You are on page 1of 44

Il modello catechistico del catecumenato antico

di Giuseppe Cavallotto

Premessa
Nei primi secoli della Chiesa il catecumenato, al servizio dei nuovi credenti non battezzati, sorto e si progressivamente strutturato come cammino di evangelizzazione e formazione di giovani e adulti, capaci di scelte autonome e responsabili[1]. La prassi, diffusa nel ! e ! secolo, dei genitori cristiani di iscrivere tra i catecumeni i propri figli in tenera et", di fatto rinviava negli anni della maturit" la scelta personale del battesimo, preceduta da un esigente cammino di fede e conversione. l catecumenato degli adulti, sorto nei primi scoli, pu#, dun$ue, essere applicato ai fanciulli e ai ragazzi solo in modo analogico e con i necessari adattamenti[%].

& partire dal ! secolo, $uando il pedobattesimo divenne la scelta pastorale predominante, la Chiesa si preoccup# di adattare il processo iniziatico'catecumenale degli adulti ai bambini nati da pochi mesi o con et" non superiore ai due'tre anni. (i trattava di un cammino a tappe, relativamente breve, essenzialmente cultuale. )urante la $uaresima erano programmate alcune specifiche celebrazioni liturgiche che, insieme alla presenza dei bambini, prevedevano il coinvolgimento dei genitori, dei padrini e della comunit" cristiana. L*iniziazione aveva il suo momento culminante con la celebrazione del battesimo, confermazione ed eucaristia nella !eglia pas$uale[+]. Nelle Chiese d*,riente $uesta prassi continu# nei secoli ed tutt*ora vigente. n ,ccidente sub- un progressivo ridimensionamento, fino a scomparite nel .! secolo allorch/ il Concilio di 0irenze 1122%3 chiese di amministrare il battesimo ai bambini 4$uam primum5[2]. n pratica dopo +6 o 27 ore dalla nascita. 8uesta antica prassi dell*iniziazione cristiana dei bambini, sebbene limitata al solo processo liturgico e priva della dimensione catechistica e di $uella ascetico'penitenziale, racchiude una elo$uente lezione. l processo iniziatico di pi9 di un cammino catechistico'formativo: esso una progressiva opera di educazione e santificazione compiute dalla Chiesa e nella Chiesa.

Nelle testimonianze patristiche si incontra la prassi non il termine 4catecumenato5[;]. &bitualmente si parla di catecumeni, uditori e, in prossimit" del battesimo, di competenti, eletti, illuminandi. Non solo una $uestione semantica. Con $uesti termini la Chiesa antica ci ricorda che al centro della sua azione evangelizzatrice e materna posta la

persona umana con la sua storia, la propria esperienza culturale e religiosa, i suoi ritmi di crescita. Nell*antica prassi catecumenale $uest*attenzione alla singola persona espressa, tra l*altro, dalla flessibilit" nella durata del catecumenato, dall*esame o verifica delle motivazioni e disposizioni iniziali del nuovo credente e, successivamente, della sua crescita spirituale, dall*accompagnamento individuale del garante e del padrino, dai progressivi compiti ed impegni che via via il catecumeno deve assumersi sino alla formale rinunzia a satana e alla solenne professione di fede nella !eglia pas$uale prima dell*atto battesimale. ,gni persona unica e irripetibile nella sua identit", vocazione e cammino spirituale. <na proposta pastorale e formativa risponde, dun$ue, a verit" se al servizio dell*individuo, chiamato a sviluppare in pienezza la sua vita di figlio di )io secondo la sua et", condizione, possibilit".

l nuovo simpatizzante, che per la prima volta veniva accolto nella comunit" ecclesiale per approfondire la sua fede e conversione, sia in ,ccidente che in ,riente era chiamato 4catecumeno5, cio colui che veniva catechizzato attraverso l*istruzione orale. Con $uesto termine si evidenziava la funzione essenziale e primaria della catechesi nel processo catecumenale. =alvolta gli stessi catecumeni erano denominati 4auditores 4 o 4audientes5 per sottolineare la centralit" dell*ascolto della parola di )io approfondita nel tempo del catecumenato. Per la Chiesa antica la catechesi, fondata sull*ascolto e accoglienza della Parola, costituiva un tratto fondamentale, anche se non unico, della formazione catecumenale.

Non semplice, senza cadere in facili generalizzazioni, definire il modello catechistico del catecumenato antico, sia perch/ la disciplina del catecumenato varia sensibilmente nel periodo pre e post costantiniano, come pure tra le Chiese, sia perch/ le testimonianze catechistiche pi9 significative ci riportano al ! e ! secolo, epoca nella $uale il processo catecumenale conosce un sensibile ridimensionamento sul piano formativo. >esta, comun$ue, fondamentale un dato: si pu# delineare il modello catechistico elaborato nei primi secoli per la formazione dei nuovi credenti solo se si colloca nell*organica e articolata esperienza catecumenale, che, a sua volta, parte integrante del pi9 esteso processo di iniziazione cristiana.

Modelli iniziatici

4Cristiani non si nasce, si diventa5[6]. Con $uesta espressione lapidaria =ertulliano, verso il %??, si faceva interprete di una consapevolezza che anim# l*azione missionaria e pastorale della Chiesa fin dai primi tempi e che continuer" lungo i secoli. (i diventa cristiani attraverso una progressiva introduzione alla vita nuova rivelata e offerta in @es9 Cristo. & $uesto processo si d" il nome di iniziazione cristiana, fondata su due presupposti: lo sviluppo di una fede personale accompagnata da un fattivo cambiamento di vita e l*apporto fondamentale dell*azione educativa e santificatrice della Chiesa che trova la sua espressione culminante nella celebrazione dei sacramenti dell*iniziazione.

Lungo i secoli la struttura iniziatica ha conosciuto diverse interpretazioni e modalit" di attuazione. Nella Chiesa occidentale si possono individuare, in modo sommario ed indicativo, tre forme principali di struttura iniziatica: un processo organico e unitario di formazione e santificazione degli adulti che, fondato sul cammino catecumenale e completato con i sacramenti dell*iniziazione, prese corpo nei primi secoli della ChiesaA una iniziazione battesimale dei bambini alla $uale seguiva nel tempo una formazione cristiana caratterizzata essenzialmente da un processo di socializzazione, che si diffuse nel Bedioevo e nell*epoca modernaA infine una iniziazione battesimale dei bambini integrata successivamente da un*educazione cristiana affidata principalmente alla formazione catechistica, che si svilupp# nell*ultimo secolo.

l processo iniziatico catecumenale, elaborato nei secoli '! e rivolto a giovani'adulti, aveva lo scopo di promuovere una progressiva introduzione dei nuovi credenti nel mistero di salvezza, una sempre pi9 profonda partecipazione alla morte e risurrezione di Cristo ed un crescente inserimento nella vita della Chiesa. Prevedeva una rigoroso cammino formativo spirituale a tappe, dove l*esperienza catecumenale occupava un ampio spazio temporale prima del battesimo e svolgeva un ruolo rilevante nello sviluppo della fede e conversione. L*iniziazione aveva il suo momento culminante con la celebrazione del battesimo, confermazione ed eucaristia nella !eglia pas$uale, per concludersi con la breve tappa della mistagogia. l processo iniziatico antico, con un cammino limitato nel tempo, era caratterizzato da una struttura dinamica, organica e unitaria che, fondata su un accompagnamento comunitario'ecclesiale, si articolava in alcune componenti essenziali, vitalmente relazionate: evangelizzazione e catechesi, riti e celebrazioni, esercizi ascetici e penitenziali, testimonianza e sostegno spirituale dei fedeli. La catechesi, integrata con le altre componenti, contribuiva all*iniziazione 4globale5[C] del nuovo credente: educazione della fede, conversione e sviluppo di un comportamento evangelico, esercizio della vita cristiana, progressiva purificazione e santificazione, inserimento sempre pi9 pieno nella Chiesa.

& partire dal ! '! secolo, con la generalizzazione del pedobattesimo, l*unit" e la ricchezza dell*antica struttura iniziatica conobbe un progressivo sfaldamento: il cammino

catecumenale fu prima ricondotto a pochi incontri cultuali per poi scomparire totalmenteA l*accompagnamento ecclesiale prebattesimale, sempre pi9 ridimensionato, venne reso impossibile $uando si instaur# la disciplina di amministrare il battesimo a pochi giorni dopo la nascitaA la celebrazione unitaria dei tre sacramenti dell*iniziazione si dissolse progressivamente prima con il distacco della confermazione, poi dell*eucaristiaA lo stretto legame fra iniziazione sacramentale e !eglia pas$uale venne via via meno con il diffondersi della celebrazione del battesimo nelle grandi feste, successivamente in tutti i giorni dell*anno. )i fatto la nuova struttura iniziatica si articolava in due fasi: in senso proprio l*iniziazione sacramentale con la celebrazione del battesimo nei primi giorni di vita, $uindi, negli anni successivi, la formazione cristiana. =eologicamente il bambino diventava cristiano, figlio di )io, 4iniziato5 con il battesimo, amministrato nella fede della Chiesa. )i fatto egli si sviluppava come credente, discepolo di Cristo con un processo formativo posbattesimale senza limiti di tempo, dove erano determinanti l*educazione familiare, l*influsso dell*ambiente cristiano, l*esercizio della piet" popolare, l*appartenenza alla comunit" cristiana. &ll*antico processo catecumenale subentr# cos-, dopo il battesimo, una sorta di 4catecumenato ambientale o sociale5[7], che consisteva essenzialmente in una socializzazione cristiana. n $uesta proposta formativa postbattesimale scomparve la ricca dimensione liturgica propria del catecumenato antico, restarono eclissati la funzione materna della Chiesa e il coinvolgimento della comunit" cristiana, progressivamente confermazione ed eucaristia perdettero il loro legame con il processo iniziatico. n epoca moderna, poi, la socializzazione cristiana dei fanciulli e dei ragazzi fu arricchita con una specifica catechesi, espressamente richiesta dal Concilio di =rento[D]. Progressivamente sviluppata sul piano organizzativo e contenutistico, la catechesi, finalizzata soprattutto al sapere della fede, ha rivestito un ruolo rilevante ma sempre integrativo alla formazione cristiana svolta dalla famiglia e sostenuta dalla comunit" sociale e cristiana.

Nel secolo .. la catechesi conobbe una stagione privilegiata: un ricco approfondimento della sua natura e finalit", un rinnovamento nei contenuti, modelli e metodi, una pi9 accurata organizzazione e formazione dei catechisti. n $uesto tempo l*iniziazione cristiana conserv# la precedente struttura: il bambino era formalmente iniziato con la celebrazione del battesimo, amministrato nei primi mesi di vita, a cui seguiva negli anni la formazione cristiana. Nei primi decenni del secolo l*educazione cristiana del ragazzo era assicurata dalla famiglia, dal contesto ambientale, dall*esperienza formativa dell*oratorio e dei gruppi dell*associazionismo cattolico, dall*insegnamento della religione nella scuola, dalla catechesi parrocchiale e sacramentale. La formazione cristiana del ragazzo, sebbene diversa dalla proposta catecumenale, era ancora il frutto convergente di una pluralit" di esperienze educative. n seguito alle profonde trasformazioni sociali, culturali e religiose, si -EFGD GGGGHGIGGGGGGGGGGGGGGGJGGG GbKbKLMLMGGGGGGGGGGGGGGGGGGGGGG.NGGOEGGOEGGP' GG4QGGGGGGGGGGGGGGGGGGGGGGGGGGRRGGGGGGGGGGRRGGGGGGGGGGRRGGGGGGGGGGGGGGG GGGlGGGGGSGGGGGGGSGGGSGGG2GGGTGGG1GGGUGGGGGGGUGGGGGGGUGGGGGGGGGGGGGGGVGG GGGGGVGGGGGGGVGGGGGGGVGGG7GGG6GGG5GGGWGGGdGGGVGGGGGGGXLGGYGGG:GGGGGGG:GG

GZGGG[GGGGGGG[GGGGGGG[GGGGGGG[GGGGGGG[GGGGGGG[GGGGGGGd\GGGGGGf\GGGGGGf\GGG GGGf\GGGGGGf\GGGGGGf\GGGGGGf\GG]GGGBGG GGGO,GG^GGG_\GG9GGGGGGGGGGGGGGGGGGGUGGGGGGG[GGGGGGGGGGGGGGGGGGGGGGG[GGGG GGG[GGGGGGG[GGGGGGG[GGGGGGG_\GGGGGGpCGGGGGGUGGGGGGGUGGGGGGG[GGGGGGGGGGGGG GG[GGGGGGG` LGGGGGGpCGGGGGGpCGGGGGGpCGGGGGG[GGGabGGUGGGGGGG[GGGGGGGUGGGGGGG[GGGGGGGd\ GGGGGGGGGGGGGGpCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG[G GGGGGGd\GGGGGGpCGGcGGGpCGGGGGGGGGGGGGGd\GGGGGGUGGGGGGGUGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGd\GGGGGG[GGGGGGG.GGG

GGGde zf*gFGVGGGGGGGVGGGGGGGhiGGGGGGd\GGGGGGGGGGGGGGd\GGGGGGjLGG?GGGXLGG GGGGd\GGGGGGCPGGGGGGhiGG^GGGCPGGGGGGd\GGGGGGpCGGGGGGVGGGGGGGVGGGGGGGU GGGGGGGUGGGGGGGUGGGGGGGUGGGGGGGGGkGGG L B,)gLL, C&=gCl (= C, )gL C&=gC<BgN&=, &N= C, Premessa Nei primi secoli della Chiesa il catecumenato, al servizio dei nuovi credenti non battezzati, sorto e si progressivamente strutturato come cammino di evangelizzazione e formazione di giovani e adulti, capaci di scelte autonome e responsabiliG. La prassi, diffusa nel ! e ! secolo, dei genitori cristiani di iscrivere tra i catecumeni i propri figli in tenera et", di fatto rinviava negli anni della maturit" la scelta personale del battesimo, preceduta da un esigente cammino di fede e conversione. l catecumenato degli adulti, sorto nei primi scoli, pu, dunque, essere applicato ai fanciulli e ai ragazzi solo in modo analogico e con i necessari adattamentiG. & partire dal ! secolo, $uando il pedobattesimo divenne la scelta pastorale predominante, la Chiesa si preoccup# di adattare il processo iniziatico' catecumenale degli adulti ai bambini nati da pochi mesi o con et" non superiore ai due'tre anni. (i trattava di un cammino iniziazione5 e suoi derivati, riferiti alla celebrazione del battesimo, confermazione ed eucaristia. Padri greci, richiamando l*iniziazione sacramentale, usano sovente i termini '??^????, introduco ai misteri, '??^?????, introduzione ai misteri, ^???^? '??^'??, introduzione misterica. Cos- @iovanni Crisostomo, avvicinandosi alla Pas$ua, ricorda agli illuminandi: 4&nche voi state per essere iniziati ai misteri m Gb``` n`G` b``n``o``````b b`````n``5[1?]. =ra i Padri latini =ertulliano, riferendosi ai misteri cristiani e ai sacramenti, parla di 4piae initiationes5[11]. (ia nella Chiesa orientale che occidentale i catecumeni sono ritenuti 4non iniziati5[1%]. )opo la celebrazione dei sacramenti nella !eglia pas$uale il candidato denominato '_?^?? o iniziato[1+].

(e vero che per i Padri l*iniziazione cristiana, in senso stretto, avviene attraverso l*amministrazione del battesimo, confermazione ed eucaristia[12], indiscutibile che la celebrazione di $uesti sacramenti rappresenta per gli adulti la conclusione di un lungo itinerario di crescita nella fede, di un graduale cambiamento di vita, di una progressiva santificazione e di un inserimento sempre pi9 esteso nella vita ecclesiale[1;]. Come ricorda efficacemente san pasilio Bagno: 4Prima bisogna diventare discepoli del (ignore e poi essere ammessi al santo battesimo5[16].

l termine 4iniziazione cristiana5, comunemente presente nell*odierna riflessione teologico'pastorale, deve la sua diffusione in modo particolare a Luis )uchesne[1C]. Nel secolo .. il tema iniziazione ha conosciuto un crescente interesse di studi antropologici, storici, teologici, liturgici e pastorali[17]. La pubblicazione del Rito della iniziazione cristiana degli adulti, frutto delle scelte conciliari arricchite dal contributo di numerosi esperti, rappresenta un*efficace sintesi della ricerca nel campo dell*iniziazione cristiana e un sapiente ricupero della proposta iniziatica antica[1D]. n $uesto >ituale l*iniziazione

sacramentale costituisce il momento culminante di un esteso processo iniziatico, articolato in tempi e passaggi successivi: il precatecumenato come tempo di orientamento al cristianesimo e di evangelizzazioneA il primo passaggio con il rito dell*accoglienza dei catecumeniA poi il tempo, piuttosto lungo, del catecumenato finalizzato alla formazione e maturazione cristianaA segue il secondo passaggio dell*elezione e ammissione al battesimoA $uindi il tempo, durante la $uaresima, dedicato alla purificazione e illuminazioneA finalmente, al termine della preparazione spirituale, si giunge al terzo grado o passaggio con la celebrazione, nella !eglia pas$uale, del battesimo, confermazione ed eucaristia, 4 sacramenti che formano il cristiano5[%?]A si conclude l*iniziazione con il tempo della mistagogia, durante il tempo pas$uale, destinata all*esperienza cristiana, sacramentale e comunitario'ecclesiale.

