You are on page 1of 256

Ciencias Naturales Tercer ao

Nivel de Educacin Media del Subsistema de Educacin Bsica


Presidente de la Repblica Bolivariana de Venezuela Ministra del Poder Popular para la Educacin Viceministra de Programas de Desarrollo Acadmico Viceministra de Participacin y Apoyo Acadmico Viceministro para la Articulacin de la Educacin Bolivariana Viceministro de Desarrollo para la Integracin de la Educacin Bolivariana Directora General de Currculo

Hugo Rafael Chvez Fras

Maryann del Carmen Hanson Flores Maigualida Pinto Iriarte

Coordinacin General de la Coleccin Bicentenario Maryann del Carmen Hanson Flores Coordinacin Pedaggica Editorial de la Coleccin Bicentenario Maigualida Pinto Iriarte Coordinacin General Logstica y de Distribucin de la Coleccin Bicentenario Franklin Alfredo Albarrn Snchez Coordinacin Logstica Hildred Tovar Jurez Jairo Jess Bello Irazabal Jan Thomas Mora Rujano Revisin Editorial de la Coleccin Bicentenario Norelkis Arroyo Prez Coordinacin Editorial Serie Ciencias Naturales Jos Azuaje Camperos Mara Maite Andrs Autoras y Autores Aurora Lacueva Teruel Carlos Buitrago Volcn Carmen lvarez Gloria Guilarte Hilda Herrera Itzel Chaparro Prez Jos Azuaje Camperos Juan Linares Chacoa Mara Maite Andrs Mirtha Andrade Said Geraldyne Gmez Revisin Socio - Crtica y Lecturas Adicionales Adriana Josefina Marchena Lilia Rodrguez DubraskaTorcatti Revisin de Contenido y Lenguaje Dalia Diez de Tancredi Julia Flores Espejo Jos Azuaje Camperos Luisa Rodrguez Bello Mara Maite Andrs Asesora General de la Serie Ciencias Naturales Aurora Lacueva Teruel Correccin de Texto de la Coleccin Bicentenario Doris Janette Pea Molero Marytere de Jess Buitrago Bermdez Coordinacin de Arte Julio Marcano Marini Leonardo Lupi Durre

Trina Aracelis Manrique

Conrado Jess Rovero Mora

Maigualida Pinto Iriarte Neysa Irama Navarro

Directora General de Educacin Media

Ministerio del Poder Popular para la Educacin www.me.gob.ve Esquina de Salas, Edificio Sede, parroquia Altagracia, Caracas, Distrito Capital

Ministerio del Poder Popular para la Educacin, 2012 Primera edicin: Agosto 2012 Tiraje: 450.000 ejemplares Depsito Legal: lf51620123701317 ISBN: 978-980-218-332-6 Repblica Bolivariana de Venezuela

Prohibida la reproduccin total o parcial de este material sin autorizacin del Ministerio del Poder Popular para la Educacin

Diseo Grfico Julio Marcano Marini Leonardo Lupi Durre Ilustraciones Arturo Jos Goita Csar Ponte Egui Darwin Ynez Rodrguez Eduardo Arias Contreras Gilberto Abad Vivas Julio Marcano Marini Jos Samuel Gonzlez Jos Alberto Lostal Leidi Vsquez Liendo Leonardo Lupi Durre Luis Eduardo Lupi Nicols Espitia Castillo Diagramacin Darwin Ynez Rodrguez Julio Marcano Marini

DISTRIBUCIN GRATUITA

ndice
14. De una clula a un ser humano completo..............................................................................6 - Dos metros de ADN en una pequea clula, cmo es posible? - 100 billones de clulas en mi cuerpo! Cmo se producen? - Somos hermanos pero diferentes. Por qu? - AICI. Meiosis de masa flexible - Somos millones de espermatozoides diariamente. Espermatognesis - Vivo 24 horas y maduro cada 28 das, qu soy? El vulo y la ovognesis - La mitosis y la meiosis en nuestras vidas - AICI. Una mirada a la mitosis en la raz de una cebolla - AAE. Actividades de autoevaluacin. 15. Leyes celulares, leyes de familia. Por qu somos como somos?.......................................24 - La curiosidad hace al cientfico - Cmo realiz Mendel los cruces? - AICI. Manos a la obra! Conociendo tu herencia familiar - ARP. Juguemos a construir un genotipo - Toda regla tiene su excepcin - La gentica en nuestras vidas - AAE. Actividades de autoevaluacin 16. Los genes vienen en paquetes.............................................................................................40 - Parece que las leyes de Mendel no siempre se cumplen - Cmo caben los genes dentro de los cromosomas? - Observemos los cromosomas con ms detalle - El estudio de los cromosomas es una herramienta de gran importancia - AICI. Observemos los cromosomas gigantes de Drosophila - AAE. Actividades de autoevaluacin 17. Cuando se altera el mensaje.................................................................................................58 - Cmo ocurren las mutaciones? - Algunas mutaciones de producen en un solo gen - ARP. Actividad de resolucin de problemas - Otras mutaciones implican a muchos genes, incluso a cromosomas completos. - El Proyecto Genoma Humano ha descubierto otros mecanismos genticos - El estudio de las mutaciones pueden ayudarnos a mejorar nuestra calidad de vida - AICI. Analizando cariotipos - AAE. Actividades de autoevaluacin 18. Las reacciones son acontecimientos inusuales o cotidianos?......................................... 82 - Describe las reacciones qumicas con smbolos y evidencias - La cantidad perfecta para reaccionar - El mol: el titn de la qumica - La reaccin ante las reacciones qumicas - AICI. Reacciones con alcohol - AAE. Actividades de autoevaluacin

19. Separa mezclas para formar otras nuevas........................................................................106 - Hay variedad de mezclas! Cmo podemos distinguirlas? - El patrn de separacin lo estableces t! - Contribuyendo y construyendo al mezclar y separar - AICI. Qu compone a cada tinta? - AAE. Actividades de autoevaluacin 20. Concentrados en las disoluciones.....................................................................................128 - Los componentes necesarios en una mezcla - Una preparacin insuperable! - ARP. Actividad de resolucin de problemas - Concentraciones en la cotidianidad - AICI. Preparando y cuantificando disoluciones - AICI. Te identifico con un haz de luz! - AAE. Actividades de autoevaluacin 21. Los inseparables compaeros: materia y energa............................................................148 - De dnde proviene la energa de la materia? - Cmo se manifiesta la energa qumica en la naturaleza? - Cul es la principal fuente energtica? - Los combustibles fsiles. Qu tan beneficiosos son? - AICI. Tras la pista de los tipos de energas - AICI. Cmo dividir el agua en sus componentes ms simples? - AAE. Actividades de autoevaluacin 22. Calor y temperatura............................................................................................................164 - De los cuatro elementos, al alcahesto, al calrico a la energa - A mayor energa mayor temperatura - Si aumenta la temperatura, aumentan las dimensiones - ARP. Cuidado con calentar el frasco de mercurio? - La temperatura: su control es importante en la vida cotidiana - El color: no es un fluido ni una forma de energa es un proceso - El calentamiento global - AICI. Caliente o fro? - AAE. Actividades de autoevaluacin 23. La corriente elctrica en la comunidad.............................................................................186 - Fenmenos elctricos - ARP. Comparemos la fuerza gravitacional con la fuerza elctrica de un tomo de hidrgeno - Cmo se genera una corriente elctrica? - La diferencia de potencial mueve a las cargas elctricas - Mucha energa se transforma: potencia elctrica - ARP. Cunta potencia desarrolla la batera de un automvil - ARP. Cunto se paga de energa elctrica por un bombillo incandescente? - Relacin entre la corriente elctrica y la diferencia de potencial: Ley de Ohm - Los circuitos elctricos - ARP. Anlisis de circuitos en serie y en paralelo - AICI. Montaje y estudio de circuitos bsicos de CC - Hacia la toma de conciencia - AAE. Actividades de autoevaluacin

24. El sonido: cuando algo vibra, algo suena..........................................................................206 - Lo que vibra perturba al medio - AICI. Explorando con las ondas, aprendamos - Caractericemos las ondas - AICI. Probando la audicin del grupo - Rpido o lento? Depende del medio - ARP. Aprendamos a resolver un problema - Cmo se comportan las ondas? - AICI. Midiendo la velocidad del sonido en el aire - AICI. Trabajando con simulaciones - AICI. Un mapa de ruidos de la comunidad - Beneficios y riesgos con las ondas sonoras - AAE. Actividades de autoevaluacin 25. Sin luz es imposible ver......................................................................................................224 - El ministerio de la luz: onda o particular? - La luz en movimiento - La luz se propaga en lnea recta - Los cuerpos frente a la luz - Fenmenos luminosos - ARP. Mezcla con un trompo - Lente e instrumentos pticos - El valor de la luz - AICI. Oh! Cuantas imgenes! - AICI. Jugando con simuladores - AICI. Si tapamos la mitad de la lente, qu veremos? - AAE. Actividades de autoevaluacin Algo ms para saber sobre ciencia y tecnologa.....................................................................246 - Fruto vivas: una arquitectura ecolgica y social - Arstides Bastidas: pionero del periodismo cientfico en Venezuela - Mesas Tcnicas de agua: escuelas de corresponsabilidad Fuentes de consulta para las y los estudiantes.......................................................................254 Referencias para las educadoras y los educadores.................................................................255

14

De una clula a un ser humano completo


6

En algn momento de nuestras vidas hemos tenido un rasguo o nos hemos tropezado haciendo deporte, es posible que as hayamos causado una herida en nuestra piel que a los das se cierra formando una cicatriz. Tambin hemos observado cmo se desarrolla un beb en el vientre de su madre. De stas y otras situaciones podras preguntarte: qu sucede en nuestro cuerpo para poder cerrar una herida?, cmo es posible que de la unin de apenas dos clulas nazca luego un beb de millones de clulas? Todos los das de nuestra vida estamos en presencia de la divisin celular, de ello depende nuestra salud y nuestro mantenimiento. En otros organismos como las plantas, tambin se llevan a cabo procesos de divisin celular que permiten el crecimiento de sus partes y su reproduccin. Algunas veces estos procesos de divisin fallan, causando problemas y enfermedades que pueden llevar a la persona a un estado crtico e inclusive la muerte. Esto se agudiza con la contaminacin ambiental a nuestro alrededor y los malos hbitos alimentarios, que sustituyen los alimentos naturales y elaborados en casa por alimentos procesados y comidas rpidas. En esta lectura, vamos a conocer los dos grandes procesos de divisin celular: la mitosis y la meiosis. Tambin, conoceremos cmo se originan las clulas sexuales, los vulos y los espermatozoides. Identificaremos a los cromosomas y su papel en la divisin celular. Finalmente, aprenderemos cmo se refleja la mitosis y la meiosis en nuestras vidas.

Dos metros de ADN en una pequea clula, cmo es posible?


Como podrs recordar, todas las clulas poseen material gentico que es heredado y ese material gentico es el ADN. Los investigadores estiman que la fibra del ADN de una bacteria puede medir 1.3 mm, y en los humanos, hipotticamente, el ADN del ncleo celular puede medir 2 metros, si se suman todas las fibras de este material una detrs de la otra. Ser posible que en el ncleo de una clula se pueda albergar todo ese ADN? Si participaras en un concurso donde debes colocar dos kilmetros de cable en una caja de zapatos cmo lo haras?, qu sera lo primero que intentaras? El ADN de las clulas de los humanos, al igual que el de muchos otros organismos, se encuentra formando finsimas hebras muy enmaraadas llamadas cromatina. Ese enmaraamiento le permite caber en el reducido espacio celular. Pero cuando una clula se va a dividir, su ADN se organiza de manera mucho ms apretada, ms prctica para esa mudanza. As, se empaqueta en estructuras compactas, como pequeos bastones de diferentes formas, llamadas cromosomas. Su nombre se debe a que se tien fcilmente con algunos colorantes: cromo en griego significa color, y soma quiere decir cuerpo. Cada especie de ser vivo tiene un nmero fijo de estas estructuras: las fibras de ADN siempre se organizan en el mismo nmero y tipo de cromosomas en todos los individuos de la especie. Nosotros los humanos poseemos 46 cromosomas, organizados en 23 pares. En la figura 14.1, puedes observar una representacin de algunos cromosomas y sus partes: en ella se muestra una constriccin primaria llamada centrmero que a su vez est asociada con unas protenas formando una estructura llamada cinetocoro, que va a ser til para mover los cromosomas durante la divisin celular. Tambin pueden verse los extremos, llamados telmeros. Cada cromosoma est constituido por dos partes iguales que reciben el nombre de cromtidas.

Figura 14.1. Partes de un cromosoma.

Dejo de crecer o me divido


Todas las clulas de nuestro organismo, tambin las clulas de otros seres vivos, crecen y se reproducen. El proceso por el cual las clulas crecen y se reproducen de denomina ciclo celular (Figura 14.2) y comprende dos periodos: la interfase y la divisin celular propiamente dicha. Para tratar de explicar cmo ocurre este proceso usaremos un smil. Cuando inflamos un globo podemos observar cmo aumenta su tamao. Si soplamos ms y ms aire, llega un momento en que debemos dejar de soplar pues de lo contrario simplemente el globo explota. A semejanza del globo, todas las clulas crecen y desarrollan sus estructuras. Esto ocurre durante la interfase del ciclo celular, pero llega un momento cuando la clula ya no puede crecer ms y se divide. La Figura 14.2. Ciclo celular con sus diferentes fases. mayora de las clulas se dividen por un proceso llamado mitosis. As se multiplican las clulas de nuestros huesos y msculos mientras crecemos o las clulas de nuestra piel cuando se cicatriza una cortadura. Ahora bien, las clulas reproductivas (vulo y espermatozoide) se forman por otro proceso de divisin llamado meiosis, pronto veremos a qu se debe esto. En la etapa de la interfase (Figura 14.3), la clula pasa la mayor parte de su tiempo de vida. La interfase transcurre a su vez por varios momentos o fases. Inmediatamente despus de una divisin hay un periodo de aparente inactividad y de crecimiento de la clula. A continuacin, hay una fase que es determinante para la divisin celular, porque en ella se duplica el ADN y comienza la duplicacin de los centriolos que en el futuro formarn, junto a otras estructuras, el huso acromtico (estructuras proteicas con forma de hilos) que sujetar a los cromosomas durante sus organizados desplazamientos. En la tercera fase, se sintetizan materiales necesarios para la divisin, como las protenas. Finalizado este ltimo perodo de la interfase, se da inicio a la divisin celular. Un ciclo celular vara en el tiempo en que se cumplen todas las etapas y se regresa al inicio. En clulas normales activas, el ciclo celular puede durar entre 8 y 24 horas.
8

Figura 14.3. Interfase en clulas de cebolla.

