You are on page 1of 93

SUCCESS.

com
August 2011
FREE CD
Inside
How to Win with the Power of Inuence
Warren Buffett,
Mark Cuban,
Kim Kardashian,
Bill Gates and
Nicole Kidman
What Theyre Reading
This Summer
Fire Up
Your Sales
Team!
AMAZON
KINDLE
ZAPPOS
DAVID HEYMAN
The Magic Behind
Harry Potter

Martina
Navratilova
Everyone has
the Heart of
a Champion
Whats Next,
Jeff Bezos?
App Version update:

If you have downloaded
Success Magazine App
prior to 12/12/12, please
delete and re-download
for an updated app
version.
Thank you!
*Figures reect averages for seventeen (17) afliate-owned restaurants that opened before January 1, 2006 as published in Item 19 of our April 2011 Franchise Disclosure Document. These averages are based on a 52-week annual period from December 30, 2009 through December 28, 2010. Of
these seventeen (17) restaurants, 7 (41%) had higher gross sales, 10 (59%) had higher food and paper costs and 8 (47%) had higher net prot during the reported period. The nancial performance representation contained in Item 19 of our April 2011 Franchise Disclosure Document also includes
(1) average system-wide gross sales, average franchise gross sales, and the number and percentage of restaurants exceeding these averages during the referenced period and (2) average gross sales, average food and paper cost, and average net prot information during the referenced period
for afliate-owned restaurants that were opened after January 1, 2006 and before January 1, 2010. A newfranchisees results may differ from the represented performance. There is no assurance that you will do as well and you must accept that risk. This offering is made by prospectus only.
F R E A K Y
FAST!
F R E A K Y

GOOD!
26.11%
*
$281,278
*
$1,263,172
*
AVERAGE FOOD AND
PAPER COSTS
AVERAGE NET PROFIT
FROM OPERATIONS (IN $)
AVERAGE GROSS SALES
AMERICAS FAVORITE
SANDWICH FRANCHISE!
FOR FRANCHISE INFORMATION, GO TO JIMMYJOHNS.COM OR CALL 800.546.6904

2009 JIMMY JOHNS FRANCHISE, LLC ALL RIGHTS RESERVED


.
T
a
b
l
e

o
f

C
o
n
t
e
n
t
s
:

A
n
d
y

R
o
g
e
r
s
/
A
s
s
o
c
i
a
t
e
d

P
r
e
s
s
;

C
o
v
e
r
:

J
o
e

P
u
g
l
i
e
s
e
/
C
o
r
b
i
s

O
u
t
l
i
n
e
AUGUST 2011
On the Cover
44
Change Agent
Jeff Bezos has revolutionized retail and is
shaking up publishing. And as Amazon.com
takes to the cloud, hes far from nished.
by John H. Ostdick
AUGUST 2011
Change Agent
Jeff Bezos has revolutionized retail and is
shaking up publishing. And as Amazon.com
takes to the cloud, hes far from nished.
by John H. Ostdick
Contents
40
Thought Leader
A book changed Orison Swett
Mardens life, and as a result, his
own works have influenced the lives
of countless individualsincluding
this authors.
by Jeffrey Gitomer
52
Spheres of Inuence
Each of us is influential in ways we
dont even realizewith positive and
negative results. Are you using your
power for good or for evil?
by Jennifer Reed
60
Changing the World
Jane Goodall pioneered a new
approach to studying primates. Now,
shes focused on humansinspiring
young people to change the world.
by Sally Deneen
66
Making Magic
Producer David Heyman knew he
was onto something while reading
his first Harry Potter script. He did
not know that something would
become a worldwide phenomenon.
by Amy Anderson
72
Summer Reading
Weve checked with the A-Listers to
get their summer reading lists. So
take a tip from them, put away your
potboilers and feed your brain.
by Mary Vinnedge and Amy Anderson
J
o
e
l

R
y
a
n
/
A
s
s
o
c
i
a
t
e
d

P
r
e
s
s
R
o
b
i
n

H
o
l
l
a
n
d
/
C
o
r
b
i
s

O
u
t
l
i
n
e
Jane
Goodall
David Heyman
72
Summer Reading
66
60
2 SUCCESS AUGUST 2011

Life-changing success insights


from todays leading personal
achievement experts
JUNE 2011
SUCCESS CD
FEATURING:
John C.
MAXWELL
Joel
HARPER
Tony
SCHWARTZ
I study SUCCESS
and keep every
magazine to
use as a
teaching tool
or to re-study
myself.
-LISA G., MARYLAND
SUCCESS will help you:
Discover new wa]s to excel in ]our marketplace
Build a plan to increase ]our fnancial success
learn latest techniques for revitalizing ]our mind and ood]
Find proven methods that will energize ]our relationships
Special Bonus!
FREE SUCCESS CD
in everyissue.
$60 value
SUBSCRIBE TODAY
12 Issues for ONLY $34.95
www.SUCCESS.com
800.570.6414
Get the competitive advantage in business and life.
Each issue of SUCCESS is packed with insights, ideas and strategies from
toda]'s top CE0s, revolutionar] entrepreneurs and other renowned leaders.
In Every Issue
6 Up Front
Publishers Letter, Letters, Online
Exclusives
11 Starting Points for Achievers
by Erin Casey, with Mike Zimmerman,
Nina Smith, Brandy Jules and K. Shelby
Skrhak
18 Maximum Leadership
Are you a player or a pretender?
Examine your motives and your
actions, and find out how to make
some positive changes.
by John C. Maxwell
20 Make It Happen
How to maximize your effectiveness?
Focus on what you doand do well
and ask for help when and where you
need it.
by Mel Robbins
36 Your Personal Best
Track star Louis Zamperinis greatest feat
was not a world record, but surviving
a World War II prison camp with spirit
unbroken. What can we learn from him?
by Tom Horn
80 Profiles in Greatness
During tumultuous times, President
Ronald Reagan saw opportunities in
challenges. In communicating his
optimism, he inspired the nation
to greatness.
by Deborah Huso
SUCCESS
Resources
84 Tech Tools
Gadgets to make fitness fun
by Brandy Jules
86 On the Bookshelf
Books to help you create long-
lasting and profitable bonds
with customers
88 Action Plan
Your guide to applying what
youve learned in SUCCESS
80
President Ronald Reagan
Business
26
How To
Fire up your sales team
with these tips from
the pros.
by Emma Johnson
30
From the Corner Office
Richard Robinson steered
his fathers company,
Scholastic Inc., toward
world leadership in
childrens book publishing.
How did he do it?
by John H. Ostdick
34
1-on-1
Are you under the
influence? Robert Cialdini
would say yeswe all are.
An expert in the science of
influence, he offers tips on
being more influential.
by Karyn Reagan
Well-Being
22
A Healthy YOU
We all make
mistakes, and thats
why its important
to be able to make
YOU turns to get
back on track.
by Drs. Mehmet Oz and
Michael Roizen
Relationships
24
SUCCESS for Teens
Help your teen
understand the
importance of good
habits in creating a
lifetime of success.
by David Lee
Giving Back
78
Making a Difference
Martina Navratilova
uses sport for
goodwhether shes
climbing a mountain
to prove theres life
after breast cancer,
or raising money
for youth athletic
programs.
by Don Yaeger
4 SUCCESS AUGUST 2011
he pros.
Emma Johnson
H
u
l
t
o
n
-
D
e
u
t
s
c
h

C
o
l
l
e
c
t
i
o
n
/
C
o
r
b
i
s
C
o
u
r
t
e
s
y

o
f

S
c
h
o
l
a
s
t
i
c
,

I
n
c
.
M
i
c
h
a
e
l

O

N
e
i
l
l
/
C
o
r
b
i
s

O
u
t
l
i
n
e
78
30
Martina Navratilova
Scholastic Inc.
Receive your monthly issue in a simple-to-use Web-based format with every
page exactly as it appears in print. Read it cover to cover or simply click
through to the articles that interest you the most. Plus, you receive monthly
SUCCESS Audio interviews in downloadable MP3 format.
READ
ON YOUR COMPUTER!
You SAVE 73% off
the newsstand price
ONLY
$19.99!
SUCCESS SUBSCRIPTION
12-ISSUE DIGITAL

ACCESS THE LATEST
ISSUE RIGHT AWAY!

DOWNLOAD SUCCESS
AUDIO IN MP3 FORMAT

BACK ISSUE ARCHIVES

SEARCHABLE

EASY TO USE
Subscribe Today at
SUCCESS.com/subscriptions/digital
Join the Community
facebook.com/SUCCESSMagazine
6 SUCCESS AUGUST 011 6 SUCCESS AUGUST 011

J
a
s
o
n

K
i
n
d
i
g
What do Jesus Christ,
Charles Dar wi n, Adol f
Hitler, Martin Luther King
Jr. and Vl adimir Leni n
have in common? Each
is deemed one of the 100
Most Inuential Persons in
History in Michael Harts
1978 book. Interesting,
isnt it?
You dont have to like
what their inf luence was
or what they inf luenced
peopl e t o do t hat s
beside the point, and well,
also the point. Each of
these people inf luenced
millions of others to do
as they envisioned and
directed. The key point
is: Influence is powerful,
and the same qual ities
and chari sma t hat can
inf luence people toward
human enlightenment can
also be used to influence
people to destruction and
great inhumanity.
Another vital understanding of inuence is: You
dont have to be standing on a mountaintop speaking
profound parables or pumping your sts on a lectern
while shouting madly into a microphone in front
of legions of people to be inuential. It is crucially
important to know that we are all, at all times,
inuencing people and the environment around us.
We are energetic beings. As we
enter every room, mix with
any group or converse with
any other living being,
we are either bringing
enl ightenment or we
are darkening the world
around us.
Additionally, we come
to understand ourselves by
connection and contrast with
other human beings. You are either
providing the contrast of positive potentialthe elevated
status of who they could becomeor providing the
temptation for them to surrender to their own human
frailty. This means your inuence is truly life-changing.
As you have probably gathered by now, this issue of
SUCCESS is focused on inuencehow to gain it and
how to use it for good. In this issue we will further
explore the ways each of us exerts either positive or
negative inuenceand we will ask you Are You Using
Your Power for Good or Evil? (page 52).
Speaking of inuence, I am often asked what has been
my most favorite interview of the hundreds I have done
with some of the most fascinating people on the planet.
On the CD enclosed with this issue, the rst interview
is my new, all-time favorite. The subjects name is Louis
Zamperini (read his story on page 36). He is 94 years old
and one of the most extraordinary people I have ever met.
I meet a lot of successful people, but few whom I would
call a tried-and-true hero. To interview him was one of
the most memorable treats of my life and I am sure that
listening to him will be one of yours as well. Also on the
CD is my interview with Robert Cialdini, author of the
book that has been most enlightening to me on the topic
of inuence. Dont miss it.
We hope this issue will have some small inuence in
enlightening your better you.
Darren Hardy
SUCCESS Publisher and Editorial Director
We are all, at all times,
infuencing people
and the environment
around us.
As we
th
y
with
M
ore from

D
arren on his blog at
DarrenHardy.SUCCESS.com

Connect w
ith D
arren at
Facebook.com
/DarrenHardyFan
You Are
Infuential
For Better or Worse
SUCCESS AUGUST 2011 7
Seeds of
SUCCESS!
FREE weekly newsletter for
ideas,
inspiration,
insight
and growing
achievement.
Nurture your own
success by subscribing
to SUCCESS magazines
FREE weekly newsletter.
Its delivered straight to
your e-mail inbox every
Tuesday. Featuring tips,
advice and video clips
from our experts, editors
and contributors.
SUCCESS AUGUST 2011 7
LIKE SUCCESS.
WE LIKE YOU.
Connect with the SUCCESS editors today! Join the discussion.
Facebook.com/SUCCESSmagazine
Twitter.com @SUCCESSmagazine
To Do This Month:
Read More
Books
SUCCESS BOOK
SUMMARIES
Now Available in DIGITAL Subscription
MORE ONLINE
Read SUCCESS magazines
From the Archives as
featured on page 14, including
a classic 1993 feature on
Mrs. Fields Cookies.
Listen to Web exclusive audio from
Robert Cialdini,
author of Psychology of Inuence
Hear tales from World War II hero
Louis Zamperini,
subject of Unbroken: Louis Zamperinis
Story of Survival, Resilience and
Redemption by Laura Hillenbrand.
Beginning Sept. 1, SUCCESS
editors and staff will collaborate to read Win:
The Key Principles to Take Your Business
from Ordinary to Extraordinary by Fred I.
Luntz. Think of it as a SUCCESS Book Club
for busy people.
WE HAVE
LOTS OF
BOOKS TO
READ.
WILL YOU
HELP US?
More details at blog.success.com
AVE
OF
KS TO
.
YOU
US?
ore details at blog success com
Hear a Free Preview on
video.success.com
video.success.com/rework
Fascinate
by Sally Hogshead
THIS
MONTHS
BOOK:
B
R
W
H
Buy the book.
Read along with us.
Join us for discussion
and conversation
on Facebook.
To do:
1.
2.
3.
8 SUCCESS AUGUST 011
LETTERS TO THE EDITOR
SUCCESS magazine (ISSN 0745-2489) is published monthly by SUCCESS Media,
200 Swisher Road, Lake Dallas, TX 75065.
POSTMASTER: Send address changes to SUCCESS magazine, P.O. Box 292144, Kettering, OH 45429.
SUBSCRIPTIONS: U.S.A., 12 issues $34.99; Canada, 12 issues $44.99; International, 12 issues $54.99.
To subscribe to SUCCESS magazine or to receive our free monthly Seeds of SUCCESS e-zine and online exclusives, log on
to SUCCESS.com. To subscribe to SUCCESS Book Summaries, log on to SUCCESSBookSummaries.com or call 800-570-
6414. CUSTOMER SERVICE: For service on your subscription, including renewal, change of address or other customer
service matters, call 800-570-6414, send an e-mail to CustomerService@SUCCESS.com or write to SUCCESS magazine,
P.O. Box 292144, Kettering, OH 45429. Please include your mailing label.
ARTICLE REPRINTS: Call 866-SUCCESS (866-782-2377).
ARTICLE PROPOSALS and unsolicited articles can be e-mailed to Editor@SUCCESS.com or mailed to Editor, SUCCESS
magazine, 200 Swisher Road, Lake Dallas, TX 75065. SUCCESS magazine cannot process manuscripts or art material,
and we assume no responsibility for their return.
2011 SUCCESS Media. All rights reserved. Material may not be reproduced in whole or in part in any form without
prior written permission. Printed in the U.S.A.
SUCCESS Media
Stuart Johnson, CEO
Paul Niccum, President
Steve Jamieson, Executive Vice
President and CMO
Joe OConnor, CFO
Reed Bilbray, Group Vice President
Paul Adams, VP Marketing
SUCCESS.com
Managing Web Editor
K. Shelby Skrhak
Email Marketing Specialist
Robert Frey
E-Commerce Infrastructure
Manager
Brian Cline
Web Designer
Sam Watson
Website Support/Marketing
Analyst
Nathan Noom
Web & Digital Content
Coordinator
Misty Kimball
Editor in Chief
Deborah K. Heisz
Publisher
Darren Hardy
Editorial
Editor
Lisa Ocker
Managing Editor
Amy Anderson
Associate Editors
R. Todd Eliason, David Lee
Contributing Editors
Don Yaeger, Erin Casey
Researcher/Staff Writer
Brandy Jules
Talent Executive
Paul Scott Adamo
Copy Editor
Peter Tepp
Creative
Creative Director
Carl Waters
Contributing Art Directors
Kim Baker, Amy McMurry
Graphic Designer
Floro Torres
Production
Production Manager
Alan Dwelle
Production Artists
Karla Garcia
Donna Rodgers
Christian Stovall
Advertising and Marketplace Sales
General Manager, Ad Sales and Circulation
Steve Norton
Marketplace and Inside Sales
David Williams
940-497-9961
dwilliams@SUCCESS.com
West Coast Sales
Mike Walker
213-896-9210 x201
mwalker@SUCCESS.com
Southeast Sales
Bill Bentz
404-256-0664
bbentz@SUCCESS.com
Northeast Sales
Frank Colonno
201-962-2759
fcolonno@SUCCESS.com
Midwest Sales
John Wagner
312-236-4366
jwagner@SUCCESS.com
Circulation
Newsstand Consultant
Angelo Gandino
Subscription Marketing
Sue Sidler
8 SUCCESS AUGUST 011
up front
SUCCESS Store
VP Marketing andE-Commerce
Greg Harp
Product Marketing and
Development Manager
Hugh Murphy
Marketing
Marketing Manager
Ashley Glenn
SUCCESS CD
Digital Asset Production Manager
Mariana Lenox
Customer Service
Melinda McQuillin
SUCCESS Speakers
Elizabeth Huse
STEVE MARTIN ON THE COVER
I have to admit to you that, while I always try to soak up the lessons from the
magazine and apply them to my life, my parenting and my life-coaching business,
this month I was just a smitten girl. I have always had a crush on
Mr. Steve Martin! So thanks for the wisdom with a bonus this month.
Erin Diffenderfer
South Carolina
I had not been a Steve Martin fan, but Ive changed my attitude. There is more to
the man than infantile comedy. Im glad to have a new perspective. Great article!
Bruce Walker
Florida
SUCCESS AUGUST 2011 9 SUCCESS AUGUST 2011 9
LETTERS TO THE EDITOR
Please include the writers name, city/state, e-mail address and day-
time phone number. Letters may be edited for clarity or space. MAIL:
SUCCESS Letters, 200 Swisher Rd., Lake Dallas, TX 75065 FAX :
940-497-9987 E-MAIL: editor@success.com.
TERMS OF SUBMISSION
By submitting anything to SUCCESS Media in any format, written or otherwise, you agree that: (1)
your submissions and their contents will automatically become the property of SUCCESS Media,
without any compensation to you; (2) SUCCESS Media may use or redistribute the submissions
and their contents for any purpose and in any way; and (3)there is no obligation to keep any
submissions condential.
Friends on Facebook
Follow us at
Facebook.com/SUCCESSmagazine
and Twitter.com/SUCCESSmagazine
SUCCESS asked readers, whats your most
creative caption for this photo?
Steve Martins life is another great example of how passion and
success go hand in hand. Bravo!
Rock Thomas
Quebec
What a great article about Steve Martin. It helped me get a new
perspective. Thanks so much; a real inspiration to me.
Barbara Eilert
Kentucky
Its been a long climb back up out of a glass hole. Great article about
Steve Martin, one of my 10 people Id love to meet before I die. Steve, you
remind me that loving what you do is what makes all the difference. Youre
on the list with Leonardo in my book.
Michael Knowles
South Carolina
Ive always been a huge Steve Martin fan, and the more things he
excels in, the bigger fan I become! He is someone Id love to have over
for dinner!
Shelly Burnett
Texas
THE 80-20 PRINCIPLE?
The reason Im writing is to say your magazine is great, if you are
already in the top 5 percent of successful people. Your articles address
only the top 20 percent income earners. You feature people only in the
top 5 percent. Why cant you increase pages of your current magazine
to address the common people, like adding more articles about the
basics in selling? But then maybe you only want to reach the top
5 percent income bracket.
Michael Carroll
Georgia
SUCCESS ON THE IPAD?
I have always adored Steve Martin. So excited to see him on the cover
this month. Question: When can I read SUCCESS on my iPad? I have
the digital version, but its not the same.
Krista Kalish
Arizona
Editors note: We currently have a free, basic iPad app thats very similar to
the digital edition, but work is under way to create a new, premium version for
multiple platforms. Thanks for the interest. Well keep you posted!
His hair is made
from live catsHe is
the most interesting
man in comedy.
William L.
Nelson
Doc said my Kitty
was low on iron.
Kimberly
O'Hare Schute
Blame the curiosity.
John Gonzalez
You think herding cats is difcult? Try ironing
one.
Stacy Rosas
My dog told me to do this.
Eli Morales
My wife told me to watch the cat and iron my
clothes. I took a shortcut and just ironed my cat.
Alis Kashkayan
Should have used purrrrrmanent press cycle.
Cindy Archer
for Achievers
Starting P ints
Before you are a leader, success is all
about growing yourself. When you
become a leader, success is all about
growing others.
Jack Welch
Because everything we say and do
is the length and shadow of our own
souls, our infuence is determined by
the quality of our being.
Dale E. Turner
You dont have to be a person of infuence to be
infuential. In fact, the most infuential people in
my life are probably not even aware of the things
theyve taught me.
Scott Adams
Through his freside-chat
radio addresses, President
Franklin D. Roosevelt
connected with Americans,
and helped them connect
with each other. His goal:
We are trying to construct
a more inclusive society. We
are going to make a country
in which no one is left out.
B
e
l
t
t
m
a
n
n
/
C
o
r
b
i
s
for Achievers
Starting P ints
Infuenced by Opportunity: Necessity may be the mother of invention, but opportunity is the
driving force behind entrepreneurial activities. A study by Babson College found that 87 percent of
people start businesses because they recognize an opportunity for a successful business venture.
Source: Global Entrepreneurship Monitor
@sam_farrington
@daveramsey inuenced me to eliminate debt, allowing
me to change careers without desperation for a J-O-B.
@MicheleDortch
My parents are my foundation; they taught me important
life principles. My kids provide day-to-day inspiration.
@Scotty27
My father is my greatest inuence. [He taught me]
always do your best for clients and treat them as you
want to be treated.
Imagine this scenario: You fnally have
the opportunity to connect with the
person who can help you move your
business forward. You have three
minutes to engage that individual. Do you:
a. Blurt out all the facts about your company in a prepared
speech that rivals the legalese outros on car commercials?
b. Calmly introduce yourself, show genuine interest in the
other person, and say just enough to pique his interest?
The answer, of course, is b. And in her new book, Terri
Sjodin will show you exactly how to get your message
across clearly and succinctly, and open the door for more
in-depth conversations.
Small Message, Big Impact
by Terri Sjodin
(GreenLeaf Book Group, 2011)
At the Bookstore
4 Things
to Do
Before the
School
Bell Rings
Who has had the greatest
infuence on your career
or business? And how did
they infuence you?
ACHIEVERS TWEET
You dont have to plan a full vacation to get reacquainted with the
people who matter most. In fact, just doing something new together
and sharing adventures is a great way to connect with children
of all ages, even teens who cant imagine having anything in
common with their parents. When youre doing something
youve never done before, conversation comes naturally, and so
do the laughs and memories. Check out these ideas:
Watch a movie or catch a
concert outdoors. A movie
or concert doesnt really count
as an adventure, unless its
outdoors, in a park perhaps,
viewed from a blanket spread
beneath the stars, with a cooler
of snacks close athand.
See the sights at home.
Pretend youre a tourist in your
hometown. Go to a museum,
gallery or planetarium; take
in a ball game; go to the zoo
or theme park; eat at a quirky
restaurant, or visit a historic
site. (Why not let each family
member pick at least one place
tovisit?)
Tackle a project with your
kids. Build a tree house,
make smoothies with different
ingredients and do taste
tests, restore a car, turn a
dated piece of furniture into a
whimsical creation for a kids
room, plant an herb garden,
learn to play chess, take up a
new activity like Frisbee golf or
tap dancing. Sharing a new
experience puts you and your
kids on commonground.
Go camping. Camping can
be as simple as packing your
tent and a few essentials and
heading to a state or national
park. But if sleeping on the
ground isnt your thing, load
into the RV (rent one if you
dont own one) or check
out campgrounds that offer
furnished cabins. Nature offers
a special kind of peace and
quiet, an opportunity to make
smores and tell scary stories,
and uninterrupted time for
discoverytogether.
a. Blu
sp
ac
her
success.com
Find more
Terri Sjodin
Follow our daily tweets at www.twitter.com/successmagazine
and join the conversation with #AchieversTweet.
SUCCESS AUGUST 2011 13
Play It Like Beckham
David Beckham learned theres no better motivator
than being told you cant.
by Mike Zimmerman
When David Beckham was 13 and dreaming of playing pro
football (soccer to the Americans among us), one of his coaches
said the magic words: Youll never play for England because
youre too small and not strong enough.
As Beckham told me, the coach wasnt joking or trying
to be ironic. He meant it. And young David was devastated.
Temporarily.
It occurred to him, even at 13or maybe because he was 13,
since adolescent rage can carry you farthat he could re-dedicate
himself and prove that coach wrong. As much as I was upset at
the time, it made me think, Well, Im going to prove that I can
play football professionally, he says. Back in those days there
were a lot of people who thought to be a player in England you
had to have a full-grown beard and be big enough to kick the ball
as far as possible. Its changed now.
Beckham helped change the thinking. Even though he wasnt
the biggest man on the pitch, his speed and uncanny scoring
ability helped him become one of the great players in the history
of the gameand one of the most popular athletes in the world.
Captain of the British national team for six years, he collected
more than 100 caps, meaning he played for his country more
than 100 times, an honor few players have achieved.
Stories like Beckhams are always interesting to usmaybe
because its fun to root for the underdog (though no one thinks
of Beckham as an underdog today). Maybe because we have an
innate desire to see people proved wrong. But when does a story
like this become more? When do you make it your own?
All of us have had someone tell us we cant do or be something
we dream of doing or being. Maybe it was a coach, teacher
or family member. But these days, the person telling you that
Whats Your Reason to Achieve?
Knowing your motivation will help you focus on your goal.
Extrinsic motivators are tempting.
Everyone wants to be well compensated
and recognized for a job well done. But the
euphoric effects of fame and fortune are
short-lived. Intrinsic motivatorspersonal
growth and satisfaction, purpose, making
a differencethough intangible, are more
rewarding in the long term.
In True North: Discover Your Authentic
Leadership, Bill George explains, For leaders
with a high-achievement orientation, external
motivations and positive validation by the
outside world are a natural consequence. The
key to developing as an authentic leader is
not eschewing your extrinsic motivators but
balancing them with intrinsic motivators.
Simply put, its OK if money is your goal,
but dont let it be your purpose.
you cant achieve a dream is more likely the one person you
absolutely must have on your side: you.
Henry Ford said something similar: Whether you think you
can or you cant, youre right.
Heres an interesting exercise: Every time you hear that big
voice in your head (there are no little voices in our heads), think
of it as some frustrated, ignorant coach telling you youll never
play for England. Get angry. Get motivated. Then get moving.
F
r
a
n
k

