You are on page 1of 34

Efficacy of Indian Probiotic Cultures

Sunita Grover, Ph.D Molecular Biology Unit Dairy Microbiology Division National Dairy Research Institute

Outline of presentation
Probiotics – entry y in India Status of probiotics at global level Need for Indigenous probiotics R l of Role f potential t ti l biomarkers bi k for f screening i and selection of potential strains p g Indigenous g • Initiative for Developing Probiotics of Indian origin at NDRI, Karnal (DBT) • Desired Interventions from Indian Perspective • Conclusion
20.2.2009 ILSI-India 2

• • • •

Probiotics – the New Nutraceutical Stars enter in Indian d Market k
• An old concept, with a new attitude • Probiotic based functional foods – a strong global market • Japan, Europe - the major players • Dairy based probiotic foods / drinks (> 50%) • Probiotics gaining a foothold in India
20.2.2009 ILSI-India 3

acidophilus p La1 VSL#3 (4 Lactobacillus spp. and one streptococcus) (CD Pharma) 20..2009 ILSI-India 4 . johnsonii La7 (Nestle) L reuteri (BioGaia) L. rhamnosus 271 (Probi AB) L.Status of probiotic cultures at Global level • • • • • • • • • • • • L. casei (Chr Hansen) L.2. L. i Shirota Shi (Yakult) (Y k l ) L. rhamnosus GG (Valio) L casei L. 4 Bifidobacterium spp. plantarum 299v (Probi AB) L. casei strain DN-114001 (Danisco) B animalis DN 173010 (Danisco) B. acidophilus NCFM (Nestle) L. L.

2.2009 ILSI-India 5 • .Efficacy / Prospects of probiotic strains • • • • Widely studied strains world wide S i tifi ll proven probiotics Scientifically bi ti Clinical trials conducted for their efficacy However. empiric or therapeutic Specific strain of bacteria – Various secreted components can modulate activity Quantity of bacteria Method of administration Host factors 20. results are debatable Several factors are known to influence this benefit Timing of probiotic delivery – Prophylactic.

2009 ILSI-India 6 .2.Major j Issues f for use in Indian p population p • Data in Indian population – lacking ? • Poor adhesion /colonization and short transit period in the Indian gut due to diff r nt gut different ut ecology c l and nd f food d h habits bits • Conditioning effect – critical for acclimatization and optimal functionality • Non-availability of established / Novel Indian probiotic strains with specific health functions to demonstrate their efficacy 20.

2009 ILSI-India 7 .Why W y Need N for f Indigenous g probiotics p ? • Better colonization / adhesion potential • Longer L transit t it time ti • Health promoting functions of probiotics – highly strain and host specific p • High incidences of diarrhoeal diseases and other gastric disorders in Infants and immunocompromised • Probiotics as potential Immuno-modulators – Healthy guts • Indian I di probiotic bi ti strains t i might i ht be b better b tt suited it d to t Indian gut due to longer transit time. colonization / biofilm formations and conditioning effect 20.2.

N Karnal l (DBT) ( T) • More than one hundred cultures of indigenous Lactobacilli of human origin isolated and studied for th i probiotic their bi ti attributes tt ib t and d colonization l i ti potentials t ti l • Tested for a battery y of in vitro tests for culture short li ti listing • Selection of p promising g cultures based on strong g colonization and in vitro probiotic attributes 20.Initiative for Developing Indigenous Probiotics of f Indian di origin i i at NDRI.2009 ILSI-India 8 .2.

5 p pH 2.0 Bile 1.2009 ILSI-India 9 .Selection of promising cultures based on in vitro probiotic attributes pH 1.5% Bile 2.0% 20.2.

