You are on page 1of 54

UNIVERSIDAD DE TALCA FACULTAD DE CIENCIAS DE LA SALUD ESCUELA DE TECNOLOGA MDICA

ESTUDIO DEL EFECTO DE LOS ACIDOS FERLICO Y P-CUMARNICO OBTENIDOS DE SOLANUM LYCOPERSICUM SOBRE LA EXPRESIN DE IL-2

MEMORIA PARA OPTAR AL GRADO DE LICENCIADO EN TECNOLOGA MDICA

ALUMNO: CRISTIAN TORRES VILLALOBOS PROFESOR GUA: TM. MARCELO ALARCON

TALCA-CHILE 2013

AGRADECIMIENTOS

Agradezco a Dios por haberme dado la posibilidad de vivir.

Agradezco a mis padres y mi familia que han sido un gran apoyo durante estos largos aos de estudio, que han tenido altos y bajos, pero que a pesar de eso siempre han estado cuando los he necesitado.

Agradezco a mi abuela Jova Fuentes, que a pesar de que ahora ya no se encuentra con nosotros, siempre fue un apoyo, para m fue ms que una abuela, fue mi segunda madre, la que siempre me aconsejaba y estaba ah cuando la necesitaba.

Agradezco a mi profesor gua Marcelo Alarcn, que me estuvo apoyando y guiando durante las diferentes etapas de mi tesis.

Adems agradezco a mis compaeros de la carrera de Tecnologa Mdica de la Universidad de Talca, que durante estos largos aos de estudios han estado ah para apoyarme y ayudarme.

DEDICATORIA

Dedico este trabajo a mi familia, ya que sin su apoyo no habra logrado ser la persona que soy hoy en da, a Dios por darme la alegra de haber podido nacer en esta familia tan maravillosa y a mi abuela que a pesar de que ya no est con nosotros s que me est mirando desde el cielo y que me cuida cada da.

INDICE

Pagina

1. RESUMEN

2. INTRODUCCION

3. HIPOTESIS

4. OBJETIVOS

5. REVISION BIBLIOGRAFICA 5.1 Sistema Inmune 5.2 Interleuquinas 5.3 IL-2 5.4 Monocitos 5.5 Medios de Cultivo 5.6 Tomate y sus Propiedades

7 7 8 11 15 17 18

6. MATERIALES Y METODOS 6.1 Obtencin de la muestra 6.2 Protocolo de separacin utilizando histopaque 1077 6.3 Protocolo de lavado de clulas mononucleares 6.4 Viabilidad celular 6.5 Protocolo cultivo celular

21 21 21

22 23 23

6.6 Extraccin RNA 6.7 Preparacin de RNA libre de DNA previoa la RT-PCR 6.8 Cuantificacin RNA 6.9 Sintesis de cDNA a partir de RNA 6.10 Amplificacin de cDNA por PCR 6.11 Visualizacin del producto amplificado

25 27 27 28 28
30

7. RESULTADOS 7.1 Estandarizacin extraccin clulas mononucleares


7.2 Estandarizacin cultivo celular 7.3 Viabilidad celular 7.4 Estandarizacin temperatura anneling PCR

31
31

32
33 35

7.5 Corrida Electrofortica IL-2

37

8. DISCUSION

38

9. CONCLUSION

41

10. BIBLIOGRAFIA

43

INDICE DE TABLAS

Paginas

TABLA 1. Protocolo de carga de los compuestos a estudiar

25

TABLA 2.Primers empleados para la deteccin de IL-2 Y GAPDH

29

TABLA 3. Protocolo para amplificacin por PCR

29

TABLA 4. Programa de termociclado para PCR con gradiente de Temperatura.

30

TABLA 5. Protocolos de separacin de clulas mononucleares

31

INDICE DE FIGURA

Paginas

Figura 1: Representacin esquemtica de la localizacin y estructura del gen IL-2

12

Figura 2. Protocolo de Solubilizacin de RNA

26

Figura 3. Separacin clulas mononucleares

32

Figura 4. Fotografa microscopio ptico aumento 40X del cultivo celular a diferentes concentraciones de clulas mononucleares

33

Figura 5. Fotografa al microscopio ptico 40X de conteo clulas viables.

34

Figura 6. Prueba de viabilidad realizada con clulas cultivadas a T ambiente por 24 hrs.

35

Figura 7. Electroforesis en gel de agarosa al 1% con productos. de PCR para IL-2 y GAPDH

36

Figura 8. Electroforesis gel de agarosa al 1% con producto de PCR para IL-2, de clulas cultivadas con los compuestos a diferentes concentraciones.

37

1. RESUMEN

Introduccin: La IL-2 juega un papel importante en muchos procesos fisiolgicos y ha sido estudiada por muchos aos como tratamiento contra ciertos tipos de cncer. La produccin de estos compuestos es influenciada por un gran nmero de sustancias tanto naturales como sintticas. Muchos de estos compuestos son encontrados en alimentos que consumimos diariamente, y es de vital importancia conocer estos compuestos y determinar el efecto sobre estas sustancias.

Materiales y Mtodos: Consiste en la utilizacin de ARN mensajero obtenido a partir de cultivo de clulas mononucleares con Ac. p-cumarnico y Ac. Ferlico a 3 concentraciones diferentes (4, 2 y 0.5 mg/ml), para obtener ADNc utilizando la tcnica de RT-PCR, esto luego de que las clulas son lisadas para la obtencin del contenido celular. Utilizando primers especficos, generados en base a las secuencias nucleotdicas especificas asociadas a las regiones que codifican para IL-2, se permite la transcripcin del segmento de inters y por el proceso de ciclos reiterados (PCR) obtener una gran cantidad del material gentico en estudio. Tambin se utilizan primers para evaluar la expresin constante del gen de la enzima Gliceraldehido 3 fosfato deshidrogenasa (GAPDH) que viene a hacer de control de la tcnica. Finalmente, utilizando un marcador de peso molecular es posible visualizar los fragmentos de ADN de inters luego de ser sometidos a electroforesis durante 45 minutos a 100 volts. Las muestras sanguneas se obtienen a partir de personas sanas pertenecientes a la Facultad de Ciencias de la Salud de la Universidad de Talca.

Resultados: Como resultado de la estandarizacin se obtiene que la temperatura ptima para la corrida de electroforesis de IL-2 sera de 50,1C. En relacin a la muestra analizada

no se obtienen resultados satisfactorios, debido a que no se pueden apreciar ninguna banda en la corrida de electroforesis.

Discusin: Los resultados obtenidos podran deberse a la actividad inhibitoria que presenta la IL-10 sobre IL-2, por lo que habra que revisar los protocolos utilizados y elaborar un procedimiento el cual poder suprimir el efecto de IL-10. As tambin poder implementar otro protocolo de extraccin de RNA con el cual obtener un mejor rendimiento para este procedimiento.

2. INTRODUCCION

Las interleuquinas son compuestos ampliamente estudiados, debido a su participacin en un gran nmero de procesos fisiolgicos y patolgicos. Cada da adquieren una mayor importancia dentro del mbito cientfico, llegando incluso a fabricar formas sintticas de estos compuestos para ser utilizados por ejemplo en tratamientos de algunas enfermedades. Un ejemplo de esto es Interleuquina 2 (IL-2), que ha sido estudiada ampliamente, debido las propiedades que posee esta, las cuales pueden ser utilizadas para el tratamiento de algunos canceres (Gonzlez, 1997).

Debido a esto, en el ltimo tiempo han surgido varios estudios orientados a vislumbrar las diferentes funciones que presentan estos compuestos, y a buscar compuestos que nos permitan estimular o suprimir su produccin en nuestro organismo, con la finalidad de hacer frente a ciertas patologas en las que la produccin de interleuquinas juega un papel fundamental.

Sin embargo, la utilizacin de frmacos para estimular tanto la produccin como la supresin de la produccin de interleuquinas no es la nica opcin presente estos das. Se ha visto que varios compuestos presentes en alimentos que consumimos diariamente ejerceran accin sobre la produccin de estos compuestos, lo que sera una buena alternativa al uso de medicamentos para este fin.