T
r
a
p
p
e
r
/
C
o
r
b
i
s
14 SUCCESS AUGUST 2011
for Achievers
Starting P ints
Wikinvest.com
allows you
to keep an
eye on all
your brokerage
accounts at once. With
visuals and relevant
information that gives users
a better understanding of
costs and returns, Wikinvest
makes minding your money
simple. Bonus: The free
Wikinvest Portfolio Manager
app lets you monitor your
accounts on the go.
Web Watch
Money Minder
Wikinvest.com
From the Archives
Debbi Fields, founder of Mrs. Fields Cookies, was reluctant to
trust the quality of her product and reputation to anyone else. After
launching in Palo Alto, Calif., in 1977, she and her husband, Randy,
opened 800 company-owned stores. But by the early 1990s the
companys growth stopped after incurring $49.5 million in debt.
Forced to sell off chunks of the companys ownership to investors,
Fields determined to try a new route: conversion franchising.
In September 1993, SUCCESS featured Mrs. Fields Cookies (now
known as Mrs. Fields) in an article on franchising. Whether you are
building a sales team or considering franchising as a way to expand
your business, the insights offered by Mrs. Fields and her franchisers
may smooth the way for your success.
Measure what matters.
The company used a sophisticated software system to track sales
and in-store activitydown to the number of cookies and mufns
prepared each hour. By measuring
what mattered, sales for stores using
the system increased by 17 percent
almostimmediately.
Work with people who care.
Franchisees have more at stake in
a business than employees do, which
means they may be willing to go the
extra mile. One independent store owner noted that quality was his
rst priority. I laid down ground rules: We were going to have a
spotless store, superlative product and great customer relations, said
Michael Zreik. To expand the market, Zreik delivered sample trays
of cookies to area businesses. Two days after a delivery a local bank
called and ordered $1,000 worth of cookies. An employee isnt
going to do that kind of marketing. But an owner will, Zreik said.
su
cce
ss.co
m
R
ead this and
other articles from

the Archives
Infuenced to Volunteer: What motivates people to volunteer? Almost 40 percent of people
give their time and energy because a friend, co-worker or someone already involved in an
organization introduced them to the opportunity to volunteer.
Is Your Business Scalable?
Moving to a franchise business structure kept Mrs. Fields Cookies from crumbling.
Todays technology offers
many entertaining diversions
that make it easier than ever
to get sidetracked from the
task at hand. But research
shows that there is an upside
to these distractions.
Searching online triggers
neurocircuits that really activate
the brain and may even be
a form of brain exercise, says
Dr. Gary Small, a neuroscientist
at UCLA. He cites studies that
indicate that surgeons who
play video games make fewer
mistakes. Most interesting, brain
scans show that a greater
portion of the brainalmost
two times greateris activated
by surfng the Net than by
reading a book. The greatest
increase in activity can be
seen in the front portion of
the brain, which is where
thinking and decision-
making occur.
While studies arent
conclusive, the research
indicates that when
technology is used in a
reasonable and balanced
way, it could potentially
improve short-term memory for
older adults and help children
with ADHD learn to focus their
attention as needed.
But what about those of us who
are masters of multitasking and
are plugged into technology
24/7? I tend to be one of
those people who juggle a
million different things at once,
says Small. But I fnd that if
I turn off the technology and
focus on a single project, Im
stunned by how much I can get
done in a short period of time.
Technology can be a very
good thing, he adds, but too
much of a good thing isnt
good. Balance is an important
principle to keep in mind.
Your Brain on Google
Source: U.S. Department of Labor
eople

SUCCESS AUGUST 2011 15
Sales
If you are not taking
care of your customer,
your competitor will.
Bob Hooey
SUCCESS
Q U OT E
Users on
Twitter are
more likely
to share an
article than read it, whereas
users on Facebook click on more articles than they
share, reports Mashable.com. What does that mean,
exactly? Your Twitter followers may support you with
a retweet, but that doesnt mean theyre actually
reading your content. And if they dont read your
offer, how are they going to act onit?
Mashables data also indicates that a Facebook post
gets roughly 8.7 times more clicks than a tweet
not surprising, since Facebook has signifcantly
moreusers.
In either case, updates have a short lifespan. Less
than 20 percent of likes occur after the frst 24
hours on Facebook, says Mashable. Ninety-two
percent of retweets and 97 percent of @ replies
happen in the frst hour, reports Sysomos.
The platforms reach different audiences and clearly
have different purposes. Service such as HootSuite,
TweetDeck and Seesmic make it easy to post
messages in several places at once, so why limit
yourself to just one?
Just keep in mind, whether you tweet, Facebook, or
both, repetition and follow-up are just as essential
online as they are in the real world.
Twitter vs. Facebook
If you had to pick just one social
media site to promote your products
or services, which should itbe?
In an overcrowded, hypercompetitive world, the only way to
make an impression on your prospect is to break through the noise.
The formula of telling everybody how great you are with your
state-of-the-art solutions, commitment to customer service, and
best prices in town just wont cut it, says marketing expert Lauron
Sonnier, author of Think Like a Marketer. She recommends the
following tactics to make yourself or your company stand out.
1. Do different things. Its easy to stand out when you
do something no one else is doing, Sonnier says. To
beat your competition, you cant just be a little better
than they are. You have to do something different than
theydo.
2. Do things differently. This is where you demonstrate your
understanding that the how can be more important than
the what, she says. Add a special touch of class, elegance,
humor or spice that makes even the common seem special.
3. Stir emotions; spread happiness. When you stir positive
emotions, be they joy or inspiration or peace of mind, you
send a message that theres more where that came from,
Sonnier says. And theyll keep coming back for more.
4. Be consistent. The three aforementioned methods of
standing out will work only if they are consistent. Whatever
it is, however seemingly insignicant, if it always happens
or never happens, you have created something sticky. You
have developed an identity that people can count on and will
talkabout.
Stand Out from the Crowd
How to Make Yourself, Your Product
or Your Company Memorable
U
Tw
mor
to sha
article than read
or services, which should itbe
.
e your
16 SUCCESS AUGUST 2011
for Achievers
Starting P ints
Money
Infuenced to Be Healthy or Not. Its true, you become like the people you spend time with. The
ongoing Framingham Heart Study, which began in 1948 with some 5,200 participants, reveals that people
whose friends are obese are 57 percent more likely to be overweight than those whose friends are slim and trim.
THE federal Credit CARD Act of 2009, which requires companies
to inform borrowers about the cost of credit, has helped consumers
understand the true cost of debt. The law mandates that lenders explain
how long it will take and how much it will cost to pay off your balance if
you make the minimum payment each month. It also requires companies
to show you how much youll save in the long run if you pay your card off
in three years.
But heres the kicker (that many people forget): That three-year mark
will always be 36 months away! The amount to pay off in three years is
recalculated every month, so it is, in essence, a moving target.
Three Harvard professorsClaudine Gartenberg, Dennis Campbell and
Peter Tufanoexplained to the Consumer Financial Protection Bureau
that it would take a consumer with a credit card balance of $3,900 at
15.32 percent APR 150 months to get out of debt if he paid the 36-month
amount listed on the statement.
If you want to know how much it will take to pay off your balance in
36 months, look at your current statement. Whatever the three-year amount
is on your current statement, pay that every month; disregard the new three-
year gure on subsequent statements. But remember: If you make a purchase
on your credit card, youll need to increase your monthly
payment accordingly.
3 Years=150 Months?
How long does it really take to
pay off your credit card?
Whos Infuencing Whom?
Even if your core market is baby
boomers or Gen Xers, it pays to
appeal to Gen Y.
Parents play a major
role in shaping their
childrens attitudes
about debt, saving and
spending. But 15- to
25-year-olds have a
sizeable impact on
their parents spending
behavior, particularly
when it comes to
technology, according
to a survey conducted
by InSites Consulting
and MTV.
51%
say they infuence the technology
their parents adopt.
41%
say they infuence their parents
purchase of products and services.
31%
say they infuence their parents
decisions on where to shop.
So what appeals to the Gen Y market?
Survey respondents listed the fve most
important characteristics for a brand or
product as:
1. Up to date 4. Uniqueness
2. Own style 5. Clean reputation
3. Real/authentic
Coolness and trendiness ranked much farther
down the list, which indicates Gen Yers
are looking for substance over form, and
originality instead of cookie-cutter style. If you
can manage to present an authentic image
that meets those demands, maybe theyll talk
their parents into giving your product or
service a shot.
trim.
ur product or
SUCCESS AUGUST 2011 17
SUCCESSinSeconds
PLAY FAIR:
Take turns planning
fun outings with your
friends or loved ones
each week.
UNPLUG:
Commit to turning off
your computer one
weekend or one day
a month and simply
explore the great
outdoors.
COPYCAT:
Save cents by
reusing one-sided
printouts to make a
worknotepad.
CHEER:
Attend a local
sporting event or a
citywide league game
this month.
RESET:
Be more punctual by setting
your watch or offce clock two
minutes fast.
He who inuences the thought
of his times inuences the times
that follow.
Elbert Hubbard
SUCCESS
Q U OT E
Boomers Are
Saving Green
by Going Green
In cutting back on expenses,
younger consumers show
concern for the environment as
well as their wallets. Consider
the following results of a
survey by Harris Interactive
that shows the percentage of
respondents who switched to
refllable water bottles instead
of purchasing bottles of water,
in order to save money.
SUCCESS Asks:
How do you use Facebook
for your business?
I engage
I have a business
page where I create
relationships with fans.
I inspire
I have a
business page
and an active
community
offans.
I advertise
I have a business page
but dont post often.
I wish
I dont have a
business page yet.
I update
I have a business
page and post
product/service
updates.
Gen-Y (18 34)
Gen-X (35 46)
Baby Boomers (47 65)
Matures (66+)
%
0 5 10 15 20 25 30 35 40
13
%
9
%
50
%
13
%
15
%
Maximum Leadership JOHN C. MAXWELL
18 SUCCESS AUGUST 2011
Players vs. Pretenders
What kind of followers do you lead? People who
look the part or those who do their part?
In every organization there are those who would rather
act the part than do their part. Ive classified these
people as pretenders. Pretenders can slow an organiza-
tion down, steal momentum and damage relationships.
They live for themselves. When an organization needs
we people, the I people either change or get exposed.
In order for a pretender to become a player, major changes in
personality and thought patterns must take place.
A good friend of mine, Bill Purvis, gave me the idea to do a
lesson on this very topic. He once said, I experienced much
more success when I learned to tell the difference between the
players and the pretenders.
Pretenders look the part, talk the part and claim the part, but
fall short of fullling the part. Let me give you ve differences
between players and pretenders.
Differences Between Players and Pretenders
1. Players have a servants mindset.
Pretenders have a selsh mindset.
Albert Einstein illustrated this point brilliantly:
Strange is our situation here upon Earth. Each of us comes for
a short visit, not knowing why, yet sometimes seeming to divine
a purpose.
From the standpoint of daily life, however, there is one thing
we do know: that man is here for the sake of other menabove
all for those upon whose smile and well-being our own happiness
SUCCESS AUGUST 2011 19
depends, and also for the countless unknown souls, with whose fate we are
connected by a bond of sympathy. Many times a day I realize how much
my own outer and inner life is built upon the labors of my fellow men,
both living and dead, and how earnestly I must exert myself in order to
give in return as much as I have received.
Einstein realized that he was a debtor to those who had previously
gone before him and who had given of themselves to him.
Question: How can you tell if you have a servant
attitude?
Answer: By the way you react when you are treated like one.
2. Players are mission conscious.
Pretenders are position conscious.
Players will give up a position to achieve a mission, and pretenders
will give up a mission to achieve a position. They are also worried
about what their titles are and where they are on the promotion
ladder. Players dont promote themselves; pretenders, on the other
hand, are quick to tell you how valuable they are to the organization
and will go on and on about their accomplishments.
3. Players are job-happyThey love what they do and do it well.
Pretenders are job-huntersThey cant do it where they are,
but think they could do it better where they
are going. Pretenders always think the grass is
greener on the other side of the fence.
Pretenders have three things in
their lives:
Destination DiseaseThey think
success is always somewhere else.
Someones SicknessThey thi nk
success is with someone else.
Backslider BluesThey think success
today is impossible because of yesterday.
4. Players can deliver the goods.
Pretenders promise the goods.
Author Thomas Sowell says, We hear about
the haves and the have-nots. Why dont we
hear about the doers and the do-nots?
One of my favorite stories deals with this
topic. Its about an illiterate salesman by the
name of Gooch who was sent out by a large
company, and the following are some letters
he wrote back to the boss:
Dear boss: I seen this outt which they aint
never bought a dimes worth of nothin from us
and I sole them a couple hundred thousand
dollars worth of guds. I am now in Chicago.
The second letter read:
I come here and sole them half a milyon.
The president of the company posted
these letters on the bulletin board with
this note:
We bin spending too much time
here tryin to spel instead of tryin
to sel. Lets watch these sails. I
want everybody should read
these letters from Gooch who
is doing a grate job for us, and
you should go out and do like
he done.
Gooch is a player; he knows
how to bring home the goods!
5. Players love to see others succeed.
Pretenders are only interested in their own success.
Rabbi Harold Kushner said it best:
The purpose of life is not to win. The purpose of life is to grow and
to share. When you come to look back on all that you have done in life,
you will get more satisfaction from the pleasure you have brought into
other peoples lives than you will from the times that you outdid and
defeatedthem.
When I graduated from college and started
running my rst church, I was very competi-
tive. I would find out what other churches
were doing and would compare what they
were doing with what I was doing. But I
evolved beyond being a competitor
To personal achiever
To team player
To team builder
I started out wanting to get an advantage
on the other churches; now my greatest joy
is raising up and developing leaders. Out of
developing them, they have added value to
my life and I added value to their lives. If you
can get everything accomplished by yourself,
your dream is too small. One is too small a
number to produce greatness. Its always been
about teamwork.
Players Are Real
Leaders do not try to perform for the
followers benet. They are open and truthful.
They have nothing to hide. Truth really does
set you free. You arent constantly trying to
cover up. Pretending to be real is a lot more
exhausting than just being real. S
John C. Maxwell is a leadership expert,
speaker, author and founder of EQUIP and the
John Maxwell Company, companies that have
trained more than 5 million leaders worldwide.
A New York Times, Wall Street Journal and
BusinessWeek best-selling author, Maxwell has
written more than 60 books, including three
titles that have each sold more than 1 million
copies: The 21 Irrefutable Laws of Leadership,
Developing the Leader Within You and The 21
Indispensable Qualities of a Leader. His blog is
at JohnMaxwellOnLeadership.com.
Make It Happen MEL ROBBINS
Get What
You Need
So You Can Give Others
What They Need
20 SUCCESS AUGUST 2011
Mel Robbins is a
syndicated radio host,
TV commentator and
author of Stop Saying
Youre Fine: Discover a
More Powerful You.
I walked across the hotel lobby and
headed for my room. The smell hit me
immediately: popcorn, 400 feet away in
the lobby bar. The only problem was my
heel was killing me from jumping into
a huge fountain the night before (Ill
explain later), and I didnt want to limp
the extra distance to get the popcorn.
The scent followed me onto the elevator
and into my room. I kicked off my
shoes, climbed onto the bed and turned
on the TV. I could still smell that darn
popcorn. Then the phone rang.
It was Rosalind. She is the eld coordi-
nator on my new television series for A&E,
Inlaws. She reminded me we were meeting
in the lobby in 30 minutes to head back to the set and shoot the
next scene. And then she asked, Do you need anything?
And before I had time to think, I said, Yeah, some of that
popcorn downstairs. It smelled amazing!
Rosalind said, You got it, and then hung up the phone.
I was mortied. I didnt mean for her to actually get it. I was just
joking. I called her right back but she didnt pick up. I sent her a
text: just kidding. But it was too late.
She knocked on the door of my hotel room and I hobbled over
to answer it. Rosalind, I am so sorry! I feel so bad that I made you
come all the way up here. She looked at me funny. And then read
me the riot act.
Are you kidding me, girl? Do you know what my job is? My
job is to take care of everyone on this crew. And your job is to be
on and change that familys life. If you dont get what you need,
how the hell are you going to inuence the families who need
your help?
The smell of popcorn lled the room. And so did Rosalinds
point. Id been so busy trying to not bother anyone on the crew,
I was not getting the support I needed to be my best. I wasnt
asking for help.
Same thing with my heel. When we jumped into a fountain and
climbed to the very top of it for a scene in the show the previous
day, I hadnt asked for help either.
One of the crew members extended his hand on my way down
and said, Let me help you.
I replied, Im good. I ve got thi s. What I got was a
deeply bruised heel when I jumped off a 6-foot drop into
shin-deep water.
I hate asking for help, but Rosalind reminded me that people
need me. And if I dont have what I need, how the heck can I
inuence true change for the families on our show? Rosalind also
reminded me that when I ask her for support, she gets to be a part
of inuencing these families too. I thanked her for the talk and the
popcorn. And I hobbled back over to the bed. The phone rang. It
was Chris, my husband. Im so glad you called. I wanted to thank
you, Chris.
For what?
For all the support you give me. You manage the three-ring
circus at home while Im on the road. Its a huge amount of work,
and it allows me to do my best with these families. Your support
of me is changing the lives of every single family on this show.
There was silence for a moment. He said, Thanks, I needed
to hear that. Our kids are driving me crazy. Wonderfully crazy.
You are very inuential when you want to be. Yes, you. The
question is, Are you asking for the support you need? S
LEARN MORE. IT ONLY TAKES A PHONE CALL
888-587-9246
Five Colleges of study.
One clear focus:
Your career success.
DeVry University is an accredited* university offering
you the flexibility of 90+ locations, online courses and
a wide variety of associate, bachelors and masters
degree programs. Whether you earn your degree on
campus, online, or through a combination of both,
youll find small classes and personal attention from
experienced and respected professors focused on one
thing your educational and career success.
Discover education working at DeVry University.
Corporations need business leaders. DeVry
University provides them. You can earn a
bachelors degree in Business Administration with
a specialization in Accounting, Finance, Project
Management, Human Resources or any of nine other areas. Or you can graduate
with a degree in Management or Technical Management. Whether youre working
towards your bachelors or masters degree, youll gain knowledge from top
professors with hands-on experience in the eld.
Careers in engineering, science and technology
are rapidly evolving. To develop skills for creating
innovative solutions, DeVry Universitys College of
Engineering & Information Sciences prepares you
with comprehensive degree programs. We offer the latest lab degree programs that
include Electronics & Computer Technology, Computer Information Systems and
Networking, Computer Engineering Technology and more.
With a shortage of certied personnel in business
and technology related healthcare elds, DeVry
Universitys College of Health Sciences offers
degree programs in some of the most in-demand
specialties. Each degree program is designed with input from leading hospitals and
professionals active in the healthcare industry. As a result, our degree programs
provide hands on training that will prepare you for success in your eld.
Valuable life lessons are taught in the
classroom. DeVry Universitys College of Liberal
Arts & Sciences is home to the foundational
educational requirements, including social
sciences, math and communication. Offered to students across all Colleges,
these courses ensure youll earn a well-rounded education and develop career-
focused talents.
Digital capabilities are driving todays economy.
Be prepared to enter this thriving eld with
DeVry Universitys College of Media Arts &
Technology. Degree programs include Web Graphic Design and Multimedia
Design and Development, enabling you to specialize in areas ranging from
graphic media design to computer animation to web site development.
Take the rst step
toward a university
education
YOURE NEXT: CALL TODAY TO APPLY NOW!
888-587-9246
*DeVry University is accredited by The Higher Learning Commission of the North Central Association, www.ncahlc.org. In New York, DeVry University operates as DeVry College of New York.
DeVry University operates as DeVry Institute of Technology in Calgary, Alberta. DeVry is certied to operate by the State Council of Higher Education for Virginia.
AC0060. DeVry University is authorized for operation by the THEC. www.state.tn.us/thec.
Nashville Campus - 3343 Perimeter Hill Dr., Nashville, TN 37211
Program availability varies by location. View our privacy policy at http://www.devry.edu/devry_privacy_policy.jsp. 2010 DeVry Educational Development Corp. All rights reserved.
22 SUCCESS AUGUST 2011
A Healthy You DRS. MEHMET OZ & MIKE ROIZEN
MakingYOU Turns
So, youve made some unhealthy choicesheres how to get back on track.
If youve ever ridden in a car with a GPS satellite navigation
system, you know how it works. Plug in your destination,
and the systemusing satellites to plot your current and
nal pointstells you exactly what to do and when to do
it. If you miss a turn or head down the wrong street, the
GPS doesnt berate you for the mistake. It doesnt tell you
that you might as well drive off a cliff just because you
missed First Avenue. Instead, it simply says: At the next
available moment, make an authorized U-turn. YOU-reka!
The GPS recognizes the mistake and tries to help you
correct it.
Thats the kind of mentality we want you to have regarding
your health. You are going to make wrong turns. Youre going
to turn left at the cookies, make a right at the blueberry pie, and
occasionally merge onto the interstate at banana nut pancakes
with a side order of sausage patties. Does that mean you should
steer off the cliff and onto destructive behaviors? Of course not.
You can make a YOU turn and get back on the right path.
Something else thats critical is having a buddy who can help
be your personal GPS system. Buddies help each other make
those YOU turns, get back on the right road, get healthy together
and enjoy their passions longer.
In fact, we believe the most important tness tips we can give
anybody are to:
Understand you get a do-over; its not that hard and it doesnt
take that long if you know what to do.
Start with walking and a buddy.
Learn how to make YOU turns.
Now lets get to one of your most frequently asked questions
and check next months column for more questions and answers.
SUCCESS AUGUST 2011 23
Q: I was on a diet last year and was doing
great. But after a while, I felt like I deserved
a break, so I overindulged. Ive been too
discouraged to start the diet againespecially
if Im just going to fail again.
A: How long can you hold your breath under water? Exactly. You see,
most diets promise commonsense solutions to tight-pants problems:
Eat less and youll weigh less. Keep your mouth closed and youll
keep the pounds off. Sweat like a sauna-dwelling sumo wrestler
and youll wind up skinnier than a sheet of paper. Straightforward
enough. But if it really worked that way, then most diets wouldnt
fail. Or it could be that most diets have it all wrong.
We believe its the latter. You know why? Because, with most
diets, its you versus food in a lifetime heavyweight ght. But in
that scenario, the ght is always xedand not in your favor.
Thats because the battle against extra pounds isnt won with
force, with sweat, with trying to diet. Its won with elegance, with
smarts and with healthy choices that become as automatic as a
Simon Cowell barb.
When it comes to dieting, trying to whip fat with our weapon
of willpower equates to holding your breath
under water: You can do it for a while, but no
matter how psyched up you get, at some point
your bodyyour biologyforces you to the
surface gasping for air. And with most diets,
your body forces you to gasp (or gulp) for food.
No matter how hard you try not to eat, some
hidden force deep inside is always prying your
mouth back open, making it impossible for
willpower to win. Instead of sparring with
your waistline, its time you made your body
an ally in the ght against fat.
Our process is to look at our overweight
bodies the way scientists would:
Ident i f y t he underl yi ng
biology of t he problem
then find the cures. The
scientific world has just
now started to unlock the
biological mysteries that
have caused us to store fat and
gain weight. By making this knowledge simple
and accessible, were going to give you tools
and actions to crack the code of true and life-
long waist management.
In fact, our plan will help you avoid the
dangerous yo-yo cycle of weight gain and
weight loss. Were going to help you repro-
gram your body so that you can keep off the
weight forever. Through the years, many of
us have been led to believe that our weight
problem is about two things: calorie counting
and mental toughness. While some of us may
say that the weight problem is too much of the 12-cheese lasagna, the
real problem is that most of us have no clue about how our bodies
work. Remember the YOU Diet mantra: Diet Smart, Not Hard.
Here are some tips to help you do that:
Walk. Begin walking 30 minutes every day, more if you can.
Your ultimate goal is 10,000 steps every dayno excuses! Walking
positively affects all the bodys systems and establishes the behavioral
and motivational foundation you need for success. It is also the most
important thing you can do to effect weight loss.
Dump Your Fridge. Read the ingredient labels on everything in
your kitchen cupboards, refrigerator, breadbox and everywhere else
you stash food. If you nd any of the following items in the rst ve
listed, throw it out!
You: On a Diet Rule of 5 Food Felons
1. and 2. Simple sugars and syrups. This includes brown
sugar, dextrose, corn sweetener, fructose, glucose, corn syrup,
honey, invert sugar, maltose, lactose, malt syrup, molasses, evapo-
rated cane sugar, raw sugar and sucrose.
Keep a little table sugar, honey and maple
syrup handy, because you ll use some for
recipes. (Read more about sweeteners from
our book YOU: On a Diet on success.com.)
3. Saturated fat. This includes most four-
legged animal fat, milk fat, butter or lard, and
tropical oils, such as palm and coconut.
4.Trans fat. This includes partially hydro-
genated fats, vegetable oil blends that are hydro-
genated, and many margarines and cooking
blends. (If you must, use cholesterol-ghting
sterol spreads such as Promise andBenecol.)
5.Enriched ours and all ours other than
100 percent whole grain or 100 percent whole
wheat. This includes enriched white flour,
semolina, durum wheat and any of the acro-
nyms for our that is not whole wheatthey
should not be in your kitchen.
Go Food Shopping. The rst week, youll
have a larger-than-normal shopping list
because youll stock up on essentials as well as
ingredients youll need for this weeks recipes.
We want to fill your kitchen with good-for-
your-waist foods that make it easy (and auto-
matic!) to eat right. (For a specic shopping
list that works with our suggested seven-day
schedule, see YOU: On a Diet.)
Coming next month, we ll answer more
questions on making YOU turns and employing
a buddy as your personal GPS system. S
Dr. Mehmet C. Oz is a professor and
vice chairman of surgery, as well as director
of the Cardiovascular Institute and Integrated
Medical Center at New Yorks Presbyterian-
Columbia University. Hes host of the Emmy
Award-winning The Doctor Oz Show.
Dr. Michael F. Roizen is a professor
of internal medicine and anesthesiology, and
chief wellness offcer and chair of the Wellness
Institute at the Cleveland Clinic.
Roizen and Oz are the authors of the New York
Times best-selling YOU series, including recent
releases YOU Staying Young: The Owners
Manual for Extending Your Warranty and You
Raising Your Child: The Owners Manual from
First Breath to First Grade.
bod
I
b
h
success.com
Find more
Drs. Oz &
Roizen on
24 SUCCESS AUGUST 2011
SUCCESS for Teens
The Power of
Good Habits
Good habits can serve you
for a lifetime.
by DAVID LEE
H
abits may entail simple acts that, in their
totality, have enormous power. Habits are
the result of doing things over and over
until we no longer have to think about doing
them. Our habits can be either positive or
negative, helping us to reach our goals or holding us back.
A valuable life skill you can teach your teen is how to
develop positive habits while getting rid of bad ones.
First, your teen should understand that habits can be
changed. Developing good habits can take time, but they can
be used as tools to achieve success. Looking for the positive in
people, learning to save money, creating schedules and focusing
on schoolwork are all examples of positive habits your teen
could develop.
SUCCESS for Teens offers some great tips on developing good
habits. With each tip, the book quotes actual teens who share
how they implemented the tips in their own lives and the benets
they experienced.
Develop a Schedule
One of the best ways to achieve a goal is to create a detailed
plan on how to get there. A teenager named Desiree describes
how she used a schedule to develop a habit for doing schoolwork.
She says having a schedule helps you get into the routine
of challenging your mind. Once the
schedule is laid out, its much easier to
keep on track. This habit can be applied
in nearly every aspect of your teens life.
Do Things Ahead of Time
Octavia Fugerson learned how to do
things ahead of time and seek opportu-
nities instead of waiting around for good
things to happen. She took control of
her situation and developed a habit that
helped her focus on schoolwork.
I tried to do my schoolwork ahead of time, she says. Id
make sure Id do it to retain the information, not just to pass. If I
was struggling in class, Id let the teacher know if I was having a
really hard time with it. Id try to get some extra help. I would go
online and look for tutors.
Dont Get Down on Yourself
Trying to develop new habits and getting rid of bad habits will
involve some setbacks. But its important not to give up. It may
take daily steps and choices to develop a new positive habit. Ralf
Tarrant, 18, tells how he had to learn to save money. He used
to spend every dollar he got, and often borrowed money from
people. He soon realized that hed be in trouble if he kept this up.
So, he developed a habit of putting away a portion of any money
he got. He says he still bought things, but cutting back a little
made a huge difference over time.
Separate Needs from Wants
Jeremiah Spears learned how to get his spending under control
when his friend Lisa suggested he use a chart to separate his
wants, needs and gotta-haves. Lisa said its important to get what
you need rst and let the rest come later, so I began to make a
chart every time I went shopping, Jeremiah says.
Sometimes its not enough to give up a bad habit.
Sometimes in order to do that, you need to replace the
bad habit with a good one. Over time, the good habit
becomes stronger than the bad one and eventually replaces
it completely. Make sure your teen understands the power
of creating good habits and that it takes time for actions to
turn into a habit. It wont happen overnight, but learning
how to create good habits can serve your teen for the rest
of his life. S
Sponsored by the SUCCESS Foundation