2304 7.9201 8.041 2 8.7626 8.231 8.5965 8.4471 8.2009 ILSI-India 10 . Lysozyme 10 cell count (log 8 cfu/ml) 6 4 2 0 Lp 5276 8.672 8..7447 8.221 8 8.Contd….2.284 Cell surface hydrophobicity Anti-oxidant 20.4471 8.301 8.585 Lp9 Lp72 Lp75 Lp77 Lp91 Ldch4 Pepsin 0h 1 h 8.

2.Caco2 cell line: Adhesion of Lactobacilli (109 cfu/ml for 2 hrs) to human adenocarcinomal cell lines L. plantarum (Lp5276) L.2009 ILSI-India 11 . p plantarum ( (Lp5276) p ) 20. plantarum (Lp91) L. plantarum (Lp91) HT-29 HT 29 cell line line: L. plantarum (LpVS) L. plantarum (LpVS) L.

Role of Biomarkers for selection of probiotics • Selection of a proven probiotic strain extremely crucial for application in clinical trials and product development • Potential biomarkers need to be developed for screening and selection of probiotic strains .

2009 ILSI-India .2.Expression of bacterial and host genes during transition in GIT of human that can be used as potential biomarkers for functionality ↑ MUC 2 ↑ INFINF α ↑ IL-10 ↑↑ atp operon bsh gene ↑ IL-4 ↑ groEL ↑ h hsp70 70 ↑ IL-6 ↑ groES ↑ 1dnaK ↑ Cox Surface proteins of bacteria ↑-72 hsp70 ↑ Map pA ↑ hsp 72 ↑ urvA ↑ Mub ↑ CnBp ↑ dps ↓ TNF-α ↑ Fbp ↑ Msr ↓ IFN IFN-γ ↑ EF-Tu EF Tu ↓ IL-1β ↑ dlt operon ↑ eps operon ↓ IL-2 ↓ IL-8 ↓ Cox2 13 Probiotics Human epithelial cells Stomach Small intestine Digestive system 20.

Lf -6 9 LA 1 La -1 6 .Quantification of BSH activity by modified ninhydrin assay Bi ile salt Hyd drolase act tivity (µM/min n/108cfu/m ml) 6 5 4 3 2 1 0 P<0. y GDCA hydrolase y activity y TCA hydrolase activity.01 Lp -8 2 Lp -1 1 Lp -1 0 Lp -2 7 Lp -7 8 Lp -9 1 Lp -9 0 Lp -7 5 Lp -2 1 La -2 91 La -1 95 Lj -1 69 3 Isolate No. TDCA hydrolase activity. Bile salt hydrolase activity of lactobacilli cultures was quantified against different conjugated bile salts. GCA hydrolase y activity.

HD21. HD91.1 18.2 27. casei (Shirota).9 13.01 Diet without Lp-91 ND Ctrl HD Ctrl HD + 91 HD 91 HD Cap91 HD 21 Treatment groups ND. Normal ND N l Diet.5 47. Hypercholesterolemic diet mixed with Microencapsulated Lp-91. Hypercholesterolemic diet containing noncapsulated Lp-91.5 14.21 days P<0. Di t HD. HD Hypercholesterolemic H h l t l i diet. di t HD+91.Hypercholesterolemic diet mixed with Lp-21 and HD Shirota.4 Total Cholesterol Triglyceride HDL LDL Duration of treatment:. .3 35. Hypercholesterolemic diet mixed with L. HD 91 Hypercholesterolemic H h l t l i diet di t without ith t LpL 91.Anti-Hypercholesterolemic effect of Lp-91 Lp91 TC TG LDL HDL 17. HDCap91.8 140 120 100 80 60 40 20 0 L ipid pr o fi le (m g /dL ) Lp21 9.