100 billones de clulas en mi cuerpo! Cmo se producen?


Te has preguntado cuntas clulas hay en tu cuerpo? Estaban todas all desde el principio? O cuando ves a un beb y notas que va creciendo y creciendo poco a poco a medida que pasa el tiempo, has pensado cmo es posible ese crecimiento? Para responder a estas interrogantes debemos conocer cmo ocurre el proceso de mitosis que realizan todas las clulas de nuestro cuerpo, con excepcin de las clulas madres que producen los espermatozoides y los vulos, las cuales se dividen por meiosis. Recuerda que las dos divisiones celulares nombradas hasta el momento solo se dan en clulas eucariotas, es decir, clulas que poseen ncleo diferenciado. La divisin de las clulas procariotas (como la de las bacterias) se rige por otros principios y procesos. La mitosis consiste en la divisin del ncleo celular que se separa en partes iguales a dos nuevas clulas (clulas hijas), las cuales se originan de la divisin de la madre. En este proceso el material gentico primero se duplica y luego se reparte, lo que asegura que cada nueva clula posea la misma informacin gentica. El proceso mittico est formado de varias fases: profase, metafase, anafase y telofase, a las que sigue la divisin del citoplasma, llamada citocinesis (Figura 14.4).

Vamos a comprender qu ocurre en cada una de las fases de la mitosis

Figura 14.4. Esquema de la mitosis en el que se muestran las fases de este proceso y se incluye la interfase.

Observa la siguiente figura, en ella se describen los distintos acontecimientos que ocurren durante la mitosis. Podrs notar que, en resumen, lo que ocurre es que el material gentico, que ya se ha duplicado durante la interfase, se empaqueta en cromosomas, la membrana del ncleo se rompe, los cromosomas se organizan en el ecuador de la clula y luego se separan en dos juegos iguales. A continuacin, cada juego de cromosomas se dirige a uno de los polos celulares, la clula madre se divide por su lnea media, y en cada clula hija se forma una nueva membrana nuclear. Veamos con ms atencin esta danza de los cromosomas.
9

Figura 14.5. Esquema que representa a las cromtidas unidas por el cinetocoro a las fibras que conforman el huso acromtico.

Profase. La mitosis se inicia cuando la cromatina comienza a empaquetarse, es decir, sus hilos formados por ADN y protenas se compactan, se hacen ms cortos y van adoptando un aspecto engrosado y de menor longitud que se denomina cromosoma. Al utilizar tcnicas de coloracin los cromosomas se pueden visualizar al microscopio ptico y se observan duplicados. Recuerda que la duplicacin del ADN que formar a los cromosomas ocurri en la interfase. A las dos fibras que conforman cada cromosoma duplicado se les llama cromtidas hermanas, ambas son idnticas pues poseen la misma informacin gentica (Figura 14.6a). Durante la profase, tambin se comienzan a formar las fibras del huso acromtico, que consisten en una serie de fibras proteicas que se extienden hacia los polos y el centro de la clula. En las clulas animales los centriolos se desplazan hacia los polos, en las vegetales no estn presentes los centriolos. Avanzada la profase, ya no se observa el nuclolo, mientras que la membrana nuclear desaparece y los cromosomas se unen al huso por los cinetocoros (el centrmero con protenas asociadas), y poco a poco son desplazados al ecuador de la clula (Figura 14.5). Metafase. Esta fase sucede a la profase y se caracteriza por la alineacin de los cromosomas en el ecuador de la clula. En esta fase ya ha desaparecido la membrana nuclear y se observan los cromosomas totalmente empaquetados (Figura 14.6b). Inmediatamente despus de la metafase, se inicia la anafase y se puede reconocer porque las cromtidas hermanas son separadas por las fibras del huso y llevadas a cada polo de la clula, siendo en ese instante cromosomas individuales. La anafase termina cuando los cromosomas estn en los polos de la clula (Figura 14.6c). La ltima fase es la telofase, en ella los cromosomas se desenrollan, la membrana nuclear vuelve a hacerse visible formndose los dos ncleos hijos, desaparecen las fibras del huso acromtico y se forman nuevamente los nuclolos (Figura 14.6d).
10

Durante la telofase comienza la citocinesis, proceso en el cual el citoplasma de la clula se divide hasta repartirlo entre las dos nuevas clulas, separndolas al final con la formacin de una membrana plasmtica individual.

Figura 14.6. Proceso mittico en clulas de cebolla. a.- Cromosomas condensados en la profase; b.- Cromosomas en el ecuador de la clula (metafase); c.- Cromosomas en direccin a los polos de la clula en la anafase; d.- Telofase mostrando la formacin de los nuevos ncleos.

Somos hermanos pero diferentes. Por qu?


Si prestas atencin cada vez que caminas por las calles de tu localidad, notars que circulan muchas personas y que todos presentan caractersticas diferentes entre s y pocos pueden tener cierto parecido a tu persona. Si observas en tu hogar a un familiar, te podrs dar cuenta de que a pesar de ser familia y tener rasgos, tanto fsicos como conductuales similares, no son del todo idnticos y varan en menor o mayor grado de los que t presentas. De nuestros padres heredamos informacin gentica que nos hace similares a ellos y a nuestros hermanos o abuelos, y podramos pensar que la informacin pasa intacta sin cambio, pero no es as. Aqu la divisin celular no produce clulas idnticas como en la mitosis. En el proceso de divisin celular que forma las clulas sexuales (vulos y espermatozoides) se reduce la carga cromosmica a la mitad y adems se da un intercambio de material gentico entre los cromosomas homlogos de una misma clula, sea de origen materno o paterno. Este proceso se llama meiosis. El proceso de divisin celular llamado meiosis se realiza en dos etapas. En la primera divisin meitica (figura 14.7 del nmero 1 al 4) ocurren dos procesos, la reduccin del nmero de cromosomas a la mitad del nmero caracterstico de cromosomas de la especie y el proceso de entrecruzamiento. En la segunda divisin meitica (figura 14.7 del nmero 5 al 8) ocurre un proceso similar a la mitosis, sin embargo, al final las clulas hijas resultantes tienen la mitad de los cromosomas de la clula materna que les da origen.
11

Figura 14.7. A la izquierda, representacin de la meiosis de una clula con centriolos. Del nmero 1 al 4 se esquematiza la primera divisin meitica. Del 5 al 8 se muestra la segunda divisin meitica.

En la primera divisin meitica se realizan las siguientes fases: profase I, metafase I, anafase I y telofase I con la posterior citocinesis o particin celular (figura 14.7 del nmero 1 al 4). La profase I se inicia cuando los cromosomas comienzan a empaquetarse y los homlogos van acercndose y alinendose de forma paralela, uno al lado del otro. Luego entre los cromosomas homlogos se realiza un intercambio de material gentico, lo que se llama entrecruzamiento o crossingover (Figura 14.8), que al final va a generar cromosomas con una secuencia de genes diferentes a la original. Este acontecimiento es responsable de generar variabilidad y se evidencia en que somos parecidos a nuestros hermanos, pero no iguales, porque la nueva combinacin heredada no es la misma que est en cualquiera de nuestros familiares; se estima que este proceso ocurre al azar. La variabilidad es beneficiosa desde el punto de vista evolutivo: ante los posibles cambios del ambiente, hay diversidad de rasgos entre los individuos y al menos algunos podrn responder.
12

Figura 14.8. Proceso de entrecruzamiento donde se muestra la sinapsis y los puntos de entrecruzamiento.

Las cromtidas que conforman a cada cromosoma homlogo se mantienen alineadas, y estos entre s se pueden observar por separado pero unidos en los puntos donde hubo entrecruzamiento. Estos puntos de unin llamados quiasmas son de vital importancia, debido a que mantendrn a los cromosomas unidos hasta la anafase, donde cada homlogo ser llevado a un polo de la clula. Al final de la profase I, los pares de centriolos se movilizan hacia los polos de la clula, se comienza a forma el huso acromtico y desaparece la membrana nuclear. La alineacin de los cromosomas en el plano ecuatorial da inicio a la metafase I con los cromosomas sujetos a las fibras del huso. La siguiente fase es la anafase I, esta etapa se caracteriza por la separacin de los cromosomas homlogos que estaban unidos por los quiasmas, hacia los polos de cada clula. En este momento se da la reduccin del nmero de cromosomas por clula, de 46 que posee la clula madre (en el caso de los humanos) ahora a 23 por cada clula hija resultante. La ltima fase de la primera divisin meitica es la telofase I en la que se puede observar a los cromosomas desenrollndose, reaparece la membrana nuclear y se da la citocinesis para formar dos nuevas clulas haploides (n), es decir, con la mitad del juego de cromosomas que posea la clula madre que era diploide (clula diploide: es aquella que posee un juego de cromosomas completo, lo que es lo mismo decir, dos conjuntos de cromosomas por ncleo celular). (Figura 14.7, lado izquierdo del 5 al 8). Sabas que...? Se estima que si desenrollamos todos los cromosomas de las clulas que forman a una persona y se colocan las fibras de ADN una detrs de otras, podran llegar desde la Tierra hasta el Sol y dar varias vueltas. Esta afirmacin nos demuestra cun organizado y empaquetado puede estar nuestro material gentico. Aunque la segunda divisin meitica es semejante al proceso mittico, en ella no se forman clulas diploides sino haploides, puesto que se parti precisamente de clulas haploides. Tambin se diferencia de la primera divisin meitica porque no ocurre entrecruzamiento de los cromosomas homlogos y no hay una nueva reduccin en el nmero de cromosomas. En la segunda divisin meitica se llevan a cabo las siguientes fases: profase II, metafase II, anafase II y telofase II, seguida de la citocinesis. La profase II inicia con la condensacin de los cromosomas, los centriolos migran a los polos de la clula y comienza a formarse el huso acromtico. Avanzada esta fase, la membrana nuclear no se hace visible y los cromosomas se movilizan al ecuador de la clula.

13

La metafase II es evidente cuando los cromosomas se alinean en el plano ecuatorial de la clula y estn sujetos por el cinetocoro a las fibras del huso. La anafase II comienza cuando las cromtidas hermanas son separadas y llevadas a los polos de la clula, formando as los nuevos cromosomas de las clulas hijas. En la telofase II reaparece la membrana nuclear, los cromosomas de desenrollan y al mismo tiempo o un poco despus, se puede notar la citocinesis que va a dar origen a cuatro clulas haploides que se originan de las dos producidas anteriormente en la primera divisin meitica. Gracias a la meioisis, tanto el vulo como el espermatozoide tienen la mitad del nmero de cromosomas de una clula normal: 23 pares. Por eso, cuando ellos se unan durante la fecundacin producirn precisamente una clula normal, de 46 pares de cromosomas. Luego, esta primera clula se dividir una y otra vez por mitosis dando origen a un nuevo ser.

Meiosis de masa flexible

Vamos a elaborar un modelo del proceso meitico o de una parte de este, utilizando masa flexible para realizarlo, con el fin de identificar sus etapas y los acontecimientos que en ellas se dan. Qu necesitan? Una taza (200 mL) de cola blanca. Agua. Una taza de fcula de maz suelta (Maicena). Una o dos cucharadas de glicerina (la pueden conseguir en cualquier farmacia). Una o dos cucharadas de aceite para nios. Cuatro cucharadas de almidn. Dos o tres cucharadas de crema para la piel (con lanolina en su composicin). Una cucharadita de benzoato de sodio (se puede reemplazar por formalina al 4%). xido de zinc o vinagre. Olla con tefln. Cuchara de madera o de plstico resistente. Cocinilla elctrica. Cucharilla. Colorantes vegetales o pintura al fro. Pinceles.

14

Cmo lo harn? Preparacin de la masa para moldear: Coloquen la glicerina, el aceite y los polvos (fcula de maz o Maicena y el benzoato) en la olla con tefln. Agreguen los 200mL de pega a la olla, luego revuelvan con un batidor si es su gusto. Si la pega blanca es muy espesa agreguen agua hasta que puedan mezclarla con facilidad. Junten los materiales uniformemente hasta lograr que la mezcla quede homognea y compacta. Luego, golpeen la olla donde est la mezcla contra la mesa, con la intencin de que salgan las burbujas de aire que pueden haberse formado por la batida. Cocinen la mezcla a fuego lento y revuelvan arrastrando la masa cocida desde el fondo, hasta que la mezcla se separe de las paredes del envase y se haga la masa. Esperen unos minutos a que enfre un poco y colquenla dentro de una bolsa plstica transparente, dejen reposar 20 minutos. Coloquen crema en sus manos (con lanolina) y comiencen amasar, hasta que se sienta suave. Saquen la masa y amsenla sobre una mesa de superficie lisa para quitarle ese aspecto rstico y poco uniforme. Discutan sobre los elementos de un modelo del proceso meitico o de una parte de ste, diseen un boceto de las estructuras a representar, su ubicacin, entre otros aspectos. Elaboraren las piezas del modelo con la masa. Dejen que endurezca un poco, y verifiquen que estn lisas y sin grietas, pueden lijar para eliminarlas. Coloreen las partes de acuerdo con el proceso y las estructuras que estn representando. Para ello pueden dividir la masa en partes y, a cada una, colocarle el colorante vegetal seleccionado, amasar para que quede homognea. Armen el modelo y peguen las piezas. Otra opcin es armar el modelo y pintarlo con pintura al fro. Se les ocurre otra manera de construir un modelo? Planifiquen una charla o una exposicin sobre la meiosis usando los modelos.

15

Somos millones de espermatozoides diariamente. Espermatognesis


Alguna vez te has preguntado o has tenido la curiosidad de saber cuntos espermatozoides se pueden producir diariamente por meiosis? La respuesta a esta pregunta te puede sorprender. Se cree que un hombre saludable produce diariamente entre 100 y 150 millones de espermatozoides, dependiendo de la edad y las condiciones fsicas; y en una eyaculacin promedio de 2 o 3 mL, el nmero aumenta a unos 200 a 400 millones. El volumen que ocupan los espermatozoides en dicha cantidad de semen es de 0,2 a 0,3 mL. Esto es similar a arrojar 7.200 metras en un pipote de 200 L. El proceso que permite generar los espermatozoides se llama espermatognesis (Figura 14.9) y su base fundamental es la meiosis. Este proceso comienza cuando los espermatogonios, localizados en el testculo, inician una etapa de crecimiento para formar los llamados espermatocitos primarios. Estos entran en la primera divisin meitica y producen dos clulas haploides que se denominan espermatocitos secundarios. Los espermatocitos secundarios entran en la segunda divisin meitica en la que se producen cuatro espermtidas o espermtides, que van a pasar por un proceso de diferenciacin hasta generar el espermatozoide maduro. Los espermatozoides estn conformados por tres partes bsicas: cabeza, porcin media o cuello, y flagelo. La cabeza contiene enzimas que ayudan al espermatozoide a penetrar en el vulo, y en su ncleo est la informacin gentica. El cuello del espermatozoide posee gran cantidad de mitocondrias que aportan la energa para el movimiento del flagelo. Este ltimo est conformado por microtbulos que permiten el movimiento: los espermatozoides nadan desde la vagina hacia el encuentro con el vulo.