and adapted from


the book SUCCESS for Teens

. For more information and to


order the book, go to SUCCESSFoundation.org.
www.SUCCESSFoundation.org
The SUCCESS Foundation

says
THANK YOU
to our nations educators
Teachers, principals and counselors have requested
over 500,000 SUCCESS for Teens

programs!
Eight great life skills and character-development
principles are reaching thousands of our nations
youth through dedicated, passionate educators!
For inspiring our youth, we salute you,
wethank you, and we are indebted to you.
Help us implement SUCCESS for Teens


and Eight to GR8 in school districts across
the country.
Donate at www.SUCCESSFoundation.org.
Little Things Matter
Attitude Is Everything
Use the Moment
Habits Are Powerful
Youre Always
Learning
Theres No Such
Thing As Failure
Everything Starts
with Small Steps
You Can Make Your
Dreams Come True
* The Facilitators Guide is provided to
the leader requesting the program.
SUCCESS for
Teens

helps teens
develop life skills.
How To
Your Sales Staf
Get creative with contests,
commissions and bonuses to
inspire your team.
by EMMA JOHNSON
26 SUCCESS AUGUST 2011
SUCCESS AUGUST 2011 27
S
elling is a tough jobtough on the ego, tough on the energy levelwhich explains
why sales reps are often some of a companys highest-paid employees. But even a
fat salary is usually not enough to combat steep competition, nicky customers and
grumpy prospects.
If compensation were a sufcient motivator, your people would already be performing, says
sales consultant and executive coach Mark Palmer. Instead, it is critical to identify what excites
your peoplemaybe its cash, certain gifts, prestige, peer recognition or job satisfaction. But
there is one unifying quality of all leading sales reps: They want to be on top, and they want to
be unique, Palmer says. They want to win.
However, its critical to nd ways to ignite an entire department, not just identify your leading sellers, says
management consultant Doug Johnson. Otherwise, the top three or four people work like crazy to win, and the
rest of the people who are just regular good salespeoplenot superstarsgure they cant compete so they just
give up, Johnson says. You have to create a program that allows everyone to win at some level.
First Person
Company: Mosaic commercial printer, Cheverly, Md.
Source: Joel Zelepsky, senior vice president of sales
and marketing
Number of Sales Reps: 15
Strategy: Contests in which everyone wins, inspiring the
entire company to support the sales team
Evidence of Success: 20 to 25 percent annual sales growth
Im a big believer in not giving just moneyI want
to give my team memories to treasure through
unique experiences.
Each of the last ve years weve had motivating
contests with a different theme each year.
The program is announced at the annual
companywide barbeque, which helps get the
entire company behind the sales guys. Once he
makes his goal seven out of 12 months, each
sales rep can walk into my ofce and take a
special prize off the wall. One year the theme
was the Heavy Hitters Club, and I bought one
authentic Louisville Slugger for each salesman
laser-engraved with his name, and mounted
them on a professional rack in my ofce. Other
years the prizes were personalized professional
race car steering wheels, and $400 professional-
quality NFL jerseys for the salesmans favorite
team, customized with his name and birth year.
As the months wear on, the peer pressure builds,
but it also encourages a team effort. Sales guys
mentor those lagging behind, but people from
other parts of the company become part of the
enthusiasm, too, as they walk by the window of
my ofce and see the remaining prizes. Guys
from the bindery or print shop will come by and
ask the sales associates what they can do to help
our guys earn their prize. Quite honestly, these
are prizes that any one of our 150 employees
would love to have.
On top of that, Ive found that instead of cash
prizes, sales associates are often more motivated
by a choice of services like 50 weekly gourmet
meals, or a years worth of housecleaning.
These serve as a weekly reminder of their
accomplishment, and also treat the employee
to something they probably would not buy for
themselves. I cannot tell you the mileage I got
out of the gourmet mealsthe wives absolutely
loved it. Plus, when a guy is making $200,000
and you give him a $5,000 bonus, hes like,
Whoop-de-doo.
This year our Prospector program is focused
on getting new business, and the cash prize is
based on a percentage of new business. The
twist is there is no ceiling on how much their
bonus can be. They cant believe we did that.
Itsexciting.
h
28 SUCCESS AUGUST 2011
How To
First Person
Company: Blinds.com
Source: Steve Riddell, COO
Number of Sales Reps: 25
Strategy: Initiated a bonus system designed to
improve overall performance, including gross sales
Evidence of Success: Since launching the
program, conversion rates jumped from an average
of 27 percent to 36 percent, and revenue improved
by about $2 million, directly attributed to the new
bonus program
We sell window blinds over the Internet, and 30 percent of our
sales are to customers who call in because theyre not nding
what they need online. A year and a half ago we moved from a at
salary structure to a base-plus-incentives structure, and its had a
huge effect on our conversion rates.
We never want to use incentives and compensation to x what is
broken, but rather to take our sales to the next level. Before, the
company gave kudos to the salesperson with the most revenue,
First Person
Company: Hagie Manufacturing, large farm
equipment maker, Clarion, Iowa
Source: Travis Stallkamp, business
development manager
Number of Sales Reps: 25
Strategy: 100 percent commission team
selling, a share in margins, a bonus based
on market share
Evidence of Success: Doubled revenue
since 2007
Almost all of our sales staff are on 100 percent commission,
which works really well for us. Our machines sell for
between $180,000 and $400,000, which means they are
low-volume, but the demands on margin are high. If the
sales staff doesnt sell, they dont eat. Our guys are top-dog,
A-game players, and in our industry cash is king. Its good
old-fashioned capitalism and just the way our guys are.
In recent years weve moved
toward team sellingthree
people to a team, each member
works towards a combined goal,
and they split the commission
equally. When it comes from
proting from employees,
there is a huge psychological
factor. It can be very difcult
for salespeople working alone
away from the ofce. These
teams create synergiestheyre
like little businesses within
businessesand their results far exceed those working
alone. Plus, our ofce had fewer questions and phone calls
since the sales staff had each other to turn to.
We use the human drive to be the best by publishing team
rankings monthlyincluding margins. These margins are a
big dealwhen we sell a machine, we have to take trades
of used equipment, and the team is responsible for reselling
it. We pay them 50 percent of the prot, so they have a huge
vested interest in selling it, and selling it at the best margin.
Weve seen a jump in sales since implementing a bonus
system based on market share. Again, everything is cash,
though once in a while, for an especially well-done job, well
give someone a vacation to Hawaii for him and his wife. Its
just something extra to tell them the company cares about
them as individuals.
CONSIDER THESE STRATEGIES TO FIRE UP YOUR
SALES FORCE:
Make commission a driving force. To get the results you
want, shake up your commission structure. If you
want to push a new product, offer a higher cut for
that model. Make sure staff members are encour-
aged to land the big sh with proportionally big
payoffs. Johnson once worked for an insurance
company where the receding commission struc-
ture discouraged sales reps from going after the big,
tougher-to-sell policies. The midsized policies were
the reps sweet spot, and cost the company lots
of lost, big, protable policies.
Build winning teams. Creating sales teamsin
which there is an incentive for each member to
support, mentor and encourage the other members
has proven valuable in many ways.
Build in peer pressure. Publicly posting sales, margins
and conversion rates lights a ame under everyone.
Get the whole company behind the sale. After all, the whole
organizations survival depends on the sales departments success.
Announce contests and campaigns to the whole rm. Encourage
supporting departmentssuch as customer service, engineering
and marketingto be supportive of the sales staffs efforts.
In
tow
pe
wo
an
eq
pr
th
fac
fo
aw
tea
lik
businessesand d their rresults
IRE UP YOUR
the results you
e. If you
cut for
encour-
ally big
surance
n struc-
er the big,
icies were
lots
in
mber to
members
ales, margins
veryone.
le. After all, the whole
es departments success.
whole rm. Encourage
mer service, engineering
es staffs efforts.
C
o
u
r
t
e
s
y

H
a
g
i
e

M
f
g
.
C
o
.
SUCCESS AUGUST 2011 29
but we found that person was just taking the most
calls and cherry-picking callers who were most
likely to buy.
Our program is designed to improve overall
behavior, as well as results. Our bonus system is
based on revenue, dollars sold per call, conversion
rate and the quantity of calls. When supported by
training, the sales associates skills improve, their
behavior improves, and performance goes up.
Our competitions have several components. Our Red Bull Club gives a Red Bull
energy drink to every person who makes $7,000 sales in a day and at least a
36 percent conversion rate. That qualies them to win a cash prize of at least $40,
which also requires they take 24 calls per day, average $150 per call, and have a
40 percent conversion rateas well as show up for their shift on time. Sales
associates are paid $10 per hour, but some make as much as $60,000 per year.
Also, sales results are posted every single day before the entire company. Since the
prizes dont go to the same person over and over, each person focuses on their daily
performance and competes against themselves. You have to look at sales as a holistic
and constant process. Periodic contests do not change behavior, and they dont
improve results long term.
Find out what motivates. Ask your sales team what they
want. Experiment with different bonuses and prizes.
Often, cash is king. Sometimes highly luxurious items
that are reluctant self-purchases might be big winners.
Other times, less tangible prizessuch as the ability to tele-
commute once a weekcan resonate with staff.
Mark Faust, business consultant and author of Growth or Bust:
Proven Turnaround Strategies to Grow Your Business, advises clients to
award performers with a day off, which might include a golf
course pass. Giving a vacation day is one thing, but a vaca-
tion day that includes the fee for the pay lake or greens
fee is another, Faust says. They are being paid to sh
or golf, and they have to do itthey arent stuck at
home with a honey do list or just a boring day off.
Keep it frequent. The key to successfully motivating sales staff
is to build a strategy into the daily work. Small but frequent tokens
of accomplishment might include a can of soda for making a daily
quota, or an early out on a Friday for a week well-done.
Another of Fausts ideas: hour power coupons granting a
contest winner a pass to play games in the company break room or hit the gym
in the middle of the workday. The key is to give them out in multitude and
frequently, and let the rep choose the exact time, Faust says. The one hour off
has an excellent ROI, since the employee returns to their desk refreshed and
hits the ground running. S
Find o
want.
Often,
that are
Other times
commute onc
Mark Faust
Proven Turnarou
award per
course
tion
fe
o
h
Keep it frequ
is to build a strat
of accomplishme
quota, or an early
Another of Fa
contest winner a pass to play
in the middle of the workda
frequently, and let the rep ch
has an excellent ROI, since
hits the ground running. S

D
i
x
i
e

A
n
n

D
a
l
t
o
n

P
h
o
t
o
g
r
a
p
h
y
30 SUCCESS AUGUST 2011
from the
Corner
Of ce
By the Book
Second-generation Scholastic Inc.
exec embraces a mission that grows.
by JOHN H. OSTDICK
F
or Richard Robinson, expanding a successful
business has proved challenging childs play.
During the past 90 years, Scholastic Inc. grew
from the one-room classroom magazine enterprise
his father started into the worlds largest publisher
and distributor of childrens books that Robinson oversees
today. The $2 billion revenue company has more than 9,000
employees in 16 countries. Since the mid-1970s, when
Robinson became president and CEO, Scholastic has emerged
as a world leader in school-based distribution through book
clubs and book fairs.
We are constantly looking for a connection to the childs
basic interests, what about a book captures whats important
to the child reader or presents some fact in an amazing way,
Robinson tells SUCCESS. In general, thats what has
characterized our most successful books, both as a
publisher and distributor.
Robi nsons st rengt hs as a mot ivator and
communicator of his companys mission have
proved critical as he expands his fathers company
into a significant online services provider and
burgeoning new media player.
I think the most amazing thing about Scholastic
is that you can ask anyone in the company, and
to a person they will tell you our mission, Robinson says. My
favorite story in this regard is from a trip to our distribution
center in Jefferson City. I asked one of our many long-term
employees there, What is your job? What are you doing here?
He never mentioned the forklift he was sitting on but rather
said, My job is to help children love to read. As far as he was
concerned, when he was moving the books off the stacks of
pallets to the people who would send them out to the kids, thats
what he was doing.
Robinson credits his father with his early leadership lessons.
He had a great sense of mission, the younger Robinson says.
He was most interested in clear communication, focusing on
every single word the company put out, and in serving the
customer. What I also gained from him as he navigated his
ups and downshe was constantly struggling to make the
payroll in the companys rst 35 yearswas the importance
of resilience and focus. As I took the company to a different
level, I tried to follow the basic tenets that I could see had
worked for him. Keeping them working in a bigger company
was my challenge.
M.R. Robinson was Scholastic CEO for 55 years, a title
Richard has held for the past 35 years. Their leadership
overlapped for ve years, which Richard calls the most difcult
years of my life and perhaps his as well, as M.R. agonized over
many of the decisions the son made. After he died, eventually I
gured out that he had just been trying to maximize his ability
30 30 30 30 30 30 00 30 30 30 30 30 0 30 0000 30 300 330 33330 00 3330 30 333 SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSUC UC UC UC UC UC UC UUUUC UC UC UC UC UC UC UUC UC UC UC UC UC UC UC UC UC UC C UC C UC UC UC UC CCCCC UC UC CCCCC UCC UU CE CE CE CE CCCCCCCCCE CE CE CE CE CE CE CCCCCCCCCE CE CE CE CCCCCCCCE CE CE CE CCCCCE CCCCE CE CCCCCCCE CE CE CCCE CESS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SS SSS SS SS SS SS SSSS SS SS SSSS SSS AAAAAAAAAAAAU AAAUUUUUUUUG UG UG GGGGGGGG AU AAAAU AAUUUUUUUUG UG UGGGGGGG AAAAAAAAU AAUUUUUUUG UGGGG AAAAUUUUUUG UUUUUUUGGGGGG AAAAUUUUUUUG UGGGG AUUUUUG UG UG GG UUUGGG AAAAU UUUUUG GGGGGG AAAU UUUGGGG UUUGGGG AAAUUUUUGGGG AAUUGG UUUUGGGGGG UUUUUUUUGGGGGGGG UUGGGGGGG AUUUUGGGGG UUGGGGGG AUUUUGGGGGGGG UUUGGGGGGGGGG AUGGGGGGG AU UUGGGGG UUGGGGGGGGGGGGUS UST US US US US UUS SST UST ST UST T STTTT UUUS US USTTTTTTTTT UUST UST TT UST TTTT SSS US STTTT STTTT US STTTTT SSTTTT STTT US ST STTTTT US SS UST T ST STTT SS US UST STT STTTT UUS SSSSTTTTTTTT SSS US STTTTTTTTTT USSSSSSSTTTTTTTTTTT SSSSSSST UST STTTTTTTTTT SSSSSSSTTTTTT STTTT US SSSSSSSSTTTTTTT SSSSSS USTTTTT SSSSSSSSSSSTT STT STT STT UUUSSSSSSSSTT STTT UUUUUUUUUSSSSSSSSSSSTT UUUUUUUUUUSSSSSSSSSSSSTT UUUUUSSSTT UUUUUUUUUUSSSSS 22222220 20 20 20 2000001 01 01 01 01 01 01 22001 1 2222222220000000 22222200 200001 22222200001 01 22220001 01 20001 220 222000 222220 22000 200 222220 220 20 20 2001 2220 220 20 200 222220 20 20 2001 2222220001 00 20 22200 20 2001 20 20001 01 20 20000 2001 220 201 201 22 1111111111111111111111111111111
clubs and book fairs.
We are constantly looking for a con
basic interests, what about a book capt
to the child reader or presents some fac
Robinson tells SUCCESS. In ge
characterized our most succe
publisher and distributor.
Robi nsons st rengt hs
communicator of his com
proved critical as he expand
into a significant online
burgeoning new media play
I think the most amazing
is that you can ask anyon

E
r
i
c

L
a
n
s
n
e
r
C
o
u
r
t
e
s
y

o
f

S
c
h
o
l
a
s
t
i
c
,

I
n
c
.
Man on a Mission
Scholastics Richard Robinson
says the companys 9,000-plus
employees all know their
mission: to help children
love to read. Above,
Clifford the Big Red
Dog, one of Scholastics
enduring characters.
SUCCESS AUGUST 2011 31
phenomenon of Harry Potter [the company took a small big risk in
1997 by ponying up an advance to then-unknown British writer J.K.
Rowling for U.S. publishing rights on the Harry Potter books], and
from our book fair and international expansion efforts.
Today, Scholastic is developing e-book stores as an extension
of its e-commerce business, where it has converted the companys
book clubs to an Internet-based platform. Since we both create and
distribute content, and have direct customer relationships, the most
important thing for us is to provide our customers with books in
forms they want them, whether in print or on screens. Robinson
says. The selling of these books is similar to traditional print; the
making and delivering of them is different. We have many of these
skills in the company already, as we have been in the television and
movie business for 30 years and have people who are good with
animation and producing videos, including book-based videos.
Weve been in the Internet business for 15 to 20 years, and have
capability in that area. The blending of print-audio-visual techniques
into new forms of reading offers great potential.
Although the company is constantly challenged, Robinsons
mission has never been clearer. Kids are still reading great works on
a page, even in a digital format. Its clear that there is going to be some
combination of theater, movies, writing, video, audio thats going to
emerge as a new media format. What format it will take, we dont
know yet, he says.
You create in your own mind when you read, Robinson says.
The power of viewing is something different. Right now, one of
our missions is to keep the books alive. The ride at NBC-Universal
Studios in Orlando and the movies are now how many children are
introduced to Harry Potter. We are ghting for the books, and trying
to keep them in forefront of kids minds.
For Robinson, reading is more than fundamental. It is operational,
and inspiring.
The company has long sponsored an arts and writing awards
program for U.S. students in grades seven through 12; alumni
include Robert Redford, Andy Warhol, Richard Avedon, Joyce Carol
Oates and Sylvia Plath. Scholastic received about 175,000 entries
last year.
The participation in the arts and writing program in a sense
rivals the company itself in its impact on the arts in American high
schools, Robinson says.
The company also operates a social networking website, You Are
What You Read, where visitors can identify their ve favorite books.
The books Robinson nds most inspiring offer some insight
into his executive vision. Id have to include King Henry V, Act
III, William Shakespeare, once more into the breach, he says. I
would also throw in War and Peace [Leo Tolstoy]; A Portrait of The
Artist as a Young Man [James Joyce], which is one of my all-time
favorites; and the New and Old Testaments. In terms of business,
Id pick the Peter Drucker books. No one has touched him in being
fundamentally sound about business, although Jim Collins comes
close. Druckers basic principleWhat value are you adding?is
such a great basic question, and inspiring to me. The collective
impact of his books has inspired me at Scholastic to ask what are
we here for and why are we here? S
to work and to be involved as he grew old rather than there being
a vast difference in how we approached problems, Robinson says.
Growing the company brought certain demands on the younger
Robinson, who has carried with him the lessons of resilience,
persistence and optimism from his childhood favorite, The Little
Engine That Could. You have to upgrade the talent base, and then
manage those talents effectively, he says. Then you have to listen
and nd out whats on your employees minds, and to put yourself
in their shoes. Typically, people want to do a great job but they want
to know what is expected of them, and understand how they can
benet from their good work. If you link all those things together,
then youre doing your leadership job.
The second-generation CEO worked a variety of jobsranging
from linotype operator to bricklayer to teacherbefore joining
the family business. From those experiences, I learned to never
underestimate anyone, and that every individual brings his own
value to the table, he says.
Early on, Robinson realized he needed to recruit people with skills
and talents he didnt possess, and to depend on them and delegate
some of the tasks of building the company.
That philosophy proved timely. In the early 1980s, as baby
boomers children began reading, Scholastic built its childrens book
business with book fairs and clubs, and direct sales to the home. In
the early 90s, the company leapt into Internet product development
before Internet usage was widespread, with an interactive teacher
service in association with AOL. We knew that teachers would be
using the Internet to teach, so it became a part of our growth strategy.
We also developed a strong technology education business, which is
now worth about $250 million in revenue.
The companys education core grew dramatically. We kept
making our company more relevant, and were able to increase our
revenues, Robinson says. We had some great fortune, such as the
BOOT CAMP
SOCIAL MEDIA
for CEOs
90 Minute Course in Social Media
Social Media 101
Successful Case Studies
Discover Proven Strategies
Learn Tested Techniques
Generate New Customers
Coming to a
city near you...
Atlanta
Austin
Boston
Chicago
Dallas
Denver
Fort Lauderdale
Houston
Kansas City
Las Vegas
Los Angeles
Minneapolis
Nashville
Philadelphia
Phoenix
Orlando
Oakland
Raleigh Durham
Salt Lake City
San Antonio
San Diego
San Francisco
San Jose
Seattle
St. Louis
Tampa
Washington DC
Register Today! www.splashmedia.com
(877) 861-0010 or info@splashmedia.com
Has Your Traditional
Marketing Stalled?
Its time to use social media
marketing to move the needle!
FREE
WORKSHOP!
@splashmedialp www.facebook.com/splashmedia
M AG A Z I N E
Darren HARDY
Introduction
2
: Louis ZAMPERINI:
On being an overcomer
3
: Robert CIALDINI:
On being a detective
of inuence
4
: John C.
MAXWELL:
On the importance
of delegation
5
: Key Ideas
Summaryand
CalltoAction
With every issue of SUCCESS, we bring
you strategies and insights from past and
present personal achievement experts.
This issue on inuence includes:
Great Reasons to Listen!
5
BONUS Audio Downloads
Listen NOW!
Exclusive interviews with
SUCCESS Publisher Darren Hardy


D
i
x
i
e

W
a
t
e
r
s

P
h
o
t
o
g
r
a
p
h
y
C
o
u
r
t
e
s
y

o
f

A
s
s
o
c
i
a
t
e
d

P
r
e
s
s
34 SUCCESS AUGUST 2011
The Science
of Infuence
Learn the principles behind
the art of persuasion.
by KARYN REAGAN
R
obert Cialdini has spent his entire
career learning and teaching the
science of inf luence. His book
Inuence: Science and Practice has
sold more than 2 million copies
and can be found in 26 languages. Cialdinis
immense knowledge of the subject has earned
him the title of The Godfather of Inuence,
and he is one of the most cited living social
psychologists in the world. Cialdini is currently
regents professor emeritus of psychology and
marketing at Arizona State University and president of
Inuence at Work, an international consulting, strategic
planning and training organization.
SUCCESS: How did you start studying the
psychology of infuence?
Robert Cialdini: The very beginning was the realization
that I was the characteristic patsy; I was easily swindled and
bought things I did not want and contributed to organiza-
tions Id never heard of. As an avid student of what makes
people do what they do, I became curious as to how we are
inuenced. Upon further investigation, I discovered that there
was no systematic scientic approach that modeled inuence.
There were no universal features of the inuence process that,
if incorporated into a request, proposal or recommendation,
inclined people toward saying yes.
Can everyone beneft from the principles of
infuence you have defned?
RC: Due to the fact that the principles are based on scientic
laws, they are both teachable and learnable, and therefore bene-
cial to everyone. It used to be that we thought of the ability to
be persuasive as an art bestowed upon a chosen few. There are
those who seem to be gifted. But inuence is not just an art; it is
a science based on principles and facts.
In your profession, you can become more successful agents
of inuence by learning and applying the principles while being
entirely ethical. This is not a lesson in manipulation, but a guide
W
IT
H