Sviluppo storico del processo iniziatico antico


La struttura iniziatico'catecumenale degli adulti appare gi" adeguatamente articolata alla fine del secolo e si incontra nelle principali Chiese del secolo, $uali >oma, Cartagine, &lessandria, &ntiochia. 8uesto tempo pu# considerarsi il periodo aureo del processo iniziatico per la sua rigorosa ed estesa proposta formativa. )opo un primo accostamento al cristianesimo ed un*iniziale fede, grazie soprattutto alla testimonianza e all*accompagnamento di esemplari cristiani, il nuovo credente, valutate le sue intenzioni e disponibilit", era accolto fra i catecumeni. (eguiva un lungo periodo di formazione cristiana durante il catecumenato, di circa tre anni, promossa attraverso la catechesi, prevista probabilmente pi9 volte alla settimana, integrata da esorcismi e arricchita dalla preghiera individuale e comunitaria. &ccompagnato dalla guida spirituale di un padrino, il catecumeno si impegnava in un esercizio di vita cristiana ricca di opere di carit"[%1]. &l termine di $uesto esigente periodo formativo il catecumeno, se ritenuto idoneo, veniva ammesso al battesimo, preceduto da una breve ma intensa esperienza spirituale che, a >oma, aveva la durata di una settimana, durante la $uale, oltre all*ascolto del !angelo, era previsto un fecondo intreccio di riti e gesti penitenziali: esorcismo $uotidiano, un bagno di purificazione il gioved-, digiuno il venerd-, un solenne esorcismo il sabato, fatto dal vescovo, e seguito dall*insufflatio sul volto e dal segno della croce in fronte, sulle orecchie e sulle narici[%%]. l processo iniziatico culminava con la celebrazione del battesimo, confermazione ed eucaristia all*alba della domenica a conclusione di una veglia che durava tutta la notte: al canto del gallo veniva benedetta l*ac$ua, seguiva lo spogliamento dei candidati, la rinunzia a satana e la solenne professione di fede, poi l*unzione con l*olio dei catecumeni, $uindi il battesimo per immersione, successivamente la crismazione, infine la prima partecipazione alla eucaristia[%+].

La disciplina del catecumenato e, pi9 in generale, l*articolato processo iniziatico diventano nel ! e ! secolo una prassi estesa in tutte le Chiese. Nonostante l*arricchimento liturgico e l*elaborazione di esemplari catechesi, in $uesto periodo post' costantiniano l*itenerario iniziatico conosce un affievolimento come proposta di evangelizzazione e formazione cristiana. Con facilit" si era iscritti fra i catecumeni, sovente senza una previa preparazione[%2]. Nella prima fase del catecumenato, della durata di %'+ anni e a volte di tutta la vita, i candidati erano aiutati a sviluppare una fede iniziale ed un primo esplicito orientamento al cristianesimo. La catechesi, anche se talvolta prevedeva specifiche istruzioni, si limitava sovente alla partecipazione della prima parte dell*eucaristia domenicale: ascolto della Parola e omelia. La formazione era arricchita da fre$uenti esorcismi e dall*accompagnamento spirituale del padrino. )i fatto la crescita nella fede e il cambiamento della vita erano modesti. &gostino si lamentava della scarsa fre$uenza dei catecumeni alla catechesi e della loro condotta poco edificante[%;]. Con un*immagine efficace >inaldo 0alsini, riferendosi a $uesto tempo di formazione, parla di 4catecumenato di parcheggio5[%6]. &l termine di $uesta essenziale formazione i catecumeni che, dopo insistente sollecitazioni dei pastori, decidevano di accedere al battesimo, venivano esaminati e, se ritenuti idonei, iscritti dal !escovo stesso nel libro degli eletti, chiamati anche competenti o illuminandi[%C]. Con $uesta celebrazione incominciava la seconda e decisiva fase del catecumenato, che coincideva con la 8uaresima. Prevedeva un*intensa e rigorosa formazione, scandita dalla catechesi $uotidiana, arricchita da numerosi esercizi ascetico'penitenziali, sostenuta da molteplici riti e celebrazioni: esorcismo $uotidiano, scrutini, traditio del (imbolo e, in alcune Chiese, anche del Padre Nostro. L*iniziazione raggiungeva il suo momento culminante con l*amministrazione del battesimo, confermazione ed eucaristia nella !eglia pas$uale. La struttura celebrativa di $uesti sacramenti era analoga alla fase precedente: agli stessi riti, espressi con una maggiore solennit", si aggiungevano alcuni minori, $uale $uello del rivestirsi dell*abito bianco, la consegna della lampada e, a Bilano, la lavanda dei piedi. nfine il processo iniziatico si concludeva con la tappa della mistagogia, estesa a tutta la settimana di Pas$ua, durante la $uale i neofiti ordinariamente erano istruiti sui sacramenti attraverso la spiegazione dei singoli riti e una catechesi tipologica[%7]. )i fatto il processo iniziatico del ! e ! secolo si concentrava in ;? giorni: la 8uaresima e la settimana di Pas$ua. (i trattava di una formazione intensa, ma limitata nel tempo.

Identit del processo iniziatico


L*antica struttura iniziatica, pur con significative diversit" di attuazione, presenta una propria identit", sostanzialmente costante nelle Chiese dei primi secoli. n generale l*iniziazione cristiana si caratterizza come un processo originale ed organico di formazione cristiana e come un cammino di santificazione, operati dalla Chiesa e nella Chiesa. q diretta ai giovani e adulti che desiderano diventare cristiani. la una durata

limitata nel tempo: si estende dai primi passi nella fede sino alla mistagogia. >aggiunge il suo apice con la celebrazione del battesimo, confermazione ed eucaristia. q finalizzata, attraverso tappe successive, a formare il discepolo di Cristo, a introdurre il nuovo credente nella salvezza, rendendolo progressivamente partecipe del mistero della morte e risurrezione, a incorporarlo sempre pi9 profondamente nella comunit" ecclesiale sino a diventare membro a pieno titolo della Chiesa. (viluppatosi con una propria struttura e finalit", il processo iniziatico presenta tratti specifici con una loro particolare valenza antropologica, teologica ed ecclesiologica.

un progressivo cammino di liberazione e santificazione. @razie ad esso i nuovi credenti rivivono una storia di salvezza analoga a $uella del popolo di sraele. =ertulliano delinea il processo iniziatico con tre verbi che connotano il dinamismo del cammino in tappe progressive: anzitutto accedere ad fidem, cio il primo accostamento alla fede e l*iniziale conversioneA segue ingredi in fidem, l*entrare nella fede attraverso un suo approfondimento che implica l*osservanza della legge'parola del (ignoreA infine signare fidem, cio porre il sigillo della fede con il battesimo[%D]. La conclusione di $uesto cammino spirituale il raggiungimento, con il battesimo, della libert" dei figli di )io, della piena liberazione nella nuova =erra promessa, dove scorre latte e miele, efficacemente simboleggiata dall*accesso al calice di latte e miele durante la prima celebrazione eucaristica dei neofiti[+?]. (oprattutto ,rigene paragona il processo iniziatico all*esodo di sraele: 48uando tu lasci le tenebre dell*idolatria perch/ desideri arrivare alla conoscenza della legge divina, allora cominci a uscire dall*ggitto. 8uando ti sei unito alla folla dei catecumeni e hai cominciato a obbedire ai comandamenti della Chiesa, hai attraversato il Bar >osso. )urante le tappe del deserto, ogni giorno ti applichi ad ascoltare le Legge di )io e a contemplare il volto di Bos che ti svela la gloria del (ignore. Ba $uando arriverai alla sorgente spirituale del battesimo, e in presenza dell*ordine sacerdotale e levitico sarai iniziato a $uei misteri venerandi e sublimi noti soltanto a coloro che hanno diritto di conoscerli, allora, avendo attraversato il @iordano, grazie al ministero dei sacerdoti, entrerai nella =erra promessa, $uella terra dove @es9, dopo Bos, ti accoglie e diventa la tua guida per la nuova vita5[+1]. &nche in una omelia su Numeri l*&utore istituisce un parallelismo fra il processo iniziatico e il cammino di liberazione di sraele che si estende dall*uscita dall*ggitto all*attraversamento del @iordano[+%]. Per ,rigene, dun$ue, il nuovo credente, in tappe successive, si allontana dall*idolatria, incomincia ad aderire alle leggi divine, vive un*esperienza di deserto nella $uale si imbeve della parola di )io e si esercita a viverla, finalmente con il battesimo entra nella nuova =erra promessa abilitato ad aderire ai precetti evangelici.

Primariamente, dun$ue, il cammino inziatico una crescente santificazione, opera dall*&lto, alla $uale via via corrisponde una progressiva liberazione, una nuova condizione spirituale 'prima simpatizzante, poi catecumeno, $uindi eletto o competente,

infine neofita' una capacit" sempre pi9 ampia nell*accogliere la parola di )io e i misteri salvifici[++], un compito sempre pi9 esigente di fedelt" alla Parola e di cambiamento di vita. & pi9 riprese i Padri sottolineano l*esigenza di una seria crescita spirituale prima del battesimo. l nuovo credente chiamato a 4mettere del suo5[+2], a partecipare con diligente premura alla catechesi e portare frutti operosi[+;], sollecitato a sviluppare 4una fede completa e matura5[+6], a liberarsi dal dominio di satana, allontanarsi dalle passioni, correggere i difetti, confessare i peccati e ac$uistare la virt9[+C]. 8uesto impegnativo compito di liberazione e di rinnovamento spirituale del credente possibile grazie all*azione di )io, primo attore della santificazione. q la grazia divina che muove il cuore dell*uomo alla fede: 4 nvero, ricorda &gostino, accade molto raramente, anzi mai, che $ualcuno venga con l*intenzione di diventare cristiano senza essere toccato nel profondo da un certo timore di )io5[+7]. q ancora l*aiuto del (ignore che sostiene il cammino di conversione. Cirillo di @erusalemme rassicura l*illuminando nel suo combattimento spirituale: 4(ar" a tua disposizione la spada dello (pirito5[+D]. Per sottolineare l*azione liberatrice e santificatrice di )io nella prassi catecumenale antica viene dato grande rilievo alla preghiera 'della comunit", del catechista e dello stesso catecumeno' e all*ascolto della Parola, prevista una molteplicit" di celebrazioni e riti. =ra essi hanno una particolare rilevanza gli esorcismi, 4senza dei $uali l*anima non pu# venire purificata5[2?]. (e vero che 4)io, che ci ha creati senza di noi, non pu# salvarci senza di noi5[21], la responsabilit" e l*impegno del credente restano fondamentali, ma sempre come risposta e cooperazione all*iniziativa di )io: 4& lui spetta piantare e irrigare, a te portare fruttoA a )io donare la grazia, a te riceverla e conservarla5[2%].

scuola di formazione ed esercizio di vita cristiana. L*intero processo iniziatico e, in particolare, l*esperienza catecumenale hanno lo scopo di formare il cristiano: il discepolo del (ignore[2+], l*atleta e il soldato di Cristo[22], il cittadino della Chiesa[2;]. q vero discepolo di Cristo, secondo san pasilio, 4chi si accosta al (ignore per seguirlo, cio per ascoltare le sue parole, credere e ubbidire a lui come a padrone e re e medico e maestro5[26]. L*obiettivo della formazione la crescita spirituale del nuovo credente: sviluppo della fede, progresso nella conversione e cambiamento di vita, graduale inserimento nella comunit" ecclesiale. Per $uesto non basta conoscere il messaggio cristiano. Ci si deve 4sbarazzare delle cattive abitudini5[2C], 4sradicare i vizi e spegnere i barbari costumi5[27]. ,ccorre accogliere la parola di )io e conformare ad essa cuore, parole e opere[2D]. (i chiamati a sviluppare la fede, la speranza e la carit"[;?]. (i deve portare frutti di opere buone e, in particolare, impegnarsi in opere di carit"[;1]. =utto ci# si ottiene attraverso un vero 4tirocinio degli uditori5[;%], trasformando, cos-, il catecumenato in un 4tempo di penitenza, di prova e di timore5[;+].

Le testimonianze dei Padri confermano $uesto concetto di esercizio della vita cristiana con altre immagini semplici ed elo$uenti. l cammino che precede il battesimo

considerato un tempo di combattimento spirituale: lotta contro le seduzioni del male e impegno di rinnovamento interiore. Per $uesto Cirillo di @erusalemme, all*inizio della 8uaresima, ricorda agli illuminandi che 4sono stati chiamati alle armi5 e che devono 4con buona volont" combattere la battaglia del (ignore per vincere le avverse potest"5[;2]. (econdo =ertulliano i catecumeni sono 4novicioli5[;;], cio 4soldati di leva5 che devono apprendere l*arte del combattimento. )a Commodiano sono invitati ad essere 4buone reclute5[;6]. l Crisostomo considera gli illuminandi 4nuovi soldati in Cristo5[;C]. Con un*immagine sportiva, poi, il catecumenato presentato come un tempo di allenamento, di esercizi ginnici. Per @iovanni Crisostomo la tappa che precede il battesimo 4palestra e ginnasio5, dove gli illuminandi si allenano prima di scendere, con il battesimo, nell*arena per la gara[;7]. &naloga immagine espressa da &gostino, che esorta i competenti: 4gcco dov* il vostro stadio, ecco il $uadrante per i lottatori, ecco la pista per i corridori, ecco la palestra per i pugili5[;D]. (oprattutto il periodo $uaresimale che precede il battesimo $ualificato come un tempo di forgiatura e di rinnovamento interiore. >ichiamando un*immagine classica, Cirillo di @erusalemme afferma che l*illuminando 4come oro grezzo e sofisticatof che non pu# essere purificato dalle scorie senza il fuoco5. Per $uesto chiede che 4l*anima venga forgiata, sia lavata a colpi di martello la durezza dell*infedelt"A cadano dal ferro le s$uame superflue e ne rimanga il metallo purificato5[6?]. l Crisostomo non esita ad entrare nei dettagli. (i tratta di sradicare le cattive abitudini, in particolare $uella di giurare, di essere violento, di parlare male, di compiere azioni illecite. (i deve frenare la lingua, gli occhi, le passioni, soprattutto la collera, l*ira, il rancore, l*ostilit", l*invidia, i desideri perversi. Ci si astenga dai presagi, sortilegi, spettacoli. (i rinunci al male, si disprezzi le ricchezze e ci si distacchi dalle cose presenti. Ci si eserciti nelle buoni azioni, nella liberalit" verso i poveri, nella modestia, nella mitezza[61]. nfine, in termini generali, il cammino catecumenale ritenuto un tempo di crescita spirituale. l catecumeno, come il bambino, per svilupparsi deve essere nutrito prima con il latte, poi con cibo solido[6%]. Chi vuole crescere e diventare cristiano, come l*albero, ha bisogno di cura e potature[6+].

crescita spirituale promossa e operata dalla Chiesa. @i" nell*&ntico =estamento il popolo di sraele il partner di )io: popolo eletto dal (ignore e suo interlocutore, destinatario della sua &lleanza, luogo dove si manifesta il suo disegno, inviato a testimoniare il suo mistero di salvezza. ,gni pio israelita fa l*esperienza di )io condividendo vita e vicende del proprio popolo. La Chiesa, 4convocazione5 del nuovo sraele, il popolo della nuova &lleanza. !oluta da )io come sacramento universale di salvezza, la Chiesa ha la missione di incontrare ogni uomo e donna per introdurli nell*economia salvifica, per farli entrare in comunione con )io e partecipare al mistero di morte e resurrezione di Cristo. Per $uesto l*iniziazione cristiana, $uale cammino progressivo di crescita spirituale e di configurazione a Cristo, essenzialmente opera della Chiesa: viene attuata da essa e in essa. n $uesta azione iniziatica si rivela e si compie in modo eminente la vocazione missionaria e materna della Chiesa.

