You are on page 1of 13

Cell Transplantation, Vol. 22, pp. 1061–1073, 2013 Printed in the USA. All rights reserved.

Copyright  2013 Cognizant Comm. Corp.

0963-6897/13 $90.00 + .00 DOI: http://dx.doi.org/10.3727/096368912X656036 E-ISSN 1555-3892 www.cognizantcommunication.com

Comparative Study of Human Dental Follicle Cell Sheets and Periodontal Ligament Cell Sheets for Periodontal Tissue Regeneration
Shujuan Guo,*†1 Weihua Guo,*1 Yi Ding,*† Jian Gong,*† Qing Zou,* Dan Xie,* Yali Chen,* Yafei Wu,*† and Weidong Tian*‡
*State Key Laboratory of Oral Diseases, Sichuan University, Chengdu, Sichuan, China †Department of Periodontology, West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan, China ‡Department of Oral and Maxillofacial Surgery, West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan, China

Periodontal ligament cell (PDLC) sheets have been shown to contribute to periodontal tissue regeneration. Dental follicle cells (DFCs), acknowledged as the precursor cells of PDLCs, have demonstrated stemness, embryonic features, heterogeneity, and pluripotency. Therefore, we hypothesized that DFC sheets might be more effective and suitable for periodontal tissue regeneration than PDLC sheets. In this study, we compared the biological characteristics of DFC sheets and PDLC sheets in vitro. To investigate the potential for periodontal tissue regeneration in vivo, complexes composed of two types of cell sheets combined with dentin matrix were implanted subcutaneously into nude mice for 6 weeks. Our results showed that, when forming cell sheets, DFCs secreted richer extracellular matrix than PDLCs. And compared to DFCs, DFC sheets expressed high levels of calcification-related genes, including alkaline phosphatase (alp), bone sialoprotein (bsp), osteopontin (opn), runt-related transcription factor (runx2), as well as the periodontal ligament-specific genes collagen III (col III) and periostin, while the gene expression of bsp, osteocalcin (ocn), and opn were greatly increased in PDLC sheets, when compared to PDLCs. col I expression did not change significantly. However, cementum protein 23 (cp-23) expression increased several fold in PDLC sheets compared to PDLCs but decreased in DFC sheets compared to DFCs. DFC and PDLC sheets were both positive for Collagen I (Col I), cementum attachment protein (CAP), ALP, BSP, OCN, and OPN protein expression, and Col I, ALP, BSP, and OPN expression were increased after cell sheets were formed. Furthermore, the levels of laminin and fibronectin were higher in DFCs and DFC sheets than that of PDLCs and PDLC sheets, respectively. In vivo, DFC and PDLC sheets could both regenerate periodontal tissue-like structures, but DFC sheets demonstrated stronger periodontal regeneration potential than PDLC sheets. Therefore, DFC sheets derived from discarded dental follicle tissue after tooth extraction may be more advantageous for clinical periodontal tissue regeneration in the future. Key words: Periodontal tissue regeneration; Cell sheets; Dental follicle cells (DFCs); Periodontal ligament cell (PDLCE)

INTRODUCTION Periodontitis is one of the most widespread diseases and is characterized by chronic inflammation of the supporting tissue of the tooth, eventually leading to tooth loss. The ultimate goal of periodontal treatment is the regeneration of periodontal tissue (18). However, conventional methods of periodontal tissue engineering, such as guided tissue regeneration (GTR) or application of various growth factors and regeneration materials, only result in partial regeneration, depending on the periodontal defects of the patient (2,28,35). This is likely due to the unique structures of periodontal tissue, which include

alveolar bone, cementum (hard tissue), and the connection between them—periodontal ligament (soft tissue). In addition, periodontitis leads to the destruction of periodontal tissue and loss of periodontal ligament cells, so it is often necessary to transplant cells into the periodontal defects (22). Therefore, suitable seed cells and an efficient regeneration system are crucial for the regeneration of the periodontium. The dental follicle is an ectomesenchyme-derived loose connective tissue sac surrounding the enamel organ and the dental papilla of the developing tooth germ before eruption. Dental follicle cells (DFCs) are the

Received August 24, 2011; final acceptance March 10, 2012. Online prepub date: September 21, 2012. 1 These authors provided equal contribution to this work. Address correspondence to Weidong Tian, Department of Oral and Maxillofacial Surgery, West China Hospital of Stomatology, Sichuan University, No. 14, 3rd Section, Renmin Nan Road, Chengdu, Sichuan, China 610041. Tel: +86-28-85503499; Fax: +86-28-85503499; E-mail: dove2002185@sina.com or Yafei Wu, Department of Periodontology, West China Hospital of Stomatology, Sichuan University, No. 14, 3rd Section, Renmin Nan Road, Chengdu, Sichuan, China 610041. Tel: +86-28-85503483; Fax: +86-28-85503499; E-mail: yafeiwu@tom.com

