa grazie anche all'aiuto di altre proteine; 4.La fibra da 700 nm di diametro, la cromatina si superavvolge, il diametro dei singoli cromatidi; 5.La fibra da 1400 nm di diametro, il livello di condensazione massimo, quello dei cromosomi mitotici.

Un passo iniziale per fare ricerca sul ruolo della cromatina nelle malattia sar determinare il modo in cui lorganizzazione della cromatina influenza la regolazione genica.
le caratteristiche identificative (le firme) ereditabili e quindi passibili di evoluzione della cromatina sono probabilmente limitate allinterazione fisica diretta con il DNA, dato che lorganizzazione fine della cromatina, definita dal posizionamento del nucleosoma sul DNA, dipendente dalla composizione e dalla disposizione spaziale della sequenza di nucleotidi. la componente non ereditabile e dinamica della cromatina probabilmente una caratteristica dellorganizzazione di livello superiore, pi lontana dalle influenze biofisiche dirette delle sequenze di DNA, poich la cromatina anche modificabile in modo reversibile a livelli superiori di organizzazione strutturale, per esempio per mezzo di modificazioni chimiche delle code dellistone.

La ricerca nel campo della biologia della cromatina ha conosciuto una crescita enorme negli ultimi anni. La nuova area della epigenetica, che include qualsiasi cambiamento ereditabile nel fenotipo o nellespressione genica non direttamente dovuto a un mutamento della sequenza del DNA, ora una delle pi importanti linee di finanziamento dei National Institutes of Health.

Che coshanno in comune la fioritura di una pianta, gli influssi della dieta materna sul metabolismo del figlio da adulto e una serie di tumori e malattie neurologiche? Tutti dipendono dallazione, normale o alterata, dei processi epigenetici: cio modifiche chimiche, a volte permanenti o persino trasmesse alla progenie, che la cellula introduce sul DNA, spesso in risposta a stimoli ambientali, per regolare lespressione dei vari geni rendendoli pi o meno accessibili.
Il DNA va letto per assemblare le proteine, ma va anche riparato, si combina per dare la diversit e cos via dicendo.

Negli ultimi 10-15 anni si scoperto che tutte le molecole che devono accedere al DNA per questi processi devono fare i conti con limpalcatura su cui il DNA si avvolge: istoni e altre proteine che lo impacchettano per far rientrare i suoi lunghi filamenti nel piccolo spazio del nucleo. Per regolare lavvolgimento del DNA, e quindi quanto accessibile ai macchinari cellulari, le cellule dispongono sul DNA stesso, o sugli istoni, molecole come gruppi metilici o acetilici.

Ma i meccanismi del controllo epigenetico si stanno rivelando sempre pi articolati. Sta emergendo un ruolo importante degli RNA non codificanti (ncRNA): piccoli RNA di 10-20 nucleotidi costituiscono una parte strutturale della cromatina, che contribuiscono ad avvolgere il DNA e non codificano per proteine.
Il DNA si avvolge intorno agli istoni, ma questo filamento di DNA e istoni, a sua volta, si arrotola su se stesso in spirali di ordine superiore. Gli ncRNA restano intrappolati in queste spirali, legandosi alle sequenze con cui hanno unomologia, e sono essenziali nel mantenere una data regione del DNA aperta o chiusa, quindi attiva o inaccessibile.

Pertanto, gli ncRNA non codificanti sono parte del nostro epigenoma.

Interferenza a RNA
La RNAi, scoperta nelle piante come meccanismo di difesa dai virus, un processo specifico e potente portato avanti dalla cellula. Sebbene non tutti i dettagli del processo stesso siano ancora chiari, sembra che il cosiddetto macchinario dell'RNAi, una volta individuata una molecola di RNA a doppio filamento (dsRNA), sia in grado di avviare il meccanismo della RNAi.
1. Attraverso un enzima (chiamato Dicer), la sequenza di dsRNA tagliata in frammenti di lunghezza minore (19-21 paia di basi). 2. Il breve frammento di dsRNA (chiamato short interfering RNA, o siRNA) si associa ad un complesso enzimatico denominato RISC (dall'inglese RNA-interference silencing complex, complesso silenziatore della RNAi). 3. L'RNA a doppio filamento viene aperto, probabilmente da una elicasi: solo il filamento di RNA antisenso rimane associato a RISC, mentre il filamento senso viene degradato. 4. La RISC ora attiva: in grado di scansire molti mRNA presenti nel citosol fino a trovarne uno complementare al frammento di RNA antisenso associato al complesso stesso. 5. Se l'appaiamento tra siRNA e mRNA perfetto (o quasi perfetto), una componente della RISC (detta argonaute protein o Argo) in grado di operare un taglio sull'mRNA. I due frammenti di mRNA risultanti, privo di cappuccio al 5' uno e di coda di poliA al 3' l'altro, vengono cos rapidamente degradati dalle RNAsi della cellula stessa. Se l'appaiamento, invece, non perfetto, si pensa che la RISC sia comunque in grado di inibire la traduzione del gene. Sebbene il meccanismo di questo secondo evento non sia chiaro, sembra che possa essere molto diffuso negli animali.