R
O
B
E
R
T

C
IA
L
D
IN
I


D
i
x
i
e

W
a
t
e
r
s

P
h
o
t
o
g
r
a
p
h
y
SUCCESS AUGUST 2011 35
to detecting authentic desires within a
person and bringing them to the surface.
Becoming a detective of inuence is both
ethical and effective.
Would you explain some of the principles
of infuence you have uncovered?
RC: The rst is reciprocation. People will be ready and eager to
help you when you have rst done something for them. This principle
suggests that to be successful one must be proactive in their approach
instead of reactive. Give first, and then receive, not the opposite.
Actually, it is a maxim that is embedded in every major religion.
Christianity calls it the Golden Rule.
As an example of its effectiveness, there was a study done on
tip amounts given to servers at restaurants. The study proved that
applying reciprocity can signicantly increase tips when used at
the moment patrons are deciding the tip amount. When a mint was
given on the tray holding the check, tips went up 3.3 percent. If two
mints were on the tray for each diner, tips increased by 14 percent.
Receiving two mints was unexpected by the diners, causing them to
want to give back.
In this day and age, one of the most valuable assets you can give
someone to help them do their job better and
be more successful is information. Giving
information first can generate a feeling of
gratitude causing one to want to reciprocate.
The second is commitment or consis-
tency. People want to be consistent with
what they have already said or done, especially
in your presence. So help them start out on a
positive note so they will stay consistent with
that tone.
For instance, if you are called for a job
interview, arrange for the interviewers to say
something positive about you. One way to
accomplish that is to say, Im pleased to be
here today and happy to give you information
about myself, but why did you see t to invite
me for an interview? The interviewer will
explain the favorable features about you that
they identied. Then he or she will spend the
rest of the interview seeking to validate what
they have publicly said about you.
Another principle we discovered is social
validation. People are more willing to perform a recommended
action if a leader or peer provides evidence that many similar others
are performing it.
This principle is seen at work in all walks of life. A study
done in Beijing used a restaurant menu as the vehicle to analyze
human tendencies. When the menu listed certain items as most
popular, those items became 13 percent more popular than they
had been.
If our friends or colleagues are raving about something, we
have a tendency to give it a try. That can include anything from
food to the latest technological advance. And if the item or
concept is something we dont have time or desire to study, its
almost as if those pushing it have done the research for us.
A principle very similar to this is scarcity. People find
recommended opportunities or items more desirable to the
degree that they are scarce, rare or dwin-
dling in availability.
The most obvious example of this prin-
ciple is the lines of people wrapping around
the corner of a building, perhaps spending
a cold night in sleeping bags in order to be
the rst to purchase the latest hot item. The
perception of scarcity motivates extreme
measures. In business, the way to implement
this principle ethically is to ask yourself what
it is that you can offer that is unique that a
consumer can only get if they purchase your
product or idea. But make sure that it is true.
If you offer something that has competition,
package it uniquely. For example, maybe
offer a certain combination that clients can
only get from your company.
So do these principles take
practice or work to master?
RC: Becoming a detective of inuence
plays an important role. People like those
who are like them. It is the job of you, the detective, to actively listen
and watch in order to uncover those similarities. Maybe you both
like hockey or watch the same news station. When those common
interests are brought to the surface, there is instant rapportthey
like you and you like themand there is no better environment in
which to do business than one in which you like each other. S
Authority is
inuential.
Cialdini was asked to uncover
why stroke patients at a certain
hospital were avoiding the
physical therapy they were
prescribed, causing slower
recovery. He discovered that
the physical therapists they
went to see did not display their
credentials in their ofces like
the doctors did. Hanging their
degrees on the wall caused an
increase in patient compliance
by 30 percent in just one week.
Listen to Robert
Cialdinis
interview
w
ith
Darren Hardy.
SU
C
C
ESS C
D
36 SUCCESS AUGUST 2011
Your Personal Best
A
drift upon the face of an endless
Pacific, Louis Zamperini and
his pilot clung to the tatters
of a life raft as days blurred
together in relentless hallu-
cination. Sun and salt water transformed
their skin into a crust of sores and ssures.
Sporadic rainsqualls dropped just enough
water for occasional sips while birds and
small sharks they caught bare-handed
provided meager sustenance.
Zamperini, a California track star, had been a
favorite to clock the worlds rst 4-minute mile at
the 1940 Summer Olympics in Tokyo.
Then history intervened: As global warfare
erupted, the 1940 Games were canceled, and the
Army Air Corps trained Zamperini as a bombar-
dier stationed on Oahu.
A 1943 raid on Wake Isl and i ntroduced
Zamperini to combat; the B-24 limped home with
594 shrapnel holes, one ier died and everyone
except Zamperini and two others got shot up.
Hoping for the 44 or 48 Olympics, Zamperini
stayed t; in May 1943 he ran an unofcial 4:12
mile. But within days of that feat, Zamperinis
aircraft crashed at sea on a search-and-rescue
mission. He was one of three crewmen who made
it to a life raft.
So began a harrowing ordeal. In 47 days at sea,
Zamperini and his pilot dropped 60 percent of their
body weight; the third man died.
Occasionally the men saw aircraft aloft, but
only a Japanese bomber came near, swooping
The Indomitable MAN
Louis Zamperini dreamed of clocking the
rst 4-minute mile, but his greatest feat would
be surviving the horrors of war with his spirit
unbroken.
by TOM HORN
in on strang runs to riddle the
life raft with 48 bullet holes.
Ocean cur rent s car r ied t he
two survivors 2,000 miles west
unti l a Japanese patrol boat
sighted the men, who became
prisoners on Kwajalein.
Th e n t h i n g s g o t b a d .
Zamperini describes his 43 days
on Execution Island as much
worse than the raft: a waking
nightmare of an outhouse-like
cell, frequent beatings, intense
hunger and thirst.
Life as a ward of the Empire
was literally a world away from
Zamperini s previous experi-
ence. It nearly broke him.
Nearly.
As a teenager back home,
Zamperini had caroused with
petty thieves who lived to top one anothers exploits. An older brother
whom Zamperini adored inspired an abrupt turnaround: I got locked
up and Pete came to the jail. Pete asked the police chief how we ought to
channel my energy. The chief said Well, your little brother is one hell of a
runner! What about track?
So Zamperini threw himself into training full-bore. With his natural
ability, the effort paid dividends as Zamperini set California and U.S.
high-school records. That roar from the crowd tasted good, he recalls
intently. He gave up impressing small-time thugs in dark alleys in favor
of showcasing his speed for a public audience. Instead of farmers chasing
Zamperini with shotgun blasts of rock salt, he became popular with girls.
At 19, Zamperini earned a spot on the 1936 American Olympic team,
C
o
u
r
t
e
s
y

o
f

L
o
u
i
s

Z
a
m
p
e
r
i
n
i
Listen to
DarrenHardys
interview
w
ith
Louis Zam
perini.
SU
C
C
ESS C
D
J
o
h
n

H
e
l
l
e
r
/
W
i
r
e
I
m
a
g
e
/
G
e
t
t
y

I
m
a
g
e
s
SUCCESS AUGUST 2011 37
enjoying unimagined luxuries heading for the Berlin Games aboard
the ocean liner Manhattan. We could only train up in rst class,
making loops inside the rail, hopping over the legs of millionaires and
movie stars. He gained 12 pounds devouring shipboard fare, alertly
spotting a service window featuring ever-present cold beer.
The highlight of Zamperinis Atlantic voyage? Dancing with
swimmer Eleanor Holm, who paid a price for late-night partying:
That was a gold medal for me! But Eleanor got kicked off the team
before we arrived in Europewhat a raw deal! So Eleanor shot dice
and had some champagne? She was invited! We drank our share of
beernobody got bombed, but we liked that little window.
Of Berlin, Zamperini recalls Storm troopers were everywhere.
Only a fool would have missed itGermany was gearing up for
something big. He pauses. For war.
Finishing eigth in the 5-kilometer run, Zamperini turned a
blistering 56-second nal lap that generated stadium buzz nearly
as frenzied as the crowds reaction to an entrance by Hitler. They
always went berserk when Hitler arrived, says Zamperini, who
shook der Fhrers hand at the Nazi leaders request but regarded him
as a dangerous comedian.
Celebrating in the German capital after his big race, every bier-
garten liter amplified the hilarity of an inside joke: popping off
with Heil Hitler! to anybody in uniform and triggering robotic
salutes. Earlier Zamperini had swiped a Do Not Disturb sign from
Going the Distance
After the 1936 Olympics, Zamperini ran track for the
University of Southern California until enlisting in the
Army Air Corps in 1941. Captured and imprisoned by the
Japanese, he returned home after the war, bottom photo.
Today, hes the subject of a book and upcoming movie.
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
38 SUCCESS AUGUST 2011
Your Personal Best
teammate Jesse Owens, but when he pulled a much crazier
stunt, his Olympic sweater probably saved his life. Zamperini
stole a Nazi agnaturally, grabbing that souvenir right off
the front of Hitlers chancellery. A rifle went crack! and a
guy hollered Halten Sie! I knew what that meant. The eet
Zamperini could also talk fast, telling dumbstruck guards Its
just to remember your wonderful German hospitality!
Zamperini still owns that flagand the sign from Jesse
Owens door, too.
After returning home, Zamperini attended USC on a track
scholarship. The cancellation of the 1940 Summer Olympics hit
him hard: That really hurt! People dont understandyou train
four years for one event. Disappointed? You bet! He ponders a
moment, musing: The Olympics exist to help stop war, but only
war can stop the Olympics.
Disappointment about being unable to compete soon was
eclipsed by the cruel realities of life as a prisoner of war on
Kwajalein. Most Japanese guards behaved savagely; American
prisoners interned by the Japanese died at 37 times the rate
of Americans held by German and Italian captors. One guard
spoke enough English to stop by and belt Zamperini with a
cheery Thump on the head for a biscuit? Complaints of thirst
brought scalding water thrown in his face.
Zamperini hoped that transfer to another prison might offer
more humane treatmenta right mandated under the Geneva
Conventionbut he was wrong. In a camp called Omori,
a maniacally cruel guard nicknamed the Bird delighted in
starving and assaulting captives. Despised by fellow guards
and prisoners alike, the Bird singled out Zamperini for sadistic
brutality. He was a psychopath, Zamperini says.
Before he and his fellow captives could enact a plan to kill
the Bird, the Empire surrendered. The Bird disappeared. A
40-person arrest warrant for war criminals signed by Douglas
MacArthur named Prime Minister Hideki Tojo Japans most-
wanted man. Although a lowly corporal most of the war, the
Birds 84-count indictment ranked him number 23.
After Zamperinis lengthy recuperation in Hawaiian hospitals,
the Bird stalked his dreams; the demon ruined sleep. Back home
in California, Zamperini settled down with a beautiful bride
named Cynthia. But trying for a normal life was rough sledding.
Legions of repatriated servicemen rendered jobs and housing
scarce. With an incomplete degree from USC, Zamperini was
at a disadvantage. He chose not to seek full-time work, wasting
money in shaky ventures.
After resolutely experiencing overseas hell, Zamperini
underwent an excruciating stateside psychological collapse. His
greatest shame? Taking Cynthia along a miserable spiral down
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
Race to the Finish
Zamperini was close to breaking
the 4-minute-mile record in this
1940 workout. Below, with wife
Cynthia and opposite, atop a
B-18 bomber.
SUCCESS AUGUST 2011 39
to the brink of divorce. He awoke from nightmares strangling the
Bird with his hands locked around Cynthias neck. Liquor became a
mistress to blot out the Birds specter. Secretly Zamperini decided to
return to Japan and murder his captor.
Then Cynthia dragged Zamperini to hear the Rev. Billy Graham, at
whom Zamperini initially sneered until something clicked, as he
recalled a survival prayer offered while adrift in the Pacic.
Zamperini went home to jettison his supply of cigarettes
and alcohol. Even the Bird disappeared: I accepted
Christ and my bad dreams ended.
Zamperini had once commented that with foreknowl-
edge in 1943 of what lay ahead in Japanese hands, he
would have committed suicide. But thats just what I felt at
the time, he says quietly.
With renewed spirit, he founded the Victory Boys camp for
wayward youth. The Zamperinis raised two daughters, living
comfortably if not lavishly; Roger Banister ran the 4-minute mile in
1954; Mutsuhiro Watanabe, otherwise known as the Bird, emerged
from hiding after a 1952 amnesty declaration and died a wealthy man
in 2003.
If Zamperini could talk with the Bird now, I would forgive him,
he says rmly.
Today Zamperini maintains an active calendar as a lecturer. A jolly
demeanor and quick wit belie his 94 years. The erstwhile world-class
runner has hardly lost a cognitive step. The New York Times best-seller
Unbroken: A World War II Story of Survival, Resilience and Redemption
by Laura Hillenbrand chronicles his life, and a movie is in the works.
After outliving not only his Olympic teamates, but his former
tormentors and most of his friends and family, what of the man
himself and his comrades-in-arms?
Well, Im not keen on that Brokaw Greatest Generation
stuff, Zamperini states atly. We did what we had to. Call us
the Hardy Generation. S
s strangling the
Liquor became a
erini decided to
Billy Graham, at
g clicked, as he
Pacic.
ettes
ed
wl-
s, he
I felt at
s camp for
hters, living
B
e
t
t
m
a
n
n
/
C
o
r
b
i
s
SUCCESS.com/store
SHOP NOW at
I learned leadership
principles from
John C. Maxwell
on my morning run.
Success Mentors to Go!
Download quality, convenient MP3s and
eBooks at great prices!
1im Rohn 1ohn C. Moxwoll Tom Po|ors Connio Podos|o Los Brown
Doniol Pink S|ophon Covoy Torri S|odin 1ock Conhold Mido uboin
Tom Hopkins Horvoy Mockoy ond moro!
40 SUCCESS AUGUST 2011
ORISON SWETT MARDEN
An riginal
Thinker
by Jeffrey Gitomer
Men of Infuence
Inspired by the work of Samuel Smiles, top, Marden
in turn infuenced Dale Carnegie, bottom left, and
Napoleon Hill, as well as countless others.

M
a
r
k

R
o
s
s
SUCCESS AUGUST 2011 41
I
ts very hard to nd original thought.
Orison Swett Marden was part of The New Thought
Movement, a spiritual group that emphasized metaphysical
beliefs and personal development. While there were religious
overtones, the philosophies were fundamentally based on
innite insight and intelligence.
Heres a classic Marden example: Dont wait for extraordinary
opportunities. Seize common occasions and make them great. Weak men
wait for opportunities; strong men make them.
Marden was inuenced and inspiredas were manyby one of
the original personal-development writers, Samuel Smiles. Smiles
was an original. The Smiles book, Self-Help, was the trigger for
Mardens career. The little book was the friction which awakened
the spark sleeping in the int, Marden is quoted as saying. The 21st
century translation might be, Samuel Smiles lit my re.
Early in his life, Marden came across the Smiles book by accident,
while rummaging through an attic. He became an evangelist for
the book, and for his own positive-thinking philosophy. When he
looked for more books, and found few, his mission was set. Study,
write, publish, preach, speakand by being a living example of his
writings, set the standard for others to follow.
You might know some of the original writers who preceded
Marden. The most prominent author was William James, a physi-
ologist and a pragmatist. James hung out with a bunch of brainiacs,
the most notable being P.T. Barnum, Mark Twain, Horatio Alger and
Sigmund Freud. (Not a bad group of guys.)
Its more interesting to note who followed Orison Swett Marden,
most notably Napoleon Hill and Dale Carnegie. These guys came 30
years after Marden founded SUCCESS Magazine in the late 1890s.
Also note that Napoleon Hill was a signicant contributor, and he
also published his own magazine in the late teens and 1920s called
Hills Golden Rule. The subtitle: For those who think and want to grow.
(Sound familiar?) As popular as Napoleon Hill was (and is), he was a
disciple and a follower of Orison Swett Marden.
Marden had one amazing contemporary. Elbert Hubbard. Their
work often appeared in other magazines, but they never wrote
anything together. I can only assume that they knew one another,
and corresponded with one another, out of respect for their mutual
capabilities. They were competitors in their time. While Marden
was writing Pushing to the Front, Hubbard was writing Message to
A Champion of
Self-Reliance
Born in 1850, Orison Swett Marden is
considered by many to be the fatherand an
exemplary productof the self-improvement
movement in the United States.
Orphaned at age 7, Marden was placed in the
guardianship of a neighbor, who bound out the
child to families who needed an extra farmhand. Life
was extremely cruel, as he suffered whippings at the
slightest provocation, near starvation, and subfreezing
temperatures wearing threadbare clothes during harsh
New Hampshire winters.
But after discovering a copy of Samuel Smiles Self-Help
in an attic of a family for whom he worked, Marden
realized he could make much more of his life. Persuading
his guardian to allow him to attend school, he worked
and paid for his education, liberating himself from his
difcult youth. He ultimately earned degrees in oratory,
business, law and medicine. He became an entrepreneur,
and in the late 1890s he founded SUCCESS Magazine.
Mardens inuence continues to reverberate in these
pages as it does in the works of todays personal-
development gurus.
His bookswith such rousing titles as An Iron Will, How
to Succeed, Making Life a Masterpiece and Pushing to the
Front, his 1894 masterpiecehave been translated into
dozens of languages and have been on the reading lists
of everyone from political leaders to schoolchildren.
Garcia. They both began their own publications. Hubbards
was the magazine FRA. They both were exceptionally prolic
authors. Hubbard and Marden were considered the thought
leaders of their time.
Marden expanded the original thoughts of Smiles to an
unprecedented degree. Not just a prolific writer, he was
also a speaker, an editor, a publisher, a doctor and a lawyer.
Mardens books could be found in the library of every major
early-American industrialist. He was the word, and words, of
success andspirit.
42 SUCCESS AUGUST 2011
Orison Swett Marden wrote more than 60
books in a period of 30 years without a word
processor, and barely with a typewriter. He
was an educated person, having graduated
from Boston University, Andover Theological
Seminary, and Harvard University with
M.D. and LL.B. degrees. He also went back
to school to master oratory skills. Wow!
Marden was successful at every endeavor
because he was a student who put his
knowledge to work. And through his reli-
gious beliefs, he literally practiced what he
preached. His genius allowed him to take
on business ventures, capture publishing
opportunities, study every aspect of life,
and still speak and write. His success
came from putting all those elements
into positive execution and achievement.
When I wrote The Patterson Principles
in 2002 (now titled Jeffrey Gitomers
Little Platinum Book of Cha-Ching!) my
research took me to Dayton, Ohio,
the home of John Patterson and the
business he founded, the National
Cash Register Company (NCR). I was
contacted by a bookseller in Dayton
who offered me several books from the
Patterson library dating to the turn of
the centurythe 20th century.
These books were actually signed by
Patterson to connote ownership, and
they include passages he underlined
because he found them meaningful
and wanted to act on them. I bought the books
without hesitation.
One of the books I purchased was He Who Thinks
He Can, by Orison Swett Marden, with passages generously
underlined by the hand of John Patterson. Wow!
ORISON SWETT MARDEN
An
SSOOOOOOOONNNNNNNN SSSSSSSSSWWWWWWW
riginal
Thinker
Self-reliance
is the best
capital in the
world. Self-
depreciation is
a crime.
The greatest
enemies of
achievement are
fear, doubt
and vacillation.
Every child
should be taught
to expect success.
The man who
has learned the
art of seeing things
looks with
his brain.
The best
educated people are
those who are always
learning, always
absorbing knowledge
from every possible
source and at
every opportunity.
People do not
realize the immense
value of utilizing
spare minutes.
IN HIS
VOICE
t a word
iter. He
duated
ological
y with
t back
w!
deavor
ut his
s reli-
hat he
o take
shing
life,
ess
nts
nt.
les
rs
my
o,
e
l
s
n
th
s He Who Thinks
h passages generously
rson Wow!

i
ca
w
de
a c

en
ach
fea
and

shou
to ex
T
has l
art of
looks
his br
Th
educat
those w
learnin
absorbi
from ev
source a
every op
Peop
realize t
value of
spare mi
he books
Orison Swett Marden
was a prolifc writer who
authored more than 60
books, as well as columns
in SUCCESS Magazine,
which he founded. His
command of language is
evident even in letters to
potential subscribers.
SUCCESS AUGUST 2011 43
Orison Swett Marden was the
word, and words, of success and spirit.
In my collection of Mardens work I have a personal
letter sent by Marden to potential subscribers of his
SUCCESS Magazine (early direct mail). It gives a rare
glimpse into the philosophy and salesmanship of the
founder. Dated 1922 and signed by Marden himself,
the letter has a quote at the top of the page that reads,
Impossibilities are merely the half-hearted efforts of
quitters. The letter begins: Dear Dreamer, and exhorts
readers to grant [their] imagination full sway. For never
before in the history of the world has the door of opportu-
nity been ung so wide. The words in this classic solicita-
tion are timeless.
Through the years, I have been inuenced by many
writers and thinkers. Orison Swett Marden is at the top of
my short list. Not just as a writer, but as a thinker. Not just
an author, but someone who practiced what he thought.
Start reading Marden today. Many of his works have
been reprinted in paperback. Own a few and get a feeling
for his philosophies and ideas. Whats the best way to
apply Mardens wisdom to your life? Start studying, and
apply what feels comfortable for you. S
Jeffrey Gitomer is the author of Social BOOM!, The Little Red
Book of Selling, and The Little Gold Book of YES! Attitude.
President of Charlotte-based Buy Gitomer, he gives seminars,
runs annual sales meetings, and conducts Internet training pro-
grams on selling and customer service.
Your judgment is your best friend; your common sense is
your great life partner.
Do not stop dreaming.
Some of the greatest men in history never discovered
themselves until they lost everything but their pluck
and grit.
Responsibility is a great power developer.
Almost anybody can resolve to do a great thing; it is
only the strong, determined character that puts the
resolve into execution.
No substitute has ever yet been discovered for honesty.
Happiness is a condition of mind.
The world makes way for the man with an idea.
Poverty is of no value except as a vantage ground for a
starting point.
There is no word in the English language more misused
and abused than luck.
The idle man is like an idle machine. It destroys itself
very quickly.
Do not imitate. Originality is the best substitute for
advertising.
Many people are imprisoned by ignorance.
To eliminate every thing that can possibly retard us is
the rst preparation for a successful career.
Get freedom at any cost.
It can not be done cries the man without imagination.
It can be done, it shall be done cries the dreamer.
No man can be happy when he harbors thoughts of
revenge, jealousy, envy or hatred.
No matter how humble your work may seem, do it in
the spirit of an artist, of a master.
Do not be afraid to trust yourself. Have faith in your
own ability to think along original lines. If there is
anything in you, self-reliance will bring it out.
The very essence of happiness is honesty, sincerity,
and truthfulness.
Letter courtesy of Jeffrey Gitomer; quotes from He Who Thinks He Can by
Orison Swett Marden, published in 1906, as highlighted by original book owner
John Patterson, founder of the National Cash Register Company (NCR).
After changing the
retail industry and
now shaking up the
publishing world, the
sky is the limit for
Jeff Bezos widening
empire as Amazon
takes to the Cloud.
44 SUCCESS AUGUST 2011
by John H. Ostdick
SUCCESS AUGUST 2011 45
J
o
e

P
u
g
l
i
e
s
e
/
C
o
r
b
i
s

O
u
t
l
i
n
e
Exhaustive
research, some gutsy calls and an intuitive
understanding of customer service enabled
Jeff Bezos to change the way Americans
buy books when he left a thriving New
York nance career and started the online
bookseller that became the most successful
Internet retailing site ever. He didnt stop
there, however. Hes taken his lofty and
zealous Amazon.com Inc. vision to accelerate
access to things that inspire, educate and
entertain into e-books, e-publishing and
technology services. Before hes done, he just
may reinvent the wheel a couple more times.
Genuine pioneers dont stop after just
one discovery or innovation, Microsoft
founder Bill Gates wrote in a short essay
on Amazons founder and CEO for the Time
100 list in 2009. They are driven to build
on their accomplishments and to follow
them into new frontiers. He called his
Seattle-area neighbor a great example of
one of those insatiable pioneers of business
and technology.
That insatiable pioneer often talks about
how grumpy he gets when he has to
read a paper book these days. With Bezos
forays into the Kindle reader, introduced
in November 2007, and e-publishing, hes
trying to ensure that everyone has the
chance to enjoy his reading style preference.
And the technological prociency Amazon
has gained has allowed the company to
launch another high-growth potential
unitoffering cost-efcient tech services
and Cl oud stor age for st ar t ups and
other corporations.
Although Amazon is not an industry
sales leader for publishing, it is a high-
prole inuence leader. The tens of millions
of people who buy books from Amazon
every day are part of Bezos grand plan for
his company over time to sell every book
ever printed, in any language, in and out
of print, in less than 60 seconds. E-book
sales remain a small share of the publishing
market, but its trend line is showing a
dramatic climb, and for Amazon itself,
e-books are going great guns.
We love inventing on behalf of customers and have never been
more excited about the long-term opportunities, Bezos said when
the company released its first-quarter earnings in April. (The
company did not respond to interview requests for this story.)
The short-term opportunities are impressive in their own right as
last years fourth-quarter earnings hit $10 billion, a record for a three-
month period, and Kindle books topped Amazon.coms combined
sales of paper books and hard covers.
Meanwhile, Kindle books pricing is wreaking havocboth
practically and emotionally in the publishing industry, which
has been glacial in reacting to the technological changes that have
reshaped the music and entertainment businesses. In the rst quarter
of 2011, Amazon announced the U.S. Kindle Store now has more than
900,000 books, more than 740,000 of which are $9.99 or less.
As with Amazons other business sectors, the customer experience
is the critical guiding hand: We humans do more of whats easy,
Bezos said during a conversation with writer Steven Levy at the 2009
Wired Business Conference. When you lower friction, you always get
more of what you just made easier. Weve co-evolved with our tools
over time.
Defying Skeptics
One of Amazons strengths is its ability to evolve along with
those tools. Despite market skeptics who have questioned the
companys strategies at every stop, e-books and the Kindle are but
part of the expanding pieces of the Amazon empire, including
a broadening range of retailing products and partnerships, Web
services and Cloud content storage.
During that expansion, Amazon has managed to grow its
revenue base by an average of nearly 32 percent per year in the last
decade, compared to the 3 percent average performance among
S&P 500 companies over the same time.
In the process, 47-year-old Bezos guiding hand has touched
virtually every aspect of daily life. The tracks of that inuence
lead from extension cords laid into a Seattle garage for a brash
online book beta test among friends in 1994 to the shiny nearly
1.7-million-square-foot LEED Gold certified headquarters in
the revitalized South Lake Union area of Seattle. Amazon has
overcome challenge after challenge by steadfastly adhering to
Bezos unyielding straight-arrow mission: Our vision is to be
earths most customer-centric company; to build a place where
people can come to nd and discover anything they might want to
buy online.
People keep coming. Far and away the worlds largest online
retailer by sales, Amazon was growing at roughly three times the rate
of online retail sales as a whole in the United States and Canada at
the end of 2010. In its rst-quarter earnings statement, the company
counted about 137 million active customers and reported that about
2 million merchants sell on the Amazon marketplace. And the
future looks robust: Two hundred million U.S. consumers will be
46 SUCCESS AUGUST 2011
R
o
b
y
n

