SOFTWARE Radionico

1 )Digital radionics

Questa applicazione consente la generazione di rata radionica da un insieme di parole che contengono un desiderio o un qualsiasi file binario; tono associato in ottava 0 e il colore è calcolato a partire tasso principale. Animato spirali logaritmiche vengono utilizzate come risorsa energetica espansione per diffondere le informazioni radionica contenute nella tariffa. L'uso è semplice: Caricare la foto del soggetto che si desidera lavorare con la radionica. Scrivere il desiderio o aprire qualsiasi tipo di file (testo, immagine, suono, ecc) che si desidera associare al soggetto e cliccare sul pulsante 'Vai' (freccia sinistra), il tasso di radionico è calcolata e anche ottava 0 tono e il colore è visualizzati. etichetta Quando il desiderio è scritto 'testo' appare nella barra degli strumenti, nel caso in cui è aperto un file 'file' etichetta viene visualizzata. forma di carico opzionale (alcuni esempi frattali sono in dotazione) per migliorare le prestazioni radionico anche se la forma d'onda. Per avviare l'applicazione radionica riprodurre il tono per diversi minuti.

2) La versione multiradionics è incluso nel pacchetto stesso, questa versione consente di lavorare contemporaneamente con un massimo di quattro diverse sessioni radionica. Operazioni è equivalente alla versione singola sessione, ma delle caratteristiche

del file è disattivata e il suono viene generato solo per la prima sessione (riga). Lavorare su un multisessione radionico aumenta le prestazioni complessive.

3) Radionic Card

Ampiamente usato nella terapia radionica, questa scheda radionico è una implementazione stile libero delle carte noto Malcolm, ma compresi scala musicale generata ellissi di colore e ulteriori risorse grafiche, generato carte possono essere copiati e incollati in qualsiasi applicazione grafica, questo consente di realizzare radionico documento multimediale che può essere utilizzato da terapeuta, all'avvio del programma visualizza un motivo casuale che può essere modificato, copiato / incollato e integrati in un documento, programma include controlli per il cerchio, l'angolo e la selezione dei colori, trascinando dentro il quadro genera schemi casuali, rappresentazione del contorno può essere abilitata per la visualizzazione del modello più preciso. Tasso è calcolato in base alla forma geometrica, cliccando su di esso per copiare negli appunti ed utilizzarlo in altre applicazioni come la radionica digitale.

Esso genera un segnale binaurale del canale sinistro è l'unico tavolo di frequenza e il diritto. più un offset scalata a -8 ottava del tono di base. 5) TONES Contiene diverse centinaia di toni radionici-scalati a ottava 0 .4 )Fiori di Bach radionica Questo software visualizza un elenco di applicazioni di Bach 38 rimedi floreali e calcola per ognuno di essi il proprio codice radionico. . indicazioni fiore principale è dotato. . Questo suono udibile può essere ascoltato a volume selezionabili.rappresentano gli elementi più comuni e le malattie. secondo le pratiche radioniche è possibile ascoltare i toni o per preparare rimedi omeopatici. passo e frequenza degli impulsi.

Chi dovrebbe utilizzare? Chiunque. da 4 a 99 anni. Ascoltare corde emotive contenute nella tua voce. Come usarlo. sonore e musicali. iniziare con brevi sessioni e aumentare progressivamente la sua durata. Esso utilizza una combinazione di risorse generate visive. Esplora accordi musicali e li identificano con le emozioni. 3. Questo programma richiede l'uso quotidiano.seguendo questi quattro semplici passi: 1. Usalo ogni giorno in brevi sessioni di cinque minuti è sufficiente. Visualizza animato spirali con binaurale suoni rilassanti. 4.6 )Radionic rate Calcolo delle rate radioniche 7 )Sound Harmonizing Studio Questo programma consente di armonizzare la vostra vita quotidiana migliorare la vostra concentrazione. che vuole migliorare la creatività e l'intelligenza emotiva. 2. una dedica pochiminuti è sufficiente per sentire i suoi benefici. Animato spirali logaritmiche . Analizza la tua voce e ascoltare la voice2voice bilanciamento(V2V) suoni. la creatività el'aggiunta di più la coscienza di intelligenza emotiva (EI).

Voice spettro radiale .