2010 Davide Corona (Istituto Telethon di Palermo)

ha pubblicato che i geni attivi non producono solo il trascritto codificante, ma anche piccoli RNA antisenso, che restano attaccati al promotore, pronti a intervenire: se il trascritto si fa troppo abbondante, vi si legano formando un RNA a doppio filamento, che quindi distrutto.

Questi RNA antisensi sono parte dellepigenoma, poich sono integrati nel cromosoma e possono essere trasmessi alle cellule figlie, che cos ricorderanno quanto RNA devono produrre.

Per capire meglio come il genoma dirige la sinfonia di attivit biologiche che chiamiamo vita si sta analizzando la disposizione dei cromosomi, e dei geni che ospitano, nello spazio tridimensionale del nucleo cellulare e come questa disposizione pu influenzare le loro attivit.
E noto che: allinterno del nucleo, i cromosomi interagiscono fisicamente con cromosomi vicini, i geni si spostano verso regioni nucleari diverse a seconda del compito che devono portare a termine e le molecole che regolano lattivit genica si raggruppano in punti ben precisi. i cromosomi si condensano durante la divisione cellulare, assumendo la forma a clessidra che immaginiamo quando pensiamo alla forma delle entit che trasportano i geni da una generazione alla successiva. I cromosomi hanno una forma pi rilassata quando le cellule non sono in fase di divisione e sono impegnate nelle consuete attivit.

Lipotesi pi diffusa era che i cromosomi si mescolassero tra loro come gli spaghetti nel piatto.

Theodor Boveri

uno scienziato tedesco, nei primi anni del Novecento, aveva contestato questa organizzazione a spaghetti e aveva sostenuto che, sebbene potesse cambiare forma e dimensione durante la vita di una cellula, ciascun cromosoma occupava una regione distinta e definita del nucleo, che lo scienziato tedesco aveva chiamato territorio cromosomico. Per lungo tempo questo concetto non fu preso nella giusta considerazione.

Allinizio degli anni ottanta i fratelli tedeschi

Thomas e Christoph Cremer dimostrarono che: nel nucleo della cellula i cromosomi sono entit individuali; che ciascuno occupa uno spazio separato rispetto agli altri; che alcuni cromosomi preferiscono la periferia del nucleo, mentre altri preferiscono raggrupparsi verso il centro; la posizione di ciascun cromosoma e la sua vicinanza a uno o pi cromosomi specifici possono influenzare notevolmente il funzionamento della cellula.
Nei globuli bianchi, per esempio, di solito il cromosoma 18 si trova vicino alla parete del nucleo, mentre il cromosoma 19 preferisce rimanere al centro; il cromosoma 7 invece si trova tra queste due posizioni.

La tendenza di ciascun cromosoma a occupare una posizione preferita, vicina o lontana dalla parete del nucleo, crea anche quartieri distinti in tutta la regione nucleare. Di conseguenza, ciascun cromosoma ha una serie di vicini di casa che di solito sono costanti da cellula a cellula, nellambito dello stesso tipo cellulare.
Nei globuli bianchi murini il cromosoma 12 spesso si aggrega con i cromosomi 14 e 15.

La posizione dei cromosomi, per, non sempre fissa e immutabile.

La posizione di un gene ne influenza la funzione


E stato scoperto e dimostrato che:

i cromosomi sono disposti diversamente in differenti tipi di cellule; le disposizioni cambiano durante lo sviluppo e le malattie; la posizione occupata da un cromosoma influenza laccensione e lo spegnimento dei geni che trasporta.
Per esempio, gli astrociti, contengono una copia attiva del gene GFAP e una copia silenziata. E stato scoperto che la versione silenziata si trova alla periferia del nucleo, mentre la copia attiva si trova allinterno.