Debido a esto, es muy importante la realizacin de estudios que nos permitan conocer tales compuestos y los alimentos que los posean, dentro de estos alimentos, el tomate se posiciona en uno de los primeros lugares, debido a que una gran poblacin del mundo consume esta hortaliza de manera habitual. Debido a esto es necesario poder determinar
3

cules de los diferentes compuestos presentes en el tomate podran ejercer un efecto sobre la produccin de interleuquinas y as poder reconocer los beneficios que conllevara el consumo regular de esta hortaliza.

3. HIPOTESIS

Se ha visto que el tomate presenta grandes beneficios para la salud, debido a su alto contenido de vitaminas, minerales y antioxidantes. De acuerdo a esto se propone que el cido Ferlico y cido p-cumarnico, dos compuestos presentes en el tomate, tendran un efecto inmunoestimulante sobre IL-2

4. OBJETIVOS

4.1 Objetivo General Estudiar el efecto inmunoestimulante in vitro del cido Ferlico y Acido pcumarnico presentes en Solanum licopersicum sobre IL-2

4.2 Objetivos especficos Estandarizar un proceso de cultivo de clulas mononucleares a partir de sangre total. Estandarizar proceso de extraccin de ARN a partir de cultivo de clulas mononucleares. Evidenciar el efecto de Ac. p-cumarnico y Ac. Ferlico a diferentes concentraciones sobre la produccin de IL-2.

5. REVISION BIBLIOGRAFICA

5.1 Sistema Inmune

En nuestro entorno estamos en contacto con una gran variedad de agentes infecciosos (hongos, bacterias, protozoos, etc.). Todos estos microorganismos pueden causar enfermedades, y si se llegan a multiplicar sin control pueden ocasionar incluso la muerte, sin embargo, este tipo de situaciones no son muy frecuentes, ya que la mayora de las enfermedades son de corta duracin y apenas dejan secuelas (Roitt et al., 2000). Es aqu donde nuestro sistema inmune adquiere un rol principal actuando como barrera de defensa contra microorganismos extraos.

La respuesta inmunitaria del ser humano est regulada por diversos tipos de clulas y un gran nmero de molculas que en conjunto logran reconocer sustancias extraas y reaccionar con ellas con el fin de eliminarlas (Murphy et al., 2009). Dentro de este sistema de defensa adems de clulas especializadas en la eliminacin de agentes extraos, tambin tenemos una serie de barreras como la piel y mucosas, sustancias antimicrobianas, que en conjunto mantienen alejados los diferentes agentes patgenos que pueden causar enfermedades en el ser humano.

Para proteger al individuo con eficacia contra enfermedad, el sistema inmunitario debe satisfacer cuatro tareas principales (Murphy et al., 2009). La primera es ser capaz de reconocer al agente extrao. Lugo contener y eliminar completamente, si es posible, al agente extrao, sin embargo, esta respuesta debe mantenerse regulada para evitar daar al organismo, y es en esta regulacin donde radica la tercera tarea del sistema inmune.
7

Finalmente proteger al individuo contra enfermedades recurrentes debidas a los mismos agentes patgenos (Murphy et al., 2009).

Hablando en forma general, la inmunidad del ser humano se divide en dos partes: una inmunidad de tipo natural (o innata), la cual es adquirida por medios biolgicos o de la madre (Murphy et al., 2009). Esta es adquirida por la inmunizacin activa o como consecuencia de una infeccin. Mientras que la inmunidad adquirida la cual presenta una respuesta ms especfica frente a un agente extrao y su principal funcin es evitar una segunda infeccin, esta es mucho ms rpida que la innata.

Dentro de estas clulas encontramos a los linfocitos, que participan activamente en la inmunidad especfica o adquirida. Los linfocitos se dividen en tres grupos funcionales diferentes: linfocitos T (LT) que participan en la inmunidad adquirida de tipo celular, los linfocitos B (LB) que participan en la inmunidad adquirida de tipo humoral y las clulas NK (Natural Killer) que no expresan marcadores de clulas T ni clulas B y que participan en la inmunidad natural o innata. (Palomo et al., 2002).

Existe diferentes poblaciones de linfocitos, las que podemos diferenciarlas genticamente de acuerdo a la presencia de antgenos de diferenciacin de leucocitos humanos, designados como CD (cluster of differentation). Esto nos permite diferenciar entre las tres poblaciones mencionadas anteriormente e identificar subpoblaciones presentes en cada uno de ellos.

5.2 Interleuquinas

Como se mencion anteriormente nuestro sistema inmune est conformado por diferentes elementos que en conjunto nos protegen de agentes perjudiciales para nuestra salud. Dentro de este enorme complejo que es nuestro sistema inmune encontramos un
8

grupo se sustancias secretadas por diferentes clulas de nuestro sistema inmune, que cumplen una labor muy importante no solo en la defensa de nuestro cuerpo, este grupo de sustancias se conocen con el nombre de citoquinas. Dentro de las diferentes funciones que pueden desempear estos compuestos podemos mencionar su participacin en procesos inflamatorios, defensa contra agentes extraos, mediante la activacin de varias clulas del sistema inmune, como por ejemplo macrfagos, clulas NK, tambin actan en procesos alrgicos activando a eosinofilos, entre muchas otras funciones que desempean estos compuestos en nuestro organismo(Palomo et al., 2002).

Las citoquinas son protenas solubles de bajo peso molecular mediadoras de crecimiento celular, inflamacin, inmunidad, diferenciacin y reparacin, entre otras actividades (Hernndez et al., 2001). Por lo general su accin suele ser breve, siendo restringido al tiempo que dure el estmulo, una accin sostenida en el tiempo de estos compuestos se asocia principalmente a procesos patolgicos.

Como se mencion anteriormente en ciertas ocasiones los beneficios otorgados por estos compuestos son sobrepasados por sus efectos nocivos, ejemplo de esto es la produccin mantenida o un sobreproduccin de citoquinas. En un estudio realizado en China en donde se estudiaron la produccin de citoquinas en pacientes que presentaban Fiebre Severa con Sndrome de Trombocitopenia (SFTS, de sus siglas en ingles). Es una enfermedad viral emergente en China, causada por virus SFTS (SFTSV). Los pacientes con SFTS grave pueden rpidamente pasar a disfuncin multiorgnica y muerte, sin embargo, los mecanismos subyacentes patgenos no estn claros (Yulan et al,. 2012). En este estudio se evaluaron pacientes que presentaban esta enfermedad y se midi la produccin de citoquinas. Los investigadores demostraron en su estudio que la infeccin por SFTSV induce una tormenta de citoquinas expresadas anormalmente, que se asocian con la gravedad de la enfermedad, llegando a la conclusin que la gravedad de dicho cuadro era

causado principalmente por la sobreexpresin de citoquinas inducida por el virus (Yulan et al,. 2012).

Otro de los procesos que involucra la participacin de citoquinas son los procesos inflamatorios, los cuales consisten en una serie de fenmenos moleculares y celulares, con la finalidad de protegernos ante agresiones fsicas, qumicas o biolgicas. El proceso inflamatorio normalmente conduce a la recuperacin y la curacin. Sin embargo, la inflamacin puede perder su funcin de reparacin de daos en los tejidos y aumentar si el proceso no est correctamente regulado (Godoy et al., 2012). La inflamacin es reconocida como un importante contribuyente a muchas patologas agudas y crnicas del sistema nervioso central (SNC), que juega un papel importante en su patognesis. Para trastornos neurodegenerativos crnicos como la enfermedad de Alzheimer y enfermedad de Parkinson, la neuroinflamacin depende de la activacin de la respuesta inmune innata del cerebro (Rivest, 2009; von Bernhardi et al., 2010; Godoy et al., 2012 ) que implica desregulacin de clulas gliales ( Von Bernhardi, 2007 ).

