You are on page 1of 0

EFECTO DEL GEN fadH1 EN LA PRODUCCION DE PHA CONTENIENDO

MONOMEROS INSATURADOS POR Pseudomonas putida







DIEGO ARMANDO CASTILLO FRANCO





PONTIFICIA UNIVERSIDAD JAVERIANA
FACULTAD DE CIENCIAS
MICROBIOLOGIA INDUSTRIAL
So Paulo, SP, Brasil
Noviembre de 2008





EFECTO DEL GEN fadH1 EN LA PRODUCCION DE PHA CONTENIENDO
MONOMEROS INSATURADOS POR Pseudomonas putida



DIEGO ARMANDO CASTILLO FRANCO



TRABAJO DE GRADO
Presentado como requisito parcial para optar al ttulo de
MICROBIOLOGO INDUSTRIAL


PONTIFICIA UNIVERSIDAD JAVERIANA
FACULTAD DE CIENCIAS
MICROBIOLOGIA INDUSTRIAL
So Paulo, SP, Brasil
Noviembre de 2008




















NOTA DE ADVERTENCIA


La Universidad no se hace responsable por los conceptos emitidos por sus alumnos en
sus trabajos de tesis. Solo velar por qu no se publique nada contrario al dogma y a la
moral catlica y por que las tesis no contengan ataques personales contra persona
alguna, antes bien se vea en ellas el anhelo de buscar la verdad y la justicia.

Artculo 23 de la Resolucin N 13 de Julio de 1946












EFECTO DEL GEN fadH1 EN LA PRODUCCION DE PHA CONTENIENDO
MONOMEROS INSATURADOS POR Pseudomonas putida


DIEGO ARMANDO CASTILLO FRANCO



Prof. Dr. Jos Gregorio Cabrera Gmez
Bilogo , Ph.D.
Director




Dr. Rafael Costa Santos Rocha Dra Sonia Regina Silva Queiroz
Bilogo, Ph.D. Ing. Qumica, Ph.D.
Jurado Jurado




EFECTO DEL GEN fadH1 EN LA PRODUCCION DE PHA CONTENIENDO
MONOMEROS INSATURADOS POR Pseudomonas putida




DIEGO ARMANDO CASTILLO FRANCO



APROBADO



Dra. INGRID SCHULER, Ph.D JANETH ARIAS
Decana acadmica Bacteriloga, M.Sc
Facultad de Ciencias Directora de Carrera
























A mi Mam, a mi Hermana y a Lina




vii

AGRADECIMIENTOS
A mi mam sencillamente por todo. Sin ella nada de esto hubiera sido posible
Al profesor Dr. Jos Gregorio Cabrera Gmez por permitirme trabajar en su
laboratorio y desarrollar este trabajo.
A la Dra. Sonia Regina Silva Queiroz por todas sus enseanzas, consejos y
orientaciones durante este trabajo
A la profesora Dra. Luiziana Ferreira da Silva por haberme permitido usar las
instalaciones de su laboratorio para desarrollar parte de este trabajo.
A Nuri Merchn por su apoyo, enseanza y sobre todo, su amistad.
A todos los compaeros y amigos de laboratorio: Marco, Rafael, Rogerio, Daniela,
Sayuri, Thatiane, Karen, Renata, los cuales siempre estaban dispuestos a ayudar y
dar una mano.
Al personal del laboratorio de gentica de microorganismos: Juan, Eric, Fabiana,
Karen y Marcia por la ayuda prestada.
A todas las personas que de una u otra manera hicieron parte colaborando con este
trabajo








viii

TABLA DE CONTENIDO
LISTA DE TABLAS .................................................................................................... x
LISTA DE FIGURAS ................................................................................................ xi
LISTA DE ABREVIATURAS ................................................................................. xiii
RESUMEN ................................................................................................................. xv
1. INTRODUCCION .................................................................................................. 16
2. REVISION BIBLIOGRFICA .............................................................................. 18
2.1. Biopolmeros ............................................................................................................... 18
2.2 Polihidroxialcanoatos ................................................................................................... 19
2.2.1 Historia y Produccin ............................................................................................ 20
2.2.2. Caractersticas qumicas y fsicas ......................................................................... 22
2.2.3. Aplicaciones ......................................................................................................... 24
2.3 Sntesis de PHA ............................................................................................................ 25
2.3.1 Sntesis de PHA
SCL
................................................................................................ 26
2.4 Deteccin y cuantificacin de PHA ............................................................................ 28
2.5. Metabolismo de cidos Grasos ................................................................................... 29
2.5.1. -Oxidacin de cidos grasos ............................................................................... 30
2.5.2. cidos grasos insaturados .................................................................................... 32
2.6. Pseudomonas spp. ....................................................................................................... 33
3. FORMULACION DEL PROBLEMA Y JUSTIFICACION ................................. 35
4. OBJETIVOS ........................................................................................................... 37
4.1. Objetivo General ......................................................................................................... 37
4.2 Objetivos especficos .................................................................................................... 37
5. MATERIALES Y MTODOS ............................................................................... 38
5.1 Microorganismos y Plsmidos ..................................................................................... 38
5.2 Medios de cultivo ......................................................................................................... 38
5.3.1Medio LB (Luria-Bertani) ...................................................................................... 39
Las siguientes denominaciones fueron dadas a los diferentes medios LB con diferentes
antibiticos: .................................................................................................................... 39
5.2.2 Medio Mineral ....................................................................................................... 39

ix

5.3. Condiciones de cultivo ................................................................................................ 40
5.4 Manipulacin de ADN ................................................................................................. 41
5.4.1 Extraccin de ADN plasmdico ............................................................................. 41
5.4.2 Digestin de ADN con enzimas de restriccin ...................................................... 42
5.4.3 Ligacin de ADN .................................................................................................. 42
5.4.4 Preparacin de clulas competentes ...................................................................... 42
5.4.5 Transformacin Bacteriana ................................................................................... 42
5.4.6 Electroforesis en gel de agarosa ............................................................................ 43
5.4.7 Purificacion de ADN a partir del gel de agarosa ................................................... 43
5.5 Construccin del plsmido por insercin del fragmento purificado a partir del gel de
agarosa ................................................................................................................................ 43
5.6 Complementacin ......................................................................................................... 43
5.7 Ensayos de acumulacin de polmero a partir de cido linolico................................. 44
5.7.1 Determinacin de Masa seca celular (MSC) ......................................................... 44
5.7.2 pH .......................................................................................................................... 45
5.7.3 Cantidad y composicin de PHA .......................................................................... 45
6. RESULTADOS Y DISCUSION ............................................................................ 47
6.1 Evaluacin en la produccin de PHA por mutantes deficientes en la utilizacin de
cidos grasos insaturados ................................................................................................... 47
6.2 Clonacin del gen fadH1 en pBBR1MCS-5 ................................................................ 48
6.3 Complementacin de Pseudomonas putida IPT 046 y los mutantes deficientes en
crecimiento en cido 4-pentenoico con el gen fadH1. ....................................................... 53
7. CONCLUSIONES .................................................................................................. 60
8. REFERENCIAS BIBLIOGRFICAS ................................................................... 61
9. ANEXOS ................................................................................................................ 70




x

LISTA DE TABLAS

Tabla 1. Compaas involucradas en la investigacin y produccin de PHA en
el mundo 21
Tabla 2. Propiedades Fsicas de PHA y PP 24
Tabla 3. Principales Caractersticas metablicas de Pseudomonas sp. 30
Tabla 4. Microorganismos Utilizados 39
Tabla 5. Plsmidos utilizados 40
Tabla 6. Antibiticos y concentraciones utilizadas 41
Tabla 7. Composicin monomrica de PHA acumulados por P. putida IPT046,
AG46, BJ5, CF12, CN25 Y DU54, cultivadas en cido linolico 48
Tabla 8. Perfil de crecimiento de IPT 046 y los mutantes frente a las cepas
complementadas con pBBR::fadH1 en MMGGm, MMV y MM4P 52








xi

LISTA DE FIGURAS

Figura 1. Microfotografa electrnica de P. putida con grnulos de PHA 11
Figura 2. Estructura General de los Polihidroxialcanoatos 14
Figura 3. Sntesis de PHB. 17
Figura 4. Vas metablicas propuestas a partir de diferentes sustratos 19
Figura 5. Ruta metablica de Biosntesis de PHA a partir de cidos Grasos 20
Figura 6. Hidrolisis de Triglicridos 21
Figura 7. Modelo de -Oxidacin de cidos Grasos 22
Figura 8. Regiones del genoma de diferentes subespecies Pseudomonas putida
donde se encuetra el gen fadH1
Figura 9 Secuencia de la regin del amplicn conteniendo el gen fadH1.

Figura 10. Electroforesis en gel de agarosa. 1. 1Kb ladder; 2. pGEM; 3.
pBBR1MCS-5::fadH1 digerido con ApaI; 4. pGEM:fadH1; 5.
pGEM::fadH1 digerido con ApaI 51
Figura 11. Cajas con LBGm, IPTG y X-Gal mostrando colonias transformadas
posiblemente con pBBR1MCS-5::fadH1 51
Figura 12. Electroforesis en gel de agarosa. 1. 1Kb ladder; 2-11. ADN plasmidial
digerido con ApaI 52
Figura 13. EVALUACIN DE CRECIMIENTO No. 1 53

Figura 14. EVALUACIN DE CRECIMIENTO No. 2 54

Figura 15. EVALUACIN DE CRECIMIENTO No. 3 55
Figura 16. EVALUACIN DE CRECIMIENTO No. 4 56


xii

Figura 17. Evaluacin de crecimiento de los mutantes complementados en
MM4PGm 56
Figura 18. Evaluacin de crecimiento entre IPT 046::pBBR1MCS-5::fadH1 y
mutantes complementados. 57
Figura 19. Evaluacin de crecimiento entre IPT 046::pBBR1MCS-5::fadH1 y
mutantes complementados 58


















xiii

LISTA DE ABREVIATURAS
L microlitro
3HD 3- Hidroxidecanoato
3HDd 3-Hidroxidodecanoato
3HDd
6
3-Hidroxidodecanoato con insaturacin en C
6
3HHx 3-Hidroxihexanoato
3HO 3-Hidroxioctanoato
ADN cido desoxirribonucleico (DNA)
CoA Coenzima A
fad fatty acid degradation
IPTG (isopropil-tio--D-galactsido)
Gm Gentamicina
Kb Kilopares de bases
kDa kilodalton
LB Luria-Bertani
LBA Luria-Bertani con Ampicilina
LBGm Luria-Bertani con Gentamicina
LBK Luria-Bertani con Kanamicina
mM milimolar
Min minutos
mL mililitro

xiv

MM medio mineral
MM4P medio mineral con cido 4-pentenico
MM4PGm medio mineral con cido 4-pentenico y gentamicina
MMG medio mineral con glucosa
MMGGm medio mineral con glucosa y gentamicina
MML medio mineral con cido linolico
MMV medio mineral con cido valrico
MSC masa seca celular
NADH Nicotinamida adenina dinucleotido- Forma reducida
P3HB Poli-3-Hidroxibutirato (PHB)
P3HV Poli-3-Hidroxivalerato
P3HB-co-3HV Poli-3-Hidroxibutirato-co-hidroxivalerato
PHA Polihidroxialcanoatos
PHPE Polihidroxipentanoato
PHA
SCL
Polihidroxialcanoatos de cadena corta
PHA
MCL
Polihidroxialcanoatos de cadena media
PP polipropileno
Rpm revoluciones por minuto
SS solucin salina 0.085% (m/v)
X-Gal (5-bromo-4-cloro-3-indolil--D-galactsido)

xv

RESUMEN

La produccin de polihidroxialcanoatos conteniendo monmeros insaturados fue
evaluada en Pseudomonas putida IPT 046 y en mutantes mini-Tn5 deficientes en
crecimiento en cido 4-Pentenico. El mutante BJ5 presento un porcentaje mayor de
incorporacin del monmero insaturado HHd
6
en comparacin a la cepa salvaje.
Mediante la insercin del gen fadH1 (codificador de 2,4-dienoil CoA reductasa) en el
plsmido pBBR1MCS-5 fue posible complementar a los mutantes con este gen el
cual probablemente esta afectados. 5 mutantes que estaban afectados parcialmente en
el crecimiento en cido 4-pentenico, restablecieron este fenotipo despus de haber
sido complementados con el gen fadH1. Los mutantes que presentaron mayor
incorporacin de HHd
6
, no restablecieron el fenotipo de crecimiento en cido 4-
pentenico despus de la conjugacin con el plsmido cargando el gen fadH1, lo que
sugiere la existencia de ms genes involucrados en el metabolismo de cidos grasos
con insaturaciones que se extienden de carbono par hacia impar.
Palabras clave: Polihidroxialcanoatos, Pseudomonas, cidos grasos insaturados,
fadH1

16

1. INTRODUCCION
Los plsticos de origen petroqumico son ampliamente utilizados debido a su fcil
moldeamiento y alta resistencia qumica, pero son un problema ambiental, debido a
su alto peso y conformacin molecular, la accin de los microorganismos en los
procesos degradadores es mnima, por lo cual permanecen en el ambiente durante
amplios periodos de tiempo.
Las medidas que se han adoptado para solucionar el problema de acumulacin de
basuras plsticas engloba desde el reciclaje hasta la incineracin de las mismas, las
cuales no son soluciones muy viables debido a que los procesos son costosos, no
abarcan todos los desechos y generan emanaciones gaseosas nocivas para el
ambiente, las cuales en los ltimos aos estn siendo mas restringidas por las nuevas
legislaciones medioambientales.
La sobrepoblacin humana, combinado con el actual estilo de vida exige el uso
racional, eficiente y auto sostenible de fuentes naturales para producir sustancias
amigables para el medio ambiente como los Polihidroxialcanoatos (PHA).
Los polihidroxialcanoatos (PHA) constituyen una familia de polisteres acumulados
intracelularmente, en forma de grnulos, los cuales representan una alternativa
biotecnologa para la produccin de plsticos biodegradables y biocompatibles.
Los PHA poseen una amplia gama de propiedades que permiten su aplicacin en
diversas reas. Son termoplsticos, insolubles en agua, no txicos, biocompatibles y
biodegradables. Estos polisteres son una alternativa ecolgica a los plsticos
derivados del petrleo.
Estos polmeros son clasificados en dos grandes grupos dependiendo de su
conformacin: PHA
SCL
(short chain length), los cuales estn constituidos por
monmeros de 3 a 5 carbonos; y PHA
MCL
(mdium chain length) que de 6 hasta 16
carbonos.