1061

20 µl). 550315. resuspended to a final concentration of 1 ´ 107 cells/ml and 100 µl was distributed into each tube. which were developed by Okano et al. DFCs contain more stem cells and show stronger differentiation potential.15. DFC sheets may possess more potential to regenerate periodon­ tal tissue that is structurally and functionally intact than PDLC sheets. As the precursor cells of PDLCs. and centrifuged to cell pellets (1. Flow Cytometry Analysis To test cell surface cluster of differentiation (CD) antigens.14. OMA1-06001). The secondary antibody used was fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgM at a dilution of 1:200. Subsequent steps were performed according to the manufacturer’s recommended protocol. washed twice with PBS. Hyclone). mouse monoclonal anti-vimentin at 1 µg/ml (Thermo.25. minced. In this study. FWA10. cell sheets provide a living microenvironment for seed cells. Human DFCs. 5 min). The dental follicle and periodontal ligament were carefully washed with phosphate-buffered saline (PBS) containing 100 units/ml penicillin and 100 mg/ml streptomycin. the stained cell samples were analyzed by flow cytometry (BD Biosciences). PDLC sheets have been used for periodontal tissue regeneration (5. Immunofluorescence Microscopy To identify cell surface markers and characteristics. 20 µl). thus providing a more efficient way to regenerate periodontal tissue. Finally. we explore the biological characteristics and capacities of the two kinds of cell sheets. which have been isolated from wisdom teeth (25). MATERIALS AND METHODS Human cell culture and animal experiments were approved by the ethics committee of Sichuan University. 100 units/ml penicillin. progenitor cells of cementoblasts. 100 µg/ml). Presently. Antibodies used included FITC-conjugated mouse antihuman CD31 (BD Biosciences. FWA10). washed twice with PBS containing 20% FBS. The control group was incubated with PBS instead of primary antibody. An additional goal of this work was to determine if DFCs have potential as a seed cell. which increases the application efficiency and reduces the inflammatory reaction and immunologic response often induced by foreign materials. and digested in a solution of 1% collagenase and 1% dispase (Sigma) sequentially for 40 min each at 37°C. and 110 µl fresh culture medium containing 10 µl of cell counting kit-8 (CCK-8) solution (Dojindo) was added to each well. are an embryonic-like stem cell population from dental germ that can be found in adults and express early neural progenitor markers and vascular endothelial growth factor receptors (3).1062 Guo ET AL. The cells were fixed with 4% polyoxymethylene for 10 min. periodontal ligament cells (PDLCs). Each experiment was performed using three wells per experimental condition. After 2 h of incubation in the dark. Human periodontal ligament was isolated from a first premolar extracted from an ortho­ dontic patient. and their potential for use in periodontal regeneration. The culture medium was discarded. Informed consent of patients was obtained for all human studies. F0118) and incubating for 30 min. and 100 mg/ml streptomycin. Subsequent steps were performed according to the manufacturer’s recommended protocol.42). ab49747) at a dilution of 1:800.43). DFCs and PDLCs were collected.000 rpm. 555445. Stro-1 was visualized by adding goat anti-mouse IgM-carboxyfluorescein secondary (R&D Systems. DFCs and PDLCs were collected. Cell sheets. Structural and functional periodontal tissue regene­ ration is difficult to achieve via conventional methods. cells were seeded into 96-well plates (5 ´ 103 cells/well). All samples were examined under a fluorescence microscope (Leica). CCK-8 Cell Proliferation Assay To detect cell proliferation. which is beneficial for periodontal regeneration. and mouse monoclonal anti-cytokeratin-14 (CK-14. Therefore. Both single cells and digested tissues were suspended in 3 ml complete a-modified minimum essential medium (a-MEM) supplemented with 15% fetal bovine serum (FBS. The culture medium was added to 2 ml after 24 h and changed every 2–3 days until cells were confluent. Transmission Electron Microscope (TEM) To observe cellular microstructure via transmission electron microscope. and the experiment lasted for seven continuous days. They were then fixed with 3% . Antibodies used included mouse monoclonal anti-Stro-1 at 10 µg/ml (R&D Systems. DFCs and PDLCs were seeded onto glass coverslips in a six-well plate (2 ´ 104 cells/well) and further cultured for 1 day. and osteoblasts (11. As a result. phycoerythrin (PE)-conjugated mouse anti-human CD146 (BD Biosciences. maintain their naturally formed networks without the use of proteolytic enzyme treatment or mechanical methods often employed to destroy the extracellular matrix and surface proteins (6). Abcam. in the 1990s. the absorbance was measured at 490 nm via a plate reader (Thermo). mouse anti-human Stro-1 (R&D Systems. Cell Culture Human dental follicle was isolated from an embedded third molar after extraction. They were seeded into a 25-cm2 plastic flask (Corning) and incubated at 37°C in 5% CO2 in a humidified atmosphere.

To induce adipogenic differentiation. Immunostaining controls were incubated with PBS instead of primary antibody. and 2 mM l-glutamine (Sigma). AB9568) at a dilution of 1:200.3 NM_000237. 1 µM hydroxycortisone. To induce neurogenic differentiation. To detect the protein expression. The cells were fixed with 4% polyoxymethylene for 10 min. the medium was replaced with complete a-MEM culture medium supplemented with 10% FBS. Western blot analyses were performed with samples normalized for protein concentration. rabbit polyclonal antialkaline phosphatase (ALP. ab3280. 1% osmium tetroxide for 10 min. NM_002046.3% Oil Red O (Sigma) solution to evaluate adipogenesis. ab6308.5 mM isobutyl-methylxanthine (IBMX. the medium was replaced with complete a-MEM culture medium supplemented with 10% FBS. The primers used are listed in Table 1. In Vitro Multidifferentiation of DFCs and PDLCs DFCs and PDLCs were seeded into a six-well plate (1 ´ 105 cells/well) separately and further cultured for 1 day. Cell Sheet Culture Cell sheets were cultured as described previously (45).1 BC000748. and a reverse transcription-polymerase chain reaction (RT-PCR) was performed to test the cell differentiation specific gene expression. After 2 days. rabbit polyclonal anti-bone sialoprotein (BSP.000). 10 mM b-glycerophosphate (Sigma). 2% dimethyl sulfoxide (DMSO).000). Western Blot Proteins were extracted from cells or cell sheets. and 10 nM dexamethasone (Sigma) for 14 days. 1:500). Membranes were probed with primary antibodies including mouse monoclonal anti-actin (actin.3 NM_000478. ab95462.4 NM_004967. 5 µg/ml insulin (Sigma). Table 1. and embedded with epoxide resin.2 . 10-8 M dexamethasone (Sigma). 2 mM insulin (Sigma). and 10 nM vitamin D3 (Sigma) for 14 days.REGENERATION OF PERIODONTIUM USING CELL SHEETS 1063 glutaric dialdehyde (pH 7. The samples were sliced into ultramicrocut and observed under transmission electron microscope (Hitachi). Scanning Electron Microscope (SEM) To observe cellular microstructure. 25 mM KCl. cell sheets were harvested after 4 weeks of culture. Third passage DFCs and PDLCs were separately subcultured into six-well plates (5 ´ 104 cells/well). dehydrated through a graded ethanol series. mouse monoclonal anti-collagen I (Col I. 1:1. cells were fixed and immunostained with rabbit monoclonal anti-neurofilament-L (NF. and observed under a scanning electron microscope (FEI). Sigma) and changed every 3 days until cell sheets formed.4) for 30 min. The Oligonucleotide Primer Sequences Utilized in the RT-PCR Gene GapdH lpl ppaR-γ alp bsp Neurofilament β-tubulin III Primers (5¢–3¢) F: gagccaaaagggtcatcatctc R: aaaggtggaggagtgggtgtc F: cagagagaggacttggagatgtg R: gcctgattggtatgggtttcac F: ggtgactttatggagcccaagt R: gactcatgtctgtctccgtcttc F: taaggacatcgcctaccagctc R: tcttccaggtgtcaacgaggt F: gatttccagttcagggcagtag R: cccagtgttgtagcagaaagtg F: taccaggaagccattcagcag R: ccaaagccaatccgacactct F: agcaaggtgcgtgaggagtatc R: gcagtaggtctcatccgtgttct Fragment (bp) 542 325 313 170 169 170 147 GenBank No. the medium was replaced with complete a-MEM culture medium containing 10% FBS and 50 µg/ml ascorbic acid 2-phosphate (AA. Millipore. The medium was changed every 3 days. The cells were fixed with 4% polyoxymethylene for 10 min and stained with 0. fixed with 2% glutaraldehyde at 4°C for 12 h. 10 µM forskolin (Sigma). Abcam. After 24 h of incubation. Abcam. followed by Alizarin Red (Sigma) staining to assess mineral deposition. 2 mM valproic acid (Sigma). Abcam. dried in a critical-point dryer. coated with conductive material. They were washed with PBS three times. the medium was replaced with complete a-MEM culture medium supplemented with 10% FBS. 0. 200 µM butylated hydroxyanisole (Sigma). Sigma).2–7. Abcam. dehydrated with a concentration gradient of alcohol. Total RNA was extracted separately.3 AF203032. 1:2. 50 µg/ml ascorbic acid. To induce osteogenic differentiation.2 NM_138711.