Numerosi Padri, con un*immagine semplice ed immediata, paragonano l*esperienza del catecumeno nella comunit" ecclesiale a $uella del bambino nel grembo della madre durante il tempo della gestazione. 0ra le testimonianze si pu# richiamare $uella di Betodio, vescovo di ,limpo in &sia Binore, che verso il +1? scriveva: 4<na donna, $uando ha ricevuto informe il seme dell*uomo, d" alla luce, una volta compiuto il tempo, un essere perfetto. &llo stesso modo si potrebbe dire che la Chiesa non cessa di concepire nel suo grembo $uelli che cercano riparo presso la Parola, e che essa li forma e li modella a immagine e somiglianza di Cristo, per farli, una volta compiuto il tempo, cittadini della vita immortale5[62]. La Chiesa, concepiti i nuovi credenti attraverso un*iniziale fede, li porta nel proprio grembo, li cura, li nutre, li protegge, progressivamente li forma e li santifica, per poi generarli a vita nuova con il battesimo. l giorno di Pas$ua &gostino, rivolgendosi ai neofiti, ricorda il loro precedente cammino di crescita, operato da )io e dalla Chiesa, implicitamente espresso con l*uso della forma passiva dei verbi: 4g ora pensate a voi stessi: non eravate e siete stati creati, siete stati radunati nell*aia del (ignore, siete stati trebbiati con il lavoro dei buoi, ossia di coloro che annunziano il !angelo, avete cominciato a essere macinati con digiuni ed esorcismi. 8uindi siete venuti all*ac$ua e siete stati impastati e siete diventati una cosa sola. Con il sopraggiungere del fuoco dello (pirito (anto siete stati cotti e siete diventati pane del (ignore5[6;]. Pi9 esplicitamente 8uodvultdeus, rivolgendosi ai competenti oramai prossimi al battesimo, rammenta: 4@li esorcismi, i salmi, le insufflazioni, il cilicio, le genuflessionif tutto ci# il cibo con cui vostra madre vi alimenta nel suo grembo, per potervi fare nascere dall*ac$ua del battesimo e presentarvi preservati a Cristo esultanti di gioia5[66]. &nche Leone Bagno, verso la met" del ! secolo, ricorda agli eletti che per accedere al battesimo 4devono essere scrutinati con esorcismi, santificati con digiuni e istruiti pi9 fre$uentemente con predicazioni ' et eOorcismis scrutandi et ieiuniis santificandi et fre$uentius predicationibus imbuendi5[6C].

n $uesto tempo di gestazione, dun$ue, la madre Chiesa si prende cura dei figli, appena concepiti, li educa e promuove la loro crescita spirituale in primo luogo con un appropriato nutrimento della Parola, con una continua impetrazione dell*aiuto del (ignore, di cui sono espressione elo$uente gli esorcismi $uotidiani, la preghiera comunitaria nella sinassi eucaristica per i catecumeni, le veglie di preghiera, i molteplici riti e celebrazioni. Li segue con un premuroso e costante accompagnamento spirituale attraverso il !escovo, i presbiteri e i diaconi, i catechisti e gli esorcisti, i garanti e i padrini, ma anche con la presenza e la testimonianza dei fedeli, la loro condivisione alla catechesi e agli esercizi ascetico'penitenziali dei catecumeni, la loro continua preghiera. n $uesto modo la Chiesa esercita la sua maternit" attraverso i propri figli gi" rigenerati a vita nuova[67]. & sua volta &gostino associa i battezzati di lunga data all*azione materna della Chiesa che, dopo la gestazione e generazione dei nuovi figli, continua a prendersene cura. l giorno del battesimo, a conclusione della !eglia pas$uale, rammenta: 4Bi rivolgo a voi, fratelli 1battezzati3, a voi che in $ualche modo, data l*anzianit" della vostra generazione, siete per loro 1i neofiti 3 come dei genitori, e vi raccomando di comportavi

in modo che con coloro che prenderanno da voi l*esempio possiate godere e non perire insiemef 8uando vi comportate male, voi, che siete fedeli gi" da tempo, dovrete rendere conto a )io sia di voi stessi che di loro5[6D].

proposta unitaria e organica di educazione e santificazione. La crescita spirituale del catecumeno, la sua progressiva adesione e configurazione a Cristo sono il frutto convergente di numerosi operatori e della comunit" cristiana, nello stesso tempo sono il risultato di una ricca esperienza unitaria nella $uale confluiscono molteplici attivit" promosse e offerte dalla Chiesa: evangelizzazione e catechesi, riti e celebrazioni, esercizi ascetici e penitenziali, testimonianza di fede e di carit" fraterna, condivisione, sostegno e accompagnamento spirituale dei fedeli. L*obiettivo lo sviluppo integrale della vita cristiana nel nuovo credente, la sua progressiva partecipazione al mistero pas$uale e il suo inserimento sempre pi9 pieno nella Chiesa, raggiunti compiutamente con la celebrazione dei sacramenti dell*iniziazione. L*unit" del processo iniziatico assicurata dallo stesso obiettivo e dall*azione concorde dei diversi operatori, fondata sulla continuit" progressiva delle tappe e su una ricca e vitale esperienza comunitaria' ecclesiale, espressa dalla celebrazione unitaria del battesimo, confermazione ed eucaristia. La organicit" del cammino formativo spirituale radicata sul profondo e armonico legame delle componenti o azioni iniziatiche che si intrecciano, si richiamano e si completano reciprocamente: l*approfondimento della Parola trova conferma e sostegno nella testimonianza dei fedeli, preparato e attuato attraverso l*esperienza ascetico' penitenziale, viene arricchito e aiutato efficacemente con una molteplicit" di riti e celebrazioni, completato e sostenuto grazie all*accompagnamento spirituale dei garanti e padrini.

partecipazione e attuazione della storia della salvezza. L*economia salvifica di )io inizia con la creazione, si manifesta in modo privilegiato con fatti e parole nella storia del popolo eletto, si realizza in modo definitivo con l*incarnazione del 0iglio di )io, la sua vita, la sua morte e risurrezione. La venuta di @es9 Cristo e il suo mistero pas$uale rappresentano il compimento della promessa antica e costituiscono l*irruzione della salvezza messianica, grazie alla $uale il nuovo popolo del (ignore pu# vivere pienamente il dono dell*&lleanza nell*esperienza di comunione filiale e sponsale con il suo )io. La storia della salvezza, che viene da lontano, continua oggi. =utto il processo di iniziazione cristiana uno dei luoghi privilegiati dove si manifesta, continua e si compie la storia salvifica di )io, che trova la sua espressione pi9 alta nella celebrazione dei sacramenti. Per $uesto gli eventi della storia della salvezza costituiscono il riferimento costante e il contenuto dominante della catechesi che, nel processo iniziatico, precede e segue il battesimo.

<n*esplicita ed elo$uente testimonianza offerta da &gostino nella prima catechesi ai 4rudes5 nella fede, precedente il loro ingresso tra i catecumeni. La narrazione, suggerita dal !escovo di ppona, riassume in grandi tappe la storia della salvezza: creazione, caduta, progressiva azione liberatrice di )io che ha il suo momento culminante con l*incarnazione di @es9 Cristo. Le cin$ue precedenti tappe trovano la loro continuazione e attuazione nella sesta: con la morte e risurrezione di Cristo e la Pentecoste inizia il tempo della Chiesa, in attesa del ritorno finale del Cristo glorioso[C?]. La stessa catechesi morale, proposta da &mbrogio agli eletti nelle prime settimane della 8uaresima, viene sviluppata 4leggendo la storia dei Patriarchi e i precetti dei Proverbi5[C1]. n particolare la catechesi storico'salvifica dei competenti o illumunandi, con approfondimenti dottrinali, caratteristica delle numerose spiegazione del (imbolo, presentato come sintesi della storia della salvezza. (oprattutto nella catechesi mistagogica ai neofiti la storia della salvezza incontra una pi9 ampia e dinamica interpretazione. Particolarmente significativa la testimonianza di Cirillo di @erusalemme. Nella prima catechesi mistagogica la rinunzia a satana e la liturgia battesimale sono poste in relazione al passaggio del Bar >osso. L*antico esodo detto nG```, il nuovo ``````b`: l" abbiamo Bos/, la liberazione dalla schiavit9 dell*ggitto, il sangue di un agnelloA $ui il Cristo, la liberazione dal peccato, il sangue dell*&gnello immacolato. l termine nG``` ha il senso di 4figura5, 4ombra5, 4prefigurazione5. 0a riferimento ad un evento specifico dell*&ntico =estamento, ricco di un profondo e misterioso significato che rinvia all*agire, pur nascosto, di )io nella storia. L*evento di liberazione operata da Cristo nel battesimo, invece, ``````b`, cio verit", realizzazione piena, vera. Con la seconda catechesi mistagogica Cirillo istituisce una relazione fra la morte risurrezione storica di Cristo e la sua partecipazione sacramentale e simbolica degli illuminandi nel battesimo: Cristo veramente '`````o``' morto e risorto, mentre il nuovo credente, con il battesimo, partecipa 4in imitazione5 'bbb```b' alla morte e risurrezione di Cristo. n $uesto caso il battesimo detto ```n`n````: nel sacramento si verifica una partecipazione imitativa simbolica alla morte e risurrezione di Cristo. l suo effetto, per#, vero e reale: attua la salvezza. Per Cirillo, dun$ue, tre termini scandiscono la storia della salvezza: l*antico esodo nG```, 4figura5 della liberazione divina. 8uesta diventa verit", realizzazione piena, ``````b`, in Cristo. Nel tempo della Chiesa il nuovo credente inserito nella liberazione di Cristo attraverso il battesimo, che ```n`n````, partecipazione vera, ma imitativa simbolica, alla morte e risurrezione di Cristo. Ci# che viene affermato del battesimo si applica, nelle successive catechesi gerusalemitane, alla confermazione e all*eucaristia[C%].

n generale nella catechesi mistagogica i Padri 'come =ertulliano, Cirillo di @erusalemme, &mbrogio, =eodoro di Bopsuestia' si avvalgono di una spiegazione tipologica: diversi avvenimenti dell*&ntico e Nuovo =estamento, connessi all*ac$ua m della creazione, del diluvio, del Bar >osso, di Beribafdel @iordano' alle unzioni dei re e dei profeti, alla manna e alla moltiplicazione dei pani, nei $uali si manifesta l*azione salvifica di )io, sono presentati come nG```, vale a dire immagine, figura, anticipo di ci#

che )io, in modo pieno, compie oggi con il battesimo, la confermazione e l*eucaristia. (i tratta di 4segni5, ricchi di efficacia, che aiutano a scoprire il valore e l*ordine della storia della salvezza: essi rinviano alla presenza operante di )io nel passato, nello stesso tempo confermano ed esprimono l*agire di )io nell*oggi in pienezza e potenza maggiori. 8uesti sacramenti sono, dun$ue, le magnalia )ei, le grandi azioni con le $uali )io non solo fa crescere la Chiesa ma continua in modo sorprendente la sua storia di salvezza. 8uesta visione invita a superare la concezione individualistica dei sacramenti, a riscoprire il loro significato ecclesiale e la loro valenza di segni efficaci dell*economia salvifica. (i giustifica, cos-, la loro celebrazione comunitaria, il loro stretto legame alla Pas$ua, la coerente novit" di vita richiesta ai neofiti, non solo sul piano personale ma anche su $uello ecclesiale e apostolico'missionario: ogni credente in Cristo, infatti, chiamato a collaborare con )io, che opera nella Chiesa e nella storia, per la costruzione del mondo nuovo. (e la conversione al !angelo l*opera che )io ha riservato a se stesso, la testimonianza del >isorto opera che )io affida a coloro che sono discepoli del (ignore per l*edificazione del suo >egno nella Chiesa e oltre[C+]. & tutto ci# introduce e abilita il processo di iniziazione cristiana.

L*insieme di $uesti tratti specifici conferisce all*intero processo d*iniziazione cristiana un carattere di sacramentalit. )ionisio porobio, riferendosi alla totalit" del cammino iniziatico, parla del 4grande sacramento dell*iniziazione cristiana5[C2]. n altre parole, tutto il processo iniziatico significa e comunica la salvezza: gradatamente suscita e nutre la fedeA in tappe successive, grazie all*aiuto divino, purifica il cuore dell*uomo e lo libera dal potere del maleA in forma sempre pi9 ricca apre il nuovo credente al dono di vita e alla comunione con )io che, accolto con cuore disponibile, lo configura progressivamente a CristoA via via introduce il catecumeno nel mistero di morte e risurrezione, sino alla sua piena partecipazione con la celebrazione del battesimo, confermazione, eucaristia[C;]. diversi momenti ed interventi del processo iniziatico, espressione dell*azione materna e salvifica della Chiesa, assumono, pertanto, una valenza sacramentale'salvifica: ci# vale per l*accompagnamento della comunit" ecclesiale, per l*azione pastorale'formativa dei numerosi ministri ed operatori '$uali il !escovo, i sacerdoti, i diaconi, gli esorcisti, i catechisti, i garanti e i padrini' si applica all*esperienza della preghiera e della vita penitenziale, alla catechesi e all*approfondimento della Parola, si attua in modo eminente con i diversi riti e celebrazioni, in particolare $uella dei sacramenti dell*iniziazione[C6].

&d un*analoga conclusione, seppure diversamente motivata, perviene N. >atzinger, che scrive: 4La formula battesimale nella sua forma pi9 antica stata una professione di fede. g parimenti la professione di fede, nella sua forma pi9 antica, stata parte del sacramentof La formula battesimale, essendo veramente un credo dialogico, presuppone un lungo processo di apprendimentof Ci# significa che, tramite la professione battesimale, l*intero catecumenato si inserisce nel battesimo. gssendo la professione di

fede elemento essenziale di $uesto sacramento, anche il catecumenato ne diventa parte5[CC].

(i pu#, dun$ue, affermare che il divenire cristiano attraverso l*esteso processo iniziatico tutto un evento di grazia, che si estende dalla chiamata alla fede sino al suo momento conclusivo con la celebrazione del battesimo e la mistagogia. Per $uesto le diverse tappe del cammino inziatico non sono tappe verso il battesimo, bens- tappe del battesimo, vale a dire tappe dell*evento di liberazione e salvezza che culmina con la celebrazione battesimale[C7]. l processo di iniziazione cristiana ac$uista, cos-, un nuovo significato: in esso le numerose attivit" e i diversi interventi della comunit" cristiana e dei singoli ministeri esprimono l*azione salvifica della Chiesa, restano ad essa profondamente vincolati a livello spirituale ed operativo, hanno un valore non solo individuale ma comunitario.

Il cammino catecumenale
l catecumenato antico era una tappa fondamentale del processo iniziatico. n senso proprio esso si estendeva dalla prima accoglienza dei nuovi credenti nella comunit" cristiana tra i catecumeni sino alla soglia del battesimo[CD]. l tempo catecumenale si articolava in due tappe: un esteso ed esigente periodo di formazione e conversione, arricchita, nel secolo, da una breve esperienza spirituale, di pochi giorni, precedente la celebrazione battesimaleA una prima tappa, al$uanto ampia, di orientamento al cristianesimo e di una iniziale conversione, alla $uale, nel ! e ! secolo, seguiva una seconda tappa, durante la 8uaresima, di intensa e rigorosa formazione e crescita spirituale, prima della celebrazione, nella !eglia pas$uale, dei sacramenti dell*iniziazione.

Parte integrante del processo iniziatico, la proposta del catecumenato ne assumeva gli stessi tratti fondamentali e costitutivi. 0inalizzato a formare il vero discepolo di Cristo e a promuovere una progressiva santificazione, il cammino catecumenale si fondava su una vitale esperienza comunitaria nel grembo materno della Chiesa. catecumeni, sostenuti dall*accoglienza fraterna, dalla testimonianza e preghiera dei fedeli e dall*accompagnamento spirituale dei padrini, percorrevano un ricco itinerario formativo spirituale, fondato su una triplice esperienza: approfondimento della parola di )io soprattutto attraverso la catechesi, esercizi ascetico'penitenziali, inoltre riti e celebrazioni.

La catechesi, universalmente attestata, occupava un posto centrale e insostituibile nella formazione e crescita spirituale dei nuovi credenti. ,rganica e sistematica, profondamente radicata nella (acra (crittura, introduceva al piano salvifico di )io e proponeva, seppure in forma essenziale, i contenuti fondamentali del messaggio cristiano. &veva lo scopo di favorire l*apprendimento, soprattutto la risposta di fede, la conversione del cuore, lo sviluppo di un comportamento cristiano. l suo vitale legame con le altre componenti del processo iniziatico, le scelte contenutistiche e i criteri pedagogici e applicativi conferivano un volto proprio e originale al suo modello di trasmissione della Parola.

@li esercizi ascetico-penitenziali erano numerosi, severi, sempre pi9 fre$uenti con l*avvicinarsi del battesimo. &bituale era la richiesta del digiuno, a cui si aggiungeva sovente l*invito all*astinenza dalle carni e dal vino, alla moderazione nel cibo e nelle bevande, in alcune testimonianze anche alla rinunzia temporanea per gli sposati ai rapporti matrimoniali. grano proposte elemosine, opere di carit" e solidariet" fraterna, distacco dai beni materiali. @rande risalto veniva dato alla preghiera. grano previsti diversi esercizi di mortificazione corporale: oltre al digiuno e all*astinenza, si raccomandava la frugalit", talvolta la rinunzia all*ac$ua, il cilicio, prostrazioni, lacrime, veglie notturne, dormire per terra, in alcune Chiese anche la privazione del bagno. &ncora pi9 insistente era la richiesta di un*ascesi spirituale: confessione dei peccati, perdono delle offese, freno della lingua e degli occhi, lotta contro le passioni, correzione di vizi e difetti. La severit" di $ueste forme penitenziali paragonata da &gostino alla macinazione del grano[7?]. 8ueste diversi esercizi, proposti dalla Chiesa e testimoniati dai fedeli, erano un efficace sostegno al cammino spirituale dei catecumeni. &vevano un valore ascetico: si mortifica la carne per liberare lo spirito, ci si esercita in un combattimento spirituale per rompere con le cattive abitudini e per ac$uisire un comportamento evangelico[71]. 0avorivano un*apertura e disponibilit" a )io e agli altri[7%]. grano, poi, un via di purificazione. 4 mponendo sofferenze e afflizioni al nostro corpo e al nostro spirito, scrive =ertulliano, noi rendiamo soddisfazione dei peccati commessi5[7+]. g &gostino ricorda che i competenti 4si purificano con l*astinenza, i digiuni e gli esorcismi5[72].

l cammino catecumenale, inoltre, era sostenuto da riti e celebrazioni, sempre pi9 numerosi nella tappa che precede il battesimo. n ,ccidente si incontra il rito dell*accoglienza dei nuovi credenti tra i catecumeni: segno di croce, sale e imposizione delle mani. <niversale era la prassi dell*esorcismo ripetuto con fre$uenza: si invocava l*aiuto del (ignore per liberare il catecumeno dalle catene del male. >ivestiva particolare rilievo, all*inizio della 8uaresima, il rito di ammissione dei catecumeni tra gli eletti o illuminandi, seguito dalla nomendatio in ,ccidente o dalla onomatographia in ,riente. (i avevano, $uindi, gli scrutini, una sorta di celebrazioni penitenziali comunitarie con

l*inserimento dell*esorcismo, che a >oma e a Bilano venivano celebrati tre volte nelle domeniche $uaresimali. &nche gli esorcismi, che prevedevano la partecipazione dei fedeli, avevano lo scopo di purificare i candidati al battesimo e di sostenerli nel loro combattimento spirituale[7;]. !erso la fine della 8uaresima erano comunemente previste la traditio del (imbolo e, dopo alcuni giorni, la sua redditio. n alcune Chiese si incontrava anche un*analoga traditio e redditio del Padre Nostro. & $uesti riti si deve aggiungere la pubblica preghiera per i nuovi credenti durante l*eucaristia domenicale per i catecumeni. =utti $uesti riti e celebrazioni, mentre esprimevano la presenza materna della Chiesa e introducevano progressivamente alla vita liturgica della comunit" cristiana, nello stesso tempo sostenevano e alimentavano la risposta di fede ricordando che la crescita spirituale primariamente un dono dall*&lto.