T
w
o
m
e
y
/
C
o
r
b
i
s

O
u
t
l
i
n
e
For Amazon.com, Kindle is
king, with e-book offerings
outselling all hardcover
and paperback books
combined. Amazon made this
announcement in May, along
with these fun facts:
Since April 1, 105 Kindle books
sold for every 100 print books
sold by Amazon.com.
Growth in Kindle book sales,
plus Amazons continued growth
in print book sales, resulted
in the fastest year-over-year
growth rate for Amazons U.S.
books business.
Amazon sold more than three
times as many Kindle books
in 2011 than during the same
period of 2010.
K
i
n
g

o
f

t
h
e

M
o
u
n
t
a
i
n
SUCCESS AUGUST 2011 47
The Kindle Adventure
Jeff Bezos has spent the past four years
spreading his e-vangelism everywhere from The
Daily Show with Jon Stewart to The Oprah Winfrey Show to
The Martha Stewart Show, using his unbridled enthusiasm and
eruptive laughter to push the unglamorous Kindle reader to the
forefront of the e-book wave.
Bezos continues to deect skeptics of the single-purpose
nature and plain look of the deviceGavin Grant, publisher
of Small Beer Press, an innovative independent press in
Massachusetts, referred to it as outdated technology during an
MIT Future of Publishing panel in April 2009: Its like Texas
Instruments designed a book reader in the 1970s, put it in a
box, and Amazon found it.
Although steadfast in its belief in its one-function Kindle,
the company is not blind to the pressures of the broadening
iTablet market. Bezos intimated to Consumer Reports in May
that Amazon might be close to launching a multipurpose tablet
device as a supplement rather than replacement for the Kindle.
We will always be very mindful that we will want a
dedicated reading device, he said. On adding advertising
and special offers to the newest version of the Kindle, Bezos
said, We drew the line at adding anything that gets in the
way of reading.
The ads and deals, Bezos noted, are restricted to the
screensaver and a band along the bottom of the devices
home page. The reason for such a limited presence, he said,
is not just because ads placed within books would disrupt
the reading experience but because people would eventually
learn to ignore [them] and thus reduce their value.
In fact, when Amazon introduced the Kindle, its one-
handed portable reader, in 2007 with more than 90,000
books in its Kindle Store, Amazon alarmists surfaced. How
could the company not bundle service agreements with
discounted device costs? How could the publishing industry
function by selling the electronic version of $35 to $45
hardcover books at such a low cost?
The strategies were consistent with the Amazon way. It has
never made money on hardcover best-sellers. The company
has always sold them below cost and rather makes money on
the mix of new and old book sales.
According to IHS iSuppli, a leading market research
rm based in El Segundo, Calif., e-readers and e-books
are expected to add $2 billion to Amazons 2011 revenue.
The research rm also predicts that e-book devices could
eventually prove bad news for the publishing industry as a
whole. The book publishing industry has entered a period
of long-term decline because of the rising sales of e-book
readers, according to an April 28 research note. Book revenue
should decrease at a compound annual rate of 3 percent
shopping online by 2015, up from 163.1 million in 2009, according
to projections by the New York-based research rm eMarketer.
Invention in Its DNA
When Amazon announced it was folding the meteoric-growing
retailer Zappos Inc. into its organization in 2009, Bezos delivered an
everything I know address to Zappos employees. He stressed how
critical it is to think long term and not just give it lip service. I nd
that most of the initiatives we undertake may take ve to seven years
before they pay any dividends for the company, he says. They may
start paying dividends for customers right away. We can tolerate
being misunderstood. Weve been called amazon.toast, amazon.con,
many different things. If we think were right, then we continue. If we
think were wrong, if were criticized about something and we think
were wrong, we change it. We x it.
The deal was vintage Bezos. Amazon, which let the fellow
customer-friendly shoe and apparel retailer maintain its iconoclastic
independence, signicantly broadened its hip quotient and product
reach through the acquisition.
Amazon, which today employs about 34,000 full-time and part-
time employees worldwide, continues to defy the retailing model
that says growth slows as a company matures. Jeffs strategy about
selection and availability and low pricing is all kind of a miracle, Bing
Gordon, a partner with the noted Silicon Valley venture-capital rm
Kleiner Perkins Caueld & Byers and a seat-holder on Amazons board
of directors since 2003, told MarketWatch in December. Amazon is
one of these companies that reinvents Manifest Destiny [under which
operations keep] getting better and better.
In his most recent letter to shareholders, Bezos talked up Amazons
investments in new technology, which have raised concern that the
company is squeezing its margins too tightly. Such investments, Bezos
wrote, lead directly to free cash ow.
Invention is in our DNA, and technology is the fundamental tool
we wield to evolve and improve every aspect of the experience we
provide our customers, he wrote.
The Back Story
Bezos, born in 1964 in Albuquerque, N.M., showed inventiveness
at an early age. His company biography notes that as a toddler he
asserted himself by dismantling his crib with a screwdriver. He was
especially close to his stepfather, Mike Bezos, a Cuban immigrant who
moved the family to Houston when he got an engineering position at
Exxon. He was also close to his maternal grandparents, spending the
summers of his youth at their 25,000-acre ranch in Cotulla, Texas.
His grandfather, who was a regional director of the Atomic Energy
Commission in Albuquerque, retired early to the ranch. Bezos had a
wide variety of chores there.
I helped x windmills, vaccinate cattle and do other chores, he
says. We also watched soap operas every afternoon, especially Days
of Our Lives.
(Continued on page 50)
48 SUCCESS AUGUST 2011
through 2014a reversal from the period between 2005 and
2010, when revenue rose, iSuppli forecasts.
For the traditional book publishing industry, the
implications of the rise of the e-book and e-book reader
markets are frightening, given the decline in paper book
printing, distribution and sales, Steve Mather, IHS iSupplis
principal analyst for wireless, wrote in an April 28 statement,
The industry has entered a phase of disruption that will be
as signicant as the major changes impacting the music and
movie business.
Much of the fear in the publishing sector is part of the
natural evolution of an industry incumbent, Bezos has said
repeatedly in the past few years, noting that rapid change is
always anxiety inducing.
Customers are smart, and they know that they shouldnt
pay the same for an e-book as for a paper book, especially
a $35 or $45 hard cover, Bezos said during the 2009 Wired
conference. He explained that the pricing for Kindle books is
completely sustainable as there are supply-side efciencies
that can provide plenty of revenue in the margin for everyone
involved. Everybody is going to read more, everybody is going
to make more, and the returns on invested capital are going to
be greater.
The stakes are clearly getting larger for Amazon. When
the company introduced its rst wireless reading device,
there was a press conference but little fanfare. By the
introduction of the new Kindle2, a major publicity
event was in the cards, a celebrity-infused event that
included author Stephen King, high-prole book
agents and publishing industry heavyweights.
Amazon has aggressively introduced new
offerings under its book-related units this year.
Among them are Kindle Direct Publishing,
which allows authors and publishers
worldwide to make their books available
on the Kindle, and Kindle Library
Lending, a new feature launching
later this year that will allow Kindle
customers to borrow Kindle books
from more than 11,000 libraries in
in the United States.
J.H.O.
J
o
e

P
u
g
l
i
e
s
e
/
C
o
r
b
i
s

O
u
t
l
i
n
e
At home, the garage became a lab for his
science projects. In a 2010 baccalaureate
address to Princeton University graduates
he recalled how he invented an automatic
gate closer out of cement-lled tires, a solar
cooker that didnt work very well out of an
umbrella and tinfoil, baking-pan alarms to
entrap my siblings. The family moved to
Miami, Fla., during his high school years,
where Bezos discovered a love for computers
and graduated as the class valedictorian.
Af t er gr aduat i ng f rom Pr i ncet on
University with a degree in computer
science and electrical engineering, Bezos
worked at Fitel, a startup company building
an international trade network; at Bankers
Trust, where he rose to vice president level;
and at D. E. Shaw, a rm specializing in
developing computer science applications
for the stock market. After he discovered
that usage on the neophyte World Wide
Web was increasing 2,300 percent a year,
he methodically studied the top 20 mail-
order businesses with an eye toward what
made sense for transition to the Web.
Betting on Jeff
Bezos understood the disruptive nature
of the Internet and that change was going to
be rapid. He settled on books for a number
of reasons, not the least being that major
book wholesalers had already compiled
electronic lists of their inventory.
I told my wife, MacKenzie, that I wanted
to quit my job and go do this crazy thing
that probably wouldnt work, since most
startups dont, and I wasnt sure what would
happen after that, Bezos told the Princeton
graduates. MacKenzie [a novelist and also
a Princeton grad] told me I should go for
it. Id always wanted to be an inventor,
and she wanted me to follow my passion.
Bezos typed a busi ness pl an whi le
his wife drove to Seattle. He candidly
told his original investors there was a 70
percent chance they would lose their entire
investment, but his parents signed on for
$300,000, a substantial portion of their
life savings. We werent betting on the
Internet, his mother has said. We were
betting on Jeff.
The origins of the company are now
part of Internet lore. In 1995, Bezos
opened Amazon.com and told his several-
hundred beta testers to spread the word.
No advertising, no press. Within 30 days,
the company had sold books in all 50
states and 45 foreign countries.
Revolutionizing Retail
He understood from the beginning
that he wasnt just inventing a new and
more efficient way for people to find
books they wanted to buy, but that he was
also helping to define a fundamentally
new way to conduct a consumer retail
business, Microsofts Gates wrote of Bezos
in his Time 100 essay. Indeed, Jeffs idea
was just as revolutionary as when Sears,
Roebuck started its mail-order catalog
business a century earlier.
The company quickly expanded into
dozens of product categories, internally
and through sales partnerships with large
U.S. retailers such as Toys R Us, forcing
the worlds biggest retailers to rethink
their business models and ultimately
changing the way people shop. Amazon
became a master of the up-sell strategy,
showing customers interested in one
product others that they might also prefer.
Amazon addressed its customers by their
rst names in all correspondence, offering
services that traditional retailers could
not: lower prices, authoritative selection
and a wealth of product information.
By 1999, Time magazine was naming
Bezos its Person of the Year, in recognition
of Amazons success in populari zing
online shopping. The companys initial
business plan, however, projected that it
would not show a profit for four to five
years, and bottom-line anxiety created
the first cadre of outside doomsayers
Amazon would encounter. Stockholders
and analysts complained that the company
needed to rethink its strategies to show
more immediate prots.
If you are going to do large-scale
invention, you have to be willing to
do three things: You must be willing
to fail; you have to be willing to think
long term; and you have to be willing
to be mi sunderstood for long periods
of time, Bezos said at the 2009 Wired
convention. If you cant do those three
t hi ngs, you shoul d l i mi t yoursel f to
sustaining innovation, which is critical.
No company I know could survive over
time without doing sustained innovation.
During the rise of the dot-com bubble
(roughly from 1995 through 2000), Bezos
says he warned his people at all-hands
meetings not to feel 30 percent smarter
this month because the stock price is up
30 percent because you ll feel 30 percent
dumber when it declines. The stock price
deated dramatically during the dot-com
bustit was referred to often as Amazon-
dot-bombbut Bezos saw that the business
metrics continued to improvethe number
of customers continued to grow and the
prot per unit sold increased.
The Ultimate Survivor
While many of the early players failed
during the dot-com bubble burst, Amazon
persevered and nally turned its rst prot
in the fourth quarter of 2001. BBCNews.com
triumphantly declared that if the Internet
was the new rock and roll, Jeff Bezos
was its Elvis. [Today hes] the ultimate
dotcom survivor. Amazon succeeded by
establishing high standards for reliability
and customer service and earned deep
loyalty through its innovations, such as
the user reviews, one-click shopping and
shopping cart icons that have become so
familiar to online retailing.
One of the differences i n founder/
entrepreneurs and professional managers
i s that the founder/entrepreneurs are
more st ubbor n about t he vi sion and
keep working on the details, Bezos told
the Wired conference audience. One of
the dangers of bringing in professional
managers is that the rst thing they want
to do is alter the vision, and usually thats
not the right thing to do. The trick as an
entrepreneur is to know when to be exible
and when to be stubborn.
The rule of thumb is to be stubborn on
the big things and exible on the details.
(Continued from page 48)
50 SUCCESS AUGUST 2011
We c e n t e r
our strategy
on the things
that we know
will be stable
in time. No
matter what
pa r t of t he
retail business
i s i nvol ved,
Bezos says he
knows t hat
i n 10 year s
customers are
going to want
low prices, fast
delivery and
vast selection.
We h a d
s o me v e r y
harsh critics
during that period of time, but we always
observed that some of the harshest critics
were our best customers, Bezos said. So we
gured it couldnt be that disastrous if that
was the case. Having a culture that is heads-
down focused on the customer instead of
the external world makes a company that is
more resilient to external inuences.
That customer focus is why the companys
product base evolved from books, CDs and
movies to almost any consumer interest,
from f lat-screen TVs to groceries, and
why they ship many items for free, allow
competitors to use the companys product
pages to undercut its own listings, and often
price high-prole offerings at a loss to draw
in customers.
By the end of the decade, the faith
hi s parents showed i n Bezos paid off
famously as 6 percent owners of Amazon.
com, they were billionaires.
Making A Bigger Umbrella
In 2006, Amazon spread it s wi ngs
again, into the technical and logistical
areas of other businesses.
Bezos aims to transform Amazon into
a kind of 21st century digital utility,
Bloomberg Businessweek reported i n a
cover story at the time. Its as if Wal-Mart
Stores Inc. had decided to turn itself
inside out, offering its industry-leading
supply chai n and logi stics systems to
any and all outsiders, even rival retailers.
Except Amazon is starting to rent out
just about everything it uses to run its
own busi ness, from rack space i n it s
10 mi l l ion square feet of warehouses
worldwide to spare computing capacity on
its thousands of servers, data storage on its
disk drives, and even some of the millions
of lines of software code it has written to
coordinate all that. Even after all these
years spent battling back claims that his
company would be Amazon.toast, hes
still bounding up and down stairs two at a
time to exhort his band of nerds on to the
Next Big Thing.
Amazon has evolved i nto t he early
l e ader i n t he f a s t - g r owi ng Cl oud
computing sector through its network of
sophisticated data centers. Companies are
choosing to bypass establishing internal
dat a cent er s and out s ourci ng t hei r
computing needs using the Cloud model:
They use the Web to access computer
proces si ng and stor age wi t hout t he
associated costs of owning the machines
or operating the software. Thousands of
corporate clientsincluding such names
as Netix, Foursquare and Pzerhave
moved t hei r busi ness comput i ng to
Amazon Web Services.
Bezos told Fortune in mid-2010 that he
expects legacy companies to gravitate to
Amazon Web Services during the next
ve years. The right analogy here is the
electricity grid, he said. A hundred years
ago if you wanted to run your factory and
you needed electricity, you had to become
an expert in power generation. You had
to buy your own electric power generator.
You had to maintain it. You had to make
your own electricity. And today, because
of Amazon Web Services, you dont have
to be in the power generation business.
Its not a differentiator for companies.
So if youre going to build your own data
center and buy your own server hardware
and manage all your own networking gear
and all of the things that you have to do, it
has to be done at an A-plus quality level.
But its just the price of admission. Its
not your secret sauce. It doesnt help you
differentiate from your competitors.
Amazons Next Wave
Technology support poses a signicant
chal lenge for the doggedly customer-
centric Amazon: In April, it faced its rst
high-prole service glitch when technical
problems knocked some of its clients
off l i ne for various wi ndows duri ng a
48-hour period.
The Seattle company is investing to build
data centers to bolster its e-commerce
pl atform, as wel l as it s Amazon Web
Services business. Amazon spent $855
million on fulllment in the rst quarter,
up f rom $546 mi l l ion a year earl ier.
Spending on technology and content rose
to $579 million from $366 million. In the
past few months, it has announced the
opening of distributions in several states
and plans to hire in each of them.
During the rst quarter this year, the
company also rolled out Amazon Cloud
Drive, Amazon Cloud Pl ayer for Web
and Amazon Cloud Player for Android.
Together, these services enable customers
to securely store music in the cloud and
play it on any Android phone, Android
tablet, Mac or PC, wherever they are. In
addition to music, Cloud Drive allows
customers to upload and store all kinds
of digital les, including photos, videos
and documentsall available via Web
browser on any computer.
We wor k b a c k wa r d f r om our
customers needs and forward from our
skills, Bezos says, explaining that the
Kindle is an example of Amazon working
backward from its customer needs and
Amazon Web Services is an example of
working forward from its skills. When
we started working on the Kindle (in the
mid-2000s), we didnt have the hardware
skills needed. We had to go out and hire
and develop those skills.
Developi ng. Expandi ng. Evol vi ng.
Hiring. Jeff Bezos Amazon, like the river,
never sleeps. S
if the
Internet
was the
new rock
and roll,
Jeff Bezos
was its
Elvis
SUCCESS AUGUST 2011 51
52 SUCCESS AUGUST 2011
Are You Using Your Power for
or
by Jennifer Reed
SUCCESS AUGUST 2011 53
E
a
c
h

o
f

u
s

h
a
s

t
r
e
m
e
n
dous in


u
e
n
c
e

o
v
e
r

o
t
h
e
r
s
.

H
o
w

a
r
e
y
ou usin
g
y
o
u
r
s
?
54 SUCCESS AUGUST 2011
P
ATRICIA BUITRAGO
stood in a oor-length
amethyst gown at a
convention center
in Fort Myers, Fla.,
one of six teachers to receive
her communitys top prize for
teaching. Hundreds of fellow
educators, local politicians and
business leaders had come out
to honor these instructors on the
one day of the year when they
were thrust into the spotlight to
tell their stories.

A
a
r
o
n

B
r
i
s
t
o
l
SUCCESS AUGUST 2011 55
Buitrago spoke of her childhood dream of leading a classroom, inspired by her fourth-
grade teacher, a spunky little woman with contagious energy. But ironically, it was
another teacher, her 10th-grade math instructor, who nearly dashed Patricias dreams.
Hed called her up to his desk at the start of class one day and, not bothering to lower
his voice, told her that her grades were abysmal and he was sending her to a lower-level
course. You dont understand math. You shouldnt even think about college, he told her.
Patricia cried all the way to her new class. Shed been raised to believe in the wisdom
of teachers and took his words to heart. The straight As she received in her other courses
dropped to solid Cs.
I gave up, she remembers.
Buitrago graduated high school, got married, took a job in a department store, had two
kids and stayed home to raise them. She played teacher to her children, but her career
aspirations had died the day she changed math classes.
Such is the power of inuence.
Every day, in ways big and small, we inuence each other. A remark like the one
Buitragos math teacher made can dismantle a dream. A word of encouragement, however,
can plant a seed, grow a career, offer someone strength to persevere.
Scientic studies prove the power of inuence. A 2007 Harvard University report
found a persons chance of being obese increases 57 percent if a friend becomes obese,
40 percent if a sibling becomes obese, and 37 percent if a spouse becomes obese. A 2009
Stanford University study found that people who have worked with entrepreneurs are far
more likely to give up the security of a steady paycheck and strike out on their own, too.
Thats some pretty intense behavioral inuence.
Our leadership styles, our moods, our means of dealing with situations, the examples
we set (for good or for ill) can have a profound impact on those around us. Often, we have
no idea of the power we wield.
Buitrago thinks her math teacher certainly never gave his words a second thought
even as they sent her spiraling downward. Ultimately, she prevailed in her childhood
dream, went to college, earned her elementary education certication and landed here, at
a Golden Apple awards ceremony honoring the very best in this 80,000-student school
district in southwest Florida.
I feel cheated in a way by that teacher, she confesses after the ceremony. I was 38
when I started teaching. I could have started when I was 21thats 17 years.
Pause for a minute and think: What kind of inuence do you have on the people
around youyour family, your colleagues, your employees, your students, your friends?
Then consider: Are you using your inuence for good or for evil?
Every one of us is either a plus or a minus in peoples lives, says John C. Maxwell, the
leadership expert, speaker and author who has written, among other things, Becoming a
Person of Inuence, co-authored with Jim Dornan.
The positive people usually know itMaxwell himself tries to wake up each day and
consider, Who can I add value to today? Its an intentional lifestyle.
But human nature does not typically put others before the self, and many people can
negatively impact othershowever unintended that behavior may be. I think its highly
probable for people to be a negative and not know it. If you are positive, its inuential
because it goes against human nature, Maxwell says.
Dreams Deferred
After a callous remark by her 10th-grade
teacher, Patricia Buitrago gave up her
own dreams of teachingfor 17 years.
56 SUCCESS AUGUST 2011 56 SUCCESS AUGUST 2011
We are in uencing people
to one degree or another
all day, every day.
Circles of Inuence
A young entrepreneur receives a gift
and a life lesson.
Graduation loomed for Matt Lauzon, a student at Babson
College in Massachusetts. He dreamed of delving into the
world of e-commerce and marrying online retailing and
custom jewelry design. Lauzon turned to a Babson alumnus
for advice, offering to take the man to lunch to pick his brain
about entrepreneurship.
That experienced (and anonymous) businessman not only
listened to Lauzon and offered advice, but he also wrote him
a $5,000 check to jump-start his company. The man did not
want to be repaid; he asked only that Lauzon help out a fellow
novice once he himself was established.
In this case, the cycle of positive inuence would come full circle.
Lauzon, now 26, went on to establish Gemvara, a custom
jewelry design company, and amassed $25 million in
venture capital funding for his launch in February 2010.
But that $5,000 gift remains his most memorable
funding. That was one of the key experiences in
my lifetime, he says from his firms Lexington,
Mass., headquarters.
Now Lauzon is heeding his mentors wishes and
using his growing clout in the business world to
help others. He and two other young online business
founders hosted an event in May in Boston that they
dubbed The Ruby Riot. The idea was to connect
young techies and business people with more
experienced mentors and potential employers. In
addition to the riot, Lauzon planned to develop
paid apprenticeships and internship opportunities at
his companyanother way of paying it forward.
So the question becomes: How does one become a
person of positive inuence? It starts with the small
things, the routine exchanges and interactions we
have each day.
A
ll of the little things add up, says
Chris Widener, a personal-devel-
opment speaker, author and busi-
nessman whose works include The
Art of Influence: Persuading Others
Begins with You. We are inuencing people to one
degree or another all day, every day.
Is that influence effective? Widener says theres a
simple test. Ask yourself: Do people listen
to me? Do they respond? If not, he says,
its time for some introspection.
What kind of life are we living?
Widener asks. The more we change
ourselves, the more people will
admire us and want to follow us.
He encourages people to conduct an
honest self-assessment and reect on the
good, the bad and the ugly and then
think about how they can use
their daily interactions to
positively touch others.
Wi d e n e r w i l l
al ways remember
o n e c h i l d h o o d
encounter. He was
about 12 years old
and a bal l boy
for t he Seattle
S up e r s o n i c s .
One of his tasks
was to lug two
5-gallon jugs of
Gatorade onto
the court before
the start of each
g a me . Wi d e n e r
broke his arm. He

C
h
r
i
s

N
a
v
i
n
Matt Lauzon
Paying It Forward
SUCCESS AUGUST 2011 57
reported to work anyway. The team trainer, upon seeing him, said he
couldnt keep his job if he couldnt do his job.
Well, it happens that Dennis Johnson, the late Celtics star who was
then a young guard on the Supersonics, was sitting on the trainers
table at the time and overheard the exchange. For the next six weeks,
Johnson carried the Gatorade onto the court himself. Widener says it
didnt matter to Johnson that the fans would be ling into the seats
and likely witnessing the basketball player hauling his teams drinks.
He taught me an interesting lesson in leadership, says Widener,
who then paraphrases Scripture: Whoever becomes great must
become the least. Whoever wants to become the leader must become
a servant of all.
L
ately, Ive been thinking a lot about inuence.
Two years ago, I became a high school journalism
and English teacher, and I discovered my inuence
reaches beyond my wildest expectations. It starts
the minute my students walk into the room. My
moods set the tone for that days lesson. If Im frazzled, theyre
distracted. If Im tired, they are listless. If I am energized, they
are engaged.
Long after Buitrago had her run-in with that math teacher,
I had my own discovery about how a teachers small remark
can have a broad reach. My school underwent a scheduling
shake-up at the end of the rst semester, and I inherited a
young woman from another instructors class. I was imme-
diately struck by her: She was attentive and maturea
standout in a class comprising too many kids who cared too
little about academics.
She bombed her rst grammar quiz, which surprised me. I attrib-
uted her performance to her adjustment to the class. She came after
school for a review and retake, raising her score from a D to an A.
Then, she did poorly on a writing exercise, surprising me again.
I invited her for another tutoring session. Lets x this. You really
should be an A student, I told her. Based on her classroom behavior, I
assumed she had always done well in school.
I never imagined my earnest comment to her would have such a
meaningful impact. A few months later, I asked my students to write
personal essays about someone who had inuenced their lives. This
young lady wrote about me. Of my A-student comment, she wrote,
No one had ever told me that before, not even my mother.
I later learned she was a special-needs student with learning
Competitive or
Conniving?
Nasty ofce politics provides a
cautionary tale.
Mike Sprouse was in his late 20s and working for a
major entertainment company. He was the youngest
senior executive in company history and working
under the supervision of a division president.
A colleague whom Sprouse thought to be a
friend emailed the boss, suggesting Sprouse was
too young and inexperienced for his position.
The message was bandied back and forth
some 12 to 15 times before it somehow landed
in Sprouses inbox. He was appalled by the
damning languagehis colleague was trying
to inuence the division president and undercut
Sprousesworth.
Though hurtful, the incident helped
Sprouse shape his own behavior as
he climbed the business ladder and
became a company leader himself. I
never wanted to do that if I were in a
similar position, he says.
Now 36, Sprouse is based in Chicago
and serving as chief marketing
ofcer for Epic Media Group. Sprouse
sometimes catches wind of less-than-
desirable behavior in lower-levels of
the company. And when he does, he
quietly tells employees not to go down
that path.
In his words: In business, I believe were
impacted immensely by the words and actions
of others because of the basic fact that most
businesses are tremendously competitive.
Especially in competitive environments, people
tend to want to listen and use information or
inuence in order to get ahead or to advance.
This is sometimes human nature, but true
leaders do not use their inuence exclusively in
that way. True leaders exert their inuence by
boosting others up around them to make the
team or company better in addition to bettering
ones self.