En un estudio realizado en nuestro pas por el Departamento de Neurologa de la Pontificia Universidad Catlica de Chile en el cual se pretenda demostrar la relacin que hay entre el Sistema Nervioso Central (SNC) y los procesos inflamatorios. Para esto, utilizaron cultivo de astrocitos provenientes de tejido celular de ratones, en el cual se midi la produccin de NO2 y IL-1, el estudio arrojo que a pesar de que IL-1 es una Interleuquina que aumenta en procesos inflamatorios, esta no se vio aumentada, sino que adems inhibi la produccin de NO2 de los astrocitos, la cual fue estimulada adicionando al cultivo lipopolisacarido (LPS) + INF. De acuerdo a esto se pudo llegar a la conclusin de que los astrocitos tienen un papel importante en procesos inflamatorios, y que no solo estara implicado el sistema inmune en estos procesos, sino que el SNC tambin jugara un rol importante en este proceso (Godoy et al., 2012).

10

Sin embargo, el alcance de estos compuestos an no se ha podido determinar por completo, cada da surgen nuevos estudios en los cuales aparecen nuevas propiedades de las interleuquina o nuevos procesos fisiolgicos en los cuales estn implicadas. La

liberacin de interleuquinas y la movilizacin de linfocitos desde las clulas presentadoras de antgenos, parecen tener un papel clave en la modulacin de la respuesta autoinmune que media la destruccin de la clula beta pancretica (Prez F et al., 2004)

Como se puede apreciar hay varios estudios concernientes a determinar el alcance total de las interleuquinas, y los posibles beneficios y complicaciones de su produccin. A pesar de los avances tecnolgicos experimentados en este ltimo tiempo an no se ha podido abarcar una investigacin completa de estos compuestos, y hasta hoy en da se siguen realizando estudio sobre estos compuestos para as poder determinar su verdadero alcance.

5.3 IL-2

La Interleuquina 2 (IL-2) es una protena que fue descubierta en 1976 en los laboratorios del National Cancer Institute (Morgan et al., 1976), se encuentra ubicada en el cromosoma 4q27 y consta de 4 exones, tal como se puede observar en la figura 1. Cumple un rol importante en lo que es la respuesta inmune normal del individuo. La interleuquina-2 es un compuesto elaborado naturalmente por el cuerpo cuya funcin principal consiste en activar la reproduccin de las clulas (generalmente, las clulas CD4+).

La IL-2 humana es producto de un gen situado en el cromosoma 4 y es una linfocina sintetizada y secretada primariamente por clulas NK, timocitos medulares activados y clulas T helper 1 (Th1) estimuladas por mitgenos o por interaccin del complejo receptor de clulas T (Rodrguez et al., 2009). Su gen fue clonado en 1984, lo que ha permitido obtener grandes cantidades de IL-2 recombinante. A partir del descubrimiento de su genoma se han desarrollado un sin nmero de ensayos clnicos, que han demostrado su
11

actividad antitumoral. En Mayo de 1992, la Food and Drug Administration (FDA) aprob su utilizacin para el tratamiento de adenocarcinoma renal metastsico, siendo el primer agente biolgico aprobado para el tratamiento de cncer (Gonzlez E. 1997).

Figura 1: Representacin esquemtica de la localizacin y estructura del gen IL-2

La activacin de las clulas Th induce la expresin del receptor de IL-2 y subsecuentemente la expansin de clulas T antgeno especficas; desde este punto de vista IL-2 es un factor autocrino, pero tambin acta como estimulante paracrino influenciando la actividad de otras clulas del sistema inmune e incluso de estirpes celulares de otros sistemas (Rodrguez et al., 2009). En el sistema inmune cumple diversas funciones, como por ejemplo: estimular el crecimiento de clulas NK, actuar como factor estimulante del crecimiento de linfocitos B y estimular en ellos la produccin de anticuerpos, adems de potenciar la funcin fagoctica de neutrfilos y macrfagos.

Como se mencion anteriormente, IL-2 es utilizada para el tratamiento de algunos canceres, los tipos de cncer que ms comnmente son tratados con IL-2 incluyen algunos
12

tumores de riones y melanoma, la cual es administrada en conjunto con otros frmacos. Esta es administrada en forma de inyeccin bajo la piel. Esta sustancia se encuentra normalmente en el cuerpo, y es sintetizada por clulas T. An no se sabe a ciencia cierta cmo actuaran estos compuestos contra el cncer, pero se postula que IL-2 reforzara el mecanismo de defensa natural de nuestro cuerpo, lo que causara que algunas clulas cancerosas fueran reconocidas y eliminadas por el sistema inmune (Llarena R. 2009)

Adems de las propiedades que posee IL-2 para combatir ciertos tipos de cncer, se han realizado varios estudios con el fin de determinar el verdadero alcance de este compuesto. Segn Hfer (2012) la IL-2 jugara un papel importante en la regulacin de la respuesta inmune dada tanto por las clulas T reguladoras y efectoras, el cual estara dado por una competencia en el consumo de IL-2 por estos dos tipos de clulas, lo que sera una forma de regulacin complementaria a las conocidas hoy en da. Sin embargo, los investigadores postulan realizar estudios posteriores para esclarecer an ms la funcin que poseera esta citoquina, y las posibles utilidades que tendra en la regulacin de la respuesta inmune.

Los niveles de IL-2 no solo se pueden asociar a procesos cancergenos, se ha podido demostrar en estudios realizados en pacientes con Lupus Eritematoso Sistmico (LES) que la actividad calcio/calmodulina dependiente de la protena quinasa IV (CAMK4) de clulas T esta aumentada, lo que provocara una disminucin en la concentracin de IL-2. Se ha demostrado en estudios realizados en ratones MRL/lpr, los que presentaban niveles elevados de CAMK 4, en los cuales por procedimientos genticos la protena CAMK 4 se asociaba a un mejor pronostico y una normalizacin de los niveles de IL-2, por lo que se ha postulado esta protena como un probable tratamiento de pacientes con lupus eritematoso sistmico (LES) (Koga et al., 2012).

Sin embargo, no siempre es beneficioso la produccin de interleuquinas, ejemplo de esto son las personas con trasplantes de rganos, en los cuales el sistema inmune debe estar
13

suprimido con el fin de evitar el rechazo de rganos. En relacin a esto, uno de los mayores descubrimientos de la ciencia moderna son el descubrimiento de los agentes inmunosupresores (Pelez et al., 2004). En este campo el descubrimiento de la ciclosporina A por cientficos de Sandoz y su aplicacin en el transplante de rin en 1978 representa un punto de inflexin, y luego la ciclosporina pronto fue un frmaco inmunosupresor ms usado en clnica (Plosker et al., 1996).

La ciclosporina A, es un metabolito producido por Tolypocladium inflatum y otros hongos, suprime la respuesta inmune bloqueando la cascada de transduccin dependiente de calcio que media la activacin de los receptores de clulas T, inhibiendo la produccin de IL-2 (Pelez et al., 2004).

Sin embargo las ciclosporinas no son los nicos compuestos que tienen efecto sobre la inhibicin de IL-2, hay muchos compuestos de origen natural, mayoritariamente producidos por bacterias y hongos, que son capaces de inhibir la sntesis de esta Interleuquina, a continuacin mencionaremos algunos de ellos, y como ejercen su efecto sobre IL-2.

La rapamicina, un metabolito producido por una cepa de Streptomyces hygroscopicus, ha sido introducido en la prctica clnica (desde 1999 en USA y desde el 2001 en Europa). La rapamicina, es una macrlida que se une a la FKBP y suprime la proliferacin celular de los linfocitos y la produccin de IL-2 a travs de la inhibicin de una fosfatidilinositol 3quinasa denominada TOR (target of rapamycin), que resulta en el bloqueo del ciclo celular en la transicin G1/S por inhibicin de las ciclinas que regulan la divisin celular (Crespo et al., 2002).

