Volume 2 • Issue 1 • 1000105

J Gastroint Dig Syst
ISSN: 2161-069X JGDS, an open access journal
Gastrointestinal & Digestive System
Vafaeimanesh et al., J Gastroint Dig Syst 2012, 2:1
http://dx.doi.org/10.4172/2161-069X.1000106
Research Article Open Access
Molecular Detection of Helicobacter Species and Other Bacteria in Human
Bile Samples of Patients with Biliary Diseases
Jamshid Vafaeimanesh
1
, Masoud Alebouyeh
2
, Mohammadreza Seyyedmajidi
2
*, Elahe Tajeddin
2
, Somayeh Jahani Sherafat
2
, Elahe
Zanganeh
2
, Amirhoushang Mohammadalizadeh
2
and Mohammadreza Zali
2
1
Department of Internal Medicine, Qom University of Medical Sciences, Qom, Iran
2
Research Center for Gastroenterology and Liver Disease, Department of Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran,
Iran
Abstract
Background & study aims: Bacterial infection is accepted as a precipitating factor in gallstone formation and
recent studies have revealed the presence of Helicobacter species in the biliary system. The aim is to determine
whether bacterial infections could be detected in bile obtained at ERCP and to evaluate the prevalence of these
infections in patients with biliary diseases.
Patients & methods: 102 consecutive patients undergoing ERCP for various indications at Tehran Taleghani
Hospital were asked to participate in this study. Bile juice was aspirated after selective cannulation of the common bile
duct and stored at -20°C. Each of the patient samples had been tested by PCR on 16s rRNA region and RFLP-DGGE
for bacterial infections.
Results: Helicobacter DNA was detected by PCR in bile samples 2 out of 74 with gallstone diseases, 1 out of 15
pancreatobiliary malignancies and 1 out of 13 other benign biliary diseases (p=0.582). Direct sequencing confrmed
strains of H. pylori in all four bile samples. Bacteria were detected by the amplifcation of 16s rRNA 43.2% in gallstone
diseases, 53.3% in pancreatobiliary malignancies and 53.8% in other benign biliary diseases (p=0.646).
Conclusion: E.coli, Enterococcus, Klebsiella, Pseudomonas, Acinetobacter and H. pylori were found in the biliary
system, suggesting that these bacteria are of etiological importance in gallstone formation and other biliary diseases.
*Corresponding author: Mohammadreza Seyyedmajidi, Department of Gastroen-
terology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Teh-
ran, Iran, Tel/Fax: +98 21 22418885; E-mail: mrsmajidi55@yahoo.com
Received January 04, 2012; Accepted March 24, 2012; Published March 26,
2012
Citation: Vafaeimanesh J, Alebouyeh M, Seyyedmajidi M, Tajeddin E, Sherafat
SJ, et al. (2012) Molecular Detection of Helicobacter Species and Other Bacteria in
Human Bile Samples of Patients with Biliary Diseases. J Gastroint Dig Syst 2:106.
doi:10.4172/2161-069X.1000106
Copyright: © 2012 Vafaeimanesh J, et al. This is an open-access article
distributed under the terms of the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided
the original author and source are credited.
Keywords: Biliary disease; PCR; RFLP-DGGE; Bacterial infection;
Helicobacter
Introduction
Detection of microbial agents is an important impress in diseases
pathogenesis. Bacterial infections play a principal role in the formation
of brown pigmented and pure cholesterol gallstones depends on
cholesterol saturation and solubility. Consequently, bacterial infection
is now accepted as a precipitating factor in the pathogenesis of mixed
cholesterol gallstones. Attempts to culture potentially causative bacteria
from gallstones have failed because the formation of gallstones takes a
very long time, thus bacteria might be damaged or killed [1]. Swidsinski
et al. [2] identifed E. coli and Pseudomonas in cholesterol gallstones
using PCR and these bacteria were suggested as the pathogens in
cholesterol gallstone formation by Lee et al. [3].
