You are on page 1of 55

PROJECT REPORT

Candidate Number: 100754 MSc Control of Infectious Diseases

Title: Whatdrivessilvatictrypanosomediversification?

Insightsfromthemolecularepidemiologyofthe TrypanosomaCruziinBolivia

Supervisor: Martin Llewellyn

Word Count: 7,912 Project Length: Standard


Submitted in part fulfilment of the requirements for the degree of MSc in Control of Infectious Diseases

For Academic Year 2010-2011


1

ABSTRACT Trypanosoma cruzi, the agent of Chagas disease remains an important public health issue in Latin America. Theparasiteisgeneticallyhighlygeneticallydiverseandtheunderstandingofits molecular epidemiology is crucial in guiding control programmes. The kinetoplastid is divided in 6 DTUs (TcI TcVI)butthecurrentsubdivisionisunlikelytoreflectthegeneticdiversitythroughoutthecontinent. Ecologicalhostfittingisthoughttodriveparasitediversificationandthisstudyexplorethemolecular epidemiology of TcI (n=128) and TcIII (n=18) in the light of vectors, hosts and ecology within differentBolivianbiomes. ThestudyfirstascertainedthecorrectT.cruzigenotypesusingPCRRFLPtechnique.Then,apanelof 27 microsatellites markers allowed the construction of a neighbour joining (NJ) tree, based on individual pairwise distance comparisons. The latter enabled the identification of deep internal branching within TcIII and lowland TcI genotypes reflecting stable long term population structures. TcIII appeared in terrestrial ecotopes principally within mammals but was sporadically present in Triatomainfestansindicatingevidenceofreemergencefromsilvaticenvironment. TcI was silvatic, present in arboreal and terrestrial biomes in various hosts and vectors. Population genetics analyses of the DTU confirmed population subdivisions observed in the NJ tree between high/lowland Bolivia: FST>0.183 and strong isolation by distance (IBD) correlation (Rxy = 0.418, p<0.001). In the lowland of Bolivia, parasite subpopulations were highly genetically divers. Lowland populations found in arboreal ecotopes displayed increased homozygosity (He>Ho), corroborated withsignificantpositiveFISvalues(FIS>0.241). Highland populations were present in terrestrial niches and displayed low genetic diversity with an inbreedingcoefficientclosetoHWallelefrequencies(FIS=0).IntensegeneflowrevealedbysmallFST values (FST <0.055) disclosed the intense mixing within this ecoregion and the possible human association with parasite dispersal. The low diversity and the excess heterozygosity (Ho>He) of highlandparasitescouldbetheresultofapasthybridizationfollowedbyclonalpropagation.

Contents

Pages


5 5 7 8 9 10 11 11 11 12 14 14 14 15 16 16 17 18 18 18 20 20 20 21 22 23 25 27 27

IINTRODUCTION
1.1Chagasdisease

1.2TrypanosomacruziMolecularEpidemiology 1.3EcologicalHostFitting

1.4PotentialofMultilocusMicrosatelliteTyping(MLMT)tounravelT.cruzidiversity Aim&Objectives

IIMATERIALSANDMETHODS
2.1Samples

2.1.1BolivianEcotopes

2.1.2Sampledistributionoverthedifferentecoregions

2.2PCRRFLPproceduresfortheidentificationofT.cruzigenotypes
2.2.1PCRreactions

2.2.2RestrictionFragmentLengthPolyphormism(RFLP)procedures 2.2.3Visualization

2.3MicrosatellitesanalysesofTCIandTCIIIDTUs
2.3.1PCRamplificationofmicrosatelliteloci 2.3.2Analyses

IIIRESULTS

3.1PCRRFLPanalyses

3.2MicrosatelliteAmplification

3.3Individualpairwisedistancecomparisons
3.3.1TcIIIpairwisegeneticdistance 3.3.2TcIpairwisegeneticdistances 3.3.3Heterozygosityindices 3.3.4Geneticdiversity

3.4PopulationsubdivisionFSTandFIS

3.5Isolationbydistance(IBD)geographicaldispersalinpopulations IVDISCUSSION

4.1PCRRFLPtodifferentiateT.cruzigenotypes

42MLMTasatoolforT.cruzipopulationstructureanalyses 4.3TheroleofbiomesinthediversificationofT.cruzi
4.3.1TcI,ecotopes,hostsandvectors 4.3.2TcII,hostsandvectors

27 28 28 29 29 30 31 33 34 35

4.3.3AnexplanationforthenichespecificitybetweenTcIIIandTcI

4.4MolecularepidemiologyofTcI

4.5Consequencesonpopulationstructures 4.6LimitationsandFutureWork VCONCLUSION

References

Acknowledgements AnnexeA CAREFORM EthicsApproval

IINTRODUCTION
1.1Chagasdisease
The causative agent of Chagas disease is the singlecell vectorborne kinetoplastid, Trypanosoma cruzi. The protozoan possesses a complex life cycle and is widely distributed throughout Latin America. After the extensive control efforts of the Southern Cone Initiative, created in 1991, the prevalence of the infection declined from around 18 to 9.8 million infected people with over 60 millionremainingatriskofinfection(Cmara2010). T. cruzi is transmitted to human mainly through infected faeces of hematophagus triatomine bugs (Reduviidae) but the transmission can also occur congenitally, through contaminated blood transfusion and in some cases orally. The parasite circulates in silvatic, peridomestic and domestic environments; its transmission cycle is associated with both wild and domestic animals, vectors and humans (Garcia 2007). The parasite is thought to be able to infect over 130 invertebrate Reduviidae vectorsandmorethan100mammalianspecies(Fernandes1999). The clinical form of Chagas disease is highly variable. The acute phase of the infection is associated with high parasitaemia but present unspecific or mild symptoms. In less than 7% of cases, the acute form of the disease is fatal due to cardiac or neurological complications. The chronic phase can last for years and is asymptomatic. About a third of infected patient will, at term, develop severe cardiovascularorgastrointestinalproblems(Macedo2004). ThesouthernConeInitiativesucceededtoeliminatedthevectorTriatomainfestansfromUruguayin 1997 and Brazil in 2006, but the infection rate in Bolivia remains one of the highest in Latin America withbetween1.1and1.8millionpeoplecurrentlylivingwiththeparasite(MedranoMercado2008). Chagas disease has a long historical association with Bolivia, where about 55% of the territory is endemic and approximately 3.5 million people are at risk. Bolivia is ranked as the poorest country in South America by the International Monetary Fund (Mosley 2001) and thus have limited resources to implement control measures. Vector control and transfusion screenings only started in 2000. Bolivia has the highest prevalence in South America (6.75%) and seroprevalence can reach 42% in someruralareas(Weiss2011).

1.2TrypanosomacruziMolecularEpidemiology
The epidemiology of T. cruzi is complex. In view of the parasite distribution throughout South America,thenomenclatureofthetaxonhasrecentlybeenrevisedduringasymposiumheldinBrazil

(Zingales 2009). TcITcVI replaced the previous 6 Discrete Typing Units (DTUs: TcITcIIae) to allow a better understanding of the intraspecific genetic variation of the parasite. The intraspecific variability of the natural subpopulation of T. cruzi has been longterm established. In 1977, Miles et al. have first demonstrated using biochemical methods the heterogeneity and the complexity of the Americantrypanosome(Miles1977). The divergence between Trypanosoma. cruzi and T. brucei is evaluated at 100 million year ago (MYA), in the midcretaceous during the separation of the former South America from Africa (Stevens 1998). Historically, among the different DTUs, TcI and TcII are the most divergent groups. Their common ancestor is estimated at 3 to 10 million years, based on molecular techniques (Machado 2001). TcI is thought to have coevolved mainly with arboreal mammals in a silvatic transmission cycle (Yeo 2005). The parasite has a capacity for genetic exchange but it appears to be distinctprocessthanthatdescribedinTrypanosomabrucei(Gibson1999;Gaunt2003).Accordingto Westernberger et al. (2005), the two ancestral lineages, TcI and TcII, have arisen as aresult of a first hybridization event between these two ancestral lineages, the common ancestor of TcIII and TcIV has been formed (Figure 1). A nonmeiotic hybridization event involves the fusion of the two parental nuclei in their diploid form to produce polyploidy progeny. The latter undergoes allelic recombination and finally return to a diploid state (Sturm 2010). This genetic exchange mechanism hasbeenobservedinfungalpathogen(Legrand2008).Thepopulationstructureofthetaxonreveals a second hybridization between TcII and TcIII, which is probably at the origin of the DTUs TcV and TcVI(Hamilton2007). The revision of the former DTU II into TcIIVI had significant epidemiological implications on the understanding of disease transmission. For example, TcV and TcVI appeared to have a strong association with human (Llewellyn 2011). T. cruzi I has been previously neglected. The genotype predominates in the north of the continent and is present throughout South America. However it waspreviouslythoughttobeassociatedwithlessseverehumanformofclinicaldiseasecomparedto the DTUs TcII, TcV and TcVI, which are mostly present in southern countries (Miles 2009). More focussed attention has recently been paid to TcI as the relationship between this widespread genotype and severe cardiomyopathy manifestations had been revealed (Burgos 2010; Ramrez 2010).TcIdisplaysahighgeneticdiversitybutlittleisknownonitsepidemiologicalimplications.

Figure1:EvolutionofTrypanosomacruzifromthecommonancetortothesixcurent DTUsadaptedfrom(Westernberger2005)

1.3EcologicalHostFitting
The different lineages of T. cruzi are widely spread throughout Latin America. The different sub populations are present in various biomes and are influenced by multiple ecological constraints. T. cruzi genetic diversity has suggested that parasite lineages have an evolutionary relationship with their vectors and their reservoirs hosts but also with their environments (Yeo 2005). Cospeciation of trypanosomes with their hosts or vectors is rare, thus it is recently believed that an ecological host fitting drives parasite diversification (Hamilton 2007; Llewellyn 2009) . Parasite clades are thought to be associated with ecological niches with the respective hosts and vectors which populatethepreciseecotopes. Triatomine bugs have a long evolutionary history and the vector species are strongly adapted to particular biomes. Molecular phylogeny of Triatoma and Rhodnius genus estimated their divergence

between4864MYA(Gaunt2000).PanstrongylusgeniculausandTriatomarubrovariaareassociated withterrestrialniches,whererodentburrowsarepresent.Thetwogeneraarealsostronglylinkedto Dasypus sp. armadillos (Llewellyn 2009). Rhodnius species are primarily associated with arboreal palms tree habitats and with Didelphimorpha (opossum) species. According to ecogeographical hypotheses, armadillos and opossums may have carried T. cruzi to North America 1 to 2 MYA, through the Pleistocene bridge (Marcili 2009). Another element potentially in favour of ecological host fitting is the distribution of the clinical form and morbidity of the disease. Macedo et al. (2004) have reported that the digestive complications of Chagas disease was almost absent of Venezuela and Central America, whereas megacolon is common in Chile and Central Brazil. The group also affirms that these geographic variations cannot be explained by genetic differences in human populationsandthusfitsinacontextofenvironmentalandhostvariations. The differences among vectors populations and clinical trends tend to agree with the ecogeographical hypothesis which is thought to drive Trypanosoma cruzi genetic diversity. Investigations of the molecular epidemiology of the agent of Chagas disease have attempted to link the T. cruzi genetic variations to the clinical progression of the disease. However, few studies have been conducted to determine if the genetic diversity of the parasite is mainly driven through geographical distances and ecotopes rather than vector and host associations. For example, Llewellyn et al. (2009) have revealed that TcIII seems to be clustered within terrestrial biomes. The epidemiological implications of the association of certain T. cruzi genotypes with specific ecotopes arekeytodevelopcontrolmeasures. Trypanosoma cruzi I is strongly linked with Didelphis spp., but this association is not absolute as the parasite can be found in many other mammals (Arajo 2011). The highly genetically variable genotype is present in silvatic environments, predominantly in arboreal ecotopes throughout the Americas(Cura2010).Controlinterventionswouldgreatlybenefitfromabetterunderstandingofits epidemiology. Previous studies have revealed that TcI show spatial clustering at a continent scale (Llewellyn2009),andthepresentstudyfocusesonthegeneticdiversityofTcIatarefinedscale.

1.4PotentialofMultilocusMicrosatelliteTyping(MLMT)tounravelT.cruzi diversityinBolivia
AdeeperunderstandingofthisgenotypeinBolivia,whereseveralecotopesarepresentonrelatively limited distances, might unravel, using microsatellite markers, new epidemiologically and ecogeographicallysignificantsubdivisionswithintheneglectedDTU.