Le tre esperienze proposte nel catecumenato 'la catechesi e l*approfondimento della Parola, gli esercizi ascetici e penitenziali, i riti e le celebrazioni' erano vitalmente connesse: si integravano vicendevolmente e si sostenevano reciprocamente al servizio della formazione e santificazione del catecumeno. grano le azioni con le $uali la Chiesa si prendeva cura dei figli concepiti nella fede, come ricorda espressamente il vescovo 8uodvultdeus, rivolgendosi ai competenti: 4@li esorcismi, i salmi, le insufflazioni, il cilicio, le genuflessionif tutto ci# il cibo con cui vostra madre vi alimenta nel suo grembo5[76]. La triplice esperienza, testimoniata con dovizia nella prassi antica anche se con diverse accentuazioni, ancora chiaramente attestata da Leone Bagno, verso la met" del ! secolo[7C].

Modello della catechesi catecumenale

n senso proprio la catechesi del catecumenato antico presuppone una prima evangelizzazione ed successivamente integrata con la catechesi mistagogica nei primi giorni dopo il battesimo. n modo esplicito Clemente &lessandrino pone la distinzione tra un primo annuncio o rerigma e la successiva catechesi: 4(i pu# dire che il latte la prima predicazione 'Z````b`' diffusa in abbondanza, mentre il cibo solido la fede solidamente stabilita grazie alla catechesi mZ`n````b`5. g spiega: all*inizio i nuovi catecumeni sono 4esseri di carne ancora come bambini5 che devono essere alimentati con latte, poi, un po* pi9 cresciuti, dovranno essere nutriti con cibo solido[77].

Insegnamento iniziale
Prima della catechesi, dun$ue, si aveva una prima evangelizzazione, che sovente, soprattutto nel secolo, precedeva l*ingresso tra i catecumeni, altre volte aveva luogo all*inizio del cammino catecumenale. 8uesta primo incontro con il messaggio cristiano e con il !angelo era opera di missionari itineranti, come testimonia ,rigene[7D], veniva assicurato dall*azione evangelizzatrice di laici[D?], trovava attuazione nell*accompagnamento dei garanti[D1]. =alvolta era offerto attraverso sermoni che, soprattutto &mbrogio e &gostino, rivolgevano unitamente a cristiani e pagani, altre volte grazie ad una prima catechesi ai principianti, come testimoniato a Cartagine e in altre Chiese del Nord &frica ai tempi di &gostino.

Per ,rigene la prima predicazione aveva lo scopo di suscitare l*abbandono degli idoli e l*adorazione a )io, creatore di tutte le cose. (eguiva una prima presentazione di @es9, annunciato dalle profezie e testimoniato dagli scritti neotestamentari[D%]. Pur con sensibilit" teologica e pastorale diversa, analogo procedimento era previsto da &mbrogio per uditori pagani. &nzitutto, scrive il !escovo di Bilano, si deve dimostrare che vi un solo )io, poi confutare il politeismo[D+]. 8uindi, aggiunge: 48uando hai fatto accogliere l*idea d*un unico )io, allora, grazie alla sua testimonianza, dimostrerai che la salvezza c* stata data attraverso Cristo5[D2]. g nel presentare @es9 Cristo si deve partire dalla sua umanit" e, successivamente, arrivare al suo mistero. (olo cos- si evita il rifiuto dell*ascoltatore, perch/, argomenta, 4$uando mai gli &teniesi avrebbero potuto credere che il s!erbo si fece carnet e la !ergine concep- dallo (pirito, se fecero ironia all*udire la risurrezione dei morti`5[D;]. 8uando, poi, l*annuncio veniva rivolto ai giudei, il discorso di &mbrogio ignora, come ovvio, il riferimento al monoteismo e all*idolatria, per concentrasi subito sulla figura di @es9 Cristo, movendo dall*orizzonte familiare ai destinatari dell*&ntico =estamento, in particolare dei profeti[D6]. &nche @regorio di Nissa riteneva necessario, prima di una formale catechesi, sviluppare una corretta idea di )io, unico, creatore, trascendente, perfetto, movendo dalle 4particolari concezioni5 degli uditori e dai 4loro pregiudizi5[DC]. (oprattutto nel e catechizandis rudibus! &gostino offre la proposta pi9 articolata di un primo annuncio: nell*esporre la storia della salvezza si deve soprattutto 4mostrare l*amore che )io per ha noi5[D7], soffermandosi sui 4mirabili eventi5[DD] operati dal (ignore, che trovano il loro compimento nella salvezza attuata in @es9 Cristo, che non solo venuto per rivelare l*amore di )io, ma si 4fatto uomo per noi5[1??], ha ottenuto il perdono dei peccati con la sua morte e risurrezione e continua ad operare nella Chiesa, suo corpo.

n generale il nuovo credente era introdotto alla fede cristiana attraverso la testimonianza ed evangelizzazione di cristiani, alla $uale seguiva una sorta di 4catechesi di avvio5 per suscitare l*abbandono degli idoli e l*adesione al )io unico, dando risalto al carattere alternativo della proposta evangelica rispetto alle abitudini e ai valori pagani, assumendo, come nel caso di &gostino, un pi9 esplicito carattere rerigmatico.

Catechesi catecumenale
La predicazione del !angelo caratterizz# l*azione degli &postoli, dediti al 4ministero della parola5 1&t 6, 23. &lla predicazione missionaria seguiva ordinariamente l*approfondimento della fede e della vita cristiana attraverso un*istruzione dottrinale e parenetica. Con i Padri apostolici l*insegnamento catechistico, destinato a sostenere e rafforzare la fede dei nuovi credenti, assunse diversi moduli, come lo schema delle 4due vie5[1?1], $uello della 4promessa'compimento5[1?%], senza escludere $uello apologetico[1?+].

Con lo sviluppo del catecumenato si assistette alla nascita di una proposta catechistica con connotazioni proprie e originali, anche se essa conobbe varianti nel tempo e tra le Chiese. )estinatari dell*istruzione catechistica erano giovani e adulti che, grazie al primo incontro con il messaggio cristiano, avevano sviluppato un*iniziale fede e conversione. Nel secolo la catechesi, svolta in talune Chiese da laici, in altre da diaconi o presbiteri, costituiva l*esperienza portante e continuativa del cammino catecumenale, come espressamente documentato da ppolito >omano e ,rigene, da =ertulliano e Cipriano, cos- pure dalla idascalia degli "postoli. Conobbe, nel ! e ! secolo, uno sviluppo organico e un approfondimento contenutistico. L*azione catechistica, assicurata dal !escovo o da un suo delegato durante la 8uaresima, aveva una periodicit" $uotidiana, dal luned- al venerd-. gra finalizzata a promuovere nel catecumeno'eletto un approfondimento della fede e conversione[1?2].

La catechesi dei Padri non si esaurisce con $uella del catecumenato. q certo, per#, che la catechesi catecumenale, con la sua finalit", il suo sviluppo contenutistico, il suo raccordo con la comunit" e l*intero processo iniziatico, raggiunge un valore e una esemplarit" che travalica il catecumenato.

Sua identit
due termini 4catechesi5 e 4catecumeno5 rinviano allo stesso verbo: Z`n```o. (e catechesi indica l*azione dell*insegnare a viva voce facendo echeggiare la parola, catecumeno designa il soggetto che ascolta la parola trasmessa verbalmente lasciandola riecheggiare nella propria vita[1?;]. 8uesta reciproca implicanza dei due termini, espressa a livello etimologico, trova una sua propria e concreta traduzione nel cammino catecumenale, impegnando chi fa e chi riceve la catechesi ad una relazione dinamica e aperta al mistero della parola di )io: un atto di fedele interpretazione e di sapiente mediazione nel primo, un cuore disponibile all*ascolto e all*accoglienza nel secondo. & sua volta la catechesi condivide la stessa finalit" del processo iniziatico: sviluppare fede e conversione del nuovo credente, promuovere conoscenza e adesione al piano salvifico, sostenere il cammino spirituale di liberazione e santificazione. n particolare la catechesi si caratterizza per il suo inserimento vitale nel processo iniziatico'catecumeanle: colonna portante, fattore di continuit" dell*esperienza formativa e spirituale, luogo di connessione delle componenti iniziatiche, che arricchisce e dalle $uali arricchita, ricevendo sostegno e fecondit".

Tratti fondamentali
@li aspetti essenziali della catechesi catecumenale, schematicamente anticipati nella descrizione della sua identit", meritano un*ulteriore esplicitazione. gssi delineano pi9 chiaramente il modello catechistico.

#a catechesi ha un carattere dialogico. Come ricorda efficacemente Nean )ani/lou, 4la catechesi trasmissione viva del deposito della fede ai nuovi membri della Chiesa5[1?6]. gssa si fonda sulla (. (crittura e sulla fede sulla Chiesa espressa sinteticamente nel (imbolo che, secondo &gostino, 4regola della fede5[1?C]. La catechesi, al servizio della fede e della conversione del catecumeno, una trasmissione della Parola non disincarnata ma attenta all*uomo, alla sua concreta condizione religiosa, culturale e spirituale. Per $uesto chi fa catechesi deve anzitutto preparare e disporre il cuore degli uditori ad accogliere la Parola come il contadino che butta il seme dopo avere dissodato il campo[1?7]. ,ccorre che la predicazione iniziale, come ricordano ,rigene, &mbrogio,

@regorio di Nissa, faccia riferimento alla situazione religiosa del pagano, dell*ebreo o dell*eretico per smantellare l*idolatria, i pregiudizi e gli errori, che l*insegnamento si adatti ai diversi destinatari e alle loro categorie culturali e filosofiche[1?D]. q poi necessario sviluppare e nutrire la fede con un progressivo nutrimento, rispondente alle capacit" spirituali del credente: l*immagine del latte e cibo solido di Clemente &lessandrino diventa, per ,rigene, latte per i principianti, legumi per chi comincia a progredire, carne per i perfetti[11?]. (oprattutto la catechesi mediazione della parola, capace di promuovere dialogo e risposta vitale. Lo afferma Clemente &lessandrino con un efficace paragone: 4Come il gioco della palla non dipende solo da chi la batte secondo le regole, ma richiede $ualcuno che la riceva sullo stesso ritmo, perch/ la partita si possa giocare secondo le norme del gioco, cos- la dottrina insegnata si trova idonea a essere creduta $uando vi collabora la fede degli ascoltatori, che , per cos- dire una sorta di sarte naturalet. &nche il terreno, $uando fecondo, collabora all*opera della seminaA cos- non v* giovamento alcuno nell*educazione anche ottima senza la disponibilit" del discepolo5[111]. &nalogo concetto, sintetico ed efficace, viene espresso da Cirillo di @erusalemme nella sua catechesi di avvio agli illuminandi: 4& me spetta parlare, a voi aderire alla parola, a )io portare a compimento5[11%].

Commenta @iuseppe Laiti: 4Necessariamente la catechesi dialogica: $uesta la sua regola5[11+]. gssa suppone un*apertura di fede, comporta un insegnamento che introduca e approfondisca il piano salvifico, mira a informare tutta la vita. Nell*ascolto della Parola il catecumeno invitato a interrogarsi, a 4sradicare i vizi abituali e spegnere i barbari costumi5[112], ad aprirsi all*amore di )io[11;]. 8uesto dialogo con la Parola e con )io[116] non si esaurisce con la catechesi. gsso si fa risposta con la preghiera, con il combattimento spirituale e la conversione attraverso esercizi ascetico'penitenziali, con gli esorcismi. =rova sostegno nel confronto, silenzioso o aperto, del catecumeno con la testimonianza della comunit" cristiana e degli accompagnatori. >aggiunge la sua espressione pubblica e solenne nella traditio e redditio del (imbolo. )iventa impegno definitivo nella rinunzia a satana e nella professione di fede prima dell*atto battesimale. La catechesi trasmissione viva del deposito della fede. Non, per#, da sola.

#a catechesi $ servizio alla fede e alla vita cristiana. )ani/lou, utilizzando 4iniziazione5 in senso lato, attribuisce alla catechesi antica anche la caratteristica di 4iniziazione cristiana integrale, che risponde alla totalit" della personaf n $uesta prospettiva totale la catechesi , insieme, iniziazione al contenuto della fede, alla vita cristiana, alla preghiera e alla vita sacramentale5[11C]. =ale funzione, comunemente testimoniata dai Padri, si applica ad un titolo particolare alla catechesi catecumenale. (e =ertulliano richiede fede matura e conversione per accedere al battesimo, &gostino ricorda ai nuovi credenti, in tutto il tempo in cui sono catecumeni e in modo pi9 approfondito $uando sono competenti, che 4imparino $uale deve essere la fede e $uale la vita del cristiano' audiant $uae fides et $ualis vita debeat esse cristiani5. g pi9 oltre, nella stessa opera, aggiunge: 4Coloro che chiedono il battesimo devono essere catechizzati in modo tale che

non solo ascoltino ed accolgano che cosa credere ma anche come debbono vivere5[117]. Non dissimile il pensiero di Cipriano, secondo il $uale il catecumeno, 4avendo abbracciato la verit" della Chiesa, viene per imparare ed impara per vivere5[11D]. n particolare il compito della catechesi $uello di promuovere un nuovo modo di pensare e di agire ispirato alla parola di )io, come affermato efficacemente da s. pasilio. <tilizzando l*immagine della cera che assume esattamente la forma dello stampo, egli chiede che 4il cuore, la parola e l*azione 1del catecumeno3 prendano lo stampo e la forma dell*insegnamento del nostro (ignore @es9 Cristo5[1%?]. &nche ,rigene, richiamando l*azione formativa dei cristiani, scrive: 48uando essi hanno abbattuto i dogmi paganif. i cattivi pensieri e i sentimenti empi, ricostruiscono nel cuore di colui che essi hanno demolito, i buoni pensieri, i sentimenti di piet", vi deporranno la dottrina di verit", lo istruiranno nei riti religiosi, gli insegneranno i costumi e le regole dell*osservanza5[1%1]. Per &gostino lo scopo della catechesi non solo $uello di sdoceret o insegnare e di sdilectaret o allietare l*uditore, ma di smoveret, cio di commuovere l*ascoltatore per indurlo a rinnovarsi e ad aderire al (ignore. Per $uesto ricorda a )eogratias: 4gsponi ogni cosa in modo tale che chi ti ascolta, ascoltando creda, credendo speri e sperando ami5[1%%]. n altre parole si tratta di sviluppare la fede, la speranza e la carit". Per accedere al battesimo, come gi" ricordato da pasilio, bisogna prima diventare veri discepoli del (ignore. Per $uesto la catechesi catecumenale non si limita all*apprendimento. gssa diventa ascolto e approfondimento della Parola per crescere nella fede, nell*amore a )io e nella carit" fraterna, nella preghiera e nelle buone opere, per sradicare vizi e comportamenti immorali e ac$uisire un modo nuovo di pensare, giudicare e agire conforme a Cristo. 8uesto sviluppo spirituale dovuto, ad un titolo particolare, all*ascolto e accoglienza della Parola di )io, come sottolinea ,rigene[1%+]. )iventa, per#, concreto ed efficace con il sostegno della comunit" dei fedeli, grazie all*aiuto dei padrini, attraverso gli esercizi ascetico'penitenziali, per mezzo di riti e celebrazioni.

#a catechesi $ insegnamento completo! organico ed essenziale% Cirillo di @erusalemme ricorda agli illuminandi che 4la vita cristiana consta di due realt": le verit" di fede e le buone opere. )io non accetta n/ la dottrina senza le opere buone, n/ le opere buone senza la dottrina5. Premesso $uesto legame inscindibile tra verit" e vita, continua il !escovo: 4@randissimo tesoro la conoscenza delle verit" cristiane5[1%2], chiamate 4dogmi5. Nelle testimonianze patristiche le verit" cristiane abbracciano l*insieme del mistero cristiano: insegnamento morale, dogmatico e, seppure parzialmente, sacramentale.

