You are on page 1of 31

Note regarding 2007 republication : Source and binary code referenced in note 34 are no longer at that

URL. The same assets are now hosted at http://www.selfmummy.com/mss2dna

Adam Breindel Department of Classics, Brown University May 1998

The Application of a Discrete-Character Parsimony Phylogeny-Inference Algorithm to Classical Text Stemmata

The purpose of this paper is to present two interdisciplinary observations; a new

technique for stemmatic analysis; and preliminary results from an application of this

technique.

The first interdisciplinary observation is that the methods and purpose of

stemmatics overlaps substantially with the methods and purpose of the biological sub-

discipline of cladistic analysis. While this fact is rarely emphasized or exploited, it is not

a new discovery, and its history will be discussed. The second interdisciplinary

observation is that computer software which has been developed for biolog ists in order

to solve problems in cladistic analysis now offers us the possibility of advances in the

construction of textual stemmata, through a non -traditional use of traditional

manuscript collations.

The analytic technique contained herein which does not appear ever to have

been attempted heretofore is the application of an existing cladistic analysis software

package to the stemmatic analysis of a manuscript collation. The use of this technique to

analyze part of the Sallustian corpus is thorough ly documented in this study.

Preliminary results indicate that the technique produces a stemma nearly identical to

Breindel 2

that published by L.D. Reynolds, the editor of the Oxford text. Hence, this method

appears to offer an effective new approach to evaluating the relationships among extant

versions of a text.

The interplay between the disciplines of biological systematics, genetics, and

textual criticism, which makes this paper possible, has a somewhat Byzantine history

spanning the last thirty years. I ask the reader to consider with charity my exposition of

this history. For it seems that the relative uniqueness of this paper demands an

unusually large

Background

amount of background information. 1

In 1968, John G. Griffith published a paper entitled “A Taxonomic Study of the

Manuscript Tradition of Juvenal.” 2 In this study, Griffith applied methods of numerical

taxonomy to the classification of Juvenal manuscripts. The taxonomic methods, as he

explains in a similar article the following year, 3 he had in turn learned from biologist

Robert Sokal‟s 1966 Scientific American article on that topic.

Griffith describes the biological advances which he exploits in analyzing the texts

of Juvenal:

1 I have found it necessary in the course of this paper to refer to some technical aspects of systematics and genetics. I have attempted to restrict to an elementary level the familiarity required with these disciplines, in order to make this work accessible to a broad aud ience. Nonetheless, readers seeking an introd uctory exposition may find appropriate sections of the following textbooks useful:

Gamblin, Lind a and Gail Vines, eds. (1991) The Evolution of Life, Oxford, chapter 3. Maxson, Lind a R. and Charles H. Daugherty (1992) Genetics: A Human Perspective, Dubuque, Iowa, chapters 8, 10. Minkoff, Eli C. (1983) Evolutionary Biology, Reading, Mass., chapter 22.

2 Griffith, John G. (1968) “A Taxonomic Study of the Manuscript Tradition of Juvenal” Museum Helveticum

25:101-38.

3 Griffith, John G. (1969) “Numerical Taxonomy and Some Primary Manuscripts of the Gospels,” Journal of Theological Studies 20:389-406.

Breindel 3

Scientist have long been aware of the limitations of the traditional methods of classifying specimens; biologists in particular have laboured under this handicap. Within the last 10-15 years considerable advances have been made, largely because techniques developed for computer use have enabled specialists in this activity, w ho style themselves numerical taxonomists, to sift with speed and precision large masses of unpromisingly heterogeneous material, and thereby to isolate groups or „taxa‟ of related specimens, on the basis of which further inquiry may be

4

Thus, Griffith identifies a requirement which textual criticism has in common with

taxonomy: in both disciplines, objects must be grouped based on small numbers of

distinctions among vast amounts of similarity. The numeric taxonomy methods appear,

he says, to offer new quantitative approaches applicable to both problems. He then

expresses the hope that we might find associations between specimens by evaluating

large amounts of data with machine assistance. In light of the existing resources,

though, he remarks that “for a textual critic operating with only a few thousand lines of

text it is simply not worth the trouble of programming the data for machine-

processing

5

The limitations to Griffith‟s pioneering approach were unfortunately several. His

procedure was, first, extraordinarily laborious: for the fourteen Gospel manuscripts

analyzed in his article of 1969, up to fifty-six manual recording acts were required for

every variant among one or more of the manuscripts. Thus he was constrained to loo k

at only small samples of the data. Moreover, if he had had access to more data, he may

likely have lacked access to the technology to evaluate it.

4 Griffith, op. cit. 1968, pp. 113-14.

5 ibid.

Breindel 4

Griffith‟s procedure (and, in all fairness, the biological methods with he worked)

had a more troublesome limitation in that they resulted only in associations of objects.

Griffith could assert the distribution of manuscripts into various sub -groups with

statistically-argued accuracy, but the mere grouping of the manuscripts does not seem

to have accomplished much. His methods said nothing about the genealogical

relationships of the manuscripts. For example, if manuscripts A, B, and C are found to

be in a single taxon, we have only formalized their external similarity. As useful as such

formalization might be, little is indicated about the genealogical relationships likely to

inhere between the manuscripts.

Thus, Griffith succeeded in bringing numerical taxonomy into the arena of

textual criticism, but the biological approach upon which he depended was not

ambitious enough to describe the relationships among the specimens and so his textual

techniques appear to have fallen into desuetude.

In 1973, Martin West published a short work on textual criticism, Textual

Criticism and Editorial Technique. 6 In this work, West explains that computers might

theoretically hold some promise for stemma construction, because, under the best

possible circumstances, building a stemma demands only simple logic. Such a stemma

would naturally be an advance over Griffith‟s taxonomic man uscript associations. West

is, however, skeptical about the idea and holds out some theoretical reservations:

If provided with suitable prepared transcriptions of the manuscripts,

purged of coincidental errors, a computer could draw up a clumsy and unselective critical apparatus; and it could in principle where there was

no contamination! – work out an „unoriented‟ stemma. That means

it could work out a scheme simply by comparing the variants, without

that

6 West, Martin L. (1973) Textual Criticism and Editorial Technique, Stuttgart.

Breindel 5

regard to whether they were right or wrong; but this scheme would be capable of suspension from any point [i.e., the scheme could not

distinguish the subarchetypes]

determined by evaluating the quality of the variants, which no machine is capable of doing. 7

The correct orientation could only be

West‟s objections will be considered in detail later, as they are important to the

present investigation. But it is worth noting for now that even if West had wanted to

test a computerized construction of a stemma, there would have been obstacles to his

progress.

First, there would not have been readily available technology for his purpose.

