Electronic Journal of Biotechnology ISSN: 0717-3458 © 2008 by Pontificia Universidad Católica de Valparaíso -- Chile DOI: 10.

2225/vol11-issue3-fulltext-4

Vol.11 No.3, Issue of July 15, 2008 Received October 8, 2007 / Accepted January 25, 2008

RESEARCH ARTICLE

PCR-based sensitive detection of the edible fungus Boletus edulis from rDNA ITS sequences
Bin Lian*
State Key Laboratory of Environmental Geochemistry Institute of Geochemistry Chinese Academy of Sciences Guiyang, China Tel: 86 851 5895148 Fax: 86 851 5895148 E-mail: bin2368@vip.163.com

Jin-ping Zang
Jiangsu Key laboratory for Biodiversity and Biotechnology College of Life Sciences Nanjing Normal University Nanjing, China Tel: 86 25 85891067 Fax: 86 25 85891050 E-mail: zangjp@sina.com

Wei-guo Hou
State Key Laboratory of Environmental Geochemistry Institute of Geochemistry Chinese Academy of Sciences Guiyang, China Tel: 86 851 5895148 Fax: 86 851 5895148 E-mail: haital@126.com

Sheng Yuan
Jiangsu Key laboratory for Biodiversity and Biotechnology College of Life Sciences Nanjing Normal University Nanjing, China Tel: 86 25 85891067 Fax: 86 25 85891050 E-mail: shengyuan@email.njnu.edu.cn

Donald L. Smith
Department of Plant Science McGill University Macdonald Campus Quebec, Canada Tel: 1 514 398 7866 Fax: 1 514 398 7897 E-mail: Donald.Smith@McGill.Ca Financial support:The National Science Fund for Innovative Research Group (No. 40721002); Attracting Talents of Nanjing Normal University (No. 184070H2B39); Ministry of Science and Technology of China (No. 2006CB403200). Keywords: Boletus edulis, detection, edible fungi, internal transcribed spacer, PCR, specific primers. Abbreviations: AR-PCR: arbitrary primed PCR ITS: internal transcribed spacer NJ: neighbour-joining PCR: polymerase chain reaction RAPD: random amplified polymorphic DNA RFLP: restriction fragment length polymorphism

Identification of commercially important fungi, such as
*Corresponding author

the valuable edible fungus Boletus edulis can be difficult

This paper is available on line at http://www.ejbiotechnology.info/content/vol11/issue3/full/4/