La espergualina es un compuesto inmunosupresor y antitumoral, aislado en 1982 del Bacillus laterosporus, a partir del cual se ha desarrollado el derivado 15-deoxiespergualina, utilizado en la clnica para el tratamiento del rechazo agudo de transplante de rin
14

(Amemiya et al., 1996). Este compuesto inhibe la maduracin de linfocitos T estimulada por IL-2 por interaccin con Hsc70, un miembro de la familia de las Hsp70, inhibiendo su localizacin en el ncleo. En ensayos clnicos se ha observado que revierte el rechazo agudo en un 60-70%, obtenindose una supervivencia del implante en el 90% de los casos (Pelez et al., 2004). Como pueden ver hay una gran gama de propiedades atribuidas a la IL-2, y seguramente an hay muchas que an no han sido descubiertas, es por esto que es de vital importancia seguir investigando esta protena para as poder vislumbrar la gran gama de beneficios que poseera este compuesto y entender su rol en las diferentes patologas en las que se encuentra involucrada.

5.4 Monocitos

Los monocitos son las clulas ms grandes del sistema inmune, participan en la destruccin de partculas fagocitadas. Despus de salir de la mdula sea los monocitos circulan aproximadamente 8 horas; al igual que los neutrfilos (Palomo et al., 2002). Luego de esto los monocitos circulantes abandonan el espacio vascular, se unen a las clulas endoteliales y migran a la ntima donde se diferencian a macrfagos, en respuesta a factores producidos localmente, como el factor estimulador de monocitos (M-CSF) (Banderas et al., 2004). Se encuentran en varios rganos, destacando su presencia en el hgado (clulas de Kupffer), riones, pulmones (macrfagos alveolares e intersticiales), serosas (peritoneal y plural) bazo, ganglios linfticos, cerebro, aparato reproductivo (testculo, ovario, tero, oviductos), hueso (osteoclastos) e intestino. Tambin se encuentran en la leche materna (Palomo et al., 2002)

15

Estas clulas juegan un rol muy importante en la defensa de nuestro organismo, ya que son consideradas clulas fagocticas, que adems son capaces de sintetizar una gran cantidad de compuestos, incluyendo la sntesis de interleuquinas.

Adems de diferenciarse en macrfagos, estas clulas pueden dar origen a otro tipo de clulas, conocidas como clulas dendrticas (CD). Las clulas dendrticas son consideradas centinelas naturales del sistema inmune, son las encargadas de iniciar la respuesta inmune frente a la presencia de clulas alteradas del husped y/o a la invasin de patgenos (Belmonte et al., 2007). Al ser las principales clulas presentadoras de antgenos (APC) son importantes tanto en la estimulacin, activacin como en la regulacin de la respuesta de los linfocitos T (Banchereau et al., 1998).

Las clulas dendrticas actan como clula presentadoras de antgenos, siendo capaces de estimular a las clulas T (Granados et al., 2008). Se han podido identificar tres subpoblaciones: una localizada en piel y rganos linfoides, denominada CDs intersticiales, y las otras dos localizadas en circulacin, denominadas CDs de linaje mieloide y CDs plasmocitoides (Liu et al., 2001). Varios estudios han podido determinar que las CDs son capaces de inducir diferentes tipos de respuesta inmune, dependiendo de su linaje y grado de maduracin (Mellman et al., 2001).

Como podemos observar los monocitos como tal, y sus formas diferenciadas tiene un rol muy importante en lo concerniente a la defensa de nuestro organismo y el mantenimiento de la homeostasis de este.

16

5.5 Medios de Cultivo Celular

Como se mencion anteriormente la IL-2 tiene una gran importancia en varios procesos tanto patolgicos, como fisiolgicos, y su estudio es de gran importancia. Para poder estudiar el efecto de estos compuestos los cientficos han tenido que desarrollar medios de cultivos que permitan evidenciar in vitro la produccin y efecto de estos compuestos. As es como nacen los medios de cultivos celulares.

En general Podemos decir que es el conjunto de tcnicas que nos permiten mantener clulas in vitro con una gran aproximacin a sus propiedades y funciones in vivo (Garca, 2002).

La historia de los medios de cultivos celulares se remonta a finales del siglo XIX cuando Roux en el ao 1885 consigue mantener durante das clulas de embrin de pollo en una solucin salina. Luego Carrel en 1913 demostr la posibilidad de mantener en cultivo clulas de embrin de pollo, en condiciones de asepsia, durante un tiempo superior a la vida animal. As siguen los estudios y avances en relacin a este tema, los que basndose en estos y otros estudios preliminares permiten llegar a los medios de cultivos celulares que conocemos hoy en da.

Existen diferentes medios de cultivos utilizados con diferentes finalidades, por ejemplo podemos mencionar medios para cultivar clulas sistema nervioso, clulas del sistema inmune, etc. Enfocndonos principalmente en lo que es de nuestro inters, el cultivo de clulas del sistema inmune, podemos mencionar una gran cantidad de medios de cultivos, destacando entre estos el medio de cultivo RPMI-1640, ampliamente utilizado en el cultivo de clulas mononucleares.

17

El medio RPMI 1640 (Roswell Park Memorial Institute Medium), ha sido utilizado tradicionalmente en el cultivo de clulas linfoides humanas. Este medio utiliza un tampn bicarbonato, diferencindolo de otros medios similares por el pH que posee este (pH: 8). Adems esta suplementado con suero o una sustitucin sinttica de este, que proporciona las condiciones adecuadas para el crecimiento clulas. RPMI 1640 es utilizado en cultivo de muchos tipos celulares, especialmente linfocitos T/B humanos, clulas de mdula sea y clulas de hibridoma (Moore et al. 1976).

5.6 El Tomate y sus Propiedades

Este es un fruto que se cultiva en climas clidos, sin embargo se adapta muy bien a climas templados, puede ser cultivado durante todo el ao, pero las condiciones de su cultivo varan segn la estacin.

Este fruto cuenta con una gran variedad de propiedades que han sido estudiadas por un gran nmero de cientficos. Estos estudios no solo han abarcado a esta fruta, sino que tambin ha abarcado otras frutas y verduras que consumimos comnmente. Dentro de los numerosos compuestos procedentes de estos frutos encontramos los carotenoides. Numerosos estudios epidemiolgicos han sugerido una asociacin entre el alto consumo de frutas y verduras ricas en carotenoides y un menor riesgo de cncer (Khachik et al., 2002). Por lo que el consumo de tomate, o productos alimenticios derivados de este, contribuira a la absorcin de una gran gama de carotenoides, los que se encontraran tanto a nivel del suero y tejido humano.

Los carotenoides son pigmentos naturales, los cuales los podemos encontrar en varias frutas y verduras, son los responsables del color amarillo, naranja y rojo de estas, adems de las frutas y verduras estos compuestos los podemos encontrar en peces, invertebrados, algas, bacterias, hongos y levaduras (Rodrguez et al., 1997). Por supuesto este compuesto
18

tambin se encuentra presente en el tomate, siendo el carotenoide ms abundante en el tomate el licopeno, seguido de fitoeno, fitoflueno, -caroteno, -caroteno, -caroteno, neurosporeno, y la lutena (Khachik et al., 2002).

Adems de esto se ha podido determinar que el tomate poseera una actividad antiagregante. Sin embargo no todas la variedades de tomates presentan efecto

antiagregante; la variedad KG99-4 mostr un potente efecto antitrombtico es estudios previos in vitro (Yamamoto et al., 2003). Se ha sugerido que el antioxidante licopeno, presente en alta concentracin en los tomates, y componentes estables al calor y de bajo peso molecular como la adenosina y otros, podran ser responsables del efecto antiplaquetario (Dutta et al., 2001).

Dentro de los diferentes compuestos estudiados del tomate, uno de los ms conocidos y ms estudiados es el licopeno, es bien sabido que el licopeno presenta actividad antioxidante, sin embargo an no se ha logrado determinar con claridad todas las propiedades que presenta este compuesto, es debido a estos que cada vez aparecen ms publicaciones relacionadas al estudio de este compuesto, las cuales han ido determinando nuevas y novedosas propiedades del licopeno.