Figura 14.9. Procesos de la espermatognesis y la ovognesis, donde se muestra cmo se forman cuatro espermatozoides a partir de una clula madre y cmo desde un ovocito se forma un vulo y 3 cuerpos polares.

16

Vivo 24 horas y maduro cada 28 das, qu soy? El vulo y la ovognesis


El proceso de produccin del vulo en la mujer tiene sus variantes con respecto a la produccin de espermatozoides en el hombre, a pesar de que tambin se basa en la meiosis. Un vulo, despus de formado, es expulsado del ovario y tiene un tiempo de vida para ser fecundado de 24 horas. Solo se produce uno cada 28 das aproximadamente, raras veces una mujer produce 2 vulos al mismo tiempo. La ovognesis (Figura 14.9) se inicia cuando los ovogonios presentes en el ovario aumentan de tamao y forman los ovocitos primarios, que comienzan la primera divisin meitica, detenindose en la profase I cuando la nia est a punto de nacer. El proceso de divisin no se completa hasta que llega la pubertad, a partir de entonces y hasta la menopausia la mujer producir un vulo cada 28 das aproximadamente, hasta sumar unos 400 vulos durante toda su vida. Como resultado de la primera divisin, se forma el ovocito secundario y una clula de menor tamao llamada cuerpo polar. En la segunda divisin meitica el ovocito secundario se divide, forma el vulo y un cuerpo polar. El cuerpo polar producido en la primera divisin tambin se divide y genera dos cuerpos polares, que al final van a desintegrarse junto con el cuerpo polar producido por el ovocito secundario. Un vulo humano es del tamao de un pequeo punto, donde cabran 300 mil espermatozoides. En su ncleo est el material gentico. Sabas que...? Cada vez que comes una fruta ests ingiriendo el ovario de la planta y cada vez que desechas las semillas, ests eliminando el vulo fecundado y maduro. Los vegetales que tienen flores poseen uno o varios vulos y stos al ser fecundados, junto con otras estructuras vegetales, formarn la semilla. Luego de la fecundacin el ovario comienza un proceso de maduracin para formar el fruto.

17

La mitosis y la meiosis en nuestras vidas


El ttulo de esta lectura es De una clula a un ser humano completo y para decir esto nos basamos en el extraordinario evento biolgico en el que un espermatozoide del padre y un vulo de la madre se unen para dar origen a una clula, que por mltiples divisiones (mitosis) formar un nuevo cuerpo, un nuevo ser humano. Los procesos de divisin celular no son ajenos a nuestra vida, de hecho somos dependientes de ellos. Las reparaciones que nuestro cuerpo realiza y la fertilidad estn en manos de los procesos mitticos y meiticos que hemos heredado de los primeros organismos existentes sobre la Tierra. Si vamos ms all, todos nuestros alimentos tienen su origen en la reproduccin vegetativa o asexual, y en la reproduccin sexual. Cada vez que comemos una fruta somos beneficiarios de la meiosis que se da en la planta, que permite la reproduccin sexual y tambin somos beneficiarios de la mitosis, que es la responsable de que el fruto crezca y se desarrolle. Basndose en los conocimientos de estos dos procesos, la biotecnologa est avanzando enormemente en la bsqueda de nuevas aplicaciones que beneficien a la humanidad. Entre las aplicaciones se encuentran: el cultivo in vitro de especies tiles y en peligro de extincin, la seleccin de los mejores gametos para la reproduccin en plantas y animales, y la regeneracin de tejidos para trasplantes, entre otros. Debemos recordar que la efectividad y calidad de estos procesos celulares dependen de tus hbitos alimenticios, sexuales, de preparacin fsica, entre otros, que al final se reflejarn en tu salud, tiempo de vida y capacidad para responder ante las enfermedades.

Come sano, se responsable con tu sexualidad y haz deporte, eso te garantizar parte del buen vivir.
18

Una mirada a la mitosis en la raz de una cebolla

Las plantas, los animales y otros organismos, son capaces de crecer, repararse, regenerar partes de su cuerpo, reproducirse, entre otras funciones que involucran la divisin celular. Como recordars de esta lectura, la mayora de estos procesos se dan por mitosis y slo la produccin de clulas reproductivas se da por meiosis. Observar la mitosis en plantas es relativamente sencillo. Las plantas poseen un tejido de crecimiento que le permite al vegetal formar y extender ramas y races. Basado en esto, les proponemos las siguientes interrogantes:
Figura 14.10. Observen cmo se extienden, desde la base de la cebolla, las races.

Cules fases de la mitosis podrn ser observadas en clulas de races de cebolla (Allium cepa) germinadas? Cul ser el porcentaje de clulas en mitosis (ndice mittico) en races de cebolla germinadas? Argumenten sus respuestas y discutnlas. Qu necesitan? Una cebolla (Allium cepa). Frasco de compota. Microscopio. Portaobjetos y cubreobjetos. Gotero. Acetocarmn, orcena actica o carbol fucsina. cido clorhdrico. Tijera o bistur. Carnoy (Etanol y cido actico en proporcin 3:1). Pinzas. Agua. Servilletas. Aguja. Esmalte de uas. Antes de iniciar su trabajo podemos preguntarnos lo siguiente Por qu utilizar races y no otra parte de la cebolla? Qu tipo de divisin celular se est dando en el tejido de las races de cebolla? Cmo lo podemos observar? Recuerden que una de las estructuras reproductivas en las plantas capaces de producir gametos (clulas sexuales reproductivas) son las flores. Estas poseen tejido especializado capaz de llevar a cabo la gametognesis y producir los vulos y el polen.

19

A diferencia de la flor los dems tejidos del vegetal no poseen la capacidad de producir gametos, slo son capaces de producir clulas somticas o no reproductivas. Preparacin de las muestras: Coloquen 5 o 6 das una cebolla entera con la base hacia la boca de un recipiente de compota lleno de agua. Traten de que dicha base toque la superficie del agua. Al final de este tiempo obtendrn races de color blanco (Figura 14.11). Corten la punta de las races a un centmetro aproximadamente (preferiblemente en la maana cuando se consiguen la mayor cantidad de clulas en divisin) y colquenlas en el fijador (sustancia que preserva las estructuras celulares y de los tejidos) por 20 a 40 minutos. Si no se va a utilizar el material de forma inmediata, pueden guardarlo dentro del fijador en la nevera. El material puede conservarse por varios das en este estado.

Figura 14.11. Haciendo crecer races de cebolla.

En el momento en que realicen la actividad, laven con agua destilada las races por cinco minutos, colocndolas en un recipiente y repitan este procedimiento 3 veces. Esto les permitir eliminar el exceso del fijador. Para macerar las races, eliminen el agua destilada del lavado anterior y ubiquen las raicillas en un recipiente con cido clorhdrico al 50% entre 5 a 10 minutos o hasta que el tejido se ablande. Repitan el lavado que aplicaron con el fijador para eliminar el exceso de cido. Corten 2 mm de la raz que incluya la punta y colquenla en un portaobjetos (este paso es importante porque a esa altura de la raz se encuentra un crucial tejido de crecimiento donde se realiza la mitosis activamente). Con las agujas disgreguen o separen el material hasta extenderlo un poco. No hagan un licuado. Posteriormente a esto, aadan unas gotas del colorante obtenido (cualquiera de los tres sugeridos) y djenlo actuar por 2 a 5 minutos. Es recomendable que observen al microscopio o con una lupa el estado de la coloracin para que no sea ni tan intensa ni muy poca. Debe colorearse de manera uniforme. Coloquen el cubreobjetos cuidando de que no queden burbujas de aire que entorpezcan la observacin. Es bueno que coloquen uno de los extremos del cubreobjetos sobre la preparacin y el otro lo bajen lentamente con una aguja, esto los ayudar a evitar el aire dentro de la muestra.

20

Con un servilleta envuelvan la preparacin, ubquenla en la mesa y con el dedo pulgar, con mucho cuidado, presionen la lmina en la zona del Figura 14.12. Lmina con el tejido de cebolla extendido y cubreobjetos para extender coloreado para su observacin. los tejidos coloreados. Sequen bien la lmina de los excesos y lleven al microscopio para la observacin. Observacin al microscopio: pidan la colaboracin de su docente para el buen uso y manejo del microscopio. Si el montaje est correcto, es decir, bien teido, con los tejidos extendidos y donde pueden observar claramente las estructuras celulares, entonces sellen la lmina con esmalte de uas para crear una lmina semipermanente (Figura 14.12). Nmero de clulas en mitosis: para calcular el ndice mittico, observen tres puntos diferentes de la lmina preparada, donde se encuentre tejido teido, y cuenten el nmero de clulas en cada uno de los tres puntos seleccionados que se encuentran en: interfase, profase, metafase, anafase y telofase (Figura 14.13). Qu observan? Identifiquen las diversas fases del ciclo celular presentes, como lo son: la interfase y la mitosis, que incluye profase, metafase, anafase y telofase (Figura 14.13). Elaboren una tabla donde se muestren las fases identificadas, la descripcin de lo observado, la ilustracin de lo observado y cualquier otro aspecto que consideren importante. Elaboren otra tabla para el clculo del ndice mittico. Calculen dicho ndice con la siguiente frmula:

IM (ndice mittico)=

Nmero total de clulas en mitosis x100 Nmero total de clulas

Cmo lo pueden interpretar o explicar? Qu diferencias pudieron observar entre la interfase y la profase? Cul es la disposicin de los cromosomas en la metafase? Todos los cromosomas tienen la misma forma? Descrbanlos y comprenlos: en cunto se diferencian los ndices mitticos de los dems grupos con los del suyo? Si existen diferencias, a qu se debern?

21

Qu otras maneras efectivas habr para realizar la experiencia? Prueben esta experiencia con races de ajo o cebolln. Tambin pueden intentarlo con races de semillas germinadas de caraotas, alpiste o lechuga. Con respecto a la tincin, realicen pruebas con azul de metileno o tintura de yodo, y observen qu resultados obtienen.

Figura 14.13. Mitosis en cebolla: se pueden observar clulas en diferentes fases de mitosis y clulas en interfase.

Actividades de autoevaluacin

1.- Realiza un cuadro comparativo entre la mitosis y la meiosis, donde se evidencien estructuras, funciones, variacin entre los procesos, rganos y tejidos donde se dan, organismos que las realizan y variantes de estos procesos, entre otros aspectos que consideres de inters.

22

2.- Realiza una visita a una institucin especializada en medicina o encargada de prestar servicios mdicos a la poblacin, o bien revisa sus ciberpginas, y recaba la siguiente informacin: cules problemas se presentan en la sociedad relacionados con errores en el proceso mittico y meitico? Cules son las personas que ms sufren estos problemas? Qu cantidad de personas sufren en el pas dichos problemas? Cules son los tratamientos? 3.- Cul es la relacin que tiene o puede tener la misin AgroVenezuela con el proceso mittico y meitico? Qu aportes de la biotecnologa, relacionados con la mitosis y la meiosis, son importantes para el desarrollo de esta misin? Identifica en un proceso agrcola la aplicacin de los procesos de divisin celular. 4.- Recuerdas lo que leste en la introduccin de esta lectura sobre la cicatrizacin que se produce despus de que la piel se rompe? Ampla esta informacin respondiendo las siguientes preguntas: cmo se da la cicatrizacin en el ser humano? Cules son los problemas que se pueden presentar en el proceso de la cicatrizacin? Cmo contribuyen los procedimientos mdicos (suturas, grapas, entre otros) en este proceso?

Embriones de ganado selecto de razas criollas Carora y Criollo Limonero se preparan para ser implantados en vacas receptoras. Ncleo de produccin de la Universidad Nacional Experimental Simn Rodrguez, en colaboracin con el Instituto Nacional de Investigaciones Agrcolas.

23

15
Has observado que muchas de las caractersticas que posees tambin estn presentes en tus padres o abuelos? Te has preguntado por qu los seres humanos aun cuando presentamos caractersticas comunes como especie no somos totalmente iguales, no somos copias idnticas? La excepcin son los gemelos, pero incluso estos pueden presentar algunas diferencias. En una lectura anterior pudiste aprender cmo la informacin gentica que est presente en el ADN se expresa para que t seas como eres, para que las plantas, los hongos, los animales, y los dems seres vivos tengan caractersticas determinadas. La informacin gentica contenida en el ADN hace posible que tengas determinado color de cabello, color de la piel, estatura, grupo sanguneo y otras caractersticas. Los segmentos del ADN que contienen informacin para cada una de esas caractersticas (o, en el caso de los procariotas, los segmentos de ARN) son llamados por los cientficos genes. Cada gen codifica la informacin necesaria para la sntesis de determinada protena.

Leyes celulares, leyes de familia. Por qu somos como somos?


24

Con esta lectura podrs encontrar algunas respuestas a estas preguntas y tal vez te plantears otras sobre los procesos que rigen la herencia de caracteres biolgicos. Lo que presentamos te permitir aprender sobre el origen de la gentica moderna y las leyes de la herencia en los seres vivos. Tambin podrs descubrir por qu en algunas caractersticas te pareces ms a uno de tus padres, por qu heredaste los ojos de tu abuela y la estatura de tu abuelo, por qu tienes parecido con tus primos, cmo las caractersticas pasan de una generacin a otra.

La curiosidad hace al cientfico


La inquietud y la curiosidad de un monje austraco del siglo XIX, ha permitido a la ciencia tener respuesta para muchas interrogantes relacionadas con la herencia de las caractersticas de los seres vivos, el nombre de ese monje observador e investigador es Gregorio Mendel. Sabas que...? que...? En 1822 naci Gregorio Mendel, hombre de origen humilde siempre vivi como un monje en el monasterio de St. Thomas en Brnn, Austria. Lugar donde ingres mientras desarrollaba sus estudios universitarios a a los los 21 21 aos. All vivi hasta hastasu sumuerte muerteen enenero enerode de1884. 1884. Su vida vidaen en el monasterio el monasterio le perle permiti miti realizar realizar sus experimentos. sus experimentos. Los reLos sultados resultados de sus trabajos de sus permanecietrabajos permanecieron ron sin ser reconocidos sin serhasta reconocidos dcadas hasta despus dcadas de su despus muerte, de porsu lomuerte, que es por posible lo que decir es que posible no lleg decir a saber que no la lleg importancia a saber de la importancia sus trabajos de para sus trabajos la ciencia. para la ciencia.