Based on phylogenetic analysis of the rDNA ITS sequence. edulis with other basidiomycetes remains controversial in spite of its economic importance (Hibbett and Donoghue. Wilburn et al. 2005. 2006. 1987) has made the detection Figure.Lian. (2000) identified the fungus Aspergillus at species level and differentiated it from other true pathogenic and opportunistic molds using ITS 1 and ITS 2. but not from other fungal species at an annealing temperature of 60ºC. The primers were also successfully employed to identify various tissues of B. 2007). 2006). ectomycorrhizal fungi. B. 2006. and study of fungi increasingly feasible. Therefore. an advanced method needs to be developed for the identification of B. 2001). B. 1. 2 . The result indicated that B. and the results were used to assess the phylogenetic relationship between Boletus and other species. 2005. but also mobilizing mineral nutrients from rhizosphere soils (van Hees et al. On the other hand. Tsai et al. Fomina et al. 1999. edulis has attracted much attention. edulis and other mushroom. The internal transcribed spacer (ITS) region has generally been considered a convenient target for the molecular identification of fungi at species level (Sanchez-Ballesteros et al. edulis. a set of PCR primers specific for B. edulis was designed for establishing a convenient and accurate method of identifying this edible mushroom. Davoli and Weber. Urbanelli et al. Unfortunately. a pair of specific primers was designed for differentiating B. 2005. 2007). 2002. Phylogenetic relationships of Homobasidiomycetes inferred from ITS Sequences of 40 equally parsimonious trees. and also a medicinal fungus that has long been used as a Chinese traditional medicine in the treatment of various gastric digestive diseases. Wang and Lu. anti-tumour. Because of its delicious taste. allowing for earlier diagnosis and screening of effective antifungal agents for patients. 2007). including B. and there were no misidentifications under the reaction conditions used. traditional methods for identifying mushrooms are not reliable and are also problematic because most fungi in the mycelial phase are difficult to distinguish from each other using either morphological characteristics or organic/inorganic components. considering visual or metabolic approaches. In addition. PCR was performed with total DNA as a template at an annealing temperature between 56-60ºC. edulis from other mushrooms by PCR. Mello et al. biochemical and pharmacological properties all over the world (Tang and Lu. Kahle et al. 2007). edulis with all DNA templates from fruit bodies and cultured mycelium. rich nutrient value. 2001. To solve such problems. 2004. (2003) developed an effective detection method for wood-decaying fungi by hybridization of immobilized sequence-specific oligonucleotide probes with fluorescent-labeled PCRamplified fungal rDNA ITS sequences. correct identification of precious fungi is necessary. Manzi et al. 2001. a preliminary phylogenetic analysis of ITS sequences was performed. play an important role by not only promoting the growth of the plants. 2007. Wilson et al. the evolutionary history and relationships of B. 2002. The numbers represent bootstrap frequencies. molecular genetic markers have been employed for rapid identification of different kinds of mushrooms (Lee et al. 2006. 2006. With current advances in biotechnology. Furthermore. 2005. 2004. Moreau et al. et al. Henry et al. 2000). Positive amplicons were obtained from B. Boletus edulis is a valuable edible mushroom. edulis. In this study. and could help in delivering useful information for future genetic engineering or the cultivation and commercialization of this important species (Moor et al. edulis would be helpful in characterizing the novel genes and useful metabolites that could be provided by this fungus. Froslev et al. Leonardi et al. Iotti et al. The development of DNA-based PCR and taxon specific primers (Mullis and Faloona. Branches within a vertical line represent the same family. Peintner et al. resulting in an increasing number of studies on its physiological. as well as other possible medical values (Manzi et al. immunomodulatory and lipidlowering effects. Agueda et al. Oh et al. edulis could be clearly distinguished from other fungi by PCR. Accurate taxonomic identification and phylogenetic classification of B.

