You are on page 1of 19

Sveuilite u Splitu Prirodoslovno-matematiki fakultet Odjel za kemiju prof. dr. sc.

Maja Pavela-Vrani

Genetski kod

Genetska ifra ili kod redoslijed nukleotida u DNA (ili mRNA) koji nosi uputu za redoslijed aminokiselina u proteinu otkrivena 1966. p od tri baze koja j Kodon skupina odreuje jednu aminokiselinu u proteinu

Har Gobind Khorana (1922.-)

Marshall W. Nirenberg (1922.-)

Translacija je prevoenje mRNA u polipeptid


5 3 mRNA kodon
redoslijed AK u polipeptidu odreen je redoslijedom kodona u mRNA

Translacija se odvija u smjeru 5 3

amino-kraj

polipeptid karboksilni-kraj Sinteza proteina tee od amino-kraja prema karboksilnom kraju

Zato triplet baza?


Jezik od 4 baze prevodi se u jezik od 20 aminokiselina

Jedna baza = jedna aminokiselina

41 = 4

Kod od dvije baze = jedna aminokiselina 42 = 16 Kod od tri baze = jedna aminokiselina 43 = 64

1 START kodon + 3 STOP kodona + 20 kodona za pripadne AK = 24 kodona

to s preostalih 40 kodona? U nedegeneriranom kodu skoro svaka mutacija bi rezultirala STOP kodonom

Genetski kod je degeneriran, jer 64 kodona odreuje 20 aminokiselina


Druga baza
Veina aminokiselina ima vie od jednog kodona START kodon = AUG STOP kodoni = UAA, UAG, UGA Met i Trp imaju po jedan kodon XYC i XYU uvijek znae istu aminokiselinu XYA i XYG obino znae istu aminokiselinu genetski kod je gotovo univerzalan

Prva baza

Trea baza

Degeneracija smanjuje pogubno djelovanje mutacija

Tri mogua okvira itanja u mRNA


Otvoreni okvir itanja (engl. Open Reading Frame, ORF) nastaje ispravnom kombinacijom triju elemenata

Tyr Thr

Tyr Thr

Tyr Thr Leu

Prvi okvir itanja Drugi okvir itanja Trei okvir itanja

Leu

Leu

1. start kodon lei blizu 5-kraja mRNA 2. duljina okvira itanja i broj kodona odgovaraju broju peptidnih veza u proteinu 3. stop kodon je u okviru sa start kodonom i lei blizu 3-kraja mRNA

Mutacije
Tokasta mutacija kao posljedica zamjene baze tiha mutacija, pri emu se mijenja kodon, ali ne i aminokiselina missense mutacija ili mutacija krivog smisla, kojom se mijenja priroda aminokiseline nonsense mutacija ili besmislena mutacija kojom se kodon pretvara u stop kodon Insercija ili delecija baze kada se nukleotid pogreno ugrauje u kodon ili izrezuje iz kodona - dolazi do pomaka u okviru itanja GAU GAC UCC GCU AGG kodira za AspAspSerAlaArg

Primjer:

Ako se iz GAU kodona deletira A, ifra prelazi u GUG ACU CCG CUA GG Odredite slijed aminokiselina!

U translaciji sudjeluju tri vrste RNA molekula

glasnika RNA (mRNA) nositelj genske upute s DNA na ribosom tj. na mjesto sinteze proteina transportna RNA (tRNA) nekodirajua RNA donosi aminokiselinu na ribosom u obliku aminoacil-tRNA ribosomska RNA (rRNA)- nekodirajua RNA strukturna komponenta ribosoma

Molekule RNA u bakteriji E. coli


Vrsta Relativna Koeficijent Broj koliina sedimentacije nukleotia % S

ribosomska RNA (rRNA)

80

23 16 5 4 5

3700 1700 120 75 heterogena

transportna RNA (tRNA)

15

glasnika RNA (messenger, mRNA)

Molekule mRNA razlikuju se po veliini (heterogene su), jer se i geni razlikuju po veliini

Kodone itaju molekule transportne RNA (tRNA), koje slue kao posrednici u sintezi proteina

polipeptid tRNA nukleinska kiselina (mRNA)

Aminokiselina 1

Aminokiselina 2

Aminokiselina 3

Kodon 1

Kodon 2

Kodon 3

Struktura tRNA
3 OH
mjesto vezanja aminokiseline i ki li

trodimenzionalna struktura

fosforilirani 5-kraj 5 5 P TC-oma DHU-oma


jednolanana molekula (73-93 nukleotida) dijelom dvolanana sparivanje baza specifina za odreenu aminokiselinu vie od jedne tRNA prenosi jednu aminokiselinu sadri neuobiajene baze

antikodonska oma antikodon


dvodimenzionalna struktura

Neuobiajene baze u sastavu tRNA


O H O N N H H O Riboza N N O H H H H

pseudouridin ()
O H H2N N N CH3 N
+

Riboza

dihidrouridin (UH2)
O H (CH3)2N N N N N Riboza

N Riboza

N7-metilgvanozin (mG) N2N2-dimetilgvbanozin (m2G)