H
i
r
o
k
i

K
o
b
a
y
a
s
h
i
Mike
Sprouse
58 SUCCESS AUGUST 2011
disabilities. Because I did not have her at the beginning of the
year, her le had not been agged for me. I think now it was
better that way; I saw only her maturity and determination. She
saw only my belief in her.
Look at this young lady and look at Patricia Buitrago. Two
students, two remarks, two entirely different paths.
I think about co-workers who have inuenced me, particularly
in the rocky two years of my transition from journalist to teacher.
This school needs you, a respected veteran instructor told me
during my rst year.
Me? A career changer with no classroom experience and no
clue how to handle the curriculum that had been thrust upon me?
My expression must have betrayed my skepticism. He persisted.
With my real-world experience, I could offer much to these students,
he told me. His words helped me persevere at a time when I was
ready to hand in my classroom keys.
The power we have over each other is enormous.
T
hats why communications expert Lillian Glass
suggests we weed out what she calls the toxic
people in our lives.
Her book Toxic People: 10 Ways of Dealing with the
People Who Make Your Life Miserable identifies some
all-too-familiar personality types: the cut-you-downer; the gossip;
the opportunistic user; the bitchy, bossy bully; the snob; the arrogant
know-it-all; and a host of other kinds of people who make us wince.
Who are the people throughout your life that make you miserable?
Glass asks. Reect on how other people make you feel, she suggests.
Do you feel bad about yourself after being around them? Do they
make you stressed? Who are some of the most troubling characters in
Have You Filled a Bucket?
Teaching Children about the Power of Inuence
Imagine a generation of children
being taught the power of
inuence starting in their
preschool years.
Carol McCloud has turned this concept
of inuence into language so simple
that the 4-year-olds she once taught
could get it.
McCloud is author of the Bucket Fillers
series, brightly illustrated childrens books
that teach how kind words and actions
can ll the buckets of the people we
encounter daily, from moms and dads to
school bus drivers to classmates.
All day long everyone in the whole
wide world walks around carrying an
invisible bucket, begins her rst book,
Have You Filled a Bucket Today? You
feel very happy and good when your
bucket is full, and you feel very sad and
lonely when your bucket is empty.
You need other people to ll your
bucket and other people need you to
lltheirs.
McCloud was at an education
conference when she rst heard
about the bucket concept, a phrase
coined by psychologist Donald Clifton.
McCloud began using the idea in her
preschool classroom.
This is very simple language. They
understand it, McCloud says. Its
much more concrete than, Are you
being good? Are you being kind?
Those are abstract concepts.
McCloudwho no longer teaches
and her team have visited some 500
schools in the United States. Hundreds
more schools, she says, have dubbed
themselves bucket-lling schools.
Almost everything we do is lling a
bucket or dipping in to a bucket, she
says. If they can learn that [concept]
early, they will be the best parents, the
best bosses, the bestfriends.
Carol McCloud
SUCCESS AUGUST 2011 59
your life? If you attached adjectives to them would the words
be the same? Thats how you gure out the negative inuences
in yourlife.
Often, the person left feeling miserable thinks theres some-
thing wrong with him, especially over time as the negative
persons comments gain traction and begin inuencing his
life, Glass says.
The most important thing is to deal with the people and
the tensions they create. Glass offers 10 strategies, ranging
from using humor to confrontation. You need to confront it,
she says of the negative feelings brought on by others. Thats
the most important thing. You cant keep it inits like pres-
sure. You will explode.
U
ltimately, a chance comment by
Patricia Buitragos then 5-year-old
son, C.J., set her back on the path
she had abandoned all those years
ago. (Even the youngest among us
have inuence).
It was open house at C.J.s soon-
to-be elementary school, and Buitrago had taken
him to meet his kindergarten teacher. Im holding
his little hand, and I remember saying to him, You
know C.J., I always wanted to be a teacher. And he
said, Why dont you, Mommy?
She enrolled in her local community college the next
day. She later went on to graduate summa cum laude
from a state university.
Buitrago keeps her graduation robe hanging in
her bedroom and posts her goals next to it, a self-
motivation technique she shares with herstudents.
After her own experience, she thinks hard about
the inuence she has on her fth-graders. I think
teachers dont realize everything you say to a child
matters. They process everything, shesays.
Shes right about children, but then, she could
just as easily be talking about adults. The power
of inuence is a tremendous one. How are you
using yours? S
Turn the Page to
Greater Success
b k f l b
SUCCESS.com/store
The Richest Man
in Babylon
by George S. Clason
Classic book holds the secret to
acquiring money, keeping it and
making it earn more money.
(YS010-006)
Paperback
Retail $8.99 ONLY $6.99
Twelve Pillars
by Jim Rohn and
Chris Widener
This popular novel will
challenge and encourage you
to become the best that you
can be! (JR010-010)
Paperback
Retail $12.95 ONLY $9.00
Put Your Dream
to the Test
by John C. Maxwell
Get powerful direction to
help you create a clear and
compelling path to your dream.
(MA010-010)
Paperback
Retail $19.95 ONLY $12.99
ng
60 SUCCESS AUGUST 2011
Power of
One
by Sally Deneen
D
e
n
i
s

R
o
u
v
r
e
/
C
o
r
b
i
s

O
u
t
l
i
n
e
SUCCESS AUGUST 2011 61
A
line of autograph-seekers snakes through the lobby of Seattles
McCaw Hall performance venue, winds downstairs and stretches
partway across the oor below. One might assume fans await a
rock star. But, in this case, an actual rock star, Dave Matthews of
Dave Matthews Band, waits in line with a few kids in tow. They
eventually get their turn for autographs and to pose for a photo with the celebrity
of this autumn night: not a rock star, but the worlds best-known primatologist,
Jane Goodall.
For two and a half hours, until nearly midnight, the grandmotherly London native
smiles, signs books and poses for photos. Some people are moved to tears. Are crowds
always like this? Im afraid so, yes, Goodall tells SUCCESS the next morning. But
shes very strictjust one book autograph per person. Otherwise, she quips,
wed still be there.
It was half a century ago that Jane Goodall, petite, ponytailed and just 26,
walked through brushy undergrowth to a rocky peak in what today is Tanzanias
Gombe National Park and peered into the distance at a dark shape hunched over
a termite mound. Through binoculars, she got a better look, making a discovery
that would help redene humanity and make her a household name: She saw a
male chimpanzee she nicknamed David Greybeard strip leaves off a twig and dip
them into a termite mound to scoop up yummy termite snacks.
What made it such an exciting breakthrough was that until then scientists
believed only humans made and used tools. When Goodall was a kid in school,
humans were dened as Man the Toolmaker. So when her famed paleontolo-
gist boss and mentor Louis Leakey got her news via telegram, he pronounced in a
telegram back: Now we must redene tool, redene Man, or accept chimpanzees as humans.
The last part of that sentence brings laughter from packed audiences like the
one in Seattle.
Still ponytailed at age 77, the former secretary who revolutionized the way animals are
studied now travels 300 days a year to speak to audiences worldwide, spreading a message
designed to save endangered chimpanzees and to empower young people to make the
world better. She is, as one book title put it, Jane Goodall: The Woman Who Dened Man.
Janes Armies
Goodalls life now is completely focused on her cause, yet is so distant from the life she
yearned for as a child, the life she reveled in as a researcher in the African forests amid her
beloved chimpanzees. When the number of chimps in the wild dwindled perilously low
(to about 150,000 as of 2002), she felt she needed to go out and raise awareness around the
A half-century after her first
groundbreaking discoveries,
primatologist Jane Goodall
continues on her mission
empowering young people to
improve the world.
62 SUCCESS AUGUST 2011
world about the interconnectedness of life and how everyone
makes a differencegood or badevery day.
And yet, she professes optimism. What gives her hope, in
part, is that tens of thousands of youths in 120-odd countries
are taking up her call. Theyve launched chapters of Roots &
Shoots, a Jane Goodall Institute program that requires members
to pursue three types of projects to make the world a better
placeone project that will help people, another that will help
the environment and a third to help animals.
With three grandkids, she could call it quits. Instead of
serving as a UN Messenger of Peace helping focus attention
on the work of the United Nations, she could enjoy retirement
in her childhood home in England. Or she could return to
Africa, the continent where she spent decades and dreamed of
living since she was a girl reading Tarzan books. Instead, she
continues on a peripatetic mission. Its what the young people
are doing that gives me the energy, Goodall says, to carry on
travelling 300 days a year.
She is practically a cult gure. With the possible exception of
Marie Curie, Jane Goodall must be the most widely celebrated
woman scientist of our century, writes Dale Peterson in the
introduction to one of Goodalls 20-odd books, Africa in My
Blood, published in 2000 by Houghton Mifin.
Creating Her Own Niche
Goodalls story captivates, as the odds were stacked against
her: Ever since she read Tarzan and Dr. Doolittle stories as a
kid, she dreamed of living with animals in Africa and writing
about them. Her mother was the only person who didnt laugh
but instead assured her that if she worked hard and didnt
give up, she could do it. Lacking money for university tuition,
young Jane trained as a secretary, at Moms urging, at Queens
Secretarial College to make it easier to get a job. Bored stiff by
various secretarial tasks, she had moved onto a London lm
studio, choosing music for documentaries. Then she received a
letter that changed everything: An old friend invited her to visit
her familys large farm in Kenya. Jane moved back home to live
rent-free and saved money from waitressing at a big hotel to pay
Power of
One
D
a
v
i
d

S
.

H
o
l
l
o
w
a
y
/
G
e
t
t
y

I
m
a
g
e
s
SUCCESS AUGUST 2011 63
for the three-week boat journey.
This was the opportunity I had been waiting for. I saved up
enough money, working as a waitress, for a roundtrip boat fare and
set off, Goodall writes in The Chimpanzees I Love. Within months
of her 1957 arrival, she arranged to meet Leakey. Impressed with
her enthusiasm and self-learned knowledge of Africa, he let her
take part in a three-month archaeological dig before asking her to
use her utmost patience to learn whatever she could by observing
chimps living on the shore of Lake Tanganyika. Leakey hoped the
chimps might bring insight into human evolution.
I had no training, I had no degreeand I was female! Women
didnt do that kind of thing in those days, Goodall writes.
But being a woman was never an obstacle for me, she says in
our interview. In fact, it may even have been helpfulhelpful in
that Louis Leakey believed that women were better at observation,
that they were more patient.
British authorities required her to take a companion into the
wilds of their protectorate (current-day Tanzania), so her mother
volunteered for four months; after that, she could be alone. To
locals, white women were less of a threat to them than a white
male. They were wanting to help this poor young girl on her own
with her mother, you know?... Ive never found being a woman
an obstacle. I was lucky. I wasnt competing with men in a mans
world. Its my own niche that I created.
Groundbreaking Discoveries
In a June 1960 letter from Africa to the family back home, her
mother described Janes passion:
Jane is seated almost motionless, on an anthill or a hummock of
grass, staring, staring, remembering, noting, waiting and watching her
monkeys!! The sun beats down, ants wander over her, her nose peels,
her forehead peels, but she is there, never stopping her work for a single
second. Happier than Ive ever seen her. Shes brown now, & in an odd
mixture of scarlet, brown freckles and a sort of orange haze overall. Wish
I looked like Jane, her skin, her pony tail, her khaki slacks & blouse are
all ideal for her job. She melts into the landscape. She loves the monkey
families, & the other night I dreamed, & woke, expecting to nd her
outung arm covered in soft brown monkey fur!!
Before Jane Goodall, chimps were presumed beasts; nobody knew
much about how they lived in the wild. Thanks to Goodalls four
decades of research and her National Geographic documentaries, the
public learned that chimps kiss, hold hands, embrace, have long child-
hoods, eat meat, are capable of altruism, have a sense of humor, can
manipulate others, pat one another on the back, swagger, shake their
ststhe kinds of things that we do, and they do them in the same
context, Goodall says. Chimpanzees are more like humans than any
other creature living today.
Counter to stuffy scientic convention, she gave human names to
individual chimps and let readers in on their personalities as part of
the longest continuous eld study of any wild primates. There was
dominant Mike, popular Flo, irascible J.B., playful Gilka, clever
Fagin, as Jonathan Marks summarized in What It Means to be 98%
Chimpanzee: Apes, People and Their Genes, published in 2002 by
University of California Press. Goodall feels every pet owner will nd
it obvious that animals have distinct personalities, something she
says she rst learned from her childhood dog, Rusty.
Courage of Your Convictions
Its remarkable what she has done. She basically redened what
humanity is and she redened what a chimpanzee is. It is not a
beastwe understand its our closest cousin, says Reiko Matsuda
Goodwin, a Fordham University adjunct assistant professor who
authors studies on primates.
Goodall shrugged off criticism from the scientic community,
which told her she shouldnt ascribe personalities or give chimps
names instead of assigned numbers. See, I wasnt wanting a career
in science. I didnt really care, Goodall says. Her income came from
Leakeys patrons and National Geographic, who were ne with her
approach. I didnt want to let Louis Leakey down. I just passionately
wanted to get enough money to go on studying chimpanzees. I didnt
want to be a professor.
At Leakeys urging and to help make it easier to raise money for
her work, she took time out to earn a Ph.D. at Cambridge University,
becoming one of only eight people to do so without a bachelors
degree. She returned to Africa to do research the way she wanted.
If people said I was doing it wrong, I would say: Well, its the way
64 SUCCESS AUGUST 2011
Power of
One
I want to do it. Ive got the money to do it this way. If you
think its wrong, well, then, go and do your own study in a
different way. Thats ne.
I had a mother who said: If people dont agree with you,
listen to them and if you still think youre right, have the
courage of your convictions.
Goodall is disarming, charming. Adding
to her celebrity is her famous-person-
next-door personality, notwithstanding
numerous honors, including her Dame of
the British Empire title awarded by Prince
Charles. Shes such a big figure, yet she
can be intimate. She has this connection on
the individual level, says Fordhams Matsuda
Goodwin. Thats the kind of thing people seek out.
Something to Say
Her audiences arent always lled with admirers.
Goodall also speaks to students like the 1,480
Syracuse University freshmen whose atten-
dance is mandatory at her lecture. While
many are interested in what she has to say,
others are there because they have to be, and
their body language says so. As these students slouch in their seats
or are turned around chatting, Goodall shyly walks to the podium.
She doesnt say a word. She looks to one side, then the other.
Then without warning, the prim, proper grandmotherDame
Goodall, the woman bestowed with the distaff equivalent of
knighthoodstarts making chimpanzee noises, softly at first:
ooohhh-oooohhh-oooohhh-ooohhh-ooohhh-ooohhh-ooohhh-
ooohhh. Then rising to a crescendo in the loudest voice she can
muster: HOOO-who-HOOO-who-HOOO!
In this group of 17- and 18-year-olds, you could hear a pin
drop, recalls Cathryn Newton, now dean emeriti of the College
of Arts & Sciences at Syracuse. She had them in the palm of
her hand.
Goodall is famous for this greeting; its chimp-speak for hello.
She uses it to remind audiences that humans arent Earths only
important inhabitants. Its because she has lived in this world
[of chimps]. I dont think anybody else could pull this off,
Newton says.
I actually believe that her shyness in a sense gives her a height-
ened accessibility because people understand that, Newton says.
And they understand that she speaks because she has something
to say and not to draw attention to herself.
A Cultural Revolution
Looking out at that audience of college freshmen, Newton imag-
ined some students caught the Goodall bug. She clearly remembers
being a 16-year-old sophomore at Duke University in the 1970s
trying to decide on a career when she attended a physical anthro-
pology lecture given by this smart, willowy, intrepid young eld
scientist, Jane Goodall. I remember leaving that presentation and
thinking: I am absolutely going to be a eld scientist. Its a very
simple concept, but, if she can do this, then maybe I can do this,
says Newton, who went on to an accomplished career researching
ancient and modern biodiversity before becoming a Syracuse dean.
It was just absolutely traceable to that moment of not just seeing
her, but seeing the images and hearing in her words what her work
was about, what motivated her.
In the end, Jane Goodalls power is this: She has shown us the
power of one long before the book The Power of One emerged,
Newton says. Jane has created a kind of scientic revolution, but
also a cultural revolutionby taking an iconic group and essen-
tially turning inside out almost everything we thought we knew
about this particular group of organisms. For me, its a case of the
power of oneone personin creating an intellectual revolu-
tion that has both a scientic strand and a cultural strand. How
many people have done that? Who would be on your list? Would
Copernicus be on your list? Would Isaac Newton? Well, Jane
Goodall would be on my list.
Jane Goodall is not done yet. Theres no telling, Newton says,
what Janes going to do when she grows up. S
B
e
t
t
m
a
n
/
C
o
r
b
i
s
Curious Cousins
Goodall and research
subject, 1972
*Prices shown are for U.S. delivery. International prices vary. Please note that current SUCCESS Book Summaries subscribers receive access to the digital download edition for the duration of their original subscription term.
Receive in-depth summaries and reviews of top-rated books, including popular classics
and some of the latest best-sellers on business, leadership, wealth accumulation,
personal development and more. Each summary includes recommended action steps!
T|N-SAV|h6 8LVAhT 00hVh|hT
Get started now and gain
the valuable knowledge and
information that will take your life
and business to the next level.
12- Nooth Pr|ot aod A0d|o 00
ed|t|oo ONLY $99*
3 book summaries on audio CD and
in print
4 printed book reviews
12- Nooth 0o||oe 0|g|ta| ed|t|oo
ONLY $79
3 book summarieslisten or read
online or download (MP3 and PDF les)
4 book reviewsread online or
download (PDF les)
SUCCESS Book Summaries is the answer!
Is Your Busy Schedule Preventing You from
Keeping Up with the Latest Books?
SUCCESS.com SUCCESS BOOK SUMMARIES Page 1
SUCCESS Points
From this book youll learn that:
Anything, and anyone, can become fascinating
To survive new competitors and a changing economy, every brand must adjust its fascination cues
Its important to balance virtue and vice
If youre not generating a negative reaction from someone, youre probably not fascinating anyone
Fascinated people merge into larger groups who can incite cultural movements
HarperCollins 2010, Sally Hogshead ISBN: 9780061714702 266 pages, $26.99
JULY 2011
Get Sticky
You have the power to
attract attention.
QUICK OVERVIEW
Sally Hogsheads Fascinate does just thatfascinates its readers. She begins by
snapping her audience to attention by explaining human fascination using the setting of
a sexually charged St. Paul Airport Marriott cocktail lounge. Imagine it, replete with
lust, vice, mystique, power, prestige, and a good dose of alarmto be sure. Who knows,
maybe theres some trust to be found there as well?
Its only after youve completed this powerhouse book that you appreciate how
Hogshead masterfully created a lead chapter that not only outlines the subject of the
bookfascination triggersbut also employs themto keep the pages turning.
Our fy-on-the-wall visit to the darkened, fern-and-brass hotel bar doesnt last long.
Hogshead transports readers to the world of art and science to clear the mystery.
She uncovers what fascinates people, and explains why and how to craft a fascinating
message that gets your brand noticed.
Dont fret. This book never gets boring; Hogshead wont let it. She explains, but
doesnt wear a subject out. Throughout the book, she uses parentheses to pop in an
entertaining sense of humor. Even her footnotes can be fun. Make sure you read them.

APPLY AND ACHIEVE
Whether you are building a personal brand or embarking on a business marketing
plan, understanding what triggers fascination within your audience and marketplace
will transition whiteboard scribbles into tangible success.
Youre already using triggers, intentionally or not. The key is to use the optimal
mixture of lust, mystique, alarm, prestige, power, vice and trust. Seldomdoes just one
consistently fascinate. Instead, you need a personalized trigger chemistry set.
To get started, imagine seven trigger beakers sitting in front of you. Your job is to
evaluate your current use of triggers by flling these beakers. Several may be nearly
empty; others are flled at various levels. If youre really lucky, one may overfow.
Fascinate
Your 7 Triggers to Persuasion and Captivation
by Sally Hogshead
SUCCESS.com SUCCESS BOOK SUMMARIES Page 1
SUCCESS Points
This book will teach you how to:
Be teachable and learn
from those around you
Be willing to take risks
and make sacrices for
personal growth
Apply failures as lessons
instead of as roadblocks
Step outside your comfort
zone and expand your skills
and success
Thomas Nelson 2009, John C. Maxwell ISBN: 9781400280247 129 pages, $9.99
JULY 2011
Intentional Personal
Development
To keep growing, you must
keep learning.
QUICK OVERVIEW
In Self-Improvement 101, best-selling author John C. Maxwell builds on centuries of
wisdom on personal growth and leadership skills, from Plato to Gandhi, to provide
a concise look at how to be successful. An easy read, Self-Improvement 101 looks at
success as an ongoing journey of personal development, requiring one to be open to
learning new ideas, willing to let go of past achievements to keep moving forward,
and ready to accept failure and loss as part of the growing process.
A must-read for any entrepreneur or small-business owner who wonders what
is holding him back from moving to the next level, Maxwells book provides quick
and powerful insights into the fears that often keep us from living our full potential.
He provides inspiration for overcoming risk aversion, adopting an attitude of
humility, and trying new things that take us outside our comfort zones. And he does
with chunky sections flled with action points for turning that next conference or
mentoring session into an opportunity for massive change.
APPLY AND ACHIEVE
It may be no surprise that the thing that keeps most people from living life fully
and achieving their dreams is fear of failure. But Maxwell points out that failure is
an essential component of success. He says everyone should be willing to not only
risk failure, but to embrace failure as an opportunity for learning how to do things
diferently in the future. Maxwell points to the story of Joseph in the Old Testament,
who continually faced adversity, years and years of it, but maintained his faith in his
ability to overcome, which he did, ultimately becoming a key leader of Egypt.
And as we learn from failure, Maxwell also advises us to be willing to let go in
order to keep growing. Rather than resting on our laurels once we achieve a goal,
Self-Improvement 101
What Every Leader Needs to Know
by John C. Maxwell
SUCCESS.com SUCCESS BOOK SUMMARIES Page 1
SUCCESS Points
In this book youll learn:
How to control your
thoughts
Why you must train your
brain
How to develop the habit of
concentration
How character is formed
Why negative attitudes are
so difcult to hide
Published in 1908
JULY 2011
Training the Brain
We control the most complex
machine ever created.
QUICK OVERVIEW
In this day and age, we operate any number of machines, from cars and
motorcycles to computers, fax machines, cell phones and BlackBerrys. But in
1908, when Arnold Bennett first published The Human Machine, people werent
so technologically equipped. Still, each person has always had at least one
machinehis or her own body, controlled by the brain.
Although times change, people generally havent. Each person should
control his own brain, but Bennett points out that, too often, this isnt the
case. Instead, people are often driven by impulse or external stimuli. Bennett
explains thatsuccess in any endeavor comes from harnessing the power ofthe
brain, and thus the bodythoughts drive actions, actions drive results. He
encourages readers to train their brains and realize that they control the most
amazing machine: the human body. While some of his examples are dated, his
commonsense approach to training the brain is as applicable as ever.
APPLY AND ACHIEVE
We know our thoughts control our actions, but poor habits indicate that
we dont always have enough control over our brains. That can and should
change. In The Human Machine, Bennett explains that we can train our brains to
control our actions, even our instincts. The brain, when trained correctly, is a
diplomat, talking down the impulses that could lead us deeper into difficulty
and helping us extricate ourselves. But it must be taught obedience, and
Bennett tells readers exactly how to do that.
We must impose our will, by sheer force, on the brain and we must exercise
willpower to stay within the guidelines we have set. We need to talk to our
brain, leading it in the right direction. After that has been done consistently,
the brain will have good habits, which will lead an individual to his
highest standards.
The Human Machine
by Arnold Bennett
SUCCESS.com SUCCESS BOOK REVIEWS
Page 1
Page 4
BY THE EDITORS OF SUCCESS MAGAZINE
2011 SUCCESS Media. All rights reserved. Materials may not be reproduced in whole or in
part in any form without prior written permission. Published by SUCCESS Media, 200 Swisher
Rd., Lake Dallas, TX 75065, USA. SUCCESS.com.
hole or in 0 Swisher
e
is
ou

JULY 2011
Chances are there is at least one thing you want to change
about your life. Perhaps youre not satisf ed with your
relationships. Maybe you know you need to lose a little, or a lot,
of weight. Or it could be that your business isnt moving in the
direction you want, or as quickly as youd like.
If you do need or want to make a change, you should know
youre not alone. In fact, according to Mel Robbins, 100 million
Americans secretly feel bored or frustrated with their lives.
Youre in good company. The question is, What are you going to
do about it?
In her new book, Stop Saying Youre Fine, Robbins leaves no
room for excuses. Her book follows suit with the conversations
on her radio talk show in that she gets to the root of the problem
within seconds, refusing to pull any punches. Almost without
exception, Robbins explains, your problem is you. No more
meandering around the idea that something needs to change. The
truth is, you need to make a change, stop deceiving yourself,
move toward your dream life, reject mediocrity, and above all,
stop saying youre f ne. Youre not f ne, she writes. There is
a lot more in store for you than what youve got going on right
now, and the f rst step to getting it is to stop pretending that
everything is okay.
That admission gets the ball rolling, but Robbins points out
that change isnt an instant, one-time event. Instead it is the
slow accumulation of details. Change is checking days of on a
calendar. Big leaps and drastic measures rarely work in real
life, she writes. To help readers make a move, and then keep
moving toward change, Robbins
of ers simple tools and practical
strategies. Her advice includes
doing a brain dump, breaking
with routines and exercising
for 20 minutes every day. The
biochemical cocktail that you
release into your body every
time you push your muscles and
your heart to work a little harder
is like a momentum potion.
More than once Robbins
encourages readers to actnow!
If you have a game-changing
impulse, an idea that could move you toward whatever it is that
you desire, dont delay. Dont think about it; dont put it of until
later this afternoon. Take one tiny action within f ve seconds
of that impulse. Why the sense of urgency? After f ve seconds
that impulse will begin to disappear and youll be back to living
the status quo. If you really want to change, you have to act
dif erently. Without action, nothing changes and you stay stuck
with the other 100 million Americans who are dissatisf ed with
their lives.
If you want to make a change and need a little push, pick up
Stop Saying Youre Fine. Go on do it now.
SUCCESS MAGAZINE EDITOR RATING:
STOP SAYING
YOURE FINE
Discover a More
Powerful You
by Mel Robbins
Crown Archetype
2011, Mel Robbins
256 pages, $24.00
ISBN: 9780307716729
SUCCESS Points
From this book
youll learn:
How your brain works
against you
How to connect with others
Why its not OK to hit the
SNOOZE button
How to jump-start change in
your life
About the Author
Mel Robbins is a lawyer turned life coach. She
hosts a daily syndicated radio talk show on which
she dispenses advice to men and women about
how to get out of their own way and create the life
they want.
Robbins is a blogger, relationship expert and
columnist for SUCCESS magazine. She lives with
her family in Sherborn, Mass.
The best time to act on a feeling you
have is right now. Thinking about it
just makes it harder. er
ns
ine,
of One,
p,
SUCCESS.com SUCCESS BOOK SUMMARIES
Page 1
BY THE EDITORS OF SUCCESS MAGAZINE
BOOK SUMMARIES & REVIEWS
F
SS!
To learn how to share SUCCESS Book Summaries with your friends and
business associates, visit www.sbsummaries.com.
J U L Y 2 0 1 1
W
elcome to the July 2011 edition of SUCCESS Book Summaries. As business leaders and entrepreneurs, we spend a lot of time thinking about our prospects and customers. We do surveys to better understand their needs, we watch how they respond to our offers, and we study demographics and psychographics so we can get to know our clients. And thats a good thing; we need to know what compels our customers to buy! But its also smart to step back every so often and think about ourselves. What
makes us tick? What makes us unique? How do we need to grow and improve? If we spend all of our time looking outward, we ignore our own growth and personal
development. And thats a shame. Because its only by understanding and improving
ourselves that we can offer our best to the world. The three books featured this month give us a little time to focus on both ourselves and our customers. Youll learn how to grab and hold your prospects attention, how to become a more effective leader, and how to tune out the worlds
constant noise and sharpen your ability to focus. Heres a quick look at the lineup: Well kick things off with Fascinate: Your 7 Triggers to Persuasion and Captivation, by Sally Hogshead. This excellent book is appropriate for anyone who needs to inf luence otherswhether youre a salesperson, or a parent dealing with kids, or
youre trying to convince your spouse to agree to a vacation in Bora Bora. You dont
want to miss the communication secrets this summary reveals. Then well hear the summary of Self-Improvement 101: What Every Leader Needs to Know, by John C.
Maxwell. In this book, Maxwell talks about intentional growth. Its almost impossible not to learn. We
learn from our own and others experiences. We learn from the things we hear and see online and on
television or radio. We are always learning. But if we want to grow, we need to be intentional about what
we learn and how we use that information. Maxwell has some tips for how to be more purposeful in our
approach to learning so we can achieve better results as a leader. And last, but not least, our classic this month is The Human Machine by Arnold Bennett. Written in the
early 1900s, youll quickly notice Bennetts writing is very different from our other two modern-day
authors. But if you listen closely, youll learn a very important strategy for increasing your attention span
and harnessing the power of your thoughts. Thanks for being a loyal subscriber to SUCCESS Book Summaries. I hope you enjoy learning about our
featured books this month, but more than that, I hope youll apply what youve learned. Take notes as
you read and hear advice that resonates with you. And be sure to tune in at the end of the audio for a few
tips from me on how to get the most out of this edition. When you put your newfound knowledge and
motivation into action, I know youll see excellent results. Until next time, keep listening, reading, and achieving more!
Darren Hardy, Publisher, SUCCESS magazine
0oo't wa|t. S0bscr|be Today!
www.sbs0mmar|es.com
800.570.6414
or get both print edition and
digital download edition for
ONLY$119*
66 SUCCESS AUGUST 2011 66 666 66 666 66 SSSSSSUC UC UC UC UC U CE CE CEE C SS SS SS AAAAAAU AUUUUG AUG UUG AUG AAAAAAUUUUUG UUUUGGG UGGGGGGG U AAUUUUUUG UG AU AAAAAAUUUUUUG UG AUGGG UUG AU AAU AUUUUUUG U AU AAUUUUUUG UG UG AUU AUUUG UGGG AAAU AU AUUUUUUGG AAAU AU AAUUUUGGGGGGGG AAUG UG UG UGG AAAAAUUUGG AAAAAAAUUUUUUG UUG UGGGGGGG AAAAAAAAAAUUUUUUUGGGGGG U AAAUUUUUGGGGGGGGG U UUS US US S US SSST UST ST ST ST UUS UUUUSSSSS USST UUUUS SSSSSST UUUS S USST UUSS UUUUUUUUUUUUUUUUUS UUUUUUUS UUUUU T UUUUUUUU T UUUUUUUUSSTTT UUUUU TT 22220 201 201 22 1111