But more importantly, outside of theoretical computer science or mathematical graph

theory, there had not been practical research on automating the construction of

stem mata when the data for the specimens is inconsistent or underdetermined. That is, if the

variants in a set of manuscripts were completely compatible with a unique stemma, we

would need only make the right inferences to generate it. In reality though, there is

usually no stemma which is not inconsistent with at least one locus in the manuscripts;

conversely, if a degree of latitude is allowed so as to overcome such strict

inconsistencies, we find a multitude of possible stemmata. These stemmata we must

distinguish on the basis of some criterion capable of evaluating the likelihood that each

would give rise to the manuscripts as they exist.

Thus, a variety of difficult problems, theoretical and computational, inhere in the

task of mechanically constructing a stemma and they are not problems which

classicists were likely to attack on their own. Fortuitously, however, development had

simultaneously been taking place within the biological disciplines of taxonomy and

7 West, op. cit., pp. 71-2.

Breindel 6

systematics so as to motivate biologists to attempt these same problems. For derivation

of the evolutionary relationships of a group of extant specimens was a key part of the

emergent study now called cladistics.

Biologist Willi Hennig had begun to develop and advocate a strictly phylogenetic

approach to arranging organisms. 8 Hennig‟s view, that the evolutionary relationships of

organisms formed the best foundation for classifying and systematizing them, was and

remains the object of debate. 9 Parts of his theory however, seem to have been adopted

or ad apted by increasing numbers of systematists throughout the 1970s.

The cladistic approach seems intuitively obvious, and G.D.C. Griffiths (along

with many defenders) insisted that it alone had the advantage of relying on objective

fact about the organisms in question (rather than deploying the organisms into classes

invented by humans). Griffiths writes, “[Hennig‟s method] provides the only

theoretically sound basis for achieving an objective equivalence between the taxa

assigned to particular categories in a phylogenetic system.” 10 Unfortunately, what seems

intuitively obvious can also be deceptively fallacious, and cladistics does have a

disingenuous side. It is worth pointing out two objections to the system here, largely so

that the reader may see that th ey do not apply to a textual application of the theory.

8 Hennig might be called the father of modern cladistics; his work was developed and debated in various publications includ ing (1950) Grundzüge einer Theorie der Phylogenetischen Systematik, Berlin. (1966) Phylogenetic Systematics, Urbana, Illinois. (1971) “Zur Situation der biologischen Systematik,” Erlanger Forschungen, R. Siewing ed., Erlangen. 9 For views on the early intellectual positions in the debates, see Ernst Mayr (1976) Evolution and the Diversity of Life: Selected Essays, Cambrid ge, Mass., pp. 435-41. 10 Griffiths, G.D.C. (1972) “The Phylogenetic Classification of Diptera Cyclorrhapha with Special Reference to the Structure of the Male Postabdomen,” W. Junk, N.V., The Hague.

Breindel 7

First, even if we are granted a thorough knowledge of the evolutionary

interrelationships of the specimens in question, no method is thereby presented for

determining the level of descent at which class divisions should be made. We are only

shown that, having made a choice, we are bound to include and exclude certain

specimens.

Second, given three organisms, A, B, and C, suppose that A and B are similar in

form, while C differs greatly from both A and B. Suppose further that A and C are

closer evolutionarily to one another than either is to B. In this situation which is not

uncommon in nature – we would be forced under Hennig‟s system either to class A, B

and C all together, or else to class A and C together against B (Figure 1).

or else to class A and C together against B (Figure 1). Figure 1 Neither of

Figure 1

Neither of these options appeals to our intuition the way that the system at first did. For

A and B appear to form a group as against C, and yet this is precisely the classification

which we are prohibited from making.

These two objections, while having much practical import for the classifying of

organisms, will clearly be irrelevant when we come to apply this method to

manuscripts. First, we needn‟t classify manuscripts by name (and if we do, we accept

that classification as our own production); second, we have no sympathy for similarity

Breindel 8

of appearance between manuscripts if we have hard evidence that they are unrelated in

origin (since it is the origin that is the object of the textual quest).

These cladistic methods of analysis and classification, even if controversial,

prompted research into the creation and evaluation of stemmata (or cladograms) from

incomplete and incompatible data. The cladistic approach depends for a starting point

on determining the evolutionary relationships of the specimens and these

relationships must be assembled from lists of variations among the specimens. Hence,

in a sense, biologists set to work on the problems which had stood in front of Martin

West.

But debate about the philosophical underpinnings of the cladistic methodology

did not subside. In 1977, the methodology attracted a defender in University of

Michigan classicist and zoologist H. Don Cameron, due to cladistics‟ evident similarity

to established techniques in traditional (i.e., not mechanical) textual criticism. 11 Cameron

along with Norman I. Platnick describe the debate, and situate themselves in it, thus:

Recent years have seen an increasing awareness and use among zoological systematists of the theory and methods of phylogenetic analysis (cladistics) developed by Hennig. These methods have been well

defended by [E.O.] Wiley from the point of view of Popperian “hypothetico-deductive” science. Critics, both of the methods themselves

and of their application to classification, have not been silent

purpose of this paper is to point out a fact overlooked during the controversy, namely, that methods analogous to those of Hennig are accepted as the standard tools of analysis in two other fields that resemble

phylogenetic systematics in being primarily concerned with constructing and testing hypotheses about the interrelationships of taxa connected by ancestor-descendant sequences.

The

11 Platnick, Norman I. and H. Don Cameron (1977) “Clad istic Methods in Textual, Linguistic, and Phylogenetic Analysis,” Systematic Zoology 26:380-85.

Breindel 9

The fields referred to are reconstruction. 12

textual criticism

and

linguistic

Cameron and Platnick, writing for an audience of biologists, next summarize the

techniques of textual criticism put forth by Paul Maas. 13 Differences of technique

between biological and textual stemmatics which Cameron and Platnick view as

subordinate to an overarching similarity are described in moderate detail. 14 The paper

is intended to provide a critique of a situation within a discipline of biology, but it

serves also to indicate that these scholars can recognize and make precise the

correspondence between stemma construction and cladistic analysis.

In a conference concluded in 1983, Cameron again presented his view of textual

criticism. The conference had been organized to investigate the biological and cladistic

metaphor in other intellectual fields. 15 Cameron treated stemmatics, but he did not

discuss stemmata as a metaphor from biology, since, as he points out, the stemmatic

methods as used in both fields “were developed by classical scholars systematically in

the nineteenth century and

the origins of the method can be found as early as the

sixteenth century

16 Beyond merely recounting the techniques of Maas, Cameron

explores the distinction as far as it impacts his cladistics-stemmatics comparison

between “vertical” or uncontaminated traditions and “horizontal” transmissions, those

12 Platnick, op. cit., p. 380.

13 Maas, P. (1958) Textual Criticism, Oxford; Platnick, op. cit., p. 381-3.

14 Platnick, op. cit., p. 384.

15 Biological Metaphor Outside Biology (1982) and Interdisciplinary Round -Table on Clad istics and Other Graph Theoretical Representations (1983) symposia at the University of Pennsylvania. Proceedings in Hoenigswald, Henry M. an d Linda F. Wiener, eds. (1987) Biological Metaphor and Cladistic Classification, Philadelphia.