Esso offre una grafica dettagliata per l'analisi dello spettro e la voce di matching musica. aiuto Versione 1. è possibile utilizzare sia la registrazione diretta o aprirefile. è possibile utilizzare sia la registrazione diretta o aprirefile. 5 ottava a spettro completo con ottava scala locale e la griglia dinota. Musical griglia di frequenze matrice voce di corrispondenza con le note musicali (scala temperata) PHI e le relazioni di musica armonica tra le frequenze vocali. 10/2002 425KB Dimensioni (1'30 "modem 56Kb) Analisi VBS la tua voce e genera voice2voice (V2V) i toni di bilanciamento opzionalmente mescolati con la vostra musicapreferita. Esso offre una grafica dettagliata per l'analisi dello spettro e la voce di matching musica.Musical accordi tavola VBS Voice Balancing System Analisi VBS la tua voce e genera voice2voice (V2V) i toni di bilanciamento opzionalmente mescolati con la vostra musicapreferita. .2 Data di uscita Mar. wav. Spiral spettro VBS Voice Balancing System Download Installabili. wav.

quinti) Spettro radiale Formanti Octave pesi ogni nota in un grafico 5 spettro di ottavaradiale. Ruota armonica relazioni armoniche (terze. Spiral spettro Ruota armonica fornisce il peso delle banconote e delle relazioniarmoniche (terze. quinti) . 5 ottava a spettro completo con ottava scala locale e la griglia dinota.Musical griglia di frequenze matrice voce di corrispondenza con le note musicali (scala temperata) PHI e le relazioni di musica armonica tra le frequenze vocali. ottave. ottave.

Da sinistra a destra canale offset viene sottratto dal nostro cervellodi bilanciamento per l'effetto corrispondente.Spettro radiale Formanti Octave pesi ogni nota in un grafico 5 spettro di ottava radiale. beta-creatività . 8 )MultiFreq MultiFreq genera toni di frequenza più basato sulle composizioni di forme d'onda diverse. . il canale di sinistra contiene l'onda generata e canale destro può essere spostata in una certa quantità di Hz completare l'espressione R = (differenzaHz) + L.. Include un semplice foglio di lavoro in cui è possibile calcolare ivalori delle onde e copia da / per pannello dell'onda definizione. vale a direl'alfa-meditazione.. I toni sono generati in un suono stereo.

questo programma fornisce un unico esperienza interattiva geometriche così vicino alla . BowlXplorer è un simulatore di ciotola. le tecnologie di recentecostruzione permesso di quarzo puro ciotola ricca di suoni armonici. Rilassa suono Bowl e solleva la concentrazione. messa a punto i loro principali parametri e l'animazione. sono ampiamente utilizzati per la riproduzione di musica sacra in diverse culture come tibetano (metallo bocce). principali parametri del suono possono essere cambiati eseguire diversi effetti sonori. 10 )Logaritmica Spirali Spirali logaritmiche sono la rappresentazione grafica della legge di crescita di base della natura.9 )BowlXplorer Campane di cristallo sono strumenti semplice ma tuttavia straordinarie.

11 )Planet Toni Planet Toni.effetto descrizione pianeta tabella e selezionare Autoplay su. Varie. Audizione periodicamente queste combinazioni di frequenze può aiutare il processo di guarigione.Spettacoli pannello con frequenza di mappatura del colore.caratteristiche: controllo del volume. Tono generati possono esseresalvati in un file wav a 44100 frequenza di campionamento..natura che si può vedere e sentire. Sequenza di istantanee possono essere salvate in formato. controllo di durata in sec.Maggiori info rmazioni sul sito web Hans vale la pena di visitare! 12 )Healing Vibrations Guarigione Vibrazioni Questo programma contiene una serie di 14 combinazioni di frequenze applicabile ad un elenco selezionabile di oltre 400 malattie. GIF di animazione per la costruzione di ulteriori. Riproduce il suono in ottava 0 scala associata con il pianeta corrispondente (tra cui la Sun & Moon) periodo dirotazione. onde cerebrali ottava differenza basata sulla principalepianeta tono può essere aggiunto. .