J
a
a
p

B
u
i
t
e
n
d
i
j
k
68 SUCCESS AUGUST 2011
H
eyman, 49, has told countless interviewers that, no, he did not know the lms would
be the kind of phenomenal box-ofce record-breakers they have become. Throughout
making the rst lm, we knew that there was interest, he says. But when it came out
and it did what it did, it was like, Wow. I dont think anybody anticipated that.
The seven books have been made into eight lms, with the nal story spanning two screenplays.
Throughout, Daniel Radcliffe (as Harry), Rupert Grint (as Ron Weasley) and Emma Watson (as
Hermione Granger) battle evil at Hogwarts School of Witchcraft and Wizardry. In the fourth lm,
Harry Potter and the Order of the Phoenix, Harry, Ron and Hermione start a student organization
to practice spells for defense against the dark arts. They call it Dumbledores Army, after their
Hogwarts headmaster Albus Dumbledore, played in most of the lms by Michael Gambon. In each
movie, the students test their classroom skills in real-life battles alongside their mentors, played by
various legendary British actors, including Emma Thompson, Gary Oldman and Alan Rickman.
The lms epic scope has helped create a cultural icon of the boy wizard, generating vast merchan-
dising, worldwide tours and a shared vocabulary reminiscent of Star Trek fandom. Director David
Yates has said that audiences feel like they know the coming-of-age teens personally: The audience
and fans have a relationship that goes back 10 years, and thats something really magical. That is actu-
ally more important than all the battles, frankly, and all the special effects and everything, because
they are going through the cycle of life that weve all been through.
But behind the fan restorm, Heyman was focused on running a business: As a producer just
as with any business, you have to look at the market and determine what that market will accept
and what that market is willing to pay for the product that I have. That being said, I think for me
what has always been integral to my business approach and the way that I approach the lms is Im
drawn to projects that I connect with. I had no idea that Harry Potter would have achieved the level of
success that it has, but it was something that touched me, that moved me, that made me laugh, that I
could relate to. Youve got to realize that this is in 1997, early 1997, before the book was published. I
connected with it. And there was a belief that if I connected with it, that others would.
I
n 1997, Heyman had just moved home to Britain and launched
Heyday Films, after previous stints in Los Angeles as a creative
executive for Warner Bros. and as a vice president at United
Artists. He had already produced two short independent lms, but
they were small projects. I was a struggling producer, he said in an
interview for The Telegraph, so he brokered a deal with Warner Bros. to
pay for his ofce in London in exchange for giving them a rst look
at whatever interesting projects he might nd. Then he set to work
looking for books that might make good movies.
That spring, Heymans secretary, Nisha Parti, took home a manu-
script that no one else in the ofce had bothered to read. Harry Potter
and the Philosophers Stone had yet to be published. Parti read the entire
manuscript over the weekend.
At the Monday morning staff meeting, Heyman asked if anyone
had read anything good recently. Parti raised her hand and
said, Harry Potter and the Philosophers Stone. Heyman
was unimpressed by the title but asked what it was about.
About a boy who goes to wizarding school, Parti said.
So Heyman took the manuscript home, read it that
68 68 68 68 68 68 68 68 668 8 68 888 68 68 8888 68 68 68 6666668 668 68 88 68 68 668 68 88 68 6888 SSSSSSSSSSSSSSSSSSSSSSSSSSSUC UC UC UC UC UC UC UC UC UC UC UUC C UC UC UC CCCC UC C UC UC UC CCCC UUUUU CE CE CE CE CE CE CE CE CE CE CE CE CE CE CCE CCE CE CE CE CE CCCE CE CE CE CE CCE CE CCE CE CE CE CCE CCE CE CE CCCCCE CCE CCCCCE CE CCE CCCEEEEEESS SS SS SSSS SS SS SS SS SS SS SS SS SSS SSS SS SSSSS SS SS S SSSSSSSSSSSSSSSSSSSSSSS AUG AUG AUG UG UG AUG UG AUG UG AUG UG UG UG AUG AUG UUG UG AUG AUG UG AUG GGG UG UG UUG UG GGGGGGGG UUG UG UG GGG UG UG GG UG UG G UUG GGGGGGGGGGGGGG UG A G U UST US UST UST UST UST US US US US SS US US S US US UST UST UUUUUUUUUUUS US US S US UUSS US S UST UUUUS S US UUUS US US S U 01 01 01 01 01 01 201 222222201 201 01 01 201 1 2201 11 222201 201 201 01 20 2001 0001 1 001 1 01 1 001 001 20 200 2001 001 01 20 2001 2220 22000 111111111111
and it did what it did, it was like,
The seven books have been made into e
Throughout, Daniel Radcliffe (as Harry),
Hermione Granger) battle evil at Hogwart
Harry Potter and the Order of the Phoenix,
to practice spells for defense against the
Hogwarts headmaster Albus Dumbledore,
movie, the students test their classroom sk
various legendary British actors, including
The lms epic scope has helped create a
dising, worldwide tours and a shared voca
Yates has said that audiences feel like they
and fans have a relationship that goes back 1
ally more important than all the battles, fra
they are going through the cycle of life that
But behind the fan restorm, Heyman w
as with any business, you have to look at
and what that market is willing to pay for
what has always been integral to my busine
drawn to projects that I connect with. I had n
success that it has, but it was something tha
could relate to. Youve got to realize that thi
connected with it. And there was a b
n 1997, Heym
Heyday Films
executive for
Artists. He ha
they were small p
interview for The
pay for his ofc
at whatever int
looking for boo
That spring
script that no
and the Philosop
manuscript ov
At the Mon
had
sa
w
A
So
J
o
e
l

R
y
a
n
/
A
s
s
o
c
i
a
t
e
d

P
r
e
s
s
SUCCESS AUGUST 2011 69
night and was captivated by the story of the one boy who had faced the most powerful, evil
wizard and lived. He called Rowling and her agent. I was enthralled, he recalled. It
drew me in. I just loved the characters, Jos [Rowlings] voice. But Heyman wasnt the only
one interested. The small-time producer had to compete with the likes of Disney during his
negotiation with Rowling.
Jo wanted what was best for her books, and she sensed that I understood her book, [she
knew] that I was British, I related to them, that I would do everything in my powerwhich
at the time, frankly, wasnt that much other than being a producer. It wasnt like I was a
huge mogul, that it was my own money, that I was going to pay for it myself and have all the
control. Absolutely not. But she appreciated that I had passion for her material.
After Rowling was onboard, it took some convincingand maybe a little magicfor
Heyman to persuade the very American studio Warner Bros. to option the rights for the very
British Harry Potter.
Heymans instincts paid off, but he also invested some common business sense to broker
the deal. Once I love a project or a piece of material, I am aware of certain things that I enjoy
or that touched me that might not appeal on as large a scale. So in that sense youve got to
look at the market; youve got to understand who is the right buyer, who are the right people
who are going to go to that lm, who are the right people that are going to nance it and
make it the appropriate budget.
Filmmaking is usually a short-term project compared to most other small business
endeavors. While it could be years between projects, and Heyman says it could take another
decade to see a project realized, Once it takes off and once you get nancing for itnot
development but production nancingthen the process is quite quick. About a year and
Heyman on
Taking Criticism
There is a wonderful story of Winston
Churchill at the age of 90 going up to
speak to a class at Charterhouse, a school
that he went to and was actually kicked
out of. He was speaking to graduating
students who were 17 years old, and he
hauled up to the microphone with his
walking stick and he said, I have just nine
words of advice for you: Never give in,
never give in, never give in. And he turned
around and he sat down.
I think you have to have an absolute
belief in the project. And also that belief
has to sustain itself over a fair period of
time because inevitably you are going to
face opposition. You are the voice, and
I really think that its important to keep
that your voice. Along the way, things
will be diluted or changed or shifted, and
I think its really important to remember
what it was that drew you to the project in
the rst place. That is central.

M
u
r
r
a
y

C
l
o
s
e
Growing Up with Harry
Co-stars Daniel Radcliffe, from left, Rupert Grint and
Emma Watson (not shown) were just 11 when originally
cast in Harry Potter. Says Heyman: Its great to see how
theyve grown, not just as actors, but as people.
70 SUCCESS AUGUST 2011
a half from beginning to end. Of course, with Harry Potter it has been
much longer than that because its eight lms. But again, like a
business, youre looking clearly for things that will appeal to the
nancier, being the studio for example. With Harry Potter, there
are multiple revenue streams; you have the DVDs, you have the
lm itself, you have the merchandising, etc. From the start, Harry
Potter appealed to both investors and audiences alike.
W
hen people began to suggest American actors, an
American Hogwarts School or other Hollywood-
centric solutions for the transition of Rowlings
books to the big screen, Heyman was adamant about
protecting the original vision. The themes and ideas that are
integral to J.K. Rowlings universe are universal, and they do
not need to be located in the United States. You do not need
an American lead to make that story more appealing. Part of
the appeal of the book is that, yes, we have all been to school, but this feels like
a specically British institution, and I think you would be losing some of that.
Harry, Ron and Hermione, who cheerfully sing the silly Hogwarts theme song in
Harry Potter and the Goblet of Fire, would probably agree.
And thanks to Heymans inuence, the Harry Potter lms have maintained a
universal appeal while remaining true to their British origins. Heyman and his
team receive fan mail as far as from the Philippines to China and Japan and Brazil,
he says. The nal installment, Harry Potter and the Deathly Hallows Part 2, will be
released in more than 40 countries in just over three weeks in July.
Each lm release has reected countless hours of work. There were thousands of
people who worked on each lm, Heyman says. And every one of them is a part
of making these lms what they are. And every one of them is integral in the lms
success. It is a true collaboration. With any business, you hire people to help you
realize your project. I think the key was that everybody working on the lm was
ambitious for them; everybody wants to make each one better than the last. So we
would never settle for anything that was less than it could be.
When casting began for the rst movie, more than 40,000 boys had applied to be
Harry. The boy who won out, Radcliffe, and the two other leads, Grint and
Watson, started lming the series when they were 11 years old. Its great
to see how theyve grown, not just as actors, but as people, Heyman said
recently. They are funny and wicked and naughty and bright. And I think
as actors, their work is just getting better andbetter.
I love them, I just love them, Rowling said of the three leads after Aprils
BAFTA ceremony in London, where she and Heyman were honored with
the award for Outstanding Contribution to British cinema. You could not
meet three better adjusted, nicer, more talented people. And its almost
miraculous, you know. David and [director] Chris Columbus found these
three kids who turned out to be incredible actors and incredible people. So
how lucky were we that we managed to keep them?
The three stars have avoided the Hollywood curse of crazy that befalls so many
young actors, in part because Heyman chose to lm at Leavesden Studios in bucolic
ke
.
n
a
is
,
be
of
rt
s
u
as
we
be
ny
ic
Raking in the Galleons
(Wizard-speak for bucks)
In addition to multiple versions of each
book and lm, Harry Potter products
and events are hot. Here are some
best-sellers.
Wands Dumbledores Elder Wand
Costumes Luna Lovegoods Spectrespecs
Lego building setsHagrids Hut
ClothingGryfndor Scarves and Ties
Action gures Fenir Greyback with claws out
JewelryHermiones Time Turner
Prop ReplicasMarauders Map
Fan sites TheLeakyCauldron.org
Video GamesHarry Potter and the
Half Blood Prince
Theme ParkWizarding World of
Harry Potter at Universal Orlando
Resort
MuseumLeavesden Studios,
opening as The Making of Harry
Potter in spring 2012
SpinoffA behind-the-scenes
documentary about the lming of Harry Potter and
the Deathly Hallows is in the works.
and
reat
aid
nk
ls
h
t
t
o Prop op
Fan an
Vid
Ha Ha Ha
Th Th
HHHHHHHHHHHHHHHHHHHHHHHHHH
R
MMM
Spin i
I have never known any distress that an
hours reading did not relieve, promised
18th-century French philosopher Charles
de Montesquieu. Whether youre on
vacation or just checking out for a midday
break, summer can be the best time to
learn from a great book or to lose yourself
in one.
Weve compiled an assortment, from
page-turners to classic novels, from
autobiographies to business basics, to help
you chill out or get charged up. Either
way, reading is rewarding.
by MARY VINNEDGE and AMY ANDERSON
SUCCESS AUGUST 2011 73

J
o
n

N
e
u
s
c
h
w
a
n
d
e
r
74 SUCCESS AUGUST 2011
A survey of entrepreneurs turned up these
favorites and current reads.
Mike Repole, brand-builder, investor and entrepreneur: My favorite book
is Who Moved My Cheese? Its all about embracing change and not doing things
the same old way. I share it with all my new employees at Vitaminwater, Pirates
Booty and Energy Kitchen.
Liz Lange, fashion designer and Shopafrolic.com founder: She is most
inuenced by autobiographies of trailblazers and entrepreneurs, particularly:
Mary Wells Lawrences A Big Life (in Advertising) [2003], [Starbucks CEO]
Howard Schultzs Pour Your Heart Into It [1999], and Just Do It: The Nike Spirit
in the Corporate World [by Donald Katz, 1994]. These great pioneers stories
are ones I can relate to and also learn from. I just started Bossypants by Tina Fey
[2011]hilarious! And I recently read Just Kids by Patti Smith. Its one of the
most beautiful and moving stories I have ever read and incredibly well-written.
Mark Cuban, entrepreneur and owner of the
NBAs Dallas Mavericks: Hes reading In The Plex: How
Google Thinks, Works and Shapes Our Lives by Steven
Levy (2011) to get some insights into the company. The
Fountainhead [by Ayn Rand] is my all-time fave. It just
motivates the hell out of me.
Entrepreneur and marketer extraordinaire Seth
Godin recommends Derek Sivers Anything You Want
(2011). He was the founder of CDBaby, and he shares
40 lessons for a new kind of entrepreneur. I liked it so
much, Im publishing it!
Microsoft founder and Gates Foundation co-founder Bill Gates just
nished The Emperor of all Maladies by Siddhartha Mukherjee (2010), which
covers the history of cancer.
Warren Buffett praised The Intelligent Investor by Benjamin
Graham, revised edition. Jason Zweig did a rst-class job in revising The
Intelligent Investor, my favorite book on investing. [Its for] defensive and
enterprising investors.
Mark Sanborn, author of the best-seller The Fred Factor: How Passion
in Your Work and Life Can Turn the Ordinary into the Extraordinary, says
Because of my work in leadership development, Ive been reading books about
recent research in brain studies and neuroscience, notably Shawn Achors The
Happiness Advantage: The Seven Principles of Positive Psychology That Fuel
Success and Performance at Work [2010] and David Rocks Your Brain at Work:
Strategies for Overcoming Distraction, Regaining Focus and Working Smarter
All Day Long. I nd [the latter] fascinating and reafrming (and write about it
in my upcoming book Up, Down or Sideways: How to Win When Times Are
Good, Bad or In Between) that science is conrming many of the principles of
the power and effects of attitude that cynics have been so critical of. For those of
us who have studied and applied the principles of success, it is great to see what
we believed intuitively to be true being validated by research.
Wayne Rogers
M*A*S*H TV star turned
investment advisor
On his bedside table:
Rogers consistently keeps two books by his bed,
usually dealing with scientic breakthroughs.
Early this summer, those books were The
Hidden Reality: Parallel Universes and the Deep
Laws of the Cosmos (2011) by Brian Greene and
Chimpanzee Politics: Power and Sex Among
Apes (1982) by Franz de Waal.
For lovers of e-reading devices,
books are a constant companion.
Here are a few recent downloads.
Kim Kardashian, reality TV star
Tuesdays With Morrie by Mitch Albom (1997)
Are you there, Vodka? Its Me, Chelsea by
Chelsea Handler (2008)
The Purpose-Driven Life by Rick Warren (2002)
Reinventing the Body, Resurrecting the Soul: How
to Create a New You by Deepak Chopra (2009)
Jessica Simpson, pop star and actress
The Best Kind of Different: Our Familys Journey
with Aspergers Syndrome by Shonda
Schilling (2010)
Made for Goodness: And Why This Makes
All the Difference by Desmond Tutu (2010)
The Power of Now!: A Guide to Spiritual
Enlightenment by Eckhardt Tolle (1997)
Kristin Chenoweth, Glee star
and singer
Eat Pray Love by Elizabeth Gilbert (2006)
The Godfather, the classic maa novel
written by Mario Puzo (1969)
Zooey Deschanel, actress and
singer/songwriter
Columbine by Dave Cullen (2009)
Food Rules: An Eaters Manual by
Michael Pollan (2009)
most beautiful and mo
f f d
urney
SUCCESS AUGUST 2011 75
Robert David Hall
CSI Star and Musician
Recent reads:
I love to read and am rather obsessive
about it, Hall says. As an English
lit grad from UCLA, I used to read
weightier tomes, but now Im probably
more a creature of ction, crime dramas
and biography. I recently nished the
Stieg Larsson crime trilogy The Girl
with the Dragon Tattoo [2008], et al. I
read a lot on planes and also nished
the latest Lee Child, George Pellicanos
and Michael Connelly books; Ive read
everything theyve written.
On his bedside table:
Almost nished is Keith Richards
biography Life, which is incredible. On
deck is Leavitt and Dubners book Super
Freakonomics [by Steven D. Levitt and
Stephen J. Dubner, 2009].
Digital books:
I dont have a Kindle; Ive got an iPad.
But I still prefer the tactile feeling of a
real book.
Jaclyn Smith
Entrepreneur and one of
the original Charlies Angels
Favorite Book:
My Reading Life by Pat Conroy. He
reawakens my desire to read poetry, the
classics. And his love of language and
how he uses it is unmatched! And he
writes about his native South, which is
my favorite place.
On her bedside table:
Sabbath: Restoring the Sacred Rhythm
of Rest by Wayne Muller (2000) and
The Fountainhead by Ayn Rand (1943).
A recent read she recommends is New
and Selected Poems Volume 1 by Mary
Oliver (1992). Poetry takes you to a
place of thought, sometimes peace and
melts away the day, Smith says.
success.com
Read more
business book
recommendations
Check out these books to help you steer around
potholes in the road to prosperity.
Reality Check: The Irreverent Guide to Outsmarting,
Outmanaging, and Outmarketing Your Competition by
Guy Kawasaki (2008)
Ignore fads and stick to commonsense practices in
growing your business, the high-prole entrepreneur advises.
Trust Agents: Using the Web to Build Inuence, Improve
Reputation, and Earn Trust by Chris Brogan (2009)
Great marketing depends on trust, and Brogan shares how to gain peoples
trust online and turn it into a potent force for your business.
The Toilet Paper Entrepreneur: The Tell-it-like-it-is Guide to Cleaning up in
Business, Even If You Are at the End of Your Roll by Mike Michalowicz (2008)
Stop procrastinating and get with it, says the author, because a shortage of cash
and experience are not obstacles.
Delivering Happiness: A Path to Prots, Passion, and Purpose by Tony
Hsieh (2010)
The Zappos CEO applies research from the science of happiness to forming the
kind of corporate culture that breeds customer loyalty.
Hit the Deck: Create a Business Plan in Half the Time with Twice the Impact
(2010) by David Ronick
Step-by-step tips for starting a businessfast.
Never Get a Real Job: How to Dump Your Boss, Build a Business
and Not Go Broke by Scott Gerber (2010)
Gerber empowers people to leave their 9-to-5 jobs by dissecting failures, sharing
hard-learned lessons and presenting steps to building, managing and marketing a
successful business on a shoestring budget.
Rework by Jason Fried and David Heinemeier Hansson (2010)
Fried and Hansson, founders of the software company 37signals, describe a new
reality where anyone can be in business without being a workaholic.

J
o
n

N
e
u
s
c
h
w
a
n
d
e
r
76 SUCCESS AUGUST 2011
These personal development
best sellers, revealing
universal truths and time-
tested strategies, had record
runs on the New York Times
Bestseller List.
1. Tuesdays with Morrie by Mitch
Albom (206 weeks from 1997 to 2004)
Successful sports journalist Mitch
Albom nds life-changing moments in
his weekly visits to his dying college
mentor, Morrie Schwartz.
2. The Power of Positive Thinking
by Norman Vincent Peale (186 weeks
from 1952 to 1956)
Teaches techniques to carry out
your ambitions, stop worrying and
improve relationships.
3. Proles in Courage by John F.
Kennedy (139 weeks from 1956 to 1964)
Recounts brave acts by eight U.S. senators who crossed party
lines or deed constituents to do what they felt was right.
4. Freakonomics by Steven D. Levitt and Stephen J.
Dubner (111 weeks from 2005 to 2008)
Complex economic phenomena can be understood if you
deliver information from the right perspective.
5. All I Really Need to Know I Learned in Kindergarten
by Robert Fulghum (110 weeks from 1988 to 1991)
Core principles such as sharing and cleaning up after
oneself are useful throughout life.
6. Games People Play by Eric Berne (109 weeks from 1965
to 1967)
Berne digs into the psychology of human relationships.
7. The Art of Happiness: A Handbook for Living by the
Dalai Lama and Howard C. Cutler (97 weeks from 1999
to 2001)
Inner development contributes to overall happiness;
Buddhist elements can help you achieve contentment.
8. How to Live 365 Days a Year: 12 Principles to Make
Your Life Richer by John A. Schindler (90 weeks from 1955
to 1956)
Author introduced the idea that elevated stress can manifest
itself in the nervous and endocrine systems, resulting in
disease-like symptoms. One-liner philosophies aim to
counteract the stress, such as: Allow yourself the delightful
feeling of being happy and Avoid running your misfortune
through your mind like a repeating phonograph record.
9. The Millionaire Next Door by Thomas J. Stanley and
William D. Danko (86 weeks from 1997 to 1998)
Book reveals the habits and shared characteristics of
millionaires. Learn the seven traits often shared by people
who started with nothing and built fortunes.
10. Blink: The Power of Thinking Without Thinking by
Malcolm Gladwell (81 weeks from 2005 to 2006)
Author analyzes factors that feed into smart decisions in
situations ranging from emergencies to marketing.
success.com
Discover past summer
best sellers from the
1940 to the 1990s

J
o
n

N
e
u
s
c
h
w
a
n
d
e
r
SUCCESS AUGUST 2011 77
Tim Sanders, New York Times best-selling author, speaker
and former Yahoo! executive, spent his childhood living with his grandmother. In his book, Today We
Are Rich: Harnessing the Power of Total Confdence (March 2011), Sanders reveals the seven books on his
grandmothers bookshelf that changed his early troubled life for the better.
Norman Vincent Peales Guide to Condent Living (1948) helps readers achieve condence and contentment with
guidance for losing your inferiority complex, achieving calm, practicing prayer and freeing yourself from
fear and sorrow.
Peales The Power of Positive Thinking (1952), his most famous work.
Dale Carnegies How to Stop Worrying and Start Living (1948), a self-help book that tells stories of people
who have switched off their anger and anxiety to turn their lives around.
Claude Bristols Magic of Believing: The Science of Setting Your Goal and Then Reaching It (1948) tells how
to use the subconscious mind and unleash your creativity to overcome obstacles and fulll your dreams.
Napoleon Hills Think and Grow Rich (1937) teaches how to attain permanent prosperity.
James Allens As a Man Thinketh (1902) posits that your thoughts prompt every action, and inuence your
character,resulting in your reality.
Maxwell Maltzs Psycho Cybernetics: A New Way to Get More Living Out of Life (1960) states that happiness and
success are habits that can be instilled, and negative habits can be changed. S
Ethan Zohn
Survivor winner
and author of
Soccer World: Spain:
Explore the World
Through Soccer
Recent reads:
Im reading Hunger
Games on my Kindle,
Zohn said recently. Its
a perfect combination of
the TV show Survivor, [the
book] Lord of the Flies and
some cheesy love story.
Its fun and exciting. Im
almost nished with the
second book in the series.
Cant wait for the movie.