Qu aport Gregorio Mendel?


Mendel se dedic durante aos a estudiar cmo se heredan las caractersticas en las plantas de guisantes: Pisum sativum. Trabaj de forma sistemtica sus observaciones, para lo cual eligi siete caractersticas en sus estudios (Figura 15.1). Una de las fortalezas de los estudios de Mendel fue el uso de las matemticas para interpretar sus resultados, en especfico de la estadstica, lo que le permiti establecer leyes que sealan cmo se transmiten las caractersticas de una generacin a otra. Todos estos aspectos fueron significativos para sentar las bases de la gentica moderna. Para el momento en que Mendel realiz sus experimentos, ya se conoca que las plantas hbridas descendientes de dos progenitores tienen caractersticas similares, adems si los hbridos a su vez se cruzan, la descendencia cambia y ya no se hacen evidentes las mismas caractersticas.

25

Es importante que como aprendiz de investigadora o investigador consideres los detalles esenciales que llevaron a Mendel a tener xito en sus experimentos, entre ellos: Eligi el material biolgico adecuado para su investigacin. Dise cuidadosamente los experimentos que realiz. Fue cuidadoso en el registro de los resultados y para su anlisis e interpretacin utiliz la estadstica. Mendel reflexion cada resultado que obtuvo y en funcin de sus anlisis propuso otras posibilidades para los cruces, lo que le permiti formular diversas hiptesis. Todo esto le permiti plantear las leyes que explican la herencia de caracteres de una generacin a otra. Lo ms importante en el trabajo de Mendel fue conseguir patrones en la manera en que se heredan las caractersticas.

Al utilizar plantas de guisantes (Pisum sativum) como material biolgico, Mendel logr varias ventajas: la planta es fcil de cultivar, resulta fcil su polinizacin controlada ya que posee una flor con partes masculinas y femeninas que permite realizar autofecundacin o autopolinizacin, por esto mismo tambin es posible eliminar las anteras y as evitar la autofecundacin puesto que las estructuras reproductivas estn aisladas gracias a los ptalos (Figura 15.2).

Figura 15.1. Las siete caractersticas estudiadas por Mendel en las plantas de guisantes (Pisum sativum).

Figura 15.2. Flor de la planta de guisante Pisum sativum. (a) En la flor cerrada ocurre la autopolinizacin, produciendo las lneas puras, es decir organismos que se autofecundan. (b) Al separar los ptalos es posible realizar la polinizacin cruzada, se eliminan los estambres y se utiliza el polen de otra flor con las caractersticas deseadas para estudiar.

26

Mendel inici sus experimentos cultivando variedades de la planta de guisante para obtener lneas puras y as realizar luego polinizacin cruzada con ellas. Sus experimentos se basaron inicialmente en cruzar plantas que se diferenciaban solo en una caracterstica, este tipo de cruce se denomina monohbrido, luego tom las semillas de ese cruce y las sembr para observar la descendencia (Figura 15.3). En uno de los cruces realizados Mendel hizo la polinizacin cruzada de una planta de guisantes amarillos con otra de guisantes verdes a los que llam generacin de padres (P) (Figura 15.3) de este cruce obtuvo la primera generacin filial (F1) con plantas que solo daban semillas amarillas. Qu habra pasado con el color verde? Como en la primera generacin filial Mendel obtuvo solo plantas que daban semillas de color amarillo, decidi plantar las semillas producto de ese cruce y permiti que se autopolinizaran. De este cruce obtuvo que tres cuartas partes de las plantas daban semillas amarillas y una cuarta parte semillas verdes obteniendo as la segunda generacin filial (F2) (Figura 15.3). De dnde sali el color verde de las nuevas semillas, que haba desaparecido?

Figura 15.3. Cruce monohbrido realizado por Mendel en los guisantes Pisum sativum. Para facilitar la comprensin de los cruces se representan con letras los alelos (dominantes en mayscula y recesivos en minscula).

27

Mendel repiti varias veces estos cruces y sus resultados se repitieron. Realiz distintos cruces con diferentes caractersticas y los resultados se mantuvieron. Para tratar de explicar los resultados obtenidos, Mendel pens: La diferencia entre una caracterstica y otra se debe a determinantes hereditarios a los que llam factores y que hoy conocemos como genes. Los factores existen en parejas y durante la formacin de los gametos los pares de factores se separarn (Recuerda lo que se trabaj en el tema de la meiosis). Los gametos femeninos y masculinos se fusionan al azar. Existen caractersticas que dominan sobre otras, sin embargo la caracterstica recesiva aunque no se manifiesta no se ve alterada y puede pasar a la siguiente generacin. Actualmente se conoce que es dominante el alelo que se expresa a expensas del alelo alternativo. El fenotipo dominante es el que se expresa en la F1 de un cruzamiento entre dos lneas puras. Por otra parte el alelo recesivo se presenta cuando la expresin de un gen se suprime en presencia de un alelo dominante. El fenotipo recesivo es el que desaparece en la primera generacin de un cruzamiento entre dos lneas puras y reaparece en la segunda generacin. Los organismos de lneas puras tienen los mismos factores para la caracterstica en estudio, mientras que los hbridos poseen dos factores diferentes. Asimismo, a medida que se fueron ampliando los conocimientos en gentica luego de los trabajos realizados por Mendel, se establecieron otra serie de definiciones bsicas que es importante comprender: El genotipo, o constitucin gentica de un individuo, es el conjunto de genes que contiene un organismo heredado de sus progenitores. Mientras que el fenotipo es la manifestacin externa del genotipo, es decir, la suma de los caracteres observables en un individuo. El fenotipo es el resultado de la interaccin entre el genotipo y el ambiente. Un alelo es cada una de las formas diferentes en que se puede representar un gen, es decir, las variantes de un gen. Si ambos alelos son idnticos para un gen, el organismo es homocigoto para esa caracterstica. Si son diferentes, es heterocigoto. De las conclusiones del trabajo de Mendel se deriva la Primera ley de Mendel o Ley de Segregacin, que plantea segn su interpretacin en la actualidad que: los alelos de un mismo gen se separan, es decir, se segregan cuando se forman los gametos y de esta manera al azar cada gameto lleva la mitad de la informacin (un alelo de un gen). Por consiguiente las caractersticas que se enmascaran (recesivas) en la F1 reaparecern en la F2, es por esta razn que de un cruce de dos lneas puras (homocigotas) resultan individuos heterocigotos. Luego que Mendel termin con sus estudios en cuanto a la herencia de una caracterstica se plante realizar cruces donde incluyera ms caractersticas, para ello realiz cruces dihbridos, donde consider dos caractersticas por cruce. Realiz la fertilizacin cruzada de una planta de guisantes amarillos y textura lisa con otra de guisantes verdes y textura rugosa, de este cruce obtuvo en la primera generacin filial (F1) slo plantas que daban semillas amarillas y lisas, mientras que al realizar la autofecundacin en la F2 obtuvo semillas amarillas y lisas, amarillas y rugosas, verdes y lisas y verdes y rugosas en distintas proporciones (Figura 15.4).
28

De este cruce realizado Mendel propuso su Segunda Ley o Ley de Segregacin Independiente de los caracteres la cual establece segn su interpretacin en la actualidad que: durante la formacin de los gametos en el proceso de gametognesis, la segregacin de los alelos de un gen es independiente de la segregacin de los alelos de otro gen. Los resultados de Mendel no fueron aceptados ni reconocidos por la comunidad de bilogos de la poca, slo fueron reconocidos 30 aos despus de su muerte, a comienzos del siglo XX, ya que en su poca no causaron ningn impacto en la biologa. Fue en 1900 que gracias a Carl Correns, Hugo de Vries y Erick Tschermak bilogos que trabajaron de manera independiente y que al principio desconocan los trabajos de Mendel, se redescubrieron los principios de la herencia. Es importante sealar que para ese momento de la historia de la gentica no se haba estudiado profundamente la ubicacin de los genes en los cromosomas, aspecto que influye en la segregacin de los alelos ya que genes ubicados en un mismo cromosoma se encuentran ligados, es decir, no se distribuyen de manera independiente, excepto cuando existe entrecruzamiento como lo trabajamos en la lectura anterior.

Figura 15.4. Cruce dihbrido realizado por Mendel en los guisantes Pisum sativum.

Los resultados de Mendel no fueron aceptados ni reconocidos por la comunidad de bilogos de la poca, solo fueron reconocidos 30 aos despus de su muerte, a comienzos del siglo XX, ya que en su poca no causaron ningn impacto en la biologa. Fue en 1900 que gracias a Carl Correns, Hugo de Vries y Erick Tschermak, bilogos que trabajaron de manera independiente y que al principio desconocan los trabajos de Mendel, se redescubrieron los principios de la herencia. Es importante sealar que para ese momento de la historia de la gentica no se haba estudiado profundamente la ubicacin de los genes en los cromosomas, aspecto que influye en la segregacin de los alelos ya que genes ubicados en un mismo cromosoma se encuentran ligados, es decir, no se distribuyen de manera independiente, excepto cuando existe entrecruzamiento como lo trabajamos en la lectura anterior.

29

Cmo realiz Mendel los cruces?


Mendel cruz plantas de lneas puras que tenan flores prpuras con otras de flores blancas. Determina el genotipo, el fenotipo, el porcentaje y la proporcin en la que se encuentra cada descendiente de la F1 y la F2. 1. Tipo de cruce: Monohbrido 2. Caracterstica: Color de flor 3. Simbologa: Color prpura = R Color blanco = r 4. Cruce segn el mtodo matemtico 5. Gametos 6. Primera Generacin filial Fenotipo 4/4 100% Plantas con flores color prpura 4/4 Genotipo plantas heterocigotas Rr

Proporcin: 1:1 Ahora repetimos los pasos 4, 5 y 6 para sacar la F2 luego de la autofecundacin. 4. Cruce 5. Gametos 6. Segunda generacin filial

Fenotipo 3/4 75% Plantas con flores color prpura 2/4 1/4 1/4

Genotipo 50% plantas heterocigotas Rr 25 % Plantas homocigotas dominantes RR 25 % Plantas homocigotas recesivas rr

1/4
30

25 % Plantas con flores color blanco

Proporcin: 3:1 Por cada 3 plantas con flores color prpura sale 1 de color blanco. Mendel cruz plantas de lneas puras que tenan tallo alto y flores laterales (axiales) con otras de tallo bajo y flores terminales. Determina el genotipo, el fenotipo, el porcentaje y la proporcin en la que se encuentra cada descendiente de la F1 y la F2. 1. Tipo de cruce: Dihbrido 2. Caractersticas: tamao de la planta, ubicacin de la flor 3. Simbologa: Tamao de la planta: alta=A, baja =a; Ubicacin de la flor: lateral o axial= L, terminal= l 4. Cruce segn el mtodo matemtico

En esta generacin se producen 16 plantas. Cada padre produce 4 tipos diferentes de gametos, sin embargo como en este caso la carga gentica es igual se resume en el esquema Fenotipo 16/16 100% Plantas de tallo alto y flores axiales 16/16 Genotipo Plantas heterocigotas AaLl

31

Proporcin: 1:1 Ahora repetimos los pasos 4, 5 y 6 para sacar la F2 luego de la autofecundacin, en este caso vamos a utilizar otro procedimiento para facilitar el trabajo. 4. Cruce segn el mtodo del cuadrado de Punnet

P2 AaLl

Gametos G2 AL Al aL al

AL AALL AALl AaLL AaLl

AaLl Al AALl AAll AaLl Aall

aL AaLL AaLl aaLL aaLl

al AaLl Aall aaLl aall

9/16

Fenotipo Plantas de tallo alto y flores laterales

Genotipo 1/16 2/16 4/16 2/16 1/16 2/16 1/16 2/16 1/16 AALL AALl AaLl AaLL AAll Aall aaLL aaLl aall

3/16 3/16 1/16

Plantas de tallo alto y flores terminales Plantas de tallo bajo y flores laterales Plantas de tallo bajo y flores terminales Proporcin: 9:3:3:1

32

Manos a la obra! Conociendo tu herencia familiar


Las caractersticas fsicas que posees son la expresin de tu gentica, muchas de esas caractersticas son la prueba de la herencia de tus antepasados, con esta actividad descubriremos cules de esas caractersticas son propias de tu familia. Qu necesitas? Una foto tuya reciente Fotos de tus familiares ms cercanos, tus padres, tus hermanos, abuelos, tos, primos Hojas de papel Lpiz Colores Pega Regla Cmo lo hars? En una hoja realiza un rbol genealgico, puedes utilizar como ejemplo el que aparece en la figura. Compara tus rasgos fsicos con los de tus familiares cercanos e identifica cules son los ms comunes. Elabora un cuadro con las caractersticas fenotpicas ms resaltantes de tu familia y anota en cules aspectos coincide cada familiar segn su parentesco. Qu explicaciones puedes dar a lo observado? Consigues parecido entre tus familiares? Qu caractersticas son comunes? Segn tu conocimiento sobre la gentica, a qu crees que se deba esto? Consideras de importancia el estudio de la gentica? Socializa tus resultados con tus compaeras y compaeros de clase, presenta tu rbol genealgico.

33

Juguemos a construir un genotipo

A continuacin simularemos los cruces que realiz Gregorio Mendel cuando llev a cabo sus experimentos. Esta actividad es para realizarla en grupo. Qu necesitan? 8 fichas de cada uno de los siguientes colores: amarillo, verde, rojo y azul. 2 crculos de 5 cm c/u como aparece en el esquema que se te sugiere. 1 hoja. 2 vasos de colores diferentes. Lpiz, marcador. Cmo lo harn? Seleccionen un ser vivo ficticio y dos caractersticas que deseen trabajar de l. Decidan cul ser la caracterstica dominante y cul la recesiva. Marquen 8 fichas con una letra mayscula y 8 con letra minscula, asgnenle a cada una la caracterstica que eligieron. Separen las fichas de cada caracterstica al azar y colquenlas en dos vasos identificados con los smbolos de masculino y femenino, en total cada vaso debe tener 16 fichas combinadas formadas por cada color. Ahora realicen distintos cruces: - Tomen 4 fichas al azar de cada vaso. - Simulen el cruce sacando los gametos y la primera generacin, intenten hacerlo ms rpido que sus compaeros. - Anoten los resultados en una hoja. Luego traten de establecer el genotipo y el fenotipo. Ahora intenten otro cruce seleccionando al azar otras fichas.