Aminoacil-tRNA sintetaza (aaRS)


sinteza peptidne veze je termodinamski j pa AK treba prethodno aktivirati nepovoljna, aaRS kataliziraju aktivaciju AK i osiguravaju vezanje AK s pripadnom tRNA
aminokiselina aaRS

aminoacil adenilat

aminokiselina + ATP aminoacil-AMP + PPi (aminoacil-adenilat)


pokreta ok et ka k snaga reakcije e k ije je hid hidroliza oli pirofosfata i ofo f t

PPi + H2O 2Pi

aminoacil-AMP + tRNA aminoacil-tRNA + AMP


aminoacil-tRNA

Aktivirani oblik aminokiseline aminoacil-tRNA


na 3-kraj tRNA (CCA kraj) vee se aminokiselina

tRNA Adenin

CCA kraj

esterska veza
antikodonska oma

aminoacilna skupina

Kodone prepoznaju antikodoni pripadnih tRNA


5 CCA kraj
3

mRNA

III II II

antikodon

antikodonska oma

Leu
Antikodon i kodon su suprotne polarnosti Antikodon i kodon povezuju vodikove veze

5- pirimidin pirimidin X Y Z modificirani purin varijabilna baza - 3

Jedna molekula tRNA moe prepoznati vie kodona

antikodon inozin 3 5 kodon 5 3

Inozin (I) je esto u antikodonu Inozin (I) se moe spariti s U, C ili A Postoji sterika sloboda (kolebanje) pri sparivanju tree baze kodona

Sparivanje kolebljive baze antikodona

Prva baza antikodona

Trea baza kodona

C A U G I

G U A ili G U ili C U, C ili A

Degeneracija genetskog koda djelomino proizlazi iz kolebanja u sparivanju tree baze kodona

Sinteza proteina (translacija) dogaa se na ribosomima


ribosom prokariota

70S

50S 5S rRNA

30S

Ada Yonath (1939. -) Nobelova nagrada 2009.

16S rRNA 23S rRNA 34 proteina 21 protein

ribosomi su ribonukleoproteini

ribosomski proteini

Molekule mRNA imaju signale koji oznaavaju poetak i kraj polipeptidnog lanca za kojeg nose genetski kod

Start kodon

Stop kodon

Genska uputa u mRNA prevodi se u smjeru 5 3

Startni signal u prokariota


AUG (ili GUG) ispred kojeg se nalazi purinima bogati slijed od nekoliko baza koje se mogu spariti s 16S rRNA
Shine-Dalgarnov slijed (purinima bogati slijed) start kodon

fMetArgAla

mRNA

UUCCUAGGAGGUUUGACCUAUGCGAGCU

UCCUCCACCACUAG - - - - - 3 HO AU 5

16S rRNA

10

Startni signal u eukariota

Prvi AUG s 5 - kraja


Kapa AUG

startni signal u eukariota tvore prvi AUG triplet s 5-kraja i kapa zatita

Primjer
Odredite poetno mjesto translacije i slijed aminokiselina prema slijedu lij d baza b u dijelu dij l prokariotske k i t k mRNA: RNA

-UUCCUAGGAGGUUUGACCUAUGCGAGCUAUGUUGfMet Arg Ala Met -Leu-

-UUCCUAGGAGGUUUGACCAUGCGAGCUUAUGUUGAfMet Arg -Ala- Tyr Val -

11

Vezna mjesta na ribosomu


P mjesto E mjesto
na A mjesto vee se tRNA s AK koja se treba ugraditi u polipeptid (aa-tRNA) na P mjesto vee se peptidiltRNA na P mjestu dolazi do stvaranja peptidne veze s E mjesta otputa se deacilirana tRNA
deacilirana tRNA peptidil- tRNA mjesto za vezanje mRNA

A mjesto
velika podjedinica mala podjedinica

aa-tRNA

ribosom antikodon kodon

mRNA

Pomoni translacijski proteini u bakterije E. coli


Faktor IF-1 IF-2 IF-3 Uloga sudjeluje pri vezanju IF-3 vee inicijacijsku tRNA i GTP otputa 30S podjedinicu s inaktivnog ribosoma i sudjeluje u vezanju mRNA donosi aminoacil-tRNA i GTP uklanja GDP s EF-Tu potie translokaciju vezanjem GTP na ribosom prepoznaje UAA i UAG stop kodone prepoznaje UAA i UGA stop kodone vee GTP i potie vezanje RF-1 i RF-2