17

La posibilidad de usar diferentes sustratos renovables para la produccin de PHA
hace ms atractivo el proceso, ya que dentro de las grandes posibilidades se
encuentran el uso de carbohidratos, pasando por alcoholes, hasta aceites vegetales,
los cuales estn constituidos por triglicridos y radicales con cadenas de cidos
grasos saturados e insaturados.
Dentro de los diferentes PHA producidos, el primero en ser descubierto y
caracterizado fue el poli-3hidroxibutirato (P3HB), siendo objeto de varios estudios
los cuales revelaron, entre otros resultados, una gran diversidad de microorganismos
producen este polmero de caractersticas cristalinas y pertenecientes al grupo de
PHA
SCL..

Los PHA
MCL
son polisteres que presentan propiedades elastiomricas. Son
producidos por diferentes especies de Pseudomonas y presentan caractersticas
diferentes al P3HB y a sus copolmeros, los cuales son cristalinos. Es por esto que
los PHA
MCL
son necesarios para cubrir las necesidades que el P3HB y sus
copolmeros no abarcan.
Para la produccin sostenible de PHA
MCL
se buscan sustratos que cumplan con las
condiciones para la obtencin del polmero, por lo cual, entre las mejores opciones,
est el uso de cidos grasos derivados a partir de aceites vegetales, debido a que son
de bajo costo, son renovables y adems, su constitucin presenta insaturaciones, las
cuales sirven como precursores de monmeros insaturados para la incorporacin al
polmero, modificando sus propiedades qumicas y as proporcionarle caractersticas
propias que amplan su aplicacin industrial. Adems de eso, las insaturaciones
sirven como blanco para modificaciones qumicas posteriores.
Este trabajo tiene como propsito evaluar la produccin de PHA
MCL
conteniendo
monmeros insaturados por mutantes de P. putida IPT046 afectados en el
crecimiento en cido 4-pentenico.

18

2. REVISION BIBLIOGRFICA
2.1. Biopolmeros
Una amplia variedad de polmeros son sintetizados a partir de materia viva,
productos agrcolas y de procesos biotecnolgicos Dependiendo de su estructura
qumica, estos polmeros se clasifican en: cidos nuclicos, poliamidas,
polisacridos, polisteres, politiosteres, polianhdridos, poli-isoprenoides y
polifenoles (STEINBCHEL, 2001).
Los bioplsticos son polisteres producidos por una amplia variedad de
microorganismos, cultivados bajo unas condiciones especficas (MADISON &
HUISMAN, 1999). Las propiedades fsico-qumicas de estos materiales dependen
del microorganismo productor y del sustrato suministrado (HA & CHO, 2002).

Adems de su obtencin natural, los bioplsticos son de gran importancia gracias a
su biodegradabilidad, la cual es debida al metabolismo de organismos presentes en
la naturaleza, que transforman los materiales polimricos en compuestos de bajo
peso molecular como CO
2
y H
2
O.

Los plsticos biodegradables son clasificados en 3 grandes grupos:
Polmeros qumicamente sintetizados: son susceptibles a la accin de
microorganismos y no pueden ser usados con fines comerciales debido a su
alta tasa biodegradativa y propiedades fsicas. Ej.: cido poligliclico, poli
(e-caprolactona), alcohol polivinlico, etc. (KHANNA & SIVRASTAVA,
2004).

Plsticos biodegradables a base de almidn: en este tipo de plstico, el
almidn acta como complemento y a la vez sirve como relleno y agente
adherente para crear una mezcla entre almidn y plstico (almidn-
polietileno). Las bacterias del suelo degradan el almidn y tambin alteran la
matriz del plstico, aumentando la biodegradabilidad pero generando nuevos

19

compuestos recalcitrantes que quedarn en el ambiente durante largos
periodos de tiempo (KHANNA & SIVRASTAVA, 2004).

Polihidroxialcanoatos: Son los nicos polmeros 100% biodegradables
(KHANNA & SIVRASTAVA, 2004).
2.2 Polihidroxialcanoatos
Los Polihidroxialcanoatos (PHA) son una familia de polisteres compuestos
principalmente de cidos R-3 hidroxialcanoicos acumulados en forma de grnulos
intracelulares, que pueden representar hasta el 80% de la masa seca celular (Fig. 1),
los cuales sirven como fuente de carbono, energa y equivalentes reductores.
(MADISON & HUISMAN, 1999) Son producidos bajo condiciones desbalanceadas
de cultivo, es decir, con exceso en la fuente de carbono y limitacin en los elementos
esenciales (N, S, O, P, Mg) (ANDERSON & DAWES, 1990).

1m

Figura 1. Microfotografa electrnica de P. putida con grnulos de PHA (Luengo et al. 2003)
La acumulacin de este polmero se puede considerar una estrategia desarrollada por
las bacterias para su supervivencia en ambientes cambiantes. Adems de servirle a la
clula como fuente de carbono, los PHA tambin sirven como fuente de energa para

20

el proceso de enquistamiento (Azotobacter sp.) y de esporulacin (Bacillus sp.), para
la proteccin de complejo nitrogenasa en las bacterias fijadoras de nitrgeno, ya que
el PHA acta como compuesto oxidable y tambin es constituyente de la membrana
citoplasmtica de bacterias (ALMEIDA et al., 2004; ANDERSON & DAWES,
1990, FILIPOV, 2000).
Los PHA pueden ser clasificados en dos grandes grupos: (i) de cadena corta (HA
SCL
-
HydroxyAcids of Short-Chain-Length), teniendo de 3 a 5 tomos de carbono en la
cadena principal, y (ii) de cadena media (HA
MCL
-HydroxyAcids of Medium-Chain-
Length) teniendo de 6 a 16 tomos de carbono en la cadena principal
(STEINBCHEL & VALENTIN, 1995).
2.2.1 Historia y Produccin
El primer hidroxialcanoato en ser estudiado fue el poli 3-hidroxibutirato (P3HB), el
cual fue descubierto por Lemoigne en 1926 (LEMOIGNE, 1926). En 1964 se
identifico El cido 3-hidroxi-2-butenico producido por una bactria del gnero
Nocardia (ANDERSON & DAWES, 1990). En 1972, a partir de estudios en aguas
residuales, se confirm la presencia de otras sustancias como los cidos 3-
hidroxivalrico (3HV), 3-hidroxihexanico (3HHx) y 3-hidroxiheptanico (3HHep)
mediante la extraccin con cloroformo (WALLEN y ROHDWEDDER, 1974). En
1976, la empresa inglesa Imperial Chemical industries (ICI) empez estudios para
producir polihidroxibutirato (P3HB) a partir de Ralstonia eutropha, depositando en
1981, una patente para la produccin del copolmero P (3HB-co-3HV). Este
copolmero es conocido como BIOPOL

y es obtenido a partir de glucosa y cido


propinico (BYROM, 1990). Cargill Dow Polymers comercializa sus resinas
EcoPla in Japn. Algunas de las marcas que estn en el mercado actualmente son
NODAX
TM
(Copolmero de hidroxibutirato e hidroxihexanoato) y BIOCYCLE
TM

(homopolmero de hidroxibutirato, copolmero de hidroxibutirato e hidroxivalerato)
producido por la empresa brasilera PHB Industrial S.A. desde el ao 2000, con una
capacidad inicial de produccin de 50 toneladas por ao, la cual se encuentra en fase
de ampliacin (NONATO et. al., 2001) (LEMOS et. al., 2006).

21

La empresa estadounidense Procter & Gamble desarroll y comercializ en 2004, un
copolmero de P3HB y 3HA con radicales laterales con ms de 3 carbonos utilizando
microorganismos genticamente modificados (NODA et al. 2004).
Debido a su crecimiento econmico y demogrfico en la segunda mitad del siglo
XX, China se ha convertido en una de los pases que ms produce y a su vez,
consume plsticos en el mundo (Tabla 1). En este pas asitico se estn desarrollando
varias investigaciones para la obtencin de PHA, contando con el 50% de las
empresas a nivel mundial que producen este biopolmero (CHEN, 2008).

Tabla 1. Compaias involucradas en la investigacin y produccin de PHA en el mundo (CHEN, 2008)
Compaia Clases de PHA Escala (ton/ao) Periodo
ICI, UK PHBV 300 1980 hasta 1990
Chemie Linz, Austria PHB 20-100 1980s
BTF, Austria PHB 20-100 1990s
Biomers, Alemania PHB Desconocido 1990s - presente
BASF, Alemania PHB, PHBV Escala piloto 1980s - presente
Metabolix, USA Desconocido Desconocido 1980s - presente
Tepha, USA Desconocido PHA como Bio-
Implantes
1990s - presente
ADM, USA (con Metabolix) Desconocido 50,000 2005 - presente
P&G, USA PHBHHx Hecho por encargo 1980s - presente
Monsanto, USA PHB, PHBV Planta de produccin
de PHA
1990s
Kaneka, Japn (with P&G) PHBHHx Desconocido 1990s - presente
Mitsubishi, Japn PHB 10 1990s
Biocycles, Brasil PHB 100 1990s - presente

22

DSM, Holanda Desconocido Desconocido 2006-Presente
Zhejiang TianAn, China PHBV 1000 1990s - presente
Beijing TianZhu Biomaterials, China PHBHHx PHA como Bio-
Implantes
2003 - presente
Jiangmen Biotech Ctr, China PHBHHx Desconocido 1990s
Tianjin Northern Food, China PHB Escala piloto 1990s
Shantou Lianyi Biotech, China PHB Escala piloto 1990s to 2005
Jiangsu Nan Tian Group, China PHB Escala piloto 1990s - presente
Shenzhen OBioer, China P(3HB-co-4HB) Desconocido 2004 - presente
Tianjin Guo Yun, China P(3HB-co-4HB) Escala piloto 2004 - presente
Shandong Lukang, China PHA
MCL
Escala piloto 2005 - presente
Shijiazhuang Pharma Group, China Desconocido Desconocido 2006-Presente


2.2.2. Caractersticas qumicas y fsicas
Como se mencion anteriormente, los PHA son polisteres compuestos por
monmeros de (R)-3-hidroxicidos, generalmente lineales, en los cuales, el grupo
carboxilo forma un enlace ster con el grupo hidroxilo con del monmero siguiente.
(MADISON & HUISMAN, 1999) (Fig. 2).
Hasta el momento se han identificado ms de 150 cidos hidroxialcanoicos,
saturados, insaturados, halgenos, aromticos, etc. (STEINBUCHEL & VALENTIN,
1995) los cuales son incorporados a la cadena lateral del PHA y a su vez cambian sus
propiedades fsicas, llevndolas a ser usadas en nuevas aplicaciones tecnolgicas.
Esta variabilidad depende del tipo de sustrato que se suministra, especificidad en la
polimerizacin y las diferentes rutas metablicas que conllevan la formacin de los
monmeros (MADISON & HUISMAN, 1999) (SILVA-QUEIROZ, 2007).