16 Cameron, H.D. (1987) “The Upside-Down Cladogram: Problems in Manuscript Affiliation,” in Hoenigswald, op. cit.

Breindel 10

“full of Byzantine, and even ancient, editing and conjecture.” 17 In the latter cases,

“cladistic methods give little aid.” But in the former, he concludes:

[V]ertical transmission and uncontaminated text tradition make the mechanical application of cladistic methods to reconstruct a single archetype a workable and successful method, with a claim to being scientific

18

Thus, Cameron argues that, at least in a vertical textual tradition, we ought to be able to

use methods from cladistics to derive a stemma and even an archetype.

At this point, the next move for a textual critic might have appeared obvious:

mate West‟s insight about mechanical production of stemmata with Cameron‟s insight

that cladistics provides the theoretical and algorithmic underpinning for West‟s

operation. That is, use cladistic techniques to attack thorny problems of textual

transmission. It is unclear why this approach was not exploited in the 1980s. We might,

however, hypothesize a paucity of tools to support such research.

In the 1980s, three further developments came about which made the project

presented herein more practicable. 19 One breakthrough was improved DNA

sequencing: 20 it became possible to put genetic material from various species into an

automated process and receive, as output, essentially a collation showing every genetic

difference between the samples. 21 More abundant data was now available with which

cladistic analysis could work.

17 Cameron, op. cit., p. 238.

18 ibid.

19 It is im portant to note that none of these three developments sprang fully formed from the head of Zeus in the 1980s. It is convenient to describe them here, as their confluence seems to change the research environment at the time, but research on DNA sequencing, parsimony algorithms, and of course computers had a long prior history.

20 In paticular the development of polymerase chain reaction (PCR) duplication of DNA segments.

21 That is, in the sequenced strands of DNA.

Breindel 11

The second development of this time period was the availability of computers

sophisticated enough to compare and evaluate the thousands or tens of thousands of

possible cladograms (stemmata) which might result from comparing large numbers of

species. That is, computers allowed biologists to overcome that challenge which Maas

had identified for textual critics, when he observed that a large number of specimens or

witnesses would produce an astronomical number of possible stemmata. 22

The last pre-requisite development was software systems to put large quantities

of data (whether from DNA or elsewhere) together with the computers. Software to

compute likely stemmata involves, at its core, algorithms which have been topics in

computer science and mathematics for a half-century or more. Hence, strictly speaking,

appropriate software had probably been “in development” in research universities and

corporate labs for some time. But the early 1980s saw the release of packages designed

specifically for cladistics, tailored to the needs of practicing biologists, and ready to run

on existing microcomputers.

The present experimental study, described below, is an attempt to establish a

stemma for the textual tradition of Sallust‟s De Coniuratione Catalinae using one such

software package, the freely-distributable Phylogeny Inference Package (or, as henceforth,

PHYLIP). 23

22 Maas, op. cit., p. 47: “If we have four wit nesses, the number of possible types of stemma amounts to 250, if we have five, to approximately 4,000, and so on in quasi-geometrical progression.”

23 Felsenstein, J. (1993) PHYLIP (Phylogeny Inference Package) version 3.5c, distributed by the author, Dept . of Genetics, Univ. of Washington, Seattle. See http:/ / evolution.genetics.washington.edu

Breindel 12

Before proceeding to describe the method and outcome of the experiment, it is

appropriate to consider two technical objections which textual critics have put forward

concerning stemma construction.

The first objection is one of M.L. West, printed above. West correctly pointed out

that any stemma derived by algorithm would be an unoriented stemma (or, as the

cladists say, an „unrooted cladogram‟). 24 That is, the algorithm could determine the

branchings of the stemma but could not ascertain which branching belongs “at the

top”(in practice, this amounts to identifying the nodes representing the subarchetypes).

An unrooted cladogram (Figure 2) can represent several distinct rooted versions (Figure

3). Each rooted cladogram can, in turn represent several distinct possible phylogenies

(Figure 4). 25

several distinct possible phylogenies (Figure 4). 2 5 Figure 2. Unrooted cladogram. This cladogram shows the

Figure 2. Unrooted cladogram. This cladogram shows the relationships of the specimens relative to one another, but does not indicate their relationship to ancestors from which they descend.

their relationship to ancestors from which they descend. Figure 3. Rooted cladograms. Each of these five

Figure 3. Rooted cladograms. Each of these five rooted cladograms is consistent with the unrooted cladogram above (Figure 2). By postulating the first branching in the descent, the known relationships specify the remainder of the tree. Note, however, that the lenths of branches, and the specimens which might lie on the nodes of the tree, are not indicated.

24 West, op. cit., pp. 71-2.

25 Humphries, C.J. and P.H. Williams (1994) “Clad ograms and Trees in Biodiversity,” Models in Phylogeny Reconstruction , Robert W. Scotland, Darrell J. Siebert, and David M. Williams, eds., Oxford, pp. 336 -7.

Breindel 13

Breindel 13 Figure 4. Phylogenetic Trees. All four of these phylogenetic trees are compatible with a

Figure 4. Phylogenetic Trees. All four of these phylogenetic trees are compatible with a single cladogram above (Figure 3.ii). Note that schemata involving direct descent are included.

West‟s objection is legitimate. It should not, though, prevent us from pursuing

automated stemma construction, for several reasons. First, the unrooted cladogram is, if

accurate, a great advance over no stemma and an even greater advance over an

incorrect stemma. Second, it may in many cases be tolerably easy to properly root the

cladogram, thus producing a traditional stemma, based on our knowledge of the dates

and locales of origin for the various manuscripts. Third, computer methods are

particularly useful in the frequent circumstance that the collation is not uniquely

compatible with any single proposed stemma. In such cases, we shall be happy to have

an analysis of the entire collation, a most-likely stemma, and a mathematical

justification for excluding many other stemmata.

The second objection is one advanced by Roger David Dawe in studies of the

traditions of Aeschylus and Sophocles. 26 Dawe‟s contention is that there is so much

horizontal transmission in the traditions for these authors, as indicated by numerous

true readings appearing in dependent manuscripts though absent in other manuscripts,

as to invalidate the stemmatic approach. 27 Dawe confronts the methodology of Pasquali

26 Dawe, R.D. (1964) The Collation and Investigation of Manuscripts of A eschylus, Cambridge and (1973) Studies on the Text of Sophocles, 2 vols., Leiden.