5’254 bp 1057 bp GGCAGATTGCAAGAAATAACTTGAACGAATTTAATGACGTAAATTAAGCAAGA AGATCTCGATTGGGGTATGCCAATTAAGACATTTAAGTGGCCGTGAATTCAAA TACCAATTAATTTGAACCAATTGGTGATCACTTAGTTCTTCAATGGCTTGGCC TTTGGGAATAAAGCGCCGCAAAACTCGGTTACGGTTCTCATTACTGCCTCTTT CATGCGGTGAATAGGCAGGGGCAAAATAAACCTGTGTACCAGTTCGCCGTTCA ATTGTCTGATAGGTAGCGAACTCTTTACCATGATCTACGGTAAGCGTCTTGAG CTTGTCTTGAAGTTGACTAGCTAGTTCAAGTACGGCTTGAGTCATGGACTGAC TGTCGCGACCATGGAGCCGTTTACAATTGTCAGGCGACTCTTACGCTCCACAA AAGTAGCCACAGCTTGACCTTTACGTTTACCAGAAAGTACGGTATCAGCTTCA AAGTGGCCGAATTCCTGGCGAGTTTCGACTTTATGAGGCCGCTCCTCAATGGA GCGGCCGTGATTGAACGTACCACGCTTTTCTTTAGCACGATGACGACGAATCC CATGATCAGGCAAATCGGGCAACTGTATATCAAGCCATCCTTGATCAATCCAG TTATAGACCGTCTTGTAGGCAATCCCCACCACATGGGCAACTTGTTCAGGGGA CCACTTTTGGACTTGAATCTTTTCCTCGATCAAGTGTTTAAGGTTTTTAGTGA GCGAAGACTTCCGCCCCCGTTGACTAACCTTTCGTTCAAAGTCAGTTTGCGCT AGCCCAGCCTGGTACTCACTATTTAGCCCGTGAAGTTCGTTAAAGATGGTGGT CTTACTAAAGCCTAAGTAGTTAGCGATGTATCGCAAGGAACGTCCTTCATTAT GTAAGCGTGTCAATGACAACACGGTTCTGGAATGAAAAAATAGTGGTGCTCAT CAAGGTCCTTCCTTTCTAATGGAGTGGGTGGTAACATCATTTAAGGACCTTGA TTGGGTTTTTCTGGGCCCCTTAAATGTTCAACTTAAATTTTACAATCTGC 619 bp -3’ ATGTGTACTGCCATAACTTATCAATCTTATAATA ATTACTTCGGTAGAAATTTCGATTATGAAATTTC ATACAATGAAATGGTTACGATTACGCCTAGAAAA TATCCACTAGTATTTCGTAAGGTGGAGAACTTAG ATCACCATTATGCAATAATTGGAATTACTGCTGA TGTAGAAAGCTATCCACTTTACTACGATGCGATG AATGAAAAAGGCTTGTGTATTGTGGGATTAAATT TTGCAGGTTATGCTGA CAAAAACTAAACTTGGTTAATATTAATTTTAGTGAACAATTACCATTATCAC CGCTACATTGGTTGGTTGCTGATAAACAGGAATCGATAGTTATTGAAAGTGA TAAAGAAGGACTAAAAATTTACGACAATCCAGTAGGTGTGTTAACAAACAAT CCTAATTTTGACTACCAATTATTTAATTTGAACAACTATCGTGCCTTATCAA ATAGCACACCCCAAAATAGTTTTTCGGAAAAAGTGGATTTAGATAGTTATAG TAGAGGAATGGGCGGACTAGGATTACCTGGAGACTTGTCCTCAATGTCTAGA TTTGTCAGAGCCGCTTTTACTAAATTAAACTCGTTGCCGATGCAGACAGAGA GTGGCAGTGTTAGTCAGTTTTTCCATATACTAGGGTCTGTAGAACAACAAAA AGGGCTATGTGAAGTTACTGACGGAAAGTACGAATATACAATCTATTCTTCT TGTCGTGATATGAACAAGGGAGTTTATTACTATAGAACTTATGACAATAGTC AAATTAACAGTGTCAATTTAAACCATGAGCACTTGGATACGACTGAATTAAT TTCTTATCCATTACGATCAGAAGCACAATACTATGCAGTTTAACTAA 1057 bp 873 bp