23


Figura 2 Estructura General de los Polihidroxialcanoatos (LEE, 1996)

La masa molecular de los PHA es del orden de 50kDa hasta 100kDa, esto depende
de la naturaleza del polmero (MADISON & HUISMAN, 1999). Intracelularmente,
el P3HB, existe en unos estados lquidos y amorfos, mientras que, despus de su
extraccin mediante el uso de solventes orgnicos, ste pasa a un estado cristalino,
confirindole caractersticas rgidas, pero a su vez quebradizo. Su punto de fusin es
relativamente alto (180 C), pero cerca del punto de degradacin trmica (200 C)
(KIM & LENZ, 2001).
Debido a su conformacin estructural, los PHA
SCL
y PHA
MCL
, difieren en sus
caractersticas termoplsticas y elastiomricas. Los PHA
SCL
son catalogados como
termoplsticos, mientras que los PHA
MCL
, por tener menor cristalinidad y puntos de
fusin menores son reconocidos como elastmeros (POIRIER et al., 2001). Los

24

PHA
MCL
tienen un alongamiento para ruptura mayor que 100%, mientras que los
PHA
SCL
poseen un alongamiento para ruptura menor que 5%; la incorporacin de
unidades de 3HV al P3HB permite aumentar la maleabilidad y resistencia,
alcanzndose valores de alongamiento para ruptura cerca de 50% (SUDESH et al.,
2000).
Tabla 2 Propiedades fsicas de PHA y PP. Modificado de REHM, 2007. Tg(Temperatura de transicin
vtrea) Tm( Temperatura de cristalizacin)
Propiedades PHA
MCL
PHA
SCL
PP

T
m
(C) 177 61 176
T
g
(C) 2 -36 -10
Cristalinidad (%) 70 30 60
Elongacin (%) 5 300 400

Las caractersticas del medio ambiente tambin repercuten en la produccin de los
biopolmeros. Varios estudios han demostrado la influencia que tienen los campos
magnticos en el rendimiento productivo de los microorganismos (ZHI-YONG et al.,
2007; TAKEHIRO et al., 2003). CHEN & LI (2008) determinaron que
definitivamente existe una influencia de los campos magnticos estticos en la
produccin de PHB.
2.2.3. Aplicaciones
El mercado de los PHA se puede clasificar en dos grandes grupos: (i) Envases
desechables biodegradables, con un mayor volumen de demanda, debido a que son
producidos bajo formas predeterminadas, pero en donde los productos petroqumicos
tienen ventaja debido a su excelente procesabilidad y bajo costo de produccin. En
este grupo, el objetivo fundamental es crear un mercado ecolgico donde su
biodegradabilidad le confiera un valor agregado al producto terminado, ya que segn
Nonato y colaboradores (2001), el PHB puede ser vendido a US$5.83 por Kilo,
siendo mucho ms barato que el polmero producido por Biomol cuyos precios

25

oscilan entre US$10-20 por kilo, dependiendo de la naturaleza de este. Algunos
productos comerciales fabricados a partir de PHA son botellas, recipientes para
cosmticos, bolgrafos, palos de golf, entre otros. (ii) rea farmacutica, ya que
desde 1990, los PHA estn siendo estudiados como posibles microencapsulados para
liberacin controlada de medicamentos. Algunas sustancias de origen natural como
el colgeno ya fueron utilizadas para tratamiento de tejidos cardiacos afectados, pero
se observ una baja eficiencia en la reparacin debido a que durante el
procedimiento quirrgico, las partculas pueden migrar de lugar del implante antes
del crecimiento del nuevo tejido (GALEGO et al., 2000). En el campo de la
oncologa, los PHA tambin estn siendo evaluados en diferentes tratamientos, como
por ejemplo, el P3HB y el PHPE son utilizados como microesferas portadores de
NzPC, un colorante fotosensibilizador el cual es usado en terapia fotodinmica. (R
et al., 2005). Diversas pruebas han sido realizadas y han mostrado que el P3HB es
biocompatible, debido a que R-3-Hidroxibutirato es un constituyente normal de la
sangre en concentraciones entre 0.3 y 1.3 mM, as mismo, estudios demuestran que
no existe alteracin en los parmetros funcionales, bioqumicos y fisiolgicos en los
pacientes, adems de presentar propiedades mecnicas iguales o mejores que los
termoplsticos convencionales. Los PHA
MCL
, gracias a sus caractersticas
elastiomricas, poseen aplicaciones potenciales como precursores de molculas con
propiedades anti-reumticas, analgsicas, radiopotenciadores, anti-tumorales, adems
en biopelculas mdicas y dispositivos especiales como soporte de frmacos, nuevos
tipos de suturas, soporte regenerativo de tejidos vasculares, etc. (POUTON &
AKHTAR. 1996; ZINN et al. 2001; SANCHEZ et al. 2003; SHISHATSKAYA et al.
2001; LUENGO et al. 2003).

2.3 Sntesis de PHA
En diversos grupos de bacterias ha sido estudiada profundamente la biosntesis de
PHA. Algunas rutas metablicas han sido descritas especialmente para 4
microorganismos: Cupriavidus necator, Rhodospirillum rubrum, Pseudomonas

26

oleovorans y Pseudomonas aeruginosa. (STEINBCHEL, 1996; STEINBCHEL
& LTKE-EVERSLOH, 2003).

2.3.1 Sntesis de PHA
SCL

En Cupriavidus necator la formacin de PHA
SCL
, polmero con cadenas de hasta 5
carbonos, ocurre por la accin de 3 diferentes enzimas producidas a partir de genes
organizados en un opern conocido como phaCBA. Dos molculas de Acetil-CoA
producidas a partir de la degradacin de la fuente de carbono suministrada son
condensadas a acetoacil-CoA por la accin de la -tiolasa (phaA). La molcula de
acetoacil-CoA es reducida en la posicin 3 por la acetoacil-CoA reductasa NADH
dependiente (phaB), produciendo (R)-3-hidroxibutiril CoA. La reaccin final
involucra la polimerizacin de dos molculas de (R)-3- hidroxibutiril CoA mediante
la formacin de un enlace ster gracias a la enzima PHB polimerasa (phaC) (Figura
3). Esta enzima es muy activa en monmeros que contienen menos de 5 tomos de
carbono. (STEINBCHEL, 1991; ZINN et al., 2001; SUDESH et al., 2000).

Figura 3. Sntesis de PHB. (1) -Cetotiolasa (2) acetoacil CoA reductasa (3)PHB polimerasa

2.3.2. Sntesis de PHA
MCL

Uno de los factores clave en la sntesis de PHA
MCL
es la enzima pha sintasa del
grupo II, producida por Pseudomonas, la cual es diferente a la pha sintasa producida
por C. necator en cuanto a la afinidad que tiene por sustratos que poseen de 6 a 16
tomos de carbono (AMARA & REHM, 2003).

27

Distintas vas metablicas han sido propuestas para la biosntesis de PHA
MCL
a partir
de diferentes tipos de sustrato (Figura 4).
A partir del metabolismo de carbohidratos, son producidas molculas de acetil-CoA,
las cuales, va malonil-CoA, son incorporadas a la biosntesis de novo de cidos
grasos, donde es generado el 3-hidroxiacil, el cual es transportado de la ACP (Acyl
carrier Protein) para la coenzima A (CoA) y ah, es polimerizado por la accin de la
pha sintasa (REHM et al. 1999).


Figura 4. Vas metablicas propuestas a partir de diferentes sustratos
(http://mbel.kaist.ac.kr/lab/index_en.html)

El metabolismo de los cidos grasos (-oxidacin) es una de las vas ms comunes
para producir PHA de cadena media. La composicin de estos polmeros est
directamente relacionada con la estructura de la fuente de carbono. Cuando el
sustrato posee de 6 a 12 tomos de carbono, los monmeros de PHA poseen la

28

misma longitud, o tienen 2, 4 o 6 carbonos menos. Cuando se suministran cidos
grasos de 13 a 18 carbonos, la composicin del PHA no es relacionada con la
longitud del sustrato, debido a que el monmero ms largo que es incorporado
posee 12 o 14 carbonos, aunque en su estructura puede presentar insaturaciones
(VILA-LEN, 2007). Aun no est claro si una epimerasa, 3-cetoacil reductasa o
enoil-CoA hidratasa (Figura 5) es la encargada de realizar el transporte de
intermediarios de la -oxidacin para la sntesis de PHA
MCL
(GOMEZ, 2000).


Figura 5. Ruta metablica de Biosintesis de PHA a partir de cidos Grasos
(http://mbel.kaist.ac.kr/lab/index_en.html)

2.4 Deteccin y cuantificacin de PHA
Diferentes tcnicas han sido empleadas para la deteccin de grnulos de polmero
intracelular. Los colorantes lipoflicos negro de Sudn (SCHLEGEL et al. 1970)
azul de Nilo A, y rojo de Nilo (KRANZ et al. 1997) son utilizados ampliamente.
Este ltimo produce una fuerte fluorescencia naranja a una longitud de onda de

29

543nm han sido utilizados para distinguir colonias acumuladores de PHA de las
colonias que no acumulan el polmero. (SPIEKERMAN et al. 1999).
El mtodo cuantitativo para deteccin de polihidroxialcanoatos es mediante
cromatografa de gases, utilizando como patrn interno cido benzico, el cual
establece tiempos de retencin determinados para cada uno de los tipos de
estructuras y cantidad de carbonos presentes en ellas. Para realizar esta
cuantificacin es necesario extraer los PHA de las clulas previamente y
despolimerizarlos mediante mtodos como metnolisis para formar metil-steres
(BRAUNEGG et al., 1978) o propanlisis para formar propil-steres (RIIS & MAI,
1988)
La cuantificacin de los Polihidroxialcanoatos tambin se realiza mediante en
anlisis espectroscpico de Resonancia Magntica Nuclear con C
13
(C
13
-NMR). Esta
tcnica es muy til para PHA
SCL
, pero presenta complicaciones con PHA
MCL

saturados e insaturados debido a la equivalencia de los cambios qumicos en los
tomos de carbono y los patrones protnicos del espectro de NMR.
2.5. Metabolismo de cidos Grasos
Los triglicridos son lpidos formados por la unin de tres molculas de cidos
grasos con una molcula de glicerol mediante un enlace ster. Los cidos grasos
constituyentes de la estructura del glicerol difieren generalmente en su estructura.
Los aceites estn compuestos de triglicridos, los cuales por accin de lipasas, son
hidrolizados a cidos grasos. (Figura 6) El glicerol es fosforilado y oxidado a
dihidroxiacetona fosfato, el cual es un intermediario de la gliclisis, para convertirse
finalmente en acetil-CoA, molcula precursora de diferentes vas metablicas, entre
ellas, ciclo de Krebs y Biosntesis de novo de cidos grasos. (ROMERO, 2006).

30


Figura 6. Hidrolisis de Triglicridos (http://www2.ufp.pt/~pedros/bq/fatty.htm)
2.5.1. -Oxidacin de cidos grasos
Un amplio grupo de bacterias pueden crecer y dividirse en cidos grasos de cadena
larga que son oxidados a Acetil-CoA por una va metablica denominada -
oxidacin (WHITE, 2OOO). Esta ruta consiste en una serie de 4 reacciones, al final
de las cuales, el acil-CoA ser reducido a dos carbonos, liberados en forma de
Acetil-CoA. (Figura 7).
En el modelo propuesto para E. coli por DiRUSSO y colaboradores (1999) los cidos
grasos entran a la clula mediante un mecanismo de translocacin que involucra a
dos enzimas: FadL, que sirve como receptor de los cidos grasos y ayuda a su paso a
travs de la membrana externa; y fadD (Acil-CoA Sintetasa), protena encargada de
la activacin del cido graso internalizado. La oxidacin de esta molcula activada se
da mediante la accin de las protenas fadF y fadG (Acil-CoA deshidrogenasa), las
cuales tienen afinidad por sustratos de cadena media-larga y cadena corta
respectivamente. El producto generado es un enoil-CoA (Acil-CoA con insaturacin
en la posicin 2). El producto del gen fadE es una flavoprotena encargada del
transporte de electrones necesarios en la accin de las Acil-CoA deshidrogenasas.


31


Figura 7. Modelo de -Oxidacin de cidos Grasos Modificado de DiRusso, 1999

Las enzimas que continan con el proceso oxidativo de los cidos grasos estn
agrupados en un complejo multienzimtico conocido como el opern fadBA, en el
cual son producidas las siguientes enzimas: 2-enoil-CoA hidratasa, 3-hidroxiacil-
CoA deshidrogenasa, 3-oxoacil-CoA tiolasa, 3-hidroxiacil-CoA epimerasa y
3
-cis-

2
-trans-enoil-CoA isomerasa. Este complejo est compuesto por una subunidad alfa

32

de 78 kDa y una subunidad beta de 42 kDa. (PRAMANIK et al., 1979; KUNAU et
al. 1995).
2.5.2. cidos grasos insaturados
Los principales cidos grasos presentes en los aceites vegetales son el cido oleico el
cual presenta una instauracin en el carbono 9 (C18:1
9
) y el cido linolico, el cual
posee dos insaturaciones (C18:2
9,12
). Estos dos cidos grasos representan ms del 70%
de la composicin general de estas sustancias de origen natural. (VANZIN, 2008).
La oxidacin de estos cidos grasos requiere de dos enzimas ms, enoil-CoA
isomerasa y 2,4 dienoil-CoA reductasa para que el proceso de degradacin contine.
La enzima enoil-CoA isomerasa es la responsable por la conversin de compuestos
cis-3-enoil-CoA para trans-2-enoil-CoA, debido a que la acil-CoA deshidrogenasa
no reconoce molculas con conformacin cis. Esta enzima acta en las
insaturaciones que se extienden de un carbono impar hacia un carbono par. Despus
de esta isomerizacin el ciclo de oxidacin contina normalmente. (KUNAU, 1987).
La enzima 2,4 dienoil-CoA reductasa dependiente de NADH es especifica cuando el
doble enlace se extiende de un carbono par hacia uno impar. Partiendo de esta
premisa, el cido linoleico, que posee dos insaturaciones (C18:2
9,12
) es oxidado
hasta 3-cis-dodecenoil-CoA. Luego una enoil-CoA isomerasa acta, generando 2-
trans-6-cis-dodecadienoil-CoA, el cual entra de nuevo al ciclo de -oxidacin y se
produce 2-trans-4-cis-decadienoil-CoA. Es aqu cuando es necesaria la reduccin de
este compuesto mediante la 2,4 dienoil-CoA producida a partir del gen fadH, para
generar 3-trans-decenoil-CoA, molcula la cual es intermediaria del ciclo de -
oxidacin. Es as como las insaturaciones (dobles enlaces) son manipulados por
isomerasas cuando se extienden de carbonos impares a pares, por isomerasas y
reductasas cuando las insaturaciones se extienden de carbonos pares a impares
(STRYER, 1998; SCHULZ & KUNAU, 1987),