Helicobacter pylori (H. pylori) is a Gram-negative, spiral-shaped,
motile micro-organism that plays a causative role in the pathogenesis
of chronic gastritis, peptic ulcer disease, development of gastric
adenocarcinoma and mucosa-associated lymphoid tissue lymphoma
in humans. Although H. pylori is recognized as a pathogen associated
with gastric lesions, recent studies have revealed the presence of
several Helicobacter species in the hepatobiliary system [4-7]. In
animals, Helicobacter species have been isolated from sites including
the gastrointestinal tract, liver and biliary tree. H. hepaticus and H.
bilis have been detected in liver tissue from mice with chronic active
hepatitis and hepatocellular cancer [2,3]. Similarly, H. canis has been
isolated from the liver of a dog with multifocal necrotizing hepatitis [8].
Kawaguchi et al. [9] demonstrated a microorganism resembling H.
pylori in a resected gall-bladder specimen by H. pylori urease B gene and
immunohistochemical staining and bile-resistant hepatic Helicobacter
species such as H. bilis, H. pullorum, and F. rappini were extracted from
gallbladder mucosa and bile juice of patients with chronic cholecystitis,
suggesting that these agents may be key elements in the development
of various biliary diseases, especially cancer [10]. H. pylori DNA in
gallstone was detected by PCR in several reports [11-13]. Te discovery
of H. pylori in bile juice has led to the suggestion that Helicobacter
species are etiological agents in gallstone formation [14-16]. However,
one study in Germany reported no association of Helicobacter species
with gallstone formation suggesting possible regional and ethical
diferences [17].
Te16s rRNA is the most conserved (least variable) gene in all cells.
Portions of the rDNA sequence from distantly-related organisms are
remarkably similar. Tis means that sequences from distantly related
organisms can be precisely aligned, making the true diferences easy
to measure. For this reason, genes that encode the rRNA (rDNA)
have been used extensively to determine taxonomy, phylogeny and to
estimate rates of species divergence among bacteria [18].
Te aim of this study was to determine the frequency of bacterial
infection using PCR and DNA sequencing in bile obtained from
endoscopic retrograde cholangiopancreatography (ERCP) and the
evaluation of the potential pathogenic role of Helicobacter species in
biliary diseases in Iranian patients.
Volume 2 • Issue 1 • 1000106
J Gastroint Dig Syst
ISSN: 2161-069X JGDS, an open access journal
Citation: Vafaeimanesh J, Alebouyeh M, Seyyedmajidi M, Tajeddin E, Sherafat SJ, et al. (2012) Molecular Detection of Helicobacter Species and
Other Bacteria in Human Bile Samples of Patients with Biliary Diseases. J Gastroint Dig Syst 2:106. doi:10.4172/.1000106
Page 2 of 5
Patients and Methods
Clinical subjects
102 consecutive patients (≥18 years) undergoing ERCP for various
indications at Tehran Taleghani Hospital were asked to participate in
this study from March 2010 to September 2011. Subjects were excluded
if they were taking antibiotics during the previous four weeks. Patients
with history of recent pancreato-biliary infections (≤6 months), renal
and hepatic impairment were not enrolled. All patients signed an
informed consent form. Tis research was approved by the Ethical
Committee of Research Center for Gastroenterology and Liver Disease
in Shahid Beheshti University of Medical Sciences.
Patient demographics and diagnoses were recorded and bile was
collected by aseptic aspiration afer selective cannulation of the common
bile duct. Bile samples stored at -20°C and each of the patient samples
will be tested by 16s rRNA universal and specifc PCR for bacterial
identifcation. Te frequencies of 16s rRNA will be confrmed by
sequencing and identifcation of the bacterial genus will be determined
by RFLP-DGGE (Restriction Fragment Length Polymorphism &
Denaturing Gradient Gel Electrophoresis).