27 Cameron, op. cit., p. 237.

Breindel 14

and consequently confronts my method, which derives partly through Pasquali, Maas,

and West at least in the case of individual authors such as Aeschylus. He writes:

We believe that the fact of unique preservation has been demonstrated [in the Aeschylean case]; consequently the fault must lie with the theory of

descent, and we conclude that the

even in the simplest form, the true ch aracter of the

stemma does not after all represent,

It seems clear that the picture presented by the manuscripts is one of a recension so entangled that it is utterly impossible for us to unravel the threads. 28

Cameron summarizes the problems which Dawe‟s assertion poses to an y method such

as the one employed in the present study:

Dawe denies radically that archetypes can be reconstructed, but he necessarily pays a theoretical price for his conclusion

If there are no archetypes or stemmata, and if true readings are uniquely preserved in any manuscript regardless of its stemmatic position, we are then thrown back to a procedure of evaluating readings which is unaided by considerations of outgroup comparison, reconstruction of an archetype, or to push the concept to its logical conclusion, without the consideration of manuscript authority of any kind. 29

In order that we may avoid an imbroglio in Aeschylean Textkritik, we might concede

Dawe‟s assertion to hold true in certain specific textual traditions. But we need not

suppose that any particular number of such traditions invalidates the deductive

stemmatic method in general. Hence, in the absence of any argument against stemmatic

representation of the Sallustian tradition, we can proceed to analyze it via the cladistic

approach.

Experimental Procedure

28 Daw e, op. cit. 1964, pp. 157-8.

29 Cameron, op. cit., pp. 237-8.

Breindel 15

In this study, the manuscripts containing the De Coniuratione Catilinae and the De

Bello Iugurthino were examined, as these two works are found together in one set of

manuscripts. Absent access to a complete collation, an adapted collation was formed by

the following method. Eleven manuscripts were selected from those included in L.D.

Reynolds‟ Oxford text of 1991 (Table 1).

Siglum

Manuscript

A

Parisinus 16025

B

Basileensis

C

Parisinus 6085

D

Parisinus 10195

F

Hauniensis Fabricianus

H

Berolinensis Phillippsianus 1902

K

Vaticanus Palatinus 887

N

Vaticanus Palatinus 889

P

Parisinus 16024

Q

Parisinus 5748

V

Vaticanus 3864 (Florilegium Vaticanum)

Table 1

Beginning at Catilina 1.1, the first 300 loci were selected which contain variants in

one or more of the above eleven manuscripts. 30 The adapted collation was then formed

by listing, for each locus, the groups of manuscripts which exhibited the same reading.

The collation then consisted of a sequence of rows such as appear in Table 2.

Locus:

Group 1

Group 2

Group 3

Group 4

[rows 1-11]

12

ABCDFNP

HK

V

13

C

N

A

BDFHKPV

[rows 14-300]

Table 2

30 To be more precise, in keeping with the biological metaphor, only the latest markings in the manuscripts were collated. Thus, as corrected markings were ignored, loci containing variants in ear lier hands are not included in the 300. The selected loci do, however, include every variant in the last hand (at each locus) of the appropriate manuscript from Catilina 1.1 to 52.35.

Breindel 16

To analyze the collation, the DNAPARS component of the PHYLIP package was to be

employed, because it is the only component of PHYLIP which can process multi-state

discrete characters (albeit by marking the states with DNA labels). 31 DNAPARS is a

program which compares DNA base sequences for a set of specimens and evaluates

various possible cladograms on the basis of a parsimony criterion.

A parsimony criterion favors arrangements of the specimens which require the

fewest character state changes in the course of the specimens‟ evolution. For example, a

phylogeny which requires a specimen possessing a DNA sequence of AAA to give rise

to one possessing ACT and, thereafter, requires the specimen possessing ACT to give

rise to one possessing the sequence AAA again would not be favored. This proposed

phylogeny requires two bases to change state (AA to CT) and later to change again

(back to AA), involving four base changes overall. Instead, a parsimony criterion might

favor an arrangement where one specimen featuring the AAA sequence gives rise to the

other with the AAA sequen ce, and the latter gives rise to that possessing the ACT

sequence. 32 This latter phylogeny requires only a single change of two bases, or two

character state changes overall, and is thus more parsimonious than the former.

Further assumptions involved in the parsimony method, and differing views

about them, are listed (or references provided) by Felsenstein. 33

In order to evaluate the collation using DNAPARS, the collation data had to be

converted from the form illustrated in Table 2 to a form wherein manuscripts grouped

31 See “Frequently Asked Questions,” Felsenstein, op. cit.

32 This phylogeny “might” be favored because one can observe other possible phylogenies with only two character state changes. Such phylogenies would be equally parsimonious with the one given, and hence would be judged equally d esirable by a parsimony criterion.

33 “DNAPARS – DNA Parsimony Program” (documentation) in Felsenstein, op. cit.

Breindel 17

by a shared reading were each assigned a particular DNA base abbreviation (A, C, G, T,

or “-“, which indicates a fifth state to DNAPARS). The DNA base label assigned to a

manuscript at a particular locus would correspond to the group in which t hat

manuscript resided at that locus.

Each row of the collation would yield one DNA base label for each manuscript;

thus the 300 loci in the collation would produced a 300-base “DNA strand” for each of

the eleven manuscripts. The creation and data entry of these 3,300 base labels was

beyond what could easily be accomplished manually. To perform the task, a custom

application program was written (MSS2DNA) which allows the entry of the collation in

table form, performs the translation to sequences of DNA base labels for the various

manuscripts, and mounts the results on the Microsoft Windows clipboard (Figure 5). 34

From the clipboard, the DNA data for the various manuscripts was assembled

with a text editor into the file format required by DNAPARS, as documented by

Felsenstein. 35 In order to facilitate comparison to Reynolds‟ stemmatic work on the

Sallust manuscripts, and because they represent only parts of the text, data for

manuscripts V (a florilegium) and Q were removed from the data file, leaving the nine

m anuscripts for which Reynolds had published a stemma. In removing V and Q, some

27 (i.e., 9%) of the loci were rendered irrelevant, although they remain in the set. 36

34 This program, while not elegant, is publicly available (with source code) so that others may independently conduct investigations or repeat and verify the present investigation. The pr ogram, MSS2DNA, runs on 32-bit Microsoft Wind ows platforms (Windows 95, Windows 98, Windows NT) and may be downloaded in archived (ZIP) form at http:/ / homer.bus.miami.edu/ ~ad breind/ mss2dna.zip

35 “Molecular Sequence Programs” in Felsenstein, op. cit.

36 These data points represent loci at which only Q and/ or V differed from the consensus of remaining manuscripts. These sites can be identified from Appendix B, in the table marked “steps in each site,” as sites where the table shows 0 steps. That is, the r emaining manuscripts show consensus at the site, so no character state changes are required for any phylogenetic arrangement of the manuscripts.

Breindel 18

The completed DNAPARS file appears in this report as “Appendix A: Infile.”

