You are on page 1of 6

Transboundary and Emerging Diseases

ORIGINAL ARTICLE

Development and Evaluation of a Loop-Mediated


Isothermal Amplification Method for Diagnosis of Tropical
Theileriosis
D. A. Salih1,3, Z. Liu1, M. A. Bakheit2, A. M. Ali1, A. M. El Hussein3, H. Unger4, G. Viljoen4,
U. Seitzer1 and J. S. Ahmed1
1
Division of Veterinary Infection Biology and Immunology, Research Center Borstel, Parkallee 22, D-23845 Borstel, Germany
2
National Research Center for Protozoan Diseases (NRCPD), Obihiro University for Agriculture and Veterinary Medicine, Inada-cho,
Obihiro, Hokkaido 080-8555, Japan
3
Central Veterinary Research Laboratories, Al amarat, PO Box 8067, Khartoum, Sudan
4
Animal Production and Health Section, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic
Energy Agency, Vienna International Centre, Wagramer Strasse 5, PO Box 100, A-1400 Vienna, Austria

Keywords: Summary
Diagnosis; LAMP; Theileria annulata
A loop-mediated isothermal amplification (LAMP) assay was developed and
Correspondence: evaluated for diagnosis of tropical theileriosis. A set of six primers was
J. S. Ahmed. Division of Veterinary Infection designed based on the unique gene of Theileria annulata (Theileria annulata
Biology and Immunology, Research Center strain Ankara hypothetical protein (GeneDB TA04795). The protocol for the
Borstel, Parkallee 22, D-23845 Borstel, reaction was setup and the specificity and sensitivity of the assay were estab-
Germany. Tel.: +49 (0) 4537 188 428;
lished. The specificity experiment showed that LAMP primers amplified
Fax: +49 (0) 4537 188 627; E-mail: jahmed@
fz-borstel.de
T. annulata DNA successfully, while no amplification was seen for Theileria
parva, Theileria mutans, Theileria sergenti, Theileria sinensis, Babesia bovis as
Received for publication March 5, 2008 well as bovine genomic DNA and water control. When the sensitivity of
LAMP assay was compared with that of conventional PCR a 10-fold higher
doi:10.1111/j.1865-1682.2008.01033.x sensitivity was found, with a detection limit of 10 pg/ll of genomic DNA
isolated from a T. annulata-infected cell line. The LAMP product was con-
firmed by restriction digestion and staining with SYBR Green I. Furthermore,
the LAMP assay was applied for the diagnosis of T. annulata in field samples
and compared with reverse line blot (RLB), demonstrating that results of the
LAMP assay corresponded to those of RLB. These results indicate that the
LAMP assay is rapid and simple to run, cost-effective, sensitive and specific
and has potential usefulness for application in epidemiological studies on
T. annulata infection of cattle.

Generally, diagnosis of theileriosis is based on the


Introduction
microscopic examination of blood smears or lymph node
Tropical theileriosis (Theileria annulata infection of cat- biopsies. This method is useful in detection of acute cases
tle) is an economically important protozoan disease of but has limited value in carrier status, where low numbers
cattle in tropical and subtropical regions (Robinson, of erythrocytes remain infected with piroplasms. The
1982). Theileria annulata is transmitted by ticks of the development of molecular biology has made accurate
genus Hyalomma after cyclical development in these ticks tools available for the detection of the parasite. A PCR
(Uilenberg, 1981). The endemic area of T. annulata assay for the diagnosis of T. annulata in the bovine host
stretches out from the Mediterranean coastal regions in has been developed based on the Tams-1 gene (d’Oliveira
Southern Europe, Northern Africa including Mauritania et al., 1995). Also, reverse line blotting (RLB) to detect
and surroundings of the Nile into Central Sudan and and differentiate all known Theileria and Babesia species
Middle East to south of the Caucasus splitting round the on the basis of differences in their 18S subunit rRNA
Himalaya (Dolan, 1989). gene sequences has been developed (Gubbels et al., 1999).