Microsatellitesareshorttandemrepeats(STRs)of26basespairunit(bp).Theyarewidelydispersed within the nuclear genome and provide an interesting tool for the analysis of T. cruzi population structure (Oliveira 1998). Microsatellite sequences, (GT)n or (ATA)n, are ubiquitous and mutate fasterthanstandardsequences(Balloux2002).PopulationgeneticanalysisbasedonSTRshashelped to differentiate the two form of human African sleeping sickness (MacLeod 2000). The human form of trypanosomiasis is transmitted by T. b. rhodesiense and T. b. gambiense which both display low genetic diversity and are endemic in distinct foci (Tait 2011). Their differentiation is essential when administrating treatment, since these strains cause very distinct clinical forms (Wastling 2011). Llewellyn et al. (2009) have developed a panel of 27markers of polymorphic microsatellite loci. These markers allow the observation of T. cruzi population genetics at the finest resolution and improve the understanding the disease transmission. For example they shed the light on the role of mammalianreservoirsinthediversificationoftheTcIlineage(Llewellyn2011). Bolivia offers a wide diversity of ecoregions where T. cruzi is highly prevalent within different transmission cycles such as the western highlands of the Andes where silvatic colonies of Triatoma infestans seem to predominate (Noireau 2005), the Chaco region were peridomestic or domestic transmission actively occur (Cortez 2006), as well as El Beni to the North, where transmission is poorly understood (Figure 3). It has been shown that similar diversity could be observed in a 10 km2 areasofBoliviathanon4,500,000km2inNorthEastBrazil(Llewellyn2009). The need to understand population structure of this formerly neglected DTU is increasingly important. Pioneering analyses by Brisse et al. (2001) and Barnab et al. (2000) had demonstrated the high variability of TcI. Guhl et al. (2011) have reviewed and clarified the need of relevant subdivisionwithinTcItoaccountfortheseverecardiomypathiesrecentlyreported.FivedifferentTcI genotypes have been reported throughout the Americas (Ia, Ib, Ic, Id, Ie) based on miniexon gene sequences(Herrera2009;Cura2010). Few studies have focused on the role of these different biomes on the diversification of the kinetoplasmid. Parasites are not only influenced by vector or host species, but climatic or physical barriers might segregate parasite populations. This project looks at TcI as this genotype is widely spread in arboreal silvatic cycle as well as terrestrial and domestic cycle. Previous work has revealed that TcIII overlap with TcI within terrestrial ecotopes (Marcili 2009). The study investigates the spatial distribution of some TcIII isolates to see if its presence is restricted terrestrial niches and to observe the extent of the geographic TcI and TcIII overlap within Bolivia. Samples from different Bolivian regions are gathered, and analyzed to ascertain the correct parasite genotype. Then using thepanelof27microsatellitemarkers,thegeneticdiversityofTcIandTcIIIwillbeinvestigated.

Aim&Objectives
Aim:ToexplorethemolecularepidemiologyofTcIandTcIIIgenotypesinBoliviainthelightofhosts,
vectors,ecologyandinvestigateindetailthegeneticdiversityofTcIDTU. SpecificObjectives: 1 GenotypingofarepresentativepanelofsamplesusingPCRRFLPtoascertainthecorrect DTUsoftheBoliviancryobank. 2 Applicationmultilocusmicrosatellitetyping(MLMT)using27markerstoestablishthe microsatelliteprofileofTcIandTcIIIsamples. 3 EvaluatethegeneticdiversityofTcIisolatesusingpopulationgeneticanalysis 4 EstablishsubpopulationswithinTcIisolatesdependingongeneticcharacteristicsto investigatepopulationstructures

10

IIMATERIALSANDMETHODS
2.1Samples
A total of 145 samples were used in this study (nonincluding clones, see Annexe A). Analysis was performed on both original samples and biological isolated clones. Two different lineages were selected, TcI (127 isolates) and TcIII (18 isolates). For TcI, clones were preferred to original samples when available. Indeed, multiple T. cruzi genotypes are known to be present sympatrically within a singlehostorvector(Yeo2007).AllsampleswereisolatedduringpreviousfieldworkbyGarciaetal. and Llewellyn (2008). The isolated are from four different Bolivian regions spread over several ecoregions 2.1.1BolivianEcotopes Samplesarespreadover7differentecotopesshownbelowonfigure1:

Cochabamba: the Bolivian Yungas are part of the Andean foothills which extend into Peru and
contained high level of biodiversity. The south of the department is characterized by the montane dry forests, composed of wildlife capable of surviving dry seasons. Wild and domestic T. infestans arepresent witha T. cruziprevalence of60%(Cortez2006)but T.guasayana,andT.sordidacanbe found.

Potosi: Isolated from the department were found in the Central Andean puna. An ecotope
correlated with high elevation, wet and montane grassland. Main vectors in the region aredomestic T.infestans.

Santa Cruz: The eastern lowland of the department is composed of the Chiquitano dry forrest,
which represents one of the most richness dry forest ecosystems in the world. The south of the department is filled with grassland which also supports a high diversity of wildlife, the dry Chaco. Many vectors populate Santa Cruz ecosystem, domestic T. sordida, T. infestans, R. robustus, P. megistus.

El Beni: Two main vegetation types are found in the department. The savannah grassland which
constitutes a large ecoregion, the latter is bordered by the moist forest of the northwest of Santa Cruz.T.sordid,P.geniculatus,R.robustus,R.staliaremainlypresentintheregion. InformationonthedifferentBolivianecoregionscanbefoundonhttp://www.worldwildlife.organd triatominedistributionisfromCortez(2007).

11

Figure2:ThedifferentecoregionspresentinBolivia 2CCentralAndeanpuna
2FChiquitanodryforrest 2DBenisavanna 2ABolivianYungas 2BMontanedryforests

2EDrychaco

*Allpicturesarefromhttp://www.worldwildlife.org/homefull.html

2.1.2Sampledistributionoverthedifferentecoregions The localisation of the different samples is shown on figure 3. The samples were grouped into 10 different study sites across 4 Bolivian regions: Cochabamba (green x5), Potosi (Turquoise), Santa Cruz(bluex2)andElBeni(Redandpurple).AllfollowingmapswererealisedusingArcGIS9.2.

12

Figure3:Samplelocalisation
Figure1Legend:

13

2.2PCRRFLPproceduresfortheidentificationofT.cruzigenotypes
2.2.1PCRreactions

Thereactionwascarriedoutin25lmixturescontaining12.5lofGoTaqHot StartGreen Master Mix, 10M of primers targeting either gp72, 1f8 or hsp60, 7,5 to 7l of nuclease free water and 25 mM of MgCl2 (Bioline, London, UK) for the gp72 reactions only. The Primers sequences are listedinTable1.Allreactionmixtureswereincubatedinaprogrammableheatingblockinapeltier thermal cycler. The cycling conditions were 95oC for 5 min as an initial denaturation step followed by35cycles of94oCfor30min,65oCfor45secand72oCfor90sec,withafinalelongation stepof 72oCfor5min. 2.2.2RestrictionFragmentLengthPolyphormism(RFLP)procedures

All the three Restriction Fragment Length Polyphormism reactions were performed as described by theoriginalauthors(Maes2010).Thereactionswereconductedinafinalvolumeof25lcontaining 2lofnucleasefreewater,2.5lofrespectiverestrictionbufferforeachofthethreereactions,0.5 l of the restriction enzyme. Gp 72 was carried out using the restriction buffer, Buffer TaqI with the restriction enzyme TaqI. Similarly, the 1f8 digestion was performed using Buffer O and the enzyme Alw21l. Hsp60 used Buffer R and the restriction enzyme EcoRV (Eco32l). 20l of the previous PCR products were added to the mixture. Then the reaction was incubated at 37 oC for 2 hours for the 1f8andhsp60reactionsandat65oCfor2hoursforthegp72mix.

14

Table1:PrimersequencesforthePCRreactions
Gene Gp72 Accession#
(M65021) (X02838) (X67473)

Primer

Sequence(53)
CGCGACAGTGCCAACAACCT CGCCGAACTTCCAACCATCAG CTGGAGTTCCGTCTGATGCTG CAACAAAGTCCTCGGAGCCCT GTGGTATGGGTGACATGTAC CGAGCAGCAGAGCGAAACAT

Reference

GP72sen GP72anti 1F8sen 1F8anti HSP60sen HSP60anti

Rozasetal. (2007) Rozasetal. (2007) Lewisetal. (2009)

1f8

Hsp60

2.2.3Visualization Amplification results were visualised on 3% agarose (w/v) trisacetic acid EDTA (TAE) gels, stained with4lGelRed10,000xinwater(Biotium,UK).12lofthedigestedproductswereloadedonto the gels and electrophoresed at 90 V for 3 hours. 4 l superladdermid 1000bp ladder (ABgene, UK) was added for sizing bands as seen on figure 4. The expected band sizes of the different DTUs arelistedintable2.Inallcases,thepresenceofDNAwasrevealedbyvisualizationunderUVlight. AnexampleofthethreeDTUsfoundinthestudyisshownonthefigurebelow. Table2:Expectedbandsize(bp)ofthedifferenceDTUswiththethreerestrictionenzymes Genotype Genomictarget Gp72 TcI 780 450 TcII 500 450 280 380 210 100 150:2 450 TcIII 780 450 TcIV 780 510 450 380 210 180 100150:1 450 TcV 780 500 450 280 380 210 180 100150:2 450 300 150 TcVI 780 450

1f8

380 210 180 450

Hsp60

380 210 180 100150:1 300 150

380 210 (180) 100150:2 450 300 150

15

Figure4:PCRandRFLPvisualisation PCRproductsof1:1f8(950bp),2:hsp60(450bp),3gp72(1230bp).(4B)RFLPvisualisation (4A)

threedifferentDTUs,TCI(1,4,7),TcIII(2,5,8),TcV(3,6,9). of

2.3MicrosatellitesanalysesofTCIandTCIIIDTUs
2.3.1PCRamplificationofmicrosatelliteloci A panel of 86 samples of the TcI genotype and 31 TCIII samples were analysed using microsatellite motifs (Annexe A). The concentrations of all samples were estimated using a NanoDrop 1000 Spectrophotometer (ThermoScientific 2008). The sensor was first washed with 1.2 l of double distilled water and the blank was established using 1.2 l of double distilled water. Each measurementwasmadebypipetting1.2loftheelutesampleonthe endof thefibberoptic cable. Microsatellites were extracted from the draft sequence of the T. cruzi genome (http://www.genedb.org). Five fluorescent dyes were used to label forward primers 6FAM and TET (Proligo, Germany),nNED, PET and VIC (Applied Biosystems, UK). The microsatellite panel comprises a total of 27 markers available at http://www.ki.se/chagasepinet/mlmt.html. For each 96 wellplate,a mastermixwaspreparedfor3differentsamples. Thefinalvolume ofthe eachreaction was10landcontained:1lofThermoPolReactionBuffer(NewEnglandBiolabs(NEB), UK),0.3l of 50mM MgCl2, 0.068 l of dNTPs (5mM), 0.75 pmols of each primer, 1 unit of Taq polymerase (NEB, UK) and finally 1 ng of genomic DNA were added. The reaction conditions used for the amplification were the following: a denaturation step of 4 min at 95oC, 30 amplification cycles, each

16

composed of 20s at 95 oC, 20s at 57 oC, 20s at 72 oC and a final elongation step of 20min at 72oC. Allele sizes were determined using an automated capillary sequencer (AB3730, Applied Biosystems, UK),checkedmanuallyforerrorsandtypedblindtocontrolforuserbias. 2.3.2Analyses The microsatellite analysis was conducted using the ChagasEpiNet guidelines available on the websites (http://www.ki.se/chagasepinet/mlmt.html). Individuallevel pairwise distances were calculated using the Infinite Alleles Model (IAM) in MSAT2.exe (Minch 1995). A Neighbour Joining (NJ) algorithm was implemented using Neighbor.exe (part of Phyllip package), based on these distances. The visualisation of the hierarchical NJ tree of individuals was performed using Figtree v1.3.1. The DAS value (Stephens inverse allele sharing distance) is equal to 1 proportion of shared alleles at all loci / n. Microsoft Visual Basic was used to accommodate for multiallelic loci and allow to generate a single random diploid profile at each multilocus. A thousand bootstrapped datasets were built over loci using Mre consensus. The observed and expected heterozygosity over loci per population was estimated with Arlequin 3.1 These estimations are based on the deviation from HardyWeinberg equilibrium (HWE) at the level of individual loci within population. Estimators of Wrights Fstatistics (Wright 1965), mean FIS and FST were calculated with Arlequin 3.1 and Fstat 2.9.3.exe. FIS is the inbreeding coefficient; it estimates the level of inbreeding of individuals relative to the level of inbreeding from the samples they come from. It allows the measure of the distribution of heterozygosity between individuals per locus and per population. Its value oscillates between+1(allindividualshomozygousforthesamealleles)and1(allindividualsheterozygousfor the same alleles). FST is the fixation index; the statistic allows the observation of the extent of population subdivision between different isolates. Allelic richness (Ar) which is the total number of allele per locus adjusted for sample size was also generated using Fstat 2.9.3. The Ar allows the estimation of population level genetic diversity. Isolation by distances using a Mantels test was tested using GenAlEx 6 (Peakall 2006). The statistic allow to test the relationship between the pairwisegeneticdistance(DAS)andthepairwisephysicaldistance(km)betweenisolatesofdifferent population. The Mantels test was implemented using 10,000 random permutations. Assignment of eachisolatetoonepopulationwasmadeonaprioribasisaccordingtogeography.