1990) for the region containing ITS1 and ITS2 and the 5. 1 µL dNTP Mix (10 mM each). Inc. followed by extraction with chloroform: isoamyl alcohol (24:1. USA). 1. PCR amplification and sequencing of the rDNA ITS region Amplification and sequencing of B. edulis can be obtained about 7 weeks later. edulis Volvariella volvacea Ganoderma lucidum Ganoderma sinense Aspergillus oryzae Aspergillus nidulans Source Yunnan Isolated from Yunnan Jiangsu Jiangsu Jiangsu Jiangsu Jiangsu Identification material Fruiting body Liquid shaken mycelia Liquid shaken mycelia Liquid shaken mycelia Liquid shaken mycelia Liquid shaken mycelia Liquid shaken mycelia MATERIALS AND METHODS Sample sources B. until pure mycelium covered the agar surface in the slant tube. KH2PO4 0.. Agar 18 g. 1 min at 72ºC. 0.8S rDNA. 1 min at 56-60ºC. A small tissue from the fresh section between the pileus and stipe was cut with a sterilized knife and placed into a slant of GlucosePeptone-Agar medium (Glucose 20 g. Nº 1 2 3 4 5 6 7 Strain B. China). About 100 mg fresh mushroom tissue or fungal mycelia (Table 1) were ground in 0. Phylogenetic analysis Sequence data from ribosomal ITS genes of Homobasidiomyetes were used to perform a preliminary phylogenetic analysis. 1979). 40 ITS sequences were obtained from Genbank-database (htpp://www. v/v) until the upper phase was clear.. The amplification was carried out in a PTC-100 thermocycler in a 50 µL reaction mixture containing 5 µL 10 x PCR buffer. pH 8.gov/) (Table 2). and the mixture was placed in a water bath at 65ºC for 10 min. and then sequenced directly with BigDyeTM on an ABIPRISM 310 automated DNA sequencer (PE Applied Biosystems Inco.7 mL 5% CTAB buffer (5% CTAB [w/v]. edulis(MH1) B. and 0. v/v). The B. Visualized spherical mycelia of B. 100 mM NaCl.000 rpm for 10 min. The tissue was incubated for 8 weeks at 26ºC. VB1 0. Amplified products were purified using a DNA purification kit (Shanghai Watson Bioengineering. Yunnan Province. 4 µL 25 mM MgCl2. 26ºC and 150 rpm. and those of other species. 4 µL template DNA.4 M NaCl) was added. edulis was performed using a pair of universal primers: ITS5 (5’~GGAAGTAAAAGTCGTAACAAGG~3’) and ITS4 (5’~TCCTCCGCTTA TTGATATGC~3’) (White et al. Genomic DNA was visualized in a Gel Documentation System LG 2020 (Hangzhou Langqi. Inco. China and were identified according to a previously published guide (Wei.nlm. The precipitate was washed with 70% ethanol and pure ethanol. 25 mM EDTA.5 mL microfuge tube. These species designations were based on 3 . which are growing much faster.PCR-based sensitive detection of the edible fungus Boletus edulis from rDNA ITS sequences Table 1. dried.ncbi. DNA extraction Total genomic DNA was extracted as described by Graham et al.0. The reaction mixtures were denatured at 94ºC for 5 min and subjected to 30 cycles of 1 min at 94ºC. edulis fruit bodies (MH1) were collected from Kunming. and they were also employed as a positive control in subsequent diagnostic PCR. The upper phase was then transferred to a new tube and DNA was precipitated with an equal volume of isopropanol. The specimens were placed in the collection of Nanjing Normal University.0. MgSO4 0.5 g. China.5 g.5% Sodium dodecyl sulfate) and