000).1 NM_002701. The specification curve was established at first. total RNA of cells and cell sheets was isolated by RNAiso plus® (Takara) and reverse transcription was performed to produce complementary deoxyribonucleic acid (cDNA). ab52128. With the blank well Table 2. mouse monoclonal anti-osteopontin (OPN.2 NM_000228. The mean fold changes of gene expression relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were calculated using the 2-ΔΔCt method. Fifty microliters of enzyme was added to every well. 1:500). Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) To detect pluripotency. and the plates were carefully washed at least three times. and migrationrelated gene expression.000 rpm at 4°C. The Oligonucleotide Primer Sequences Utilized in the qRT-PCR Gene GapdH alp bsp Ocn Opn Runx2 col I col III periostin cp-23 laminin fibronectin Notch-1 Nestin fgfr1-III Oct4 Primers (5¢–3¢) F: ctttggtatcgtggaaggactc R: gtagaggcagggatgatgttct F:taaggacatcgcctaccagctc R:tcttccaggtgtcaacgaggt F:gatttccagttcagggcagtag R:cccagtgttgtagcagaaagtg F:ctcacactcctcgccctattg R:ctcccagccattgatacaggtag F:cagttgtccccacagtagacac R: gtgatgtcctcgtctgtagcatc F:ctttacttacaccccgccagtc R:agagatatggagtgctgctggtc R:aacatggagactggtgagacct F: cgccatactcgaactggaatc F:aatgcctggagaaagaggaggt R:aataggaccagtaggaccccttg F:tggagaaagggagtaagcaagg R:ttcaagtaggctgaggaaggtg F:aacacatcggctgagaacctcac R:ggatacccacctctgccttgac F:actggactcacctacgccaac R:gggagcacactggtcacattt F: aaagaccagcagaggcataagg R: cagacattcgttcccactcatc F: cgaaccaatacaaccctctgc R: ctggtagctcatcatctgggaca F: aggaatgccgctagtctctga R: ggactctctatctccttccctctg F: ctgaccacagaattggaggctac R: gttgatgctgccgtactcattc F: tcccatgcattcaaactgagg R: ccaaaaaccctggcacaaact Fragment (bp) 132 170 169 166 127 127 145 124 134 117 150 151 140 151 125 103 GenBank No.2%).3 NM_000478. qRT-PCR was performed using the ABI Prism 7300 Real-Time PCR System (Applied Biosystems) according to the manufacturer’s protocol (Takara). 1:500). Finally.3 NM_006617. differentiation. Enzyme-Linked Immunosorbent Assay (ELISA) The culture supernatant and total protein of cells or cell sheets were collected separately and centrifuged for 20 min at 3. 50 µl stop solution was added to stop the reaction.1 NM_017617. ab14041.4 .3 J04765. except the blank well.3 NM_000088. Fifty microliters of sample was added to each well and incubated for 30 min at 37°C.1 NM_001024630. 1:1. Following several washes in Tris-buffered saline with Tween (0. Abcam. The specific primers used are listed in Table 2.3 NM_001135934.2 BC143763. ab8448.3 NM_199173.000).3 NM_000090.4 NM_004967. Sandwich ELISA plates (R&D System) were adopted to detect the production of laminin (LN) and fibronectin (FN) quantitatively. rabbit polyclonal to anti-periostin (periostin. and incubated for 30 min at 37°C and washed thoroughly. Abcam.1 NM_001048212. Fifty microliters of chromogen solution A and 50 µl chromogen solution B were then sequentially added to each well and protected from light for 15 min at 37°C.1 FJ809916.1064 Guo ET AL. membranes were incubated with horseradish peroxidase-conjugated anti-rabbit or mouse secondary antibody (1:5. NM_002046.