17

IIIRESULTS
All samples had been characterized during previous work using a different protocol Amplicon length polymorphism of the Spliced leader intergenic region (SLIR) and D71/D72 ribosomal RNA locus (Souto 1999). In this study, samples genotype was established using the PCRRFLP procedure described previously on a representative selection of 50 isolates. Then, using a panel of 27 microsatellitesmarkersinfinaldatasets of145isolatesfromdifferentvectors,hostsorhuman,their microsatelliteprofilewasestablished.Individualpairwisegeneticdistances(DAS)ofthedifferentTcI and TcIII isolates were compared. TcI samples were allocated to five different populations: Cot, Pot, Toro which are present in the highland regions of Bolivia and Noben and Ben present in El Beni departmentinthelowlandofthecountry.Fstatisticswereperformedtoassessthegeneticdiversity of these Bolivian isolates. Finally a test for isolation by distance within highland and lowland parasiteswasperformed.

3.1PCRRFLPanalyses
A representative panel of 50 samples were analysed using the RFLP procedure. The samples were selected randomly from the cryobank of the University of San Simon, Cochabamba. Only two genotypes were identified during PCRRFLP analyses. 60% of the samples (n=30) analysed displayed the genotype corresponding to TcV, a highly prevalent genotype in Bolivia. The rest of the selected pool(40%;n=20)wereTcI.AllthePCRRFLPresultsmatchedtheinvestigationspreviouslyperformed using the SLIR and AFLP rDNA protocol. Finally, using all the samples present in the Bolivian cryobank, a total dataset of 145 samples was used for the microsatellite analyses: 127 TcI samples and18TcIIIsamples(listedfigure5).TcIanalysiswasperformedon44originalsamplesandatotalof 84clones.

3.2MicrosatelliteAmplification
On the 145 positively amplified isolates using Multilocus Microsatellite Typing, 65% (n=94) had one or two alleles per locus. 51 isolates presented multiple alleles (>3 per locus) and were either from the original strain or from biological clones. After random diploid resampling to account for the presence of multiple alleles, samples with no or low microsatellite amplification were removed of theanalyses.

18

19

Just over 90% of isolates analysed were from silvatic cycle (n=130), 9 were from peridomestic environments and 6 were found in domestic settings. Parasites were principally isolated from vectors (68%; n=100) then mammal reservoirs (27%; n=40) and finally 7 isolates were from human infections (5%). The most ubiquitous vector was Triatoma infestans (88%; n=88) while 12 isolates belonged to the Rhodinus genus. Among mammals, two main species present were Didelphis marsupialis(n=21)andDasypusnovemcintus(n=7). It is also interesting to note the variation of the microsatellite profile obtained from the control (X 10),whichrevealstheerrorintroducebytheMLMTanalysis.

3.3Individualpairwisedistancecomparisons
Theneighbourjoiningtree(Figure5)basedonIAM(DASvalues)fromthe27microsatellitelociallow the differentiation between TcI and TcIII. The differentiation between the two genotypes was correlatedwithstrongbootstrapvalue(89%overa1,000bootstrappeddatasetsoverloci)

3.3.1TcIIIpairwisegeneticdistance
TcIII isolates demonstrate strong inter branching with solid bootstrap values. The 6 isolates from SantaCruzwhich havebeenfoundinT.infestansin peridomesticsettingstendtoclustercompared to the rest of TcIII samples (Bootstrap 45%). Parasites from the Chaco region tend to be different from the Santa Cruz isolates and samples from El Beni. However only weak bootstrap support was found (28%). A cluster by hosts seems to emerge but probably mainly because the different hosts present in the study belong to different transmission cycles. 3 samples were found in silvatic triatomines and were located in Cochabamba. Overall bootstrap values supported clustering of the population.

3.3.2TcIpairwisegeneticdistances
In TcI, the NJ tree based on genetic distance values (DAS) confirmed the division of the two populations: highland (Green) and lowland (Red). A reasonably robust bootstrap value for STR loci (48%) corroborates this segregation. The two populations tend to have different hosts. Within arboreal ecotopes, Rhodinus vectors and Didelphis marsupialis appeared to be most frequently infected with T. cruzi even if some other mammals such as Philander opossum or Scuireus spp. were also carriers of the trypanosome. In terrestrial ecotopes, transmission tends to be almost entirely duetosilvaticT.infestans. 20

Based on the DAS value, deep internal branching, reflecting stable long term population structure, was found in Beni savannah ecoregion compared to the short internal branching found throughout the highland. In terrestrial biome where silvatic transmission seems to dominate, isolates appeared genetically similar and T. infestans seemed to only arbour terrestrialtype of parasite. No lowland isolate was found in any of the highland sites. Interestingly, two clones with the lowland microsatellite profile (38 A & B) appeared to circulate in T. infestans of the Cochabamba region. A small cluster of samples from Potosi can be observed (Bootstrap= 45%) even if 6 clones (43%) matchedtheprofiledetectedintheCochabambavalleys.

3.3.3Heterozygosityindices
TcIpopulationwasdividedinto5subpopulationsdependingonthedifferentstudysites(displayed onfigure10):Cot,Pot,Toro,Noben,Ben. Table3:HeterozygosityindicesandAllelicrichnessofthefiveTcIpopulations HO 0.488 0.468 0.379 0.562 0.459 HE 0.492 0.426 0.355 0.632 0.595 Allelicrichness(+/SE) 2.273(0.207) 1.707(0.166) 1.824(0.158) 2.631(0.268) 3.070(0.319)

Cot Pot Toro Noben Ben

HardyWeinberg equilibrium was originally designed to predict the proportion of two alleles in a population after one generation of random mating. The HardyWeinberg principle states that alleles andgenotypefrequenciesremainsconstantinapopulation(Hedrick2005).FromtheHWEprinciple, it is possible to calculate the expected heterozygosity (He) at a single locus in a population; it is derivedfromthefollowingequation:

ExpectedheterozygosityofasinglelocuswithmultipleallelesatHWE Piexpectedfrequencyofhomozygotes;1totalnumberofallelesinthepopulation(Hedrick2005)
Howevermanyphenomenainfluencesallelesfrequencies,suchasmutation,populationsizeorgene flow. Deviations from the HWE enable to denote the evolution of a species. The observed level of

21

heterozygosity(Ho)isthenumberofheterozygotesperlocusinasamplefromarealpopulation.The application of these deviations on nonMendelian protists is debatable but can give general insights intopopulationsubdivisionandpossiblymatingstrategy. Figure6:Meanheterozygosityindicesoverloci:observedandexpectedvalues(+/SE)
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 Cot Pot Toro Noben Ben Ho He

Ho>HeindicatesanexcessofheterozygosityandHe>Hoanexcessofhomozygosity.

The observed heterozygosity in the Cot population is close to the expected value under Hardy Weinberg equilibrium (HWE) (Table 3). However the other populations of the highland region (Toro and Pot) gave substantially higher observed value than the expected ones under HW. Ho>He indicates an excess of heterozygosity from HW expectations at these study sites. As opposed to the exclusively silvatic isolates, Noben and Ben populations demonstrated important deviation from the HWE, where He>Ho, implying an excess of homozygosity. However, only the Ben subpopulation showedsignificantdifferencebetweenHeandHo,asitserrorbarsdonotoverlap(Figure5).

3.3.4Geneticdiversity
Allelic richness, which accounts for sample size reveals significant differences between El Beni isolates and the highland population. The low allelic richness in cot, pot and toro (1.707 to 2.273) demonstratereducedgeneticdiversityamongthesesilvaticparasites(Table3Figure7).Nobenand Bendisplayedimportantlevelsofgeneticdiversity(2.6313.070).

22

Figure7:Allelicrichnessperloci(+/SE)
4 3.5 3 2.5 2 1.5 1 0.5 0 Cot Pot Toro Noben Ben

3.4PopulationsubdivisionFSTandFIS
The mean Wrights Fstatistics allow two different measures: the fixation index FST, which accounts for the level of subdivision within the population and the inbreeding coefficient FIS (as described in themethods). No evidence of subdivision was observed between the three highland isolates (Table 4). The unbiased estimator suggested an important gene flow between the three populations as no subdivision was detected. The Pvalue indicates a non significant degree of subdivision between Cot andPotisolatesreinforcingthehighgeneflowsuggestedbytheFST. Lowlevelofsubdivision(FST=0.067)betweenthesamplesfromElBeniwasestimated.Nevertheless, this value is significant whereas it was not the case for the fixation index estimated within highland isolates. The level of subdivision was more pronounced between lowland/highland samples with FST rangingfrom0.183and0.259.ThesehighFSTvaluessuggestanimportantdiscontinuitybetweenthe two ecoregions. Indeed there is a high gene flow between Cot and Pot (FST=0.018) which are separated by 500 km, whereas Cot and Ben do not mix (FST=0.183) even if the two subpopulations areonly200kmapart. All geographic distances between these isolates are relatively small; an equivalent fixation index estimate (FST = 0.148) was found between Venezuela and Argentina which are separated by 5000

23

km, although direct comparison between F statistics from different datasets should be interpreted withcaution(Llewellyn2009). These data is consistent with the ecological hostfitting and corroborate the pattern of dispersal observed on the NJ tree based on the DAS values. Isolates from similar ecotopes have a high gene flow.Thelatterhasaneffectofhomogenisationofallelefrequenciesbetweenpopulations. Table4:FST(unbiasedestimator)forthedifferentpopulations(*Pvalueindicatedinbrackets)

Population Cot Pot Toro NoBen Ben

Cot
0 0.018 (0.162+/0.040)* 0.031 (0.0360+/0.0148) 0.199 (0.0000+/0.0000) 0.183 (0.0000+/0.0000)

Pot
0 0.055 (0.000+/0.000) 0.259 (0.000+/0.000) 0.254 (0.000+/0.000)

Toro

NoBen

Ben

0 0.255 (0.000+/0.000) 0.256 (0.000+/0.000) 0 0.067 (0.000+/0.000) 0

FIS represents the level of inbreeding in each subpopulation (see methods). Cot, pot, tor (highland) FIS are contained around 0, which represent the allele frequencies expected under HW equilibrium.
As seen on figure 8, all standard errors bars cross 0. These three values indicate that no deficit or excessofheterozygositywasobservedfromtheHWexpectations. Noben and ben show significant variation from HWE, with respective FIS value of 0.241 and 0.332. The two subpopulations appear to have a heterozygosity deficit. These findings confirm the excess ofhomozygosityatpopulationleveldescribedinsection3.3.3,heterozygosityindices.
0.2

Figure8:FISvalue(+/SE)foreachsubpopulation
0.4 0.3

0.1

0.1 0.2
0.3 cot pot tor noben ben

24

3.5Isolationbydistance(IBD)geographicaldispersalinpopulations
Someofthe pairwisegeneticdiversificationobservedintheNJ tree,figure5, could beexplainedby isolation by distance. The Mantels test investigates the relationship between pairwise genetic distance (DAS) and geographic distance (km). The latter was performed between all the TcI isolates and revealed to be highly significant with a positive correlation, Rxy = 0.418, p<0.001, R2=0.1749 (Figure 9 A). The isolation by distance reinforces the possibility that TcI genotypes present in these differentecoregionsmightbedifferent.

AllIsolates

0.000 Das 1.000 0.800 0.600 0.400 0.200


Das 0.700 0.600 0.500 0.400 0.300 0.200 0.100 0.000

100

200

300

400

500

600

700

800

900

Distances(km)

Figure9A:spatialisolationofallisolatesRxy=0.418,p<0.001,slope=0.0004

HighlandPopulation

100

200

300 Distance(km)

400

500

600

Figure9Bspatialisolationforhighlandpopulation:Rxy=0.238,p=0.003,slope=0.0002 25


1.000

Lowlandpopulation
0.800 Das 0.600 0.400 0.200 0.000 0 50 100 150 200 250 300 350

Distance(Km)

Figure9Cspatialisolationforlowlandpopulation:Rxy=0.214,p=0.045,slope=0.0004 A weak but significant degree of correlation was observed within highland population only Rxy = 0.238, p= 0.003. However, the low R2 value (R2=0.0565) points out the poor fit of the data with the regressionline.Thislevelofisolationbydistanceseemnegligiblecomparedtothehighlevelofgene flow(Fst)describedpreviously. However no significant IBD was observed among lowland isolates (Rxy= 0.214, p= 0.045) even if the slope was twice as steep in El Beni. Nonetheless, the pairwise comparison from El beni sub population revealed important population subdivisions. The distances between the isolates are relatively small and might explain the nonsignificance of the IBD. Important variations between the

DASvalueshavebeenobservedfromisolateofthesamesite(Figure5).

26

IVDISCUSSION
This study attempts to support the fact that the high genetic diversity present in T. cruzi is linked to the environment where the parasites evolve rather than uniquely due to hosts or vectors. The population dynamics of the trypanosome is investigated at a refined scale where several ecoregions arepresentwithinarestrictedarea.

4.1PCRRFLPtodifferentiateT.cruzigenotypes
The study attempted to first identify the correct genotype of the isolates used in the project. The genotyping techniques for the correct identification of T. cruzi subgroups are often subject to confusion. This project tried to use the standardised PCRRFLP protocol to ascertain of the correct genotype. The latter matched 100% with the previous genotyping methods used on the samples. Basic DTU genotype identification was presumably good as the Multilocus Microsatellite Typing technique supported these results by allowing the delimitation between TcI and TcIII isolates, supportedbystrongbootstrapvalue(89%).