Nel 2008 alcuni esperimenti condotti in diversi laboratori hanno dimostrato che la periferia del nucleo aiuta a mantenere in forma quiescente almeno alcuni geni.
Linterno del nucleo, potrebbe offrire qualcosa di speciale a cromosomi e geni a cui richiesta unattivazione rapida: gruppi di aggregati proteici noti come transcription factory.

Si tratta di aggregati di componenti cellulari necessarie per attivare i geni, tra cui gli enzimi polimerasi (che trascrivono il DNA in RNA, che poi tradotto nella proteina per cui codifica un gene), e i fattori di trascrizione (proteine che si legano a regioni regolatrici dei geni e attivano le polimerasi). Unovvia spiegazione per questo schema suggerisce che si creino ammassi di molteplici geni in centri di attivit trascrizionale, dove i geni condividono polimerasi e fattori di trascrizione. Questidea ha un precedente: centinaia di geni che codificano per RNA ribosomiali sono trascritti insieme nel nucleolo, una sottostruttura del nucleo abbastanza grande da essere visibile al microscopio.

Lo spazio nucleare in cui si trovano i geni importante per uno sviluppo normale e uno stato di buona salute.
Esperimenti sulle cellule staminali embrionali, elementi indifferenziati pluripotenti, dotati della capacit peculiare di differenziarsi in uno dei circa 220 tessuti specializzati del nostro organismo, hanno dimostrato che sono prive degli ampi tratti di eterocromatina in cui i geni sono silenziati e sono prive di proteine chiamate lamine, che aiutano a legare il DNA non attivo alla periferia del nucleo.

Di conseguenza, quasi ogni gene nel genoma di una cellula staminale attivo a livello di base.
Quando le cellule staminali embrionali ricevono un segnale che le induce a differenziarsi per esempio in cellule delle ossa o neuroni, la loro struttura nucleare cambia drasticamente. Compaiono le lamine, proteine che si uniscono a formare un reticolo estremamente intrecciato, la lamina nucleare, sotto la membrana del nucleo. In questo modo, la comparsa delle lamine durante lo sviluppo embrionale permette alle cellule di silenziare geni che non sono pi necessari, relegandoli in periferia.

Mutazioni delle lamine determinano un gran numero di malattie negli esseri umani, che vanno dalle distrofie muscolari e i disturbi neurologici allinvecchiamento precoce.
forse le mutazioni indeboliscono la lamina, rendendola incapace di proteggere il nucleo da forze meccaniche e di conseguenza gran parte del genoma viene danneggiato da un punto di vista fisico. forse le lamine difettose non sono in grado di organizzare a dovere il genoma e quindi spostano i geni nel posto sbagliato, alterandone il normale funzionamento.

La posizione dei cromosomi svolge un ruolo pi decisivo in alcune forme di tumore.


Alcune forme di tumore si formano quando due cromosomi in una stessa cellula si rompono (forse a causa di radiazioni o di tossine) e poi si uniscono tra loro in modo improprio, formando una combinazione anomala chiamata traslocazione. Spesso le cellule maligne contengono traslocazioni cromosomiche. In alcuni casi queste traslocazioni provocano il cancro perch la fusione crea un gene mutante che promuove una proliferazione cellulare eccessiva; in altri casi le traslocazioni cromosomiche sono semplici spettatori.

Esperimenti sul linfoma di Burkitt (traslocazione del gene MYC, che si trova nel cromosoma 8 e il gene IGH, che si trova sul cromosoma 14) suggeriscono un collegamento fra la distanza tra i geni e la probabilit di traslocazione. Lo stesso collegamento stato trovato per numerosi altri tumori. Inoltre, quando un cromosoma si spezza le estremit danneggiate rimangono vicine al punto di rottura e non si allontanano molto da dove si trovavano al momento della rottura.
Questo spiega perch: i cromosomi ammassati in una stessa regione del nucleo hanno pi probabilit di fondersi rispetto a cromosomi distanti tra loro; perch specifiche traslocazioni sono un elemento distintivo di tumori che colpiscono un tessuto ma non un altro.

La conoscenza delle posizioni abituali dei cromosomi nel nucleo potrebbe offrire opportunit per scoprire tumori?
Esperimenti preliminari hanno dimostrato che la posizione dei geni pu aiutare a indicare se una cellula tumorale.
Per esempio alcuni geni hanno una posizione diversa nelle cellule tumorali rispetto a quella osservata nelle cellule di tessuto mammario normale. Questo geni si sono dimostrati buoni marcatori del cancro al seno.

Forse un giorno le analisi sulla posizione dei geni possono diventare un potente strumento molecolare con cui diagnosticare il cancro in stadi precoci.