DNA extraction and amplifcation
1 mL of each bile samples was pelleted by centrifugation for
15 minutes at 14,000 rpm. Ten DNA was extracted with phenol-
chloroform. To amplify DNA of eubacteria and Helicobacter species
from the bile samples, the PCR method was used. To obtain higher
amounts of DNA, the products were re-amplifed with nested PCR
primers (Tables 1,2). Primer set 27F/1492R was used in separate
reactions to amplify extracted rRNA genes. Te PCR products were
denatured at 94°C for 5 minutes, elongated at 30 cycles of 94°C for 30
seconds and 56°C for 30 seconds; and a fnal extension of 72°C for 10
minutes.
Final nested PCR products were electrophoretically separated in a
1% agarose gel, then the DNA band from the agarose gel was cut by
Sma I (from Serratia marcescens S) enzyme (Roche, Germany) and
stained with ethidium bromide. Resulting sequences were compared
to databases accessed through the NCBI (National Center for
Biotechnology Information) server.
Statistical analysis
Statistical analysis was performed with Chi-square test as well as
Fisher’s exact test, and one-way analysis of variance (ANOVA) test. P
values of 0.05 or less were considered statistically signifcant. All the
data were analyzed using SPSS 16 for Windows (SPSS Inc., Chicago,
IL, USA) and the values were expressed as mean ± standard deviation
(SD) for continuous variables and percentages for categorical variables.
Results
One hundred and two patients were included in this study. Fify-
two patients (50.98%) were female, and the age ranged from 18 to
92 years (mean, 59.5 ± 16.6 years). Te diagnoses of these patients
are listed in table 3. We divided the patients in 3 groups based on
diagnosis; Group A: 74 patients (72.6%) with stones including CBD
(Common Bile Duct) stones only, Gallbladder and CBD stones and
microlithiasis. Group B: 15 patients (14.7%) with malignancy including
cholangiocarcinoma, ampullary carcinoma, pancreatic carcinoma and
duodenal adenocarcinoma. Group C: 13 patients (12.7%) with other
benign diseases including SOD (Sphincter of Oddi Dysfunction)
and PSC (Primary Sclerosing Cholangitis). Tere were no statistical
diferences among the study groups in age, gender and body mass index
(BMI) (Table 3).
Bacterial DNA was detected in 47 (46.1%) of 102 samples of bile
juice by PCR assay (Figure 1). Additional PCR assays were done on
the 47 positive bacterial DNA bile samples using Helicobacter genus-
specifc primers. Four samples had positive PCR for Helicobacter
species (Figure 2). Helicobacter pylori-specifc primer pairs HPF and
HPR were used to identify H. pylori by PCR, and generate amplicons
of approximately 296 bases for H. pylori ureC genes (glm region) in 4
samples positive for Helicobacter 16S rRNA (Figure 3). All of them (4 of
4) were positive for H. pylori ureC genes (glm). For detection of diferent
bacterial isolates, molecular typing with RFLP-DGGE method was done
in 47 positive bile samples for bacterial DNA (Figure 4) and 51 bacterial
isolates were found in 47 positive samples (Table 4), including E.coli
(20.6%), Enterococcus (11.7), Klebsiella (9.8%), Pseudomonas (9.8%),
Acinetobacter (3.9%) and H. Pylori(3.9%). Tere was no diference in
the identifcation of bacterial DNA and Helicobacter species among the
groups based on diagnoses (Table 4).
Seventy-four gallstones were classifed by their gross appearance
and composition of cholesterol, resulting in 63.5% cholesterol
gallstones, 31.1% black pigmented stones and 5.4% brown pigmented
stones. Tere was no diference in the isolation of bacterial DNA and
Helicobacter species among the groups based on gallstone composition
(Table 5).
Primers name Primer sequence (5’to3’) Size (bps)
R
CCGTCAATTCTTT-
GAGTTT
~1500 bp
GM5F-G-C-clamp
G-C-clamp-ACGGGAG-
GCAGCAG
~1172 bp
G-C-cl amp: 5’ -CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAC-
GGGGGG-3’
Table 1: Primers for Bacterial 16S rRNA.