33


2.6. Pseudomonas spp.
Pseudomonas spp., es un gnero de bacterias aerbicas, Gram-negativas,
quimiohetertrofas, mviles y de forma bacilar (MERCADO-BLANCO, 2007)
adaptadas a un gran variedad de ambientes debido a sus simples requerimientos
nutricionales y por la misma razn ampliamente distribuido en el suelo formando
asociaciones con plantas. Crecen a pH casi neutro y en temperaturas mesoflicas,
hasta 43 C. Se ha reportado que muchas especies de Pseudomonas crecen
eficientemente en medios qumicamente definidos conteniendo diferentes
compuestos alifticos (carbohidratos, cidos grasos, cidos dicarboxlicos y
tricarboxlicos, alcoholes) y aromticos como fuente de carbono (MARTNEZ-
BLANCO et al., 1990; MIAMBRES et al., 1996).
Metablicamente, las especies pertenecientes a este gnero bacteriano presentan
caractersticas muy similares entre s, las principales pruebas bioqumicas se
encuentran resumidas en la Tabla 2.
Muchas especies de Pseudomonas pertenecientes al grupo I de homologa rRNA
producen PHA con diversos grupos funcionales tales como halgenos, alquilos
ramificados, fenilos, fenoxilos, olefinas y steres, cuando son cultivados con las
correspondientes sustancias qumicas (KIM et al. 2000).
Tabla 3. Principales Caracteristicas metablicas de Pseudomonas (BERGEY, 2005)
Prueba Bioquimica Resultado
Oxidasa (+)
Indol (-)
Rojo de Metilo (-)
Voges Proskauer (-)
Citrato (+)
Catalasa (+)

34


Clasificacin cientfica de Pseudomonas sp (BERGEY, 2005).
Dominio: Eubacteria
Phylum: Proteobacteria
Clase: Gamma Proteobacteria
Orden: Pseudomonadales
Familia: Pseudomonadaceae
Gnero: Pseudomonas

Las Pseudomonas poseen una amplia variedad de enzimas lipolticas, las cuales son
de vital importancia para su metabolismo. P. fluorescens y P. aeruginosa presentan
enzimas hidrolticas de tipo ster enantioselectivas, las cuales las hacen participes de
los procesos de biotransformacin y esterificacin.
Los primeros reportes de la produccin de PHA
MCL
por Pseudomonas fueron en la
especie P. oleovorans, describiendo la produccin de polmero conteniendo 3-
hidroxioctanoato por la metabolizacin de cidos grasos de cadena media, larga y
tambin en alcanos (KESSLER Y PALLERONI, 2000). Hoy en dia se tiene
conocimiento de la capacidad productora de todas las Pseudomonas fluorescentes
(BALLISTRERI et al. 2001).
El efecto de la temperatura en el crecimiento y en la posterior produccin de PHA
tambin ha sido estudiado en Pseudomonas (HABA et al. 2006) mostrando que a
diferentes temperaturas la composicin monomrica del polmero puede ser
modificada.


35

3. FORMULACION DEL PROBLEMA Y JUSTIFICACION

Los plsticos se han convertido en un material de uso cotidiano en la sociedad. Estas
sustancias son de origen petroqumico y han sido producidos desde hace ms de 100
aos. Debido a la sobrepoblacin humana la demanda de estos se ha incrementado
en los ltimos aos y sumado a los altos costos del petrleo los cuales rondan los
US$110 por barril[ http://www.opec.org/home/basket.aspx consultado agosto 2008],
hacen que muchas investigaciones se dirijan a desarrollar nuevas tecnologas
productoras de materiales con caractersticas similares a los productos petroqumicos
y a la vez no tenga un impacto negativo en el medio ambiente.
Millones de toneladas de residuos son producidos diariamente por las actividades
humanas, entre los cuales, los plsticos aportan un gran porcentaje de estos desechos.
En el caso de Bogot, se producen diariamente 23 mil toneladas de basura, de las
cuales, el 30% corresponden a residuos plsticos. Diversos programas de reciclaje
estn en funcionamiento aliviando de cierta manera este problema, pero, debido a la
gran cantidad de desechos producidos, estos esquemas parecen no dar abasto,
adems de no ser totalmente limpios, debido a que generan una cantidad
considerable de nuevas emisiones nocivas a la atmsfera.
Tomando en cuenta esto, los biopolmeros, en especial los PHA aparecen como una
de las opciones ms viables, debido a su alta tasa de biodegradabilidad y a su
generacin a partir de sustancias naturales, productos de la agricultura, en general, de
productos renovables.
Sin embargo, la produccin y el precio de los bioplsticos sigue siendo demasiado
altos como para poder desplazar a los plsticos tradicionales, debido a que la
infraestructura de produccin es completamente nueva y especfica para este
producto.

36

El uso de sustratos baratos y de fcil adquisicin como los aceites de origen vegetal,
los cuales confieren monmeros de diferentes conformaciones, como insaturaciones
y radicales acilos que poseen mayor numero de tomos de carbono, que pueden ser
incorporados a la estructura de los PHA para as, proporcionarles nuevas
caractersticas y as permitir que las insaturaciones puedan ser blanco para nuevas
modificaciones.
El estudio de los genes involucrados en la degradacin de los cidos grasos permite
modular la composicin de los monmeros constituyentes de los PHA
MCL
, y as,
pensar una produccin de polmeros hechos a la medida.












37

4. OBJETIVOS
4.1. Objetivo General
Evaluar la incorporacin de monmeros insaturados a PHA
MCL
producidos por
mutantes de Pseudomonas putida IPT 046 afectados en el crecimiento en cido 4-
pentenico, as como los genes afectados en estos mutantes.

4.2 Objetivos especficos

Determinar la composicin de los PHA producidos por los mutantes de P.
putida IPT 046 incapaces de crecer en acido 4-pentenoico utilizando como
fuente de carbono cido linolico.
Evaluar el efecto de la sobreexpresin del gen fadH1 en Pseudomonas putida
IPT 046.
Evaluar el efecto de la complementacin de los mutantes obtenidos a partir
de Pseudomonas putida IPT 046 con el gen fadH1;
Evaluar los genes afectados en estos mutantes







38

5. MATERIALES Y MTODOS
5.1 Microorganismos y Plsmidos
Las cepas utilizadas y plsmidos que fueron utilizados estn descritos en las tablas 4
y 5
Tabla 4. Microorganismos utilizados
Microorganismos Caracteristicas
Escherichia coli XL1-Blue PHA
-
, Lac
-
, Gm
s
, Kan
s
Escherichia. coli S17-1 PHA
-
, F
-
80dlacZ M15 (lacZYA-argF) U169 recA1 endA1hsdR17(r
k
-
,
m
k
+
) phoAsupE44
-
thi-1 gyrA96 relA1 (SIMON et al., 1983)
Pseudomonas putida IPT 046 Glu
+
, PHA
+
, Lin
+
, Val
+
, 4Pen
+
, Gm
s
, Kan
s
(GOMEZ, 1996)

Pseudomonas putida AG46,AK1,
BG45, BJ5, CF12, CN25, DG45,
DM26, DR52, DW4, DX38
Pseudomonas putida IPT 046, mutantes obtenidos con el plsmido
pUTKm2 conteniendo transposon mini-Tn5 Glu
+
, PHA
+
, Lin
+
, Val
+
,
4Pen
+
, Gm
s
, Kan
r
(SILVA-QUEIROZ, 2007)

Pseudomonas putida AM1, CM29,
CM51, CR4, DU54, EB50
Pseudomonas putida IPT 046, mutantes obtenidos con el plsmido
pUTKm2 conteniendo transposon mini-Tn5 Glu
+
, PHA
+
, Lin
+
, Val
+
, 4Pen
-
, Gm
s
, Kan
r
(SILVA-QUEIROZ, 2007)

Tabla 5. Plsmidos utilizados
Plsmido Caractersticas
pGEM:fadH1 pGEM conteniendo el gen fadH1 (SILVA-QUEIROZ, 2007)
pBBR1MCS-5 Gm
r
lac POZ, MCS, Mob (KOVACH et al. 1995)


5.2 Medios de cultivo
Los medios de cultivo fueron esterilizados en autoclave durante 20 minutos a 121
C, 1 atm.
En la preparacin de los medios minerales, la fuente de carbono y el agar-agar fueron
esterilizados y adicionados despus de la esterilizacin de la solucin de sales.

39

5.3.1Medio LB (Luria-Bertani)
(SAMBROOK et al., 1989)
Triptona 10,0 g/L
Extracto de Levadura 5,0 g/L
Cloruro de Sodio (NaCl) 5,0 g/L
Agar-Agar 20,0 g/L
Las siguientes denominaciones fueron dadas a los diferentes medios LB con
diferentes antibiticos:
LBA: medio LB con ampicilina
LBGm: medio LB con gentamicina

5.2.2 Medio Mineral
(RAMSAY et al. 1990)
(NH
4
)
2
SO
4
1,00 g/L
Na
2
HPO
4
3,50 g/L
KH
2
PO
4
1,50 g/L
MgSO
4
.7H
2
O 0,20 g/L
CaCl
2
.2H
2
O 0,01 g/L
Citrato frrico amoniacal 0,06 g/L
Solucin de elementos traza 1,00 mL/L

Cada litro de solucin de elementos traza contiene:
H
3
BO
3
0,30 g
CoCl
2
.6H
2
O 0,20 g
ZnSO
4
.7H
2
O 0,10 g
MnCl
2
.4H
2
O 0,03 g
NaMoO
4
.2H
2
O 0,03 g
NiCl
2
.6H
2
O 0,02 g
CuSO
4.
5H
2
O 0,01 g

Las siguientes denominaciones fueron dadas a los diferentes medios minerales con
diferentes fuentes de carbono:

40

MMGGm: Medio mineral con glucosa (1g/L) y gentamicina (15L/mL)
MM4P: Medio mineral con cido 4-pentenico (1g/L)
MM4PGm: Medio mineral con con cido 4-pentenico (1g/L) y gentamicina
(15L/mL)
MMV: Medio mineral con cido valrico (1g/L)
MML: Medio Mineral con cido linolico (2,5g/L)
MMLGm: Medio Mineral con cido linolico (2,5g/L) y gentamicina
(15L/mL)
5.3. Condiciones de cultivo
Las bacterias del gnero Pseudomonas fueron reactivadas en medio LB durante 24
horas, 30C 150rpm. Luego fueron sembradas en agar LB durante 24 horas a 30C.
Posteriormente fueron sembradas en agar MMGGm, MM4P, MM4PGm, MMV
durante 72 horas a 30 C. Tambin se cultiv P. putida IPT 046 en MML y
MMLGm.
Escherichia coli fue cultivada en medio LB suplementado con antibitico, durante
24 horas a 37 C, 150 rpm.
Los antibiticos fueron preparados de acuerdo a SAMBROOK et al. (1989),
esterilizados mediante filtracin por membrana de 0.22m (Millipore) y
posteriormente adicionados a los medios de cultivo en las concentraciones indicadas
en la tabla 5.
Tabla 6. Antibiticos y concentraciones utilizadas

Antibitico
Solucin Stock
(mg/mL)
Concentracin final
(g/mL)
Ampicilina
Gentamicina
100 (en H
2
0)
15 (en H
2
0)
100
15



41

5.4 Manipulacin de ADN
5.4.1 Extraccin de ADN plasmdico
Fueron utilizados para la extraccin de ADN plasmdico los siguiente kits, siguiendo
las recomendaciones del fabricante:
- DNA plasmdico: Quick Plasmid Miniprep (Invitrogen Corp. ) y Qiaprep


Spin Miniprep (Qiagen).
Tambin fue utilizado el mtodo BIRBOIM & DOLY (1979), modificado. E. coli
cargando el plsmido de inters fue cultivada overnight en 25mL de LB con el
antibitico al cual es resistente. El cultivo celular fue centrifugado en alcuotas de
1,5mL por 5 minutos a 13000 rpm. El sobrenadante fue descartado y las clulas
fueron resuspendidas en 100L de solucin GETL [Lisozima 4mg/mL; Glucosa
50mM; EDTA de calcio y sodio (etileno diamino tetracetato) 10mM; Tris/HCL
(hidrocloruro de hidroximetil aminometa) 25mM; pH 8,0] enfriado previamente,
agitadas vigorosamente e incubadas en bao de hielo durante 5 minutos. Se
adicionaron 200L de SDS en NaOH 0,2M, se mezcl por inversin y se incub
durante 5 minutos en bao de hielo. Para la precipitacin de ADN cromosmico y
protenas, se adicionaron 150L de solucin de acetato de potasio (Acetato de
potasio 60mL; cido actico 11.5mL; H
2
O 8.5mL) enfriado previamente y
nuevamente incubada durante 5 minutos en bao de hielo. Despus de esto, la
solucin fue centrifugada durante 10 minutos, 6000rpm, 4 C. El sobrenadante,
conteniendo el ADN plasmidial fue transferido para un nuevo tubo, donde se realiz
la extraccin con fenol/cloroformo (250L de fenol y 250L de cloroformo), luego
se centrifug durante 10 minutos, 13000rpm, 4 C. En seguida fue hecha la
precipitacin con etanol absoluto (750L), se incub durante 15-30 minutos en bao
de hielo para luego centrifugar durante 20 minutos, 13000rpm, 4 C. Posteriormente
se realiz un lavado con etanol 70% para luego centrifugar durante 10 minutos,
13000 rpm, 4 C y el pellet fue secado en incubadora a 65 C hasta que todo el