Che cosa determina la posizione di un gene o di un cromosoma nel nucleo? Come fanno a sapere dove devono andare e come arrivano a destinazione via via che le cellule si differenziano nel loro stato specializzato?
Forse una proteina che lega il DNA e che riconosce una specifica sequenza genica si lega a quella sequenza e quindi sposta quella parte di cromosoma fino a una particolare posizione nel nucleo. Oppure la posizione allinterno del nucleo un processo autoorganizzato, simile a quello di studenti che formano tanti piccoli gruppi perch attratti da interessi comuni e non perch sollecitati da genitori o insegnanti.

Quando un gene in una cellula differenziata viene attivato in risposta a un segnale, per esempio un ormone. Prima dellarrivo del segnale nella cellula il gene inattivo, molto probabilmente si trova in una regione di cromatina condensata, forse addirittura in un agglomerato di eterocromatina che avvolge la periferia nucleare. Quando il segnale arriva nel nucleo, molecole conosciute come complessi che rimodellano la cromatina distendono il DNA condensato nel gene e intorno al gene, rendendo pi accessibile questa regione allapparato di trascrizione. In un nucleo autoorganizzato, grazie a questo processo quella regione di cromatina pu scollegarsi dalleterocromatina alla periferia e penzolare allesterno, esplorando nuove regioni del nucleo. Con un pizzico di fortuna, alla fine lanello che sporge entrer in contatto con una transcription factory.

Questo modello porta a una conseguenza affascinante:


suggerisce che sebbene la posizione di un gene nel nucleo non sia casuale, pu essere casuale il modo in cui un gene arriva in una determinata posizione.
Quando i leucociti sono stimolati da citochine, i geni che codificano per proteine del sistema immunitario chiamate molecole MHC di classe II si allontanano parecchio dalla struttura del cromosoma su cui si trovano a volte arrivando anche a met del nucleo.

I ricercatori dovrebbero riuscire a determinare la posizione di cromosomi nel nucleo di differenti tessuti in momenti e in condizioni diverse per ottenere una conoscenza su come lorganizzazione nucleare influenza la funzione dei geni e su come le alterazioni di questa organizzazione contribuiscono alle malattie.

La prima bozza della sequenza del genoma umano ha richiesto circa 10 anni di duro lavoro. Spinti dal desiderio di capire di pi rispetto a quello che le sole sequenze di DNA possono rivelare, i ricercatori hanno iniziato a scoprire e a studiare il modo in cui si comportano i genomi nel loro ambiente cellulare naturale.

Data la complessit, probabile che gli scienziati saranno impegnati per molto pi tempo rispetto a quanto stato necessario per il primo sequenziamento del genoma umano.

Il metodo scientifico
La scienza un insieme sistematizzato di conoscenza derivata da osservazioni ed esperimenti. I ricercatori eseguono esperimenti, fanno osservazioni e cercano di spiegare i risultati, queste spiegazioni possibili si chiamano ipotesi e la loro validit viene controllata sistematicamente formando e rigettando spiegazioni alternative.

Il metodo scientifico la modalit tipica con cui la scienza procede per raggiungere una conoscenza della realt oggettiva, affidabile, verificabile e condivisibile. Esso consiste, da una parte, nella raccolta di evidenza empirica e misurabile attraverso l'osservazione e l'esperimento; dall'altra, nella formulazione di ipotesi e teorie da sottoporre nuovamente al vaglio dell'esperimento.

CELLULA

UNITA STRUTTURALE E FUNZIONALE DI UN SISTEMA BIOLOGICO

TESSUTO

AGGREGATO DI CELLULE SIMILI

ORGANO

PARTE DIFFERENZIATA DI UN ORGANISMO CON UNA FUNZIONE DEFINITA

COLTURA DI TESSUTO

CAMERA GESTAZIONALE

SACCO VITELLINO

CAMERA GESTAZIONALE

PRELIEVO DI UN PICCOLO FRAMMENTO DI MEMBRANA

FRAMMENTAZIONE DI UN PICCOLO PEZZO DI CAMERA

PRELIEVO DI PARTE DELLA MEMBRANA FRAMMENTATA

POSIZIONAMENTO DEI FRAMMENTI IN UNA CAPSULA PETRI PICCOLA

DISTRIBUZIONE DEI FRAMMENTI NELLA CAPSULA PETRI PICCOLA

POSIZIONAMENTO DEL VETRINO ROTONDO

ELIMINAZIONE DELLE BOLLE DARIA

AGGIUNTA DEL TERRENO

Triturazione tessuto

I frammenti vengono sottoposti allazione di agenti chelanti (EDTA, ecc.) o enzimi proteolitici (tripsina o collagenasi) che degradano la matrice del tessuto

FIBROBLASTI CRESCIUTI INTORNO AD UN FRAMMENTO DI TESSUTO

COLTURE CELLULARI

MDA-MB-435

MCF-7

MCF-10

TECNICHE DI COLTURE CELLULARI

FASI DI SPERIMENTAZIONE
Preclinica
studia gli effetti di una sostanza su cellule o animali prima di essere testate sulluomo.