Se ha propuesto que el licopeno protegera contra el cncer de prstata a travs de diversas propiedades, incluyendo la disminucin de la oxidacin de lpidos, la inhibicin de la proliferacin de clulas cancerosas, y en particular propiedades antioxidantes ms potentes (Wei et al., 2012). Tambin se ha estudiado el efecto que poseera el licopeno sobre las plaquetas, de acuerdo a esto se ha podido determinar que le licopeno tendra una actividad antiagregante sobre la plaquetas, aunque no se ha podido determinar con exactitud el mecanismo por el cual actuaria este compuesto.

19

Esta hortaliza presenta un gran nmero de compuestos que son beneficiosos para nuestra salud, sin embargo an no se han podido determinar los verdaderos alcances de los diferentes compuestos presentes en el tomate, es por esto que el anlisis de estos compuestos se convierte en una interesante lnea de investigacin. Son de vital importancia la realizacin de estudios que nos permitan evidenciar los alcances reales de estos compuestos y los posibles beneficios que conllevaran el consumo frecuente de estos.

20

6. MATERIALES Y MTODOS

6.1 Obtencin de la muestra

La muestra se obtuvo a partir de puncin venosa de pacientes voluntarios sanos, sin medicacin, pertenecientes a la Facultad de la Salud de la Universidad de Talca. Se realiz la extraccin de sangre venosa con mariposa 19G realizando recambio de jeringas (n=10), estas jeringas (10 ml) se encontraban heparinizadas para evitar la coagulacin de la sangre. En total se extrajeron 100 ml de sangre del paciente.

6.2 Protocolo de separacin utilizando histopaque 1077

a) Extraer 100 ml de sangre (ver nota 1) de un voluntario sano, mediante la utilizacin de jeringa heparinizada, utilizando una mariposa 19G conectada a esta.

b) Diluir la sangre en proporcin 1:1 con PBS estril, pH: 7,4.

c) En tubos falcn de 15 ml depositar 3 ml de histopaque 1077 (Sigma-Aldrich), y depositar 10 ml de la sangre diluida en cada tubo (ver nota 2).

d) Centrifugar la sangre a 2000 rpm por 5 minutos a temperatura ambiente (ver nota 3). La fase superior debe contener el plasma, luego se encuentran las clulas mononucleares, bajo estas el histopaque, y finalmente al fondo del tubo deben encontrarse los glbulos rojos.

21

e) Extraer la nube que se encuentra entre el plasma y el histopaque y depositarla en un tubo falcn de 15 ml para su posterior lavado.

Notas

1. Extraer la sangre lentamente para as evitar la hemolisis de los glbulos rojos.

2. Depositar la solucin por las paredes del tubo suavemente, para evitar que la sangre se mescle con el histopaque.

3. Quitar el freno de la centrifuga, debido a que este provoca que la muestra se mescle nuevamente impidiendo la separacin de las clulas.

6.3 Protocolo de lavado de clulas mononucleares a) Separar en varios tubos (falcn de 15 ml) la muestra obtenida en el paso anterior, para as disminuir la carga celular y facilitar el lavado de clulas. b) Agregar 10 ml de PBS estril a cada uno de los tubos. c) Centrifugar a 1000 rpm por 10 minutos a temperatura ambiente. d) Eliminar el sobrenadante, resuspender el pellet y repetir el proceso anterior. e) Finalmente resuspender el pellet en aproximadamente 5 ml de medio de cultivo RPMI 1640.

22

6.4 Viabilidad celular.

Antes de realizar el cultivo celular se realiza una prueba para ver la viabilidad de las clulas obtenidas a partir de este proceso para esto se prepar una solucin de azul de tripn al 0,4%. La solucin para realizar el conteo de clulas se realiza utilizando 50 l se la solucin de azul de tripn al 0,4%, mezclndola con 350 l de medio y 100 l de la solucin de clulas mononucleares. Una vez obtenido esto se realiza un conteo de las clulas viva en una Cmara de Neubauer.

La prueba de viabilidad se realiza contando 100 clulas y anotando la cantidad de clulas blancas (clulas vivas) y clulas muertas (clulas muertas), para luego calcular el porcentaje de clulas vivas, segn la siguiente formula:

(Clulas blancas/total de clulas contadas) x 100= porcentaje de viabilidad

Para poder continuar con el proceso de cultivo se estipula que el porcentaje de clulas viables sea de al menos el 98%.

6.5 Protocolo Cultivo Celular

a) Previo a la realizacin del cultivo celular realizar un conteo de las clulas presentes en la suspensin de medio de cultivo, para esto tomar una pequea alcuota y utilizar contador hematolgico (valtek BC-2800) para realizar conteo de clulas blancas.

23

b) Posterior a esto realizar la preparacin de los extractos (Ac. p-cumarnico y Ac. ferlico) a diferentes concentraciones (4, 2 y 0,5 mg/ml), usar solucin salina para preparar los compuestos.

c) Preparar solucin de Concanavalina A, pesando 0,95 mg, suspendindolo en 2 ml de solucin salina. Concentracin final Concanavalina A en cada pocillo es de 50 g/ml.

d) Luego de haber obtenido el recuento de las clulas, diluir la muestra con medio de cultivo hasta llevar la solucin a una concentracin de 900.000 clulas/ml.

e) Se agregan a una placa de 96 pocillos 150 l de muestra, en cada uno de los pocillos.

f) Agregar 20 l de Concanavalina A, a cada uno de los pocillos, menos a los ltimos 12 pocillos de abajo, tal como aparece en la tabla 1.

g) Agregar 20 l de cada uno de los compuestos a las diferentes concentraciones de la forma en la que aparece en la tabla 1.

h) Realizar cultivo celular en una atmosfera de 5% de CO2 a 37C por 48 horas.

24

TABLA 1. Protocolo de cargar de los compuestos a estudiar Compuesto Ac. Ferlico (4 mg/ml) Ac. Ferlico (2 mg/ml) Ac. Ferlico (0,5 mg/ml) Ac. p-cumarnico (4 mg/ml) Ac. p-cumarnico (2 mg/ml) Ac. p-cumarnico (0,5 mg/ml) Concanavalina A Controles Compuesto Solucin salina Solucin salina Volumen 20 l 40 l Pocillos Desde G1-G12 Desde H1-H12 Volumen 20 l 20 l 20 l 20 l 20 l 20 l 20 l Pocillos Desde A1-A12 Desde B1-B12 Desde C1-C12 Desde D1-D12 Desde E1-E12 Desde F1-F12 Todos, menos de H1-H12

6.6 Extraccin ARN

Retirar el sobrenadante de los pocillos, luego agregar al primer pocillo 150 l de la solucin RNA-solv Reagent (Omega Bio-Tek) y 50 l desde el segundo al nmero 12, la finalidad de esto es destruir las clulas y con esto solubilizar el material gentico de esta. Luego traspasar el contenido de los pocillos a un tubo eppendorf 1,5 ml, tal como se observa en la Figura 2.

25

Figura 2. Protocolo de Solubilizacin de RNA.

Lo siguiente que se realizo fue la separacin del RNA, ya que en solucin quedo tanto el ARN, ADN como proteinas, para esto se agreg al tubo eppendorf cloroformo en proporcin 1/5 con la solucin RNAsolv, dado que el volumen total de solucin es de 250 l, se adiciono al tubo 50 l de cloroformo, se agito por 15 segundo (no utilizar vortex) y se dej incubar a temperatura ambiente por 5 minutos, para finalmente centrifugar el tubo a 12.000 rpm por 15 minutos a 4C.