For statistical analysis. 8-week-old nude mice were purchased from the animal center of Sichuan University. 1:100). The cell sheets and TDM complex were dissected out and conventionally fixed with 4% polyoxymethylene at 4°C for 24 h. . The cell sheets were carefully uncovered after 4 weeks of culture. Santa Cruz. For immunofluorescence/ immunohistochemical staining. The EnvisionTM Detection Kit (Gene Tech) was used for immunohistochemical staining. 1:100). 1). ab14041. For histochemical analysis. 1:500). Inactivated TDM was deactivated through high temperature and pressure. The outer treated dentin matrix ring was inactivated through high temperature and pressure.REGENERATION OF PERIODONTIUM USING CELL SHEETS 1065 as zero. Premolars extracted from orthodontic patients were used to prepare treated dentin matrix (TDM) as described previously (21). and inactivated TDM. embedded in paraffin. the absorbance was read at 450 nm via plate reader (Thermo). 1:400). sections were incubated with the following primary antibodies: anti-ALP (Abcam. The 5-µm paraffin sections were prepared for further histological analysis. wrapped in at least three layers of treated dentin matrix. The nude mice were sacrificed 6 weeks after surgery. anti-osteocalcin (OCN.05 was considered statistically significant. Histological Analysis Cell sheets were harvested after 4 weeks of culture. anti-BSP (Abcam. 1:200). sc53947. Scheme for cell sheet complexes combined with treated dentin matrix (TDM). 1:100). TDM was used to instead of the root surface. and placed in the inactivated treated dentin matrix ring (Fig.0). which mainly consisted of hyaluronan (HA). 1:100). ab6308. In Vivo Transplantation of Cell Sheets With Treated Dentin Matrix Complexes To evaluate the periodontal regeneration potential of cell sheets in vivo. ab13418. Nearly all the cells exhibited high levels of vimentin staining but were negative for CK-14 (Fig. and the results were confirmed by three independent experiments to duplicate the experimental conditions. Figure 1. RESULTS Characteristics of Human DFCs and PDLCs DFCs and PDLCs both displayed the typical morphology of mesenchymal cells. anti-Col I (Abcam. antiperiostin (Abcam. fixed with 4% polyoxymethylene at 4°C for 24 h. Quality Control All samples were done in triplicate. placed at the muscle surface and sutured carefully. was used to imitate the alveolar bone. anti-OPN (Abcam. Ten male. Masson’s trichrome. Abcam. ab95462. antimitochondria (Millipore. followed by the Student–Newman–Keuls posttest using SPSS l7. A value of p < 0.0 statistical software. DFCs exhibited higher expression levels of mesenchymal stem cell surface markers. dehydrated through a graded ethanol series. H&E. General anesthesia was performed by intraperitoneal injection of 10% chloral hydrate during all surgical procedures. These complexes were then cultured in complete a-MEM culture medium containing 10% FBS and 50 µg/ml ascorbic acid 2-phosphate at 37°C for 1 h to allow stable adhesion. Secondary antibodies included FITC-conjugated goat anti-mouse or anti-rabbit IgG at a dilution of 1:200. ab8448. The control group was incubated with PBS instead of primary antibody. one-way analysis of variance (ANOVA) was performed. All samples were examined under a compound microscope (Leica). and sectioned at 4 µm prior to hematoxylin and eosin (H&E) and immunofluorescence staining. dehydrated through a graded ethanol series. Statistical Analysis All data are expressed as mean (±SD). The transplants were decalcified with 10% EDTA (pH 8. MAB1273. or immunofluorescence (IF)/immunohistochemical (IHC) staining was performed on the sections according to the manufacturer’s protocol. 1:500). washed three times in PBS. 2A). The cell sheets and treated dentin matrix complexes were implanted into the subcutaneous dorsa of the nude mouse. the cell sheets and treated dentin matrix complexes were transplanted into the subcutaneous dorsa of the nude mouse. anti-cementum attachment protein (CAP. ab52128. and embedded in paraffin.

3%. and ribosomes (Fig. when PDLCs proliferation reached a plateau. The distinguishing markers of DFCs were more highly expressed than those of PDLCs. respectively) (Fig. vimentin. The cell proliferation curves revealed an obvious difference between DFCs and PDLCs. (C) The proliferation curves of DFCs and PDLCs. DFCs and PDLCs were also weakly positive for CD31 (6. we observed a large nucleolus. In particular. PDLCs were rich in rough endoplasmic reticulum and ribosomes (arrows). rich mitochondria. (E) The relative gene expression of DFCs and PDLCs were examined by qRT-PCR. roughsurfaced endoplasmic reticulum. the divided nucleolus and some distinctive electron-dense particles were observed. ribosomes. Scale bars: 100 µm. in addition to multiple lysosomes. 2D).05. 2B). both DFCs and PDLCs began to grow very quickly. This trend persisted until the 7th day. roughsurfaced endoplasmic reticulum. while DFCs continued to expand (Fig.1066 Guo ET AL. and cytokeratin (CK)-14 for dental follicle cells (DFCs) and periodontal ligament cells (PDLCs). including Stro-1 and CD146. and CD31 expression in DFCs and PDLCs. CD146. A divided nucleolus and electron-dense particles (arrows) could be found in DFCs. While in PDLCs. and cytoplasmic processes contacting other cells. (A) Immunofluorescence staining for Stro-1. the proliferation rate of DFCs was much higher than that of PDLCs. After 2 days.1% and 5. Figure 2. 2C). (B) Flow cytometry analysis of Stro-1. All of the stem cell-related . (D) The ultrastructure of DFCs and PDLCs. For DFCs. Cellular ultrastructure was observed by transmission electron microscope. *p < 0.

cementum protein 23 (cp-23). ALP. including nestin. including alp. The cells became confluent and continued to grow until overlapping. 5). The relative gene expression profiles of DFCs and PDLCs were very different after forming cell sheets. DFC sheets appeared thinner and softer than the PDLC sheets when observed with the naked eye. .REGENERATION OF PERIODONTIUM USING CELL SHEETS 1067 genes. Neurogenesis: immunofluorescence staining of neurofilament and β-tubulin III gene expression. adhesion. opn. the space between cells and ECM was lower in DFC sheets than PDLC sheets (Fig. col III. In addition. For instance. Eleven genes related to cellular differentiation. and nanog. laminin. Figure 3. while PDLC sheets secreted cytoplasm-like mineralization and were prone to form a tenacious membrane. neuronal morphology. compared to DFCs. and periostin expression were significantly increased in cell sheets when compared to cells but that the expression of OPN was nearly unchanged in DFC sheets (Fig. 4). mineral nodules were also observed in DFCs and PDLCs after Alizarin Red staining. col I. When the cell sheets were cut into slices and stained with H&E. notch-1. For instance. and OPN immunofluorescence in DFC and PDLC sheets. Scale bars: 100 µm. CAP. and migration were analyzed. oil droplets were observed in DFCs and PDLCs via Oil Red O staining. Morphology of Cell Sheets Cell sheets were formed after 10 days in culture. Specifically. DFC sheets secreted rich extracellular matrix (ECM) and were prone to form a tight network of collagen fibers and less calcification. periostin. were more highly expressed in DFCs (Fig. Cellular multidifferentiation. Immunofluorescence staining for neurofilament. Protein and Gene Expression We observed Col I. The appearances of cell sheets observed via scanning electron microscope were also very different. OCN. BSP. ALP. octamer-binding transcription factor 4 (oct4). 3). DFC sheets exhibited high expression of calcification-related genes (alp. Osteogenesis: Alizarin Red staining and alkaline phosphatase (ALP) and bone sialoprotein (BSP) gene expression. runt-related transcription factor 2 (runx2). BSP. bsp. Following 14 days of adipogenesis inducing culture conditions. Cell differentiation-specific genes were also expressed (Fig. Both DFCs and PDLCs exhibited pluripotency. our Western blot results showed that Col I. a marker for late-stage neurogenesis revealed high levels of staining after induction. bsp. and fibro­ nectin. ocn. and DFCs and PDLCs gradually assumed a multipolar. Adipogenesis: Oil Red O staining. following osteogenesis. and peroxisome proliferator-activated receptor gamma (PPARγ) gene expression. Furthermore. Induction of neurogenesis lasted for 24 h. lipoprotein lipase (LPL). 2E).