In particolare studia:

DL50 (Dose Letale 50) concentrazione minima inibente concentrazione senza alcuno effetto prima concentrazione con effetti tossici prima concentrazione con effetti benefici Pu essere effettuata: su colture di cellule, di tessuti e/o organi (in vitro) su animali da laboratorio (in vivo)

Clinica

studia gli effetti di una sostanza su luomo dopo gli studi preclinici.

Sperimentazione preclinica COLTURE IN VITRO Tecnica che implica lisolamento e il mantenimento in vitro di cellule isolate da tessuti od organi Strumento di indagine che evita i problemi etici e morali legati alla sperimentazione animale

COLTURA CELLULARE
Insieme di cellule mantenute in vitro, derivanti dalla disgregazione di tessuti o isolate da fluidi biologici come il sangue. Le cellule vengono poste a contatto di tutti i fattori e metaboliti necessari alla loro crescita.

DIFFERENZE PRINCIPALI FRA IN VIVO E IN VITRO


Il sistema passa da architettura 3-D a 2-D

In vitro si perde linterazione tessuto specifica


Incremento in vitro di frazione cellulare in crescita Metabolismo pi alto in vitro

In vitro si perde la regolazione sistemica (endocrina e


nervosa)
Vantaggi
Controllo di ambiente fisico-chimico Risposta rapida Omogenizzazione e caratterizzazione di cellule/tessuto

Svantaggi
Senza esperienza difficile Molte cellule sono necessarie ed il costo alto Cellule possono cambiare caratteristiche col tempo

COLTURE CELLULARI VANTAGGI


Sistemi semplificati e altamente riproducibili Consentono lanalisi di meccanismi cellulari e molecolari Controllo ambientale Economicit e rapidit di risposta Disponibilit

SVANTAGGI
Sistemi semplificati rispetto ad un organismo integrato Condizioni di esposizione alle sostanze diverse da quelle in

vivo
Difficolt di correlare le concentrazioni in vitro con quelle in vivo Le sostanze somministrate possono interagire con il terreno di coltura

APPLICAZIONI DELLE COLTURE CELLULARI


Studio di processi intracellulari:
- sintesi proteica - meccanismi di trasduzione dei segnali

Studio di citotossicit Studio del meccanismo di azione dei farmaci Studio dei meccanismi di interazione cellula-cellula Studio di anomalie genetiche (analisi del cariotipo) Biologia molecolare (mappature, trasfezioni, analisi di
mutanti, proteine ricombinanti, anticorpi monoclonali)

Studio di processi infettivi virali Caratterizzazione di tumori In campo industriale: studio di effetti farmacologici e tossici di farmaci

CLASSIFICAZIONE COLTURE CELLULARI


Colture a breve/lungo termine:
ridotto/elevato (infinito) numero di cicli cellulari

Colture in monostrato/in sospensione:


- le cellule che crescono in monostrato risentono della inibizione da contatto -le cellule che crescono in sospensione non necessitano di alcuna struttura di adesione

Co-colture:
nello stesso recipiente cellule di tipo diverso (ricostruzione di un semplice sistema tissutale)

Colture cellulari
ADERENTI: le cellule aderenti solitamente crescono fino ad occupare l'intera superficie disponibile (coltura confluente). A confluenza le cellule devono essere staccate e trasferite in nuove fiasche (divisione).

IN SOSPENSIONE: in generale crescono in sospensione le linee di origine emopoietica. La crescita in sospensione pu avvenire in condizioni statiche o in agitazione (per produrre grandi quantit di cellule).

Sistemi di Crescita
ADESIONE: cellule di origine nervosa, epiteliale o
mesenchimale (che in vivo fanno parte di tessuti solidi)
Fenomeno che richiede linterazione di recettori di membrana con proteine adesive, adsorbite sulla superficie della piastra di coltura

SOSPENSIONE: cellule di origine


ematopoietica (che normalmente vivono in un mezzo fluido)

Molecole di adesione cellula-cellula (CAM, indipendenti da Ca2+) Caderine (dipendenti da Ca2+) Integrine, recettori per molecole della matrice (fibronectina, laminina, collageno) Proteoglicani interagiscono con la matrice

Le colture si distinguono a seconda che le cellule siano in sospensione o aderenti.