Luego de la centrifugacin se lograron distinguir 3 fases: una superior (encuentra ARN), una fase intermedia (ADN) y una fase inferior (donde se encuentran protenas y lpidos). Se separ la fase superior y se deposit en otro tubo eppendorf. Posterior a esto se realiz la precipitacin del ARN, para esto al tubo eppendorf que contiene el ARN se le agrego 250 l de citrato de sodio estril 0,8 M, ms 250 l de isopropanol a -20C y se incuba a temperatura ambiente por 5 minutos, luego de esto se incubo por 10 minutos a -80C. Luego se centrifuga a 12.000 rpm por 15 minutos a 4C, se removi el sobrenadante y el pellet que quedo en el tubo se lav con 400 l de etanol al 70%, se aplic vortex suavemente para soltar el pellet y se centrifugo a 12.000 rpm por 10 minutos a 4C, eliminando el sobrenadante y dejando secar el pellet (el pellet corresponde al RNA).
26

Finalmente se resuspende el pellet en 50-100 l de agua DEPC, se calienta a 58C por 10 minutos y se guarda a -20C para ser utilizado en el proceso siguiente.

6.7 Preparacin de ARN libre de ADN previo a la RT-PCR

Previo a la realizacin de la RT-PCR, el ARN obtenido en la etapa anterior, fue tratado con DNasa I-RNasa free, paso fundamental que evita la contaminacin genmica de la muestra, mediante la digestin del ADN presente, consiguiendo mantener nicamente el RNA. Se adicion a un tubo libre de RNasa: 1 g de ARN, 1 l de buffer de reaccin 10X con MgCl2, y se complet hasta 9 L con agua libre de RNasa, para luego agregar 1 l (1U) de la enzima DNase I, RNase-free. Una vez adicionado los reactivos, las muestras fueron incubadas a 37C por 30 min., al cabo del cual se agreg 1l de EDTA 25 mM y se incub a 65C por 10 minutos. La adicin de EDTA es crucial, ya que el aumento de temperatura hidrolizara el ARN en ausencia de este agente quelante. Este preparado se utiliz directamente para la transcripcin reversa.

6.8 Cuantificacin ARN

Obtenido el ARN, se procedi a la cuantificacin de este, por medio de espectrofotometra. Se tom 1 l de la muestra de ARN y se midi la absorbancia (Nanodrop Spectrophometer ND-100). Las mediciones se hicieron a dos longitudes de onda para cada muestra: a 260 nm ( 1 unidad D.O corresponden a 40 g de ARN/ml), la cual nos indic la cantidad de ARN presente y a 280 nm, que nos proporcion la cantidad de protena. La cantidad de ARN se obtuvo aplicando la siguiente formula:

Concentracin de ARN= 40 g/ml x Absorbancia


27

La integridad del ARN obtenido se comprob corriendo 1 l del mismo en un gel de agarosa, teido con GelRed Nucleic Acid Stain 10.000X (Biotum) (agarosa al 1% en tampn TAE 1X, con adicin de 2,5 l de GelRed). Se carg el gel con la totalidad de las muestras, 5 l de cada muestra adicionando 2 l de tampn de corrida respectivamente.

6.9 Sntesis de cDNA a partir de ARN

El objetivo de esta etapa es llevar a cabo la sntesis de copias de cDNA a partir de RNA, obtenido de la etapa anterior.

A un tubo libre de RNAsa se agregan los siguientes componentes en el orden y concentracin que se describe a continuacin: 5 l de RNA molde, 1 l de primer Oligo (dT) y se completa hasta 20 l con agua libre de RNasa, luego se agregan 4 l de buffer de reaccin, 0,5 l (20U) de inhibidor de RNAsas (RiboLockTM), 2 l del mix de dNTPs 1mM concentracin final (cada uno 10 mM) y 1 l de la enzima Transcriptasa reversa (RevertAidTM). Las muestras se incuban por 60 minutos a 42C en el termociclador PTC100 y se termina la reaccin aumentando la temperatura a 70C por 10 minutos. El producto de la transcripcin reversa, corresponda a cDNA el que se utiliza directamente en la PCR. En el caso de no utilizar inmediatamente, se almacena para su uso posterior a -20C.

6.10 Amplificacin de cDNA por PCR

Se utiliz como muestra el cDNA molde obtenido en la etapa anterior, para su amplificacin a travs de PCR. Se emplearon partidores para la deteccin IL-2, as como para deteccin del gen GAPDH. La utilizacin de este ltimo gen se realiz como control de la tcnica, debido a que corresponde a un gen de expresin constante. La tabla 2 muestra los primers empleados en el estudio.

28

TABLA 2. Primers empleados para la deteccin de IL-2 Y GAPDH Gen IL-2 Secuencia primer (5`3`) F: GAATCCCAAACTCACCAGGA R: GGTAGCAAACCATACATTCAACA GAPDH F: GTACATCATCTCCGCCCCTTC R: GCCTGCTTCACCACCTTCTTGA 440 Producto (Pb) 400 Tm EXP.(C) 54,5 53,5 64,0 68,0

Para la estandarizacin de la PCR se prob el protocolo que se muestra en la tabla 3. Se agreg a un tubo eppendorf libre de RNasa los reactivos, en las cantidades y orden especificado como se muestra a continuacin.

TABLA 3. Protocolo para amplificacin por PCR Reactivos Buffer PCR Primer Forward Primer Reverse Magnesio DNTPs Agua libre RNasa cDNA Enz. Taq Polimerasa Volumen Final IL-2 (l) 1,3 1 1 1 1 5,5 1,4 0,3 12,5 GAPDH (l) 1,3 1 1 1 1 5,5 1,4 0,3 12,5

29

Para realizar la PCR se utiliz un termociclador en gradiente de temperatura (TC-Plus de TECHNE), el cual permite probar en forma simultnea diferentes temperaturas de anneling para IL-2 y GAPDH. Los programas de termociclado a los que fueron sometidas las muestras se exponen en la tabla 4.

TABLA 4. Programa de termociclado para PCR con gradiente de Temperatura. N ciclos 1 Desnaturalizacin Inicial 30 Annealing 30 segundos 30 segundos 95 50,1; 50,5; 51,6; 52,6; 53,6; 54,3; 55; 55,7; 56,6; 57,7; 58,8; 59,4 30segundos 1 Elongacin 5 minutos 72 72 5 minutos 95 de Pasos Duracin Temperatura (C)

Las muestras de cDNA fueron dispuestas en el termociclador de acuerdo a las diferentes temperaturas de annealing.

6.11 Visualizacin del producto amplificado

Una vez que se obtuvo el producto amplificado se realizo una corrida electrofortica en gel de agarosa al 1%, teido con GelRed (agarosa al 1% en tampn TAE 1X, con adicin de 25 l GelRed 10.000X). En tubos libres de RNasa, se mezclaron 5 l de muestra ms 2 l de solucin de frente corrida, mezcla que posteriormente se carg en los respectivos pocillos del gel. Se utiliz un marcador de peso molecular I nvitrogen, que se carg con 1 l de tampn de corrida Se conectaron los electrodos y se dej correr el gel a 100 volt, por un
30

periodo de 45 minutos. Luego se observaron las bandas presentes en el gel a travs del transiluminador. 7. RESULTADOS

7.1 Estandarizacin extraccin clulas mononucleares

Para estandarizar la extraccin de clulas mononucleares se probaron 3 protocolos distintos, los que se pueden apreciar en la tabla 5.

TABLA 5. Protocolos de separacin de clulas mononucleares Protocolo 1 Sangre extrada Relacin PBS/sangre Volumen histopaque 1077 Velocidad centrifugacin Tiempo centrifugacin 30 minutos 10 minutos 10 minutos 1750 rpm 2000 rpm 2000 rpm 3 ml 3 ml 3 ml 9 ml 1/9 Protocolo 2 10 ml 3/10 Protocolo 3 10ml 1/1

Con los primeros dos protocolos de extraccin no obtuvimos buenos resultados, tal como se puede apreciar en la figura 3A, mientras que con el tercer protocol pudimos obtener una separacin de las clulas, tal como se puede observar en la figura 3B.