1068 Guo ET AL. and adipose-derived stem cells (ASCs) (11. The two cell adhesion and migration-related genes were also expressed differently in sheets compared to cells. while PDLC sheets were thick and tough. both intracellularly and extracellularly. were also expressed (Fig.41. which contained some cells outside the dentin (Fig. a mineral matrix-like structure formed. (A) Gross observation: DFC sheets were thin and soft. while fibronectin expression was slightly increased cell sheets (Fig. ELISA Analysis of Cellular Matrix The synthesis and secretion of laminin and fibronectin were detected by ELISA kit. col I expression did not change significantly. periostin). The periodontal ligament was formed and weaved into a network. white arrow. 9). red arrow. This was demonstrated in DFC sheets after Masson trichrome staining. but decreased in PDLC sheets. 7). while on the surface of the cementum lacunas were found. when compared to PDLCs. 6). Fibronectin was decreased in PDLCs both intracellularly and extracellularly after forming cell sheets (Fig. There was no significant difference between DFC sheets and PDLC sheets. With IHC staining. The production of laminin was the highest in DFCs. whether the heterotopic seed . extracellular matrix. Col I and periostin. Cell sheet morphology. A layer of cementum-like structure was observed outside the dentin. DISCUSSION The source of the seed cells for periodontal tissue regeneration is worthy of careful consideration (1. the production of fibronectin was decreased in the intracellular matrix of DFC sheets but increased significantly in the extracellular matrix. while the gene expression of bsp. with some fibers observed embedded within. ocn. we found that the regenerated tissue in both kinds of cell sheets exhibited positive antibody staining for human mitochondria. opn. slightly increased in DFC sheets. and there were very rich blood vessels within the ligament. The Periodontal Regeneration Potential of Cell Sheets Both DFC sheets and PDLC sheets formed periodontal tissue-like structures in the subcutaneous areas of nude mice. In the PDLC sheets group. Overall. (20) found that the embryonic origin and homeobox (Hox) gene expression status distinguished neural crest-derived cells from mesoderm-derived skeletal progenitor cells and that both characteristics influenced the process of adult bone regeneration.24. Laminin was decreased significantly.13). However. Black arrow. (C) Scanning electron microscope views showed the cellular arrangement and extracellular matrix (ECM) of cell sheets. compared to DFCs. Rawlinson et al. However.46). which are specific markers of periodontal ligament. (D) Histological observation showed the proportion of cells and ECM in cell sheets. the potential seed cells under investigation for periodontal tissue regeneration have included PDLCs. collagen fibers. 8). The cementumlike structure was stained red. but devoid of cells. (B) Light microscope view. Figure 4. bone marrow mesenchymal stem cells (BMSCs). Scale bars: 100 µm. which might constitute the lacuna of cementoblasts. Thus far. runx2) and periodontal tissue-specific genes (col III. and opn were greatly increased in PDLC sheets. the production of laminin and fibronectin were higher in DFCs and DFC sheets than in PDLCs and PDLC sheets. (33) found that adult bones acquired site-specific characteristics and also noted the persistent expression of site-specific markers associated with the development of the skeleton in both bone organ and isolated adult bonederived cells. cp-23 expression increased several fold in PDLC sheets compared to PDLCs but decreased in DFC sheets compared to DFCs. On the other hand. DFCs. thus confirming the human source of these cells. cytoplasmic-like mineralization. Leucht et al. Therefore.

cementum protein 23. and migration-related genes were examined by qRT-PCR before and after forming cell sheets. Col I. (B) Western blot analysis. The ratio of relative intensity was the ratio of the gray value between the target protein and actin in the same sample. . osteopontin. runx2. runt-related transcription factor 2. OPN. CAP. osteocalcin. Figure 6. cementum attachment protein.05. Cellular differentiation. OCN. *p < 0. *p < 0.05. The expression of cell differentiation-related proteins in cell sheets. (A) immunofluorescence staining. Scale bars: 100 µm. cp-23. collagen I. adhesion.REGENERATION OF PERIODONTIUM USING CELL SHEETS 1069 Figure 5.

the expression of the stemness-related genes (nestin. indicating that DFCs may contain more stem cells. (A) Laminin. DFCs and PDLCs are derived from different developmental stages of the periodontal tissue. we demonstrated that DFCs were more pluripotent than PDLCs. Furthermore. cementum. cementum. it also suggested that PDLCs had the same ability to synthesize and secrete proteins as mature cells (30).17). DFCs and PDLCs were also weakly positive for CD31. In addition. . oct4. These results suggested that DFCs could potentially act as seed cells in periodontal regeneration. including cementum. DFCs showed a higher expression of Stro-1 and CD146. Meanwhile.05. DFCs also attained robust proliferative capacity. Furthermore. as the precursor cells of PDLCs. alveola. The histological observation of regenerated tissue derived from DFC and PDLC sheets. the ultrastructure of DFCs showed that these cells were in the active phase of differentiation. and alveolar bone in canines. and osteoblasts. Previous studies (15) showed that PDLC sheets could be used to achieve relatively complete periodontal tissue regeneration. In this study. Stro-1 and CD146 are surface markers of mesenchymal stem cells (MSCs) (4. periodontal ligament.1070 Guo ET AL. The greatest advantages of cell sheets include more effective utilization of seed cells. as well as form supporting tissues of the tooth. ELISA analysis of laminin and fibronectin. C. because the periodontal tissue consists of gingiva. it is better to choose periodontal-derived source cells for periodontal regeneration.10. suggesting these cells have the potential for angiogenic differentiation (32). DFCs could also differentiate into cementoblasts. cells could regenerate the normal structures in defect sites was debatable. PL. and periodontal ligament. nanog) also suggest the pluripotency of DFCs is superior to that of PDLCs. D. and preservation of cell surface receptors and junctional factors to achieve efficient reconstruction of Figure 8. which may be an advantage of DFCs for transplantation applications. Scale bars: 50 µm. periodontal ligament. Figure 7. Therefore. However. (A–D) DFC sheet group. (B) Fibronectin. secretion of extracellular matrix. In this study. PDLCs. (E–H) PDLC sheet group. *p < 0. Cell sheet technology use in periodontal regeneration has been a rapid and recent advancement (6. dentin. Moreover.14). so different characteristics may exist between them. the surface marker of vascular endothelial cells. DFC sheets might be more effective and suitable for periodontal tissue regeneration than PDLC sheets. notch-1.