The DNAPARS program was then run, using this file as its data source. 37

was then run, using this file as its data source. 3 7 Figure 5. MSS2DNA. The

Figure 5. MSS2DNA. The columns collect the manuscripts which share a reading at each locus. The column headings indicate the DNA base labels which will be attached to the manuscript groups.

DNAPARS produced the output file which appears in this report as “Appendix B:

Outfile,” and which includes the preliminary phylogenetic tree (Figure 6). DNAPARS

was then run on the input data several more times in order that other possible most

parsimonious trees might be discovered. No other most parsimonious trees were found.

37 The 386-Windows precompiled PHYLIP executables were used throughout. The program options selected for DNAPARS were all defaults with the following exceptions: Randomize order was selected, with a seed of 69 (=4*17+1) and 100 permutations of the input rows; terminal type was set to (none); input sequences interleaved was set to No; and all printing options for the output were selected.

Breindel 19

One most parsimonious tree found:

+--F.Hauniens

+--8

+--7 +--D.Par10195 ! +--6 +-----H.Beroline ! +--------5 +--------K.VatP_887

!

!

!

!

!

+-----------N.VatP_889

+--4

! !

+--C.Par_6085

! !

+--3

--1 +--------------2 +--B.Basileen

!

!

!

+-----A.Par16025

!

+-----------------------P.Par16024

remember: this is an unrooted tree!

Figure 6

In order that the output from this program might be compared to Reynolds‟

published stemma for Sallust, and in recognition of Reynolds‟ judgments about the

quality of the textual variants, the tree was re-oriented using the PHYLIP‟s RETREE

program. Since manuscripts F, D, H, K, and N formed a monophyletic group and

because they had been collected in Reynolds‟ presentation of the Sallust stemma, the

node representing their common ancestor was selected for the outgroup (or

subarchetype). Note that although the tree was re-oriented no changes were made to

the genealogical relationships inferred between the manuscripts by DNAPARS. 38 The

transcript of the RETREE session appears in this report as “Appendix C: RETREE

38 Re-orientation in effect asserts likely positions for the subarchetypes. As described above, West had indicated that such a step would be required, and that it should be conducted using a critic‟s evaluation of the variants.

Breindel 20

Session.” 39 The session also produced as output a new tree file. This tree file was used as

input to PHYLIP‟s DRAWGRAM program, which constructed a graphical

representation of the stemma (Figure 7).

a graphical representation of the stemma (Figure 7). Figure 7 For the sake of comparison, Reynolds‟

Figure 7

For the sake of comparison, Reynolds‟ stemma is reproduced (Figure 8). 40

Reynolds‟ stemma is reproduced (Figure 8). 4 0 Figure 8 As can be observed from the

Figure 8

As can be observed from the computer-generated tree and Reynolds‟ tree

(Figures 7 and 8), they are nearly identical modulo inversion. There are, however, two

39 The program options selected for RETREE were all defaults with the following exception: “no graphics” was selected.

40 Reynolds, L.D., ed. (1991) C. Sallusti Crispi: Catilina, Iugurtha, Historiarum Fragmenta Selecta, Appendix Sallustiana, Oxford, p. xi.

Breindel 21

differences. First, Reynolds associates N and K more closely with each other than with

H, D, or F, while DNAPARS detected no such difference in proximity. Second,

Reynolds associates A more closely with P than with B or C, while DNAPARS indicated

no such closer affiliation. This latter distinction can in fact be attributed to differences in

the text being collated, rather than to differences between the analyses of Reynolds and

DNAPARS (see below).

Analysis

Since several hundred rearrangements of the order of the “DNA strands”

produced no further most parsimonious trees, it seems reasonable to suppose that the

manuscript collation data specify a unique most parsimonious tree. 41 The existence of a

unique most parsimonious tree is itself an indication that the present method may be

productive, as it obviates the need for a human to insert prejudices into the analysis, by

selecting one cladogram from a list of many. The similarity of the results derived

through Reynolds‟ analysis to those derived through the parsimony analysis can, in

light of the novelty of the approach, only be called stunning.

This similarity is further strengthened when we account for one of the two

indicated differences between the stemmata. As described above (see n. 30), in keeping

with the metaphor of biological evolution, only the latest extant markings (corrections,

not including deletions) on each manuscript were collated. Thus, where the first and

41 This supposition is based on Felsenstein‟s implicit assumption that a relatively small number of rearrangements of the input data ought to yield multiple most parsimonious trees if they exist. Such an assertion seems mathematically suspect, considering th e large number of possible permutations of, say, nine manuscripts (over 360,000). On this matter, however, I defer to Felsenstein‟s knowledge as a specialist.

Breindel 22

second hands of A differed, the second hand was read for the collation instead of the

first. Reynolds naturally constructs his stemma indicating the position of the original A

text. But he notes that “Secunda manus (A 2 ) librum lectionibus instruxit ex aliquo stirpis

(A 2 ) librum lectionibus instruxit ex aliquo stirpis [= B, C] codice petitis.” That is,

[= B, C] codice petitis.” That is, where readings exist in A 2 , they come from the B-C

branch which fact DNAPARS appears to have recognized, in asserting the A -A 2

manuscript to descend both from an ancestor of P and also from a closer ancestor of B

and C. To test this hypothesis, we would merely need to modify the collation to reflect

only A-A 1 readings, and then see where DNAPARS places the manuscript.

Having taken the discrepancies into account, it seems that both the human and

the machine-assisted analysis derive results from the same underlying pattern among

the manuscript readings. This study, then, preliminarily suggests that the parsimony

analysis technique could substantively advance knowledge of textual transmission.

Furthermore, the parsimony analysis can indicate the readings likely to appear in

the archetype and subarchetypes, in order that they most efficiently give rise to the

extant manuscripts. A detailed examination of such archetype reconstruction is beyond

the scope of this study. But ambitious readers should note that Appendix B to this

paper (i.e., the DNAPARS output) provides the readings likely to appear at various

nodes in the cladogram for every locus studied. On Reynolds‟ view of the transmission,

the archetype (his

Future Research

Reynolds‟ view of the transmission, the archetype (his Future Research ), ought to bear the readings

), ought to bear the readings given for node 4.

Breindel 23

The future presents a number of immediate challenges and possibilities for the

cladistic analysis of texts using p arsimony techniques. The obvious methods through

which the procedure may be tested include examining a variety of texts, as well as

using full collations in place of collations built from apparatus critici so as to avoid

dependence on one editor‟s opin ion of what may be viable manuscript readings. 42

If positive results are indicated, parsimony analysis might be deployed to assist

the textual critic in determining the relationships of texts, and in reconstructing

archetypes, for new publications. Perspectives may also be presented for re-evaluating

existing dogma about traditions which have not been recently examined. 43 In the

classroom, the use of graphical interactive parsimony programs, which allow one to

manipulate stemmata on -screen and immediately to observe the consistencies or

inconsistencies thus fostered, may facilitate integration of stemmatics into the standard

classics curriculum. 44 Lastly, literary theorists may wish to ponder the existence of

deeper metaphors connecting the enzymes and mutation s of DNA replication with the

corresponding verbal agents and scribal errors giving rise to many of our textual

variants.