Non mancano sensibili varianti nell*esposizione dei contenuti catechistici. l Crisostomo accentua l*aspetto morale con essenziali accenni ai riti e ai sacramenti. &mbrogio, dopo una catechesi d*inizio su )io unico e creatore e sulla figura di Cristo, d" spazio alla formazione morale nelle prime settimane della 8uaresima, per poi concentrarsi sulla spiegazione del Credo. Cirillo, richiamate nelle prime due catechesi le disposizioni e la conversione necessarie al catecumeno per accedere al battesimo, il cui

significato viene sinteticamente sviluppato nella catechesi, presenta, nella !, una sintesi delle verit" cristiane, alla $uale segue, nella !, la trattazione della fede richiesta per aderire alla spiegazione del (imbolo, che 4racchiude tutta la dottrina della fede in pochi versettif tutta la conoscenza della piet" contenuta nell*&ntico e nel Nuovo =estamento5[1%;]. Completa la formazione, nelle catechesi ! '.! , con un ampio approfondimento dei contenuti che, seguendo gli articoli del Credo, riguardano )io, @es9 Cristo, Lo (pirito (anto, la risurrezione della carne, la Chiesa e la vita eterna. !erso il +7? a @erusalemme, secondo la testimonianza di ggeria, i catechizzandi ricevono nelle prime cin$ue settimane $uaresimali una catechesi biblica, con probabile riferimento alla storia della salvezza, per poi essere istruiti sul (imbolo, spiegato articolo per articolo dal !escovo[1%6].

La spiegazione dei Padri costantemente fondata sulla (crittura, attenta a richiamare l*economia salvifica, sollecita a evidenziare, di volta in volta, verit" dogmatiche, deviazioni eretiche, aspetti morali, esigenze applicative. La testimonianza pi9 esemplare offerta da Cirillo di @erusalemme nella sua spiegazione del (imbolo. ,gni catechesi inizia con il richiamare un articolo o una sua parte, a cui segue la citazione di un testo scritturistico attinente al tema. (i ha $uindi un approfondimento dell*argomento con ampi riferimenti ai due =estamenti e con la confutazione di eresie o errori. (i conclude additando la bellezza e la fecondit" della fede della Chiesa, la sua fondazione biblica, la sua rilevanza per la vita del credente. )i fatto la catechesi catecumenale ad un tempo biblica e dottrinale. g l*accostamento alla (crittura si sviluppa sovente con una interpretazione letterale e spirituale: sono richiamati e spiegati avvenimenti e personaggi, per poi sottolinearne il loro significato esistenziale, la loro incidenza nella vita del credente.

L*insegnamento catechistico, inoltre, va all*essenziale, assicurando tuttavia uno sviluppo organico. q comprovato dalla prassi: nel periodo di maggiore ricchezza contenutistica la catechesi dei battezzandi si limitava al tempo della 8uaresima. <lteriore conferma viene da esplicite testimonianze. ,rigene distingue fra punti essenziali e chiari, destinati a tutti i credenti, ed enunciati che possono essere approfonditi da chi ha il dono della sapienza ed amante delle scienza[1%C]. Per il Crisostomo il compito della catechesi $uello di 4porre salde fondamenta5 all*albergo, che il catecumeno, e di 4renderne salde le pareti5[1%7]. La stessa immagine ripresa ed arricchita da Cirillo di @erusalemme, che paragona la catechesi alla costruzione di un edificio, dove occorrono solide fondamenta e una forte connessione fra le pietre: 4 Pensa che la catechesi sia la costruzione di un edificio. (e non scaviamo profondamente nel porre le fondamenta, se non congiungiamo ordinatamente il fabbricato con raccordi murari per eliminare ogni discontinuit" che ne compromette la consistenza, non ricaveremo alcun vantaggio neppure dalle precedenti fatiche. Ba occorre che una pietra si appoggi ordinatamente all*altra e un angolo all*altro, e che, amputata ogni sporgenza, il resto dell*edificio s*innalzi uniforme. &llo stesso modo noi ti portiamo come le pietre della scienza: bisogna

che tu sia istruito sul )io vivente, sul giudizio, su Cristo, sulla risurrezione. g molte altre cose devi impararef (e tu non ne fai la sintesi e non ricordi $uanto precede e $uanto seguef hai un edificio destinato a crollare5[1%D].

Se vero che lapprofondimento ordinato del mistero cristiano assicurato formalmente dalla catechesi, hanno, per, una dimensione catechistica le celebrazioni -in particolare la liturgia della Parola della messa domenicale e gli scrutini- lesperienza della comunit cristiana, la testimonianza e lammaestramento del padrino !accoglienza della Parola, trasmessa nella catechesi, trova poi efficacia applicativa grazie agli esercizi ascetico-penitenziali ed sostenuta soprattutto con gli esorcismi

La catechesi componente fondamentale del processo iniziatico catecumenale! Catechesi, liturgia e esercizi ascetico penitenziali camminano insieme, sostenuti dall"esperienza della comunit ecclesiale e dalla testimonianza dei fedeli! La catechesi assolve una funzione propria in un rapporto di reciprocit con le altre componenti iniziatiche# grazie alla sua regolare scansione temporale assicura continuit e progressione al cammino spirituale del catecumeno$ con la trasmissione della %arola sviluppa la fede e il dialogo con &io che continuano, arricchiti e potenziati, nelle cele'razioni$ attraverso il suo insegnamento invita alla conversione, richiama comportamenti ispirati alla parola del Signore che trovano una risposta concreta negli esercizi ascetici e penitenziali, idonei a favorire l"acquisizione di atteggiamenti cristiani!

(ssendo, poi, la catechesi parte viva del processo iniziatico, ne condivide finalit e natura! Come l"iniziazione tutta anche la catechesi tende

allo sviluppo integrale della vita cristiana! Con il suo insegnamento apre all"orizzonte della storia della salvezza che continua e trova nell"oggi conferma e cele'razione nei sacramenti dell"iniziazione cristiana! Insieme all"intero processo iniziatico anche la catechesi ha una valenza sacramentale# la %arola mediata dal catechista, accolta dal catecumeno disponi'ile, ma sempre dono di vita e opera di salvezza operata dal Signore, come ricorda efficacemente )gostino# *Colui che ci ascolta, o meglio attraverso noi ascolta &io, incomincer a progredire nella scienza e nella vita morale, e ad entrare alacremente nella via di Cristo, non oser attri'uire questo progresso n+ a noi ,catechisti-, n+ a se stesso! Ma se stesso, noi, e tutti gli altri che ama, amer in Lui e per Lui che lo amato quando era nemico, s. da farlo amico santificandolo/01234! Inoltre, anche la catechesi, come il processo iniziatico nella sua glo'alit, avviene nella Chiesa ed opera della Chiesa# sviluppa *quella fede che ti consegnata dalla Chiesa/01214, trova alimento e sostegno nella esperienza comunitaria e cele'rativa, esprime l"azione materna e salvifica della Chiesa01254! %er questo sovente ai catecumeni era riservato uno spazio proprio nell"edificio dove era convocata la comunit dei fedeli! Si voleva, concretamente, ricordare che erano gi appartenenti alla Chiesa, che avevano diritto ad una particolare cura e sostegno, che condividevano gi i 'eni della %arola, della fede, della carit, della preghiera6 in attesa della piena condivisione nella mensa eucaristica!

La catechesi catecumenale non esaurisce l*intera catechesi del processo iniziatico. gssa seguita e completata da $uella mistagogica, con una sua finalit", propri contenuti ed uno specifico procedimento che ne configurano in modo originale il suo modello[1++]

Senza archeologismi

n $uesti ultimi decenni, insieme al catecumenato degli adulti, stato programmato o avviato in Chiese sempre pi9 numerose anche $uello dei fanciulli. La stessa riflessione pastorale ha riservato un*attenzione sempre pi9 estesa alla catechesi a modello catecumenale, sottolineata a sua volta da alcuni documenti ufficiali. La &vangelii nuntiandi osserva 4che le condizioni attuali rendono sempre pi9 urgente l*insegnamento sotto la forma di un catecumenato5 1n. 223. Nel 1DCC il 'essaggio al popolo di io del (inodo dei !escovi dichiara che 4modello di ogni catechesi il catecumenato antico5 1n. 73, soffermandosi successivamente su gli aspetti fondamentali di tale catechesi 1nn. 7'1?3. &nche il Catechismo della Chiesa Cattolica ricorda che 4per la sua stessa natura il battesimo dei bambini richiede un catecumenato post'battesimale5 e che nel rito romano 4l*iniziazione cristiana dei bambini continua durante alcuni anni di catechesi, per concludersi pi9 tardi con la confermazione e l*eucaristia, culmine della loro iniziazione cristiana5 1n. 1%+1 e 1%++3. (oprattutto il nuovo irettorio generale per la catechesi, del 1DDC, prevede per un primo approfondimento della fede una catechesi di base 4al servizio dell*iniziazione cristiana5, detta anche 4catechesi di iniziazione5 1nn. 6;'66 e 6D3, delineandone le caratteristiche fondamentali 1nn.6C'673, ricordando che 4il catecumeno battesimale il modello ispiratore dell*azione catechizzatrice5 della Chiesa 1n. D?3.

,ggi parlare di catechesi a modello catecumenale implica un riferimento all*esperienza dei primi secoli. 4,gni volta, scrive lenri )e Lubac, che la Chiesa indaga sulla sua fede, sul suo pensiero e sulla sua teologia, essa ritorna ai Padri5[1+2]. Nello stesso tempo l*attuale contesto sociale, culturale, religioso e anche $uello ecclesiale ha pochi contatti con $uello dei primi secoli. 8uale lezione, dun$ue, il modello di catechesi del catecumenato antico pu# offrire alle comunit" e agli operatori del nostro tempo`

0are riferimento al passato non significa cadere nella tentazione di archeologismo. <n richiamo che, gi" alla fine del . . secolo, risuonava nelle sagge parole di Luis )uchesne: 4Nella Chiesa nessuna preoccupazione per l*avvenire pu# disinteressarsi della tradizione. Ba non sono cos- anti$uato da credere che l*avvenire del cristianesimo consista nella restaurazione di $uesto o $uell*altro antico stato di cose, $ualun$ue siano i nomi che lo raccomandano5[1+;]. >ichiamarsi all*esperienza dei Padri impegna a individuare le scelte ispiratrice del processo inziatico e della catechesi catecumanale per, poi, attuarle con discernimento e creativit", adattandole al nostro tempo.

&nzitutto la scelta di una catechesi catecumenale nelle nostre Chiese suppone il ricupero delle componenti fondamentali dell*autentico processo iniziatico.

',ccorre anzitutto promuovere nelle nostre comunit" ecclesiali una nuova coscienza missionaria e un rinnovato impegno evangelizzatore verso chi non ha ancora conosciuto o accolto il !angelo, ma anche verso i cristiani che si sono allontanati dalla fede.

[1] La disciplina del catecumenato sino al ! secolo era prevista solo per persone sufficientemente mature: oltre ai giovani e adulti, probabilmente si estendeva anche a $uanti avevano raggiunto la prima adolescenza, come sembrerebbe alludere &gostino: 4Chi, infatti, oramai arbitro della sua volont" 'omnis enim (ui arbiter voluntatis suae constitutus est' se intende accostarsi ai sacramenti dei fedeli, non pu# incominciare una vita nuova se prima non si pente di $uella passataf )a tale penitenza sono esonerati solo i piccoli 'parvuli' non potendo essi ancora avvalersi del loro libero arbitriof Prescindendo dai piccoli, nessuno passa a Cristo, in modo da cominciare a essere ci# che non era, se prima non si pente del suo passato di non cristiano5, in iscorso +;1,%, )*" +2, 1C?. [%] L*applicazione dei tratti fondamentali del catecumenato ai fanciulli e ragazzi, con et" inferiore ai 12 anni, si incontra ufficialmente solo nel nostro tempo con la pubblicazione, nel 1DC%, dell*+rdo initiationis christianae adultorum 1, C&3. l capito ! di $uesto testo pastorale'liturgico dedicato al 4>ito dell*iniziazione cristiana dei fanciulli nell*et" del catechismo5. [+] Nella Chiesa di >oma testimonianze significative di $uesta prassi sono offerte dal ,acramentario gelasiano, la cui redazione definitiva risale alla fine del ! secolo, e dall*+rdo Romano -., compilato nel ! secolo. 8uest*ultimo rituale, utilizzato come il precedente nelle parrocchie romane, prevedeva sette celebrazioni durante la 8uaresima, chiamate 4scrutini5. &d essi seguiva la celebrazione dei sacramenti dell*iniziazione durante la !eglia pas$uale, anticipata nel pomeriggio del (abato (anto. l processo dell*iniziazione cristiana si concludeva con sette celebrazioni eucaristiche durante la settimana di Pas$ua, alle $uale assistevano i neofiti insieme ai loro genitori e padrini. [2] Nel ecretum pro .acobis del Concilio di 0irenze si afferma: 4Circa i bambini, in ragione del pericolo di morte che pu# presentarsi soventef 1la Chiesa romana3 esorta a non differire il sacramento del battesimo nei 2? o 7? giorni, secondo l*usanza di certuni, ma di conferirlo il pi9 presto possibile m $uam primum5, in )gNu N@g>, ed. +D, n. 1+2D. [;] =alvolta si incontrano parafrasi che alludono al catecumenato: il Concilio di Nicea, can. %, parla di 4tempo per il catecumeno5, in N. ). B&N( , ,acrorum Conciliorum nova et amplissima collectio, >iprod. &nastatica, @raz 1D6?, vol. , 667A in &gostino si trova l*espressione 4per tutto il tempo in cui i candidati mantengono il posto e il nome di catecumeni5, in e fide et operibus, ! , D, /# 2?, %?%.

[6] =g>=<LL &N,, "pologeticum, .!

, 2, CC# 1, 117.

[C] Per )ionisio porobio la 4iniziazione globale5 l*insieme di tutto il processo iniziatico: 4Non ci riferiamo soltanto ai momenti sacramentali dell*iniziazione, ma prendiamo in considerazione tutti gli elementi che compongono il processo iniziatico: battesimo, pedagogia familiare, prima eucaristia, catecumenato e catechesi, confermazione, comunit" eucaristicaf Nell*azione iniziatoria totale entrano in gioco la seriet" dell*evangelizzazione, l*autenticit" della comunit" ecclesiale, la verit" dell*essere cristiano5, in #a iniciaci0n cristiana. pautismo educacivn familiar primera eucaristwa catecumenado confirmacivn comunidad cristiana, gd. (igueme, (alamanca 1DD6, D. [7] Negli anni cin$uanta il catecheta francese, Paul litz, scriveva: 4Nel mondo d*oggi il scatecumenato socialet scomparso oppure si rivela inefficace. )a secoli il battesimo dei bambini generalizzato. <no diventa cristiano senza essere stato preparato alla fede e alla vita cristiana, perch/ la Chiesa d" fiducia alla famiglia e alla comunit" cristiana. &ttraverso la famiglia e la comunit" si stabilisce il congiungimento organico tra il battesimo del bambino e la fede della Chiesa. n pratica la famiglia e la comunit" assicurano insieme la formazione, l*educazione e la protezione della fede del giovane cristiano. n un mondo con tradizioni e strutture cristiane l*ambiente familiare, parrocchiale e sociale costituiscono insieme un catecumenato sociale molto reale e veramente efficace. L*intera pastorale ordinaria della Chiesa, elaborata nei nostri paesi a partire dal Bedioevo, presuppone $uesto catecumenato sociale, come pure la fede dei battezzati che vengono formati e protetti da esso. 8uesto genere di spastorale dell*ovilet fatto in funzione di persone gi" credenti e in funzione di un mondo cristiano5, in #1annonce missionnaire de l12vangile, Cerf, Paris 1D;2, 1C2'1C;. [D] Nel 1;6% il Concilio di =rento stabilisce che i !escovi 4si adoperino affinch/ almeno nelle domeniche e negli altri giorni festivi nelle singole parrocchie i fanciulli siano diligentemente istruiti, da coloro ai $uali compete, nei rudimenti della fede e nell*obbedienza a )io e ai genitori5, (essione .. !, cap. !, in Canones et ecreta Concilii 3ridentini, gd. >ichter, Lipsia,17;+, ++C. [1?] @. Ng@> , 4Prospettive odierne di un rinnovamento catechistico5, in .l catechismo oggi in .talia. &tti del 1x Convegno &mici di Catechesi, L)C, =orino 1D6?, 11C. [1?] @ ,!&NN C> (,(=,B,, Cat% , ;, /4 2D, %+D. (i veda anche Cat. , /4 2D, %%;A Cat. , +, e 6, ,C +66, 1C2 e 177. [11] =g>=<LL &N,, "pologet% ! , C, CC# 1, DD. [1%] n greco ?'_?^?' e in latino nundum iniziati. Cf. @ ,!&NN C> (,(=,B,, Cat% , 7, ,C +66, 1D2A &Bp>,@ ,, e '5steriis %, p&CN 1C, 1%6. [1+] & coloro che erano 4iniziati5 grazie ai sacramenti della !eglia pas$uale il Crisostomo d" anche il nome di b`b``b```b, oppure b``n``o`````n`` e anche b``n``o`` Gb```b. Cf. Cat. ! , %?, ,C ;?, 16%A Cat. ! , 16, ,C ;?, 1D1A Cat. , %, /4 2D, %+2A