This suggests that DFC sheets have a greater potential to differentiate into periodontal connective tissue. was increased several fold in PDLC sheets and decreased in DFC sheets. TDM was used instead of the root surface. Periodontal scaling and root planning was the effective treatment for periodontitis. tissue (6. Fibronectin. and embedded periodontal ligament fibers (34). was more highly expressed in DFC sheets. but that DFCs need to differentiate and mature step by step. were also highly expressed in DFC sheets. This could be due to the fact that the PDLC group included several differentiating cementoblasts that could secrete the cemental-related protein. the specific marker of cementum formation. which is involved in cell adhesion. the main collagen components of periodontal connective tissue (19). and bsp genes. This study showed that. and motility via its activity as a cell substrate adhesion protein (39). But PDLC sheets showed an obvious increase in ocn and opn expression. wound healing. which mainly . DFC sheets exhibited significantly higher expression of alp. Moreover. The higher expression levels of laminin and fibronectin in DFC sheets revealed that DFC sheets may be more easily attached to the tooth root and that these cells could move to the injured area to repair and regenerate the periodontal tissue. In vivo. the cell sheets and treated dentin matrix complexes were constructed to simulate the periodontal microenvironment between root surface and alveolar bone in periodontal defects. has been found to modulate cell differentiation. and maintenance of cell shape (29). the most abundant structural and biologically active component of basement membranes. morphology. This constitutes the connection between tooth root and periodontal tissue and contained cementum. cell motility. In addition. cp-23. Col I and Col III. This gene is specifically expressed in periodontal tissue and is involved in periodontal tissue repair and regeneration  (26). This may lead to the enhanced formation of new attachments.21). This suggests that DFC sheets have a stronger potential to regenerate periodontal tissues. opsonization. perhaps because DFCs are derived from embryonic developmental stages and retain embryonic characteristics.REGENERATION OF PERIODONTIUM USING CELL SHEETS 1071 Figure 9. Immunohistological staining against mitochondria.14). has already been applied in the clinical treatment of periodontal defects and to promote the formation of new attachments. (26) found that periostin could regulate Collagen I fibrillogenesis and serve as an important mediator of the biomechanical properties of fibrous connective tissues. also called osteoblast-specific factor 2 (12). laminin.31. compared to cells. referred to as the new attachment of the periodontium. including alveolar and cementum. which aids in the early adhesion of cell sheets and the formation of the new periodontal tissue attachments and is the key point for periodontal regeneration (38). including cementum and dentin. Scale bars: 50 µm.36). runx2. Compared to the cells. but the hard tissues. and inactivated TDM. For this reason. on the root surface were also removed (8). when cultured under the same conditions and period. Col I and periostin in periodontal ligament-like structures derived from DFC and PDLC sheets. similar to the root surface after scaling and root planning. Norris et al. alveolar bone. DFC and PDLC sheets both showed a notably high expression of calcification-related genes. DFC sheets exhibited greater pluripotency than PDLC sheets. Periostin. Previous studies found that TDM could release dentinogenic factors and promote cell attachment and growth through demineralization (9. DFC sheets were rich in extracellular matrix. which are involved in the formation of the main mineral matrix of mineralized tissue (31). suggesting that these cells were in the early stage of osteoblast differentiation and the extracellular matrix had just begun to mineralize (27. However.