31

Figura 3. Separacin clulas mononucleares

7.2 Estandarizacin cultivo celular

Para realizar la estandarizacin del cultivo celular se realiz una curva de concentracin, los resultados de esta curva se pueden observar en la figura 4, en donde podemos observar claramente que tanto en la figura 4A, 4B y 4C hay un crecimiento pobre de las clulas mientras que en la figura 4D y 4E podemos observar una gran cantidad de clulas. Debido a que no existe una diferencia significativa entre la figura 4D y 4E, se decide escoger el punto correspondiente a la figura 4D, que es el punto con el cual se realiz el cultivo celular.

32

Figura 4. Fotografa microscopio ptico aumento 40X del cultivo celular a diferentes concentraciones de clulas mononucleares. A) 1x106. B) 2x106. C) 4x106. D) 6x106. E) 8x106 clulas/ml

7.3 Viabilidad celular

En la figura 5 podemos observar los resultados de la prueba de viabilidad realizada con azul de tripan, como podemos observar en esta imagen, casi la totalidad de las clulas se
33

aprecian de color blanco, lo que nos dice que estas estn aptas para el cultivo. El clculo del porcentaje de viabilidad dio de un 98%, el cual se encuentra dentro del porcentaje estipulado anteriormente en procedimientos (>98%).

Figura 5. Fotografa al microscopio ptico 40X de conteo clulas viables. En rojo se sealan clulas teidas azules, que representan clulas no viables.

Adems de esto se decidi repetir la prueba a las 24 hrs, para poder determinar el deterioro que sufren las clulas en el tiempo, para esto previo al cultivo celular se extrajo una alcuota de la muestra y se dej a temperatura ambiente, luego de 24 hrs se realiz nuevamente la prueba de viabilidad con azul de tripan, esta prueba puede observarse en la figura 6. Como se puede apreciar en la figura al contrario de la prueba realizada con las clulas recin extradas, aqu la totalidad de las clulas se tien azul, lo que nos quiere decir que las clulas cultivadas a temperatura ambiente mueren fcilmente, ya que no se encuentran en las condiciones adecuadas de mantencin.

34

Figura 6. Prueba de viabilidad realizada con clulas cultivadas a T ambiente por 24 hrs (Aumento 40X).

7.4 Estandarizacin temperatura anneling PCR

En la figura 6 se puede observar la corrida electrofortica realizada para IL-2 y GAPDH a diferentes temperaturas de anneling. El gen GAPDH, utilizado como control, fue detectado a las diferentes temperaturas de anneling con una ptima resolucin de las bandas (figura 7A). Este proceso fue repetido tambin para IL-2 (7B), obtenindose solo una banda detectable a la temperatura de 50,1C, por lo que fue esta la temperatura utilizada para la corrida electrofortica de la muestra analizada.

35

400 pb 500 pb

400 pb

Figura 7. Electroforesis en gel de agarosa al 1% con productos de PCR para IL-2 y GAPDH. A) Figura que muestra PCR para GAPDH (PM: 440pb) con distintas temperaturas de anneling. B) Figura que muestra PCR para IL-2 (PM: 400pb) con distintas temperaturas de anneling.

36

7.5 Corrida Electrofortica IL-2

Una vez realizado la estandarizacin de las diferentes tcnicas utilizadas en este estudio, se procedi al anlisis de la muestra con los diferentes compuestos. Como se menciono anteriormente se utilizaron dos compuestos diferentes (Ac. ferlico y Ac. p-cumarnico) a tres concentraciones diferentes (4; 2; 0,5 mg/ml). Los resultados de esta corrida electrofortica se pueden apreciar en la figura 8, en esta figura podemos apreciar que la corrida de electroforesis fue negativa para los dos compuestos (Ac. ferlico y Ac. pcumarnico) a sus diferentes concentraciones, y que los controles se apreciaron levemente.

Figura 8. Electroforesis gel de agarosa al 1% con producto de PCR para IL-2, de clulas cultivadas con los compuestos a diferentes concentraciones.
37

8. DISCUSION

La IL-2 tiene un rol muy importante en muchos procesos patolgicos, y como una buena terapia para ciertas patologas. La utilizacin de IL-2 para el tratamiento de algunos canceres es una de las propiedades mayormente reconocidas de esta Interleuquina, sin embargo hay muchos estudios en los cuales el uso de IL-2 ha probado ser una buena terapia. Se ha podido probar mediantes estudios que el uso de IL-2 durante la primera etapa de la infeccin por Leishmania donovani sera una buena opcin de tratamiento (Bodas et al., 2012).

La identificacin y posterior estudio de genes especficos, es uno de los temas de mayor importancia en la biologa molecular, debido a que estos estudios son capaces de proporcionar valiosa informacin respecto a la funcin, regulacin y potencial papel que presentaran estas protenas en diversos procesos patolgicos, y poder evidenciar los posibles beneficios que traera su uso como tratamiento para ciertas patologas.

Por otro lado el desarrollo de la metodologa de PCR ha constituido un importante avance, el cual logra ser una buena alternativa para el estudio de un gran nmero de molculas que se encuentran implicadas tanto en procesos fisiolgicos como patolgicos. Si bien dentro de las diferentes modalidades de PCR existentes hay variantes que son mucho ms sensibles (por ejemplo: real time PCR), estas son muchos ms costosa, y por ende menos accesibles para nuestro laboratorio. A pesar de esto la metodologa de RT-PCR (reverse transcription PCR) ha probado tener un buen rendimiento, y los costos son menores al compararlos con otras metodologas (Archanco et al, 2007).

Por otro lado la extraccin de RNA con el reactivo RNA-solv y la metodologa empleada no fue satisfactoria, debido a que se obtuvo una cantidad de RNA muy pequea,
38

lo cual puede haber sido una de las causas posibles de que no se pudiera visualizar nada en la corrida de electroforesis. Sin embargo, esta metodologa ya haba sido probada con existo en otro trabajo, para la extraccin de RNA de plaquetas, en la cual haba obtenido un buen resultado (Bravo, 2012).

Algo que nos llama la atencin del protocolo utilizado es la conservacin de la muestra de RNA, la cual se realiz a -20oC. Sin embargo, en varios protocolos de trabajos revisados se realiza la conservacin de este tipo de muestras a -80oC, debido a lo lbil que es el RNA y la facilidad con la que se degrada. Dicho punto podra haber afectado la integridad de nuestra muestra, debido a que la lectura del RNA no se realiz inmediatamente, sino que la muestra fue guardada a -20oC, para ser leda con posterioridad.

Otro punto para tomar en consideracin es la posible inhibicin de la sntesis de IL-2, ya que como mencionamos anteriormente hay diferentes compuestos producidos

principalmente por bacterias y hongos que inhibiran la sntesis de IL.2. Sin , esto no se queda aqu, ya que estudios han podido determinar que existiran otras interleuquinas que podran poseer un efecto inhibidor sobre IL-2, este es el caso de IL-10, la cual inhibira la produccin de IL-2 (Barros et al., 2011). Esto podra explicar los resultados obtenidos en esta tesis, ya que la IL-10 podra haber ocasionado la supresin de IL-2 lo que ocasionara que no se pudiera apreciar est en la corrida del gel de electroforesis.

Debido a lo mencionado anteriormente es de vital importancia realizar nuevos estudios en relacin a estimulacin IL-2. Sera interesante hallar una forma de estimular selectivamente la produccin de esta Interleuquina y al mismo tiempo hallar una forma de inhibir IL-10, con la finalidad de disminuir la supresin que est dada por esta Interleuquina. Adems una buena alternativa para el estudio de este tipo de compuesto seria la utilizacin de kit comerciales para la extraccin de RNA, que a pesar de poseer un costo mayor en comparacin con la metodologa que utilizamos, tienen un mejor rendimiento.
39

Finalmente, mencionar que a pesar de que los resultados obtenidos al analizar la muestra no fueron los esperados, logramos detectar ciertos puntos crticos, que deberan ser analizados y corregidos en estudios posteriores.

40

9. CONCLUSION

Los resultados obtenidos en esta memoria nos permiten concluir:

Logramos estandarizar el proceso de cultivo celular, obteniendo un recuento de clulas apropiado para la extraccin de RNA a partir de estas.