42

etanol remanente se evaporara. El pellet fue resuspendido en 30L de solucin TE
(Tris 10Mm, EDTA 1Mm, pH 7.5) para luego ser almacenado a -20 C.
5.4.2 Digestin de ADN con enzimas de restriccin
Para la digestin de ADN fue utilizada la enzima ApaI, siguiendo las indicaciones
del fabricante (Invitrogen Corp.) Despus del tiempo indicado, la enzima fue
inactivada a 65 C durante 10 minutos.
5.4.3 Ligacin de ADN
Las reacciones de ligacin fueron realizadas usando la enzima T4 DNA ligasa
(Fermentas Inc.) de acuerdo con el protocolo del fabricante.
5.4.4 Preparacin de clulas competentes
Las cepas de E.coli XL1-Blue y/o E.coli S17-1 fueron inoculadas en 25mL de medio
LB, conteniendo MgCl
2
10mM, MgSO
4
10mM, e incubadas en agitador rotativo a
37 C hasta lograr una DO
650
= 0.3-0.5. En tubos estriles fueron centrifugados 8mL
de cultivo por 15min, 5000rpm, 4 C. El pellet obtenido fue resuspendido en un
tampn de transformacin (Tris 10mM; CaCl
2
50mM; MgCl
2
10mM; MgSO
4
10mM;
pH 8,0) Las clulas se mantuvieron durante 15 minutos en hielo y nuevamente fueron
centrifugadas. Para la obtencin de las clulas competentes, el pellet obtenido fue
nuevamente resuspendido en 0,8mL de tampn de transformacin, y posteriormente
fue dividido en alcuotas de 200L y mantenido en hielo. Las clulas fueron usadas
de inmediato.
5.4.5 Transformacin Bacteriana
Para cada 200L de clulas competentes, se adicionaron 10L de ADN, se incubaron
en bao de hielo durante 30 minutos, posteriormente esta solucin fue sometida a un
choque trmico a 42 C durante 90 segundos y enfriada inmediatamente en hielo. Se
adicionaron 600L de medio LB y se incubaron durante 1 hora a 37 C. Los clones
transformados fueron seleccionados en medios de cultivo con el antibitico
apropiado. Los reactivos IPTG (isopropil-D-tio-galactsido) e X-Gal (5-bromo-4-

43

cloro-3-indolil--D-galactsido) fueron adicionados para diferenciar los clones
recombinantes conteniendo el fragmento de inters.
5.4.6 Electroforesis en gel de agarosa
Para el anlisis de ADN se utiliz gel de agarosa 0.8 % (m/v) con bromuro de etidio
0.01% (v/v). Se us solucin TAE [Tris-base 242g; cido Acetico Glacial 57.1mL;
EDTA de calcio y sodio (etileno diamino tetracetato) 0.5M (100mL); H
2
O 1000mL]
como tampn de corrida. Las muestras de ADN fueron aplicadas en los geles con
1/10 del volumen del colorante de corrida Blue Green Loading Dye I (LCG
Biotecnolgia). Las corridas electroforticas fueron realizadas a 90V, 80mA, 80W
durante 1 hora. El marcador de corrida fue GeneRuler 1Kb DNA ladder Plus
0,5g/L (Fermentas Inc.). Los geles fueron observados bajo Luz UV (254nm) en
transiluminador (Ultralum 100)
5.4.7 Purificacion de ADN a partir del gel de agarosa
Para la purificacin de ADN del gel de agarosa fue utilizado el kit de purificacin
QIAquick Gel extraction kit (QIAGEN) siguiendo las instrucciones del fabricante
5.5 Construccin del plsmido por insercin del fragmento purificado a partir
del gel de agarosa
El plsmido pBBR1MCS-5 fue digerido con la enzima de restriccin ApaI y ligado
al fragmento fadH1 purificado utilizando la enzima de ligacin T4 DNA ligasa
(Fermentas Inc.). El plsmido fue transferido por transformacin para E. coli S17-1
y XL1-Blue
5.6 Complementacin
E.coli S17-1::pBBR1MCS-5::fadH1 fue sembrada en LBGm mientras que P. putida
IPT046 y los mutantes mini-Tn5, fueron sembradas en LB. Colonias aisladas fueron
inoculadas en 25mL de medio LBGm para el caso de E. coli y en 25mL de medio
LB para el caso de Pseudomonas. Despus de 24 horas de cultivo a 37 C, 150rpm
las clulas (25mL) fueron centrifugadas durante 10 minutos, 5000 rpm. Cada uno de
los pellets obtenidos fueron resuspendidos en 10mL de solucin salina (SS) y

44

centrifugados de nuevo durante 10 minutos, 5000 rpm. Estos pellets fueron
nuevamente resuspendidos en 1mL de SS. Fueron sembrados 100L de E.coli S17-1
en agar MMGGm y homogenizados utilizando esptula de Drigalski. Una vez seca
esta capa, fueron sembrados 100L de suspensin celular de P. putida IPT046 y los
mutantes en cada una de las cajas e incubadas a 30 C durante 24 horas.
Las colonias crecidas fueron repicadas en una nueva caja con MMGGm e incubadas
durante 24 horas, 30 C. Despus de este periodo, las colonias aisladas fueron
sembradas en MMGGm, MM4P, MM4PGm y MMV para evaluar el crecimiento.
5.7 Ensayos de acumulacin de polmero a partir de cido linolico
Clulas de Pseudomonas putida IPT 046 y de los mutantes fueron sembradas en
placas con agar LB. Colonias aisladas de estas placas fueron inoculadas en 25mL de
medio LB en agitacin continua 30 C, 24h, 150rpm. Una alcuota de este cultivo
(6%) fue transferida para 50mL de MM con glucosa (5g/L), en agitacin 30 C, 24h,
150rpm. Despus de este tiempo, las clulas fueron lavadas y resuspendidas en
solucin salina. Esta suspensin fue utilizada para inocular 50mL de MM sin fuente
de nitrgeno y con cido linoleico (2.5 g/L) como fuente de carbono. Despus de 48
horas de cultivo fueron analizados: masa seca celular, pH y composicin de PHA.
5.7.1 Determinacin de Masa seca celular (MSC)
10 mL de suspensin celular fueron centrifugados (10000rpm, 10 min, 4 C). El
pellet obtenido fue resuspendido en solucin tween 80 a 0,1% (v/v) y nuevamente
centrifugado. Fue resuspendido en SS y filtrado a travs de membranas de poro
0.45m (Millipore). La membrana con las clulas fue secada en un horno durante 4
horas a 100 C. Luego de este tiempo, las membranas fueron colocadas en un
desecador durante 20 minutos a temperatura ambiente. Pasado este periodo, fue
determinada la masa celular con la siguiente ecuacin:
MS= [(MMC MM + HM)/VOL] X 1000
Donde:

45

MMC= masa de la membrana y clulas despus del secado
MM= masa de la membrana
HM= humedad relativa media del lote de membranas
VOL= volumen de suspensin centrifugado
5.7.2 pH
El pH fue determinado a partir del sobrenadante obtenido de la centrifugacin, en un
potencimetro (Mettler modelo Delta 350) utlizando patrones de pH de 4,0; 7,0 y 9,0
(Ingold Mettler Toledo Int. Inc.).
5.7.3 Cantidad y composicin de PHA
Para determinar la cantidad y la composicin de PHA, fue el mtodo de propanlisis
descrito por Riis y Mai (1988), en donde se tomaron 20mg de clulas liofilizadas, se
adicionaron 2mL de solucin de cido clorhdrico (HCl) 0,1N en propanol (1:4) v/v,
2mL de 1,2-dicloroetano y 200L de solucin de 40g/L de cido benzoico en
propanol, como patrn interno. Los tubos fueron cerrados, agitados y sometidos por
3 horas a 100
o
C en bao de Mara, agitndolos despus de los primeros 30 minutos.
Se enfriaron a temperatura ambiente y se les adicion 4mL de agua Milli-Q, agitando
vigorosamente por 30seg. La fase acuosa (superior) se descart y la fase orgnica
(inferior) que contiene los propil-steres fue analizada en cromatgrafo de gases
HP6890 Series GC System equipado con una columna HP-5 (5% fenil- metil-
siloxano, 30m de alto; 0,25 mm de dimetro; 0,25 m de espesor del filme). El
anlisis fue llevado a cabo bajo las siguientes condiciones: Gas de arrastre: Helio
(0,8 ml/min), temperatura del inyector: 250 C, temperatura del detector: 300 C,
sistema de deteccin: Ionizacin de llama (FID), programa de temperatura: 100C
por 1 minuto, aumento de la temperatura hasta 185C a 8 C por min y 185 C por 15
minutos. Fue usado cido benzico como patrn interno y polmeros producidos por
P. oleovorans fueron utilizados como patrones externos. Para el anlisis de
monmeros conteniendo insaturaciones, especialmente en la regin de 12 carbonos,

46

se us el mismo factor de respuesta del componente saturado con 12 carbonos, es
decir, el 3HDd.


47

6. RESULTADOS Y DISCUSION

6.1 Evaluacin en la produccin de PHA por mutantes deficientes en la
utilizacin de cidos grasos insaturados

Este ensayo se realiz seleccionando 5 mutantes que presentaron, en una evaluacin
pasada (SILVA-QUEIROZ, 2007) mayor incorporacin de monmeros insaturados
(3HDd
6
) en comparacin con Pseudomonas putida IPT046 y usando como fuente
de carbono cido linolico (Tabla 6). Todos los mutantes evaluados mostraban un
crecimiento mnimo en cido 4-pentenico.
Tabla 6. Composicin monomrica de PHA acumulados por P. putida IPT 046, AG46, BJ5, CF12, CN25 Y
DU54, cultivadas en cido linolico*
Cepas
bacterianas
MSC
(g/L)
pH
PHA (mol%) PHA
(%MSC) 3HHx 3HO 3HD 3HDd 3HDd
6

IPT 046 0,77 6.72 12,73 31.06 32,75 2,95 20,49 26.11
AG46 0,72 6,70 10,36 30,10 32,75 4,93 21,86 24,21
BJ5 0,87 6,98 8,67 25,78 33,57 4,35 27,6 25,43
CF12 0,83 6,87 10,62 27,59 34,95 3,38 23,42 30,74
CN25 0,67 6,65 10,84 26,67 31,85 4,72 21,75 27,49
DU54 0,93 6,94 9,70 26,20 34,51 4,61 24,95 42,70
*Los resultados corresponden al valor medio de dos replicas
La cepa salvaje (IPT 046) acumul cerca de un 26% de biomasa en forma de PHA.
3HD y 3HO fueron, respectivamente, los monmeros producidos en mayor
porcentaje. Si bien se conoce que a partir de la -oxidacin del cido linolico no se
produce 3HDd, este monmero fue detectado en proporciones mnimas en todos los
microorganismos evaluados. La produccin de este compuesto probablemente se da
debido a la biosntesis de cidos grasos, en donde, molculas de Acetil-CoA
producidas a partir del metabolismo del cido linolico son condensadas hasta
formar compuestos de mayor peso molecular. La fraccin molar de 3HDd
6

producida por IPT046 fue de 20,49mol %.