T.. Y. D. He.. Horiuchi.. H.1072 Guo ET AL. Yamato. 2010. 1999. Studer.. Intern. J. Y.. A. Periodontal tissue engineering and regeneration: Current approaches and expanding opportunities.. Wang... Bone Miner.... Martino... Deng Z.... Liu. C. I.... Lu.. Liu. Y. (5) found that allogeneic PDLC therapy for periodontitis in swine did not trigger serious immune reactions. J.. Liu. L. H. Mitsiadis... d’Aquino. Elloumi-Hannachi. Wang. Zhou. Kudo.. Y. S. the periodontal tissue-like structure was observed both in the group transplanted with DFC sheets and that treated with PDLC sheets. Shi. J. L. Morsczeck. Wang. Cell. Human neural crest-derived postnatal cells exhibit remark­ able embryonic attributes either in vitro or in vivo. Oral Sci. G.. Utility of PDL progenitors for in vivo tissue regeneration: A report of 3 cases... Okano. 13. 2009. the cell proliferation and differentiation must be regulated by the extracellular matrix. National Basic Research Program of China (973 Program) (2006CB708505 and 2010CB944800). DFC sheets resulted in better periodontal regeneration. M. DFC sheets were superior to PDLC sheets in cell differentiation and extracellular matrix secretion. References   1. Ding D. Mech. H. Yamaza. Li. Therefore.   7. J. B. V.. V.37)... DFCs were cultured from the discarded dental follicle after extraction of wisdom teeth or embedded teeth. De Angelis. 20:53–66. although this remains controversial (16). C.. M. M. The inflammation of periodontal tissue should also be taken into consideration when attempting to simulate the microenvironment of periodontitis. Eng. the relatively low immunogenic and tumorigenic nature of fetal stem cells makes them attractive candidates for transplantation (23. Bonewald.. N.. Inst. Allogeneic periodontal ligament stem cell therapy for periodontitis in swine. 21:304–316.. The use of dentin matrix scaffold and dental follicle cells for dentin regeneration. Jin. Periodontal regeneration: A challenge for the tissue engineer? Proc. DFCs were derived from the developmental phase of teeth and exhibited remarkable embryonic attributes either in vitro or in vivo (3). Oral Dis. Nagasawa.. Lin S. it was very difficult to completely regenerate both structure and function without the formation of a new periodontal attachment. Abramov. Halfon. M. 2009. M. 6:20–28. especially in cementogenesis and new periodontal attachment.... 14:1239–1249. was used to imitate the alveolar bone. H. Part. Huang. However. Wang.. F.. Fan. consisted of Hyaluronan (HA). J.. The authors declare no conflicts of interest. B. Feng. Desiderio. Catón. . Okano. Dental follicle stem cells and tissue engineering.. 2010. C. An.. Takamatsu. Med. T. Stem Cells 28:1829–1838. Periodontol. Paino.. J. Laino. cells secreted the extracellular matrix. 2011. Z. J. Ishikawa.. Y. Z. Bostanci. Biomaterials 30:6708–6723. N. Tissue Eng. Cell sheet engineering and other novel cell-based approaches to periodontal regeneration. T. A. K. H. K. Zhang. L.. Zhang. H 224:1345–1358. Y.40). These advantages make DFCs more suitable for periodontal regeneration than PDLCs. with DFCs acting as the precursors of PDLCs. Markers distinguishing mesenchymal stem cells from fibroblasts are downregulated with passaging. F. S. Amizuka. Tirino... M. K. S. 2010. Y. Rev. Di Nucci.. 16:219–255. 65:168–176. 20:5–14. I. Y. DFCs and PDLCs are derived from different development stages of periodontal tissue. K. which also constituted the niche of cells. 11. M. M. perhaps because the regeneration process was closer to the periodontal tissue development process.. C. Y. X. Akiyama. R. Cell Transplant. 267:54–70. Future dentistry: Cell therapy meets tooth and periodontal repair and regeneration. Y. 12. Ding et al. F. Iwata. Jin. 2011. The Sharpey’s fibers were embedded in the newly formed cementum and grew toward the outside to connect the cementum and alveolar bone. heterogeneity. 2011.. Mol. M. Ghuman. Hughes. T.. Katsuura.. Previous work has shown that PDLCs contribute to periodontal regeneration (7. Mesenchymal stem cells. F. J. and proliferative capacity than PDLCs. and the chance of obtaining DFCs is less than for PDLCs. G. Iwasaki.. In vivo. A.   5. S.. 52:541–552. B. During periodontal regeneration. T. stem cells were less in the periodontal ligament than the dental follicle. Wei. Zhang. 10. Zhou. DFC sheets may be more suitable and efficient for periodontal regeneration in situ and may also be suitable for bone regeneration (44). In addition.   2. 2000. S. Papaccio... Imaizumi. Therefore. F. making allotransplantation of seed cells feasible. Chen. but DFC sheets showed stronger periodontal regeneration potential than PDLC sheets. Identification and characterization of a novel protein. Remboutsika. Wang.   6..   3. DFCs appeared more pluripotent than PDLCs. C. T. N. Eur.   8. periostin.. Periodontol. W. De Bari. In vivo. K. P. W. C.. Chen.. Ginis. Stem Cells Dev.. In addition. Sampaolesi. S. E. Therefore. I.. Grinblat. De Rosa. In sum. 1994. Takeshita. J... Ozawa. A. T. Cell sheet engineering: A unique nanotechnology for scaffold-free tissue reconstruction with clinical applications in regenerative medicine. E. C. G. M. Ding. 2010. Ando.. 14. Guo. to some extent. Shyu W. B. 2010.. L. Fukazawa. T. Q. DFCs exhibited more pluripotency. After forming cell sheets. J. J. M. ACKNOWLEDGMENTS: This work was supported by the National Natural Science Foundation of China (30973348). D.. W. Wang. Cell Mater.. Further work must be done in large animal models of periodontal defects.. M. H. G. Liu. Talal. However. with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor-beta. L.   4. T. J. Y. Washio. Honda. 15:1054–1065.. L. 51:220–238. Toyama. But how does the regulation work? And what are the differences between DFCs and PDLCs? These all need further study. F. which includes new cementum and embedding Sharpey’s fibers (34). in the cell sheets. Res. and Doctoral Fund of Ministry of Education of China (20070610064).   9. Med. Yu.. Superfacial cemental curettage: Its efficacy in promoting improved cellular attachment on human root surfaces previously damaged by periodontitis. 2010. Nishimura. Tsuchiya. Here we evaluated the periodontal regeneration potential of cell sheets transplanted into the subcutaneous space of nude mice. 2011. S.