transferred into a 1. can be obtained within a week. 1 µL 20 µM each primer.05 mg. edulis isolate and other fungal species were fostered in 100 mL sterilized liquid Glucose-Peptone-Agar (agar free) medium. and 0. After incubation at 65ºC for 1 hr. peptone 2 g.8 mL lysis buffer (200 mM Tris-HCl. China) according to the manufacturer’s instructions. K2HPO4 1 g..nih. and H2O 1000 mL). The solution was extracted with an equal volume of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1. Table 1 lists 7 samples of 6 species used in this study. and then centrifuged at 12. and a final extension step of 10 min at 72ºC. (1994). 100 mM Tris-HCl pH 8.25 µL Taq DNA polymerase (5U/µL). and re-suspended in 50 µL sterile water. Species used for identification assay.

The primer pairs were tested for sensitivity with total genomic DNA from 7 samples of fungi (Table 1) in PCR and a DNA fragment (approximately 300 bp) from the rDNA ITS gene was amplified. A pair of primers. PCR amplification of ITS gene region at different annealing temperatures. The genus of Boletus lineage could be identified from the tree.nlm. Diagnostic PCR was performed under the conditions mentioned above. N: Negative control without DNA template. Phylogenetic analysis of the aligned sequences was performed by Neighbor-Joining (NJ) analysis. was designed for PCR detection of authentic species of B. Bootstrapping was performed with NJ analysis using 1000 replicates. The phylogenetic tree was generated from 40 aligned sequences (Table 2) of Homobasidiomycetes (Figure 1). in which gaps were treated as missing data (Jeanmougin et al.0) Kimura2-Parameter Distance model. using the MEGA (2. edulis. M: DNA marker (DL-2000 ). (a) Positive control annealing at 56ºC with the primers ITS4 and ITS5. Phylloporus and Chalciporus genera all belong to the family Boletaceae and maybe share a very close phylogenetic distance. 1997. and Chalciporus piperatus appearing within the Boletus lineage (indicated in the bottom of the tree). Primer design Based on the results of the phylogenetic analyses. However. edulis ITS sequence to identify the fungal species. The closely related rDNA ITS sequences were retrieved from the DNA database using the BLAST program (htpp://www.Lian. 58ºC and 60ºC respectively with the primers BE-1 and BE-2. 4 . 2002). (d) Annealing at 56ºC. The numeric codes are concordant with those in Table 1. Hibbett and Binder. B.gov/blast/) to verify the specificity of the primer pairs.ncbi. Figure 2.nih. (b). BE1 and BE2. We comprehend the situation for that the Boletus. 1998). et al. RESULTS Sequencing and phylogenetic analysis A 698 bp fragment of the r-DNA ITS region was amplified and sequenced. we investigated ITS sequences of the Boleteae family and of other species (Table 3). and it was feasible to design a pair of specific primers within B. the results were submitted to gene bank databases (Accession number: DQ352861). (c). it is also shown that there are great genetic variations within the Boletus genus according to phylogenetic distances based on ITS sequences. morphological species concepts or referred to previous reports (Hibbett et al. in spite of a low frequency value and other species such as Phylloporus sp.