ª 2008 The Authors


238 Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243
D. A. Salih et al. LAMP for Detection of T. annulata

However, these techniques require equipped laboratories


Materials and Methods
to perform and elevated application costs, thus they are
not widely applied in developing countries. Primers design
Loop-mediated isothermal amplification of DNA Six specific primers (F3, B3, FIP, BIP, LF and LB) for
(LAMP) is a novel method, whereby DNA is amplified with T. annulata were derived from the sequence of the unique
high specificity, efficiency and rapidity under isothermal gene of T. annulata (Theileria annulata strain Ankara
conditions using a set of four or six specifically designed hypothetical protein (GeneDB TA04795) partial mRNA
primers, which recognize six or eight specific target seq- (Pain et al., 2005). LAMP primers (F3, B3, FIP and BIP)
uences, and a DNA polymerase with strand displacement were designed using the Primer Explorer V4 program
activity (Notomi et al., 2000; Nagamine et al., 2002). This (http://primerexplorer.jp/e/), while loop primers (LF and
method can amplify a few copies of DNA to 109 copies in LB) were designed manually. The primers were synthe-
less than an hour under isothermal conditions. Moreover, sized by MWG Biotech AG (Munich, Germany). The
LAMP can be applied using non-denatured template, and sequence of each primer and location within the target
DNA extraction may also be neglected, because a drop of sequence are shown in Table 1 and Fig. 1, respectively.
blood spotted on a filter paper meets the requirements to
initiate the reaction (Nagamine et al., 2001). The method
LAMP reaction conditions
has been successfully developed for the detection of several
viral, bacterial and protozoan infections (Iwamoto et al., The reaction was performed in a final volume of 25 ll
2003; Kuboki et al., 2003; Ihira et al., 2004). which contained 12.5 ll 2· LAMP reaction buffer [20 mm
The present study was designed to develop and evaluate Tris–HCl (pH 8.8), 10 mm KCl, 10 mm (NH4)2SO4, 8 mm
a LAMP for the diagnosis of T. annulata infection of cat- MgSO4 and 0.2% Tween 20], 125 lm each deoxynucleo-
tle. Moreover, the application of LAMP for diagnosis of side triphosphate, 0.8 m betaine (Sigma-Aldrich Chemie,
T. annulata infection in naturally infected animals from Munich, Germany), 8 U of the Bst DNA polymerase large
Sudan is reported and compared with RLB. fragment (New England Biolabs, Frankfurt am Main,

Table 1. LAMP primers designed for Theileria annulata and used in this study

Primer name Type Length Sequence (5¢–3¢)

F3 Forward outer 24-mer CGCATTTGATCTTCTTATCGTTAT


B3 Backward outer 18-mer CACTGGACATCGTGATGA
FIP Forward inner primer 45-mer; GCGGGATTACCTTTGGTGTCTTTT
(F1 + TTTT+F2) F1,20mer, CTAGATGTCATTTTTGTATACTCAC
F2, 25mer
BIP Backward inner primer 40-mer; AGTGGCGGTGCTAGTTTTAATGTTTT
(B1 + TTTT+B2) B1, TAACTTCACCACTGAGCG
22mer,B2,
18mer
LF Loop Forward 23-mer GTAGAGATCAGTGAAAAATTGAC
LB Loop Backward 20-mer GGCTGCCATCACAATCAAAG

Fig. 1. Positions of LAMP


primers on Theileria annulata
TA04795 unique gene. The
recognition site for the HhaI
restriction enzyme is under-
lined. F3 and B3 were also
used in PCR.

ª 2008 The Authors


Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243 239
LAMP for Detection of T. annulata D. A. Salih et al.

Germany), 40 pmol each FIP and BIP primers, 20 pmol


LF and LB primers, 5 pmol each F3 and B3 primers, and
2 ll of target DNA. The mixture was incubated at 63C
for 45 min using a conventional heating block (Stuart
Scientific, Stone, Staffordshire, UK) and then heated at
80C for 3 min to terminate the reaction.

Detection of LAMP product


An aliquot of 5 ll of LAMP product was subjected to
electrophoresis on a 1.5% agarose gel in a Tris-acetic
acid-EDTA (TAE) buffer at 90 V for 1 h, then visualized
under UV light after staining with ethidium bromide. In
addition, LAMP amplicons were detected directly by the
naked eye by addition of 1.0 ll of 1:10-diluted SYBR
Green I (Roche Diagnostics, Mannheim, Germany) to the
mixture and observation of the solution colour. The solu- Fig. 2. Restriction digestion of LAMP product with HhaI. Lanes: M,
tion turned green in 1 min in the presence of a LAMP molecular marker (1 kp); 1, non-digested LAMP product; 2: LAMP
product digested with HhaI.
amplicon, while it remained orange when no amplifica-
tion occurred. On the basis of the restriction map of the
target sequence, the HhaI enzyme (Invitrogen, Karlsruhe,
Application of LAMP for field study
Germany) was selected for use for restriction analysis of
the LAMP product. Restriction digestion with this To evaluate the feasibility of LAMP method for diagnosis
enzyme was performed for 3 h at 37C. The digested of field samples, a total of 61 samples collected from Cen-
products were analyzed by electrophoresis on a 1.5% aga- tral Sudan were subjected to LAMP. These samples were
rose gel as described above. analysed previously by RLB (Ali et al., 2006) and showed
an infection rate of T. annulata of 65.4% (106 positive
samples of 162 tested).
PCR verification of target length
The outer LAMP primer pairs designated F3 and B3 were
Results
used for PCR amplification to verify whether a correct
target was amplified. The reaction was performed as To establish an optimum incubation time needed for
described by Gubbels et al. (1999), with the following LAMP with T. annulata primers, reactions were incubated
modifications: the primers were applied in a concentra- at different time lengths starting from 15 min to 90 min
tion of 10 pmol and the annealing temperature was set at at 63C. Analysis of the results indicated that incubation
57C for 35 cycles. PCR product was analysed on a 1.5% for 45 min is sufficient for the reaction to occur (data
agarose gel as described above. The PCR product was not shown). In the gel electrophoresis analysis, LAMP
subjected to cloning and sequencing experiments. products showed ladder-like patterns with fragments of