Biomaterials 30:2716– 2723. Helms. A. Conway. Rawlinson. Zou. Periodontol. Rho G. Zaman. 2012. Promising cell-based therapy for bone regeneration using stem cells from deciduous teeth.. J.. T... M. Soehren. 56:933–943. X. Pascucci. C. Sugi. 26.. N. 2011. Post-translational modifications of sibling proteins and their roles in osteogenesis and dentinogenesis.. 101:695–711. Saito. S.... Park B. 2000. PLoS One 5:e10305. Attachment formation after transplantation of teeth cultured with enamel matrix derivative in dogs.. Forgacs. Potts. R.. X. K.. Hughes. 2008. Y. Takahashi... M.. Volponi. Gronthos.. C. Chen Y. L. Yamato.. J. S. Handa. Yoshida. J. Goodwin. Martin.. Kapila. Markwald. Yang. Invest. Exp. Y.. H. Periodontol. V. L. Robey. Molecular markers of bone turnover: Biochemical. 2011. C. Biochem.. 2009. J. R. Comparative analysis of telomere length. J.. Gu. Ueda M. J. 16. 2011. 82:1462–1468. M. 43:812–820. T. Gargiulo... 22. 2008. 11:S18–S29. Liu. M. C. R... J. Wang. 43. 24. Mizuno... Pagani.. S.. 2010. J. Li. P. M. 19. 45. Histol.. McKay. 2005.. F... N. Adipose-derived stem cells for periodontal tissue regeneration. Yamada. Cell 3:11. Periodontal regeneration with multi-layered periodontal ligament-derived cell sheets in a canine model. R.. 27. 2011. 2010. Human treated dentin matrix as a natural scaffold for complete human dentin tissue regeneration. Timpl. 2008. 32. Laminin—a glycoprotein from basement membranes. SI. K. C.. Lin. Cortellini. R. J. Y. P.. S. Tsang. S. Jacobs. 46. R. 702:461– 470. PG.. Yang. G. 2011. F. Miura. D.. Kumada. D. 35:106–116. 2000 1:26–35.. Saito... K. P. Moro. Development of the biological concept of guided tissue regeneration—­ animal and human studies. K. S. T. T.. D. K. S. Int. Periodontol. L. 2008. G. 2004. Sippel. Lin. P. 39.. Zhejiang Univ. Zheng X. Robey.. W. Ito K. Q. 40. Kühn. telomerase and reverse transcriptase activity in human dental stem cells. K. 2009.. Rae. T. H.. Pang. 29. Young. Chem. Turner. 31.. Zhang... Kingsmill.. Ishikawa. Tsuchioka.. Arch. Maeng G. A. 28:8–13. T. J. Norris.  D. Oral Biol. James. Periodontol. Novel markers of mesenchymal stem cells defined by genome-wide gene expression analysis of stromal cells from different sources... Washio. Ohno. V.. Cell Transplant. M. O.. Izumi. G. Stem cells and future periodontal regeneration... Y. J. R. and bone marrow. Batouli. M. Kern. J. Development 135:2845–2854. U. Kelly. R. Iwata. Trends Cell Biol. 18. 2010. Update 35:304–312. Okano. Laurell. 35. Y. P. Periodontol. J. J. Nikolidakis. A.. G. Ma. K. A.. C. Takagi. Amasha. Foidart. D. Guo.. Ringe... X. Seibel. Möhl. Oral Biol. Trusk. 36. Yamato. Hoffman... E. J... N. Matrix Biol.. 34. Kang E. Mark Bartold. Takagi. B.. F. Niemeyer. J. Sharpe. K. Prajaneh... M. Z. 2007. Seo. I. 17. C... Li J. Y. M. C. B. Ghuman. J.. B.. M. S. Y. Zhang. S. Guo W... Charbord. T. Vasc. Davis. Marchesan. Tang W.. R. Mukobata. Biochem. J.. Biomaterials 31:8574–8582.. Nakamura S. Tsumanuma... 254:9933–9937. Ceccarelli. B 12: 18–27... Honma. J... Schierholz. 30. Ock S. Embryonic origin and Hox status determine progenitor cell fate during adult bone regeneration. John. H. Pankov. 2009. 2000 51:239– 251...REGENERATION OF PERIODONTIUM USING CELL SHEETS 1073 15.. C. 25:1277–1285.. Yoshimura. R. J.. 20. 2010.. Y. 115:3861–3863.. Y. technical and analytical aspects. S.. Jeon B. D. Regeneration of periodontal tissues: Combinations of barrier membranes and grafting materials—biological foundation and preclinical evidence. W. Okano. 24:155–165.. Baba. Leung.. Markers of bone turnover: Biochemical and clinical perspectives. Zeilhofer. W. Egginton. Adult rat bones maintain distinct regionalized expression of markers associated with their development.. Biomaterials 32:5819–5825. Shi.. St. Brahim. R. S. Sharpe. Osteoporos. Ishikawa.. Mjaatvedt. V. 28. A. Li. Tian W. Periostin regulates collagen fibrillogenesis and the biomechanical properties of connective tissues. P. Rossi. L. Palmer. 41. G. R. Peschel. Häupl. Rennard. Sheng. C. T. 38. Mironov. I.. A. 2011. Crit. R. Oostendorp. R. Yamada Y. Gottlow.... C. Leucht. Biomaterials 32:4525–4538. Putnins. B.. L. T... Paterson. Kasyanov. A. Reduced immunogenicity of pancreatic progenitor cells derived from first-trimester human fetal pancreas... Kwack D.. Y. J.. 2010.. T. 20:1003–1013.. Periodontal regeneration using engineered bone marrow mesenchymal stromal cells... R. Iwata. Rev. M. J.. Francucci. M.. K. Butler. L. A systematic review. P. R. Ramamurthi.. E.. Molkentin. J. Washio. Periodontal tissue engineering and regeneration: Consensus Report of the Sixth European Workshop on Periodontology. K. Tooth root regeneration using dental follicle cell sheets in combination with a dentin matrix-based scaffold.. J. S. 2002. Dall’Aglio. L. C. M. Methods Mol. C. Angiogenic potential of endothelial progenitor cells and embryonic stem cells... Chen. N.. J. W. I. D. Girod.. E. . T. 1993. Comparison of different tissue-derived stem cell sheets for periodontal regeneration in a canine 1-wall defect model. P. M. 2011. W... F... M. Biol. Immunomodulative effects of mesenchymal stem cells derived from human embryonic stem cells in vivo and in vitro. H. Nyman.. 37.. Biomaterials 33:2449– 2461. S. Lancet 364:149–155. Wen.. S. Int. Oka.. Tian. Kim. Y... 44. Schwarz. Fibronectin at a glance. 35:83– 86. 2005.. A.. Clin. Cell Transplant. Zhao. Gronthos.. Yang B.. Ryan. X. B. Moreno-Rodriguez. Z.. Mohana Kumar B. Y. Damon. H. Isolation of precursor cells (PC) from human dental follicle of wisdom teeth. Clin. Regenerating the periodontium. R. T. M. PLoS One 4:e8358. L. 33. Med. Pedini. Xie. Su. Y. Marini. Qin. F. Matsuo. Tobita. V. Dent. D. L. An. 21.. B. G. S... C. A. Nagasaka T. 23. 20:1693–1705. P.. Sci. H. C. P. Endocrinol. A.. Karring.. 20:715–722. Stem cell-based biological tooth repair and regeneration. Wang H. Scanlon. Holzwarth. R. Wellmann. J. Xie D. R.. H. 316:2609–2617. R.. T. J... C. Cell Sci. M.. Cell Res. Cell Biol. Ultrastructural morphology of equine adipose-derived mesenchymal stem cells... Chen. F. Histopathol. J. Rohde. Chen G. O. A. 2011. A. 2011. G. Significant type I and type III collagen production from human periodontal ligament fibroblasts in 3D peptide scaffolds without extra growth factors. Investigation of multipotent postnatal stem cells from human periodontal ligament.. T. 15:126–136.. Ohata. V.. M. Seymour.. M. Morsczeck.. Cell. Hoffmann. Bartold.. Long J.. Yamada. 2011. Implications of cultured periodontal ligament cells for the clinical and experimental setting: A review. P.. Sculean. 25. Leung. Kaltz. Wu. dental pulp. C. 1979. W.. 42. Y. Guo. Mercati. S. Zou Q. Biol.. 2004. H. S. J. Götz. Tan..