ATGTGTACTGCCATAACTTATCAATCTTATAATAATTACTTCGGTAGAAATTTCGATTATGAAATTT CATACAATGAAATGGTTACGATTACGCCTAGAAAATATCCACTAGTATTTCGTAAGGTGGAGAACTT AGATCACCATTATGCAATAATTGGAATTACTGCTGATGTAGAAAGCTATCCACTTTACTACGATGCG ATGAATGAAAAAGGCTTGTGTATTGTGGGATTAAATTTTGCAGGTTATGCTGACAAAAACTAAACTT GGTTAATATTAATTTTAGTGAACAATTACCATTATCACCGCTACATTGGTTGGTTGCTGATAAACAG GAATCGATAGTTATTGAAAGTGATAAAGAAGGACTAAAAATTTACGACAATCCAGTAGGTGTGTTAA CAAACAATCCTAATTTTGACTACCAATTATTTAATTTGAACAACTATCGTGCCTTATCAAATAGCAC ACCCCAAAATAGTTTTTCGGAAAAAGTGGATTTAGATAGTTATAGTAGAGGAATGGGCGGACTAGGA TTACCTGGAGACTTGTCCTCAATGTCTAGATTTGTCAGAGCCGCTTTTACTAAATTAAACTCGTTGC CGATGCAGACAGAGAGTGGCAGTGTTAGTCAGTTTTTCCATATACTAGGGTCTGTAGAACAACAAAA AGGGCTATGTGAAGTTACTGACGGAAAGTACGAATATACAATCTATTCTTCTTGTCGTGATATGAAC AAGGGAGTTTATTACTATAGAACTTATGACAATAGTCAAATTAACAGTGTCAATTTAAACCATGAGC ACTTGGATACGACTGAATTAATTTCTTATCCATTACGATCAGAAGCACAATACTATGCAGTTTAACT AA GGCAGATTGCAAGAAATAACTTGAACGAATTTAATGACGTAAATTAAGCAAGAAGATCTCGATTGGG GTATGCCAATTAAGACATTTAAGTGGCCGTGAATTCAAATACCAATTAATTTGAACCAATTGGTGAT CACTTAGTTCTTCAATGGCTTGGCCTTTGGGAATAAAGCGCCGCAAAACTCGGTTACGGTTCTCATT ACTGCCTCTTTCATGCGGTGAATAGGCAGGGGCAAAATAAACCTGTGTACCAGTTCGCCGTTCAATT GTCTGATAGGTAGCGAACTCTTTACCATGATCTACGGTAAGCGTCTTGAGCTTGTCTTGAAGTTGAC TAGCTAGTTCAAGTACGGCTTGAGTCATGGACTGACTGTCGCGACCATGGAGCCGTTTACAATTGTC AGGCGACTCTTACGCTCCACAAAAGTAGCCACAGCTTGACCTTTACGTTTACCAGAAAGTACGGTAT CAGCTTCAAAGTGGCCGAATTCCTGGCGAGTTTCGACTTTATGAGGCCGCTCCTCAATGGAGCGGCC GTGATTGAACGTACCACGCTTTTCTTTAGCACGATGACGACGAATCCCATGATCAGGCAAATCGGGC AACTGTATATCAAGCCATCCTTGATCAATCCAGTTATAGACCGTCTTGTAGGCAATCCCCACCACAT GGGCAACTTGTTCAGGGGACCACTTTTGGACTTGAATCTTTTCCTCGATCAAGTGTTTAAGGTTTTT AGTGAGCGAAGACTTCCGCCCCCGTTGACTAACCTTTCGTTCAAAGTCAGTTTGCGCTAGCCCAGCC TGGTACTCACTATTTAGCCCGTGAAGTTCGTTAAAGATGGTGGTCTTACTAAAGCCTAAGTAGTTAG CGATGTATCGCAAGGAACGTCCTTCATTATGTAAGCGTGTCAATGACAACACGGTTCTGGAATGAAA AAATAGTGGTGCTCATCAAGGTCCTTCCTTTCTAATGGAGTGGGTGGTAACATCATTTAAGGACCTT GATTGGGTTTTTCTGGGCCCCTTAAATGTTCAACTTAAATTTTACAATCTGC .Transposon mediated insertional inactivation of bsh gene of L. plantarum 77 strain.