Bacterial Primers Primer sequence (5’to3’) Genes
Size
(bps)
Helicobacter
species
F GGCTATGACGGGTATCCGGC
R GCCGTGCAGCACCTGTTTTC
16S
rDNA
764
H.pylori
F GGATAAGCTTTTAGGGGTGTTAGGGG
R GCTTACTTTCTAACACTAACGCGC
ureC
(glm)
296
Table 2: Primers for Helicobacter species.
Diagnosis n Female (%) Age(years) BMI(kg/m2)
Group A: Stones
CBD only
Gall-bladder & CBD stones
CBD microlithiasis
74
19
44
11
41 (55.4%)
14 (73.6%)
23 (52.2%)
4 (36.3%)
60.8 ± 16.7
57.1 ± 17.3
62.8 ± 16.3
58.9 ± 17.7
23.38 ± 2.49
23.67 ± 2.93
23.40 ± 2.35
22.84 ± 2.33
Group B: Malignancy
Cholangiocarcinoma
Pancreatic carcinoma
Duodenal adenocarcinoma
Ampullary carcinoma
15
6
6
1
2
4 (26.7%)
2 (33.3%)
1 (16.7%)
0
1 (50%)
60.8 ± 14.5
62.8 ± 9.2
63.5 ± 16.3
75.0
40.0 ± 8.4
22.21 ±1.92
21.75 ± 1.85
21.92 ± 2.19
23.91
23.57 ± 1.55
Group C: Other Benign
Dis.
SOD
PSC
13
8
5
7 (53.8%)
6 (75%)
1 (20%)
50.4 ± 16.7
56.5 ± 18.1
40.8 ± 8.4
23.90 ± 1.74
24.32 ± 0.98
23.22 ± 2.55
p. value - 0.124 0.111 0.270
Total 102 52 (50.9%) 59.5 ± 16.6 23.28 ± 2.36
Table 3: Diagnoses and characteristics of study subjects in different groups.
Volume 2 • Issue 1 • 1000106
J Gastroint Dig Syst
ISSN: 2161-069X JGDS, an open access journal
Citation: Vafaeimanesh J, Alebouyeh M, Seyyedmajidi M, Tajeddin E, Sherafat SJ, et al. (2012) Molecular Detection of Helicobacter Species and
Other Bacteria in Human Bile Samples of Patients with Biliary Diseases. J Gastroint Dig Syst 2:106. doi:10.4172/2161-069X.1000106
Page 3 of 5
Discussion
Te biliary system is thought to be sterile but this sterility could
be broken under certain conditions. Two major routes of infection are
ascending through the sphincter of Oddi and descending through the
portal system [19,20]. For example, bacterial infection was found in
bile (20%) and the liver (17%) on post-operative individuals without
any hepato-biliary abnormalities. Also, patients underwent non-biliary
abdominal surgery had a 32% positive rate of bacterial infection in their
portal blood [21,22]. Leung et al. [23] found bacteria in 84% of the inner
cut surface of the pigmented gallstones using electron microscopy but
not cholesterol stones.
Lee et al. [1] extracted bacterial DNA from the specimens of
gallstones, bile juice and Gall-bladder (GB) mucosa at cholecystectomy.
Bacterial DNA was positive in 69.4% of the mixed cholesterol stones
compared with 10% of pure cholesterol stones. Helicobacter DNA was
detected in 4 out of 58 gallstones, 6 out of 48 bile samples and 5 out
of 46 gallbladder specimens. Almost all mixed-cholesterol gallstones
appear to harbor bacterial DNA, predominantly E. coli and identifed
the DNA of Helicobacter species in 27.7% of the GB mucosa, 25% of the
bile juice, and 11.4% of the gallstones.
Similarly, in our study, we extracted bacterial DNA from the
M + 1 2 3 4 5 6
M: DNA molecular marker; +: Positive control for E. coli; 1-6: Positive samples
Figure 1: PCR products for E. coli gene in bile samples.
M 1 2 3 4 5 + --
M: DNA molecular marker; +: Positive control; −: Negative control; 1-5: Posi-
tive samples.