42MLMTasatoolforT.cruzipopulationstructureanalyses
Microsatellite analysis is thought to have sufficient power to distinguish silvatic and domestic populations in TcI (OcanaMayorga 2010). However, as detailed previously, the present dataset displayed 35% of multiple alleles at a single locus. With Chagas disease, mixed infection with multipleT.cruzigenotypesiscommon(Llewellyn2011).Previousworkhasaffirmedthatmultiallelic loci are more likely to be representative of mixed infection rather than the presence of an isolate with an excess number of chromosomes, an aneuploid clone. The limitation of study design for the isolation of a single clone has been well documented. Many problems have been raised concerning parasite isolation, DNA extraction or parasite culture (Prugnolle 2010). Moreover, the present study uses clones and original samples which make the possibility of multiple alleles almost inevitable. Interestingly, a comparable proportion between original samples and clones presenting multiple alleles has been observed in the dataset. Cloning isolation can explained some of these multiallelic loci,asplate cloningtechnique usedin Boliviawasprobablyinadequate.Toaccountformultiallelic loci, it is expected that the diploid resampling techniques used will slightly overestimate the heterozygosityofthestudy(Llewellyn2008).

27

Few samples also presented identical microsatellite profile. This phenomenon has been reported whenstudyingothermicroparasitessuchasLeishmania(Schwenkenbecher2006).Thisisduetothe number of loci used for MLMT. 27 markers were incorporated in this project; this number seems reasonable because the corresponding dataset based on pairwise genetic distances comparison allowthedifferentiationbetweensubpopulations.Anotherproblemencounteredwastherepeatof samples which could have slightly variable microsatellite profile, as shown on figure 5 by the variationobtainedwiththecontrol(X10).

4.3TheroleofbiomesinthediversificationofT.cruzi
The ecological host fitting in T. cruzi advanced by Yeo et al. (2005) stated that TcI is thought to be mainly present in arboreal mammals within silvatic cycles while the former TcII clade (TcIITcVI) would be more likely found within terrestrial niches. Hamilton et al. (2007) affirmed that host fitting is key in driving trypanosomes diversification. Parasite clades evolve depending on the adaptation of the organism to host types. This process can then lead to the extension of host range orhostswitching.Thetwogenotypesinvestigatedtendtoagreewiththesefindings. 4.3.1TcI,ecotopes,hostsandvectors It has been demonstrated that TcI populations show spatial clustering at continental scale and are genetically highly diverse (Llewellyn 2009). In this study which only involves parasites isolated in Bolivia, TcI appears to be present in two main distinct environments. Deep branching between isolates of the lowland of the country seems to characterise this first subpopulation. The NJ tree reveals a higher genetic diversity compared to the other silvatic subpopulation present in the highland. El Beni isolates do not seem to be exclusive to one host. The biomes involve principally Rhodnius species and Didelphis marsuipialis even if overall the parasite was found in 4 different mammals. Sampling bias is likely to be skewed toward Didelphis mammals as this host has a long historical association with T. cruzi (Travi 1994). The marsupial tolerates high parasitemia and is believed to have been the essential carrier of the trypanosome throughout the Americas (Legey 2003). Inrockyhighlandecotope,allsilvaticparasiteswereT.infestans.Againthevectorsamplingmightbe linked to the abundance of the species at the different study sites. Internal branching is less pronounced than in El Beni department and the bootstrap values were weaker, suggesting less

28

diversity within the ecotope. In this biome, some of the sample exhibited identical microsatellite profile.Thevectorsfromsixdifferentstudysites(Figure3&10)displayedlittlepolymorphism. 4.3.2TcII,hostsandvectors If TcI population appears almost entirely silvatic, all TcIII isolates from the Chaco region are from peridomestic settings. T. cruzi is known to frequently reemerge from silvatic environment (Aguilar 2007) and this is the first evidence to suggest that the same occurs in TcIII. However, it is difficult to draw any conclusion concerning parasite subgroups and their pseudo affinity with any transmission cycleastheavailabilityofisolatesfromdifferenttransmissioncycleinthedatasetwasrestricted. TcIII is known to cluster according to geography rather than host and is believed to be primarily associated with terrestrial ecotope and armadillo (Marcili 2009). There are strong association with D. novemcintus, which can appear in peridomestic settings even if the study shows that TcIII is not exclusive to armadillos. The genotype was principally sampled in the dry Chaco and the Chiquitano dry forest, but about a third of these isolates were identified in Beni savannah, an ecological niche where TcI ubiquitous. The overlap between TcI and TcIII is expectable since TcIII seems to be the result of an hybridization involving TcI and TcIII (Westernberger 2005). The overlapping of the two genotypes has been previously observed within terrestrial ecotopes (Arajo 2011). The sporadic presence of the DTU in Cochabamba valleys within Phylotis sp. and in silvatic T. infestans represents anewfinding. 4.3.3AnexplanationforthenichespecificitybetweenTcIIIandTcI? The study confirms the fact that TcIII and TcI have an important host range and a large distribution pattern as they are present in dissimilar biomes. Geographic distributions and the host associations ofT.cruzihavenotyetbeenfullyportrayed.Herethehighlydiversepopulationstructureswithinthe country emphasized the complexity of the parasite transmission dynamics. Cospeciation does not agree with the present data, even if sampling bias is likely to have occurred. TcI isolates were sampledfromT.infestansinterrestrialregionsandfromRhodinusspp.inarborealenvironment.The divergence between the two genus is estimated at 4864 MYA (Herber 2003). The dataset shows that Didelphis and Dasypus are associated with different ecotopes, a statement which agrees with ecological host fitting. Moreover, Marshall et al. (1993) affirms that lineage divergence of the two

29

mammalsiscorrelatedwiththeapparitionoflowlandecotopesinBolivia,thoughttohaveappeared with the emergence of the western Andes 40 million years ago. Divergences between TcI and TcIII have been traced back to around 18 to 37 MYA (Machado 2001), which support the segregation of theDTUaccordingtodifferentecologicalnichesratherthanvectors.

4.4MolecularepidemiologyofTcI
From the NJ tree, genetic diversity seems more pronounced in El beni isolates since deep branching are observed. The significantly higher allelic richness of these two subpopulations compared to highland ones corroborates these findings (Table 3). Populations from silvatic highland environment displayed weak levels of heterozygosity with respect to HardyWeinberg expectations (Ho>He). Moreover,thelackofspatialsubdivisionobservedfromthepairwisedistancesaroundCochabamba impliesimportantmixingbetweenthepopulations.ThehighgeneflowsuggestedbysmallFSTvalues (FST <0.055) support the possibility of intense mixing within the Bolivian highland. FST values were lowandnotsignificantbetweenthesubpopulationsofCochabambaindicatingnosubdivision. Strong significant FST values between low/highland isolates are indicating important population subdivision. These sites are not distant from each other but it seems that very little gene flow circulates between Beni savannah region and Bolivian Yungas. The reason for the subdivision fit nicely with ecological host fitting as it seems that there is no parasite mixing between the two ecoregions. Isolation by distance on all the isolates showed highly significant positive correlation between genetic and geographic distances supporting the spatial division between biomes (Rxy = 0.418,p<0.001). However, IBD was not significant when only performed on savannah isolates whereas weak spatial isolation could be seen within the highland. This result does not agree with the important gene flow described. The deep branching seen in El beni isolates on the neighbourjoining tree prone some clusteringcomparedtosouthernparasites.ThenonsignificanceoftheMantelstestcouldbedueto the high variations of DAS values between isolates of the same site, possibly due to sampling bias toward D. marsupialis or other factors. An increase sampling effort in this department could clarify thesituation. The positive FIS found in Ben and Noben subpopulations, respectively 0.332 and 0.241 combined with the higher expected values derived from HW equation (He>Ho) indicate that the populations

30

have an excess of homozygosity. The high biological diversity found in arboreal ecotopes can be the reflexionofalonglivedsubpopulation. The population of TcI in the highland harbours a small excess of heterozygosity, a low genetic diversity (allelic richness<2.2) and an inbreeding coefficient close to HW allele frequencies (FIS=0). T. cruzi is recognized to undergo clonal propagation (Buscaglia 2003). Clones diverge over time as alleles evolve independently with no recombination between loci. This process, known as the Meselson effect (Welch 2000), leads at term to increase heterozygosity between homologous loci. The important gene flow between the different ecotope of the region, from Potosi to Cochabamba, and genetic pairwise similarities observed within the highland suggest that parasite diversification could be influenced by human movements. Humans would move parasite between these different localitiesatafasterratethanwildhostsorvectors.Passivetransportthankstohumanmigrationhas been proposed to explain the presence of similar clones in T. infestans at different sites (Barnab 2011).Thehighlandregionsupportsasilvaticvectorpopulationwhichislikelytobeinvasivetoperi urbansettingsorhumandwellings,sinceT.infestansdomestication5000BC(Cortez2010).Parasites reinfestation would be higher than in El Beni. The region of Cochabamba have been an attractive geographically and economic importance for farmers migrating from other parts of the country in search for greater incomes (PirezCrespo 1991). This idea would justify the presence of parasite havingsimilarmicrosatelliteprofilethanisolatesfromElBeni,orSantaCruz,butwhichwereisolated inCochabamba.

4.5Consequencesonpopulationstructures
Many protozoans undergo clonal propagation and long term clonality should increase the heterozygosity. However since 2003, T. cruzi is known to be able to have genetic exchange (Gaunt 2003). Hybridization is thought to have produce TcV and TcVI; these two genotypes are highly heterozygous.Sexualrecombinationcangeneratenewgenotypeswhichcanleadtomoresuccessful phenotype (Widmer 1987). The hybrids have rapidly colonised some ecological niches and their heterozygousformmighthavebeenanadvantagetoinfecthumanhosts(Lewis2011).Theirminimal diversity across large areas confirms a rapid expansion. Only a very restricted number of hybrid clones would be required to repopulate this ecotope thanks to clonal propagation. Speculation concerning an eventual recombination event in TcI is arguable. This study shows that substantial geneticheterogeneityexistsinhighlandTcIpopulationofBolivia.Thiswidespreadsilvaticpopulation share many characteristics with the recognized hybrids. The loss of allelic richness at each locus

31

could be due to recombination and gene conversion which act as homogenise the population. The presentworkdoesnotshowanyevidenceofgeneticexchangebutmoreresearchshouldunravelthe propagation of T. cruzi as the taxon remain considered as principally clonal in this region (Barnab 2011).


Figure10:SchematicsummaryofthedispersalofTcIpopulations

32

4.6LimitationsandFutureWork
The inability to only use isolated clones for the entire analyses is not ideal. Multiclonality was observedinbothoriginalsamplesandclonesbutoriginalsamplesaremorelikelytocontainmultiple genotypes as several strains of T. cruzi can be found over the same geographical region and in the same host (Yeo 2007). Sampling bias seems inevitable because sampling of vector or host is strongly linked to their abundance in the environment. The strength of the study would benefit from an increasedandequallydistributednumberofisolatesforeachstudysites. The study identified two TcI populations present in two distinct ecoregions. The two populations seem to match the description of TcId and TcIe advanced by (Herrera 2009). Genotype Id is found in silvatic transmission cycle mainly in Didelphis marsupialis like the lowland isolates (Falla 2009), whereas Ie, which was found in Bolivia, was isolated from T. infestans (Cura 2010). However, the limitation of using microsatellites to unravel these genotype has been previously noted (Guhl 2011). More research based on miniexon sequences should be done to confirm the presence of these genotypesinthiscountrysinceonlyfewBolivianisolateshavebeencharacterised.

VCONCLUSION
This project explored the heterogeneity of the TcI genotype of T. cruzi. The dataset assembled for the study represent one of the most important used for MLMT analysis in Bolivia. The use of the 27 microsatellite markers was successful to unravel population structures within the country and reinforcedtheideathatecologicalhostfittingdrivethediversificationoftheparasite.TcIIIappeared sporadically in silvatic T. infestans. This genotype and TcI isolates from the lowland appeared to be stable long term populations with deep interbranching according to the NJ tree. Clear isolation between highland and lowland isolates was supported with no gene flow (FST>1.8) between the ecoregions and a strong isolation by distance. Strong evidence of frequent mixing in the highland ecotope seems implies that human are involved in the spread of the parasites. The actual organisation of the taxon in six DTUs is likely to poorly transcribe the heterogeneity of the parasite. The results highlight the heterogeneous structure of TcI at a country scale, emphasising the need to clarify the subdivision of the genotype. Its epidemiological relevance concerning the different form of Chagas disease are worth been elucidated. The future advancement in sequencing technology would be relevant for the study of the molecular epidemiology of trypanosomes. Genomewide comparisons will attempt to explain the diversity of the parasite and will be able to afford a better

33

understandingofmultipleinfections.ThevariationoftheclinicalformofChagasdiseasescouldthen beunderstood. WordCount:7,912 Acknowledgments: Special thanks to Martin Llewellyn for the opportunity to realise this study and his help throughout the project. Thanks to Lineth Garcia, Rudy, Annabelle De La Barra and all the members of the Chagas diseases laboratory of the Universidad Mayor de San Simon in Cochabamba for providing the parasite DNAs and for their technical assistance, to Michael Miles for allowing the utilisation of the laboratory facilities and the London School of Hygiene and Tropical Medicine for allowingtherealisationoftheproject.