2.2009 ILSI-India 17 .20.

2009 ILSI-India 18 .2.Cell surface proteins as probiotic markers f colonization for l • • • • • Mucus Binding Protein (MBP) Fibronectin Binding Protein (FnBP) Collagen Binding Protein (CBP) EF Tu EF-Tu LTA 20.

L. 9-Lp45. casei 17. casei S3. 5.‘Mub’ specific PCR product with primer MubD1_F87/ MubD1_R0. L casei J9. 200bp 100bp Fig.5 Lanes: M-100 bp DNA ladder. 6. 3. 2. 10-Lp68 PCR Assays 400bp 200bp M 1 2 3 4 5 6 7 405 bp 250 bp Fig. 5-Lp77.M 400bp 200bp 1 2 3 4 5 6 405 bp b 250 bp M 1 2 3 4 5 6 7 8 9 10 405 bp 250 bp Fig. casei .2009 ILSI-India 19 . plantarum with primer pairs LBLMA1 /R-161 and MubD1_F87/ MubD1_R0.5 Lanes: M-100 bp marker.L. L. Multiplex PCR for L. Multiplex PCR for L. acidophilus and Bifidoacterium bifidum with primer pairs LBLMA1 /R-161 and MubD1_F87/ MubD1_R0.Lp91 5-6-Multiplex PCR with both primer for Lp9. 1-2. 1.Lp91 .L.LA1 (standard). 3-Lp75. 2-Lp20. 8-Lp44.L.Lp91 3-4. 6-Lp5276. L casei J13.5 Lanes: M-100 bp marker. L casei J7.5 of Lp9. 4-Lp76. 1-Lp10.Genus specific PCR product of Lp9. 4.BB12 (Bifidobacerium bifidum) 20. 7.L. 7-Lps2.2. Multiplex PCR with primer pairsLBLMA1 /R161 and MubD1_F87/ MubD1_R0.

1. 3-4. 14-Lp130.6 kb 250 bp 100bp Fig. brevis (standard). 5-Lp-77.5 ratio of Genus and ‘Mub’ primers). Multiplex PCR for L. Multiplex PCR for Lp9 with primer pairs LBLMA1/R-161 _ MubN_R165 _ and MubN_F0. 1-L. 1-2-(1:0. 4-Lp72. 12Lp91.93/ Lanes: M. plantarum isolates with primer pairs LBLMA1/ R161 and MubN_F0.93 0 93 / MubN_R1.5kb 500bp 1kb Fig. 10-Lp77.L.2. brevis (standard). Lp130.65 Lanes: M-250 bp DNA ladder. 5-Lp20. 4-Lp10.M 1 2 3 4 5 6 7 1. 9-Lp76.2009 ILSI-India 20 . 2-Lp5276 (standard). 5-6.Supermix DNA ladder. 7-Lp20 PCR Assays M1 1 1 5kb 1. 13-Lp-122. 8-Lp75. 3-Lp91. 7.5:1 ratio of Genus and ‘Mub’ primers). 6-Lp10. 3Lp9. i ‘Mub’ ‘ ’ PCR C with i primer i pair i mubN_F0.(0.5kb 500bp 2 3 4 5 6 7 8 9 10 11 12 13 M2 1. 11-Lp90.93/ MubN_R165 Lanes: M1-500 bp DNA ladder. Lp 122. 7-Lp72.6 kb 250 bp M 1 2 3 4 1. 6-Lp21.1kb DNA ladder (Chromous) Fig. M2-100 100 bp DNA ladder 20.(1:1 ratio of Genus and ‘Mub’ primers). 2-Lp9.6 kb 5 6 7 1.