Figure 2: Helicobacter genus specifc 16S rRNA PCR products in bile sam-
ples.
M 1 2 3 4 5
M: DNA molecular marker; 1-5: Positive samples.
Figure 3: H. pylori specifc glm gene PCR products in bile samples.
1 2 3 4 5 6 7 8 9 10 11 12 13 M
M: DNA molecular marker; 1-13: Positive different bile samples.
Figure 4: PCR-DGGE products in bile samples.
Volume 2 • Issue 1 • 1000106
J Gastroint Dig Syst
ISSN: 2161-069X JGDS, an open access journal
Citation: Vafaeimanesh J, Alebouyeh M, Seyyedmajidi M, Tajeddin E, Sherafat SJ, et al. (2012) Molecular Detection of Helicobacter Species and
Other Bacteria in Human Bile Samples of Patients with Biliary Diseases. J Gastroint Dig Syst 2:106. doi:10.4172/2161-069X.1000106
Page 4 of 5
specimens of bile juice samples %43.2 in stone group, %53.3 in
malignant group and %53.8 in other benign group including E.coli
(20.6%), Enterococcus (11.7%), Klebsiella (9.8%), Pseudomonas (9.8%),
Acinetobacter (3.9%) and H. Pylori (3.9%) without any diference in
the identifcation of bacterial DNA and Helicobacter species among
the groups based on diagnoses. Te exact mechanism by which
bacterial infections contribute to cholesterol gallstones is not known,
bacterial bioflm is suggested to play a role as a nucleation factor in
cholesterol gallstone formation, like a mucin. Other causative factors
are changes of bile composition and bacterial phospholipase, excessive
mucin production of Gall-bladder epithelial cells triggered by bacterial
lipopolysaccharides [1].
More than 25 species of Helicobacter have been found and these
microorganisms have been caused various diseases of the stomach,
intestine and the liver in mammals. Hepatitis and hepatomas are
caused by H. hepaticus in mice [24-26]. H. pulorum, Flexispira rappini,
and H.canis are isolated in diarrheal patients, showing the possibility of
zoonosis [27]. H. pylori is sensitive to bile acid and it is difcult to grow
in bile juice but the extraction of bile-resistant Helicobacter species
from animals bile showed that F. rappini, H. hepaticus, H. bilis, H. canis,
H. cholecystus, and H. pullorum may be able to grow and survive in bile
juice [21].
Lin et al. investigated the presence of urease A gene in bile sampled
by the percutaneous transhepatic route, 3 out of 7 cases showed
positive fndings, suggesting that H. pylori might be the cause of
subclinical cholangitis [14]. Figura et al. [28] implicated H.pylori as
a precipitating factor in gallstone formation by identifying H. pylori
antibodies in the bile juice of gallstone patients. de Martel et al. [13]
conducted a literature review of the epidemiological evidence linking
the presence of Helicobacter species in bile or biliary tract (BT). In
4 of 9 studies Helicobacter species were detected in patients with BT
cancer signifcantly more frequently than in controls. In two studies,
no Helicobacter species were detected in either cases or controls.
Helicobacter species were also ofen detected in benign BT diseases such
as gallstone disease or chronic cholecystitis [13].
Hamada et al. [29] collected 126 bile samples from patients with
cholelithiasis, cholecystitis, gallbladder polyp and other non-biliary
diseases. H. hepaticus was detected in bile samples with nested PCR
whereas H. bilis was not. IgG antibodies to H. hepaticus were detected
by Western blotting. Helicobacter hepaticus was detected in 32% of total
samples. Patients with cholelithiasis (41%) and cholecystitis with gastric
cancer (36%) had higher prevalence of H. hepaticus infection than
samples from patients with other diseases [29]. Kobayashi et al. [30]
examined 57 bile samples from 30 patients with benign biliary diseases,
6 malignant biliary diseases and 21 non-biliary diseases. Helicobacter
genus DNA (shorter amplicons, 400 bp) was statistically frequently
detected in bile samples from 53% (16/30) and 86% (5/6) of benign
and malignant biliary diseases, compared with 9% (2/21) of non-
biliary diseases, but longer amplicons (1200 bp) were not detectable in
any samples. Te H. pylori urease A gene (nested amplicon) was also
frequently found in bile, whether benign, malignant, or control, though
neither H. pylori 16S rRNA nor the 26K protein gene was detectable in
any bile samples. H. bilis-16S rRNA genes were detectable in only two
cases. H. hepaticus was not detectable in any samples [30].