Specificity and sensitivity of LAMP


The specificity of LAMP primers were examined by test-
ing 100 ng/ll of the genomic DNA of T. annulata,
T. parva, T. mutans, T. sergenti, T. sinensis, Babesia bovis
as well as bovine genomic DNA (PBL) and water control.
The quality of the samples was verified using specific
PCR and sequence analysis (Salih et al., 2007). To deter-
mine the analytical sensitivity of the LAMP assay, 10-fold
dilutions were made from 100 ng/ll of genomic DNA
isolated from a T. annulata-infected cell line up to 1 fg/ll
and used as templates for the LAMP reaction. The same Fig. 3. PCR amplification of T. annulata with specific LAMP F3 and
dilutions were also used as templates for normal PCR B3 primers. Lanes: M, molecular marker (1 kp); 1, positive control; 2,
using F3 and B3 LAMP primers. water control.

ª 2008 The Authors


240 Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243
D. A. Salih et al. LAMP for Detection of T. annulata

(a) B3 primers were used in regular PCR amplification,


resulting in a band with an expected size of 298 bp
(Fig. 3). The sequencing analysis of the PCR product con-
firmed that the specific gene segment was amplified.
The LAMP assay was found specific as it successfully
amplified only T. annulata DNA, while no amplification
was seen with other Theileria species, B. bovis or PBL
(b) (Fig. 4a). When reactions were detected using SYBR
Green I, only tubes containing T. annulata DNA turned
Fig. 4. Specificity of LAMP primers for T. annulata (TA04795). (a) green, while tubes containing DNA from other species
1.5% Agarose gel: Lanes M, molecular marker (1 kp), 1, T. annulata; retained the original orange colour (Figure 4b). The ana-
2, T. parva; 3, T. mutans; 4, T. sergenti; 5, T. sinensis; 6, B. bovis; 7, lytical sensitivity experiment performed using dilutions of
PBL; 8, water control. (b) The same LAMP reactions after straining genomic DNA isolated from a T. annulata-infected cell
with SYBR Green I. line revealed that the LAMP assay has a DNA detection
limit of 10 pg/ll (Fig. 5a). These results were confirmed
by staining the product with SYBR Green I (Fig. 5b).
(a)
PCR assays using the F3 and B3 primers carried out using
the same template used in the LAMP assay indicated that
LAMP assay has a 10-fold higher sensitivity than PCR
(Fig. 5c).
Table 2 presents the comparison between RLB and
LAMP for diagnosis of field samples obtained from 61
(b)
animals in the Sudan. Both techniques reported similar
results, where LAMP detected T. annulata DNA in 37
(c)
samples of 61 (60.7%), and RLB detected a total of 38
Fig. 5. Sensitivity of LAMP primers for T. annulata (TA04795) using samples (62.3%). However, 14 samples were tested posi-
10-fold serial dilutions of genomic DNA isolated from a T. annulata- tive in RLB but negative in LAMP. Likewise, there were
infected cell line. (a) 1.5% agarose gel: Lanes M, molecular marker 13 samples tested positive by LAMP negative by RLB. The
(1 kp); 1, 100 ng; 2, 50 ng; 3, 10 ng; 4, 1 ng; 5, 100 pg; 6, 10 pg; two tests agreed on 10 animals designated negative and
7, 1 pg; 8, 100 fg; 9, 10 fg; 10, 1 fg; 11, water control. (b) The same 24 animals designated positive.
LAMP reactions after straining with SYBR Green I (the same order).
(c) PCR with F3 and B3 primer (the same order).
Discussion
Table 2. Cross tabulation between LAMP and RLB analysis results of In this study, the development of the LAMP method for
61 field samples diagnosis of T. annulata infection using the unique gene
of T. annulata (GenBank accession no. XM_950085.1) is
RLB
described. The LAMP primer set designed from the
LAMP Positive Negative Total above-mentioned gene specifically amplified T. annulata
DNA. The specificity of LAMP was confirmed by restric-
Positive 24 13 37
Negative 14 10 24 tion enzyme analysis and PCR amplification of a prod-
Total 38 23 61 uct of the expected size. There are a number
of advantages of LAMP over conventional molecular
techniques. It amplifies DNA with high efficiency under
different sizes. To confirm that LAMP products corre- isothermal conditions, it is highly specific for the target
spond to the correct target sequence, the amplified prod- sequence and it is simple and easy to perform once the
ucts were digested with the HhaI enzyme. The restriction appropriate primers are prepared (Notomi et al., 2000).
map of the target sequence indicated that the HhaI The original LAMP of Notomi et al. utilized four prim-
enzyme cuts the product between LB and B2, and the rec- ers. Later, further improvement in the specificity and
ognition site is shown in Fig. 1. The sizes of the frag- reaction kinetics of LAMP were achieved by the intro-
ments resulting from the restriction digestion were in duction of loop primers (LF and LB), which reduced
good agreement with those predicted theoretically from the time taken for amplification by half (Nagamine
the expected DNA structure and showed that the reaction et al., 2002). Such a test could provide a useful diagnos-
was specific (Fig. 2). Moreover, the outer LAMP F3 and tic tool in a clinical laboratory, particularly in resource-