nidulans (Figure 2b). but a weak signal was obtained in the case of G. Species of Homobasidiomyetes used for phylogenetic analysis of Boletus. All the samples gave amplicons with sizes between 600 bp and 700 bp with the primer pairs of ITS5 and ITS4 (Figure 2a). aestivalis from Italy shared 95% (20/21) identity with BE2. edulis isolate as well as from tissues of B. China shared 100% identity with the primer BE2 and an isolate of B. aestivalis (from Italy) shared 100% identity with the primer BE1. aereus and B. the false results may be eliminated by a higher annealing temperature during diagnostic PCR. Species specific PCR primers design The primers were designed on the basis of phylogenetic analysis. When 5 . edulis fruiting body. A. oryzae and A.PCR-based sensitive detection of the edible fungus Boletus edulis from rDNA ITS sequences Table 2. only the sequence of B. and then six fungal species were chosen to test them. and B. sinense. edulis (from China and Switzerland). However. The sequences of the specific primer pairs were BE1 (5’~CATTATCGAGTTAGACCGGGAAG~3’) and BE2 (5’~CCATGCCCTCGAGATCAGA TC~3’). With the specific primers BE1 and BE2 and a chosen annealing temperature of 56ºC. respectively. a DNA fragment with a size of about 300 bp was clearly amplified from total DNA from the B. The selected ITS amplicon for specific primers ranged from bp 4 ~ 26. and from bp 334 ~ 354. edulis from Yunnan. The primer-blast results showed that partial sequences of the ITS of the isolates B.

Although they have been proven to be efficient in taxonomic identification and in distinguishing genuine crude drugs from their substitutes or adulterants in previous reports. B. the relatively high expense of DNA sequencing and the sensitivity of contamination in the PCR reaction using universal primers obstructs its wide acceptance in quality control of medicinal materials (Wang et al. oryzae (Figure 2c). Molecular technology can greatly enhance detection sensitivity. In regards to the PCR-RFLP method. arbitrary primed PCR (AR-PCR). edulis. Consequently. Therefore. being sold fraudulently for high profit. edulis. Once the annealing temperature was set to 60ºC. we were able to eliminate the negative signals of G. 2007. the application of these methods is limited by the high cost of the fine quality template DNA that is required in these experiments. nidulans other than A. PCR-RFLP and DNA sequencing. and no PCR product was obtained for other fungi (Figure 2d). and slight fluctuations of reacting components or cycling parameters. 2000). as well as simplify and expedite the identification of fungi. Several methods. G. This study presents an efficient method for identifying economically important fungi on species level. DISCUSSION With increasing demand for edible and medicinal fungal materials. including random amplified polymorphic DNA (RAPD).Lian. The reproducibility of RAPD analysis is heavily affected by the quality and concentration of the template DNA. we designed a pair of specific primers that exactly match a specific DNA sequence of B. Species of B. Tricboloma mutsutake and Cordyceps sinensis. Based on the target DNA sequence analysis of those high-value species of medicinal mushrooms. as the number of restriction enzyme sites is limited in DNA segments between two primers. Nº 1 2 3 4 5 6 7 8 9 10 11 12 13 Classification Boletus edulis Agaricus campestris Flammulina velutipes Pleurotus ostreatus Volvariella volvacea Ganoderma lucidum Clavicorona pyxidata Heterobasidion annosum Echinadontium tsugicola Boletus satanas Boletus pallidus Boletus caespitosus Boletus dryophilus Length (bp) 759 566 802 537 728 600 640 547 532 844 754 879 843 Accession number AY278769 AJ133389 AB064957 AF423120 U15973 AF079584 AF336139 AF289929 AF218398 DQ534567 DQ534564 DQ534638 AY185183 the annealing temperature was increased to 58ºC. Lakra et al. becomes more severe. Although sequence analysis of PCR products is quite precise and stable. the shortage of Chinese edible and medicinal wild fungi. sinsense and A. the ratio of template to primer. lucidum. et al. Identification of those high-quality fungal species is not only necessary but has great economic significance as it will allow product distributors to verify the material they are selling. adulterants or substitutes for those precious fungi begin to appear in the market of some areas. 2007). the amplified DNA band only appeared for B. and incompletely match with the sequence of other species. edulisand some other fungi used for primer design. a high-stringency 6 . the length of PCR products also confines its utilization. Taylor and Ford. Table 3. such as B. have recently been used for the authentication of biological materials (Lotufo et al. restriction fragment length polymorphism (RFLP). 1994. edulis.