34

Madre

Padre

Vaso del alelo hembra

Vaso del alelo macho

Ejemplo

Madre AB

Hijos caractersticas genticas Padre AaBb=heterocigoto para ambas caractersticas, flores de ab color rojo, tallo largo

Qu explicaciones darn a lo observado? Ser importante el azar en la variedad de las especies? Cuntas combinaciones podemos realizar con los gametos que elegiste? Todos los cruces que has realizado presentan las mismas caractersticas?

Toda regla tiene su excepcin


Mendel seleccion caractersticas simples en las plantas de guisante, lo que le permiti obtener resultados claros y fciles de interpretar. Sin embargo, la realidad del mundo natural es mucho ms complicada. Por ejemplo, hay casos como el de la planta de dragoncillo o el de la planta Dondiego de noche, una caracterstica particular de ellas es que al cruzar dos plantas, una de flores rojas (RR) con otra de flores blancas (RR), su descendencia da flores de color rosado (RR), es decir, el fenotipo del heterocigoto es intermedio: esto se llama dominancia intermedia. Al realizar un cruce de los descendientes de la F1 y obtener la F2 reaparecen las caractersticas roja y blanca lo que implica que la integridad de los alelos se mantiene, no se han visto afectados. (Figura 15.5). Al resolver cruces de este tipo es necesario que consideres que se utilizan letras maysculas para ambas caractersticas.

Figura 15.5. Cruce de dominancia intermedia.

35

Codominancia
En algunos casos se puede obtener la expresin conjunta de alelos de un gen, donde ninguno domina, simplemente se expresan ambos sin obtener resultados intermedios. As sucede en el caso de un tipo de glicoprotena (unin de un azcar y una protena) que se encuentra en la superficie de los glbulos rojos de la especie humana, dependiendo del tipo de glicoprotena existirn diversos tipos de sangre.

Alelos mltiples
Dado que las mutaciones son capaces de modificar la informacin presente en el ADN, un gen puede presentar ms de dos alelos como en el caso del grupo sanguneo en la especie humana, donde se consiguen diversos tipos de sangre de acuerdo a la presencia o no de antgeno y, adems, al antgeno que se posee (bien sea A o B). A ello se suma que este es un tipo de herencia codominante (Figura 15.6). Si hay un antgeno en la superficie de los glbulos rojos de una persona y su sangre se une con la de otra persona cuyo antgeno en los glbulos rojos no es compatible, reaccionarn los anticuerpos y producirn una coagulacin o aglutinacin de los glbulos rojos, por ello es importante realizar pruebas especficas cuando una persona va a ser donante.

Figura 15.6. Tipo sanguneo en la especie humana. El grupo O es donante universal (no contiene antgenos ni A ni B). El grupo AB es receptor universal (no produce anticuerpos contra el antgeno A ni el antgeno B). El alelo i es nulo, es incapaz de producir cualquier forma del antgeno. Alelos A y B son dominantes sobre el alelo i.

36

La gentica en nuestras vidas


A lo largo de la historia, los seres humanos han utilizado la gentica de forma emprica, basados en su experiencia, siempre con el objetivo de obtener mejoras en los cultivos y en los animales domesticados a fin de obtener crecientes rendimientos. Se ha buscado que las caractersticas especficas de los productos respondan a las necesidades de la sociedad: plantas ms resistentes a plagas o con frutos ms grandes, vacas que den ms leche, entre otras.

Al redescubrirse los trabajos de Mendel a comienzos del siglo XX, esta mejora dej de ser emprica y se convirti en algo ms sistemtico, es decir, ms organizado, donde se procuraba la seleccin de los mejores especmenes para cruzar, segn las leyes de la herencia, y as obtener los mejores resultados. En la actualidad incluso se aplican mayores conocimientos en la investigacin biotecnolgica, que trabaja directamente modificando genes concretos. El uso de la gentica en la mejora de cultivos o animales puede permitir potenciar sus caractersticas para beneficio de la sociedad, por ejemplo cultivar frutos de mejor sabor o cuya duracin sea prolongada. As mismo en el caso de los animales, se pueden obtener especies con menor cantidad de grasa para no afectar la salud de la poblacin, o lograr especies cuyo desarrollo sea ms rpido y as invertir menos tiempo en su cuidado.

37

Por otra parte, tambin puede permitir mejoras en la resistencia de las plantas a las plagas y a las condiciones ambientales adversas que afectan los cultivos. Asimismo, la terapia gnica es utilizada en la medicina para el diagnstico y curacin de enfermedades hereditarias, por ejemplo para el tratamiento de la fibrosis qustica, tambin para tratar enfermedades hepticas, incluso se est trabajando para ser utilizada como tratamiento contra el cncer al modificar linfocitos para que ataquen los tumores cancergenos. Lo que implica que el conocimiento de la gentica aporta tcnicas y tratamientos que logran mejorar la calidad de vida y contribuir al buen vivir de la sociedad. A pesar de los beneficios que se obtienen con el uso de la biotecnologa en la mejora de las especies animales o vegetales para consumo humano, la liberacin de estos al ambiente cuando no se realiza con el control adecuado, promueve el cruce de los mismos con los organismos silvestres, lo cual supone un riesgo para las especies autctonas ya que el genotipo que poseen los OGM (Organismo Genticamente Modificado) afecta el acervo gentico de la diversidad biolgica y el equilibrio en las interacciones biolgicas del planeta. Adems, las empresas que se dedican a la elaboracin de OGM en el mundo son escasas y tienden a monopolizar los productos que elaboran, incrementando inclusive los costos ante la demanda de los productos a costa del beneficio que estos representan para las poblaciones de agricultores o ganaderos que requieren de las variedades de especies que les ofrecen para mejorar su produccin. As mismo, las empresas productoras de OGM a menudo no consideran uno de los principales objetivos por el cual fueron creados los organismos transgnicos, que es atender las necesidades alimentarias de la poblacin mundial.

38

Actividades de autoevaluacin

El conocimiento de las bases de la gentica permite comprender cmo se transmite la informacin de los genes en las especies, sin embargo la manipulacin gentica presenta otras bases, indaga junto con tus compaeras y compaeros cmo hace la biotecnologa para producir organismos genticamente modificados (OGM). Discute con tus compaeras y compaeros, cul es la posicin de nuestro pas con respecto los alimentos genticamente modificados (OGM), para ello revisa diferentes documentos legales, entre ellos: Ley de Diversidad Biolgica (1999). De igual forma puedes revisar los siguientes enlaces donde aparece una propuesta de gerencia estratgica para el uso de transgnicos en Venezuela, http://www.rrppnet.com.ar/ transgenicos.htm. Marco Nacional de Seguridad de la Biotecnologa Moderna en la Repblica Bolivariana de Venezuela, http://www.minamb.gob.ve/files/Conservacionbioseguridad/MNB.pdf. En una lectura anterior, te invitamos a realizar un debate sobre los beneficios y los problemas ticos de la manipulacin gentica, ahora que sabes cmo se hereda la informacin gentica te proponemos que incorpores a tu investigacin las distintas tcnicas de manipulacin gentica que existen y que con ayuda de tu docente y junto a tus compaeras y compaeros organicen un foro o un panel de expertos, donde los panelistas sean distintos compaeros de clase que representen a los especialistas en biotecnologa; cada uno expone un caso real de OGM, cmo se trabaj en l y qu resultados se obtuvieron. El resto del grupo-seccin constituye la audiencia, as pueden desarrollar un debate sobre los casos presentados.

Campaa contra maz transgnico en Europa.


Fuente: Greenpeace.

39

16

Los genes vienen en paquetes

Los resultados de los cruces de plantas de guisantes que hizo Mendel en sus trabajos, para tratar de explicar cmo se heredan los caracteres, lo llevaron a sealar que la herencia estaba controlada por factores. Actualmente los cientficos llaman a los factores mendelianos genes. Otro de los aportes de Mendel fue sealar que en los gametos o clulas sexuales la informacin contenida en los genes se distribuye de manera independiente, lo que hace posible que durante la fecundacin, es decir, la unin de un gameto femenino y otro masculino, el nuevo ser tenga una mayor variedad de combinaciones de dicha informacin. En la actualidad sabemos muchas cosas sobre los genes que se desconocan en el siglo XIX cuando Mendel vivi y que han sido parte de los avances de la Gentica desde principios del siglo XX; sobre todo conocemos que los genes son porciones concretas de ADN. Por ello, hoy nos parece evidente decir que la informacin gentica est en los cromosomas y que en ellos los genes estn ordenados linealmente, pero esto es el fruto del esfuerzo de muchas investigadoras e investigadores. En esta lectura vamos a explicar cmo se desarroll la llamada Teora Cromosmica de la Herencia. Conoceremos cmo los cromosomas en las clulas eucariotas transmiten los caracteres hereditarios, en especial los relacionados con los cromosomas sexuales. Tambin veremos la forma en que los genes son empaquetados en los cromosomas. Adems, estudiaremos algunas tcnicas para observar los cromosomas humanos.

40

Parece que las leyes de Mendel no siempre se cumplen


Como recordars de la lectura acerca de los procesos de divisin celular (mitosis y meiosis), cuando el ncleo celular comienza el proceso de divisin, la cromatina, un material que se visualiza como una maraa de hilos delgados, comienza a condensarse hasta formar los cromosomas. Aunque el trmino cromosoma comenz a usarse desde 1882, no fue sino hasta el redescubrimiento de las leyes de Mendel cuando comenz a sospecharse su papel en la transmisin de los caracteres hereditarios. Hacia 1902, Walter Sutton (EEUU) y Theodor Boveri (Alemania), en forma independiente, formularon la hiptesis de que los factores mendelianos se encuentran en los cromosomas, dado el comportamiento paralelo de los genes y los cromosomas en la formacin de los gametos en la meiosis. Este paralelismo se resume en la tabla 23.1
Tabla 16.1. Comparacin entre los cromosomas y los "factores" de Mendel.

Caractersticas de los cromosomas Los cromosomas estn en pares. Los cromosomas se segregan, es decir, los pares se separan durante la meiosis. Las parejas de cromosomas se reparten independientemente de otras parejas de cromosomas. Los gametos tienen la mitad del nmero de cromosomas que poseen las clulas del cuerpo. Durante la fecundacin, los gametos se renen restaurando el nmero original de cromosomas. Cada cromosoma retiene su estructura al pasar de una generacin a otra.

Caractersticas de los factores de Mendel Los factores de Mendel estn en pares. Los factores de Mendel se segregan, es decir, los pares se separan durante la formacin de gametos. Los factores de Mendel se reparten independientemente. Los gametos tienen la mitad del nmero de factores que poseen las clulas del cuerpo. El nmero original de factores se restaura al unirse los gametos. Los factores no cambian al pasar de una generacin a otra.

Sutton formul lo que se llam despus Teora Cromosmica de la Herencia en los siguientes trminos: Los genes son unidades fsicas que se encuentran localizadas en los cromosomas. Podemos observar que los factores de Mendel son designados como genes, trmino acuado por Wilhelm L. Johannsen en 1909. Aunque la teora de que los genes se encuentran en los cromosomas pareca correcta, se requera ms evidencia experimental para apoyarla. Para ello, se necesitaba un organismo cuya gentica y cuyos cromosomas pudieran estudiarse al mismo tiempo.
41

A partir de 1910, Thomas H. Morgan comenz a estudiar la mosca de la fruta o mosca del vinagre, Drosophila melanogaster (Figura 16.1). Este organismo presenta las siguientes ventajas: Las moscas son fciles de conseguir y mantener. Requieren poco espacio y poca alimentacin. Se reproducen rpidamente (completan su ciclo en 10-11 das a 25C). Poseen solo 4 pares de cromosomas. Tienen caractersticas fciles de observar. El macho y la hembra se distinguen fcilmente. La larva tiene cromosomas gigantes en las glndulas salivares y otros tejidos, lo que facilita su observacin al microscopio.

Figura 16.1. Ciclo de vida de la Drosophila melanogaster, en un cultivo mantenido a 25C.

Figura 16.2. Cromosomas de Drosophila hembra y macho, diferencias descritas por primera vez en 1908.

Morgan observ en sus experimentos con la mosca de la fruta que aunque la hembra posee cuatro pares de cromosomas semejantes entre s (cromosomas homlogos), los machos de esta especie tenan tres pares de cromosomas homlogos, llamados autosomas, y un par de cromosomas parecidos, pero no idnticos, a los que denomin cromosomas sexuales, ya que son los responsables del sexo. Uno de los cromosomas del cuarto par es de apariencia idntica a los cromosomas del cuarto par de las hembras y lo design como X, por su parecido con esta letra; al otro cromosoma de los machos, el cual es bastante diferente, lo denomin cromosoma Y.

42

Debido a la separacin de los pares de cromosomas homlogos durante la meiosis, los vulos de esta mosca contienen uno de cada tipo de autosomas, ms un cromosoma X. Los espermatozoides producidos por los machos contienen tres autosomas y un cromosoma X o uno Y. Si durante la fecundacin un vulo de fusiona con un espermatozoide que posee un cromosoma X, el cigoto producir una mosca hembra (XX). Si el espermatozoide posee un cromosoma Y, ser un macho (XY). (Figura 16.3).

Sabas que...? El papel de los cromosomas sexuales en la determinacin del sexo fue determinado por Nettie Maria Stevens, quien en 1905 public los resultados de sus investigaciones con el escarabajo de la harina Tenebrio molitor. Esta investigadora, adems de localizar y describir los cromosomas sexuales y su comportamiento, supo interpretar su funcin en relacin con las leyes mendelianas de la herencia. Stevens muri en 1912 de cncer de mama.

Figura 16.3. Determinacin del sexo. Solo estn expresados los cromosomas sexuales.

Para realizar sus trabajos, Morgan cultiv Drosophila de tipo salvaje; en un principio se traz como objetivo realizar cruces como los realizados por Mendel con las plantas de arvejas. Despus de realizar muchos cruces observ que en uno de los cultivos haba una mosca que era diferente a las dems, tena los ojos blancos en vez de rojos, que era lo normal. Cuando la separ del grupo, observ que esta mosca diferente era un macho y la cruz con una hembra de ojos rojos normal para obtener los descendientes de la primera generacin. La descendencia resultante present ojos rojos, lo que indicaba que el carcter "ojos blancos" era recesivo. Morgan denomin white (w), blanco en ingls, al gen correspondiente.

43

Sin embargo, al cruzar los descendientes entre s, se obtenan resultados muy curiosos. Aunque se daba la segregacin 3:1 (por cada tres individuos de ojos rojos, haba uno de ojos blancos), se observ que no haba ninguna hembra de ojos blancos y, en cambio, entre los machos, la mitad tena ojos rojos, y la otra mitad tena los ojos blancos (Figura 16.4).

Figura 16.4. Cruzamientos realizados por Morgan en Drosophila melanogaster para estudiar la herencia del gen para ojos blancos.