`In study of Fallone et al. [7] bile juice was collected from 125
patients with various hepato-biliary diseases (75 with biliary stones, 15
with pancreatico-biliary malignancies and 4 with primary sclerosing
cholangitis) undergoing ERCP. All bile samples of 122 patients with
hepato-biliary diseases were negative for Helicobacter DNA. In a
similar German study no Helicobacter species were found in bile juice,
suggesting that there may be racial and demographic diferences [17].
Nilsson et al. [31] have also studied the relationship between H.
pylori and primary biliary cirrhosis and primary biliary sclerosing
cholangitis. H. pylori was found in the liver tissue but H. bilis, H.
pullorum and H. hepaticus was not [31]. In our study, we found the H.
pylori from only one of fve samples in the patients with PSC.
In summary, RFLP-DGGE is very accurate method but there are
many limitations to identify all the organisms in cases of infection
with multiple Helicobacter subtypes. Although disadvantage of lack
of comparative healthy control group, we could identify bacteria
including E.coli, Enterococcus, Klebsiella, Pseudomonas, Acinetobacter
and H. pylori in bile juice samples of Iranian patients with biliary
diseases. It may be a just innocent bystander, but bacterial infection
is of etiological importance in benign and malignant biliary diseases.
In future, researches will be needed to show the route of H. pylori
infection in biliary diseases and the efect of bacterial eradication on
the development of these diseases.
Acknowledgements
The study was supported by the Shahid Beheshti University of Medical
Sciences. We wish to thank all the researchers who took part in this research
project.
References
1. Lee JW, Lee DH, Lee JI, Jeong S, Kwon KS, et al. (2010) Identifcation of
Helicobacter pylori in Gallstone, Bile, and Other Hepatobiliary Tissues of
Patients with Cholecystitis. Gut Liver 4: 60-67.
2. Swidsinski A, Ludwig W, Pahlig H, Priem F (1995) Molecular genetic evidence of
bacterial colonization of cholesterol gallstones. Gastroenterology 108: 860-864.
3. Lee DK, Tarr PI, Haigh WG, Lee SP (1999) Bacterial DNA in mixed cholesterol
gallstones. Am J Gastroenterol 94: 3502-3506.
4. Graham DY (1991) Helicobacter pylori: its epidemiology and its role in duodenal
ulcer disease. J Gastroenterol Hepatol 6: 105-113.
5. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, et al.
(1991) Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J
Med 325: 1127-1131.
Bacterial isolates
Group A
Stones
n=74
Group B
Malignancy
n=15
Group C
Other Benign Dis.
n=13
p. value
Positive PCR 32 (%43.2) 8 (%53.3) 7 (%53.8) 0.646
E. coli 16 (%21.6) 2 (%13.3) 3 (%23.1) 0.748
Enterococcus spp. 10 (%13.5) 1 (%6.6) 1 (%7.6) 0.801
Klebsiella Pneumonia 7 (%9.4) 2 (%13.3) 1 (%7.6) 0.728
Pseudomonas 7 (%9.4) 2 (%13.3) 1 (%7.6) 0.866
Acinetobacter spp. 3 (%4.1) 0 (%0) 1 (%7.6) 0.575
H. Pylori 2 (%2.7) 1 (%6.6) 1 (%7.6) 0.582
Table 4: Bacterial isolates among the groups based on diagnoses.