Potential Biomarkers for Selection of Probiotics against specific ifi di diseases • • • • • • • • • Probiotics – Highly strain and host specific (Specific health promoting functions) Inflammatory diseases. Diabetes Rheumatoid arthritis Allergies – rhinitis Respiratory tract diseases – pneumonia etc. Liver diseases Hypertension. bladder etc. obesity etc. Gastro-intestinal disease Cancers – colon. . Ulcerative colitis. 20. Crohn’s disease. IBD. constipation p etc.2.2009 ILSI-India 21 . Autoimmune diseases – Diabetes.

2009 ILSI-India 32 .Development of DM2 and CVD through oxidative-inflammatory id i i fl cascade d 20.2.

2.Preclinical Studies di • Cell lines (In vitro) – Too simplistic to mimic human systems – Important to screen strain characteristics – Important to understand mechanisms • Small experimental animal models (In vivo) – Cannot be used for p proof of efficacy y – Excellent for safety 20.Evaluation of the evidence .2009 ILSI-India 23 .

Evaluation of the evidence . II and III • Preventive / therapeutic • Critical Data analysis • Post market surveillance studies 20.2009 ILSI-India 24 .Clinical Studies • Human target g population p p RDBPCT : cornerstone of efficacy in human studies • Phase I.2.

tuf etc.Identification of probiotics – a prerequisite • • • • Physiological function – highly strain specific Identification at strain level – very important False claims / labeling – spurious products Molecular based identification – more reliable at genus.rhamnosus(2). Lb.fermentum (25). Lb. Lb. acidophilus (2) 20. Lb.2. delbrueckii (2).) Lb.reuteri(4) and Lb. species and strain level – 16s rRNA sequencing – House keeping genes (rpo. Lb.2009 ILSI-India 25 . Lb. paracasei (4). casei (13). plantarum (26).

2009 .Nucleotide sequence of unique RAPD band of Lb casei with primer OPBB-02 • • >OPBB-02 CACTGGCTGGGAAGGCACCGAGTTGTATGTTCAGCTAGTTCCGG AAGGCAAATTTGAAGGTGACACGTTAAATCCGTATTTTCTGATCA AAACCGCGGATGAAGCGTTCAGCTTGTGGTCACCGACTGACTGT GACATTCTCGCTGAAGATTGGCAACTTGTTGACGCATGATAGCAT TCGATTTTAGCGGCAAAACGGTTGTTGTGACTGGTGCGGCATCG GGAATCGGCGCGGCTCAGGCAGCGGCGTTTACAGCAGCTGGTG CACGGGTTATTGGCGTCGATCTTCAGCCGATGACTGGGCTAGCC GTCACCATTCAGGCAGATGTCAGTAAGGCCGCGACAGCAGAAA ACATCGTTCGTGACTATGCGCCCGACATTGTCTGCAACACGGCG GGCATTCTGGATGGTTATCAAGACGTCGCCGCCACTGATCTGGC AACCTGGCAGCACATTCTTGATGTTGATCTCACCAGCCAGT >probe1 5’-TGGCAGCACATTCTTGATGTTGATCTCACCAG 5 TGGCAGCACATTCTTGATGTTGATCTCACCAG -3’ 3 ILSI-India 26 • • 20.2.

in vitro evaluation of adhesion using cell lines do not account for complex and changing mucus lining Probiotic safety ? Clinical trials on human subjects for validating health benefits 20.2.Probiotics : Few Questions which remain unresolved l d • • • • • • • • • • • Selection of probiotic culture – what should be the criteria to define the most ideal probiotic strain for a specific disease Monostrain vs multistrain ? Will cell free extracts work ? Quantity and quality of probiotic needed for desired effect ? How best to assess the activity / viability ? Which Probiotics remain viable in GI tract ? How long do they remain in the gut to be effective? The best target site in pathogenesis of a particular disease for interventions Cell lines / cell culture and Animal models Lack of correlation (In vitro versus in vivo assays) e.2009 ILSI-India 27 .g.