Le cellule di origine emopoietica, che normalmente crescono in mezzo fluido, crescono in sospensione e si moltiplicano in vitro senza aderire. Le cellule che, invece, fanno parte di tessuti solidi crescono in vitro aderendo alla superficie delle piastre da coltura.

Cellule confluenti in monostrato (100 x magnification) L929 mouse fibroblast cells

I tipi di cellule rientrano in due categorie generalmente indicate come:

COLTURE CELLULARI PRIMARIE COLTURE CELLULARI SECONDARIE

Tipi di coltura di cellule in vitro

coltura primaria

coltura secondaria

Tipi di colture cellulari


Colture primarie: cellule ottenute direttamente dalla dissociazione di tessuti
Vantaggio - Cellule molto simile al tessuto di origine Svantaggio - Cellule molto simile al tessuto di origine - Piccole quantit sono disponibili - Sterilit difficile

Colture secondarie: linee cellulari immortalizzate spontaneamente o con virus

stabili

- Possono essere cresciute per molte generazioni e in grande quantit - Le cellule sono molto simili da esperimento a esperimento

Colture cellulari
Le colture preparate direttamente da un tessuto si dicono colture primarie; le cellule isolate da un qualsiasi tessuto animale sono in grado di compiere un numero finito di divisioni cellulari in vitro, dopodich vanno incontro a degenerazione e morte. Tale fenomeno avviene indipendentemente dalla presenza di metaboliti appropriati per la crescita e si indica come senescenza. In genere, il numero di cicli che una cellula in grado di effettuare in vitro dipende dallet dellanimale. Le linee cellulari continue derivano da singole cellule in cui mutazioni spontanee o indotte hanno annullato il programma genetico della senescenza. Si dicono perci immortali: proliferano in modo continuo in presenza degli opportuni metaboliti. Molte linee cellulari continue sono state ottenute a partire da tessuti tumorali.

Le cellule trasformate, invece, presentano caratteristiche simili alle cellule cancerose: sono immortali, proliferano in vitro fino a raggiungere una densit maggiore delle cellule normali e, spesso, crescono senza aderire ad alcuna superficie.

COLTURE PRIMARIE
Le cellule discendono direttamente dal tessuto di origine. Una volta consumato il terreno di coltura bisogna provvedere ad una subcoltura in un nuovo recipiente con terreno fresco

biopsia

Si ottengono
digestione enzimatica dei tessuti VANTAGGI
mantengono le caratteristiche delle cellule in vivo

SVANTAGGI
numero finito di divisioni (cicli) senescenza popolazione eterogenea isolamenti ripetuti per progetti a lunga scadenza

Prelievo del reperto


Il prelievo deve essere effettuato in condizioni di sterilit ed il reperto posto in apposito recipiente contenente una soluzione salina bilanciata o terreno di coltura addizionati con antibiotici (gentamicina, penicillina o streptomicina). N.B.: Il prelievo e la dissezione del tessuto devono essere effettuati a 4 C

COLTURE PRIMARIE
Lisolamento delle cellule da tessuto si pu ottenere mediante varie metodiche, ad es.:
A) fluorescence activated cell sorter (FACS) B) omogeneizzazione meccanica del tessuto incubazione in terreno di coltura fino a che si notano gli aloni di crescita tripsinizzazione e piastratura C) omogeneizzazione meccanica del tessuto tripsinizzazione dissociazione e piastratura

Sospensione cellulare mista


Approcci per separare i diversi tipi cellulari: propriet fisiche capacit di adesione propriet di legame con anticorpi specifici uso di terreni o condizioni di coltura selettivi

ALLESTIMENTO DI UNA COLTURA CELLULARE PRIMARIA

Da frammenti di tessuto in coltura - Tecnica dellespianto Da una sospensione cellulare ottenuta per disgregazione enzimatica o meccanica del tessuto

ISOLAMENTO DEL TESSUTO Rimozione del tessuto in maniera asettica Trasferimento immediato in BSS o terreno Dissezione dellarea di interesse TECNICA DELLESPIANTO Il tessuto di partenza sminuzzato finemente e seminato in piastre con un mezzo di coltura contenente unalta concentrazione di siero. Le cellule, entro pochi giorni, migrano alla periferia dellespianto, adereriscono al substrato e iniziano a proliferare.