Bacterial isolates
Cholesterol
gallstones
Black pigment-
ed stones n=23
Brown pigment-
ed stones n=4
p. value
Positive PCR 19 (%40.4) 12 (%52.1) 1 (%25) 0.486
E. coli 9 (%19.1) 6 (%26.1) 1 (%25) 0.792
Enterococcus spp. 5 (%10.6) 4 (%17.3) 1 (%25) 0.583
Klebsiella Pneu-
monia
5 (%10.6) 2 (%8.6) 0 (%0) 0.775
Pseudomonas 3 (%6.3) 3 (%13.1) 1 (%25) 0.369
Acinetobacter
spp.
1 (%2.1) 2 (%8.6) 0 (%0) 0.388
H. Pylori 2 (%4.2) 0 (%0) 0 (%0) 0.554
Table 5: Bacterial isolates among the groups based on gallstone composition.
Volume 2 • Issue 1 • 1000106
J Gastroint Dig Syst
ISSN: 2161-069X JGDS, an open access journal
Citation: Vafaeimanesh J, Alebouyeh M, Seyyedmajidi M, Tajeddin E, Sherafat SJ, et al. (2012) Molecular Detection of Helicobacter Species and
Other Bacteria in Human Bile Samples of Patients with Biliary Diseases. J Gastroint Dig Syst 2:106. doi:10.4172/2161-069X.1000106
Page 5 of 5
6. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, et al. (2001)
Helicobacter pylori infection and the development of gastric cancer. N Engl J
Med 345: 784-789.
7. Fallone CA, Tran S, Semret M, Discepola F, Behr M, et al. (2003) Helicobacter
DNA in bile: correlation with hepato-biliary diseases. Aliment Pharmacol Ther
17: 453-458.
8. Fox JG, Yan LL, Dewhirst FE, Paster BJ, Shames B, et al. (1995) Helicobacter
bilis sp. nov., a novel Helicobacter species isolated from bile, livers, and
intestines of aged, inbred mice. J Clin Microbiol 33: 445-454.
9. Kawaguchi M, Saito T, Ohno H, Midorikawa S, Sanji T, et al. (1996) Bacteria
closely resembling Helicobacter pylori detected immunohistologically and
genetically in resected gallbladder mucosa. J Gastroenterol 31: 294-298.
10. Fox JG, Dewhirst FE, Shen Z, Feng Y, Taylor NS, et al. (1998) Hepatic
Helicobacter species identifed in bile and gallbladder tissue from Chileans with
chronic cholecystitis. Gastroenterology 114: 755-763.
11. 11. Monstein HJ, Jonsson Y, Zdolsek J, Svanvik J (2002) Identifcation of
Helicobacter pylori DNA in human cholesterol gallstones. Scand J Gastroenterol
37: 112-119.
12. Abayli B, Colakoglu S, Serin M, Erdogan S, Isiksal YF, et al. (2005) Helicobacter
pylori in the etiology of cholesterol gallstones. J Clin Gastroenterol 39: 134-137.
13. de Martel C, Plummer M, Parsonnet J, van Doorn LJ, Franceschi S (2009)
Helicobacter species in cancers of the gallbladder and extrahepatic biliary tract.
Br J Cancer 100: 194-199.
14. Lin TT, Yeh CT, Wu CS, Liaw YF (1995) Detection and partial sequence analysis
of Helicobacter pylori DNA in the bile samples. Dig Dis Sci 40: 2214-2219.
15. Monti J, Fay M, Banchio C, Améndola R, Farías R, et al. (1999) [Detection of
Helicobacter pylori by polymerase reaction in bile samples from gallbladder and
bile stones]. Acta Gastroenterol Latinoam 29: 251-253.
16. Neri V, Margiotta M, de Francesco V, Ambrosi A, Valle ND, et al. (2005) DNA
sequences and proteic antigens of H. pylori in cholecystic bile and tissue of
patients with gallstones. Aliment Pharmacol Ther 22: 715-720.