anche se due sono stati appositamente scelti per la bassa metallicità.13 ) Star Sound Legge 161 spettro stelle di 161 stelle di tipo spettrale O attraverso classi M e la luminosità io. Il suono viene generato direttamente da questi dati spettri digitali. I dati sono stati ottenuti con il Reticon intensificato scanner sul telescopio # 1 91 cm a Kitt Peak National Observatory. apparendo antichi ritmi del tamburo di diversi tipi. sono di metallicità solare. 14 ) Spettro infrarosso generatore di suoni Ingressi file a-JCAMP DX da pulsata di neutroni ISIS & Muon Source Strumenti & Support Spettroscopia molecolare genera un suono di composti a base di spettro sostanza . ottava distribuzione e il volume può essere controllato tramite i cursori. le stelle maggior parte III e V.

Ricerca per struttura di nome è anche attuato. mono. il suono è generato direttamente dal informazione genetica 'è come' questo produce un rumore abbastanza progetto. G = 10. Formato di file di FAST è abbastanza semplice.gov a 8 bit. Il suono è creato codifica ogni ATGC nucleotide a una coppia di binari con combinazione selezionabili. T = 01.nih. C = 11.nlm.800 farmaci vengono caricati da un file JCAMP incluso. ovvero A = 00.ncbi. Scarica una sequenza del genoma umano da questo sito in formato FAST (estensione fcgi) e aprirlo da questo programma. 16 )Genoma suoni Genera da nucleotide (ATCG) sequenze genetiche in formato FAST disponibile da www. 8000 samp. Alcuni esempi dal cromosoma umano # 3 sono inclusi nel file zip. genoma umano contiene 24 coppie di cromosomi 22 + X + Y.15 ) Farmaci Suoni Genera un tono composto da binaurale peso atomico di ogni farmaco. / risoluzione sec. Non aspettatevi qualcosa di udienza armonico. cioè . è un file di testo con un colpo di testa riga seguendo la sequenza nucleotidica in 70 blocchi di char. Più che 1.

Deve avere OpenGL installati nel sistema (questo dovrebbe essere abbastanza usuale). Questa è una delle principali tecniche utilizzate dai mineralogisti e chimici allo stato solido per esaminare le proprietà fisico-chimiche make-up di solidi sconosciuto.ATACGGGAGAACTAAGGCTGAAACCTCGGAGGAACAACCACTTTTGAAGTGACTTCG CGGCGTGCGTTGG 17 ) Solidi Platonici L'esperienza di animazione 3D dei solidi platonici con profondità selezionabile e l'angolo. 18 ) Mineral Suoni Genera risonante tre toni composti ottava da una lista di più di 3000 minerali. Questi dati vengono rappresentati . I toni sono generati utilizzando polvere di parametri di diffrazione di raggi X.

20 ) Molecolare suoni Questo programma genera toni complesso da atomi molecolare e la geometria. Il suono è generato da dati fisici e orbitali.) E la distanza di sole in au. tenendo come uno degli input dei mille. 19 ) Sistema Solare Suoni Sentire il suono del sistema solare in una data selezionata. genera un suono come . Il funzionamento è semplice: basta selezionare il giorno e cliccare sul tasto play (alterna play / stop).in una collezione di modelli in polvere monofase diffrazione dei raggi X per le tre distanze interplanare più intenso. gli altri controlli sono auto esplicative. comprende i controlli per cambiare facilmente data reale. fornisce una mappa semplificata traccia di pianeti. File PDB da banca dati di proteine. Fornisce la posizione di una griglia di dati con i pianeti effettivi in eliocentrico coordinate (eclittica loc.

un ascoltatore sentirebbe situato di fronte alla molecola. valore di default è di 300 atomi. Scarica da proteine banca dati della molecola si desidera generare. Sono le proprietà della molecola contenuta nella vibrazione del suono? Uso: 1.. il suono di rendering molecola è un processo estremamente alta intensità di calcolo. L'effetto finale è come ascoltare la vibrazione della molecola. Selezionare il numero di atomi. importante: utilizzare il formato PDB per il download. questa opzione genera 10 "di atomi selezionato. 3. quando il computer è saturo questioni programma un beep-beep e si blocca-up. Generare il suono molecola completa con la scrittura. nessuna limitazione si applica qui solo l'importo sul tempo necessario. Pdb nel programma. 2. Opzione WAV. 4. essendo gli atomi punti di risonanza alla frequenza di massa atomica spostato a cero ottava. Tassi tipici sono 1 minuto di rendering al secondo di suono. 21 ) Note e colori Vedere i colori delle dodici note musicali e ascoltarli in ottave diverse . in un computer da 1 GHz a meno di 400 atomi possono essere elaborati in tempo reale. Aprire il file.