Actress Kate Hudson: One Hundred Years of Solitude by Gabriel Garcia


Marques (1967)
Author of mega-selling crime thrillers Michael Connelly: The Long Goodbye
by Raymond Chandler (1953). I read it in college and immediately subscribed to
the idea of the crime novel as art. The books evocation of Los Angeles and the
social commentary on the city inspired me to become a writer.
Comedienne and actress Lily Tomlin: The Shipping News by E. Annie Proulx (1993)
Actress Mira Sorvino: A Brief History of Time by Stephen Hawking (1988)
Actress Nicole Kidman: War and Peace by Leo Tolstoy (1869). Its why I
wanted to become an actor, but its not light reading.
Actress Winona Ryder: The Catcher in the Rye by J.D. Salinger (1951)
National Public Radio arts correspondent Lynn Neary: To Kill a Mockingbird by
Harper Lee (1960). She says the tale of Southern racism and injustice changed the
way I looked at the world.
78 SUCCESS AUGUST 2011
Making a Diference
W
ith a tennis racket strapped
tightly to her hiking pack,
Ma r t i n a Na v r a t i l o v a
began her ascent of Mount
Kilimanjaro. The tennis
legend had visions of celebrating at the summit
of Africas highest peak by hitting a couple balls
to see how far they might y in the thin air at
19,341 feet.
But her goals were much loftier; a few months after
completing treatment for breast cancer, Navratilova
wanted to show other cancer patients that life goes on
after beating the disease. The climb last December also
was part of an effort to raise awareness and funding for
the Laureus World Sports Academy, an international
philanthropic organization of which she has been a
charter member since 1995.
Laureus has about 80 active projects in 40 countries
primarily aimed at helping impoverished children by
using athletics to instill condence, inspire leadership
and create opportunity. Navratilovas focus was on the
plight of children in the slums of Nairobi.
Considered by many to be the greatest female
competitor ever to pick up a tennis racket, Navratilovas
career highlights include 18 Grand Slam singles titles,
31 Grand Slam womens doubles titles and 10 Grand
Slam mixed doubles titles.
Ask the retired superstar what other areas of her life
she commands with such mastery and her answer is
simple. None, she says with a laugh. Im denitely
not nearly that good at anything else!... Im a jack of all trades and master
of one. I wish I could be great at other things, and trust me I try.
Over the past few years the 55-year-old Navratilova has earned her
pilots license and scuba certication, written several novels and tness
books, been featured on a reality TV show, worked with inner-city youth
in east London and the Bronx, and done charity work in Africa.
Ive had an interesting life, and Im grateful for that, she says. I am
like my mother. She was very curious and so am I; I like to dabble in
things to learn about them.
True to her intense, passionate style on the court, Navratilovas deni-
tion of dabbling might be a little different from the norm. She earned
her pilots license because she felt it was the one way to conquer her fear
of ying. She is a certied scuba diver after spending most of her life
afraid of the open water. Meeting a challenge head-on is the best way to
handle it, in her opinion. If you are afraid of something, the fear never
goes way, she reasons. The fear is always there, keeping you petried.
But when you conquer it, it is gone, behind you. It is easier to face a fear
to challenge it and conquer it than it is to live with it.
Every day is an adventure for Navratilova. Even when she is not
throwing herself into overcoming a phobia, she still wants to immerse
herself in every pursuit she can. She explains that she lives life ready to
embrace whatever opportunity might come her way. Each new endeavor
UPPING
Her Game
Retired from tennis,
Martina Navratilova continues
to push herself, and to use her
gifts to inspire and help others.
by DON YAEGER
C
h
r
i
s

J
a
c
k
s
o
n
/
G
e
t
t
y

I
m
a
g
e
s

f
o
r

L
a
u
r
e
u
s
SUCCESS AUGUST 2011 79
Her training for the climb included racing up all 55 ights of
stairs of the Bank America Tower in about 15 minuteshardly
breaking a sweat or even getting winded. Her physical tness was,
in her words, at its peak.
Yet, four days into the six-day Kilimanjaro ascent, Navratilova
found herself struggling to walk even a few feet and gasping for air
even while sitting still. Something was seriously wrong.
Wrapped in her sleeping bag and roped onto a stretcher,
Navratilova had to be carried down the mountain by a team of
porters, and then rushed to the hospital. Doctors discovered
she had developed a condition called high-altitude pulmonary
edema. A buildup of fluid in her lungs, the condition was the
result of climbing conditions and not her physical tness. If she
had continued up the mountain, the climb would have put her out
of the reach of medical attention and almost certainly would have
killed her.
She admitted it was disappointing to see the trek end that way,
but the only failure is the failure to try. And her ultimate goal was
still accomplished. Two-thirds of our group made it to the top,
which is a higher percentage than average for the mountain, so I
feel good about that. Our goal was to raise money for the children
in Nairobi and we did that. I dont need to reach the top to feel
good about myself.
Indeed, the climb helped Navratilova raise close to $100,000 for
Laureus work for impoverished children in Nairobis slums.
Navratilova is now thinking about future challenges. She has
never been to South America with Laureus, so she is hoping to
make a visit to raise awareness of the living conditions of the
poor in several major cities.
In the meantime, she will continue to tirelessly campaign
for the causes near to her heart and seek out new ways to
grow personally. Ive played hockey for about 15 years now
and I love it. And I did the biking portion of a triathalon last
year, she says. With tennis, its about slowing the deteriora-
tion, but with my other activities, Im still improving.
As Navratilova sees it, she has no choice in the matter: What
is the alternative? You have to take that rst step. Dont get over-
whelmed by the enormity of it all just keep moving forward.
Thats the only way to really live.
It should come as no surprise that a woman who was at the
top of the tennis world from her debut as a teenager to winning
a mixed doubles Grand Slam title only a month before her 50th
birthday would believe in the importance of always moving
ahead and keeping focused on the next big thing. Even in light of
the health challenges shes faced, she is determined to stay posi-
tive. Without attitude, you have nothing, she says, denitively.
Attitude is a choice. S
Don Yaeger is an award-winning inspirational speaker, ve-time New
York Times best-selling author and longtime associate editor for Sports
Illustrated magazine.
Eye on the Goal
Navratilova aimed to prove theres life after breast
cancer by climbing Mount Kilimanjaro. Below, at
Wimbledon during her heyday.
is the result of being receptive to whatever feels right, whatever grabs
me. Sometimes its a friend saying, Hey, come along! Sometimes I read
something and think, That sounds fascinating! I want to learn more.
That openness is the key to both mental and physical activity. And as
the Health and Fitness Ambassador for the AARPa position created
specically for herno excuses activity is a cause very
near to her heart.
A few years ago, driving outside of Aspen, she noticed
a woman running along the side of the road at a very
fast clip. I got closer and realized she had one leg and
was running with crutches, Navratilova recalls. I
thought, Whats my excuse for not running today?
Whenever I think I cant do something or I dont
feel like doing something, I think of that one-
legged woman running.
Its a vision that has carried her far. In February
2010, Navratilova was diagnosed with breast
cancer. For the first time, my world did stop
for a moment, she says.
But then I went into
sur vi val mode and
solution mode.
Af ter undergoi ng a
lumpectomy to remove the
tumors and six weeks of radiation treatment,
the cancer was gone and her spirit undaunted.
I only missed one day of physical activity
through the whole thing, she remembers. I
tried to play tennis but was too tired and had
to stop.
Quickly, her energy returned and she
was focused on the next goal: Kilimanjaro.
Similar to other quests, the climb was also a
way to prove to herself that she had beaten
cancer and all of its side effects.
g
in Nairobi and w
good about mys
Indeed, the cl
Laureus work fo
Navratilova i
never been to
make a visi
poor in se
In the
for the ca
grow pers
and I love
year, she sa
tion, but with
As Navratilov
is the alternativ
whelmed by the
Thats the only w
It should com
top of the tenn
a mixed doubl
birthday wou
ahead and keep
the health cha
tive. Without
Attitude is a c
Don Yaeger is
York Times be
Illustrated ma
p
no excuses activity is a cause very
ving outside of Aspen, she noticed
ong the side of the road at a very
and realized she had one leg and
rutches, Navratilova recalls. I
excuse for not running today?
ant do something or I dont
thing, I think of that one-
ng.
carried her far. In February
as diagnosed with breast
, y p time, my world did stop
ays. ssss. ssss. s. sssss. ssssss
o
d
g a
ve the
s of radiation treatment,
nd her spirit undaunted.
day of physical activity
ing, she remembers. I
t was too tired and had
gy returned and she
ext goal: Kilimanjaro.
s, the climb was also a
f that she had beaten
de effects.
H
u
l
t
o
n
-
D
e
u
t
s
c
h

C
o
l
l
e
c
t
i
o
n
/
C
o
r
b
i
s
80 SUCCESS AUGUST 2011
Profles in Greatness
The Great
Communicator
President Ronald Reagan inspired
the nation to greatness and the
world to peace.
by DEBORAH HUSO
F
ami ly legend says John Jack Reagan
looked at his newborn son, Ronald Wilson
Reagan, and said, He looks like a fat little
Dutchman. But who knows, he might grow
up to be president someday. Little did he
know what the future held for the ambitious boy born
on Feb. 6, 1911, in Tampico, Ill. The son of a shoe
salesman and a homemaker, Reagan learned early the
value of hard work, determination and ambition from
his father, who told him that every man is respon-
sible for his own destiny. His mother, Nelle, who was
very involved with her church, instilled in her son the
power of prayer and optimism.
After graduating from high school, Reagan attended Eureka
College in 1928. He began working as a sportscaster for the
Chicago Cubs, which led him to Hollywood when he followed
the Cubs to their spring training camp in Southern California.
He decided to try his hand at movie acting in 1935.
In a world wracked by hatred, economic
crisis and political tension, America remains
mankinds best hope.
Over the next 27 years, Reagan appeared in more than 50
lms. He also enlisted in the Army Reserve and was assigned
to produce Army Air Force training lms and documentaries.
During his service, Reagan saw footage from foreign war zones
that awakened a newfound passion for political causes.
After being discharged from the army as a captain in
1945 and returning to his acting career, Reagan joined the
Hollywood Democratic Committee and served on the board
of the Screen Actors Guild (SAG). He allied himself with the
big Hollywood studios and the FBI during the strike by the
Conference of Studio Unions (CSU), an allegedly communist-
led organization, and participated in breaking the strike and
the CSU. Reagan was elected president of the SAG in 1947.
You knew that in the end it was free
enterprise, not government regulation, not
high taxes or big government spending,
but free enterprise that has led to the
building of a great America.
In 1954, two years after marrying actress Nancy Davis,
Reagan became a corporate spokesperson for General
Electric, promoting their appliances and their conservative
political ideas. He also hosted General Electric Theater, a
Sunday evening television show, for eight years.
Through his visits to GE research and manufacturing
facilities, he spoke to more than 250,000 employees about
the value of hard work and not waiting on the government
to provide solutions.
We in the government should learn to
look at our country through the eyes
of the entrepreneur, seeing possibilities
where others see only problems.
Ten years later, in a 1964 televised speech supporting
presidential candidate Barry Goldwater, Reagan not only
praised American individualism and the free-enterprise
system, but also inspired hope and determination in the
nationwide audience. Ultimately, the speech paved the way
for the political and public support he needed to secure
an eight-year run as Californias governor in 1966. He
continued to represent conservative ideology while dedi-
cating himself to the needs of the people and expressing
growing concern about big and expensive government.
His success as governor made him a prime candidate for
president just two years into his term. While he ultimately
lost in the primaries to Richard Nixon, the publicity he
obtained while stumping was invaluable.
Government is not the solution to our
problems; government is the problem.
In 1980, Reagan made a successful run for president,
defeating Jimmy Carter with almost 51 percent of the
popular vote.
SUCCESS AUGUST 2011 81
Reagans so-called revolution began with the most
massive military expansion in American peacetime
history, with a budget of more than $300 billion. By
expanding U.S. military presence throughout the world
to ght Soviet communism, Reagan eventually helped to
bring the Cold War to a close without bloodshed.
But it may have been his ability to communicate
and connect with people that was his greatest legacy.
Throughout his career, he studied not only his speeches,
but the effect they had on audiences, making improve-
ments as needed.
As president, Reagan was gifted in his ability to speak
about substantive issues in clear and simple terms under-
stood by Americans, as well as people around the globe.
He often used folksy anecdotes and phrases that evoked
emotionswhich sometimes prompted criticism from
detractors. But through his speaking style, Reagan was
able to express his optimism and to inspire it in others.
Mr. Gorbachev, tear down this wall.
On a trip to Berlin in 1978, Reagan heard the story of
Peter Fechter, an East German boy who died trying to
crawl over the Berlin Wall in 1962. Reagan just gritted
his teeth, said Peter Hannaford, an aide who accompa-
nied Reagan on the trip. You could tell from the set of
his jaw and his look that he was very determined that
this was something that had to go.
Reagan tried many times to open communications
with the U.S.S.R., but it was not until Mikhail Gorbachev
became general secretary of the Communist Party that
things began to change. In 1987, after Reagan and
Gorbachev had developed a level of mutual trust, Reagan
addressed a crowd of 20,000 near Berlins Brandenburg
Gate, where he challenged Gorbachev to demolish the
wall. Many, including Reagans closest advisors, thought
his plea unrealistic, but Reagan, an eternal optimist,
never wavered from his belief.
On Nov. 9, 1989, the East German government
permitted thousands of East Berliners to pass into West
Berlin as border guests, and the destruction of the Berlin
Wall began.
Well, one of the worst mistakes
anybody can make is to bet against
Americans.
Five years after Reagan nished his two-term presi-
dency, he was diagnosed with Alzheimers disease,
and ultimately succumbed to the disease at age 93.
He always told us that for America the best is yet to
come, President George W. Bush said of Reagan after
his death. We comfort ourselves by telling ourselves
that the same is true for him. We know a shining city
is waiting for him. S
M
i
c
h
a
e
l

O

N
e
i
l
l
/
C
o
r
b
i
s

O
u
t
l
i
n
e
SUCCESS Marketplace
Advertise here! 940-497-9961
Cas| loW proo|ers r|s||r your corpary's lulure?
Fee||r |ore|y al l|e lop.rore prore lo slress?
Procrasl|ral|r or recessary dec|s|ors or c|ares?
Need lres| |deas lo rejuverale slrale|c d|recl|or?
3|orlc|ar|r your lar||y, oa|arce & r|r|slry?

Today's ecorory ca||s lor lruslWorl|y peers ard W|se course|
lo ||r| slraley, execul|or, ard l|e l|re|y app||cal|or ol oesl
pracl|ces W|l| 0od's purpose. Ta|e advarlae ol Arer|ca's
|ead|r C|r|sl|ar CE0 Rourdlao|e prov|der, as a C12 Veroer
or Area C|a|r, ard |everae l|e prover poWer ol experl|y
lac|||laled peers, ore-or-ore lo||oW-up, ard our repos|lory ol
lareled resources lo er|arce currerl perlorrarce ard
elerra| |rpacl. C12's urcorror locus y|e|ds prover resu|lsl
TM
C12 Group can help!
www.C12Group.com
Franchises Available
7.375 in X 4.75 in
1/2 Horizontal -
No bleed
Award Winning
LOGO DESIGN
You Only Have One Chance
to Make a First Impression...
MAKE IT COUNT!
Toll Free: (888) 310-3175
ideas@vividesigngroup.com
www.vividesigngroup.com
Get your FREE info pack at
Leading global franchise in
32 countries
Large cash fow,
business-to-business market
Repeat transactions and
referrals
You proft by helping others
succeed
Proven and guaranteed systems
Freedom to create your own
future
If you are passionate about business and helping others succeed,
then discover for yourself why ActionCOACH is the worlds number
one business coaching franchise.
The Ultimate Recession-Proof Business!
G
If
th
o
Th
/success
940-497-9961
2011 L.C.E. Inc. 31942
FASTSIGNS brings an experienced team of
professionals dedicated to achieving your success.
- Clint Ehlers, FASTSIGNS Franchisee
Culver City, California
For franchise opportunities, contact Brian Wieters
at 214-346-5696 or brian.wieters@fastsigns.com.
www.fastsigns.com
DAS Partnership Opportunity
Take Control of Your Future!
Are you
Uncomfortable with selling, but interested
in growing your own consulting business
Concerned about your current level
of income?
Struggling to enjoy a lifestyle with a healthy
work-life balance?
Frustrated by working for other people?
If so, we can help! DAS is looking for nancial
professionals interested in starting their own
Dynamic Advisory Solutions ofce.
Contact Ren Carlton for more information
800.440.5266 or 248.283.8834 www.globalcfos.com
Learn more at www.successwithin.tateauthor.com
Have you given up
on your dreams?
Do you feel trapped in your
present existence?
Success is Within You
a new book by Michael W. Jackson
helps you to realize the fact
that you can be as excellent
as you want to be!
An inspiring guide to achievement,
a must read!
84 SUCCESS AUGUST 2011
Tech Tools
Boost Your
WORKOUT
Get t and healthy with
these tools and gadgets.
by BRANDY JULES
G
etting healthy doesnt have to be
boring. There are gadgets and tools you
can use to help enhance your workout
and make it fun. Try incorporating
these gadgets to help you track your
progress, set goals or help with your performance.
888888884 88888888888888888888888 SSUC UCCCESS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS AAUG GGUST UST UST T 222222220 201 201 201 222222222222222222222222 1111
Running Companions
Nikes newest sports watch is for runners who
want to excel. Powered by TomTom, the Nike +
SportWatch GPS captures the runners
location as well as time, distance, pace and
calories burned on an easy-to-read screen.
Plug the sports watch into a USB port and your
information can be transferred to Nikes running
community, NikePlus.com, which includes
almost 4 million members. Track and train
better. $199
And do your feet hurt after a run? It could be
your shoes. The Nike Free Run + 2
running shoes give your feet the exibility
and freedom they need during
a run as well as the support
they need to strengthen
over time. $90
Drink and Fold
If you like to bike or hike,
you know carrying a
bulky water bottle can
be inconvenient. Theres
usually no place for you
to store it or throw it away.
The Vapur Anti-Bottle
is a simple way to quench
your thirst on the trail.
Its reusable and it can be
rolled, folded or attened
when empty so its easily
stored in your bag
or pocket. $10
e
u
ut
g
ur
Health Tracker
Need to check your blood pressure? Do it
through your iPhone, iPod Touch or iPad using the
Blood Pressure Monitor by Withings. Simply slip the
cuff onto your arm and connect the monitor to your iOS device.
A free Withings app will automatically launch to your device. Track
and compare your results for day and night readings. You can sync
your results to your personal online health records such as Microsoft


HealthVault or Google Health. $129
FOREWORD BY RUDY GIULIANI FOREWORD BY RUDY GIULIANI
GetMotivatedBook.com
100%
of the proceeds
are being donated
to childrens
charities!
100%
of the proceeds
are being donated
to childrens
charities!
Refreshing and
Inspirational.
Publishers Weekly
#1 AMAZON
BESTSELLER
WALL STREET
JOURNAL
BESTSELLER
USA TODAY
BESTSELLER
NEW YORK TIMES
BESTSELLER
BUSINESSWEEK
BESTSELLER
One of the Best
Books for 2009
Fitness Magazine
Tamara Lowes Get Motivated!
EMPOWERS Individuals and Teams
to ACHIEVE Their Toughest Goals.
Get Motivated is
AWESOME BABY,
WITH A CAPITAL A!
Dick Vitale, ESPN
86 SUCCESS AUGUST 2011
Resources On the Bookshelf
Win: The Key Principles to Take
Your Business from Ordinary to
Extraordinary
by Frank I. Luntz
Hyperion, 2011
In Win, master communicator Frank Luntz
demonstrates the how-to behind winning strate-
gies, using examples from some of the worlds most
successful businessmen, politicians and sports gures.
But more than a how-to book, Win focuses the Nine
Principles of Winning, common philosophies shared by
all winners. Chapter by chapter, Luntz outlines the character
traits you must cultivate in order to achieve not just nancial
success but the ability to make a difference in the lives of others.
Luntzs lessons can be applied by any leader because his basic
message is that winning doesnt come from focusing on the bottom
line or even on success. Instead, he says, winning is the result of
building ones business around something people actually need
something that makes the human condition better.
In addition to his coverage of successful people, from Abraham
Lincoln to Steve Jobs to Rupert Murdoch, Luntz breaks up his
narrative with lists of questions designed to help readers analyze
their own skills, like Are You People-Centered? He also includes
easy-to-scan Luntz Lessons on everything from how to read
people through body language to learning to break rules and take
greater risks. Use this best-seller as a tool to develop your own plan
for winning.
Deborah Huso
REAL
Relationships
Connecting with customers is essential
to your businesss success.
In an ber-connected world, its easy to forget that your
friends, fans and followers are only tied to you by an easy-
to-unclick choice. Dont make the mistake of believing its
love when, in truth, your relationship could be based on
ckle infatuation.
Real relationships arent based on pixels; they develop
over time. And real relationships are the foundation of
good business. In the books featured this month, youll
learn strategies for connecting and creating long-lasting,
protable bonds with your customer base.
Noteworthy Quote:
Winners know what makes people tick, and they
connect either to our fears or our aspirations
or both.
From this book youll
learn how to:
Identify your target audience.
Connect with your customers and employees
on a human level.
Stay one step ahead of the competition.

J
O
I
N

th
e
N
E
W

S
U
C
C
E
S
S
B
o
o
k
C
lu
b
!
T
h
e

K
e
y

P
r
in
c
ip
le
s

t
o

T
a
k
e

Y
o
u
r

B
u
s
in
e
s
s

f
r
o
m

O
r
d
in
a
r
y

t
o

E
x
t
r
a
o
r
d
in
a
r
y

R
e
a
d

a
n
d

d
is
c
u
s
s

w
ith

u
s

a
t
S
U
C
C
E
S
S
.c
o
m
/
B
o
o
k
C
lu
b
W
I
N
!

SUCCESS AUGUST 2011 87
THIS MONTHS THIS MONTHS
Noteworthy
Quote:
Investing in your
customers pays
tremendous
dividends.
From this book
youll learn how to:
Build rapport using a
customer-service blog.
Jump-start powerful
customer referrals.
Dig Your Well Before Youre Thirsty
by Harvey Mackay
Doubleday, 1999
Packed with anecdotes of American icons,
ranging from Billy Graham to Muhammad Ali,
this quick, entertaining book is a classic that
should be on every businesspersons bookshelf. Beginning
and veteran networkers will learn creative ways to connect with
others and build solid, mutually benecial relationships.
Jenna Lang
Noteworthy
Quote:
The idea is not
to see how many
people you can meet;
the idea is to compile
a list of people you
can count on.
From this book
youll learn how to:
Create a favorable impression
after the initial connection.
Be on the A lists of those
you network with.
Onward: How Starbucks
Fought for Its Life without
Losing Its Soul
by Howard Schultz with
Joanne Gordon
(Rodale Press)
The Healthy Home: Simple
Truths to Protect Your Family
from Hidden Household
Dangers
by Dr. Myron
Wentz and Dave
Wentz with
Donna Wallace
(Vanguard Press)
Strengths Finder
2.0: A New
and Upgraded
Edition of the
Online Test from Gallups Now,
Discover Your Strengths
by Tom Rath
(Gallup Press)
The Social Animal: The Hidden
Sources of Love, Character, and
Achievement
by David Brooks
(Random House)
The Money Class: Learn to
Create Your New American
Dream
by Suze Orman
(Spiegel & Grau)
Change Anything: The New
Science of Personal Success
by Kerry Patterson, Joseph
Grenny, David Maxfeld,
Ron McMillan, Al Switzler
(Business Plus)
Unlimited: How to Build an
Exceptional Life
by Jillian Michaels
(Crown Archetype)
A Place of Yes: 10
Rules for Getting
Everything You Want
Out of Life
by Bethenny Frankel
with
Eve Adamson
(Touchstone Books)
The Best Advice I Ever Got:
Lessons from Extraordinary
Lives
by Katie Couric
(Random House)
Win!: The Key Principles
to Take Your Business from
Ordinary to Extraordinary
by Frank I. Luntz
(Hyperion Books)
Thank you to Nielsen
Bookscan for
providing SUCCESS with this list.
Nielsen Bookscan is a subsidiary of
The Nielsen Company LLC, gathering
point-of-sale book data from more
than 13,000 locations across the
United States. Sales March 28
through April 24, 2011.
success.com
See the Top
20SUCCESS
best-sellers
Flip the Funnel: How to
Use Existing Customers
to Gain New Ones
by Joseph Jaffe
John Wiley & Sons Inc., 2010
Whether you earned your MBA at a top-rated business college
or at the school of hard knocks, youve probably been taught to
use the marketing funnel: Attract the masses in hopes that a few
will purchase. Customer acquisition requires the bulk of your
budget, while customer retention suffers. In Flip the Funnel, Jaffe
debunks that business model and explains how investing your
time, money and energy into keeping your existing customers
satised is a more protable way to acquire new ones.
Erin K. Casey
3
Stre
2.0:
and
2
The
Trut
f
8
A Pla
Rules
Every
1
On
Fou
L
6
Chan
Scien
b K
4
The
Sour
h
5
The
Crea
Dre
7
Unl
Ex
by
9
The B
Lesso
Lives
10
Win!: Th
to Take
O di
nge Anything: The New
f P l S
nn
Experts agree that achievers
are avid readers. Here are the
top 10 self-help and business
best-sellers to help you boost
your productivity, further
your education and achieve
yourgoals.
Dig Y
by Ha
Double
Pack
rangin
this qu
sh should be on eve
andd veteran networkers
88 SUCCESS AUGUST 2011
10 Actions You Can Take Right Now
Resources Action Plan
Turning Your Knowledge into POWER
PAY IT FORWARD
Were all
infuential, whether
we realize it or
not. A kind word
or gesturecan
infuence another
persons day, and
create a ripple
effect of goodwill.
Make a point
today to exert
positive infuence
with fve deeds
that beneft others.
(PAGE 52)
ENCOURAGE
YOUR CHILDREN
Jane Goodall credits her
mother for encouraging
her dreams. Think
about the last time you
said no to something
your child wanted to
do. Even if the idea
was fawed, were your
childs intentions good?
Make a list of fve ways
you couldve been
encouraging rather than
discouraging, and use
this list as a reference
next time.
(PAGE 60)
SEEK
CONSTRUCTIVE
CRITICISM
For any project to
be successful, Harry
Potter producer David
Heyman says you
have to believe in it
wholeheartedly, yet
be open minded to
constructive criticism.
Do you have a
project that isnt
progressing as you
would like? Contact
someone you respect
now and seek input
for improvements.
(PAGE 66)
FEED YOUR BRAIN
Many achievers
include classics
among the books
theyre reading
this summer. Are
there books or
audio programs
youve long wanted
to experience?
Write down fve
of them, block out
time in your daily
calendareven
as little as 15-20
minutes dailyand
get started today.
(PAGE 72)
FORGIVE AND
GET ON WITH LIFE
Louis Zamperini was
tormented by the
atrocities he suffered
as a prisoner of war
until he forgave his
tormentors. Grudges
hinder you in living
your best life. Take 10
minutes to think of any
grudges you carry, then
pick up the phone and
reach out to the person
youve been blaming all
this time. Then get on
with your life.
(PAGE 36)
MAKE A
YOU TURN
Drs. Mehmet Oz
and Michael Roizen
say everyone makes
mistakes, so its
important to be able
to make YOU turns.
Think of a bad habit
or behavior you
would like to change,
write down three
steps implementing
the change, and start
taking them today.
(PAGE 22)
GET HELP
Richard Robinson of
Scholastic Inc. knew
that if his company
was to grow, he had
to hire people talented
and skilled in areas
he was not. Spend
20 minutes taking
inventory of your
varied responsibilities
to assess which ones
you could delegate
or outsource, then
start handing off those
duties today.
(PAGE 30)
VANQUISH
YOUR DOUBTS
When Jeff Bezos
came up with
the idea that
ultimately became
Amazon.com, he wasnt
sure the technology would
improve fast enough to
make e-commerce viable.
But he didnt let his doubts
stop him. Do you tend to
discount your ideas as
impossible to execute?
Imagine there were
no factors limiting your
success and write down
three ideas you would
pursue today.
(PAGE 44)
SHARE
WISDOM
Jeffrey Gitomer
is among countless
people infuenced by
the works of self-
improvement legend
Orison Swett Marden.
Now Gitomer shares
what hes learned.
Jot down fve books
or audio programs
that have positively
infuenced you, as well
as acquaintances who
might beneft. Then
share the wisdom.
(PAGE 40)
JUST DO IT
Martina Navratilova
says she works to
keep her tennis skills
from deteriorating and
to improve her skills
in her other varied
interests. Are you
letting excuses stop
you from pursuing
new endeavors? Think
of one skill youd like
to hone, make a list of
fve steps necessary
to tackle it and
schedule those steps
in your calendar.
(PAGE 78)
FOR LESS THAN $1 A BOOK, youll be captivated
by the stories from the 100 greatest literary classics
of all time without ever having to read a word.
Listen to them in audio book format , preloaded on
the included personal MP3 player.
Your collection includes:
100 greatest books in audio format
Adapter for listening in the car
Personal headphones
Belt clip
Bonus Gift: The 50 most beloved classical
music performances
Just $99!
You Are 100% Protected
If youre not completely satisfed, you are fully
protected by our no-questions-asked, LIFETIME
MONEY-BACK GUARANTEE. Simply call us and
well refund your full purchase price.
FREE GIFT for Acting Now
Order now, and youll receive a special FREE gift: 50
of the most enchanting classical music works (a $50
value) by the worlds great composers: Beethoven,
Brahms, Tchaikovsky all your favorites!
Call now for limited time special
price and free gift!
888-471-8205
24 hours a day
2011 Library of Classics, Inc.
Wuthering Heights Sherlock Holmes
Scarlet Letter Gullivers Travels
Pride and Prejudice Little Women
Black Beauty Romeo and Juliet
Tom Sawyer Tale of Two Cities
Plus 90 More!
Enjoy the 100 Greatest Books
of All Time and
Never Have to Read a Word!

So simple to use
Just push play and enjoy!