17. Rudi J, Rudy A, Maiwald M, Stremmel W (1999) Helicobacter sp. are not
detectable in bile from German patients with biliary disease. Gastroenterology
116: 1016-1017.
18. Boye K, Høgdall E, Borre M (1999) Identifcation of bacteria using two
degenerate 16s rDNA sequencing primers. Microbiol Res 154: 23-26.
19. Csendes A, Fernandez M, Uribe P (1975) Bacteriology of the gallbladder bile in
normal subjects. Am J Surg 129: 629-631.
20. Csendes A, Becerra M, Burdiles P, Demian I, Bancalari K, et al. (1994)
Bacteriological studies of bile from the gallbladder in patients with carcinoma
of the gallbladder, cholelithiasis, common bile duct stones and no gallstones
disease. Eur J Surg 160: 363-367.
21. Dye M, MacDonald A, Smith G (1978) The bacterial fora of the biliary tract and
liver in man. Br J Surg 65: 285-287.
22. Schatten WE, Desprez JD, Holden WD (1955) A bacteriologic study of portal-
vein blood in man. AMA Arch Surg 71: 404-409.
23. Leung JW, Sung JY, Costerton JW (1989) Bacteriological and electron
microscopy examination of brown pigment stones. J Clin Microbiol 27: 915-921.
24. Fox JG, Dewhirst FE, Tully JG, Paster BJ, Yan L, et al. (1994) Helicobacter
hepaticus sp. nov., a microaerophilic bacterium isolated from livers and
intestinal mucosal scrapings from mice. J Clin Microbiol 32: 1238-1245.
25. Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, et al. (1994)
Helicobacter pylori infection and gastric lymphoma. N Engl J Med 330: 1267-
1271.
26. Ward JM, Anver MR, Haines DC, Benveniste RE (1994) Chronic active hepatitis
in mice caused by Helicobacter hepaticus. Am J Pathol 145: 959-968.
27. Stanley J, Linton D, Burnens AP, Dewhirst FE, On SL, et al. (1994) Helicobacter
pullorum sp. nov.-genotype and phenotype of a new species isolated from
poultry and from human patients with gastroenteritis. Microbiology 140: 3441-
3449.
28. Figura N, Cetta F, Angelico M, Montalto G, Cetta D, et al. (1998) Most
Helicobacter pylori-infected patients have specifc antibodies, and some also
have H. pylori antigens and genomic material in bile: is it a risk factor for
gallstone formation? Dig Dis Sci 43: 854-862.
29. Hamada T, Yokota K, Ayada K, Hirai K, Kamada T, et al. (2009) Detection of
Helicobacter hepaticus in Human Bile Samples of Patients with Biliary Disease.
Helicobacter 14: 545-551.
30. Kobayashi T, Harada K, Miwa K, Nakanuma Y (2005) Helicobacter Genus DNA
Fragments Are Commonly Detectable in Bile from Patients with Extrahepatic
Biliary Diseases and Associated with Their Pathogenesis. Dig Dis Sci 50: 862-
867.
31. Nilsson HO, Taneera J, Castedal M, Glatz E, Olsson R, et al. (2000)
Identifcation of Helicobacter pylori and other Helicobacter species by PCR,
hybridization, and partial DNA sequencing in human liver samples from patients
with primary sclerosing cholangitis or primary biliary cirrhosis. J Clin Microbiol
38: 1072-1076.
Submit your next manuscript and get advantages of OMICS
Group submissions
Unique features:
• User friendly/feasible website-translation of your paper to 50 world’s leading languages
• Audio Version of published paper
• Digital articles to share and explore
Special features:
• 200 Open Access Journals
• 15,000 editorial team
• 21 days rapid review process
• Quality and quick editorial, review and publication processing
• Indexing at PubMed (partial), Scopus, DOAJ, EBSCO, Index Copernicus and Google Scholar etc
• Sharing Option: Social Networking Enabled
• Authors, Reviewers and Editors rewarded with online Scientifc Credits
• Better discount for your subsequent articles
Submit your manuscript at: http://omicsonline.com/editorialtracking/