ª 2008 The Authors


Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243 241
LAMP for Detection of T. annulata D. A. Salih et al.

poor countries, in which tropical theileriosis is seriously mediated isothermal amplification (LAMP) method for
endemic. diagnosis of equine piroplasmosis. Vet. Parasitol. 143, 155–
The analytical sensitivity of LAMP using 10-fold serial 160.
dilutions of genomic DNA isolated from a T. annulata- Ali, A. M., M. A. Bakheit, M. M. Mukhtar, S. M. Hassan,
infected cell line showed that it could detect up to 10 pg/ J. S. Ahmed, and U. Seitzer, 2006: Epidemiology of Theileria
ll. It would be of great interest to determine the sensitiv- annulata infection of dairy cattle in the Sudan using molec-
ity of LAMP in terms of parasitaemia, which needs to be ular techniques. Ann. N. Y. Acad. Sci. 1081, 471–472.
performed in the future. Nevertheless, when the sensitiv- Dolan, T. T., 1989: Theileriosis: a comprehensive review. Rev.
Sci. Tech. Off. Int. Epiz. 8, 11–36.
ity of the LAMP assay was compared with that of conven-
Grab, J. D., J. Lonsdale-Eccle, and N. Inoue, 2005: LAMP for
tional PCR, the LAMP assay demonstrated a 10-fold
tadpoles. Nat. Methods 2, 635.
higher sensitivity. An added advantage of LAMP is that in
Gubbels, J. M., A. P. de Vos, M. van der Weide, J. Viseras,
contrast to Taq DNA polymerase used in standard PCR,
L. M. Schouls, E. de Vries, and F. Jongejan, 1999: Simulta-
the Bst polymerase is not inactivated by immunoglobulin
neous detection of bovine Theileria and Babesia species by
G and many other blood components and PCR inhibitors reverse line blot hybridization. J. Clin. Microbiol. 37, 1782–
(Grab et al., 2005). Because the LAMP method shows a 1789.
high tolerance to different biological substances, determi- Ihira, M., T. Yoshikawa, Y. Enomoto, S. Akimoto, M. Ohashi,
nation of the appropriate protocol for processing the S. Suga, N. Nishimura, T. Ozaki, Y. Nishiyama, T. Notomi,
template to make it a user friendly technique, prior to Y. Ohta, and Y. Asano, 2004: Rapid diagnosis of human
large scale evaluation, is needed. herpesvirus 6 infection by a novel DNA amplification
The current study has further applied LAMP on field method, loop-mediated isothermal amplification. J. Clin.
samples collected from central Sudan. It is noteworthy Microbiol. 42, 140–145.
that results of this study do not represent valid compari- Ikadai, H., H. Tanaka, N. Shibahara, A. Matsuu, M. Uechi,
son between LAMP and RLB because of the small num- N. Itoh, S. Oshiro, N. Kudo, I. Igarashi, and T. Oyamada,
bers of samples tested. Thus, further study of the LAMP 2004: Molecular evidence of infections with Babesia gibsoni
method using a larger numbers of samples being tested parasites in Japan and evaluation of the diagnostic potential
with a reference technique such as RLB, would be of a loop-mediated isothermal amplification method. J. Clin.
required to further validate LAMP assay for application Microbiol. 42, 2465–2469.
in large scale epidemiological studies. Iwamoto, T., T. Sonobe, and K. Hayashi, 2003: Loop-
Recent studies have evaluated the diagnostic potential mediated isothermal amplification for direct detection of
of LAMP for other protozoan diseases of animals, such as Mycobacterium tuberculosis complex, M. avium, and