42 “Readings which must quite certainly be eliminated have no place under the text,” writes Maas ( p. 23), thus giving editors license to omit even from the app. crit. those read ings deemed eliminanda.

43 We may suppose that parsimony analysis will be effective in evaluating relationships between manuscripts of texts in modern, as well as ancient, langua ges.

44 MacClade (distributed by Sinauer Associates) is one such program. Many candid ates which might be useful for heavy-duty analysis as well as pedagogy are described by Felsenstein at http:/ / evolution.genetics.washington.edu/ phylip/ software.html

Appendix A: Infile

9 300

P.Par16024AAACCCCCCCAATACCCCCCAACGCCCACACCCAACCACCACCCCCACGACGGAAACCCCCCGCCCCCCACCACAC

CACACCCCCCACCCAACCCATACCACCAAACACACGCCCCCGCCACACGACGGCACACACCCCACACAACAC-

CTCACCCACAACCCCCCCCACCACCCAACAAACCGCCCAAACCCACACCCCCACCACCCAACCCCCACCCCACACCCCCACAAACC

CCCCACCTACCCCCCCCCACCAGCCCCACCAACCAAACCAACCCCCGAACCACCCCCACCCCCCA

A.Par16025CCACACCCCACAGCCCCCCCACCGCACCCCCCACCCCCCCCCCCCCCCATCGAACCCGCCACGCCCCCCGCAACCC

CCCCCCCCCCCACACTCCCCACCACCCACACCCCCGACCCAAACCAAAAACGGCCCCCCCCCCACACCCCCCCCAC-

CCACCCAAAACACCCACCCCCCCACACCCAACCAACAAAACCACCCCCCCCAACACCCCCCACCACCCCCCCACACCCCCCAAACA ACCCACCCCCACCCCCCCGCCCCACCCACCACCCCACACCCCGACCCCACCCCGACACCGC B.BasileenAACCCCCCCAAATCACCCCCAGCGCCCACACAACCCCCACACCCCCGCCCCGGAACCCCCCCCCACCACCCCCCCC CCCCCCCCCCCACCATACCCAACGAACAAACCCCCGAACCACACACAACCCGGACACCGCCCCACACCCCCCACCACCCACCCCCA ACCCCCACACCCCACCAGACAACCACCCCCCCCACCCCCCCCAACCCCCCCCCCCCAACCCCCCCCCCCCCCCCGCCCACCCCCCC CACCACCCCGCACCACCCACCGCCCCACCCCCCGACCCCCCCCCCACACCGA

C.Par_6085AAACCCCCCAAAACACCCCCAGCGCACCCCCAACCCCCCCCCCCCCGCACCGGACCCCCCACACACCACTCAACCC

CACACCCCCCCACACTCCCCTACGCCCACACCCCCGCACCACACAAAACCCGGCCACCCCCCCACACCCCCCCCCACCCACCCCCA ACCCCCCCCCCCCCCCAGCCACCCACCCCCAACACCCCCCCCACCACCCCCCACCCCAACACACCCCCCCCCCCGCCCCCCCCCCC CACCCCCCCGCCCCACCCACCACCCCACCCCCCGACCCCACCCCGACACCGC

N.VatP_889CAACCCAACCCACACCACAAACCGCCCCACCCCCCAAAACACCCCCAAGGCAGCCCCACACAAACCCCCACCACCC

CCCCCAACCCCACCCGCCCCACAAAGAACCCACCCGCCCCCGCCCCCAGCAGGCGGCCGACACCACCCCCCAGCGCCCCCCCCCCC

AACCCCCCCCCCCCCCAGACAGCACACACCCAACACCCCCCCAACACCCCCACACCCCACCCCCCCCCCCAACCACAACAACCACC

CCCCCCCCAGCCCCCCCAACCACCCCCCCCCCCCCCCACCCCCCGCAGCCGC

K.VatP_887ACCCCCCACCCCTCCAACCAAGCGCCCCCCCCCCCAAAACACCACAAAGGAGGCCCCCCCACGACCCCCGCCGCCC

CCCCCCCCCACCCCGGACCCCACAAGACCCACCCCACACACGCCACCCGCAGAGGGCCCACACCACCCACCATCCCTCCACCCCCC

ACCACACACCCCCAACAGCCAGCCCCCCCCCAACCCCACCACAACCCACAAACCCCCCCCCCCCCCCCCCCACCACCCAACACACC

CCCACCCAAGCCCCACCACCCCCACCCCCCCCCGCCCACCACCCACCACCGC

H.BerolineAACCCACCACACTCCCCCCACGACCCCCACCCCCCCACACGCCCCAAAGCCGGACCCCACCGGCCCCACCACCCCC

CCCCCCCCCACACCCTACCCGCCTAGCCCAACCCACCCACCGCCCCCAGCCGGACTCCCCAACCCCCCGCCATCCC-

CCACCCCCAACCACACCCCACCACAAGACAGACCCCCCCCCCACCCCCCAAGCCCAAAAACAGACCAACCCCCACCCCCCCCCCCC CAC-GCCCCCCCACCCCCACACCCCCACCAGCCCCACCCACCGCCCCCCCCCAACCTCCGC

D.Par10195CACACACCACCATCCACACAATCACCACCCACCCCCAAACGACAAAACGGACCCCCCCCCCAGACAAACACCCACC

CCCCACAACACCCCTCAAACGCCAAGCCCCACACAACCAACGCCCCCCGCACCGGGCCACAAACCCCCCCCAGCCCGCCCCACCCA

CCCCAACAACAACGAAAGCAAGCCCCCCCCCACCCAACCCAACCCAAAAAACCGACCAACCACCACCCCCCCCCCCCCACGCCCAC

CCCACCACCCCACACCCACCAGCAAACACCCAAGCCCCCCCACCCCCACCAC

F.HauniensCACACACCCACATCCAAACCAGCAACACCCACCCCCAACAAAACAAACGGACCCCCATCCCACACAAACACACACA

CCCCACAACCCACCTGAACCGGCAAGCCCCCCACCACAAACGCACCCCGCCAGTGTCCGCACACCCCACCCAGCCCGCCCCACCCA

CACAAACACCAAAGAAAGCAAGCCCCACCCCACGCAACACAACCCCAAAACCCCAACACCCACCACCCCCCCCCCACCACGCCCAC

CACAACACCCCACCCCCACCAGCCAAGACCAAAGCCACCCCACCCCC-ACAC

Breindel 25

Appendix B: Outfile

DNA parsimony algorithm, version 3.572c

Name

Sequences

 

----

---------

P.Par16024

AAACCCCCCC AATACCCCCC AACGCCCACA CCCAACCACC ACCCCCACGA CGGAAACCCC

A.Par16025

CC

A

A

C.GC

.C

A.C.C

ACC

C

C

C.AT

A.CC.G

B.Basileen

C

A

CA

.G

.AACC

CA.