Principali fasi dellallestimento di colture con la tecnica dellespianto

Esempi di espianto primario


Carcinoma a cellule squamose di topo Cellule di tubulo renale

SOSPENSIONE CELLULARE
DISGREGAZIONE MECCANICA Il tessuto di partenza sminuzzato finemente con bisturi o forbici in un mezzo di coltura successivamente passato attraverso setacci con maglie progressivamente pi strette o aghi di calibro decrescente o semplicemente attraverso pipette infine la sospensione ottenuta filtrata con filtri di nylon di porosit 40-50 m in modo da eliminare gli aggregati di maggiori dimensioni.

DISGREGAZIONE ENZIMATICA Il tessuto di partenza trattato mediante una soluzione contenente enzimi digestivi che agiscono a livello delle giunzioni cellula-cellula e cellula-matrice extracellulare. Gli enzimi pi usati sono: tripsina (idrolasi, che catalizza il taglio proteolitico con specificit per l'arginina e la
lisina)

collagenasi
extracellulare)

(taglia i legami peptidici presenti nel collagene, componente della matrice

(idrolasi con specificit per i residui: isoleucina, leucina, valina, metionina, fenilalanina, triptofano) (idrolasi che degrada l'acido ialuronico, idrolizzandone i legami 14 tra residui di N-acetil--D-glucosamina e di D-glucuronato) (idrolasi, che scinde il legame glicosidico tra un acido sialico (o Nacetilneuraminico) e uno zucchero nelle glicoproteine che costituiscono il muco) (amino-endopeptidasi che idrolizza legami peptidici dal lato N-terminale di aminoacidi non polari. Agisce tagliando legami a livello della membrana basale)

pepsina

ialuronidasi

neuraminidasi dispasi

Sono anche usate combinazioni di enzimi.

VANTAGGI Controllo dellambiente di coltura (pH, temperatura, pressione osmotica, ossigeno, CO2) Controllo delle condizioni fisiologiche Omogeneit relativa delle cellule Economicit e rapidit di risposta Riduzione dellimpiego di animali SVANTAGGI Organizzazione ed esperienza Quantit e costi Instabilit Identificazione del tipo cellulare

DIFFERENZE in vivo-in vitro Architettura bidimensionale in vitro rispetto ad una tridimensionale nel tessuto in vivo Mancanza delle interazioni intercellulari tipiche del tessuto Acquisizione di motilit Modificazione della proliferazione (aumento della frazione di crescita) Selezione delle cellule Mancanza di regolazione endocrina e nervosa Modificazione del metabolismo cellulare Modificazione del processo di differenziazione

Ciclo vitale di cellule primarie

Ciclo vitale delle colture primarie

COLTURE CELLULARI PRIMARIE da cellule normali


Vita finita Inibizione da contatto Dipendenza dallancoraggio Dipendenza dal siero

da cellule tumorali
Immortali Nessuna inibizione da contatto Indipendenza dallancoraggio Minore dipendenza dal siero

Coltura primaria

a breve termine

a lungo termine

< 10 duplicazioni

50-60 duplicazioni

Linea cellulare continua


Isolamento di ceppi clonali: il programma genetico della

senescenza stato annullato attraverso mutazioni spontanee o indotte Derivazione: da colture primarie di tumori o da manipolazioni genetiche di colture primarie non tumorali Le cellule trasformate presentano caratteristiche simili alle cellule cancerose Vantaggi: cellule (clonali) pi facili da coltivare, risposte riproducibili con risultati meno variabili delle colture primarie Svantaggi: non riproducono esattamente lambiente fisiologico cellulare

Coltura secondaria

Linea cellulare continua

>150-200 duplicazioni

Linea cellulare continua


Capacit di crescere indipendentemente dallorganismo da cui derivata Crescita ininterrotta per oltre un anno Immortale

La proliferazione rende possibile la propagazione tramite lallestimento di sottocolture. LINEA CELLULARE coltura che si propaga dopo il primo trasferimento o passaggio Caratteristiche: aumento del numero totale di cellule prevalgono solo le cellule con capacit simili di crescita elevato grado di uniformit

LINEA FINITA Si propaga per un numero limitato di generazioni e infine diventa senescente e muore. Il numero di generazioni determinato geneticamente. LINEA CONTINUA Cellule con capacit illimitata di sopravvivenza: implica trasformazione. La trasformazione pu essere spontanea o indotta da agenti virali, chimici, fisici.