S. no. 16.. D. Mycologia. no. 38. M. RUBINI. 50. p. Morphological and molecular characterisation of mycelia of ectomycorrhizal fungi in pure culture.. MAYER. D. A. 403-405. 2. 359-363. p. HIBBETT. E. vol.S. KAHLE. 51-68.C.. Oral Microbiology and Immunology. p. January 1994. CHANG.H. J. K. 1.and intra-specific variability in the main species of Boletus edulis complex by ITS analysis. 52. 583. 1-2. Identification of medicinal mushroom species based on nuclear large subunit rDNA sequences. no. J. February 2005.PCR-based sensitive detection of the edible fungus Boletus edulis from rDNA ITS sequences PCR reaction with primers specific for B.. 23. vol..M. 2001.. vol. 9. HIGGINS. M. CHO.. IWEN. R. D. S. Simple method for reversed-phase high-performance liquid chromatographic analysis of fungal pigments in fruit-bodies of Boletales (Fungi).D. Agaricales) in Europe. FLYNN. FROSLEV. 7 .. PARLADE. P. 6. vol. A simplified method for the preparation of fungal genomic DNA for PCR and RAPD analysis. 269. ranges in March-April Evolution of complex homobasidiomycetes. BARBIERI.M.. and ZAMBONELLI. and BINDER. 154-160. DAVOLI. This method will aid in the quality control of identification of other economical materials and species. and HENRY. and BOELCKE. Microbial Ecology. LAESSOE. J. LAL. 44. and substrate homobasidiomycetes. vol.. I. Biotechniques. LEE. W. and PUNIA. T. fruiting-body morphologies in Proceedings of the Royal Society Biological Sciences.J. October 1998.S. V. vol. vol. JEPPESEN. the ITS sequences from Boleteae family and other species were aligned. especially in the inspection of Chinese B. and GIBSON.M. LANGER. G..S. K. no. HIBBETT. and the results were used to design a pair of specific primers (BE-1 and BE-2) only for Boletus edulis. 322-333. HENRY. Molecular Phylogenetics and Evolution. July 26 2002.. M. Effect of afforestation on soil properties and mycorrhizal formation. Systematic Biology. p. 1963-1969. character correlations among wood decay mating systems. no.H. To probe into the evolutionary history of the genus Boletus and its relationship with other basidiomycetes. G. STOCCHI.. vol. no.C. 98. Evolution of gilled mushrooms and puffballs inferred from ribosomal DNA sequences. R. PINE. 1. GOUY. GOSWAMI. REFERENCES AGUEDA. p. p.. 4. LEONARDI.. p. V. 48-50. their evolutionary relationships could provide an important clue for further exploration of the active compounds. B. Journal of Microbiology.. Hydrobiologia. M. 411-416. E. Journal of Clinical Microbiology. June 2005. CHO. vol. p. M. 129-135. J.G. GRAHAM.. vol. R. and GADD. Multiple sequence alignment with Clustal x. Fungal Diversity. we established a phylogenetic tree for Boletus and some strains related at the order and family levels in the Homobasidiomycetes.J. S. edulis. June 1994.. G. and KJOLLER. Molecular identification of five Indian sciaenids (pisces: perciformes.K. vol. M. p.F. C. 1510-1515.. no. p. and HINRICHS. LOTUFO. edulis for the design of detection PCR primers because it is abundant in China. October 1997. HIBBETT. Furthermore. 44.G. p. June 2007. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2.J. S. B. 1. D.. sciaenidae) using RAPD markers. Based on this phylogenetic tree.. 10. ALEXANDER.M. February 2006. July 2007. and SLOTS. but not for other fungi. January-February 2006. T. FEMS Microbiology Letters. C. M.M. G. 2. P. edulis export in big batch. HILLIER. SIMONINI. 964. April 2000. F. no.. LAKRA. p.W. Molecular-detection of bacteroides-forsythus in human periodontitis. In conclusion. LANGER. A. 19. edulis gave a positive signal only for genuine species of B. R. DE MIGUEL. 1. 215-242...J. F. JEANMOUGIN. F. E. Furthermore. Pedosphere. 1504. D. vol. LIM.O. FOMINA. p. no. the process of identification by PCR is very simple and convenient to use. Proceedings of the National Academy of Sciences of the United States of America. 243. 94. Analysis of mechanisms. M.. We choose B. p. Trends in Biochemical Sciences. Zinc phosphate transformations by the Paxillus involutus/pine ectomycorrhizal association. CHEN. P. 2. vol. 12002-12006. August 2006. and DONOGHUE. 15. no. and WEBER. IOTTI.S.. G. THOMPSON. J. A.J. and MARTINEZ-PENA. MOHINDRA..S.S. PAOLOCCI. T. no. p. 3... no. and DONOGHUE. p. P. Molecular phylogenetics and delimitation of species in Cortinarius section Calochroi (Basidiomycota. 22. BAUM. M. 754-760. T. of London Series Bvol. specific detection PCR is a timeand cost-effective method for the authentication of edible and medicinal mushrooms. 23-30. vol. CHARNOCK. T. and NAM. October 2002.. an accurate and practical phylogenetic analysis establishes a theoretical foundation for defining a classified status of new edible or medicinal fungi. no.H. and PACIONI. December 2005. 217-227. 29-34. In addition. and to prepare for the specific primer design.Y. P. J. Characterization and identification of field ectomycorrhizae of Boletus edulis and Cistus ladanifer. Journal of Chromatography A. Assessment of inter.Y. no. J. vol.