G.CC

C

C.Par_6085

A

ACA

.G

A.C.C

.AACC

C

C

G.AC

CC

N.VatP_889

C

AA

C.C

A.AA

.C

CAC

 

CCAA.A.

A.G

.A.CCC.A.A

K.VatP_887

.CC

A

CC.C.AA

A

.G

C.C

CCAA.A.

A.A.A.G

A

CCC

H.Beroline

C

A

A.

.C.C

A

CGAC

CAC

 

G

A.A.C

CC

A.

D.Par10195

C.CA.A

 

A.

C

C.A.A.A

.T.A

AC.C

A

CC.A.A.

GA.AAA

G

ACCCCC

F.Hauniens

C.CA.A

A

C

C.AAA

.G.AA.AC.C A

CC.A

A

.AA.AA

G

ACCCCCAT

P.Par16024

CCGCCCCCCA CCACACCACA CCCCCCACCC AACCCATACC ACCAAACACA CGCCCCCGCC

A.Par16025

A

G

.A

C

C.C

CA.A

CT

CAC.A

C

C

C.C

A

AAA.

B.Basileen

C.A

 

A.C

C.C

C.C

CA

 

.TA

CA

G

.A

C.C

AA

ACA.

C.Par_6085

A.A.A

A.T

.A

C

CA.A

CT

C

G

C

C

C.C

A

ACA.

N.VatP_889

.AAA

C

C.C

.AA

CA

 

CG

CACAA

.GA.CC

C

K.VatP_887

A

A

G

G.C

C.C

AC

GGA

CC

A

.GACCCAC.C .A.A.A

 

H.Beroline

.G

A.C

A.C.C

C.C

ACA

 

CTA

CGC.T

.G.CC.AC.C AC

A

D.Par10195

.A.A.AAA

 

CAC

C.C

A.AA.AC

 

TCAAACGC.A .G.CCCACAC AA

AA

F.Hauniens

.ACA.AAA

.ACACA.C.C A.AA

CA

 

TGAA.CGG.A .G.CCC.CAC .A.AAA

 

A

P.Par16024

ACACGACGGC ACACACCCCA CACAACAC-C TCACCCACAA CCCCCCCCAC CACCCAACAA

A.Par16025

CA.AA

 

C.C.C

CC.C.C.

A.-

AC.C.

AAA.A

 

.C

C

C

B.Basileen

ACC

 

A

CAC.G

CC.C.A.

CAC

AC.CC

.AA

AC

C

G

C.Par_6085

.A.ACC

 

CAC.C

CC.C.C.

CAC

AC.CC

.AA

C.

.C

CC

G

N.VatP_889

C.CA.CA

 

GGC.GA.A.C AC.CC.CAG. G.C

C.CC

AA

C.

.C

CC

G

K.VatP_887

C

CA.AG

GGC.CA.A.C AC.C

CAT.

C.T

AC.CC

A

A.ACA

.C

G

H.Beroline

C.CA.C

 

A

CTC.C.AA.C .C.CG.CAT. C.-

AC.CC

.AA

A.AC.

.CA

CA.G

D.Par10195

C.C

CACCG

GGC

AAAC

.C.CC.CAG. C.G

CACC

.A

AACA

ACAA.G.A.G

F.Hauniens

C.C

C.A.T

GTC.G.A.AC .C

C.CAG.

C.G

CACC

.A.A.AAACA .CAAAG.A.G

P.Par16024

ACCGCCCAAA CCCACACCCC CACCACCCAA CCCCCACCCC ACACCCCCAC AAACCCCCCA

A.Par16025

C.AA

A.C.

AAAC

.C

A.ACC

 

AC.A

C.C

A.AC.

CCC.AAA.A.

B.Basileen

AA

ACCC

C

.C

A

CC

C

AA

C.C

C.

CCC

G

C

C.Par_6085

C.AC

ACCC

A

.C

ACC

 

AC

A

A

C.

CCC

G

C

N.VatP_889

A

A

C.

ACA

 

.C

A.ACC

A

C

C.

CC.A

A.A.

K.VatP_887

C.A

CCC

AC

A

.CA

A

C.

.AAA.C

 

C.C

C.

CCCA

A

C

H.Beroline

A.A

 

CCC

C

.CAAG

AAA.AGA

A

C

A.C.

CCC

C

D.Par10195

CAA

CCC

C.AA.

.CAAC

A

AAA

GA

A

CA

A.C.

CCC

C

F.Hauniens

CAA

C.C

G.AA.

ACAAC

AA

CAA.A

C.CA

A.C.

CCC

A.C

P.Par16024

CCTACCCCCC CCCACCAGCC CCACCAACCA AACCAACCCC CGAACCACCC CCACCCCCCA

A.Par16025

C

A

C

C

C

CC

CA

C

CA

GA.A

GC

B.Basileen

A.CC

A

AC

C

A

C

G

CC

C

C

C

CA.A

G.

C.Par_6085

CC

A

C

C

C

CC

C

C

CA

GA.A

GC

N.VatP_889

.AAC.A

 

C

C

CC

CC

.CCC.AC

G.AG

GC

K.VatP_887

AAC

A

.A.C.A

C

C

C

CC

CC.AC.A.

A

GC

H.Beroline

A.-G

.A.C

CA.A

C

C.AG

CC

C

A.

CC

C

.A

T

GC

D.Par10195

A.GC

A .A.CA.CC.A .AC

C.AG

C.AAC

A

A.CC

C

A

C

A

AC

F.Hauniens

A.GC

A .AACA.CC.A

A

C

C.AG

CCAAG

AA

A.CCA.C

A

C

-A.AC

Breindel 26

One most parsimonious tree found:

+--F.Hauniens

+--8

+--7 +--D.Par10195 ! +--6 +-----H.Beroline !

+--------5 +--------K.VatP_887

!

!

!

!

!

+-----------N.VatP_889

+--4

! !

+--C.Par_6085

! !

+--3

--1 +--------------2 +--B.Basileen

!

!

!

+-----A.Par16025

!

+-----------------------P.Par16024

remember: this is an unrooted tree!

requires a total of

500.000

steps in each site:

0

1

2

3

4

5

6

7

8

9

*-----------------------------------------

0!

3

2

2

1

1

1

1

2

2

10!

2

3

2

3

2

1

2

3

1

1

20!

2

1

4

1

2

1

2

1

2

2

30!

2

1

1

1

1

1

2

1

2

3

40!

1

4

1

1

2

1

1

2

2

2

50!

4

2

2

2

2

2

1

1

3

1

60!