Abilita una (Voice2Voice) V2V dialogo. figure di Lissajous VoiceRings e sono generate dinamicamente durante la conversazione.22 )Bilanciamento V2V Chat. Variazioni) e N2H (Noise di armonica). o semplicemente tenere in silenzio e ascoltare e genererà modelli tono casuale. i parametri della voce analisi principali. . Jitter (freq. 23 ) Voice Params. solo parlare e ascoltare i toni v2v generato bilanciamento. studi approfonditi può essere trovato collegando le misure e variazione di questi parametri con stati emotivi e fisici. tra cui Shimmer (variazioni di volume).

difficile da credere fino a che non li sento!. questi toni sono ricchi di frequenze disavanzo e suono simile ad ambienti natura. Traccia delle relazioni PHI in voce e il ritmo è anche previsto. è utile per lo studio del ritmo vocale e 'vedere' con il tempo prospettiva .24 ) Voce 2 Voce (V2V). 25 ) Spettrogramma vocale. voice forma Misure con il 30% dei toni totale frequenza potenza generatrice in base al suo specchio (max-v (i)). Visualizza freq. evoluzione nel tempo e le misure della gamma che contiene il 50% della potenza vocale.

si sentono 3D rilassante e armonizzando i suoni. sentire e vedere con la tua voce e imparare a controllarlo.26 ) Generatore di toni. 27 ) PHI Analyzer. PHI appare in manifestazioni più la natura. a differenza di toni stereo. le grandi sintesi accordi in evoluzione verso una ottava più alta.Anche associati a colori visualizza tono richiesto e il valore RGB in esadecimale. Conta il numero di relazioni PHI in formanti frequenza vocale e viene visualizzato un grafico con la sua evoluzione nel tempo. . Problemi di onde cerebrali freq.

.28 ) spettrografo radiale. freq accumulato. . più precisamente a (2 ^ (1 / (2 * PI))). Vedi la differenza tra queste forme a seconda del tuo stato emotivo. 'Forma' di distribuzione in grado di fornire informazioni dettagliate sul diffusore. 29) Harrison Scala. questo gentiluomo straordinario (1693-1776) ha avuto l'idea affascinante di definire una scala musicale con sede a numero PI. 100). John Harrison. consentendo incolla da MS-Excel ® o qualsiasi editor di testo. distribuzione. Visualizza accumulato frequenze vocali in un formato radiale fornisce una depicture conveniente di freq voce. Potenza 0 . dati di spettro può essere copiato negli appunti in una tabella a due colonne contenenti (Hz.

potrebbe essere difficile da apprezzare all'inizio. la definizione di due costanti per il quinto musicale (1. scala temperata sembra essere nel mezzo di Harrison il quinto e quarto. Bach (1698-1750) a conoscenza di questa scala? e le sue conseguenze in armonia musica moderna? Charles EH Lucy ha progettato una chitarra con sede a queste scale. Potrebbe questo nuovo modo di armonia comprensione cambiare la nostra concezione della musica? In questa applicazione è possibile selezionare una nota suonata come un singolo tono o di un accordo maggiore (tono + quinto + terzi).invece di 2 ^ (1 / 12 ) in uno temperato. 30 )VoiceRings. Fu J. essendo un compromesso tra di loro. S. . i colori e il numero di anelli sono calcolati dalla frequenza e il numero di formanti vocali.319457 millions). ma dopo un breve periodo si può sentire. entrambe le scale Harrison sembrano suonare meglio e più armonicamente. con risultati sorprendenti è possibile controllare nel suo sito web. Parlare e vedere animato a colori degli anelli concentrici seguito la vostra voce.338.41151 milioni) e quarta (1.494.

.31 ) GEOSTAR. Genera stelle geometrica con tre tipi di connessioni (stella. numero di vertici 3-200. poligono. il risultato può essere copiato a clip. all2all).