2. .2009 ILSI-india 36 . nutrient survival capacity limitation. might influence?) Selection of probiotics on the basis of Adhesion potential using in vitro assays is being debated ? Can not be extrapolated to GIT (in vivo) due to – – – – Host defense systems Competition for nutrients and space with commensals Mucosal shedding Peristaltic flow that continuously washes GIT • Hence. extrapolation of these findings to clinical applications requires caution 20. antimicrobial components etc.Points to ponder • • • Probiotic definition or selection criteria should include: – Abilit Ability to t generate t an immune i response – In vitro assays to show that probiotics activate immune cells Does in vitro screening based on acid and bile predict in vivo p y ( (other stresses like oxidative.

2.2009 ILSI-India 29 .Current problems with “probiotics” probiotics in India • Extravagant claims without research – Spec Specific c species spec es and a d strain st a e effects ects • Lack of good manufacturing practices – Quality assurance – Label vs content – Viability of bacterial species • Validated biomarkers for assessing function and activity y • Identification needs to be done using molecular tools 16S rRNA FISH • No specific guidelines currently – In India 20.

food habits and regional and anthropological differences) – can be explored by metagenomic approaches High probability of biodiversity amongst probiotic strains from different gut niches at Genomics and Proteomics level Initiatives for mining the complete genome of promising Indian strains and the functional genes associated with novel physiological function Search for Novel probiotic strains (Lactobacilli and Bifidobacteria) with specific physiological functions in the gut using comparative genomics.2.2009 . Proteomics approaches etc. Transcriptomics.Desired Interventions from Indian Perspective i • A comprehensive database on Indian probiotic cultures. ILSI-India 30 • • • • 20. health well being and disease mitigation need to be generated as a National priority Indian gut – a rich habitat of diversified microbiota (gut ecology . their diversity and novel physiological functions for human health.

2009 ILSI-India 31 .2.Contd… • Identification of potential Biomarkers for evaluating functionality of probiotics because greatest challenge concerns functionality of probiotics to strengthen health claims probiotics confer on host health Development of consortia of proven strains for ethnic dairy based product development (Dahi / Lassi) for boosting mucosal immunity Biosafety evaluation of selected probiotics and appropriate validation of health claims through clinical trials in target human subjects Efforts should be made to conduct clinical trials in Indian population for comprehensive evaluation of the efficacy of the Indian probiotic cultures against diarrhoeal as well as life style diseases vis a vis established western cultures to prove their efficacy • • • 20.

2.Time for a paradigm shift Supply viable beneficial bacteria or a substrate which enhances a specific b beneficial fi i l bacteria b t i instead i t d of f trying t i to eliminate the pathogen ? “Bioecological Bioecological control control” 20.2009 ILSI-India 32 .

Conclusion • “Thy Food Shall Be Thy Remedy” Hippocrates • Disease can be: – Prevented – Mitigated – Treated • Appropriate Choice of : – Clinical proven probiotics • We need to continue rigorous evaluation of assumptions and hypothesis to discover novel l probiotics bi ti 20.2.2009 ILSI-India 33 .

DM Division Raj Kumar.2. K. Govt.2009 ILSI-India 34 . Rajesh K Ph Ph. Ph. Prof. SRF Ashish SRF Ashish.D D student t d t Ashok.Acknowledgement • • • • • • • • ILSI . Batish.India Department of Biotechnology. Director. and Head. V. of India.D student R j h Kumar. 20. NDRI Dr.