La figura 16.4 representa el cruce hecho por Morgan sobre la herencia del color de los ojos en Drosophila melanogaster. Como puedes observar en dicha figura, Morgan interpret estos resultados asumiendo que el gen implicado en el color de los ojos deba estar en el cromosoma X. En otras palabras: un gen preciso, ubicado en un cromosoma determinado, era responsable del color de ojos de esos insectos. Esta fue la primera vez que se hizo tal asociacin entre un gen y un rasgo fsico, apoyando la hiptesis de Sutton y Boveri. Como los machos poseen un solo cromosoma X, manifestaran el carcter para cualquier alelo presente en el cromosoma X. Esto se cumplira aun para el caso del alelo recesivo, ya que el cromosoma Y no tiene un alelo que pudiera ser dominante. Morgan resumi en tres sus conclusiones fundamentales: Los genes deben residir en los cromosomas, Cada gen debe residir en un cromosoma concreto, El carcter color de ojos debe residir en el cromosoma X y estar ausente en el cromosoma Y, siendo el rojo el color dominante.
44

Sabas que...? El hecho de que Gregorio Mendel siempre obtuvo una distribucin independiente de los genes para los caracteres que l estudi, solo pudo ocurrir porque estos se encontraban en diferentes cromosomas de los guisantes, ya que si hubieran estado en el mismo cromosoma se hubieran heredado juntos. Ms tarde, Morgan descubri que muchos caracteres hereditarios se transmiten juntos, como por ejemplo, el color del cuerpo de la mosca, el color de los ojos, el tamao de las alas... Despus de efectuar numerosos cruces comprob que haba cuatro grupos de genes que se heredaban ligados. Concluy, por tanto, que los genes que se encontraban en el mismo cromosoma tendan a heredarse juntos, por lo que los denomin genes ligados. Morgan supuso que estos genes ligados estaban localizados a lo largo del cromosoma en la misma forma en que se disponen las cuentas en un collar. Posteriormente, Morgan observ que esos caracteres "ligados" en ocasiones se separan. A partir de aqu, Morgan dedujo el concepto de recombinacin de cromosomas: postul que dos cromosomas apareados pueden intercambiar informacin, e incluso propuso que la frecuencia de recombinacin depende de la distancia entre ambos. Las bases fsicas del entrecruzamiento cromosmico no fueron demostradas hasta 1931, por Brbara McClintock y Harriet Creighton (EEUU) y Curt Stern (Alemania). Supongamos que tienes un collar de cuentas con nudos entre ellas, de modo que si se rompe no salgan todas las cuentas. Este collar puede romperse por cualquier parte, y obtener fragmentos de diferentes tamaos. Adems, en el collar las cuentas que estn ms juntas quedarn en el mismo fragmento, y las ms separadas, en un fragmento diferente. De la misma forma, mientras ms cerca estn dos genes en un cromosoma, mayor ser la probabilidad de que se hereden juntos, y cuanto mayor sea la distancia entre ellos, mayor ser la probabilidad de que se separen debido al proceso de entrecruzamiento que se realiza durante la divisin celular.

Morgan en su laboratorio, en 1917. Las mosquitas estn en los frascos.


Fuente: Laboratorio Cold Spring Harbor.

Brbara McClintock estudiando los cromosomas del maz comprob el entrecruzamiento y, aos despus, el importante fenmeno de los genes saltarines.
Fuente: Laboratorio Cold Spring Harbor.

45

Basndose en esas observaciones, un estudiante del grupo de Morgan, Alfred H. Sturtevant, lleg a la conclusin de que las variaciones en la intensidad de ligamiento podan utilizarse para mapear los genes en los cromosomas, definiendo la distancia relativa entre unos y otros. De esta forma, en 1913 Sturtevant complet el mapa gentico para cinco genes ligados al sexo en la Drosophila, el cual puedes observar en la figura 16.5. En este mapa, observ que la distancia entre dos genes, era igual a la suma de las distancias entre cada uno de ellos con otro intermedio, lo que demostraba que los genes estaban uno detrs de otro a lo largo del cromosoma.

Figura 16.5. Mapa del cromosoma X de Drosophila. Los nmeros corresponden a unidades de mapa o centimorgan (cM).

Resumamos entonces los postulados de la Teora Cromosmica de la Herencia: Los genes que determinan los caracteres hereditarios del fenotipo se localizan en los cromosomas. Cada gen ocupa un lugar especfico dentro de un cromosoma. Los genes se encuentran dispuestos linealmente a lo largo de cada cromosoma. Los genes alelos (o antagnicos) se encuentran en el mismo lugar de la pareja de cromosomas homlogos, por lo que cada carcter est regido por un par de genes alelos. Esto es as en los organismos que tienen los cromosomas en pares, como nosotros.
46

Cmo caben los genes dentro de los cromosomas?


Los seres procariotas, como las bacterias, no poseen en su clula un ncleo verdadero, su ADN est organizado en una estructura denominada nucleoide. El nucleoide es una estructura distintiva y ocupa una regin definida en la clula bacteriana. Esta estructura es muy dinmica y se halla mantenida y remodelada a travs de la accin de unas protenas (similares a histonas, un tipo de protena), las cuales se asocian al cromosoma bacteriano. Si bien pueden existir algunas variantes, el nico cromosoma de las clulas procariotas suele ser circular. El cromosoma bacteriano puede tener desde 160.000 a 12.200.000 pares de bases. El cromosoma de la bacteria Escherichia coli, por ejemplo, tiene alrededor de 4,6 millones de pares de bases. Esto equivale a 1,6 mm de longitud. Tomando en cuenta que la bacteria tiene unos 1,6 m (1,6 x 10-6mm) de dimetro y unos 3 m de longitud, el ADN debe ser envuelto con fuerza para encajar en las clulas. Imagnate ajustar dentro de tu morral una cuerda como de escalar de 300 metros. Como puedes ver en la figura 16.6, el nucleoide de Escherichia coli est constituido por un ncleo central proteico del que irradian 40-50 lazos de ADN superenrollado. Las protenas presentes parecen regular el grado de compactacin del ADN bacterial.

Figura 16.6. ADN de la bacteria E. coli superenrollado en el nucleoide.

En las clulas eucariticas, es decir las clulas de los animales, las plantas y los humanos, la cantidad de ADN es mucho mayor; algunas tienen 1.000 veces ms ADN que las bacterias. En una clula cualquiera de tu cuerpo, el conjunto de cromosomas equivale a 2m de ADN enrollados dentro del ncleo, cuyo dimetro es alrededor de 6 m, es decir 6x10-6m. Es como si enrollramos 40 km de hilo dentro de una pelota de tenis. Cmo puede entrar toda esta enorme cantidad de ADN en el ncleo de cada una de las clulas de nuestro cuerpo? El secreto est en que existen diferentes niveles de empaquetamiento o condensacin del ADN dentro del ncleo de cada clula. Un primer nivel de condensacin se forma gracias a la unin de cierto tipo de protenas, denominadas histonas, a manera de un collar de cuentas: el ADN rodea un ncleo compuesto por ocho histonas. Este ncleo rodeado por ADN, ms el ADN espaciador entre las cuentas, se denomina nucleosoma. Cada nucleosoma contiene un pedazo de ADN de 146 nucletidos ms ocho histonas.
47

Los nucleosomas se enrollan helicoidalmente como una especie de resorte que constituye las fibras de cromatina de los ncleos durante la interfase. Estos pueden volverse a enrollar para dar lugar a superresortes que constituiran las fibras de los cromosomas en metafase. Podemos decir entonces, que un cromosoma es una nica molcula de ADN asociada a protenas.

Figura 16.7. Niveles de condensacin del ADN hasta formar los cromosomas. Escala en nanmetros (nm). 1nm = 10-9m.

Sabas que...? Durante mucho tiempo se crey que los genes se encontraban en las protenas asociadas al cromosoma, y que el ADN era una especie de auxiliar. Solo a partir de las investigaciones de Avery y sus colaboradores, publicadas en 1944, la comunidad cientfica se convenci de que era el ADN, con la informacin contenida en su secuencia de bases, la molcula responsable de la transmisin de los caracteres hereditarios.

48

Observemos los cromosomas con ms detalle


El mejor momento para observar los cromosomas suele ser aquel en el que estos han alcanzado su mximo grado de contraccin y tienen sus bordes perfectamente definidos. Dicho momento suele ser la metafase de la mitosis. Recordars de otra lectura que en esta fase de la mitosis los cromosomas se han dividido en dos cromtidas hermanas (idnticas en grosor, longitud e informacin gentica), las cuales han alcanzado su mximo grado de contraccin y estn en el centro de la clula, en la placa ecuatorial.

Figura 16.8. Cromosoma durante la metafase. A la izquierda, visto al microscopio electrnico; a la derecha, representaciones esquemticas.

En la figura 16.8 puedes observar a la izquierda la imagen vista en un microscopio electrnico de un cromosoma durante la metafase, con el ADN fuertemente empaquetado. Notars que presenta una regin constreida, donde se unen las dos cromtidas. Este es el centrmero. Cuando se examina el ncleo de las clulas durante la metafase se observa que para cada cromosoma con una longitud y una posicin del centrmero determinada existe otro cromosoma con rasgos idnticos; es decir, por lo general todos los cromosomas se encuentran formando parejas. Como recordars, los miembros de cada par se denominan cromosomas homlogos. Otra observacin que se puede realizar cuando estudiamos el ncleo de las clulas es que el nmero de cromosomas de los individuos de la misma especie es constante. Esta cantidad de cromosomas en pares se denomina nmero diploide y se simboliza como 2n. Por ejemplo, las clulas somticas humanas normales tienen 46 cromosomas: 22 pares de cromosomas somticos o autosomas (los cromosomas 1 a 22) y dos cromosomas sexuales. Esto significa que nuestro nmero diploide es 2n = 46. Las mujeres tienen dos cromosomas X (46,XX) mientras que los varones tienen un cromosoma X y un cromosoma Y (46,XY). Las clulas germinales (vulo y espermatozoide) tienen 23 cromosomas: una copia de cada autosoma ms un solo cromosoma sexual. A esto se le llama el nmero haploide (n).
49

El estudio de la estructura externa de los cromosomas de cualquier especie de organismos eucariotas culmina con la obtencin de su cariotipo, que es el patrn cromosmico de una especie expresado a travs de un cdigo, establecido por convenio, que describe las caractersticas de sus cromosomas. Naturalmente, los cromosomas se pueden estudiar en distintos momentos segn la especie y dependiendo de los objetivos planteados. Algunas especies tienen cromosomas que se pueden observar con gran detalle en interfase, tal es el caso de Drosophila melanogaster, que posee cromosomas gigantes que se observan en las glndulas salivales de dicho insecto. En el caso de los seres humanos, el cariotipo se confecciona usualmente despus de un apropiado pre-tratamiento y tincin de las clulas, para hacer ms visibles los cromosomas individuales. Esto permite la deteccin de cambios sutiles en la estructura de los cromosomas.

Sabas que...? El sistema de determinacin del sexo XY, que compartimos con Drosophila y muchos otros animales, no es el nico que existe. Por ejemplo, en las aves y muchas mariposas ocurre lo contrario: el sexo masculino posee dos cromosomas sexuales iguales (ZZ) y el femenino es heterogamtico (cromosomas ZW). En otras especies de insectos, el sexo femenino tiene dos cromosomas sexuales iguales (XX), mientras que el masculino tiene uno solo (XO). En las abejas, hormigas y avispas, los machos provienen de vulos no fertilizados y por tanto, son haploides: tienen la mitad de los cromosomas que las hembras, que son diploides por cuanto nacen de la combinacin de un espermatozoide y un vulo.

Cardenal Bermejo

Al diagrama simplificado de los cromosomas metafsicos del cariotipo se lo denomina idiograma. El idiograma es bsicamente un "mapa cromosmico", como el que observaste para la Drosophila en la figura 16.5. La figura 16.9 muestra los idiogramas de los cromosomas humanos 1, 9 y 11, cada uno de los cuales tiene el centrmero en una posicin diferente. Observa que cada banda se numera para ayudar a indicar la ubicacin de los genes y la descripcin de reorganizaciones cromosmicas.

Figura 16.9. Idiograma de tres cromosomas humanos diferentes.

50

Para realizar el ordenamiento de los cromosomas tanto en cariotipos como en idiogramas hay que tener en cuenta el tamao de los cromosomas (ubicados de mayor a menor, con el brazo corto "p" hacia arriba y el brazo largo "q" hacia abajo); la posicin del centrmero (cen) y la presencia de constricciones secundarias o tallos (st) y satlites (sa). El anlisis de los cromosomas en glbulos blancos perifricos ha facilitado la identificacin de numerosas anomalas cromosmicas. Una de las tcnicas para obtener un cariotipo de ellos es la siguiente: 1. Se toma una muestra de sangre. 2. Se coloca una muestra en un tubo de ensayo y se deja que sedimenten los glbulos rojos, los cuales se descartan. 3. Se agrega colchicina, una droga que detiene el proceso de divisin celular de los glbulos blancos en la metafase. 4. Se agrega agua para que los glbulos blancos estallen y liberen el contenido celular. 5. Se centrifuga la muestra para que los glbulos blancos sedimenten. 6. Se toma una gota de la muestra, se fija con alcohol en un portaobjetos y se tie con colorante. 7. La preparacin se observa en el microscopio y se fotografa. 8. En una foto ampliada, se recortan los cromosomas individuales. 9. Los cromosomas se pegan por tamao decreciente, alineados por el centrmero (cen), con el brazo corto "p" hacia arriba y el brazo largo "q" hacia abajo. La figura 16.10 muestra los cariotipos de una mujer y de un hombre normales Puedes reconocer cul es cul?

Figura 16.10. Cariotipos de clulas humanas normales, uno es de hombre y otro de mujer, cul es cul?