48

Los mutantes AG46 y CN25 mostraron una gran similitud en cuanto a la produccin
de 3HDd
6
, presentando valores de 21,86 mol% y 21, 75 mol% respectivamente.
Estos valores no difieren mucho de los mostrados por la cepa salvaje IPT 046.
Los mutantes CF12 y DU54 presentaron una fraccin molar de 3HDd
6

correspondiente a 23,42% y 24,95% respectivamente, mostrando valores mayores a
los producidos por la cepa salvaje. Por otro lado, el mutante DU54 acumul cerca del
42% de masa seca en forma de PHA, adems de producir 34,5 mol % de 3HD.
El mutante BJ5 mostr la mayor incorporacin de 3HDd
6
con respecto a la cepa
salvaje, con un valor de 27,6 mol %, sugiriendo algn cambio en el metabolismo de
cidos grasos, en relacin a las enzimas involucradas en reducir los dobles enlaces de
las insaturaciones que se extienden de un carbono par hacia un impar, presentada en
el cido linolico.
6.2 Clonacin del gen fadH1 en pBBR1MCS-5

En 2007, SILVA-QUEIROZ utiliz la secuencia del gen fadH de E. coli y busc por
secuencias similares en los genomas de Pseudomonas que han sido secuenciadas y
encontr en todas al menos un gen fadH. En Pseudomonas aeruginosa se
identificaron dos genes, denominados fadH1 y fadH2. Gracias a la elaboracin de
un dendograma, logr clasificar estos genes en dos grupos: fadH1 presentes en todas
las Pseudomonas y fadH2 presente solamente en P. aeruginosa. Mediante el
alineamiento de las secuencias del gen fadH1 de diferentes subespecies de P. putida,
fueron diseados iniciadores para la amplificacin de este. ADN genmico de
Pseudomonas putida KT2440 y Pseudomonas putida IPT O46 fueron usados como
molde para realizar esta amplificacin, obteniendo amplicones de 2,6Kb del genoma
de Pseudomonas putida KT2440, mientras que, a partir del genoma de
Pseudomonas putida IPT O46 no obtuvo ninguno, sugiriendo una diferencia en esa
regin del genoma. Esta hiptesis se fundamenta en el estudio de nuevos genomas
secuenciados de diferentes sub-especies de Pseudomonas putida, los cuales muestran

49

que en regiones adyacentes al gen fadH1 se encuentran diferencias significativas
(Fig. 8), por lo cual, es recomendable redisear los iniciadores para la amplificacin
de esta regin genmica de P. putida IPT046. El producto de esta amplificacin fue
ligado al vector de clonacin pGEM T-Easy (ver Anexo I) y transferido para E.
coli XL1-Blue mediante transformacin (SILVA-QUEIROZ, 2007).

Figura 8. Regiones del genoma de diferentes subespecies Pseudomonas putida donde se encuetra el gen
fadH1

A partir de esto, uno de los objetivos de este trabajo fue la construccin del
plsmido pBBR1MCS-5::fadH1, con el fin de expresar el gen fadH1 en P. putida y
los mutantes obtenidos a partir de esta.

La construccin de este plsmido se llevo a
cabo en dos etapas. La primera consisti en la obtencin del fragmento de DNA de
inters (fadH1) el cual estaba inserido en el vector de clonacin pGEM T-Easy
(SILVA-QUEIROZ, 2007).
Luego de realizar una comparacin de los sitios de restriccin donde actuaban
diferentes endonucleasas dentro del pGEM T-Easy y la secuencia amplificada del

50

gen fadH1 (Figura 9), se determin que todas las enzimas tenan sitio de corte dentro
de la regin codificadora, y por tanto no eran adecuadas para la clonacin. La nica
excepcin fue la enzima ApaI, la cual presenta un sitio de corte dentro del amplicn
pero no en la regin codificadora. Asi ApaI fue seleccionada para realizar la
clonacin del gen fadH. Para la clonacin del gen fadH1 se realiz la extraccin del
plsmido y posteriormente se utiliz la enzima de restriccin ApaI para separar el
gen fadH del resto del plsmido
TGTCCCATCCTTTTGTCAGCATGAGCGAACCCTCCGGGCGCACTGAGTAGGCGCCACGTTCCATGGGTGGATGAT
CAAACGTGCTTGAAGAGTCTGGCAGAGCCGCGTTGTCTGGCAAATGCGCGGGGAGACTGTTTGGCGATCAAGCCA
GGCGAACCTTATAGCGCTGAAGTTCTGGAGCCTTCCCGACAGTCGCTGCCTCTGCTGTTCATCACGATCATTAAC
TTGTCAGTTTTGATCATTGAGGCAATTCAAACGGCTGTTTAATGTCGCAGGCAGACAAACGACGGGGCCCGCCAC
CCAGTGAGGTGCCCGCATTCCGTGATCACGCCATCAGGGGACCTTTCCATGGCCGCCGACCGCTACCCGCACCTG
CTTGCTCCGCTGGACCTGGGCTTTACCACCTTGCGCAACCGCACCCTGATGGGCTCGATGCACACCGGCCTCGAA
GAGCGCCCCGGCGGCTTCGAGCGCATGGCAGCTTACTTTGCCGAGCGCGCCCGGGGCGGCGTTGGCCTGATGGTC
ACGGGCGGCATTGCGCCCAATGATGAAGGCGGGGTGTATTCCGGTGCGGCAAAGCTCAGCACCGAGGAAGAGGCC
GACAAGCACCGCATCGTCACCGAGGCGGTGCACGCTGCCGGTGGCAAGATCTGCCTGCAGATACTGCATGCCGGG
CGCTACGCCTACAGCCCACGGCAGGTGGCACCTAGCGCGATCCAGGCGCCGATCAACCCGTTCAAGCCCAAAGAG
CTGGATGAGGCGGGCATCGAGAAGCAGATCGCCGACTTCGTCAATTGTGCCGTGCTGGCTCAGCGTGCCGGTTAC
GACGGCGTCGAAATCATGGGTTCGGAAGGCTACTTCATCAACCAGTTCCTGGCCGCCCACACCAACCACCGCACC
GACCGCTGGGGCGGCAGTTATGAAAACCGCATGCGCCTGGCAGTGGAAATCGTCAGCCGGGTGCGTGGCGCGGTA
GGGCCGAACTTCATCATCATCTTCCGCCTGTCGATGCTCGACCTGGTCGAGGGTGGCAGCACCTGGGACGAGATC
GAGCTGCTGGCCAAGGCCATCGAGCAGGCCGGCGCGACCTTGATCAACACCGGAATCGGTTGGCACGAGGCGCGT
ATTCCGACCATCGCCACCAAAGTGCCGCGTGCGGCCTTCAGCAAAGTCACCGCCAAGTTGCGCGGCGTGGTGAGC
ATTCCGCTGATCACCACCAACCGCATCAACACCCCGGAAGTGGCCGAGGCAGTGCTGGCCGAGGGCGATGCGGAC
ATGGTCTCGATGGCGCGACCGTTTCTCGCCGACCCGGACTTCGTCAACAAGGCCGCTGCCGGTCGTGCGGATGAA
ATCAACACCTGCATCGGCTGCAACCAGGCCTGCCTGGACCATACCTTCGGCGGCAAGCTGACCAGTTGCCTGGTC
AACCCGCGGGCCTGCCACGAGACCGAACTCAACTACTTGCCTGTACGTACGGTGAAACGCATTGCCGTGGTCGGC
GCCGGCCCGGCTGGCCTGGCGGCGGCCACCGTGGCGGCCGAGCGGGGCCACGCGGTGACCCTGTTTGACGCCGCC
AGCGAAATCGGTGGCCAGTTCAACGTGGCCAAGCGGGTGCCGGGCAAGGAAGAATTCTTCGAAACGCTGCGTTAC
TTCCGCAACAAGGTCAAAAGCACGGGCGTCGACCTGCGCCTGAATACCCGCGTGGATGTGCAGGCACTGGTGGGC
GGCGGCTTTGATGAAGTCATCCTGGCTACCGGCATCGCCCCGCGTACCCCGGACATCGCGGGCGTGGAGCATGCC
AAGGTGCTCAGCTACCTGGACGTGCTGCTCGAGCGCAAGCCGGTGGGCAAGTCGGTGGCCGTGATTGGCGCGGGA
GGTATCGGCTTCGATGTGTCCGAGTACCTGGTGCATCAGGGCGTGGCCACCAGTCAGGACCGAGCGGCATTCTGG
AAAGAGTGGGGCATCGATACCCATCTTCAGGCGCGAGGTGGTGTGGCCGGGATCAAGGCCGAGCCGCATGCTCCG
GCGCGGCAGGTGTACCTGTTGCAGCGCAAGAAATCCAAGGTGGGCGACGGGCTCGGCAAGACGACCGGCTGGATT
CACCGCACCGGGTTGAAGAACAAGGGGGTGCAGATGCTCAACAGTGTCGAGTATCTGGGTATCGACGATGCCGGC
CTGCACATTCGTGTGGACGGCGGCGAGCCCCAGGTGCTGGCGGTGGATAACGTGGTGATCTGTGCCGGGCAAGAT
CCGCTGCGCGAGCTGCAGGAAGGGCTGGTGGCGGCGGGGCAGTCGGTGCACCTGATCGGCGGCGCGGATGTGGCG
GCCGAGCTGGATGCCAAGCGGGCGATCAACCAAGGCTCGCGGTTGGCGGCTGAGCTCTGAGGTTGTCGGGGCTGC
GTGAGCCCGACACCTGCACGCGTGGGAGCGGGCATGCCCGCGAAACAGGTGACGCGGTGGATGGCACCGGCATTG
CCGGTGTTCGCGGGTGAACCCGCTCCTACGACGGGCTGTGCCGGGGCATCGATGCCTGTGTCGAGCCACCCTGGC
ACTGTGATGCCTCGGCGGGGGCGGGTCATCGATTACAAGCGCTTGCGGGATTACCCTGTAAACTGCGATCCATG
Figura 9 Secuencia de la regin del amplicn conteniendo el gen fadH1.En rojo estn
sealados los sitios reconocidos por endonucleasas

51

El plsmido pGEM T-Easy fue digerido con la enzima de restriccin ApaI y el
fragmento de 2,6Kb fue purificado a partir del gel de agarosa despus de la
electroforesis. El vector pBBR1MCS-5 fue tambin digerido con la endonucleasa
ApaI . y enseguida ligado al fragmento previamente purificado utilizando utilizando
la enzima T4 DNA Ligasa. El producto de ligacin fue transferido por
transformacin para E. coli XL1-Blue Los clones transformantes fueron
seleccionados en cajas de Petri con agar LBGm, IPTG y X-Gal. Varias colonias
blancas fueron seleccionadas y fueron sembradas en una caja de Petri con agar
LBGm, IPTG y X-Gal utilizando palitos de madera. (Figura 10)

Figura 10. Cajas con LBGm, IPTG y X-Gal mostrando colonias transformadas posiblemente con
pBBR1MCS-5::fadH1
Se seleccionaron 10 colonias que presentaron un color blanco debido a que estas
colonias recombinantes no producen -galactosidasa, con lo cual no pueden
degradar X-Gal, por lo tanto no presentan coloracin azul. Se realiz extraccin de
ADN plasmdico de estas colonias. Posteriormente se realiz una digestin con
enzima de restriccin ApaI y seguido a esto una electroforesis en gel de agarosa
permiti ver que en los pozos 5,7 y 8, habian 2 bandas, una de 5Kb
aproximadamente, la cual corresponde al plsmido pBBR1MCS-5 y otra banda de
2,6 Kb, correspondiente al gen fadH1 (Figura 11)


52



Figura 11. Electroforesis en gel de agarosa. 1. 1Kb ladder; 2-11. ADN plasmidial digerido con ApaI
La figura 12 muestra electroforesis en gel de agarosa donde se resumen los
principales pasos de la clonacin del gen fadH1 en el vector pBBR1MCS-5. Las
corridas 2, 3 y 5 corresponden respectivamente al plsmido pGEM T-easy,
pBBR1MCS-5::fadH1 y pGEM::fadH1 digeridos con endonucleasa ApaI. Las
corridas 4 y 6 muestras los vectores pGEM::fadH1 y pBBR1MCS-5::fadH1.

Figura 12. Electroforesis en gel de agarosa. 1. 1Kb ladder; 2. pGEM; 3. pBBR1MCS-5::fadH1 digerido con
Apa1; 4. pGEM:fadH1; 5. pGEM::fadH1 digerido con ApaI ; 6. pBBR1MCS-5::fadH1

53

6.3 Complementacin de Pseudomonas putida IPT 046 y los mutantes deficientes
en crecimiento en cido 4-pentenoico con el gen fadH1.
Para la complementacin de P. putida IPT 046 y los mutantes, inculos de estos y de
E. coli S17-1:pBBR1MCS-5::fadH1 fueron sometidas a conjugacin en medio
mineral con glucosa como fuente de carbono y gentamicina, que es una marca de
resistencia del plsmido pBBR1MCS-5. Cada una de las cepas no podra crecer en
este medio, porque E. coli S17-1 no crece en medio mnimo con glucosa como
fuente de carbono y P. putida IPT 046 junto con los mutantes, no crece en medio
con gentamicina, por lo cual, en este medio de cultivo solo podran crecer bacterias
del gnero Pseudomonas que hubieran recibido el plsmido mediante conjugacin.
Despus de esto, las bacterias recombinantes fueron repicadas en un nuevo
MMGGm con el fin de aislar el clon recombinante y descartar cualquier interferencia
de las cepas utilizadas para la conjugacin. Luego de esto, colonias aisladas de cada
uno de los microorganismos fueron repicadas en MMGGm, MMV y MM4P, con el
objetivo de evaluar el crecimiento en cido graso insaturado. (Ver Tabla 8)
Tabla 8. Perfil de crecimiento de IPT 046 y los mutantes frente a las cepas complementadas con
pBBR::fadH1en MMGGm, MMV y MM4P
Sin plsmido pBBR1MCS-5::fadH1
MMGGm MMV MM4P MMGGm MMV MM4P
IPT 046 - +++ +++ +++ +++ +++
AG46 - ++ + ++ + -
AK1 - +++ + ++ ++ -
AM1 - - - ++ - -
BG45 - ++ + ++ + +
BJ5 - ++ - ++ - -
CF12 - ++ ++ ++ ++ +/-
CM29 - ++ + ++ ++ -
CM51 - ++ + ++ ++ +/-
CN25 - +++ ++ ++ ++ +
CR4 - ++ + ++ - +
DG45 - ++ + ++ - +
DM26 - ++ + ++ - +/-
DR52 - ++ ++ ++ + +
DU54 - ++ ++ ++ + +