References:
Aguilar,H.,AbadFranchF,DiasJC,JunqueiraAC,CouraJR(2007)."ChagasdiseaseintheAmazon Region.."MemInstOswaldoCruz102(1):4756. Arajo,C.A.C.W.,P.J.;Xavier,S.C.C;Jansen,A.M.(2011)."GenotypevariationofTrypanosomacruzi isolatesfromdifferentBrazilianbiomes."ExperimentalParasitology127:308312. Balloux,F.L.m.,N.(2002)."Theestimationofpopulationdifferentiationwithmicrosatellite markers."MolecularEcology11:155165. Barnab,C.,Brisse,S.,Tibayrenc,M.(2000)."Populationstructureandgenetictypingof Trypanosomacruzi,theagentofChagasdisease:amultilocusenzymeelectrophoresis approach.."Parasitology120:513526. Barnab,C.D.M.,T,Noireau,F.;BossenoM.F.,MarceloMonjeE,Renaud,F.Brenire,S.F.(2011). "Trypanosomacruzidiscretetypingunits(DTUs):Microsatellitelociandpopulationgenetics ofDTUsTcVandTcIinBoliviaandPeru."Infection,GeneticsandEvolution doi:10.1016/j.meegid.2011.07.011. Brisse,S.,Verhoef,J.,Tibayrenc,M.(2001)."CharacterisationoflargeandsmallsubunitrRNAand miniexongenesfurthersupportsthedistinctionofsixTrypanosomacruzilineages.." InternationalJournalforParasitology36(337346). Burgos,J.M.,Diez,M.,Vigliano,C.,(2010)."MolecularidentificationofTrypanosomacruziDiscrete TypingUnitsinendstagechronicChagasheartdiseaseandreactivationafterheart transplantation."Clin.Infect.Dis.51. Buscaglia,C.A.D.N.,J.M.(2003)."Trypanosomacruziclonaldiversityandtheepidemiologyof Chagasdisease."MicrobesandInfection5:419427. Cmara,A.C.J.V.F.,A.A.;Valadares,H.M.S.;Macedo,A.M.;D'Avila,D.A.;Machado,C.R.;Lages Silva,E.;Chiari,E.;Galvao,L.M.C.(2010)."GeneticanalysesofTrypanosomacruziisolates fromnaturallyinfectedtriatominesandhumansinnortheasternBrazil."ActaTropica115: 205211. Cortez,M.P.,P.Cuervo,F.Alfaro,M.Solano,M.C.C.Xavier,P.S.dAndrea,O.Fernandes,F.Torrico, F.Noireau,A.M.Jansen,(2006)."Trypanosomacruzi(KinetoplastidaTrypanosomatidae):

34

ecologyofthetransmissioncycleofinthewildenvironmentoftheAndeanvalleyof Cochabamba,Bolivia,."Exp.Parasitol.114:305313. Cortez,M.R.(2007).TriatominosdeBoliviaylaenfermedaddeChagas. Cortez,M.R.,Monteiro,F.A.,Noireau,F.,(2010)."NewinsightsonthespreadofTriatomainfestans fromBoliviaimplicationsforChagasdiseaseemergenceinthesoutherncone."Infection, GeneticsandEvolution10(350353). Cortez,M.R.,PinhoA,CuervoP,AlfaroF,SolanoM,XavierS,DAndreaP.S,FernandesO,Torrico,F, JansenA,M.,Noireau,F.,(2006)."Trypanosomacruzi(KinetoplastidaTrypanosomatidae): EcologyofthetransmissioncycleinthewildenvironmentoftheAndeanvalleyof Cochabamba,Bolivia."ExperimentalParasitology114:305313. Cura,C.I.A.M.M.J.,TomsDuffy,JuanM.Burgos,MarcelaRodriguero,MartaV.Cardinal,Sonia Kjos,RodrigoGurgelGonalves,DenisBlanchet,LuisM.DePablos,NicolsTomasini, AlexandredaSilva,GracielaRussomando,CesarA.CubaCuba,ChristineAznar,TeresaAbate, MarianoJ.Levin,AntonioOsuna,RicardoE.Grtler,PatricioDiosque,AldoSolari,Omar TrianaChvez,AlejandroG.Schijman(2010)."TrypanosomacruziIgenotypesindifferent geographicalregionsandtransmissioncyclesbasedonamicrosatellitemotifofthe intergenicspacerofsplicedleadergenes."InternationalJournalforParasitology40(1599 1607). Falla,A.,Herrera,C,Fajardoa,A,Montilla,F.Vallejo,G,Guhl,F.(2009)."Haplotypeidentification withinTrypanosomacruziIinColombianisolatesfromseveralreservoirs,vectorsand humans."ActaTropica110:1521. Fernandes,O.M.,R.H.;Lisboa,C.V.;Pinhos,A.P.;Morel,C.M.;Zingales,B.;Campbell,D.A.;Jansen, A.M.(1999)."ThecomplexityofthesylvaticcycleofTrypanosomacruziinRiodeJaneiro state(Brazil)revealedbythenontranscribedspaceroftheminiexongene."Parasitology 118:161166. Garcia,E.S.,Ratcliffe,N.A.,Whitten,M.M.,Gonzalez,M.S.,Azambuja,P.(2007)."Exploringtherole ofinsecthostfactorsinthedynamicsofTrypanosomacruziRhodniusprolixusinteractions. ."JournalofInsectPhysiology53:1121. Gaunt,M.M.,M.(2000)."TheEcotopesandEvolutionofTriatomineBugs(Triatominae)andtheir AssociatedTrypanosomes."MemInstOswaldoCruz,RiodeJaneiro95(4):557565. Gaunt,M.W.Y.,M;Frame,I.;Stothard,J.,arrasco,H.;Taylor,M.C.,Mena,S.S.;GrahamA.J.; Miles,G.A.;Acostak,N.;RojasdeAriask,A.;Miles,M.(2003)."Mechanismofgenetic exchangeinAmericantrypanosomes."Nature421:936941. Gibson,W.C.S.,J(1999)."GeneticexchangeintheTrypanosomatidae."Adv.Parasitol.43:145. Guhl,F.R.,J.D.(2011)."TrypanosomacruziIdiversity:Towardstheneedofgeneticsubdivision?" ActaTropica119(2011)14119:14. Hamilton,P.B.G.,W.;Stevens,J.(2007)."Patternsofcoevolutionbetweentrypanosomesandtheir hostsdeducedfromribosomalRNAandproteincodinggenephylogenies."Molecular PhylogeneticsandEvolution44:1525. Hedrick,P.W.(2005).Geneticsofpopulations(JonesandBartletPublishers,Sudbury, Massachussets). Herber,O.K.,A.(2003)."PyrethroidimpregnatedcurtainsforChagas'diseasecontrolinVenezuela" ActaTropica88(3338). Herrera,C.,Guhl,F.Falla,A,Fajardo,A;Montilla,M;Vallejo,G.A.;Bargues,D.(2009)."Genetic VariabilityandPhylogeneticRelationshipswithinTrypanosomacruziIIsolatedinColombia BasedonMiniexonGeneSequences."JournalofParasitologyResearch(ArticleID897364): 9. Legey,A.P.,Pinho,A.P.,Xavier,S.C.,Marchevsky,R.,Carreira,J.C.(2003)."Trypanosomacruziin marsupialdidelphids(PhilanderfrenataandDidelhismarsupialis):Differencesinthe humoralimmuneresponseinnaturalandexperimentalinfections."RevSocBrasMedTrop 36:241248.

35

Legrand,M.,ForcheA,SelmeckiA,ChanC,KirkpatrickDT,etal.(2008)."HaplotypeMappingofa DiploidNonMeioticOrganismUsingExistingandInducedAneuploidies."PLoSGenet4(1): e1.doi:10.1371/journal.pgen.0040001. Lewis,M.D.L.,M.SYeo,M.,Acosta,N.Gaunt,M.W.,MilesM.A.(2011)."Recent,Independentand AnthropogenicOriginsofTrypanosomacruziHybrids."PLoSNegl.Trop.Dis.inpress. Lewis,M.D.M.,J.,Yeo,M,Carrasco,H.J.,Llewellyn,M.S.;Miles,M.A.(2009)."Genotypingof Trypanosomacruzi:SystematicSelectionofAssaysAllowingRapidandAccurate DiscriminationofAllKnownLineages."Am.J.Trop.Med.Hyg.81(1):10411049. Llewellyna,M.S.M.,M.A.;Carrasco,H.J.;Lewis,M.D.;Yeo,M.;Segovia,Vargas,J.;Torrico,F.; Diosque,P.;Valente,S.;Valente,V.;Gaunt,M.(2009)."GenomeScaleMultilocus MicrosatelliteTypingofTrypanosomacruziDiscreteTypingUnitIRevealsPhylogeographic StructureandSpecificGenotypesLinkedtoHumanInfection."PLOSpathogens5(5):19. Llewellyn,M.S.(2008).ThemolecularepidemiologyofTrypanosomacruziinfectioninwildand domestictransmissioncycles,withspecialemphasisonmultilocusmicrosatelliteanalysis. LondonSchoolofHygieneandTropicalMedicineUniversityofLondon. Llewellyn,M.S.J.B.R.C.,SineadFitzpatrick,MichaelD.Lewis,MatthewYeo,MichaelW.Gaunt, MichaelA.Miles(2011)."ExtraordinaryTrypanosomacruzidiversitywithinsingle mammalianreservoirhostsimpliesamechanismofdiversifyingselection."International JournalforParasitology41:609614. Llewellyn,M.S.L.,M.D.;AcostaN.;Yeo,M.;Carrasco,H.J.;Segovia,Vargas,J.;Torrico,F.;Miles, M.A.;Gaunt,M.(2009)."TrypanosomacruziIIc:PhylogeneticandPhylogeographicInsights fromSequenceandMicrosatelliteAnalysisandPotentialImpactonEmergentChagas Disease."PLOSpathogens3(9):510520. Llewellyn,M.S.M.,M.A.;Carrasco,H.J.;Lewis,M.D.;Yeo,M.;Segovia,Vargas,J.;Torrico,F.; Diosque,P.;Valente,S.;Valente,V.;Gaunt,M.(2009)."GenomeScaleMultilocus MicrosatelliteTypingofTrypanosomacruziDiscreteTypingUnitIRevealsPhylogeographic StructureandSpecificGenotypesLinkedtoHumanInfection."PLOSpathogens5(5):19. Macedo,A.M.M.,C.R.;Oliveira,R.P.;Pena;S.D.J.(2004)."Trypanosomacruzi:GeneticStructureof PopulationsandRelevanceofGeneticVariabilitytothePathogenesisofChagasDisease." MemInstOswaldoCruz,RiodeJaneiro99(1):112. Machado,C.,AyalaFJ(2001)."Nucleotidesequencesprovideevidenceofgeneticexchangeamong distantlyrelatedlineagesofTrypanosomacruzi.."ProcNatlAcadSciUSA98:73967401. Machado,C.A.A.,F.J.(2001)."Nucleotidesequencesprovideevidenceofgeneticexchangeamong distantlyrelatedlineagesofTrypanosomacruzi"ProcNatlAcadSciUSA98:73967401. MacLeod,A.,WelburnSC,MaudlinI,TurnerCM,(2000)."Minisatellitemarkeranalysisof Trypanosomabrucei:Reconciliationofclonal,panmictic,andepidemicpopulationgenetic structures.."ProcNatlAcadSciUSA97:1344213447. Maes,I.V.d.A.,G.(2010)."PCRRFLPforDTUtypingofT.cruzi."SOPversion147ITMA109B:18. Marcili,A.L.L.,L.;VeraC.Valente,SebastiaoA.Valente,JaelS.Batistac,AngelaC.V.Junqueirad, AldaI.Souzae,JoaoA.daRosaf,MartaCampanera,MichaelD.Lewis,MartinS.Llewellyn, MichaelA.Miles,MartaM.G.Teixeira(2009)."Comparativephylogeographyof TrypanosomacruziTCIIc:Newhosts,associationwithterrestrialecotopes,andspatial clustering."Infection,GeneticsandEvolution9:12651274. Marshall,L.S.,T.(1993)."EvolutionoftheNeotropicallandmammalfaunainitsgeochronologic, stratigraphicandtectoniccontext"YaleUniversityPress. MedranoMercado,N.U.F.,R..Butrn;UberBusek,GuerraHL.;deArajoJorge,C.;Correa Oliveira,R.(2008)."UrbantransmissionofChagasdiseaseinCochabamba,Bolivia."Mem InstOswaldoCruz,RiodeJaneiro103(5):423430. Miles,M.A.,Llewellyn,M.S.,Lewis,M.D.,Yeo,M.,Baleela,R.,Fitzpatrick,S.,Gaunt,M.W.,Mauricio, I.L.(2009)."ThemolecularepidemiologyandphylogeographyofTrypanosomacruziand