51

El estudio de los cromosomas es una herramienta de gran importancia


Al reconocer a los cromosomas como los agentes transmisores de los caracteres hereditarios, se han desarrollado tcnicas cada vez ms sofisticadas para su anlisis. La citogentica es el estudio de los cromosomas, tanto en su nmero como en estructura, y es una herramienta de gran importancia en el diagnstico de diversas afecciones humanas relacionadas con alteraciones numricas y estructurales de los cromosomas. La elaboracin de cariotipos de clulas de fetos de mujeres embarazadas, en los que se sospecha que puede haber anomalas hereditarias, mediante tcnicas como la amniocentesis y la biopsia corial, permite el diagnstico temprano para un posible tratamiento desde antes del nacimiento. El estudio de los cromosomas y la elaboracin de mapas genticos fue el primer paso en el Proyecto Genoma Humano, cuyo objetivo era determinar la secuencia de pares de bases de ADN en todos los cromosomas. La elaboracin de cariotipos tambin se hace para especies que estn emparentadas, con el objeto de estudiar cmo se han originado. Por ejemplo, a travs del estudio del cariotipo de diversas especies de casiraguas (un roedor) en Venezuela, se pudo deducir la forma como se diferenciaron tales especies, a partir de la ruptura de diferentes cromosomas. Tambin se ha determinado que en los grandes monos, el cariotipo es de 48 (24 x 2) cromosomas, y que el cromosoma 2 de los humanos fue formado por una fusin de dos cromosomas, reduciendo as el nmero de estos en nuestra especie a 46 (23 x 2) cromosomas. Este tipo de estudios ha permitido abordar el problema de la conservacin de la biodiversidad desde una perspectiva gentica. Sabas que...? La amniocentesis es una tcnica basada en el estudio de los cromosomas. Alrededor de la 16 semana de gestacin, se toma una muestra de lquido amnitico (2 a 10ml), el cual contiene abundante cantidad de clulas procedentes de la piel del feto, que pueden aislarse y cultivarse para elaborar su cariotipo; ello permite detectar anomalas cromosmicas y otros trastornos congnitos.

52

El Laboratorio de Gentica Humana que funciona desde 1969 en el Instituto Venezolano de Investigaciones Cientficas (IVIC) tiene como objetivo desarrollar el conocimiento de la herencia biolgica en la poblacin venezolana, identificando las variables que en el pasado, y en la actualidad, han influido sobre su estructura poblacional. Adems, presta un servicio de asesoramiento gentico para diagnstico, estimacin de riesgo de recurrencia y orientacin teraputica de problemas hereditarios y congnitos, y uno para indagacin de la filiacin biolgica. Por otra parte, el Centro Nacional de Gentica Mdica Dr. Jos Gregorio Hernndez (Guarenas, estado Miranda) brinda a las familias asesoramiento en materia gentica, as como otros servicios asequibles y gratuitos que mejoran la calidad de vida de la poblacin venezolana, como consultas de atencin prenatal, evaluacin de defectos congnitos al nacer, psicologa, ecosonografa, asesoramiento gentico, gentica clnica, psicopedagoga y neuropediatra. Tambin en otros institutos y en universidades del pas se realizan investigaciones sobre citogentica humana y citogentica de diversas plantas y animales.

Figura 16.11. Estudios citogenticos en el Centro Nacional de Gentica Mdica permiten atender enfermedades cromosmicas de la poblacin venezolana.
Fuente: Ciudad CCS.

Observemos los cromosomas gigantes de Drosophila

Las glndulas salivales de varias especies de Drosophila contienen cromosomas de gran tamao, denominados cromosomas politnicos, los cuales pueden ser 100 veces mayores de lo normal. Estos cromosomas se mantienen en interfase, por lo que las cromtidas no se condensan y su longitud y su grosor son mucho mayores que los de los cromosomas metafsicos. Los cromosomas politnicos en la Drosophila estn asociados en un cromocentro (Figura 16.12).
Figura 16.12. Cromosomas gigantes de Drosophila.

53

La obtencin de estos cromosomas es relativamente sencilla y rpida por lo que resultan excelentes para el anlisis citogentico. En esta actividad aprenders a preparar los cromosomas politnicos a partir de glndulas salivares de larvas de Drosophila, con el objeto de observar las bandas donde se localizan los genes. Qu necesitan? Cultivo de Drosophila sp. con larvas de 3er estadio. Suero fisiolgico al 0.7 % o cloruro de sodio (NaCl) al 7%. Agua destilada. Aceto-orcena o acetocarmn al 2%. Agujas de diseccin, jeringas de insulina (con las agujas aplastadas para que el material no se vaya dentro) o alfileres entomolgicos. Vidrio de reloj. Portaobjetos y cubreobjetos. Microscopio estereoscpico (lupa binocular). Microscopio compuesto. Toallas de papel. Pinceles. Lpiz con goma. Preparacin del cultivo de Drosphila Preparen el medio de cultivo. Disuelvan 15 g de agar con 480 ml de agua destilada y calienten hasta ebullicin, agitando bien. Aadan 500 g de pulpa de cambur previamente triturada o aplastada y viertan la mezcla en frascos limpios y secos. Tapen los frascos con tapones de algodn y gasa y djenlos enfriar a temperatura ambiente. Capturen varias Drosophila de ambos sexos. Coloquen en un vaso o plato trozos de fruta madura (cambur, manzana, pia, naranja, etc.) en lugares frecuentados por estas moscas, como jardines, cultivos agrcolas o zonas boscosas. Introduzcan las moscas atradas por las frutas en los frascos de cultivo. Recuerden que los machos son un poco ms pequeos y tiene el abdomen de color negro (Figura 16.1). Las larvas alcanzan el tercer estadio en unos 6 o 7 das a 25 C. Tienen unos 3 mm de largo y tienden a subir por las paredes del frasco. Cmo lo harn? Coloquen una gota de suero fisiolgico o solucin salina en un portaobjetos o vidrio de reloj. Seleccionen del medio de cultivo una larva del tercer estadio, colquenla en el portaobjetos o vidrio de reloj y observen bajo el microscopio estereoscpico. Es importante no dejar secar la larva durante todo el procedimiento. Localicen el extremo anterior (cabeza) de su larva; podrn ver las mandbulas, las cuales se distinguen por su forma y color negro. Las glndulas se pueden visualizar entre el tercer o cuarto segmento.

54

Con una mano coloquen una aguja de diseccin aproximadamente entre el tercer y cuarto segmento de la larva y sostnganla firmemente y con la otra mano coloquen una aguja de diseccin justamente atrs de los ganchos bucales de color negro. Muevan la aguja de diseccin que se encuentra atrs de los ganchos bucales lentamente en direccin opuesta a la otra aguja a manera de estirar la larva; las glndulas de color blanco generalmente se quedan adheridas a la regin mandibular (figura 16.13). Adems , generalmente tienen parte del aparato digestivo delgado unido a ellas. Separen bien las glndulas del resto de la larva y de lo que qued adherido a ellas. Coloquen una gota pequea de colorante (Aceto-orcena o acetocarmn) en el centro de un portaobjetos limpio y transfieran las glndulas a la gota de colorante con ayuda de una aguja. Dejen reposar la preparacin durante aproximadamente diez minutos y observen al microscopio.

Figura 16.13. Extraccin de las glndulas salivares.

Tomen un cubreobjetos por la orilla para evitar dejar huellas en l. Sostengan la otra orilla del cubreobjetos con su aguja de diseccin y suavemente bjenlo sobre la preparacin. Coloquen el portaobjetos entre dos toallas de papel y hagan presin con la goma de un lpiz para aplastar el material, con el fin de extender los cromosomas y eliminar el exceso de colorante. Qu observan? Observen al microscopio con varios aumentos y hagan un dibujo de las estructuras observadas. Comparen lo observado con las preparaciones de otros equipos y con la preparacin ilustrada en la figura 16.13. Cmo pueden interpretar lo observado? Discutan los resultados utilizando como gua las siguientes preguntas: Por qu aplastamos las glndulas salivares? Qu coloracin presentan los cromosomas teidos? Es posible identificar algunas de las estructuras de los cromosomas que se mencionan en la lectura? Qu significado tienen las bandas?

55

Qu diferencia hay entre estos cromosomas y los cromosomas metafsicos que se observan en un cariotipo? Comparen con los cromosomas de Drosophila de la figura 16.5. Investiguen cmo se forman los cromosomas politnicos, qu descubrimientos importantes estn relacionados con los mismos y si existen otros organismos que presentan tambin este tipo de cromosomas. Presenten los resultados de su investigacin ante sus compaeras y compaeros.

La protagonista de esta lectura: la mosquita Drosophila, aqu disfrutando de una naranja.


Fuente: Instituto Valenciano de Investigaciones Agrarias, Espaa.

Actividades de autoevaluacin

Enuncia los postulados de la teora cromosmica de la herencia Qu son los cromosomas? Cul es el papel de la clula, los cromosomas y los genes en los fenmenos de la herencia biolgica? Enuncia dos situaciones donde no se cumplan las predicciones mendelianas para cruces dihbridos, es decir, para cruces donde se consideran dos factores a la vez. Cules factores son responsables en cada caso particular? Qu es la herencia ligada al sexo?
56

Durante sus investigaciones, Morgan cruz hembras de ojos blancos con machos de ojos rojos. En este cruce, la primera generacin no era homognea, lo que contradeca las leyes mendelianas. An ms: la segregacin era 1:1, es decir, el 50% de la descendencia presentaba ojos rojos y el 50 % ojos blancos. A esto se sumaba que todos los individuos de ojos rojos eran hembras y todos los de ojos blancos eran machos. Explica estos resultados utilizando como gua la tabla de la figura 16.4. Morgan tambin cruz moscas de ojos rojos obtenidas de la F1 (heterocigotas) con el macho original de ojos blancos. Qu resultados debi obtener? Si se cruza una hembra de Drosophila de cuerpo amarillo con un macho de cuerpo oscuro (carcter dominante), determina: Genotipo del padre Genotipo de la madre Genotipo y fenotipo de la descendencia Qu importancia tiene determinar la distancia relativa entre los genes de un cromosoma? Qu importancia tiene la elaboracin del cariotipo? Indaga y compara las actividades que realizan en los laboratorios de Gentica Humana de diversas universidades y el Centro Nacional de Gentica Mdica Dr. Jos Gregorio Hernndez (Guarenas, estado Miranda).

Trabajos de gentica humana en Venezuela. Reconoces lo que se ve en la pantalla del equipo?


Fuente: Agencia Venezolana de Noticias.

57

17
En lecturas anteriores hemos visto que la molcula de ADN por lo general produce una copia exacta de s misma. Pero en ocasiones puede ocurrir un error, de modo que ya no es una copia exacta de la molcula original. Este cambio hace que el mensaje gentico sea diferente, de modo que la protena que se sintetiza a partir de esta molcula ser tambien diferente. Se dice entonces que se ha producido una mutacin. Los genes pueden mutar de diferentes maneras, y es as que pueden afectar al organismo mutante de muchas formas, desde su apariencia externa hasta su comportamiento; incluso pueden causarle la muerte. Cuando una mutacin afecta a las clulas sexuales (vulos o espermatozoides) se transmite a la descendencia. Los mutantes no son monstruos ni seres raros con superpoderes, como nos quieren hacer creer algunas pelculas de ciencia ficcin. En realidad, es uno de los mecanismos por los cuales se originan nuevas especies y evoluciona la vida. En esta lectura podrs conocer algunos tipos de mutaciones, en especial aquellas que afectan a los seres humanos. Tambin veremos cmo las investigaciones que conforman el Proyecto Genoma Humano han ayudado a desarrollar nuevas tcnicas, que han permitido identificar la localizacin de genes de enfermedades hereditarias para su estudio, diagnstico y tratamiento.

58

Cuando se altera el mensaje

Cmo ocurren las mutaciones?


La informacin gentica de las distintas especies biolgicas se mantiene relativamente constante en el tiempo, ya que: Tanto las molculas de ADN que contienen esta informacin como los cromosomas donde se encuentran son estructuras bastante estables. Los procesos de divisin celular (mitosis y meiosis) tienen un alto grado de precisin, por lo que generalmente no ocasionan en la informacin cambios o variaciones heredables. Las clulas de los seres vivos tienen mecanismos muy eficientes de reparacin que estn determinados genticamente, lo que les permite detectar oportunamente daos transitorios que pudieran ocurrir en el ADN o en los cromosomas portadores y as restaurar la informacin gentica original, antes de finalizar la divisin celular.

Figura 17.1. En este cuadro de Vincent Van Gogh, pintado en 1888 y titulado: Los Girasoles, se aprecia que algunos girasoles tienen ms ptalos de lo normal. Hoy sabemos que esto se debe a una mutacin en un gen.

Sin embargo, existe una probabilidad, aunque baja, de que ocurran alteraciones en la informacin gentica de una clula. As, pueden surgir cambios estructurales como resultado de errores en la reparacin de daos, la replicacin, la recombinacin gentica, la divisin del centrmero o por rearreglos aleatorios de fragmentos de los cromosomas. Tambin pueden ocurrir modificaciones en la dotacin cromosmica debido a errores en el reparto equitativo de los cromosomas durante la mitosis o la meiosis. Cualquiera de los sucesos antes mencionados ocurre espontneamente, en cualquier momento bajo las condiciones normales de crecimiento, como un evento que ocasiona cambios temporales. Pero, si esos cambios no son reparables (por ser de gran extensin) o la reparacin no es eficiente antes de finalizar el proceso de divisin celular, los cambios que se producen se heredan y se consideran mutaciones. Estas nuevas variedades genotpicas son clulas mutantes, cuya transmisin a las clulas hijas genera lneas mutantes, que son somticas cuando ocurren en las clulas del cuerpo de un organismo, o germinales, si ocurren en las clulas reproductivas. Tales cambios en la informacin gentica pueden llevar a la aparicin de nuevas variedades fenotpicas mutantes dentro de una poblacin. Esos nuevos fenotipos pueden corresponder a caracteres externos o internos, que pueden ser morfolgicos, fisiolgicos o bioqumicos, entre otros.

59

Las mutaciones somticas se trasmiten solo a clulas que vienen de la clula mutante original; nunca pasan a la progenie. Un ejemplo de mutaciones somticas son las clulas que originan el cncer. Las mutaciones germinales, en cambio, pueden pasar a las generaciones futuras. Por ejemplo, aquellas mutaciones ligadas al cromosoma X, como la que da origen a los ojos blancos en la mosca Drosophila melanogaster.
Figura 17.2. Distintos mutantes de Drosophila melanogaster.

Las mutaciones ocurren al azar. Sin embargo, la velocidad de mutacin espontnea puede ser inducida por mutagnesis, esto es, incrementando artificialmente la posibilidad de que ocurran mutaciones mediante la accin de ciertos agentes externos llamados mutgenos. A partir de los trabajos realizados por el cientfico Hermann Joseph Muller, discpulo de Morgan, fue posible demostrar que los rayos X aumentaban la frecuencia de mutaciones en los cromosomas de la mosca Drosophila melanogaster. Posteriormente se ha confirmado que muchos tipos de cncer en los seres humanos pueden ser causados por mutaciones en las clulas somticas inducidas, adems de por los rayos X, por luz ultravioleta y otros tipos de radiaciones. Otros mutgenos pueden ser qumicos, como ciertos colorantes, edulcorantes, metales pesados o drogas como la cocana o el tabaco, biolgicos como los virus, o bien la accin conjunta de la actividad de los genes y los factores ambientales. Sabas que...? Mara Curie, eminente cientfica ganadora de dos Premios Nobel debido a sus investigaciones sobre la radiactividad, muri en 1934 de la leucemia causada por exposicin a las radiaciones. Y, al parecer, el cncer que acab con la vida de Rosalind Franklin, quien particip activamente en formular el modelo explicativo de la estructura del ADN, fue causado por la exposicin a radiaciones cuando realizaba sus estudios de difraccin de rayos X de esta molcula.