54

DW4 - ++ + ++ + +/-
DX38 - ++ + ++ + +
EB50 - ++ + ++ + +

Esta tabla muestra una comparacin del crecimiento en MMGGm, MMV y MM4P
de P. putida IPT 046 y los mutantes cuando estn complementados con
pBBR1MCS-5::fadH1 y cuando no poseen el plsmido. En el caso de la cepa salvaje
y los mutantes sin complementar, no presentaron crecimiento en MMGGm, mientras
que las cepas que si poseen el plsmido con la resistencia a gentamicina crecieron
normalmente en este medio.
Cuando se cultivaron los microorganismos en MMV, estos presentaron un
crecimiento variable. AM1 y AM1::pBBR1MCS-5::fadH1 no mostraron ningn tipo
de crecimiento (ver Fig. 11), sugiriendo que la mutacin generada por la insercin
del transposon mini-Tn5 afect algn gen del metabolismo de los cidos grasos. En
el caso de IPT 046 y de los mutantes, presentaron un crecimiento acorde con los
resultados de SILVA-QUEIROZ en 2007. Los microorganismos conteniendo el
plsmido presentaron unos resultados, los cuales mostraron que la tasa de
crecimiento en MMV disminua o se inhiba, como en el caso de
AG46::pBBR1MCS-5::fadH1 y BJ5::pBBR1MCS-5::fadH1(Ver Fig.13),
BG45::pBBR1MCS-5::fadH1(Ver Fig.14), CR4::pBBR1MCS-5::fadH1,
DG45::pBBR1MCS-5::fadH1, DM26::pBBR1MCS-5::fadH1 (Ver Fig.15) y
DR52::pBBR1MCS-5::fadH1, DU54::pBBR1MCS-5::fadH1, DW4::pBBR1MCS-
5::fadH1, DX38::pBBR1MCS-5::fadH1, EB50::pBBR1MCS-5::fadH1 (Ver Fig. 16).
Estos resultados sugieren que de alguna manera, la presencia del plsmido altera el
metabolismo normal de cidos grasos, lo cual no se puede comprobar hasta realizar
una prueba, teniendo como control, estos microorganismos conteniendo el plsmido
pBBR1MCS-5.
La evaluacin de crecimiento en MM4P mostr que la cepa salvaje y la cepa salvaje
complementada con pBBR1MCS-5::fadH1 crecieron normalmente en este sustrato.

55

Algunos mutantes mostraron un crecimiento regular en MM4P, tal es el caso de
CN25 (Ver Fig.14) DR52 y DU54 (Ver Fig.16) mientras que otros mutantes
mostraron un crecimiento mnimo, como es el caso de AG46, AK1 (Ver Fig.13)
BG45, CF12, CM29, CM51 (Ver Fig.14) CR4, DG45, DM26 (Ver Fig.15) DW4,
DX38 y EB50 (Ver Fig.16). Dos mutantes (AM1 y BJ5) no mostraron ningn
crecimiento en este medio.
Los mutantes complementados con el gen fadH1 y cultivados en MM4P, mostraron
un crecimiento menor en comparacin a IPT 046::pBBR1MCS-5::fadH1, con
excepcin de las cepas AM1::pBBR1MCS-5::fadH1, BJ5::pBBR1MCS-5::fadH1 y
CM29::pBBR1MCS-5::fadH1, los cuales no presentaron crecimiento.

Figura 13. EVALUACIN DE CRECIMIENTO NO. 1. 1. IPT 046, 2. AG46, 3. AK1, 4. AM1, 5. BJ5, 6.
IPT 046::pBBR1MCS-5::fadH1, 7. AG46::pBBR1MCS-5::fadH1, 8. AK1::pBBR1MCS-5::fadH1, 9.
AM1::pBBR1MCS-5::fadH1, 10. BJ5::pBBR1MCS-5::fadH1

56


Figura 14.EVALUACIN DE CRECIMIENTO NO. 2. 1. IPT 046, 2. BG45, 3. CF12, 4. CM29, 5. CM51,
6. IPT 046::pBBR1MCS-5::fadH1, 7. BG45::pBBR1MCS-5::fadH1, 8. CF12::pBBR1MCS-5::fadH1, 9.
CM29::pBBR1MCS-5::fadH1 y 10. CM51::pBBR1MCS-5::fadH1

Figura 15. EVALUACIN DE CRECIMIENTO No. 3. 1. IPT 046, 2. CN25, 3. CR4, 4. DG45, 5. DM26,
6. IPT 046::pBBR1MCS-5::fadH1, 7. CN25::pBBR1MCS-5::fadH1, 8. CR4::pBBR1MCS-5::fadH1,
9.DG45::pBBR1MCS-5::fadH1, 10. DM26::pBBR1MCS-5::fadH1

Figura 16. EVALUACIN DE CRECIMIENTO No. 4 1.IPT 046, 2. DR52, 3.DU54, 4. DW4, 5. DX38, 6.
EB50, 7. IPT 046::pBBR1MCS-5::fadH1, 8. DR52::pBBR1MCS-5::fadH1, 9. DU54::pBBR1MCS-
5::fadH1, 10. DW4::pBBR1MCS-5::fadH1, 11. DX38::pBBR1MCS-5::fadH1, 12. EB50::pBBR1MCS-
5::fadH1.

57


Seguido de esto, el paso siguiente fue evaluar el crecimiento de los mutantes
complementados con el plsmido pBBR1MCS-5::fadH1 en MM4PGm, con el fin de
evidenciar una posible expresin de este gen. (Tabla 9) (Fig. 17) Una vez que sin la
presin selectiva del antibitico para mantener el plsmido en la clula, la no
complementacin de los mutantes podra resultar de la prdida del plsmido y no de
la incapacidad del gen fadH1 para complementar el mutante.
Tabla 9. Perfil de crecimiento de los mutantes recombinantes en MM4PGm
Microorganismo
recombinante
MM4PGm
AG46::pBBR1MCS-5::fadH1 +++
AK1::pBBR1MCS-5::fadH1 -
AM1::pBBR1MCS-5::fadH1 -
BJ5::pBBR1MCS-5::fadH1 -
BG45::pBBR1MCS-5::fadH1 +++
CF12::pBBR1MCS-5::fadH1 -
CM29::pBBR1MCS-5::fadH1 -
CM51::pBBR1MCS-5::fadH1 -
CN25::pBBR1MCS-5::fadH1 -
CR4::pBBR1MCS-5::fadH1 +++
DG45::pBBR1MCS-5::fadH1 +++
DM26::pBBR1MCS-5::fadH1 -
DR52::pBBR1MCS-5::fadH1 -
DU54::pBBR1MCS-5::fadH1 -
DW4::pBBR1MCS-5::fadH1 +++
DX38::pBBR1MCS-5::fadH1 -
EB50::pBBR1MCS-5::fadH1 -


58


Figura 17. Evaluacin de crecimiento de los mutantes complementados en MM4PGm.
1. AG46::pBBR1MCS-5::fadH1, 2. BG45::pBBR1MCS-5::fadH1, 3. CR4::pBBR1MCS-5::fadH1, 4.
DG45::pBBR1MCS-5::fadH1 y 5. DW4::pBBR1MCS-5::fadH1
Despus de 72 horas de incubacin, las cepas que presentaron un crecimiento mayor
fueron AG46::pBBR1MCS-5::fadH1, BG45::pBBR1MCS-5::fadH1,
CR4::pBBR1MCS-5::fadH1, DG45::pBBR1MCS-5::fadH1 y DW4::pBBR1MCS-
5::fadH1. Estos mutantes presentaban un crecimiento menor que IPT 046 cuando
eran cultivados en MM4P (SILVA-QUEIROZ, 2007).
A partir de estos resultados, se compar el crecimiento en MM4PGm de IPT
046::pBBR1MCS-5::fadH1 con los mutantes complementados que crecieron en
MM4PGm (Fig. 18 y 19).

Figura 18. Evaluacin de crecimiento entre IPT 046::pBBR1MCS-5::fadH1 y mutantes complementados
en MM4PGm. Cajas A y B. 1,3,5. IPT 046::pBBR1MCS-5::fadH1; 2. AG46::pBBR1MCS-5::fadH1; 4.
BG45::fadH1
A B

59


Figura 19. Evaluacin de crecimiento entre IPT 046::pBBR1MCS-5::fadH1 y mutantes complementados
en MM4PGm. Cajas A y B. 1,3,5. IPT 046::pBBR1MCS-5::fadH1; 2. CR4::pBBR1MCS-5::fadH1; 4.
DG45::pBBR1MCS-5::fadH1; 6. DW4::pBBR1MCS-5::fadH1
En estas cajas se observ que exista una tasa de crecimiento muy similar entre las
cepas recombinantes, resaltando que las colonias que estn en los extremos de las
cajas crecieron ms debido a la disponibilidad de sustrato. Por otro lado, las colonias
que se encuentran en el interior de la caja mostraron un crecimiento uniforme. Estos
resultados son compatibles con una mutacin en el gen fadH en estos mutantes, pues
el fenotipo salvaje es restablecido. Adems de eso, una vez que los mutantes
presentaron algn crecimiento en cido 4-pentenico, estn parcialmente afectados,
lo que sugiere la existencia de ms de un gen fadH en P. putida.
Por otro lado, no hubo crecimiento de los dems mutantes complementados en
MM4PGm. Esto sugiere que la mutacin generada por la insercin del transposon
mini-Tn5 afect otro gen del metabolismo de cidos grasos.
Inicialmente se crea que el gen fadH debera codificar para la enzima mas
importante en la metabolizacin de cidos grasos con insaturaciones extendindose
desde carbono par hacia impar y que, mutantes afectados en este gen, deberan
presentar una mayor incorporacin de 3HDd
6
. Entre tanto, el mutante BJ5,
present una mayor produccin de 3HDd
6
(Ver Tabla 6) pero no fue
complementado con el gen fadH1, lo cual sugiere la existencia de otros genes
involucrados especficamente en el metabolismo de estos cidos grasos.
A
B

60

7. CONCLUSIONES

Los ensayos de produccin de polmero de los mutantes de Pseudomonas
putida IPT 046, utilizando cido linolico (99% de pureza) como fuente de
carbono demostraron un mayor porcentaje de incorporacin de 3HDd
6
por
parte del mutante BJ5 demostrando que es posible alterar la incorporacin de
monmeros insaturados por mutaciones en genes relacionados con el
metabolismo de cidos grasos insaturados.
Los oligonucletidos diseados a partir del alineamiento de secuencias del
genoma de P. putida KT2440 para la amplificacin del gen fadH1 no son los
indicados para utilizarlos en P. putida IPT046 debido a que se encontraron
diferencias en las regiones adyacentes al gen de inters en varios genomas
que fueron evaluados.
Los mutantes afectados parcialmente en el crecimiento en cido 4-pentenico
que fueron complementados con el gen fadH1 sugieren la existencia de ms
de un gen fadH en P. putida. encargado de la reduccin de las insaturaciones
que se extienden de un carbono par hacia impar en los cidos grasos.
Los ensayos de produccin de polmero y de complementacin indican la
existencia de otros genes que pueden estar involucrados en el metabolismo de
cidos grasos insaturados, ya que los mutantes que presentaron mayor
incorporacin de monmeros insaturados no fueron complementados con el
gen fadH1.


61

8. REFERENCIAS BIBLIOGRFICAS

Almeida, A.; Ruiz, J.; Lopez, N.; Pettinari, J. 2004 Bioplsticos: uma
alternativa ecolgica. Revista QuimicaViva, n3, ao3, abril 2004,
http://www.quimicaviva.qb.fcen.uba.ar/v3n3/pettinari.pdf [Recurso
Electronico] [Consulta Agosto 2008]

Amara, A. A.; Rehm, B. H. A. 2003. Replacement of the catalytic
nucleophile Cys-296 by serine in class II polyhydroxyalkanoate synthase
from Pseudomonas aeruginosa - mediated synthesis of a new polyester:
Identification of catalytic residues. Biochem. J. 374, 413421

Anderson, A.J.; Dawes, E.A. 1990. Ocurrence, Metabolism, Metabolic Role,
and Industrial Uses of Bacterial Polihidroxyalkanoates. Microbiological
Reviews, v.54, n4, p.450-472,.

vila-Len, I. A. 2007. Determinacin del efecto producido por diferentes
tipos de aceites vegetales y combinaciones en la biosntesis y composicin
del polihidroxialcanoato producido por Pseudomonas putida IPT 046 y
Pseudomonas aeruginosa IPT 141. Trabajo de pregrado. Pontificia
Universidad Javeriana
Ballistreri, A.; Giuffrida, M.; Guglielmino, S.P.P.; Carnazza, S.V.; Ferreri,
A.; Impallomeni, G. 2001. Biosynthesis and structural characterization of
medium-chain-length poly(3-hydroxyalkanoates) produced by Pseudomonas
aeruginosa from fatty acids. International Journal of Biological
Macromolecules 29: 107-114
Bergey, D. 2005. Bergey's manual of determinative bacteriology. Ninth
edition. Lippincott Williams & Wilkins. p787.