36

parallelresearchonLeishmania:lookingbackandtothefuture.."Parasitology136:1509 1528. Miles,M.A.,Toye,P.J.,Oswald,S.C.,Godfrey,D.G.,.(1977)."Theidentificationbyisoenzyme patternsoftwodistinctstraingroupsofTrypanosomacruzi,circulatingindependentlyina ruralareaofBrazil.."TransactionsoftheRoyalSocietyofTropicalMedicineandHygiene71: 217225. Minch,E.,RuzLinaresA,GoldsteinD,FeldmanM,CavalliSforzaL(1995)."MICROSATThe MicrosatelliteDistanceProgram.."Stanford:StanfordUniversityPress. Mosley,P.(2001)"MicrofinanceandPovertyinBolivia."JournalofDevelopmentStudies37. Noireau,F.C.,M.R.;Monteiro,F.A.;JansenA.M.;Torrico,F.(2005)."CanwildTriatomainfestansfoci inBolviajeopardizeChagasdiseasecontrolefforts?"TrendsParasitology21:710. OcanaMayorga,S.M.S.L.,JaimeA.Costales,MichaelA.Miles,MarioJ.Grijalva(2010)."Sex, Subdivision,andDomesticDispersalofTrypanosomacruziLineageIinSouthernEcuador." PLOS4(12):915923. Oliveira,R.,BroudeNE,MacedoAM,CantorCR,SmithCL,PenaSDJ(1998)."Probingthegenetic populationstructureofTrypanosomacruziwithpolymorphicmicrosatellites."ProcNatlAcad SciUSA95:37763780. Peakall,R.,SmouseP(2006)."GENALEX6:geneticanalysisinExcel.Populationgeneticsoftwarefor teachingandresearch.."MolecularEcologyNotes6:288295. PirezCrespo,C.A.(1991)."WhyDoPeopleMigrate?InternalMigrationandthePatternofCapital AccumulationinBolivia."InstituteforDevelopmentAnthropologyIDA74:135. Prugnolle,F.,DeMeeus,T.,.(2010)."Apparenthighrecombinationratesinclonalparasitic organismsduetoinappropriatesamplingdesign.."Heredity104:135140. Ramrez,J.D.,Guhl,F.,Rendon,L.M.,(2010)."Chagascardiomyopathymanifestationsand Trypanosomacruzigenotypescirculatinginchronicchagasicpatients."PloSNegl.Trop.Dis. 4. Rozas,M.D.D.,S.;Adaui,V.;Coronado,X.;Barnab,C.;Tibyarenc,M.;Solari,A.;Dujardin,J.C.(2007). "MultilocusPolymeraseChainReactionRestrictionFragmentLengthPolymorphism GenotypingofTrypanosomacruzi(ChagasDisease):TaxonomicandClinicalApplications." TheJournalofInfectiousDiseases195:13811388. Schwenkenbecher,J.M.,Wirth,T.,Schnur,L.F.,Jaffe,C.L.,Schallig,H.,(2006)."Microsatellite analysisrevealsgeneticstructureofLeishmaniatropica."InternationalJournalfor Parasitology36:237246. Souto,R.P.,Vargas,N.&Zingales,B.(1999)."Trypanosomarangeli:discriminationfrom TrypanosomacruzibasedonavariabledomainfromthelargesubunitribosomalRNAgene" ExpParasitol91:306314. Stevens,J.R.N.,H.A.;Fover,G.A.;Gibson,W;C.(1998)."Theancientanddivergentoriginsofthe humanpathogenictrypanosomes,TrypanosomabruceiandT.cruzi."Parasitology118:107 116. Sturm,N.E.C.,D.A.(2010)."Alternativelifestyles:ThepopulationstructureofTrypanosomacruzi." ActaTropica115:3543. Tait,A.M.,LJ,.Duffy,CW;,Coopera,A.Turner,R;Macleod,A.(2011)."Trypanosomegenetics: Populations,phenotypesanddiversity."VeterinaryParasitology181:6168. ThermoScientific(2008)."NanoDrop1000SpectrophotometerV3.7UsersManual"ThermoFisher ScientificInc. Travi,B.J.,C.,Montoya,J.,Segura,I,Velez,D.(1994)."Didelphismarsupialis,animportantreservoir oftrypanosoma(schizotrypanum)cruziandleishmania(leishmania)chagasiincolombia." Am.J.Trop.Med.Hyg.50(5):557565. Wastling,S.L.W.,S.C.(2011)."Diagnosisofhumansleepingsickness:senseandsensitivity."Trends inParasitologySeptember2011,Vol.27,No.927(9):394403. Weiss,L.M.K.,L.V.(2011).AdvancesinParasitology,partAChagasDisease.

37

Welch,D.M.M.,M.(2000)."EvidencefortheEvolutionofBdelloidRotifersWithoutSexual ReproductionorGeneticExchange."Science288:12211226. Westernberger,S.J.B.,C.;Campbell,D.A.;Sturnm,N.R.(2005)."TwoHybridizationEventsDefine thePopulationStructureofTrypanosomacruzi."Genetics171:527543. Widmer,G.,Dvorak,J.A.&Miles,M.A.(1987)."Temperaturemodulationofgrowthratesand glucosephosphateisomeraseisozymeactivityinTrypanosomacruzi"MolBiochemParasitol 23:5562. Wright,S.(1965)."TheinterpretationofpopulationstructurebyFstatisticswithspecialregardto systemsofmating.."Evolution19,395420.19:395420. Yeo,M.A.,N;Llewellyn,M.;Sanchezc,H.;Adamsona,S.;MilesaG.;Lopezb,E.;Gonzalezb,N;. Pattersona,J.;Gaunta,M.;RojasdeAriasb,A.;Miles,M.(2005)."OriginsofChagasdisease: DidelphisspeciesarenaturalhostsofTrypanosomacruziIandarmadilloshostsof TrypanosomacruziII,includinghybrids."InternationalJournalforParasitology35:225233. Yeo,M.l.,M.D.;Carrasco,H.J.;Acosta,N.;Llewellym,M.;Miles,M.A.(2007)."Resolutionof multiclonalinfectionsofTrypanosomacruzifromnaturallyinfectedtriatominebugsand fromexperimentallyinfectedmicebydirectplatingonasensitivesolidmedium." InternationalJournalforParasitology37:111120. Zingales,B.,Andrade,S.G.,Briones,M.R.S.,Campbell,D.A.,Chiari,E.,Fernandes,O.,Guhl,F.,Lages Silva,E.,Macedo,A.M.,Machado,C.R.,Miles,M.A.,Romanha,A.J.,Sturm,N.R.,Tibayrenc, M.,Schijman,A.G.,.(2009)."AnewconsensusforTrypanosomacruziintraspecific nomenclature:secondrevisionmeetingrecommendsTcItoTcVI."MemriasdoInstituto OswaldoCruz104:10511054.

38

39

AnnexeA:Dataset
Samples CV05(172) CV06(171) CV044(292) CV057(294) CV059(236) CV172(237) CV180 CV181(274) CV225(276) CV254(442) CV255(507) CV073(240) CV094(246) CV095(268) CV096(269) CV097(297) CV099(248) CV065(278) CV108(270) CV111(271) CV113(298) CV116(251) CV118(272) CV126(303) CV141(299) CV142(261) CV143(262) Host
R.robustus R.stali R.robustus T.infestans T.infestans T.infestans T.infestans T.infestans T.guasayana T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans

Transmission Cycle
silvestre silvestre silvestre silvestre silvestre silvestre intradomicilio intradomicilio silvestre peridomicilio silvestre intradomicilio intradomicilio intradomicilio intradomicilio intradomicilio intradomicilio silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre

Numbercorresponding toNJtree Figure5 NoAmplification 43 28 73 68 9 38AB 88 74AB NoAmplification 59ABC 4 5 3 8 6 7 75AB 70 58ABC 64AB 71ABC 62ABC 69AB 10 92 89

Clones

3 3 3 3 2

Genotype TCI TCI TCI TCI TCI TCIII TCI TCI TCI TCI TCI TCIII TCIII TCIII TCIII TCIII TCIII TCI TCI TCI TCI TCI TCI TCI TCIII TCI TCI

Localidad
Chapare/Sanjulian Chapare/Sanjulian Chapare/Sanjulian Campero/Peacolorada2 Campero/Ilicuni Campero/Peacolorada2 Campero/Huertas Campero/Peacolorada2 Campero/CaminoMesada ToroToro/JuloChico ToroToro/JuloChico Cordillera/Kuarirenda Cordillera/Tamachindi Cordillera/Tamachindi Cordillera/Tamachindi Cordillera/Tamachindi Cordillera/Tamachindi Quillacollo/Cotapachi Quillacollo/Cotapachi Quillacollo/Cotapachi Quillacollo/Cotapachi Quillacollo/Cotapachi Quillacollo/Cotapachi Quillacollo/Cotapachi ToroToro/JuloChico ToroToro/JuloChico ToroToro/JuloChico

Latitude
16.7167 16.7167

Longitude
65.6333 65.6333

17 18.1589
18.1589 18.1725 18.2441

66 64.8666
64.8666 64.8937 64.8615

18.2441
18.1950

64.8615
64.8635

msf 18.0123 19.1781 19.4763 19.4763 19.4763 19.4763 19.4763


-17.4249 -17.4249 -17.4249 -17.4249 -17.4249 -17.4240 -17.4240

msf 65.8083 62.5309 62.5665 62.5665 62.5665 62.5665 62.5665


-66.2947 -66.2947 -66.2947 -66.2947 -66.2947 -66.2934 -66.2934

18.0122 18.0120 18.0120

65.8097 65.8097 65.8097 1

AnnexeA:Dataset
CV144(280) CV145(263) CV147(265) CV148(273) CV149(305) CV242(306) CV243(307) CV244(308) CV245(309) CV249 CV256 CV257 CV258 CV263 CV130(256) CV132 CV133(254) CV134(255) CV136(258) CV139(260) HCM152 HCM178 HCM173 HCM007 CUIF59 PCC240(513) PCC289(454) CVLF73
T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans T.infestans Didelphysmarsupialis Didelphysmarsupialis Didelphysmarsupialis Didelphysmarsupialis Didelphysmarsupialis Human Human Human silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre 91ABC 90ABC 79ABC 85ABC 87 86 80 84 76ABC 81ABC 60ABC 78ABC 77AB 83 57ABC 55 67AB NoAmplification 52ABC 53ABC 72ABC 37ABC 50 29 2 56ABC 63ABC 65
3 3 2 3 3 3 3 3 3

3
3 2

TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI

ToroToro/JuloChico ToroToro/JuloChico ToroToro/JuloChico ToroToro/JuloChico ToroToro/JuloChico ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande ToroToroJulo/JuloGrande Tupiza/Urulica Tupiza/Urulica Tupiza/Urulica Tupiza/Urulica Tupiza/Urulica Tupiza/Palquiza Omereque Chapare Chapare Chapare

18.0121 18.0121 18.0123 18.0122 18.0122 18.0160 18.0160 18.0160 18.0160 18.0123 18.0123 18.0123 18.0123 18.0123 21.5944 21.5944 21.5944 21.5944 21.5944 21.5292
-18.139066 -16.584809 -16.636986 -16.647097

65.8096 65.8096 65.8088 65.8091 65.8091 65.8000 65.8000 65.8000 65.8000 65.8083 65.8083 65.8083 65.8083 65.8083 65.8322 65.8322 65.8322 65.8322 65.8322 65.7513
64.873783 65.515964 65.584039 65.581161

3 3
3
3

AnnexeA:Dataset
CV48 CV131(252) CV137(259) CotMa22 CotMa38 Cotma9 KayMa13 KayMa17 KayMa19 KayMa21 MERC10 NUAL1 SCRI6 sjm22 sjm23 sjm25 sjm26 sjm3 sjm32 sjm33 sjm34 sjm35 sjm37 sjm39 sjm41
T.infestans T.infestans Akodonsp.(subfuscus) Akodonsp.(subfuscus) Phylotis Dasypusnovemcintus Dasypusnovemcintus Dasypusnovemcintus Dasypusnovemcintus Rhodniusrobustus Rhodniuspictipes Philanderopossum Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Philanderopossum Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Philanderopossum silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre 1 54AB 66AB 61 82 16 18 19 15AA' 17 42 30ABCDEF 48 44 33 27 45 24 31 34 41 25 23 39 32 TcIII 2
2 SudChichas SudChichas Cotopachi,Cochambamba, Bolivia Cotopachi,Cochambamba, Bolivia Cotopachi,Cochambamba, Bolivia Kayne,SantaCruz,Bolivia Kayne,SantaCruz,Bolivia Kayne,SantaCruz,Bolivia Kayne,SantaCruz,Bolivia Mercedes NuevaAlianza SanCristobal SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia SanJuandeAguasDulces, Beni,Bolivia

TCI TCI TCI TCI


TcIII TcIII TcIII TcIII TcIII TcIII

18.3179 21.5944 CL4,5


-17.43 -17.43 -17.43 -17.5 -17.5 -17.5 -17.5

64.6788 65.8322
-66.283 -66.283 -66.283 -61.5 -61.5 -61.5 -61.5

TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI

14.73 15.03
-14.13 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81 -14.81