babesiosis (Ikadai et al., 2004; Alhassan et al., 2007). M. intracellulare in sputum samples. J. Clin. Microbiol.
41, 2616–2622.
Taken together with previous results, the results reported
Kuboki, N., N. Inoue, T. Sakurai, F. Di. Cello, D. J. Grab,
herein may indicate that LAMP could provide an accu-
H. Suzuki, C. Sugimoto, and I. Igarashi, 2003: Loop-mediated
rate, sensitive, affordable and easy-to-use method and
isothermal amplification for detection of African trypano-
practicable alternative to PCR for routine diagnosis of
somes. J. Clin. Microbiol. 41, 5517–5524.
tropical theileriosis.
Nagamine, K., K. Watanabe, K. Ohtsuka, T. Hase, and
T. Notomi, 2001: Loop-mediated isothermal amplification
Acknowledgements reaction using a nondenatured template. Clin. Chem. 47,
1742–1743.
This research was supported by the International Atomic Nagamine, K., T. Hase, and T. Notomi, 2002: Accelerated reac-
Energy Agency (IAEA) through Technical Co-operation tion by loop-mediated isothermal amplification using loop
project no. SUD/05/029 entitled ‘Characterization and primers. Mol. Cell. Probes 16, 223–229.
quality assured production of an attenuated Theileria an- Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa,
nulata vaccine’. DAS received an IAEA fellowship (SUD/ K. Watanabe, N. Amino, and T. Hase, 2000: Loop-mediated
07020). This work was supported partly by the isothermal amplification of DNA. Nucleic Acids Res. 28, e63.
EU-funded Inco-Dev project ‘INCOME’ (INCO-CT-2005- d’Oliveira, C., M. van der Weide, M. A. Habela, P. Jacquiet,
515915). and F. Jongejan, 1995: Detection of Theileria annulata in
blood samples of carrier cattle by PCR. J. Clin. Microbiol.
13, 2665–2669.
References Pain, A., H. Renauld, M. Berriman, L. Murphy, C. A. Yeats,
Alhassan, A., O. M. Thekisoe, N. Yokoyama, N. Inoue, W. Weir, A. Kerhornou, M. Aslett, R. Bishop, C. Bouchier,
M. Y. Motloang, P. A. Mbati, H. Yin, Y. Katayama, T. Anzai, M. Cochet, R. M. Coulson, A. Cronin, A. de Villiers,
C. Sugimoto, and I. Igarashi, 2007: Development of loop- A. Fraser, N. Fosker, M. Gardner, A. Goble, S. Griffiths-

ª 2008 The Authors


242 Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243
D. A. Salih et al. LAMP for Detection of T. annulata

Jones, D. E. Harris, F. Katzer, N. Larke, A. Lord, P. Maser, Robinson, P. M., 1982: Theileria annulata and its transmission
S. McKellar, P. Mooney, F. Morton, V. Nene, S. O’Neil, – a review. Trop. Anim. Health Prod. 14, 3–12.
C. Price, M. A. Quail, E. Rabbinowitsch, N. D. Rawlings, Salih, D. A., A. M. El Hussein, U. Seitzer, and J. S. Ahmed,
S. Rutter, D. Saunders, K. Seeger, T. Shah, R. Squares, 2007: Epidemiological studies on tick-borne diseases of
S. Squares, A. Tivey, A. R. Walker, J. Woodward, cattle in Central Equatoria State, Southern Sudan. Parasitol.
D. A. Dobbelaere, G. Langsley, M. A. Rajandream, Res. 101, 1035–1044.
D. McKeever, B. Shiels, A. Tait, B. Barrell, and N. Hall, Uilenberg, G., 1981: Theilerial species of domestic livestock.
2005: Genome of the host-cell transforming parasite In: Irvin, A.D., M.P. Cunningham, and A.S. Young (eds),
Theileria annulata compared with T. parva. Science 309, Advances in the Control of Theileriosis, pp.4–37. Martinus
131–133. Nijoff Publishers, The Hague, The Netherlands

ª 2008 The Authors


Journal compilation ª 2008 Blackwell Verlag • Transboundary and Emerging Diseases. 55 (2008) 238–243 243