6om% #---7 in 8oh% +, /4 ;D, 26+. &nche per Narsai i battezzati sono 4iniziati5. Parlando della dimissione dei catecumeni, dice loro: 4&ndatevene, voi che non siete battezzatif perch/ solo agli iniziati permesso partecipare ai Bisteri 1dell*eucaristia3, +melia -7..! in &. l&BB&N, #1iniziazione cristiana, Barietti, Casale Bonferrato 1D7%, 17%. [12] &nche l*, C& parla di 4sacramenti con i $uali il cristiano iniziato m sacramenta $uibus christianus initiatur5, in 4Praenotanda5, 6. [1;] Non sembra corretto intendere la 4iniziazione5 solo in termini sacramentali, anche se confermata da testimonianze patristiche. ,ccorre sottolineare che i termini b``n``o``o e b``n``o``` sono utilizzati dai Padri con significati diversi: introduzione ai misteri cristiani in generale 1Betodio di ,limpo, &tanasio, Cirillo &lessandrino, )ionigi &reopagita3A iniziazione al mistero del battesimo e della eucaristia 1@iovanni Crisostomo, pasilio Bagno, @regorio di Nissa, Bassimo il Confessore, @regorio il =eologo3A rivelazione della pibbia 1@regorio di Nissa, Cirillo &lessandrino, @regorio il =eologo3A istruzione sui misteri di Cristo, dello (pirito (anto, della Chiesa 1Clemente &lessandrino, ,rigine, @regorio il =eologo, @iovanni Crisostomo, Palladio, Cirillo &lessandrino, Bassimo il Confessore3Aanche insegnamento spirituale 1&tanasio, &sterio di &masea, Cirillo &lessandrino3. <n*elencazione pi9 dettagliata dei diversi significati di b``n``o``o e suoi derivati si pu# trovare nello studio di =. 0g)g> C , 4La mistagogia della Chiesa5, in g. &NC LL 1ed.3, 'istagogia e direzione spirituale, Pont. st. di (piritualit" del =eresianum', >, >oma'Bilano 1D7;, 16+'%2;, soprattutto le pagine 1D2'1D;. (i veda anche le voci 4b``n``o``o5 e 4b``n``o```5 in @. y. l. L&BPg, " /atristic 4ree9 #e:icon, ,Oford <niversitz Press, ,Oford 1D61, 7D?'7D1. Lo studio di B'P @{, 4La notion chr/tienne d*initiation. Nalon pour une en$uUt5, in #a 'aison- ieu 1+ 11DCC3, ++' 2;, non sembra che abbia tenuto nel dovuto conto l*ampio significato del termine mistagogia utilizzato dai Padri e l*esigente cammino iniziatico richiesto nell*antichit" per diventare cristiano. [16] p&( L , ) Cg(&>g&, e *aptismo , 1, /4 +1, 1;1+p. [1C] L*&utore, nel 177D, dedica il capitolo . alla 4iniziazione cristiana5 nell*opera, pioniera in $uesto campo: +rigines du culte chr;tien% 2tude sur la liturgie avant Charlemagne, gd. de puccard, Paris 1D%;|. [17]=ra i numerosi studi sull*iniziazione cristiana e sul catecumenato antico si possono segnalare: (. (=gNugL, ie 3aufe% &ine genetische &r9l<rung der 3aufeliturgie, 0. >auch, nnsbrucr 1D;7, trad. t., .l battesimo% 4enesi ed evoluzione della liturgia battesimale, gP, &lba 1D6%A B. )<N&> g>, #e parrainage des adultes au: trois premiers si$cles de l12glise% >echerche histori$ue sur l*/volution des garanties et des /tapes cat/chum/nales avant +1+, Cerf, Paris 1D6% A >. C&p X, ZL*initiation chr/tienneZ , in &'@. B&>= B,>= ed.3, #12glise en pri$re, , #es sacramentes, )escl/e, Paris 1D72, %1'11?, trad. it., ZL*iniziazione cristianaZ, in &'@. B&>= B,>= 1ed.3, #a Chiesa in preghiera% .ntroduzione alla liturgia, , . sacramenti, 8ueriniana, prescia 1D7C, %C'1%?A !. (&.g>, #es rites de l1initiation chr;tienne du .. au 7. si$cle.

gs$uisse histori$ue et signification d*aprs leurs principauO t/moins, Centro di (tudi sull*&lto Bedioevo, (poleto 1D77A =h. B. 0 NN, &arl5 Christian *aptism and the Catechumenate = >est and &ast ,5ria, =he Liturgical Press, Collegeville 1Binnesota3 1DD% A )gB, &arl5 Christian *aptism and the Catechumenate= .tal5! )orht "frica and &g5pt, =he Liturgical Press, Collegeville 1Binnesota3 1DD% A @. C&!&LL,==,, Catecumenato antico. )iventare cristiani secondo i Padri, g)p, pologna 1DD6A ). p,>,p ,, #a iniciaci0n cristiana, gd. (igueme, (alamanca 1DD6. =ra i pi9 recenti contributi teologici e pastorali sull*iniziazione cristiana e sul catecumenato si possono richiamare: 'ade not *orn% )e? /erspectives on Christian .nitiation and the Catechumenate, <niversitz of Notre )ame Press, London 1DC6A ). p,>,p ,, /ro5ecto de iniciaci0n cristiana% Come se hace un cristiano% Come se renueva una comunidad, )escl/e, pilbao 1D7?A B. )<N&> g>, #1initiation des adultes% Commentaire histori(ue et pastoral du nouveau Rituel, C&,, &bidKan 1D7+A #a nuova proposta di iniziazione cristiana, L)C, Leumann'=orino 1D7;A >. 0&L( N , #1iniziazione cristiana e i suoi sacramenti, ,>, Bilano 1D76A N. &. !gL&, Reiniciaci0n cristiana% Respuesta a un bautismo @sociol0gicoA, !erbo )ivino, gstella 1D76A @><PP, g<>,Pg, )g C&=gC<BgN&= , "gli inizi della fede% /astorale catecumenale oggi! in &uropa, gP, Bilano 1DD?A l. p,<>@g, (, 3h;ologie cat;chum;nale, Cerf, Paris 1DD1, trad. t., 3eologia catecumenale. & proposito della nuova evangelizzazione, 8ueriniana, prescia 1DD%A C. 0L,> (=FN, /ara comprender el catecumenado, !erbo )ivino, gstella 1DD1}, trad. it., .l catecumenato, porla, >oma 1DD+A @. C&!&LL,==,, 4>inascita del catecumenato e pastorale missionaria in guropa5, in B. >,(=\,y(\ 1ed.3, #a missione senza confini. &mbiti della missione ad gentes. Biscellanea in onore del >. P. yilli lenrel, ! !g>g N, >oma %???, %7C'+1?. [1D] (&C>& C,N@>g@&= , P>, C<L=< ) ! N,, +rdo initiationis christianae adultorum, Poliglotta !aticana, >oma 1DC%. La traduzione ufficiale in lingua italiana risale al +? gennaio 1DC7: C,N0g>gNu& gP (C,P&Lg =&L &N&, Rito della iniziazione cristiana degli adulti 1> C&3, Libreria gditrice !aticana, >oma 1DC7. [%?] , C&, 4Praenotanda5, 6c. [%1] Cf. PP,L =, >,B&N,, 3rad% apost% %?, ,C 11bis, C7. [%%] vi, C7'7?. [%+] vi, 7%'D?. [%2] (olo &gostino richiama esplicitamente un*iniziale istruzione catechistica dei nuovi simpatizzanti prima di essere ammessi tra i catecumeni. Cf. e catechizandisi rudibus, in /# 2?, +?D'+2D. =ra le traduzioni italiane si pu# segnalare la pi9 recente: /rima catechesi ai non cristiani. ntroduzione e note di P. (iniscalco, Citt" Nuova, >oma 1DD+. [%;] Nel celebre discorso a pulla >egia &gostino, rivolgendosi ai catecumeni, che egli considerava cristiani, dopo aver constatato che molti dissertavano l*istruzione catechistica per il teatro, sent- il dovere di richiamarli ad un comportamento pi9 coerente: 4Bi

accorgo che siete in pochi. gcco verr" la Pas$ua e $uesti spazi non potranno contenervi, tanto sarete numerosi. &llora, ad occupare $uesti luoghi sarete voi stessi che al presente avete gremito i teatri` &lmeno confrontate gli ambienti e battetevi il pettof nostri cristiani non solo tengono in gran conto le prostitute, ma ne fanno persino un*istituzione: non solo reclutano $uante gi" lo erano, ma inducono a esserlo $uelle che non lo eranof Bentre dovremmo darci da fare per la loro salvezza, si preferisce andare con loro in perdizione. g $uesto fatto da cristiani. Non voglio dire dai fedeli 1i battezzati3. 0orse il catecumeno non tiene in conto la sua condizione. ggli dice: sono catecumeno. (ei catecumeno` Catecumeno, una tua fronte ha ricevuto il segno di Cristo ed un*altra tu porti al teatro` !uoi andare` Cambia fronte e vae (u di te viene invocato il nome di )io, Cristo viene invocato su te, )io viene invocato su te, ti viene tracciato e fissato sulla fronte il segno di Cristo5, iscorso +?~&, 7, )*" ++, 272'276. [%6]>. 0&L( N , #1iniziazione cristiana e i suoi sacramenti, ,>, Bilano 1DD%|, %%. [%C] =ra le testimonianze patristiche si pu# richiamare l*invito del vescovo @regorio di Nissa, con il $uale si rivolge ai catecumeni per sollecitarli ad iscriversi, all*inizio della 8uaresima, per la preparazione immediata al battesimo: 4)atemi i vostri nomi, affinch/ li possa scrivere sui libri materiali e segnarli con l*inchiostro. )io stesso li incider", di proprio pugno, su tavole indelebili5, nell* omelia "dversus eos (ui differunt baptismum, in /4 26, 21C. [%7] )iversamente da Cirillo di @erusalemme, =eodoro di Bopsuestia, &mbrogio, le catechesi di @iovanni Crisostomo sono dedicate all*approfondimento morale connesso alla vita nuova ricevuta dal neofita con la celebrazione dei sacramenti dell*iniziazione. [%D] Cf. =g>=<LL &N,, e idolatria .. !, +, CC# %, 11%2A e paenitentia ! , 16, CC# %, ++1. [+?] Cf. PP,L =, >,B&N,, 3rad% apost% %1, C, 11bis, D%A =g>=<LL &N,, e corona , +, CC# %, 1?2%'1?2+A #ettera a *arnaba ! , 1+, ,C 1C%, 1%2. [+1] ,> @gNg, +mel% .7 su 4ios%1, ,C C1, 127. [+%] 48uando dalle tenebre dell*errore si condotti alla luce della conoscenza, $uando da una vita terrena ci si converte agli inizi della vita spirituale, si esce dall*ggitto e si viene nel deserto, cio a un genere di vita nel $uale, in mezzo al silenzio e alla calma, ci si esercita alle leggi divine e ci si imbeve degli oracoli celesti. Poi, $uando si ricevuta la loro formazione e direzione, dopo aver superato il @iordano, ci si affretta fino alla =erra promessa, e cio mediante la grazia del battesimo si giunge fino ai precetti evangelici5, +mel% --7. su )umeri, 2, ,C %D, ;?1. [++] Per &gostino il catecumeno ascolta la parola di )io senza una piena comprensione: 4&udiens non intelligens5, iscorso 1+%, 1, )*" +1~1, %12. &nche per Niceta di >emesiana 4il catecumeno come uno straniero, ospite dei fedeliA sta loro vicino ma scolta come uno che non di loro, senza intendere i misteri e senza ancora avvertire la

grazia che essi infondono5, in Catechesi preparatorie al battesimo. =raduzione, introduzione e note a cura di C. >izzi, Citt" Nuova, >oma 1D7;, p. %7. Cirillo di @erusalemme, rivolgendosi agli illuminandi, ricorda la loro nuova capacit" spirituale, rispetto alla precedente condizione di catecumeni, nell*ascoltare della Parola: 4,sserva $uale dignit" @es9 gratuitamente ti dona. gri chiamato catecumeno ed eri avvolto da un suono che riecheggiava esteriormente: udivi la speranza senza contemplarlaA udivi i misteri ma senza intenderliA udivi le (critture ma senza comprenderne la profondit". 8uel suono ora non ti avvolge pi9, ma riecheggia dentro di te, poich/ lo (pirito, dimorando in te, fa della tua mente una dimora divina5, /rocat% 6, /4 ++, +22. [+2] >ipetutamente il Crisostomo sollecita il catecumeno a fare la sua parte, a 4mettere del suo m n` ```* ```n`` `b`P```b`5. Cf. Cat. , 1D, ,C ;?, 117A Cat. , 1, ,C ;?, 1+2A Cat. !, 1?, 11 e +1, ,C ;?, 177 e 1D7. [+;] Cirillo di @erusalemme ammonisce gli illuminandi all*inizio della 8uaresima: 4(ii sollecito nel venire alle adunanzef Nutri la tua anima con le divine letture. >icordati di $uanto viene detto 1nella catechesi3, perch/ abbia a sigillare con la fede le cose dette. Confessa $uanto hai fatto in parole e opere. (ii propenso alla preghiera. Bostra con la pratica dell*ascesi la robustezza del tuo cuore. Purifica il tuo vaso per ricevere pi9 abbondantemente la graziaf (e hai $ualche cosa contro $ualcuno, perdonaf (e ti affatichi poco, poco ricevi, se invece lavori molto, abbondante la mercede5, Cat. , ;'6, /4 ++, +C6'+CC. [+6] =g>=<LL &N,, e *apt% .! , 6, CC# 1, %D+.

[+C] q sufficiente richiamare alcune testimonianze. Per ottenere la salvezza, secondo =ertulliano, necessaria una sincera penitenza: 4Noi non siamo immersi nell*ac$ua per mettere fine ai nostri peccati. Poich/ vi abbiamo posto fine, siamo gi" lavati moralmente5, e paenit% ! , 16, CC# 1, ++1. <gualmente esplicito ,rigene: 40ate attenzione, Catecumeni. &scoltate e approfittate di ci# che vi dico, finch/ siete catecumeni, finch/ non siete ancora battezzati. !enite alla fontana, siate lavati per la salvezza. Non accontentatevi di essere lavati, come lo sono stati taluni, ma non per la salvezza. gssi hanno ricevuto l*ac$ua, non lo (pirito5, +mel% 7. su &zech. ;, ,C +;%, %%6. &ncora pi9 categorico Cirillo di @erusalemme nella sua iniziale catechesi agli illuminandi: 4&nche (imon Bago si accost# al lavacro: ne fu bagnato, ma non illuminatof lai $uaranta giorni per convertirti e tutta la comodit" per spogliarti, lavarti, rivestirti ed entrare. (e poi il tuo proposito rimane cattivof non aspettarti di ricevere la grazia: sarai ricevuto dall*ac$ua, ma non accolto dallo (pirito5 /rocat. % e 2, /4 ++, ++6 e +2?. [+7] &@,(= N,, e cat% rud. !, D, /# 2?, +16. [+D] C > LL, ) @g><(&LgBBg, /rocat. 1?, /4 ++, +2D.

[2?] vi, D, /4 ++, +27. [21] &@,(= N,, iscorso 16D, 11, 1+, )*" +1~%, CD2. [2%] C > LL, ) @g><(&LgBBg, Cat. , 2, /4 ++, +C+. [2+] q l*espressione cara a pasilio Bagno. Cf. e *aptismo , 1, /4 +1, 1;1+p. [22] =ertulliano d" ai catecumeni il nome di 4novicioli5, soldati di leva, in e paenitentia ! , 1, CC# 1, +%DA @iovanni Crisostomo chiama gli illuminandi 4nuovi soldati in Cristo5! in Cat. , 17, ,C ;?, 11%A =eodorodi Bopsuestia ricorda che con la consegna del (imbolo si diventa 4soldato arruolato nell*esercito del >e Celeste5, in Cat. . , 1C, in >. =,NNg&< m >. )g!>gg((g, #es hom;lies cat;ch;ti(ues de 3h;odore de 'opsueste, piblioteca &postolica !aticana, Citt" del !aticano 1D27, +DCA Commodiano raccomanda al catecumeno di essere 4buona recluta'bonus tiro5, in .nstruct% , ;, /# ;. %+6A &gostino paragona il competente all*atleta, in iscorso %16, 6, )*" +1~1, %;2. [2;] Cf. =g,),>, ) B,P(<g(= &, Cat. . , 12'16, =,NNg&<, +2+'+2C. &ncora nel ! secolo il vescovo 8uodvultdeus, riprendendo un*espressione di san Cipriano 1&pist% C2, C3, scriveva: 4Non avr" )io come padre chi non ha voluto avere madre la Chiesa5, e ,5mbolo ..., 1+, 1, CC# 1, +2D. [26] p&( L , B&@N,, e *aptismo , 1, /4 +1, 1;16p. [2C] =g>=<LL &N,, e paenitentia ! , D, CC# 1, ++?. [27] ,> @gNg, +melia 7. su #ev% %, (C %76, %C2. [2D] p&( L , B&@N,, e *aptismo , %, /4 +1, 1;2+p. [;?] &@,P(= N,, e cat% rud. !, 7, 11, /# 2?, +16. [;1] PP,L =, >,B&N,, 3rad% apost. %?, ,C 11bis, C7A ,> @gNg, Comm a 4iov. ! , %7, ,C 1;C, %+7'%2?. Lo stesso &utore, commentando Lc +,7 sProducete frutti che siano degni di conversionet, scrive: 4q a voi, che vi avvicinate al battesimo, che $ueste parole sono indirizzatef !olete sapere $uali sono $uesti frutti degni della conversione` La carit" un frutto dello (pirito, la gioia un frutto dello (pirito, cos- pure la pace, la pazienza, la benignit", la bont", la fedelt", la dolcezza, la temperanza e il resto 1@al ;, %%' %+3. (e noi possediamo tutte $ueste virt9, produciamo frutti degni della conversione5, +mel. --.. su #uc% B! (C 7C, +?6% [;%]=ertulliano parla di 4auditorum tirocinia5 , in e paenit. ! , 12, CC# 1, ++1. l Concilio !aticano , proponendo lo stesso concetto, descrive il catecumenato come 4totius vitae christianae institutio et tirocinium debite protracturm m una scuola e un tirocinio, debitamente esteso, di tutta la vita cristiana5, in "4 12, &7~1 11%1. &nche il

> C& usa un*analoga espressine: afferma che il tempo del catecumenato deve caratterizzarsi come 4esercizio della vita cristiana5, in /aenotanda 1D, %. [;+] =g>=<LL &N,, e paenit. ! , 7, CC# 1, ++?. [;2] C > LL, ) @g><(&LgBBg, /rocat. 1 e 1?, /4 ++, ++% e +2D. [;;] =g>=<LL &N,, e paenit. ! , 1, CC# 1, +%D. [;6] C,BB,) &N,, .nstruct. , ;, /# ;, %+6. [;C] @ ,!&NN C> (,(=,B,, Cat. , 7, ,C ;?, 11%. [;7] )gB, Cat. , 7, ,C ;?, 1;;.