65.73 64.33
-66.92 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6 -64.6

AnnexeA:Dataset
sjmc7 SJMo11 SJMo18 SJMo3 SJMo3 SJMo4 SJMo9 SJMoR20 SJMoR21 SJMoR22 SJMoR23 SJMoR29 SJMoR30 SMA16 SMA19 SMA2 SMA4 SMA6 SMA9 SMR37 MA222
Scuireussp. Didelphismarsupialis Dasypusnovemcinctus Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Rhodniuspictipes Rhodniuspictipes Rhodniuspictipes Rhodniuspictipes Rhodnius Rhodnius Dasypusnovemcinctus Dasypusnovemcinctus Didelphismarsupialis Didelphismarsupialis Didelphismarsupialis Dasypusnovemcinctus Rhodnius Euphractussexcinctus silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre silvestre 26 47 14 36AB NoAmplification NoAmplification 35 21 NoAmplification 22 20 NoAmplification 46 13 NoAmplification 49 NoAmplification 40 11 51 12

TCI TCI
TcIII

SanJuandeAguasDulces, Beni,Bolivia SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SanJuandeMocovi SantaMariadeApere SantaMariadeApere SantaMariadeApere SantaMariadeApere SantaMariadeApere SantaMariadeApere SantaMaria SantaCruz,Bolivia

-14.81

-64.6

TCI TCI TCI TCI TCI TCI TCI TCI TCI TCI
TcIII TcIII

TCI TCI TCI


TcIII

TCI TCI

15.116 15.116 15.116 15.116 15.116 15.116 15.116 15.116 15.116 15.116 15.116 15.116 14.13 14.13 14.13 14.13 14.13 14.13 14.13
-19.21

64.316 64.316 64.316 64.316 64.316 64.316 64.316 64.316 64.316 64.316 64.316 64.316 65.36 65.36 65.36 65.36 65.36 65.36 65.36
-63.43

Isolates

TcI TcIII

128 18

Clones 84 None

original 44 18

Total

145

London School of Hygiene & Tropical Medicine


(University of London)

Combined Academic, Risk assessment and Ethics (CARE) approval form for MSc Project Reports
*This form must be completed electronically. For detailed guidance, please refer to the Project Handbook for your course.

SECTION 1 STUDENT AND COURSE INFORMATION


MSc DETAILS AND DEADLINES (deadlines to be communicated by Course Director) Academic Year MSc course (and stream, where applicable) Deadline for Supervisor approval Deadline for Course Director approval Deadline for submission to Ethics Committee Target for approved form to be passed to TSO Friday 25 March 2011 Friday 13 May 2011 2010-11 Control of Infectious Diseases

STUDENT AND SUPERVISOR DETAILS (to be completed by student) Full name of student Student email address Year of study (part-time students only) Supervisor name Supervisor email address Supervisor institution/organisation Supervisor status (at time of this version of the form being completed) Name of personal tutor (where Supervisor is still to be identified) First Year Martin Llewellyn martin.llewellyn@lshtm.ac.uk LSHTM Confirmed Martin Llewellyn Provisional Still to be identified Second Year 100754

SECTION 2 APPROVAL AND SUBMISSION STATUS


*Students please note: It is a requirement of your LSHTM degree that you obtain all required approvals before beginning your project work. Your Supervisor and Course Director must specifically give Risk Assessment approval. Ethics approval must also be obtained where necessary (answers in Section 5 will help determine if this is required or not). STUDENT DECLARATION (to be completed for all projects) I agree to conduct my project on the basis set out in this form, and to consult staff (initially, my Supervisor) if making any subsequent changes especially any that would affect the information given with respect to ethics approval. I agree to comply with the relevant safety requirements, and will submit a separate request for LSHTM travel insurance where relevant. *Where seeking ethics approval for a study involving human subjects, please also attach copies of any information sheets, consent forms, and other relevant documents. Date of declaration 28-02-2011

Please save the electronic file of this CARE form in the format [MSc title]_[Year of Submission]_[Surname]_[Forename]_CARE You will also be required to submit a copy of this CARE form with your final written-up project. This should be anonymised, i.e. with your name and email address removed.
1 of 12

STAFF APPROVAL *Staff please note: Sections 3 and 4 of the form should be completed by the student before you give approval. Rather than sign this form, you should email the student and explicitly confirm approval, e.g. stating In my role as supervisor, I approve the attached form. The student is then responsible for updating the form and passing it on to any other staff. However if you would answer no to any of the Yes/No questions below, or disagree with any of the statements given, or have any other concerns, then you should not give approval. Instead, please contact the student immediately to inform them of your concerns and discuss changes which they may need to make before you may be willing to give approval. Please also be aware that in the exceptional case of a request to undertake a project in a country or region to which the Foreign & Commonwealth Office advise against travel, the student would need to fill out a separate form which will then need further School-level approval by the Safety Manager and Secretary & Registrar. SUPERVISORS APPROVAL (required for all projects this approval should be given first) Supervisor has agreed that Section 3 of this form is a reasonable summary of the proposed project. Supervisor has agreed that responses in Section 4 of this form address the main risks connected with a project of this nature. Name of Supervisor (if not yet identified, personal tutor or Course Director should approve) Date of approval Martin Llewellyn 2011-03-02 Yes Yes No No

COURSE DIRECTORS APPROVAL (required for all projects should follow Supervisor approval) Course Director has agreed that the proposed projects academic content, set out at Section 3 of this form, is suitable for this MSc. Course Director has agreed that responses in Section 4 of this form address the main risks connected with a project of this nature. Name of Course Director (or nominee) Date of approval Michael Miles 2011-04-11 Yes Yes No No

FACULTY SAFETY SUPERVISORS APPROVAL (only required if project involves working with
pathogenic organisms, human blood or radiochemicals should follow Supervisor approval)

Faculty Safety Supervisor has agreed that the proposed project, as set out in this form and particularly Section 4, may proceed. Name of Faculty Safety Supervisor (or nominee) Date of approval

Yes

No

ETHICS APPROVAL (required for all projects involving human subjects or human data, except for
public domain data that cannot enable the identification of living people NB that Supervisor approval must have been received before the application is submitted to the Ethics Committee)

The Ethics Committee has approved the project proposal set out on this form. Date of approval Ethics Committee application number assigned 2011-04-04 010/39

Yes

No

2 of 12

SECTION 3 APPLICATION FOR ACADEMIC APPROVAL


*All students should complete all sub-sections (3.1, 3.2 and 3.3). If particular questions are not applicable to you then please write N/A. 3.1 PROJECT OUTLINE (should not normally exceed 750 words total) Proposed project title: (should not normally exceed 20 words)

"ThemolecularepidemiologyofT.cruzitransmissioninCochabamba,Bolivia
Proposed project type: *See course-specific section of Project Handbook for details of project types permitted for each MSc. Be aware that restrictions may apply for individual courses.

Laboratory based research


Proposed project length: *For almost all students, this will be Standard. Long and extended projects are only available for certain ITD courses; they have a different schedule and allow a slightly greater word count. Standard Long Extended

Background: (about 200 words) *Indicate why this topic is of interest or relevance. *If the project involves work with a specific organisation please give details. *Please give any other details specifically relevant for consideration by the Ethics Committee, e.g. related to purpose.

TheagentofChagasdisease,Trypanosomacruzi,isahighlygeneticallydiverse.Sixgenotypeshave beenreported,butitsgeneticdiversityhasnotbeenfullyinvestigated.Thedevelopmentof molecularmethodshaveplayedanimportantroleinunderstandingitsepidemiologyandrevealed twodifferenttypesofT.cruzitransmission(domesticandsilvatic).Multilocusmicrosatellite (MLMT)isapopulationgeneticapproachwhichallowstheinvestigationoflocalmolecular epidemiologicalphenomena. TcIisthemajorgenotypepresentinBolivia.Somepreviousresearchhasbeencarriedoutinthe regionofCochabambainordertounderstandthelocalparasitetransmission,butfurtherworkis requiredtounderstandthelocaltransmissioninmoreextent.Thisprojectaimstocharacterisea totalofc100samplesusingMLMTanalysis.Thesampleswerecollectedfromhumanandwild reservoirbetween2003and2007.Theparasiteisolatesweresampledwithin2kmofCochabamba suburb,wheretheactivetransmissionoccurs.Thegeneticanalysiswillrevealwhethersilvatic parasitesareinvasivetodomesticsetting,orifthetransmissionintheperiurbanareasisdueto thedomesticstrains.
Hypothesis: (about 30 words, where applicable) Wild T. cruzi transmission cycles represent an continual invasive threat to suburban domestic transmission. Overall aim of project: (about 30 words) To establish the nature of T. cruzi transmission around Cochabamba and assist with the identification of risk factors for human transmission. Specific objectives of project: (about 70 words)

AssembleDNAsamplesfromc.100T.cruzistrainscollectedaroundCochabambainsitu
Assemble metadata associated with samples. Provide training to Bolivian counterpart in molecular biological techniques involved (personal training will be acquired in London prior to visit) Genotype samples initially using PCR-RFLP Analyse samples using panel of microsatellite markers Undertake population genetic analysis of resulting data
3 of 12

Feedback conclusions to participating authorities to assist with local disease control and surveillance

Proposed methods: (about 200 words) *Please summarise methods, and include any relevant details for consideration by the Ethics Committee such as numbers of participants and procedures to be performed.

ThedatatobeusedfortheprojecthavealreadybeencollectedbyUniversidadMayordeSan Simon,CochabambaaspartofanECFP7Consortiumgrant,ofwhichtheLSHTMiscoordinator. Thefollowingmethodswillbeemployed: PCRRFLP(trainingwillbeprovidedatLSHTMpriortotrip) DNAsequencing(trainingwillbeprovidedatLSHTMpriortotrip) Fragmentanalysis(trainingwillbeprovidedatLSHTMpriortotrip) Phylogenetic/populationgeneticanalysis(trainingwillbeprovidedatLSHTMpriortotrip) Limitedspatialanalysis(ArcView)inconjunctionwithgeneticdata DataanalysiswillbecompletedinLondon.


References: (max 150 words) *List any key references which will shape the project, including for methods to be used. It should not normally be necessary to quote more than 5 references.

MartinS.Llewellyn,M.A.M.,HernanJ.Carrasco,MichaelD.Lewis,MatthewYeo,JorgeVargas,Faustino Torrico,PatricioDiosque,VeraValente,SebastiaoA.Valente,MichaelW.Gaunt,GenomeScale MultilocusMicrosatelliteTypingofTrypanosomacruziDiscreteTypingUnitIRevealsPhylogeographic StructureandSpecificGenotypesLinkedtoHumanInfection.PLoSPathogens,2009.5(5):p.19. Miles,L.,M,A.,MichaelD.Lewis,MatthewYeo,Themolecularepidemiologyandphylogeographyof TrypanosomacruziandparallelresearchonLeishmania:lookingbackandtothefuture.Parasitology, 2009.136:p.15091528.


Prior work: (only where relevant; max 100 words) *Indicate any previous work you have done related to this project topic, including student work, professional work, or publications.

3.2 FEASIBILITY (about 100 words total but can write more or write less if appropriate) What could cause this project to fail, i.e. prevent you from achieving your objectives? *Please indicate any aspects of your proposed approach which could potentially experience difficulties, e.g. delays with permissions, data collection or storage problems, lack of sufficient comparable information, etc. You may also wish to mention any wider matters which could affect your project, e.g. civil unrest, natural disasters, transport availability. 1) Political instability Unlikely in Bolivia, however a large database of samples are also stored in London that could be subjected to analysis What alternative plans do you have in case you encounter any of the potential problems you have identified? Large database of samples are also stored in London that could be subjected to analysis 3.3 INTELLECTUAL PROPERTY, COPYRIGHT AND OTHER PERMISSIONS *Please also see Section 5.2 regarding any specific data rights limitations arising from local ethics or research governance requirements If you expect to use existing data, how will you obtain it and what permissions will be required? All data are from ChagasEpiNet programme http://www.ki.se/chagasepinet/description.html Having considered whether intellectual property rights (IPR) or copyright issues may affect your project, will any specific agreements be required?
4 of 12

*Please tick all boxes that apply, and attach copies of any forms/agreements (even if in draft). No specific IPR, Copyright or permissions issues should apply to this project (student retains Copyright and related IPR by default, in line with LSHTM registration declaration) IPR to be retained by LSHTM (specific LSHTM form to be completed) Copyright to be transferred to LSHTM (specific LSHTM form to be completed) IPR, Copyright or other agreements/permissions required with external parties/organisations Please give any further relevant details about IPR, copyright or other permissions.