Fue posible obtener RNA a partir de clulas mononucleares mediante el uso del reactivo RNA-Solv, sin embargo, las cantidades obtenidas fueron muy bajas, lo que se puede observar en la corrida electrofortica de la muestra analizada.

Pudimos establecer las condiciones ptimas para la realizacin de PCR, tanto para GAPDH como para la IL-2. El GAPDH mostro ser un buen gen de control dado que se expres en forma constante y en una buena cantidad.

La RT-PCR parece ser una buena herramienta para el estudio de la expresin gnica de interleuquinas a partir de clulas mononucleares humanas.

A pesar de que logramos la estandarizacin de las diferentes tcnicas utilizadas, desde el proceso de separacin de las clulas, hasta la tcnica de PCR, al momento de realizar el anlisis de la muestra los resultados obtenidos no fueron los esperados, ya que no pudimos apreciar ninguna banda en el gel de agarosa.

Se puede concluir que los compuestos utilizados (Ac. Ferlico y Ac. P-cumarnico), no ejercera un efecto inmunoestimulador sobre la IL-2, incluso podramos considerar, debido

41

a la ausencia de bandas, que estos compuestos podran inhibir la sntesis de esta Interleuquina, lo que explicara los resultados obtenidos.

42

10. BIBLIOGRAFIA

Archanco M.; et al. 2007. Expression of Leptin and Adiponectin in the Rat Oviduct. Journal of Histochemistry & Cytochemistry. 55(10): 10271037.

Amemiya, H. (1996) 15-deoxyspergualin: A newly developed immunosuppressive agent and its mechanism of action and clinical effect: A review. Artificial Organs 20: 832-835.

Banchereau J, Steinman RM. 1998.Dendritic cells and the control of immunity. Nature 392: 245-52.

Banderas M.; et al. 2004. Anlisis protemico de monocitos circulantes humanos. Aplicacin a pacientes con sndrome coronario agudo. Investigacion Cardiovascular 7(1): 1-18.

Barros C.; et al. 2011. Citocinas y Dolor. Revista Brasilea Anestesiologia. 61 (2): 137-142

Belmonte l.; et al. 2007. Papel de las clulas dendrticas en la infeccin por VIH y VHC. MEDICINA 67 (1): 63-70

Bravo Urquiza I. 2012. Estandarizacin del mtodo de RT-PCR para fosfolipasa CB2 y B3 (PLCB2,3) en plaquetas. Tesis de grado. Talca. Universidad de Talca. Facultad de Ciencias de la Salud. Escuela de Tecnologa Mdica. 30p

Crespo, J.L., Hall, M.N. (2002) Elucidating TOR signaling and rapamycin action: lessons from Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 66: 579-591.

43

Dutta-Roy A.K. Crosbie L. Gordon M.J. 2001. Effects of tomato extract on human platelet aggregation in vitro. Platelets 12(4): 218-227.

Garca J. 2002. Introduccin al cultivo de tejidos (en lnea). Disponible en http://histolii.ugr.es/jmgarcia/cultivos/cultivos.pdf. Consultado 18 Nov. 2012.

Godoy B., Murgas P., Trichauer J., Von Bernhardi R. 2012. Scavenger receptor class A ligands induce secretion of IL1 and exert a modulatory effect on the inflammatory activation of astrocytes in culture. Rev. Journal of Neuroimmunology. 251(2012): 613

Gonzlez E. 1997. Tratamiento con Interleuquina 2 en pacientes con neoplasia linfoide en remisin completa con alto riesgo de recaida. Tesis de grado. Barcelona, Universidad Autonoma de Barcelona, Facultad de Medicina. 2 p.

Hernndez M., Alvarado A. 2001. Interleucinas e Inmunidad Inata. Rev Biomed 12(4): 272-280.

Hfer T., Krichevsky O., Altan-Bonnet G. 2012. Competition for IL-2 between regulatory and effector T cells to chisel immune responses. Rev Frontier in Immunilogy 3(200):1-8

Khachik F.; et al. 2002. Chemistry, Distribution, and Metabolism of Tomato Carotenoids and Their Impact on Human Health. Experimental Biology and Medicine 227 (10):845851.

Koga T.; et al. 2012. Calcium/Calmodulin-Dependent Protein Kinase IV Suppresses IL-2 Production and Regulatory T Cell Activity in Lupus. Journal of Immunology Abstract 189 (7):3490.

44

Liu Y.; et al. 2001 Dendritic cell lineage, plasticity and cross regulation. Nat Immunol. 2:585-589.
Llarena R. 2009. Tratamiento del cncer renal metastsico: vigencia de inmunoterapia. Actas Urol Esp[online]. vol.33, n.5, pp. 584-592. ISSN 0210-4806. la

Mellman I., Steinman R. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell. 106:255-258.

Moore G.Woods L. 1976. Culture Media for Human Cells- RPMI 1603, RPMI 1634, RPMI 1640 and GEM 1717. Tissue Culture Association Manual. 3, 503-508.

Morgan D., Ruscetti F., Gallo R. 1976. Selective in vitro growth of T lymphocytes from normal human bone marrows. Rev Science 193(4257):1007-8.

Murphy, K.; et al. 2009. Inmunobiologa de JANEWAY. Mxico: Editorial Mc Graw Hill. Sptima Edicin. 3 p.

Palomo, I.; et al. 2002. Fundamentos de Inmunologa Bsica y Clnica. Talca: Editorial Universidad de Talca. Segunda Edicion. 58 p.

Pelez F., Genilloud O. 2004. Nuevos Frmacos Basados en Productos Naturales de Origen Microbiano. Centro de Investigacin Bsica Merck, Sharp & Dohme de Espaa, S.A. 38 (23027): 123-166.

Perez B., Francisco et al. Niveles plasmticos de citoquinas IL-1, IL2 e IL-4 en nios diabticos tipo 1 de diagnstico reciente y su asociacin con anticuerpos pancreticos. Rev. md. Chile [online]. 2004, vol.132, n.4, pp. 413-420. ISSN 0034-9887. Plosker, G.L., Barradell, L.B. (1996) Cyclosporin. A review of its pharmacological properties and role in the management of graft versus host disease. Drug Eval. 5:59-90.
45

Rivest, S. 2009. Regulation of innate immune responses in the brain. Nat. Rev. Immunol. 9, 429439. Rodrguez A.; et al. 2009. La modulacin de la sntesis de IL-2 e IFN- por clulas mononucleadas humanas se asocia a la inmunosupresin fisiolgica del fluido epididimario. Rev Alergia, Asma e Inmunologa Pediatrica 18(2):39-46 Rodrguez Amaya. 1997. Carotenoides y Preparacin de Alimentos: La retencin de los carotenoides Provitamina A en alimentos preparados, procesados y almacenados. Departamento de Ciencias de alimentos, Facultad de Ingeniera de Alimentos, Universidad Estatal de Campinas. Brasil. 1p.

Roitt I., Brostoff J., Male D. 2000. Inmunologa. Mxico: Editorial Harcourt. Quinta Edicin. 1p.

Von Bernhardi, R., 2007. Glial cell dysregulation: a new perspective on Alzheimer disease. Neurotox. Res. 12, 215232.

Von Bernhardi, R., Tichauer, J., Eugenn, J., 2010. Aging-dependent changes of microglial cells and their relevance for neurodegenerative disorders. J. Neurochem. 112, 1099 1114.

Wei M., Giovannucci E. 2012. Lycopene, Tomato Products, and Prostate Cancer Incidence: A Review and Reassessment in the PSA Screening Era. Journal of Oncology 2012: 1-7

Yamamoto J.; et al. 2003. Tomatoes have natural anti-thrombotic effects. Br J Nutr 90(6): 1031-1038.
46

Yulan D.; et al. 2012. Host Cytokine Storm Is Associated With Disease Severity of Severe Fever With Thrombocytopenia Syndrome. The Journal of Infectious Diseases 206 (25): 1085-1094.

47