J. 315-322..Y. Applied Spectroscopy. vol. eds..X. F. 1979. WANG. 335-350. MOREAU.. X. 346-352. SeptemberOctober 2000. 9. SANCHEZ-BALLESTEROS. 55.P. 3. 24. p. and morphological methods. M. ITS primers for the identification of marketable boletes. California: Academic Press. G. L. vol.S. WHITE. no. 1. J. PEINTNER.. April 2002. S. no. 1987.. Supported by UNESCO / MIRCEN network. and FALOONA. V..C. O. and MAU. no.. Phylogenetic study of Hypoxylon and related genera based on ribosomal ITS sequences.. SOMAN. Y. GONZALEZ. and ZAMBONELLI.. J. Soil fungal communities in a Castanea sativa (chestnut) forest producing large quantities of Boletus edulis sensu lato (porcini): where is the mycelium of porcini? Environmental Microbiology. H. D. 3. PORRETTA.J. vol. G.. vol. March 2006. October 2004. September 2007. Journal of Southwest China Normal University (Natural Sciences).. 5.B.W. Cortinariaceae) based on rDNA sequences with special emphasis on host specificity and morphological characters. S. F. April 2007. AGUZZI. 23. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex. WILSON. Z. 880-889. 101-111. SALAZAR. 340-345. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.. and HIBBETT. Zaocys. and WHITE. iron and silicon by Picea abies and ectomycorrhizas in a forest soil. 155. KLOTZ. 4. D. 794-807. 2007. and PELAEZ.Q. 214. U. WANG. K. A. p. A. Polymerase chain reaction (PCR) for the detection of king bolete (Boletus edulis) and slippery jack (Suillus luteus) in food samples. SNINSKY. no. A. ACCC 50328. Holzforschung.Y.D. W. Molecular Phylogenetics and Evolution. V. 74. March 2007. vol. VAN HEES. no. RUIU. 1. and FORD. D. p. 385-393..A. 4. no. p. P. E. et al.A.. vol.J. 318-329. no.H. Shanghai. p. BONUSO. 6. 321-325.A. Speciation of selenium in the mushroom Boletus edulis by high-performance liquid chromatography coupled to inductively coupled plasma-mass spectrometry with a collision cell. K.. TAYLOR. A.C. T. p.T. U.. JONES.. August 1999. 478-481.. Diagnostics. TSAI. M. MANZI.A. p. TSAI. DONG. May 2000. 8 . p. vol.. RUBIO. S. Canadian Journal of Botany-Revue Canadienne de Botanique. vol.. Authentication of an animal crude drug. Y.. MULLIS.W. 8. Applied Microbiology and Biotechnology.. PCR Protocols: A Guide to Methods and Applications San Diego. p. S. p.. and LU. ZHOU. European Journal of Soil Science. 3-4. GELFAND. May 2001. Mycologia. BILLS. p. ACERO. J. R. JULIAN. 1043-1051. 40. and PIZZOFERRATO. vol. Note: Electronic Journal of Biotechnology is not responsible if on-line references cited on manuscripts are not available any more after the date of publication. K. 592-600. D.P. VIZZINI. PLATAS. A.. Shanghai Scientific and Technological Press. PUNELLI. T. 780. Nutritional value of mushrooms widely consumed in Italy. MOOR. Study of the biological activity and the antitumor activity against sarcoma-180 of Boletus edulis.. Biological & Pharmaceutical Bulletin. W. 58. F.L. Detection and species identification of wood-decaying fungi by hybridization of immobilized sequence-specific oligonucleotide probes with PCR-amplified fungal ribosomal DNA internal transcribed spacers. HOBBIE.H. P. vol. Antioxidant properties of Agaricus blazei.. no. J. 4. March 2004. NICHOLAS. M. Journal of Biotechnology.. and GARDES. WILBURN. February 2006. 119. PORTAL. BRUNS.T. B. 1392-1402. and CARUSO. T. Mobilization of aluminium. P.W. J. no.. REVERBERI. no. KEATHLEY. Fungi identification manual (in Chinese). IOTTI. no. p. URBANELLI. A. 1990. J. Process Biochemistry. 3. and Boletus edulis.K. DELLA ROSA. POLISHOOK. K. and BONFANTE. M.A. p. Food Chemistry. no. PEINTNER. 38. vol. Methods in Enzymology. European Journal of Plant Pathology. R..A. genetic diversity and pathogenic variation of ascochyta blight of cool season food and feed legumes.L.J. The ectomycorrhizal status of Calostoma cinnabarinum determined using isotopic.S. Lwt-Food Science and Technology. S. FABBRI. no. March 2005. D. p. P. Phylogeny of the ectomycorrhizal mushroom genus Alnicola (Basidiomycota. E. S. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. 57. In: INNS. p. P.. MELLO. P. WEI. vol. G. KAMDEM. J.J. LEE. 585-588. 5. 73..Lian. molecular. p. 1251-1255. no. C. MOCHALES. V. European Food Research and Technology. L. by diagnostic PCR. and LU.. Agrocybe cylindracea. TANG. p. 121. and HAN.X. A. JENTSCHKE. A. A. no.A.. vol. and TSIM. 127133. D.. 40.. vol. M. vol. vol.. GHIGNONE. 4. P. 3.. D. SECHI. 10. and GODBOLD. OH.F. Optimization of processing parameters for the mycelial growth and extracellular polysaccharide production by Boletus spp. 92. XU. G. Vonderheide....L. 85. C. p. and FANELLI. R.E. vol. P.S. and TAYLOR. 2003. M. 964-977. April 2007. and EUGSTER. no.L. BRODMANN. p. D.X. T.