SECTION 4 APPLICATION FOR RISK ASSESSMENT APPROVAL


*All students should answer all questions in sub-section 4.1; this will make clear which of the subsequent sub-sections you need to complete. Ensuring safety during project work is the responsibility of each individual student, and not of LSHTM or LSHTM staff. *Please see the Project Handbook for further guidance. 4.1 TYPE OF RISK (to be completed by all students) Where will the project be carried out? (please tick all that apply) *Note that work away from LSHTM or outside the UK means any form of work for your project, not just primary data collection. Some courses may have specific restrictions on this. All work will take place either at LSHTM, in libraries in the UK, or at my personal residence in the UK. [If so, you do not need to complete either section 4.2 or section 4.3] Some work will take place in the UK that is away from LSHTM sites in London, is non-Library-based, and is not at my personal residence. [If so, section 4.2 on Work away from LSHTM must be completed] Some work will take place at my personal residence outside the UK [If so, section 4.3 on Work outside the UK must be completed] Some work will take place outside the UK that is not at my personal residence [If so, both sections 4.2 and 4.3 on Work away from LSHTM and Work outside the UK must be completed] Will the project involve working with or handling any of the following materials? Pathogenic organisms Human blood Radiochemicals Yes Yes Yes No No No

[If Yes to any of the above, Sections 4.4 and 4.5 must be completed] Are any other potentially hazardous activities likely to be carried out during the project? Yes No [If Yes, Section 4.5 must be completed] Do any special requirements (e.g. disability-related issues) or other concerns need to be taken into account for either you as a student, study participants or colleagues? Yes No [If Yes, Section 4.6 must be completed] 4.2 WORK AWAY FROM LSHTM (to be completed if any work will be done away from LSHTM, other than at your home or at libraries elsewhere in the UK) Will the project be based in an established hospital, college, research institute, NGO headquarters, field station or other institutional site? If Yes, please give the name and location of the site(s); describe approximately what proportions of your project will be spent there; and state name and role of person who has confirmed willingness to support you at each site (indicating extent of correspondence, especially what they have confirmed in writing).
5 of 12

Yes

No

Universidad Mayor de San Simon, Cochabamba, Bolivia Will you have an external supervisor, co-supervisor or other main advisor, or be working with any specific organisation(s), during your work away from LSHTM? If Yes, please indicate the name, role, contact details, and level of support that any such external advisors are expected to provide, and give details about any organisations you will be working with. Yes No

Will the project involve personal visits, interviews or interactions with people in their homes, workplaces, community settings or similar? If Yes, please give details, including approximately what proportion of your project this will involve.

Yes

No

Will the project involve lone/isolated work or significant travel? If Yes, please give details, including approximately what proportion of your project this will involve, and state how you can be contacted while working or travelling.

Yes

No

What arrangements are proposed for contact with your main supervisor while you are away from LSHTM? Indicate expected ease and frequency of contact, and communication methods to be used. internet Please tick to confirm: I have read the LSHTM Code of Practice on off-site work.

4.3 WORK OUTSIDE THE UK (to be completed if any work will be done outside the UK) What form of project work will be undertaken outside the UK? (please tick all that apply) Work at my family home or personal residence only Work at an established hospital, college, research institute, NGO headquarters, field station or other institutional site Work away from my personal residence or an established site *Note that for either the second or third options, you should also have completed Section 4.2. Name the country/countries and region(s) in which work will be undertaken: Country or countries: Bolivia Region(s) : Cochabamba Yes No

Do the Foreign & Commonwealth Offices (FCO) Travel Advice Notices (www.fco.gov.uk/en/travelling-and-living-overseas/travel-advice-by-country/) advise against travel to the regions(s), country or countries involved?
*Note that if Yes, the School will not normally permit such travel for project work. In exceptional circumstances only, requests may be considered by the Safety Committee and require approval by the Safety Manager and Secretary & Registrar.

Please tick to confirm:

I understand that LSHTM travel insurance is required for any international travel as part of my project. *Travel insurance can be applied for using a separate form.

4.4 WORK WITH HAZARDOUS SUBSTANCES (to be completed if the project involves any work with pathogenic organisms, human blood or radiochemicals NB that this will require approval by the Faculty Safety Supervisor) Name the organism or organisms to be used:

Identify all potential routes of infection:

Name the radiochemical or radiochemicals to be used:


6 of 12

List laboratories where work with pathogens or radioisotopes will be carried out:

List disinfectants to be used, and describe arrangements for disposal of used material:

Will or might Health Surveillance be required for you or any staff working with you? If Yes, please give details.

Yes

No

4.5 PRECAUTIONS AGAINST HAZARDS (to be completed if any potentially hazardous activities are likely to be carried out during the project. Refer to Project Handbook and School safety documentation for further information. Faculty Safety Supervisors approval may be further requested where felt appropriate by project Supervisor.) Indicate any procedures, activities or aspects of the proposed project which may entail hazards (including work with hazardous substances as per Section 4.4, or anything else relevant). Please set distinct hazards out separately, in a numbered list.

Indicate the precautions you will take to prevent or mitigate such potential hazards. Please number these to refer to the specific hazards identified in the preceding question.

4.6 SPECIAL REQUIREMENTS (to be completed if the project involves any special requirements, e.g. disability-related issues, or other concerns that need to be taken into account for either you as a student, study participants or colleagues) What special requirements or concerns need to be taken into account?

Do these need to be considered in planning arrangements? If Yes, please give details.

Yes

No

Do these impact on supervision arrangements? If Yes, please give details.

Yes

No

Does the project location need to be considered in relation to these? If Yes, please give details.

Yes

No

Do arrangements for access to specialist medical treatment need to be considered? If Yes, please give details.

Yes

No

SECTION 5 APPLICATION FOR ETHICS APPROVAL


*All students should answer all questions in sub-sections 5.1 and 5.2. Answers to 5.1 will make clear whether approval by the LSHTM Ethics Committee is necessary, and which later sub-sections you may need to complete. Section 5.2 covers any external approvals required. *Before completing this part of the form, please read the Ethics Approval Policy & Procedure plus guidance notes at http://intra.lshtm.ac.uk/reference/forms/ethicsstuds.html . This describes what to do next if formal LSHTM ethics approval is required. NB that supervisor approval must be obtained before an application is submitted to the Ethics Committee.
7 of 12

5.1 SCOPE OF STUDY (to be completed by all students) Which of the following applies to your project? (please tick one option only) *Note the term human data includes any documentary data, datasets or biological samples. Project does not involve any human subjects or any human data. [If so, formal LSHTM ethics approval is not required and you do not need to complete Sections 5.3 or 5.4] Project involves human data, but all this human data is fully in the public domain. [If so, formal LSHTM ethics approval is not required and you do not need to complete Sections 5.3 or 5.4] *Public domain human data must be: available to any member of the public without special permission; to which access is not restricted in any way; and which does not enable the identification of living people, either directly or by linking to other data. Project involves some non-public-domain human data, all of which was previously collected in another study or studies. [If so, formal LSHTM ethics approval is required and Section 5.3 must be completed] Project involves some additional collection of data, further to an ongoing or previously completed study or studies. [If so, formal LSHTM ethics approval is required and Section 5.4 must be completed] Project is a completely new study which will involve human subjects or human data. [If so, formal LSHTM ethics approval is required and Section 5.4 must be completed] 5.2 LOCAL ETHICS APPROVAL OR RESEARCH GOVERNANCE APPROVAL (to be completed by all students) *As well as approval from the LSHTM Ethics Committee, projects may require specific approval from other involved or responsible bodies. For example, in the UK you may need specific authorisation to work in an NHS facility, or to work with vulnerable groups such as patients or children. Outside the UK a wide range of requirements may apply e.g. from local or national Ethics Committees, government departments etc. Students must investigate all potential local approval required for your project work. Failure to check or gain any necessary external approval may invalidate LSHTM approval. Is local approval required for the work being done (whether this approval is still to be obtained, or has already been granted)? *This should include any forms of ethics approval, research governance approval or other specific permissions that may apply. If Yes, give details of local approval to be obtained (this must be in place before commencing fieldwork) or which has already been granted. *Please name all bodies whose approval is required, or indicate where work is expected to take place using permissions already granted for a parent project. Where approval has already been granted, quote approval reference numbers and if possible give web links to documents. If No, explain why formal local approval is not required, and describe any less formal permissions, invitations or support you are being given for this work. *If you will be working away from LSHTM with human subjects or human data, but cannot identify a local Ethics Committee or believe that no formal approval is required, then please give details and explain what you have done to check this. In such cases, if you do not have formal approval you should always demonstrate appropriate local support, such as correspondence with local government officials or an involved Non-Governmental Organisation. No local ethics approval is required as the project is incorporated into Chagas EpiNet. http://www.ki.se/chagasepinet/ For data to be used or collected in the project, will any specific data rights permissions be required or usage limitations apply? Yes No Yes No

5.3 PROJECTS USING ONLY PREVIOUSLY-COLLECTED HUMAN DATA (to be completed if project involves non-public-domain human data, datasets or biological samples previously collected in another study or studies; if collecting any new data, complete Section 5.4 instead)
8 of 12

*Further guidance is given at http://intra.lshtm.ac.uk/reference/forms/ethicsstuds.html Summary of purpose and methods of the original study or studies: (max 100 words) ChagasEpiNet is a European Union Seventh Framework Program funded project whose aim is to elucidate the epidemiology of the genetic lineages of Trypanosoma cruzi for improved understanding and prevention of Chagas disease. http://www.ki.se/chagasepinet/description.html Aims: Improve and standardise techniques for genotyping T. cruzi. Improve our understanding of the population genetics of T. cruzi Sequence the genome of T. cruzi lineage I. Develop lineage specific immunological diagnosis. Pilot studies to evaluate T. cruzi lineage specific associations with: 1) Clinical outcome; 2) Congenital infection; 3) Cellular infectivity; & 4) Susceptibility to trypanocidal drugs. Give details of all approvals under which the original study or studies took place: *Please quote names of Ethics Committees and approval reference numbers (required if previous approval was from LSHTM); if possible give web link to original study application. http://www.ki.se/chagasepinet/description.html http://ec.europa.eu/research/health/infectious-diseases/neglecteddiseases/projects/003_en.html

Proposed study: Ensure that the project outline given in Section 3.1 states the purpose, methods and procedures of the new work to be done in your project, and describes how this builds on the previous study or studies (for which participants will already have been recruited, data or samples collected, and procedures performed). Do not reproduce here. Will your analyses be for purposes not covered by the original application detailed above? If Yes, indicate how you will obtain (i) permission to use the data from the principal investigator responsible for each original study; and (ii) retrospective consent, where appropriate, from the participants in each original study. Yes No

Does the project involve analysis of documentary information and/or data already collected from or about human subjects? If Yes, specify analyses briefly.

Yes

No

Does the project involve laboratory analysis of human biological samples already collected, or new or additional analysis of stored samples? If Yes, specify the laboratory analyses or tests to be performed.

Yes

No

Specify how confidentiality will be maintained. When small numbers are involved, indicate how possible identification of individuals will be avoided.

9 of 12

5.4 PROJECTS COLLECTING ANY NEW HUMAN DATA (to be completed if project involves collection of human data, datasets or human biological samples either as a completely new study, or collecting additional data further to an ongoing or previously completed study) *Further guidance is given at http://intra.lshtm.ac.uk/reference/forms/ethicsstuds.html Proposed study: Ensure that the project outline given in Section 3.1 contains sufficient detail (inc. purpose, methods, procedures for both new data collection and any work building on previous studies), so as to allow the Ethics Committee to make an informed decision without reference to other documents. Do not reproduce here. Is your project a randomised trial? Will any human biological samples be collected? If Yes, specify details. Yes No Yes No

Will any human biological material be stored at LSHTM for more than 24 hours? If Yes, specify which samples and how they will be stored. *Further guidance is given at http://intra.lshtm.ac.uk/safety/safety_manual_appendix_3__human_tissue_act.pdf

Yes No

Specify the number - with scientific justification for sample size age, gender, source and method of recruiting subjects for the study.

State the location and likely duration of new or additional human data collection, and the extent to which this will be carried out by you alone, or in collaboration with others, or by others.

State the potential distress, discomfort or hazards, and their likelihood, to which research subjects may be exposed (these may include physical, biological and/or psychological hazards). What precautions are being taken to control and modify these hazards?

Specify how confidentiality will be maintained. When small numbers are involved, indicate how possible identification of individuals will be avoided.

State the manner in which consent will be obtained from subjects and supply copies of the information sheet and consent form. Written consent is normally required. Where not possible, explain why and confirm that a record of those giving verbal consent will be kept. Where appropriate, please state if and how the information and consent form will be translated into local language(s).

As well as collecting new data, will your project also make use of any human data or biological samples collected in a previous study or studies? If Yes, summarise the purpose and methods of the original study or studies for which participants will already have been recruited, data or samples collected, and procedures performed. (max 100 words)

Yes No

10 of 12

EthicsApproval
From: MScEthics Monday - 4 April, 2011 9:42 AM To: MScEthics CC: Subject: Fwd: Ethics Application Approval 010/39

LONDON SCHOOL OF HYGIENE & TROPICAL MEDICINE RESEARCH ETHICS COMMITTEE Taught Course Project - Ethics Review Application No: Name: Title: 100754 The molecular epidemiology of T. cruzi transmission in Cochabamba, Bolivia 010/39

Approval of this study is granted by the Committee.

Professor Andy Hall Chair - LSHTM Research Ethics Committee -----------------------------------Paula Elliott Administrator LSHTM Ethics Committee London School of Hygiene & Tropical Medicine Keppel Street London WC1E 7HT Tel: 020 7927 2221


11 of 12

12 of 12