[;D] &@,(= N,, iscorso %16, 6, )*" +1~1, %;2. [6?] C > LL, ) @g><(&LgBBg, /rocat. D e 1;, /4 ++, +27 e +;C. [61] @ ,!&NN C> (,(=,B,, Cat. , +, /4 2D, %+;A Cat. ;?, 1%1'1%;, 1%6 e 1%7'1+?. [6%] CLgBgN=g &Lg((&N)> N,, /edag. , +7, ,C C?, 17?. [6+] )gB, ,trom. , D;, +' D6, %, ,C +7, 1?CA ,> @gNg, Comm% su 4iov% ! , %7, ,C 1;C, %+7'%2?. [62] Bg=,) , ) ,L BP,, ,5mposium ! , 6, ,C D;, 17C. &lla fine del ! secolo anche san Paciano, vescovo di parcellona, cos- si esprime: 4Noi ci siamo sviluppati nelle viscere della madre e, usciti dal suo seno, siamo vivificati in Cristo. gcco come Cristo, $ui, nella Chiesa, ci genera grazie ai presbiteri. g, cos-, il seno di Cristo, cio lo (pirito di )io, d" alla luce, per le mani dei presbiteri, un uomo nuovo, formato nel seno della madre e raccolto come neonato nel fonte battesimale: a condizione, per#, che la fede abbia svolto il suo ruolo di paraninfo5, ,ermo de *aptismo 6, /# 1+, 1?D%'1?D+. &naloghe immagini si incontrano in sant*&gostino 1 iscorso %%7, 1, )*" +%~1, +D%A iscorso %16, C'7, )*" +%~1, %;6'%;73, in 8uodvultdeus, vescovo di Cartagine 1 e ,5mbolo ., 1, +, CC# 6?, +66A e ,5mbolo ..., 1, CC# 6?, +2D3, in @regorio di Nissa 1.n /salmorum inscriptiones , 1;, /4 22, ;D%)';D6C3, in )ionigi &reopagita 14erar% &ccl. , +, /4 +, 2++&3, in Cesario di &rles 1,ermo CC, ;, CC# 112, 71?'7113, in @iovanni )iacono 1&p% ad ,en. 2, in &. y LB&>=, "nalecta Reginensia, piblioteca &postolica !aticana, Citt" del !aticano 1D++, p. 1C+3. L*idea di Chiesa , madre degli illuminandi, si incontra anche in Cirillo di @erusalemme che, all*inizio della 8uaresima, ricorda ai battezzandi: 4 scrivendovi, siete diventati figli e figlie di un*unica madre5, in /rocat% 1+, /4 ++, +;+. <n* analoga presenza materna implicitamente supposta nella catechesi prebattesimale del Crisostomo: 4 o vi chiamo gi" fratelli anche prima delle doglie e, prima del parto, saluto la parentela con voi5, in Cat. , 1, /4 2D, %%+. <na presentazione essenziale della , %;'++, +6 e +D'2+, ,C

maternit" della Chiesa nel processo iniziatico dei primi secoli offerta da B. )<N&> g>, 4La funzione materna della Chiesa nella pratica catecumenale antica5, in @. C&!&LL,==, 1ed.3, .niziazione cristiana e catecumenato. )iventare cristiani per essere battezzati, g)p, pologna 1DD6, 1%+'12;. <na trattazione pi9 ampia della gestazione'generazione della Chiesa si pu# trovare in: \. )gL&l&{g, &cclesia 'ater chez les /$res des trois prmiers si$cles, Cerf, Paris 1D62. [6;] &@,(= N,, iscorso %%D, 1, )*" +%~1, 2?2. &nalogo pensiero si incontra in: iscorso %%C, 1, )*" +%~1, +76A iscorso %C%, 1, )*" +%~%, 1?2;. [66] 8<,)!<L=)g<(, e ,5mbolo ..., 1, CC# 6?, +2D. [6C] @>g@,> , B&@N,, &p. 16, 6, /# ;2, C?%. [67] (crive Betodio di ,limpo: 41 battezzati, resi perfetti con il battesimo, sono capaci3 di ricevere in loro il seme puro e fecondo e di collaborare, come aiutanti della predicazione, alla redenzione degli altri. Coloro, per#, che sono ancora imperfetti e non sono che debuttanti nella dottrina 1i catecumeni3, sono portati dai perfetti e sono formati come in un corpo materno, sino a $uando essi nascano alla vita e siano formati alla grandezza e alla bellezza della virt9. Costoro, in seguito, si trasformeranno a loro volta in Chiesa e opereranno allora alla nascita e all*educazione dei altri figli, realizzando nel loro seno, come in un corpo materno, la volont" di )io5, in ,5mposium , 7, ,C D;, C2'C;. [6D] &@,(= N,, iscorso %%7, 1, )*" +%~1, +D%. [C?] Cf. &@,(= N,, e cat% rud% .! '..!, /# 2?, +%7'+22. [C1] &Bp>,@ ,, e '5steriis , 1, *"C) 1C, 1+C. l contenuto di $uesta catechesi morale si incontra nel primo libro del e "braham. [C%] Per un approfondimento della catechesi tipologica di Cirillo si pu# vedere: >. =<>&, 4pattesimo e storia della salvezza nelle catechesi di (. Cirillo di @erusalemme5, in ,tudia /atavina 1C 11DC?3, ;;6';C2. [C+] 4Chi stato evangelizzato a sua volta evangelizza5, afferma &vangelii nuntiandi, %2. 8uesta convinzione gi" ampiamente attestata nei primi secoli. Come noto hanno svolto un ruolo decisivo nella scelta della fede cristiana la testimonianza dei martiri e l*attivit" caritativa delle comunit" ecclesiali, l*azione apostolico'missionaria di schiavi, di commercianti e anche di militari, l*incontro e l*accompagnamento dei nuovi credenti da parte di cristiani esemplari, ma anche una specifica azione evangelizzatrice di laici. ,rigene richiama la sapienza cristiana trasmessa da battezzati semplici e poco istruiti nello loro botteghe, come cardatori di lana, calzolai, lavandai, in Contra Cels. , ;;, ,C 1+6, 1%7'1+?. La idascalia degli "postoli, verso il %;?, invita i laici cristiani ad adoperarsi 4a convertire, a dirozzare 'mansuefacere' e a fare entrare nella Chiesa coloro che ne sono fuori5, in idascalia et Constitutiones "postolorum, ed. 0. .. 0<N\, vol. , (chning, Paterborn 1D?;, 1;7. Betodio di ,limpo 1,5mposium , 73 e &gostino

1 iscorso %%7,13 associano i battezzati all*azione evangelizzatrice e materna della Chiesa nel promuovere la crescita e la nascita di altri figli. La missione dei cristiani trova, poi, conferma e nuovi accenti nel > C&. @i" nel tempo del catecumenato i nuovi credenti sono chiamati ad operare un cambiamento di mentalit" e di costumi, che 4deve manifestarsi nelle sue conseguenze di ordine sociale5 1 n. 1D.%3 e a imparare a 4collaborare attivamente all*evangelizzazione e all*edificazione della Chiesa5 1n. 1D.23. Nella 4 ntroduzione generale5, riportata nello stesso >ito, si legge: 4 tre sacramenti dell*iniziazionef portano i fedeli a $uella maturit" cristiana per cui possono compiere, nella Chiesa e nel mondo, la missione propria del popolo di )io5 1n. %3. [C2] ). p,>,p ,, #a iniciaci0n cristiana, p. 1?. [C;] & conclusione del processo di liberazione e santificazione i candidati, attraverso i sacramenti dell*iniziazione, sono pienamente uniti con Cristo nella sua morte, sepoltura e risurrezione, e celebrano con tutto il popolo di )io il memoriale della morte e risurrezione del (ignore. L*, C&, fedele alla teologia dei Padri, precisa il dono specifico di ciascun sacramento: 4Per mezzo del battesimo, essi 1i battezzati3, ottenuta la remissione di tutti i peccati, liberati dal potere delle tenebre sono trasferiti allo stato di figli adottiviA rinascendo dall*ac$ua e dallo (pirito (anto diventano nuova creatura: per $uesto vengono chiamati e sono realmente figli di )io. Cos-, incorporati a Cristo, sono costituiti in popolo di )io. Nella confermazione, che li segna con lo (pirito (anto, dono del Padre, i battezzati ricevono una pi9 profonda abbondanza di (pirito (anto, per essere capaci di portare al mondo la testimonianza dello stesso (pirito fino alla piena maturit" del corpo di Cristo. nfine, partecipando all*assemblea eucaristica, i fedeli mangiano la carne del 0iglio dell*<omo e bevono il suo sangue, per ricevere la vita eterna e manifestare l*unit" del popolo di )io5, in 4 ntroduzione generale5, n. %. [C6] Coloro che credono in @es9, ricorda san Paolo, 4sono giustificati gratuitamente per la grazia 1di )io3, in virt9 della redenzione realizzata da @es9 Cristo5 1>m +, 1+3. Nello stesso tempo fede e conversione del nuove credente ottengono la piena salvezza nel battesimo 1&t %, +7'213: 4Chi creder" e sar" battezzato, sar" salvo5 1BC 16,163. l processo di iniziazione cristiana un evento di progressiva liberazione e salvezza che ha il suo momento culminante nel battesimo. La crescita nella fede e conversione suppone una graduale adesione al (ignore insieme ad una progressiva liberazione dal peccato e delle forze del male, frutto del dono di )io e della mediazione ecclesiale. Come la vittoria di @es9 sulla tirannia del maligno, gi" espressa nella liberazione degli indemoniati, si compie definitivamente con la sua morte e resurrezione '4allorch/ il principe di $uesto mondo sar" gettato fuori. o $uando sar# elevato da terra, attirer# tutti a me5 @v 1%, +13' cos- nel processo iniziatico il nuovo credente viene gradatamente liberato dal potere del maligno attraverso l*ascolto della Parola, gli esorcismo, le preghieref fino al suo pieno riscatto con la celebrazione battesimale. [CC] N. >&=u N@g>, 3heologische /rinzipienlehere, yeel !erlag, Bnchen 1D7%, %7' 2;.

[C7] (ull*argomento si pu# vedere: L.'B. Cl&<!g=, 4Xtapes vers le baptUme ou du baptUme ` t, in #a 'aison- ieu 17; 11DD13, +;'26. L*&utore, che anche parroco, ritiene pi9 corretto teologicamente parlare di s tappe del battesimo t. Per ragioni di opportunit" pastorale, per#, pensa che sarebbe meglio presentare ai fedeli il cammino iniziatico come 4tappe verso il battesimo5, anche se 4l*espressione pu# essere meno rigorosa teologicamente5 1p. 2+3. &nche nella relazione di Bons. Claude )agens, vescovo d*&ngoulUme, fatta a nome del Consiglio Permanente all*&ssemblea plenaria dei !escovi di 0rancia, si incontra un analogo pensiero riferito al processo iniziatico: 4 =utta l*iniziazione alla fede autentica comporta $uesta dimensione sacramentale: essa fatta ad un tempo di parole umane e di gesti umani che rivelano e che comunicano la parola di )io e il 4gesto5 dell*&lleanza di )io compiuta nel mistero di Cristo5, 4La proposition de la foi dans la soci/t/ actuelle5, , , +, in #a ocumentation Catholi(ue %1?; 11DD23, 1?;?. [CD] (crive =homas 0inn: 4L*intero processo di conversione, dall*iscrizione 1dei catecumeni3 alla soglia dell*immersione, pu# essere chiamato catecumenato5, in &arl5 Christian *aptism and the Cathecumenate= .tal5! )orth "frica and &g5pt, 2. [7?] (crive &gostino: 48uando da catecumeni eravate rinviati, venivate conservati nei granai. Poi avete dato i vostri nomiA avete cominciato a essere macinati con digiuni ed esorcismi5, in iscorso %%D,1, )*" +%~1, 2?2. [71] (econdo il Crisostomo il vero digiuno del cristiano la rinunzia alle opere cattive: furti, rapine, spettacoli vietati, calunnie, parole ingiuriose e cos- via. Cf. +mel% ... al popolo di "nt% 2, 2, /4 2D, ;+';;. [7%] Per &gostino l*elemosina deve avere due fondamentali manifestazioni. )a una parte la rinunzia al superfluo, la parsimonia e la povert" volontaria deve esprimersi in un fattivo aiuto ai poveri. )all*altra l*elemosina deve esprimersi nel perdono: chiederlo $uando si recato ingiuria, donarlo $uando si ricevuto offesa, in iscorso %1?, 1?, 1%, )*" +%~1, 1C7A iscorso %?6, %, )*" +%~1, 122. [7+] =g>=<LL &N,, e *apt% .., 1, CC# 1, %D2. [72] &@,(= N,, e fide et oper% ! , 7, /# 2?, %?%. [7;] (olo eccezionalmente allo scrutinio viene attribuito anche il significato di verifica della crescita spirituale: N Cg=& ) >gBg( &N&, Catechesi preparatorie al battesimo, p. %DA @ ,!&NN ) &C,N,, #ettera a ,enario! ed. y LB&>=, 1C;. &nche se !ictor (aOer afferma che lo scopo degli scrutini 4era di verificare se l*insegnamento della fede e dei costumi cristiani fosse stato ben compreso, ritenuto a memoria e recepito come regola di vita5 1 Cf. 4 ntroduzione5, in C > LL, g @ ,!&NN ) @g><(&LgBBg, Catechesi prebattesimali e mistagogiche, gP, Bilano 1DD2, 1?C'1?73, gli storici della liturgia vedono negli esorcismi una celebrazione pi9 solenne degli esorcismi. Netta l*opposizione di &drien Nocent verso la visione degli scrutini espressa da @iovanni )iacono: 48ui @iovanni si sbaglia e considera gli scrutini

come una sorta d*esame del catecumeno sulla fede e sulla sua conoscenza degli elementi del cristianesimoA mentre la tradizione mostra che si tratta di esorcismi5 1in P,N= 0 C , (= =<=, L =<>@ C, (. &N(gLB,, "nmnesis. +~1, #a liturgia e i sacramenti. =eologia e storia della celebrazione, Barietti, @enova 1D76, 2%3. =ra le testimonianze antiche di >oma si pu# ricordare $uella di Leone Bagno, del ,acramentario gelasiano, dell*+rdo Romano -.. &nche l*, C& colloca gli scrutini tra le celebrazioni. gssi 4tendono a purificare la mente e il cuore, a fortificare contro le tentazioni e a stimolare la volont" verso una pi9 intima adesione a Cristo e verso un sempre pi9 fermo impegno nell*amore di )io da parte dei catecumeni5 1n. 1;23. [76] 8<,)!<L=)g<(, e ,5mbolo ... 1, CC# 6?, +2D. [7C] @li eletti, scrive san Leone Bagno, 4devono essere scrutinati con esorcismi, santificati con digiuni e istruiti pi9 fre$uentemente con predicazioni5, in &p%16, /# ;2, C?%. 8uesta triplice dimensione del cammino catecumenale ampiamente documentata dalle testimonianze patristiche. <na sintetica presentazione della proposta catecumeanle si pu# vedere in: @. C&!&LL,==,, Catecumenato antico. )iventare cristiani secondo i padri, %6?'%7C. >ecentemente anche >. Cabi/ ricorda che il cammino dei candidati, che precede il battesimo, 4comporta una triplice dimensione: catechistica, liturgica e ascetica5, in 4L*iniziazione cristiana5, in &'@. B&>= B,>=, #a Chiesa in preghiera, 22. (i ha, pertanto, una certa difficolt" a condividere l*espressione di alcuni autori e documenti del nostro tempo che presentano la formazione catecumenale caratterizzata dalla dimensione catechistica, liturgica e caritativa. Lo sviluppo della carit", insieme alla fede e alla speranza, era un obiettivo fondamentale della formazione catecumenale. Per $uesto nel secondo esame, riguardante il comportamento dei catecumeni, era riservata un*esplicita attenzione alle opere di carit", come attesta ppolito >omano, in 3rad% apost, %?, ,C 11bis, C7. @li esercizi ascetico'penitenziali, previsti nel catecumenato antico, inglobavano le opere di carit" e andavano oltre. gssi, nel loro insieme, avevano una valenza sacramentale e costituivano un*esigente proposta di liberazione e rinnovamento interiore elaborata dalla Chiesa e testimoniata dai fedeli. gra una delle vie con $uale la Chiesa formava e santificava i suoi figli. [77] CLgBgN=g &Lg((&)> N,, /edagogo , +7, 1, ,C C?, 17? [7D] (crive ,rigene: 4 cristiani, per $uanto dipende da loro, lavorano per diffondere la dottrina nell*universo intero. Per riuscire in $uesto, alcuni hanno cominciato a percorrere non solo le citt", ma anche i paesi e i villaggi per condurre gli altri al servizio di )io5, in Contro Celso , D, ,C 1+6, +?. [D?] q esplicitamente attestato da ,rigene 1Contro Celso "postoli 1 , +6, 23. , ;;3 e dalla idascalia degli

[D1] Per ppolito >omano coloro che conducono 1i garanti3 i nuovi credenti per l*esame di ammissione al catecumenato devono testimoniare 4a loro riguardo che sono capaci si ascoltare la Parola5, in 3rad% apost% 1;, ,C 11bis, 67. Ci# suppone che i garanti abbiano gi" introdotto i nuovi simpatizzanti all*ascolto della parola di )io.