FAKTORI INICIJACIJE

FAKTORI ELONGACIJE
EF-Tu EF-Ts EF-G RF-1 RF-2 Rf-3

FAKTORI OTPUTANJA

12

TRANSLACIJA 1. Inicijacija slaganje 30S inicijacijskog kompleksa


INAKTIVNI 70S RIBOSOM +

IF3

IF1

Inicijacijska aa-tRNA: u prokariota: formilmetionil-tRNA fMet u eukariota: metionil-tRNA

IF1 IF3 fMet

IF2 GTP

UAC antikodon
I I I

AUG start kodon


IF2 GTP IF1 IF3

30S INICIJACIJSKI KOMPLEKS

Slaganje 70S inicijacijskog kompleksa


fMet

30S INICIJACIJSKI KOMPLEKS


IF2 GTP IF1 IF3

IF3 IF1 fMet

IF2

GDP + Pi

70S INICIJACIJSKI KOMPLEKS

13

2. Elongacija ili produljenje lanca


Popunjavanje A mjesta

Thr-tRNA fMet fMet Thr

Inicijacijska tRNA ne ita unutranje kodone Kodonu komplementarnu aminoacil-tRNA u A mjesto donosi EF-Tu uz hidrolizu GTP EF-Tu ne stupa u interakciju s inicijacijskom tRNA

Transpeptidacija i translokacija
fMet Thr fMet

transpeptidacija

Thr

translokacija

fMet Thr

fMet

otputanje deacilirane tRNA

Thr

Translokacija: dipeptidil-tRNA pomie se s mjesta A na mjesto P uz pomicanje mRNA za 3 nukleotida

14

Transpeptidacija

peptidil-transferaza
Nukleofilna adicijaeliminacija li i ij
peptidil-tRNA aminoacil-tRNA tRNA peptidil-tRNA

Stvaranje peptidne veze katalizira peptidil-trensferaza koja je integralni dio 50S podjedinice

fMet

3. Terminacija
fMet RF3 GTP

peptidil-tRNA Thr His Asp

RF1

Faktori otputanja (RF1 ili RF2) prepoznaju stop kodone

Thr His Asp RF3 GTP RF1

H2O
Mijenja se specifinost peptidil-transferaze: polipeptidni lanac se prenosi na vodu

GDP + Pi
RF3 RF3 GTP RF1

fMet Thr His Asp

RF1

INAKTIVNI 70S RIBOSOM

15

Polisom poveava uspjenost koritenja mRNA


max. 1 ribosom na 80 nukleotida

rastui polipeptid

gotovi polipeptid

mRNA start kodon stop kodon

Slijed baza u genu kolinearan je sa slijedom aminokiselina u polipeptidnom produktu ekspresije toga gena

linearni slijed baza

linearni slijed baza

linearni slijed aminokiselina

trodimenzionalna struktura

transkripcija DNA mRNA

translacija

sazrijevanje

aktivni protein polipeptidni lanac

16

Tonost sinteze proteina

Vjerojatnost sinteze ispravnog proteina Uestalost ugradnje pogrene aminokiseline Broj aminokiselinskih ostataka

Pogrena aminokiselina ne moe se izrezati nakon ugradnje u polipeptidni lanac


Neke aminoacil-tRNA sintetaze imaju sposobnost ispravke vlastitih pogreaka
na temelju razlike u strukturi aminokiselina - specifino prepoznavanje prirodne aminokiseline na razini stvaranja aminoacil-adenilata hidrolizom neodgovarajueg aminoacil-adenilata acilacija (hidrofobni dep) prednost d t ima Val hidroliza (hidrofilni dep) prednost d t ima Thr

17

Antibiotici inhibitori sinteze proteina


Antibiotik
Streptomicin Tetraciklin Eritromicin Puromicin

Djelovanje
Inhibira inicijaciju i uzrokuje pogreno oitavanje mRNA (prokarioti) Vee se za 30S podjedinicu i inhibira vezanje aminoacil-tRNA (prokarioti) Vee se na 50S podjedinicu i inhibira translokaciju (prokarioti) Uzrokuje preuranjeni zavretak sinteze polipeptidnog lanca tako to djeluje kao analog aminoacil-tRNA (prokarioti i eukarioti)

Puromicin izaziva prerani zavretak polipeptidnog lanca, jer je njegova struktura nalik na aminoacil-tRNA

Amidna veza onemoguava transpeptidaciju

transpeptidacija

puromicin

tirozil-tRNA

18

Neribosomske peptid sintetaze (NRPS)


Sinteza malih peptida (sekundarni metaboliti u bakterija) odvija se na multienzimskom kompleksu, a ne na ribosomu

bacitracin gramicidin S

surfaktin

tirocidin A

izopenicilin N

ciklosporin A

HC-toksin

eniatin B

19