Il termine trasformazione di cellule in coltura indica una modificazione fenotipica permanente spontanea o indotta che deriva da una modificazione nel DNA e nella espressione genica. La trasformazione caratterizzata da: immortalizzazione, acquisizione di una durata di vita illimitata; controllo aberrante della crescita, perdita dellinibizione da contatto, della limitazione della proliferazione da parte della densit, della dipendenza dallancoraggio; malignit, dimostrata dalla crescita di tumori in vivo.

LINEE CELLULARI
Quando si effettua una subcoltura si parla di linee cellulari, che possono essere divise in:

Linee cellulari a vita finita:


numero limitato di cicli in coltura, crescita in monostrato, inibizione da contatto, forte dipendenza dai fattori di crescita del siero

Linee cellulari continue:


hanno origine da mutazioni a partire dalle colture primarie o dalle linee cellulari a vita finita si possono ottenere direttamente da tumori hanno minore inibizione da contatto hanno minore dipendenza da fattori di crescita del siero

Linee cellulari clonali:


linee derivanti da una singola cellula (popolazioni altamente omogenee)

COLTURE SECONDARIE

Le cellule discendono da colture primarie trasformate o indotte mediante agenti chimici, fisici o biologici
Vantaggi
Fedelt del cariotipo Presentano pi cicli cellulari rispetto alle colture primarie

Svantaggi
Possono differenziarsi in altri tipi cellulari

EVOLUZIONE DI UNA LINEA CELLULARE PRIMARIA IN SECONDARIA 1) Coltura primaria: tempo di crescita lento 2) Linea cellulare primaria: maggiore velocit di crescita 3) Linea cellulare secondaria: tempi di crescita progressivamente pi lunghi (sino alla morte)

fenomeno di trasformazione linea cellulare stabilizzata


(si replica indefinitamente)

TRASFORMAZIONE
Il processo della trasformazione rende immortale una linea cellulare, che altrimenti muore dopo un certo numero di passaggi in coltura.

La trasformazione pu essere provocata da:


- trattamento con cancerogeni - esposizione a virus

Le cellule trasformate (cellule immortalizzate)


perdono la capacit di regolare la crescita: crescono continuamente e quindi hanno durata di vita infinita perdono alcune caratteristiche che hanno in vivo (mancata espressione di certi geni) richiedono meno siero per la crescita hanno tempo di raddoppiamento pi breve

Linee cellulari trasformate sono disponibili commercialmente presso banche cellulari European Collection of Animal Cell Culture (ECACC) American Type Culture Collection (ATCC)

LE PRIME LINEE CELLULARI CONTINUE

1952, John Hopkins University 1963, University of Ibadan

HELA
da tumore alla cervice uterina

RAJI
linea neoplastica di linfociti B

Henrietta Lacks donna dalle cellule immortali

Le cellule (pi di 50 milioni di tonnellate) di Henrietta Lacks sono state usate per centinaia di migliaia di esperimenti, come quelli per testare il vaccino della poliomielite prima che venisse usato sulle persone, o quelli nello spazio per vedere come le cellule umane reagivano alla gravit zero, fino alla mappatura dei primi geni. Sono state usate anche per sviluppare alcuni dei principali farmaci antitumorali come il tamoxifen. Il range di ricerche per cui sono state usate semplicemente incredibile.

Morfologia colturale
Cellule aderenti Cellule semi-aderenti

Cellule in sospensione

Linee cellulari continue aderenti


Epithelial Endothelial

Fibroblast Neuronal

Linee cellulari aderenti epiteliali

HeLa

Linee cellulari aderenti epiteliali


P-19

Linee cellulari aderenti endoteliali

CPAE a bassa densit

Linee cellulari aderenti fibroblastoidi

COS-1

Linee cellulari aderenti neuronali

NEURO 2-A

Linee cellulari continue semi-aderenti

U-266

Linee cellulari continue semi-aderenti

CCRF-CEM

Linee cellulari continue in sospensione


a singole cellule a piccoli clumps a grandi clumps

A singole cellule

BV-173

A singole cellule
K-562

A singole cellule

NB-4

A piccoli clumps

A piccoli clumps

Kasumi-1

A grandi clumps: il caso delle PC-12

A grandi clumps
PC-12

A grandi clumps

PC-12

COLTURE CELLULARI: COME SI LAVORA?


Le colture cellulari richiedono: Ambiente sterile Elementi nutritivi di base (glucosio, aminoacidi, sali minerali) Fattori di adesione, presenti nel siero Fattori di crescita, presenti nel siero Stabilit di pH e temperatura