[D%] (i legge in ,rigene: 4&nche a coloro che vengono da noi per la prima volta inculchiamo il disprezzo di tutti gli idoli e dei simulacriA poi eleviamo il loro pensiero fino al Creatore di tutte le cose, distogliendoli dal rendere alle creature un culto che dovuto soltanto a )ioA infine, dimostriamo loro che venuto colui che era stato annunciato, sia a partire dalle numerose profezie fatte a suo riguardo, sia a partire dai !angeli e dagli scritti apostolici, che vengono trasmessi con cura a coloro che possono comprenderli con intelligenza5, in Conto Celso , 1;, ,C 1+6, 2?'2%. [D+] Commentando Luca, &mbrogio scrive: 48uando alcuni pagani sono chiamati alla Chiesa, dobbiamo articolare in $uesto modo il nostro intervento. n primo luogo insegniamo che esiste un solo )io, creatore del mondo e di tutte le cose, nel $uale viviamo e ci muoviamo e di cui noi siamo anche stirpe. Per $uesto ggli deve essere da noi amato non soltanto per i doni della luce e della vita, ma altres- per una certa parentela della stirpe5, in &:p% ev% #uc%, ! , 1?2, *"C) 1%, 76'77 <n annuncio cristiano, dun$ue, connesso ai concetti di creazione, dono e parentela. Continua &mbrogio nella stessa pagina: 4 n seguito distruggiamo $uell*opinione riguardante gli idoli, insegnando che impossibile che la natura materiale dell*oro, dell*argento e del legno contenga in se stessa una forza divina5. Commenta Luigi 0. Pizzolato: 4<n passaggio per noi ovvio, che non meriterebbe neppure d*essere segnalato, se non si conoscesse la vischiosit" della consuetudine e il gap esistente nel mondo antico, magari all*interno di una stessa persona, tra accettazione razionale, filosofica, del monoteismo e mantenimento pratico delle usanze politeistiche della religio vulgi. 8uesta contraddizione tentava di giustificarsi coltivando l*idolo manufatto come luogo di abitazione della potenza divinaA cio assumendo i toni, che noi chiameremo della magia o della superstizione5, in 4Le componenti della catechesi in (. &mbrogio5, CD'7?. [D2] &Bp>,@ ,, &:p% ev% #uc%, ! , 1?2, *"C) 1%, 77. [D;] vi. [D6] vi,! , 1?;, *"C) 1%, 77'D?. [DC] Nel 4prologo5 della +ratio catechetica magna @regorio di Nissa invita a sintonizzare l*insegnamento con i diversi tipi di religiosit" dei destinatari: 4Le idee di chi aderisce al giudaismo sono diverse da $uelle di chi si formato nel paganesimo. g lo stesso si dica dell*anomeo, del manicheo, dei seguaci di Barcionef Per il fatto che ognuno ha le sue particolari concezioni, si rende necessaria la lotta contro le loro specifiche credenze, perch/ il tipo di cura va adattato alla natura della malattia5. 8uindi aggiunge: 4q necessario tenere conto dei pregiudizi delle persone e congegnare i nostri argomenti adattati all*errore proprio di ciascuno5, in #a grande catechesi, =raduzione, introduzione e note a cura di B. Naldini, Citt" Nuova, >oma1D7%, 21'2+. [D7] &@,(= N,, e cat% rud% !, C, /# 2?, +12. [DD] vi, , ;, +1+.

[1??] vi, . ., ++, ++;. [1?1] Cf. La idach$ '! e la #ettera a *arnaba .! '.., in . /adri apostolici, traduzione, introduziono e note a cura di &. 8uac$uarelli, Citt" Nuova, >oma 1DC6, %D' ++ e %11'%1+. [1?%] Cf. >gNg, ) L ,Ng, &pidei:is. &ntico catechismo degli adulti, ntroduzione, traduzione e commento a cura di g. Peretto, porla, >oma 1D71. [1?+] =ra le diverse opere apologetiche si possono ricordare: " iogneto, le due "pologie e il ialogo con 3rifone di @iustino, l*+ctavius di Barco Binucio 0elice. Per un approfondimento della catechesi nei primi secoli si pu# vedere: &. =<>\, 2vang;lisation et cat;ch$se au: deu: premiers si$cles, Cerf, Paris 1D6%. [1?2] )el secolo non ci sono pervenuti testi di catechesi per i catecumeni, se di fa eccezione del e *aptismo di =etulliano, nato probabilmente come istruzione ai candidati al battesimo, successivamente rielaborato in trattato. )el ! e ! secolo si posseggono testimonianze $ualificate, seppure numericamente limitate, della catechesi offerta a chi si preparava al battesimo. (i possono richiamare alcuni tra i testi pi9 significativi: Le Catechesi prebattesimali di Cirillo di @erusalemme, le +melie catechistiche di =eodoro di Bopsuestia, le sei Catechesi prebattesimali di @iovanni Crisostomo, il e *aptismo di pasilio di Cesarea, la &:planatio ,5mboli di &mbrogio di Bilano, i iscorsi %1%'%16 e ;6';D di &gostino sulla spiegazione del (imbolo e del Padre Nostro, le Catechesi preparatorie al battesimo di Niceta di >emesiana. <n elenco pi9 completo dei testi catechistici dei Padri, con richiamo delle fonti e traduzioni, viene offerto, al termine dello studio, in 4riferimenti bibliografici5. [1?;] @iovanni Crisostomo, dopo aver ricordato agli illuminandi che l*insegnamento catechistico esige di essere ricordato e comprovato mediante le opere, aggiunge: 4Per $uesto si chiama catechesi, perch/, anche durante la nostra assenza, il discorso vi risuoni nella mente5, 4Prima catechesi5 1, in @. C> (,(=,B,, #e catechesi battesimali, =raduzione, introduzione e note a cura di &. Ceresa'@astaldo, Citt" Nuova, >oma 1D7%, %?. [1?6] N. )&N XL,<, #a catechesi nei primi secoli, L)C, Leumann'=orino, 1DC?, C. [1?C] &@,(= N,, iscorso %1+, %, )*" +%~1, %?7. [1?7] ,rigene, commentando @eremia 2,+, s)issodate a fondo i vostri campi, non seminate nulla tra le spinet, afferma: 48uesta parabola detta soprattutto a voi che insegnate, affinch/ non consegniate le parole della (crittura agli uditori prima di aver fatto nelle loro anime dei campi nuovi. 8uando, una volta messa mano all*aratro 1Lc D, 6%3, hanno fatto nelle loro anime dei campi nuovi e gli uditori ascoltano come terra bella 1Bt 1+, 73 e buona 1Lc 7, 73, allora, seminando, essi non seminano nelle spine5, in +mel% 7 su 4er% 1+, ,C %+%, +1?.

[1?D] (crive &gostino: 4&ltro istruire una sola personaf altro insegnare a tutti $uando stanno l- ad attendere $uel che stiamo loro per diref<na cosa molto diversa $uando vi sono pochi o molti uditorif $uando sono contadini o campagnolif g se vero che a tutti dobbiamo uguale carit", non con tutti dobbiamo adoperare la stessa medicina5, in e cat% rud% .!, %+, /# 2?, +%7. &nche ,rigene, $uando si rivolge a pagani, ritiene che si debba incominciare con il problema della retribuzione, il tema dei vizi e delle virt9, la nozione di bene e di male, il richiamo dello spettacolo della creazione per arrivare al Creatore, in Contro Celso ! , ;%, ,C ;?, %76'%77. Lo stesso catecheta alessandrino richiama una sua strategia: 41(e i pagani3 rifiutano di ascoltare, perch/ si tratta della dottrina dei cristiani, noi facciamo finta di esporre una dottrina utile che non $uella dei cristiani. Poi, una volta che $uesta dottrina stata provataf e noi riteniamo utile guadagnare l*uditoref allora dichiariamo che $uesta dottrina, che egli loda, era la dottrina dei cristiani5, in +mel% -- su 4er% ;, ,C %+7, %C2. [11?] ,> @gNg, +mel 7. su 4ios% 1, ,C C1, 17%'172. [111] CLgBgN=g &Lg((&N)> N,, ,tromata , 2 1%;3, ,C +7, ;+. [11%] C > LL, ) @g><(&LgBBg, /roc% 1C, /4 ++, +62. [11+] @. L& = , 4La catechesi nel catecumenato antico5, in @. C&!&LL,==, 1ed.3, .niziazione cristiana e catecumenato. )ivenire cristiani per essere battezzati, g)p, pologna 1DD6, 66. [112] ,> @gNg, +mel 7. su #ev% %, ,C %76, %C2. [11;] (crive &gostino: 4Cristo venuto soprattutto perch/ l*uomo conoscesse $uanto )io lo ami e, per conseguenza, sapesse che deve infiammarsi d*amore per Colui dal $uale stato amato5, in e cat% rud% !, 7, /# 2?, +1;. [116] (ignificativa la correzione dell*espressine fatta da &gostino: 48uando colui che ci ascolta, o meglio, che attraverso noi ascolta )iof5, in e cat% rud% ! , 11, /# 2?, +17. [11C] N. )&N qL,<, #a catechesi nei primi secoli, 1?. [117] &@,(= N,, e fide et oper% ! , DA ..! , 2D, /# 2?, %%D. Per il !escovo di ppona i credenti esemplari da imitare sono coloro che, avvicinandosi con timore a )io e alla Chiesa 4ascoltano con diligenza la parola di )io, la ritengono nella memoria, la ruminano nel pensiero, la traducono nella vita5. Con efficacia maggiore si esprime il testo latino: 4gligite vobis $uos imitemini, )eum tementes, ecclesiam )ei cum timore intrantes, verbum )ei diligenter audientes, memoria retinentes, cogitatione ruminantes, factis implentes5, in iscorso %%7, %, )*" +%~1, +D2. (ono, cos-, delineati i tratti fondamentali di chi attivamente aderisce alla catechesi. [11D] C P> &N,, &p% C+, +, %, C,&# , %, C7?.

[1%?] p&( L ,, e *aptismo 1, %, /4 +1, 1;+Cp e 1;2+). 8uesta visione di pasilio non sembra lontana da $uella espressa nel documento dei !escovi italiani, .l rinnovamento della catechesi, nel $uale si afferma che la finalit" della catechesi 4educare al pensiero di Cristo, a vedere la storia come lui, a giudicare la vita come lui, a vivere in lui la comunione con il Padre e lo (pirito. n una parola, nutrire e guidare la mentalit" di fede5 n. +7. Cos- anche la Catechesi tradendae ricorda che 4la catechesi tende a sviluppare la comprensione del mistero di Cristo alla luce della Parola, affinch/ l*uomo tutto intero ne sia impregnatof l cristiano si pone cos- alla se$uela di Cristo e, nella Chiesa, impara sempre meglio a pensare come lui, a giudicare come lui, ad agire in conformit" con i suoi comandamenti, a sperare secondo il suo invito5, n. %?. [1%1] ,> @gNg, +mel -... su )um! +, ,C %D, %6+. [1%%] &@,(= N,, e cat% rud% !, 7, /# 2?, +16. [1%+] Per ,rigene lo sradicamento dei costumi immorali e l*ac$uisizione delle virt9 cristiane si opera in primo luogo nell*ascolto della Parola o Legge: 4!oi che desiderate ricevere il santo pattesimo e meritare la grazia dello (pirito, dovete anzitutto essere purificati a partire dalla LeggeA in primo luogo, ascoltando la parola di )io, dovete sradicare i vostri vizi abituali e spegnere i vostri barbari costumi, affinch/, rivestite la dolcezza e l*umilt", possiate ricevere la grazia dello (pirito (antof =u devi, dun$ue, in primo luogo meditare la Legge di )io, affinch/, nel caso in cui i tuoi atti siano immorali e i tuoi costumi sregolati, la Legge di )io ti purifichi e ti corregga5, in +mel% 7. su #ev% %, ,C %76, %C2. g subito dopo aggiunge: 4La Legge ti lava e ti rende puro5, ivi, ;, %77. [1%2] C > LL, ) @g><(&LgBBg, Cat% !, %, /4 ++, 2;6p. [1%;] p )gB, Cat%!, 1%, /4 ++, ;%?p. [1%6] =estimonia ggeria, pellegrina a @erusalemme: 4 l !escovof cominciando dalla @enesi, durante i $uaranta giorni, espone ordinatamente tutte le scritture, illustrando prima il significato letterale e spiegando poi il senso spiritualef !iene loro 1i battezzandi3 insegnato in $uei giorni tutto $uello che concerne la risurrezione ed anche tutto $uello che concerne la fede. 8uesto si chiama catechesi. Completate le cin$ue settimane, ricevono il (imbolo. g di $uesto (imbolo il !escovo spiega loro il significato, articolo per articolo, come ha fatto per le (critture: dapprima letteralmente, poi spiritualmente. Cos- spiega il (imbolo5, in iario di un viaggio, =raduzione e commento di g. @iannarelli, gP, >oma 1DD%, [1%C] 4,ccorre sapere, scrive ,rigene, che gli &postoli, che predicarono la fede, su alcuni punti che ritennero necessari espressero in forma chiarissima il loro insegnamento a tutti i credenti, anche a $uelli che erano meno propensi alla ricerca della scienza divina, ma la dimostrazione razionale dei loro enunciati lasciarono da indagare a coloro che avessero meritato i doni sublimi dello spirito e soprattutto ottenuto dallo (pirito (anto il dono della parola, della sapienza e della scienza. )i altre verit" 1gli &postoli3 affermarono l*esistenza ma ne tac$uero modalit" e origine, certi perch/ i pi9 diligenti dei

loro discendenti, amanti della sapienza, potessero dedicarsi a un esercizio di cui mostrare i frutti del loro impegno5, in . principi. Prefazione +, ,C %;%, C7'7?. [1%7] @ ,!&NN C> (,(=,B,, Cat% , C, ,C +66, 1D%.

[1%D] C > LL, ) @g><(&LgBBg, /rocat. 1%, /4 ++, +;%C. [1+?] &@,(= N,, e cat% rud% ! , 11, /# 2?, +17. & sua volta ,rigene, riferendosi all*approfondimento della Parola'Legge del (ignore, ricorda ai catecumeni: 4@es9 vi spiega la Legge e ne svela ai vostri cuori il senso spirituale5, in +mel% .- su 4ios% D, ,C C1, 1D7. &nche Cirillo di @erusalemme, dopo aver ricordato che la fede, fondata sulla conoscenza delle verit" cristiane, 4 puro dono gratuito dello (pirito5, esorta il battezzando: 4&bbi $uella fede in Lui 1Cristo3, per $uanto essa in tuo potere, per ricevere da Lui anche $uella che supera le possibilit" umane5, in Cat% !, 11, /4 ++, ;1Cp. [1+1] C > LL, ) @g><(&LgBBg, Cat% !, 1%, /4 ++, ;%?p. [1+%] 8uesta visione trover" un eco particolare nella &vangelii nuntiandi di Paolo ! : 4gvangelizzare non mai per nessuno un atto individuale e isolato, ma profondamente ecclesiale. &llorch/ il pi9 sconosciuto predicatore, catechista o pastore, nel luogo pi9 remoto, predica il !angelo, raduna la sua piccola comunit" o amministra un sacramento, anche se si trova solo compie un atto di Chiesa, e il suo gesto certamente collegato mediante rapporti istituzionali, ma anche mediante vincoli invisibili e radici profonde dell*ordine della grazia, all*attivit" evangelizzatrice di tuta la Chiesa5, n. 6?. [1++] =ra le catechesi mistagogiche dei Padri si possono ricordare le principali: cin$ue Catechesi mistagogiche di Cirillo o @iovanni di @erusalemme, cin$ue +melie mistagogiche di =eodoro di Bopsuestia, il e ,acramentis e il e '5steriis di &mbrogio di Bilano, la +ratio -# in sanctum *aptisma di @regorio Nazianzeno, la 6omilia in diem luminum di @regorio di Nissa, la +melia sull1&pifania e le +melie -7.. e --. di Narsai, alcuni iscorsi 1 %%2'%%D e %C%3 di &gostino, infine, con un contenuto pi9 morale riferito alla vita nuova ricevuta in dono nel battesimo, le sei Catechesi postbattesimali di @iovanni Crisostomo. [1+2] l. )g L<p&C, 4La costituzione Lumen @entium e i Padri della Chiesa5, in #a teologia dopo il 7aticano .., 8ueriniana, prescia 1D6C, %%7. [1+;] L. )<Clg(Ng, "utonomies eccl;siasti(ue% 2glise separ;es, Paris 17D6, ! .