62

Birnboim, H.C.; Doly, J. A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucleic Acids Research. v.7, p. 1513-1523,
1979.
Braunegg, G.; Sonnleitner, B.; Lafferty, R.M. 1978. A rapid gas
chromatographic method for the determination of Poly--hydroxybutyric
Acid in microbial biomass. European Journal of Applied Microbiology
and Biotechnology. 6: 29-37
Byrom, D. 1990 Industrial production of polymers from Alcaligenes
eutrophus. In: Novel biodegradable microbial polymers. Ed E.A. Dawes.
Dordrecht: Kluwer Academic Publishers,. P. 113-117

Chen G. Qiang. 2008. Recent Biodegradable Plastics Development In China.
International Centre for Science and High Technology.
http://www.ics.trieste.it/Portal/ActivityDocument.aspx?id=5397 [ Consulta:
16 Agosto 2008].

Chen, H.; Li, X. 2008. Effect of static magnetic field on synthesis of
polyhydroxyalkanoates from different short-chain fatty acids by activated
sludge. Bioresurce Technology 99: 55385544

DiRusso, C.C.; Black, P.N; Weimar, J.D. Molecular inroads into the
regulation and metabolism of fatty acids, lessons from bacteria. Prog. Lipid
Res., v. 38, p. 129-197, 1999.

Filipov, M.C.O. 2000. Obteno e caracterio de mutantes de Burkholderia
sp. IPT 101 deficientes na sntese ou no reconsumo de poli-3-hidroxibutirato
um plstico biodegradvel. Trabalho de Post-Grado. Maestra en
Biotecnologa. Interunidades en Biotecnologia USP IPT I. Butantan. So
Paulo, Brasil. 154pp


63

Gomez J.G. C. 2000. Produo por Pseudomonas sp de
polihidroxialcanoatos contendo monmeros de cadeia mdia a partir de
carboidratos: Avaliao da eficincia, modificao da composio e obteno
de mutantes. Tese (Doutorado) Instituto de Cincias Biomdicas,
Universidade de So Paulo, So Paulo, Brasil. 155 pag.

Galego, N., Rozsa, C., Snchez, R., Fung, J., Vzquez, A., Santo Toms, J.,
2000. Characterization and application of poly(-hydroxyalkanoates) family
as composite biomaterials. Polymering Testing. 19:485-492

Ha C-S, Cho W-J. 2002. Miscibility, properties, and biodegradability of
microbial polyester containing blends. Prog Polym Science. 27:759-809.

Haba, E., Vidal-Mas, J., Bassas, M., Espuny, M. J., Llorens, J., Manresa, A.
2007. Poly 3-(hidroxyalkanoates) produced from oily substrates by
Pseudomonas aeruginosa 47T2 (NCBIM 40044): Effect of nutrients and
incubation temperature on polymer composition. Biochemical Engineering
Journal. V35: 99-106

Kessler, B.; Palleroni, J. 2000. Taxonomic implications of synthesis of Poly-
-hydroxybutyrate and other Poly--hydroxyalkanoates by pseudomonads.
International Journal of Systematic and Evolutionary Microbiology 50:
711-713

Khanna, S., Sivrastava, A,. 2004. Recent advances in microbial
polyhydroxyalkanoates.Proccess Biochemistry. v 40: p607-619


64

Kim, Y.; Lenz, R. 2001. Polyesters from microorganism. En: SCHEPER, Th.
(Ed). Advances in Biochemical Engineering/Biotechnology. Vol 71.
Springer-Verlag. Berlin. p 52-74

Kovach, M.; Elzer, P.; Hill, S.; Robertson, G.; Farris, M.; Roop, M.;
Peterson, K. 1995. Four new derivatives of the broad-host-range cloning
vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene.
166. 175-176

Kranz R,G; Gabbert K,K.; Madigan M, T. 1997. Positive selection systems
for discovery of novel polyester biosynthesis genes based on fatty acid
detoxification. Appl Environ Microbiol 63:30103013

Kunau, W.; Dommes, V.; Sculz, H. 1995. -oxidation of fatty acids in
mitochondria, peroxisomes, and bacteria: a century of continued progress.
Prog. Lipid Res. Vol. 34, No. 4, pp. 267-342

Lee, S.Y. Plastic bacteria? Progress and prospects for polyhydroxyalkanoate
production in bacteria. Elsevier Science, v.14, 1996

Lee, E.Y.; Choi, C.Y. 1995. Gas chromatography-mass spectrometric
analysis and its application to a screening procedure for novel bacterial
polyhydroxyalkanoic acids containing long chain saturated and unsaturated
monomers. Journal of fermentation and bioengineering. 80,4: 408-414

Lemoigne, M. 1926.Products of dehydration and of polymerization of -
hydroxybutyric. Bull. Soc. Chem. Biol., v. 8, p. 770-782.

65

Luengo J. M, Garca B., Sandoval A, Naharroy G, Olivera E. L. 2003.
Bioplastics from microorganisms. Current Opinion in Microbiology,
6:251260.

Madison LL, Huisman GW. 1999. Metabolic engineering of poly(3-
hydroxyalkanoates): from DNA to plastic. Microbiol. Mol. Biol. Rev. 63:21-
53.

Martinez-Blanco, H., Reglero, A., Rodriquez-Aparacio, L. B. & Luengo, J.
M. 1990. Purification and biochemical characterisation of phenylacetyl-coA
ligase from Pseudomonas putida. A specific enzyme for the catabolism of
phenylacetic acid. J Biol Chem. 265, 7084-7090.

Mercado-Blanco, J., Bakker, P. 2007. Interactions between plants and
beneficial Pseudomonas spp.: exploiting bacterial traits for crop protection.
Antonie van Leeuwenhoek 92:367389.

Miambres, B., Martinez-Blanco, H., Olivera, E. R. 1996. Molecular cloning
and expression in different microbes of the DNA encoding Pseudomonas
putida U phenylacetyl-coA ligase. Use of this gene to improve the rate of
benzylpenicillin synthesis in Penicillium chrysogenum. J Biol Chem 52,
33531-33538.

Noda, I, Satkowski, MM, Dowrey, AE, Marcott, C.. 2004. Polymer allowys
of Nodax copolymers and poly(lactic acid). Macromol Bioscience. Mar 15;
v4, n3: 269-275

Nonato, R. V.; Mantelatto, P. E.; Rossell, C. E. V. 2001. Integrated
production of biodegradable plastic, sugar and ethanol. Applied
Microbiology Biotechnology, 57:1-5

66


Pramanik, A.; Pawar, S.; Antonian, E.; Schulz, H. 1978. Five Different
Enzymatic Activities Are Associated with the Multienzyme Complex of Fatty Acid
Oxidation from Escherichia coli. Journal of Bacteriology. Jan. p469-473

Poirier, Y.; Erard, N.; Pettot, J.M-C. 2001. Synthesis of
polyhydroxyalkanoate in the peroxisome of Saccharomyces cerevisiae by
using intermediates of fatty acid b-oxidation. Applied and Environmental
Microbiology, 67,11: 5254-5260.

Pouton, C.W.; Akhtar, S .1996. Biosynthetic polyhydroxyalkanoates and
their potential in drug delivery. Adv Drug Deliv Rev 18: 133162

Prieto, M.A.. 2007. From oil to bioplastics, a dream come true?. Journal of
bacteriology, v189, n2, p. 289-290,

R, M.I.; Rodrigues, M.F.A.; Silva, E.S.; Castro, I.M.; Simioni, A.R.;
Pelisson, M.M.M.; Neltrame, M.; Tedesco, A.C.2005. New PHB/PHPE
microspheres obtained from Burkholderia cepacia as biodegradable grug
delivery systems for photodynamic therapy. Minerva Biotecnologica. 18: 39

Rehm, B.H.A.; Steinbchel, A. Biochemical and genetic analysis of PHA
syntheses and other proteins required for PHA synthesis. Int. J. Biol.
Macromol., v. 25, p. 3-19, 1999.

Riis, V.; Mai, W. 1988.Gas chromatography determination of poly--
hydroxybutyrate acid in microbial acid in microbial biomas - esther
hydrochloric acid propanolisi. J. Chromatogr., v. 273, p. 285-289,


67

Snchez, R.J.; Schripsema, J.; Silva, L.F.; Taciro, M.K.; Pradella, J.G.C.;
Gomez, J.G.C. 2003. Medium-chain-length polyhydroxyalkanoic acids
(PHAmcl) produced by Pseudomonas putida IPT 046 from renewable
sources. European Polymer Journal 39: 1385-1394

Ramsay, B. A., Lomaliza, K. Chavarie, C. 1990. Production of poly--
hydroxybutyric-co- - hidroxyvaleric acids. Appl. Environ. Microbiol. 56:
2093- 2098.

Romero, C. 2006. Estudo da Biossntese de Poli-3-hidroxibutirato (P3HB) a
partir de leo de Soja. Trabajo de Pos-grado, Maestra en Biotecnologia.
Instituto de Cincias Biomdicas, Universidade de So Paulo, So Paulo,
Brasil, 111pp.

Sambrook, J.; Fritsh, E.F.; Maniatis, T. Molecular cloning: a laboratory
manual. New York: Cold Spring Harbor Laboratory Press, 1989.

Schulz, H.; Kunau, W.H. -oxidation of unsaturated fatty acids: a revised
pathway. Trends Biochem. Sci., v. 12, p. 403-406, 1987.

Shishatskaya, E. I.; Volova, T. G.; Popova T. G. 2002. Study of Biological
Properties of Polyhydroxyalkanoates in a Long-term Experiment in vivo.
Biomedical Engineering, Vol. 36, No. 4, pp. 218-222.

Silva-Queioz, S.R. 2007. Estudo do metabolismo de cidos graxos em
Pseudomonas putida visando modulao da composio monomrica de
elastmero biodegradvel. 98f. Tese (Doutorado) Instituto de Cincias
Biomdicas, Universidade de So Paulo, So Paulo, Brasil.


68

Simon, R.; Priefer, U.; Plher, A. 1983. A broad host range mobilization
system for in vivo genetic engineering: Transposon mutagenesis in gram
negative bacteria. Bio/Technology., v.1, p. 784-791.

Spiekermann, P.; Rehm, B. H. A.; Kalscheuer, R.; Baumeister, D.;
Steinbchel, A. 1999. A sensitive, viable-colony staining method using Nile
red for direct screening of bacteria that accumulate polyhydroxyalkanoic
acids and other lipid storage compounds. Arch Microbiol. 171: 73-80

Steinbchel, A. PHB and other Polyhydroxyalkanoic acids. In: Rehm HJ,
Reed G, Roehr M, editors. Products of primary metabolism. 2 ed. New York:
Willey: John & Sons; 1996. P. 405- 464

Steinbchel, A.; Valentin, H.E. Diversity of bacterial polyhydroxyalkanoic
acids. FEMS Microbiol. Lett., v. 128, p. 219-228, 1995.

Steinbchel, A.; Schegel, H.G. 1991. Physiology and molecular genetics of
poly (-hydroxyalkanoic acid) synthesis in Alcaligenes eutrophus. Mol
Microbiol. 5. P535-542

Steinbchel, A. 2001. Perspectives for Biotechnological Production and
Utilization of Biopolymers: Metabolic Engineering of Polyhydroxyalkanoate
Biosynthesis Pathways as a Successful Example. Macromolecular
Bioscience. Vol , 1-24.

Stryer, L. 1998. Bioqumica. Cuarta Edicin. Editorial Revert, S.A.
Barcelona. Pp: 606-610.


69

Sudesh K, Abe H, Doi Y. 2000.Synthesis, structure and properties of
polyhydroxyalkanoates: biological polyesters. Prog Polym Sci, 25:1503-
1555.

Takehiro, U., Yu-ichi, Y., Masanori, W., Ken, S., 2003. Stimulation of
prophyrin production by application of an external magnetic field to a
photosynthetic bacterium, rhodobacter sphaeroides. J. Biosci. Bioeng. 95 (4),
401404.

Tsuge, T. 2002.Review: Metabolic improvements and use of inexpensive
carbon sources in microbial production of polyhydroxyalkanoates. Journal
of Bioscience and Bioengineering, v. 94, n. 6, p. 579-584,

Vanzin, C.2008. Estudo da biossintese de Poli-3-/Hidroxibutirato-co-
Hidroxialcanoatos de cadeia mdia (P3HB-co-3HAmcl) a partir de cidos
graxos livres e leo vegetal. 167f. Tese (Doutorado) Instituto de Cincias
Biomdicas, Universidade de So Paulo, So Paulo, Brasil.

Zhi-Yong, L., Si-Yuan, G., Lin, L., Miao-Yan, C., 2007. Effects of
electromagnetic field on the batch cultivation and nutritional composition of
Spirulina platensis in an air-lift photobioreactor. Bioresour. Technol. 98,
700705.

Zinn, M.; Witholt, B.; Egli, T. 2001. Ocurrence, synthesis and medical
application of bacterial polyhydroxyalkanoate. Advance drug delivery
reviews. 53. 5-21



70

9. ANEXOS
ANEXO I. Esquema del plsmido pGEM T-Easy


ANEXO II. Esquema del plsmido pBBR1MSC-5