1

3

3

4

2

1

1

1

2

0

70!

5

1

3

3

1

1

1

0

2

0

80!

2

1

1

2

1

0

2

1

3

0

90!

2

4

4

2

1

1

1

4

4

1

100!

3

2

2

2

1

2

2

2

2

1

110!

1

2

2

2

3

1

2

1

2

1

120!

1

3

2

1

3

2

2

3

2

2

130!

4

3

4

1

0

5

2

1

2

1

140!

1

2

1

0

2

3

0

1

1

5

150!

0

3

1

5

0

0

3

1

1

1

160!

2

1

2

2

2

1

2

1

1

2

170!

2

2

1

1

1

1

4

3

1

0

180!

2

4

1

1

2

1

1

1

2

2

190!

2

1

1

2

3

2

3

1

1

1

200!

1

1

1

1

1

2

3

0

4

2

210!

2

1

1

2

2

3

4

1

2

1

220!

2

4

0

2

1

1

1

1

1

1

230!

0

1

1

2

2

1

1

3

1

2

240!

2

2

2

4

4

0

2

1

0

0

250!

2

0

1

2

1

1

1

2

2

0

260!

2

0

1

2

0

0

1

1

0

1

270!

3

1

3

1

1

3

2

1

0

2

280!

1

1

1

1

1

1

2

1

2

1

290!

1

0

1

4

1

1

4

1

0

2

Breindel 27

From

To

Any Steps?

State at upper node ( . means same as in the node below it on tree)

 

1

AAACCCCCCC MATMCCCCCC AVCGCCCMCM CCCMMCCACC

1

4

maybe

.S

C.C

CC

4

5

yes

M

C

M

A

MA.A.

5

6

yes

C

.M.C.M

.G

6

7

yes

A.CM.

 

V

C

7

8

yes

C

A

.A

A.A

A

A

A

8

F.Hauniens

yes

CA

A

C

A

CA

8

D.Par10195

yes

A.

C

.T

7

H.Beroline

yes

A.

AC

CC

C.AC

 

A.

C

6

K.VatP_887

yes

.C

A

.C

AA

A

5

N.VatP_889

yes

C

AA

CA

A.A.

.C

A.

A

4

2

yes

A

C

M

A

C

2

3

yes

A

A

.G

.A

3

C.Par_6085

yes

A

A

3

B.Basileen

yes

C

C.A.A

A.

2

A.Par16025

yes

CC

A

C.G

.C

A

1

P.Par16024

maybe

A

A

.A

A.A

AA

 

1

ACCCCCACGN CGGAMMCCCC CCGCCCCCCA CCACMCCMCM

1

4

maybe

CC

 

C

C.C

4

5

yes

A.G

C

.M.A

 

5

6

yes

A

M

V

6

7

yes

R

.V

A

C

7

8

yes

.A

A

C

ACC

.A

AA

A

8

F.Hauniens

yes

A.A

 

AT

C

.A

A

8

D.Par10195

yes

G

A

7

H.Beroline

yes

G

C

C

A

A.

.G.C

 

C

A

6

K.VatP_887

yes

A

A

AC

G

G

5

N.VatP_889

yes

.A

A.A

.AA

 

4

2

yes

M

V.A.

 

M

N

.M

2

3

yes

G

C

V.A

A

3

C.Par_6085

yes

C

A.A

 

T

.A

A.A

3

B.Basileen

yes

A

C.

A

C.C

C

.CC

2

A.Par16025

yes

C

C

T

A

G

A

G

.A

1

P.Par16024 maybe

 

A

AA

 

A

A.A

 

1

CCCCCCMMCC MDCCCMWMCM ACCAMACACM CGCCCCCGCC

1

4

maybe

CA

C

CA

A

C

M.C

4

5

yes

.G

.GM

C

5

6

yes

A

A

V

C

AC

.A

M

6

7

yes

GC

C

M

A

7

8

yes

A.AA

 

T

A

A.

A

8

F.Hauniens

yes

C

G

C

C

A

A

8

D.Par10195

yes

C

.C

A

A

7

H.Beroline

yes

.T

T

A

AC

C

6

K.VatP_887

yes

C

G

CA

A

A.A

5

N.VatP_889

yes

.AA

 

CA.

A

A

4

2

yes

M

.T

M

C

M

AVA.

2

3

yes

A.G

A

C

3

C.Par_6085

yes

A

T

C

C

3

B.Basileen

yes

C

A.A

AA

A

A

2

A.Par16025 maybe

 

A

C

C

A

A

1

P.Par16024 maybe

 

AC

AA

ATA.C

A

A

 

1

MCAMGMCGGC VCMCMCCCCA CACMMCMC?C YC?CCMMCMM

1

4

maybe

C.C

CC.C

C.?

C.C.

4

5

yes

C

CM

GG

M.A.C

MC

A

C

5

6

yes

G

K.

?

6

7

yes

C

.K

CA

C

Breindel 28

7

8

yes

C

V

V

A.

G.

G

C.A

8

F.Hauniens

yes

CA.T

.T

G

C

A

8

D.Par10195

yes

ACC.

.G

A

7

H.Beroline

yes

A

C

A

CT

G

T.

-

A

6

K.VatP_887

yes

A

C

A.A.

 

A

A

A

T.

T

A

5

N.VatP_889

yes

C

A

A

GA

 

A

G.

G.C

C

4

2

maybe

.M.AV

 

C

C.

A

2

3

yes

A

CC

.A

.AC

C

3

C.Par_6085

maybe

.A

3

B.Basileen

yes

.C

A

G

A.

2

A.Par16025

yes

CA

AA

A.-

A

1

P.Par16024 maybe

A

C.A

A.A.A

 

AA.A.-.

T.A

CA.AA

1

CCMCCCCCAC CMCCCMACAR MCMGCCCAMA CCCACACCCC

1

4

maybe

A

.C

G

A

C.

4

5

yes

C.

MC

 

5

6

yes

A.A.M

 

A

C.C

6

7

yes

.A

A

A

C

7

8

yes

C

A

A

A.G

 

CA

AA.

8

F.Hauniens

yes

A

A

A.

G

8

D.Par10195

yes

C

A

7

H.Beroline

yes

C

C

A

A

C.A

 

6

K.VatP_887

yes

A

C

A

A

5

N.VatP_889

yes

A

CC

A

A

A.A

4

2

yes

.A

A

A

MM

2

3

yes

C

C.C

3

C.Par_6085

yes

C.

C

C

C

AA

3

B.Basileen

yes

A

A

A

CC

2

A.Par16025

yes

A

A

C

C

C

AAAC

1

P.Par16024 maybe

C

.A

A

A

A.C

A.

1

CMCCAMCMMM CCCCCMCCCC ACMCCCCCMC MMACCCMCCA

1

4

maybe

.C

A

C.

C

C.