60

Algunas mutaciones se producen en un solo gen


Cuando en un gen se produce un cambio al perderse, agregarse o sustituirse una base en la secuencia de los nucletidos del ADN, la informacin que se traduce en la sntesis de la protena correspondiente tambin cambia, ya que el aminocido puede ser distinto al que inicialmente se refera en dicho gen. Las mutaciones puntuales o gnicas se heredan de acuerdo con las leyes de Mendel, ya que se afecta un solo gen. Pongamos un ejemplo con una frase que lleva palabras de tres letras: VAN POR MS SAL CON AJO Si aadimos la letra A entre la tercera y la cuarta palabra, la frase se altera: VAN POR MS ASA LCO NAJ O Esta sera una mutacin por adicin de una base. En el caso de mutacin por prdida, se elimina un nucletido en la secuencia del gen. Si eliminamos la letra S en la tercera palabra, la frase sera. VAN POR MS ALC ONA JO Una mutacin por sustitucin ocurre cuando se cambia un nucletido por otro. Si cambiamos la letra S por una C en la cuarta palabra, tendramos: VAN POR MS CAL CON AJO Como puedes observar, en este ltimo caso la lectura casi se conserva (solo se cambia un aminocido), mientras que en los otros se pierde el sentido de la frase debido a que se corre el marco de lectura (se modifican todos los aminocidos a partir del cambio). Sin embargo, este cambio altera de todas formas el mensaje: sera algo desagradable utilizar cal con ajo en la cocina Las mutaciones gnicas no alteran la apariencia del cromosoma donde se encuentra el gen, pero pueden producir una modificacin en la transcripcin del ARN mensajero y cambiar por tanto la sntesis de protenas y producir una diferente.
61
Figura 17.3. Ejemplo de mutacin por prdida de bases. Si se rompe el enlace entre dos bases nitrogenadas debido a cualquier agente externo (A-B), por lo general una enzima se encarga de reparar el dao (C). Si esto no ocurre, el par se elimina y se corre la secuencia (D); a partir de ese punto, los tripletes codifican para aminocidos diferentes.

La estructura del cdigo gentico minimiza los efectos de la mutacin. Un aminocido puede ser codificado por ms de un codn; frecuentemente los cambios en la tercera base de un codn no causan cambios en el aminocido que este codn especifica. Se dice que tales mutaciones son silenciosas. Sin embargo, la sustitucin de un aminocido por otro puede tener graves consecuencias. Un ejemplo de mutacin por sustitucin de una base es la que origina la anemia falciforme, denominada as porque produce alteracin de la hemoglobina de los glbulos rojos que hacen que estos tomen la forma de una hoz. La molcula de hemoglobina tiene una estructura bsica de cuatro cadenas polipeptdicas, es decir, cuatro largas cadenas de aminocidos, constituidas por dos subunidades denominadas tipo alfa () y dos tipo beta (). La hemoglobina normal se denomina hemoglobina A.

Figura 17.4. La anemia falciforme es causada por una mutacin puntual que altera la estructura de la molcula de hemoglobina.

62

La hemoglobina S se origina por una mutacin puntual en el sexto codn de la cadena tipo , de modo que el aminocido glutamina es sustituido por valina. La anemia se produce en los individuos homocigotos, ya que esta hemoglobina alterada no puede transportar bien el oxgeno a las clulas. Sin embargo, los individuos heterocigotos parecen tener cierta resistencia contra la malaria, pues se estima que la forma alterada de la hemoglobina dificulta la accin del parsito dentro del glbulo rojo. Puede ser as una mutacin a fin de cuentas beneficiosa en medios con alta incidencia de malaria o paludismo. Esta hemoglobina mutante es originaria de frica y se encuentra ampliamente distribuida en el mundo. En Venezuela, se han realizado investigaciones sobre la presencia de la hemoglobina S en nuestra poblacin, y se ha determinado que su distribucin responde a la manera como se establecieron las poblaciones afrodescendientes desde la colonia. Dependiendo del componente de origen africano de la poblacin, la hemoglobina S se encuentra distribuida en el pas en un porcentaje que oscila entre 0% y 7%. Una notable excepcin es la observada en la isla de Toas, en el estado Zulia, cuya poblacin tiene caractersticas fenotpicas caucasoides (eurodescendientes) y presenta una frecuencia del gen para esta hemoglobina de 13%.

Figura 17.5. En Venezuela, de modo general, la mutante hemoglobina S sigue la distribucin de las poblaciones afrodescendientes.

Otras enfermedades hereditarias causadas por cambios en un solo gen son el daltonismo y la hemofilia, las cuales estn ligadas al sexo. El daltonismo debe su nombre al cientfico John Dalton que padeca este trastorno. Es una enfermedad hereditaria que dificulta al que la posee distinguir los colores. Los genes que codifican los pigmentos de los conos verde y rojo de la retina se hallan en el cromosoma X; un cambio en este gen conduce a que no se formen los conos para estos colores. Por tanto, si un varn hereda un cromosoma X con esta deficiencia ser daltnico. En cambio, como las mujeres poseen dos cromosomas X, solo sern daltnicas si sus dos cromosomas X tienen la deficiencia. Se estima que un 8% de varones y menos de un 1% de mujeres tienen cierta dificultad con la visin del color (en su variante ms frecuente, la anomala rojo-verde).
63

El mtodo ms rpido para el diagnstico del daltonismo es el test de Ishihara, que consiste en una serie de lminas con numerosos puntos de los distintos colores primarios dispuestos sobre fondos de colores similares, agrupados de modo que una persona normal puede distinguir en ellos nmeros o formas conocidas (Figura 17.6). Las personas que sufren algn tipo de daltonismo, no son capaces de reconocer los nmeros dentro de dichas figuras, o bien vern otras diferentes en funcin del tipo y grado de la anomala que padezcan.

Figura 17.6. Test Ishihara para detectar si se sufre de daltonismo. Puedes distinguir los nmeros?

La tabla 17.1. Muestra lo que vera una persona normal y una daltnica en la figura 17.6.
Tabla 17.1. Resultados del Test de Ishihara

Visin Normal Lminas Superior Medio Inferior Izquierda 25 45 6 Derecha 29 56 8

Ceguera al rojo y verde Lminas Izquierda Derecha 25 Manchas Superior 56 Medio Manchas Inferior Manchas Manchas

La hemofilia (que significa amor a la sangre) es una enfermedad ligada al sexo de carcter recesivo que se caracteriza porque la sangre no coagula adecuadamente por defecto de la formacin de tromboplastina, una protena sangunea que acta en la formacin de cogulos. Una persona con hemofilia no sangra ms rpido que otra, sino que el sangrado podra durar ms tiempo. Las personas que sufren casos extremos de hemofilia pueden desangrarse hasta morir por causa de una pequea herida. Generalmente, se transmite de un hombre enfermo a travs de una hija sana, para aparecer de nuevo en un nieto. Esta enfermedad es mucho ms rara que el daltonismo, pero ha sido especialmente estudiada porque afecta a gran parte de las familias reales europeas cuyos miembros descienden de la reina Victoria de Inglaterra (1819-1901). La enfermedad apareci en uno de sus hijos y tres de sus nietos. A travs de los matrimonios entre distintos miembros de la realeza, el gen de la hemofilia se extendi entre las familias reales de Europa durante el siglo XIX y comienzos del XX. No se conocan casos de hemofilia entre los antepasados de la reina Victoria y ella era normal, por lo que se supone que la enfermedad apareci por mutacin de uno de sus alelos normales.
64

Aunque se le conoce como enfermedad de la realeza, en realidad la incidencia de esta anomala gentica es de 1 a 2 casos por cada 10.000 varones. En honor a la lucha por apoyar a estos pacientes y de incrementar la conciencia respecto a esta enfermedad, el 17 de abril de cada ao se celebra el Da Mundial de la Hemofilia.

Figura 17.7. Reina Victoria I de Inglaterra.

Sabas que...? Segn la Asociacin Venezolana para la Hemofilia, en el pas hay 3.641 personas diagnosticadas con patologas asociadas a la coagulacin de la sangre, de las cuales el 95% son tratados y atendidos gratuitamente gracias a que en nuestro pas funciona la empresa nacional Quimbiotec, adscrita al Ministerio del Poder Popular para la Salud, que produce el factor que le falta a los pacientes hemoflicos.

Figura 17.8. Control de calidad biolgica de los hemoderivados en Quimbiotec

65

Actividad de resolucin de problemas

Analiza el rbol genealgico de la Reina Victoria (figura 17.8) y contesta las siguientes preguntas: Cuntas mujeres portadoras hay? Cuntos hombres hemoflicos observas? Cuntos descendientes sanos? Qu conclusin puedes establecer?

Figura 17.9. rbol genealgico de la Reina Victoria. Se excluye la rama de la realeza britnica, por ser todos descendientes normales.

66

Otras mutaciones implican a muchos genes, incluso a cromosomas completos


Las mutaciones o aberraciones cromosmicas ya no afectan a un solo gen, sino a varios genes simultneamente y hasta a cromosomas completos. Mientras que las mutaciones gnicas suelen ser cambios de pequea extensin que usualmente se manifiestan aportando un nuevo fenotipo para un solo carcter biolgico, las aberraciones son cambios de mayor extensin y comnmente aportan nuevos fenotipos para ms de un carcter biolgico al mismo tiempo, lo que se conoce como sndromes. Por tanto, un sndrome no se trata de una enfermedad, aunque puede condicionar o favorecer la presencia de cuadros patolgicos (como problemas cardacos, por ejemplo). Existen dos tipos de aberraciones cromosmicas: las originadas por cambios en el nmero normal de cromosomas y aquellas causadas por cambios en la estructura del cromosoma mismo.

Mutaciones por cambios en el nmero de cromosomas


El cambio en el nmero de cromosomas puede darse por adicin o bien por prdida del material cromosmico. Si la mutacin aade o quita un cromosoma pero no ocasiona un cambio en el nmero bsico de cromosomas de la especie, se denomina aneuploida. En la mayora de los casos, la aneuploida ocurre si durante la meiosis una o ms parejas de cromosomas no se separan, lo que se conoce como no disyuncin. La no disyuncin puede suceder con los autosomas o con los cromosomas sexuales. Si ocurre la no disyuncin, los gametos que se forman pueden tener demasiados o muy pocos cromosomas. Si estos gametos se fecundan, la progenie no tendr el nmero correcto de cromosomas en sus clulas. La no disyuncin fue observada por primera vez por Calvin B. Bridges, uno de los colaboradores de Morgan. Como mencionamos en la lectura anterior, si se cruzan machos de Drosophila de ojos rojos con hembras de ojos blancos, se esperara obtener machos de ojos blancos y hembras de ojos rojos (puedes hacer la prueba).

Figura 17.10. No disyuncin en Drosophila.

67

Sin embargo, Bridges encontr que en muy baja proporcin (1 en 1.700) aparecan hembras de ojos blancos y machos de ojos rojos. Cuando analiz la constitucin cromosmica de estos individuos, observ que las hembras de ojos blancos eran XXY y los machos de ojos rojos eran X0, es decir, carecan de cromosoma Y. Bridges explic estos resultados relacionndolos con una no disyuncin del cromosoma X en la meiosis de las hembras, como se muestra en la figura 17.8. Este fenmeno permiti asociar el comportamiento de los cromosomas al de los genes, comprobando con evidencia independiente que los genes estn fsicamente localizados en los cromosomas. En los seres humanos, podemos observar dos tipos de aneuploida que son viables (otros tipos dan lugar a abortos espontneos): las monosomas o prdida de un cromosoma y las trisomas o prdida de tres cromosomas.

Las clulas que han perdido un cromosoma presentan monosoma para ese cromosoma. Casi todas las monosomas autosmicas llevan a la muerte poco despus de la concepcin; sin embargo, la anomala de cromosomas sexuales ms comn es la monosoma del cromosoma X o Sndrome de Turner. La figura 17.11 muestra el cariotipo de una persona con este sndrome. Observa que tiene un solo cromosoma X, lo que significa que posee 45 cromosomas en lugar de los 46 que debera tener. Las personas que presentan este sndrome son hembras estriles (sus rganos reproductores son rudimentarios), de estatura baja y un repliegue membranoso entre el cuello y los hombros. Su incidencia es de 1/5.000 en la poblacin humana.

Figura 17.11. Sndrome de Turner.

El sndrome de Down o trisoma del cromosoma 21, es la anomala autosmica numrica ms comn, y afecta al 0,15% de la poblacin. La figura 17.12 muestra el cariotipo de un varn que posee tres cromosomas 21 en lugar de un par, por lo que tiene en total 47 cromosomas. Los individuos con este sndrome se caracterizan por la presencia de un grado variable de dificultad cognitiva y unos rasgos fsicos peculiares que les dan un aspecto reconocible.
Figura 17.12. Sndrome de Down.

68

El sndrome de Down es la primera causa conocida de dificultad intelectual, representando aproximadamente el 25% de todos los casos. Las personas con sndrome de Down pueden asistir a la escuela sin problemas, si reciben una adecuada atencin desde los primeros meses de vida. Posteriormente, pueden participar en actividades laborales apropiadas y atender por s mismas diversos aspectos de su rutina de vida. El hacer valer sus derechos y el cambio de actitud de la sociedad hacia ellas y ellos est suponiendo actualmente un cambio cualitativo positivo en sus expectativas de vida.

La educacin y la integracin social son un derecho de las personas con diversidad funcional, y llevan a una mejor sociedad.

El sndrome de Klinefelter, por otra parte, es una trisoma de los cromosomas sexuales. Ocurre por la no disyuncin del cromosoma X durante la meiosis, por lo que los individuos con este sndrome son XXY, de sexo masculino. Suelen ser de talla elevada, rasgos feminoides (desarrollo mamario y atrofia de los testculos), a veces ligero retraso en el aprendizaje. Sin embargo, los individuos afectados a menudo llevan vidas normales.

Figura 17.13. Sndrome de Klinefelter.

69

El otro tipo de cambio en el nmero de cromosomas es la euploida, que es cuando se altera el nmero bsico de la especie. Puede ser de dos subtipos: monoploida, significa que el organismo solo tiene un nico cromosoma de cada tipo y es el caso de los organismos haploides como las bacterias; y poliploida, cuando un individuo posee ms de un juego de cromosomas. En seres humanos, puede darse una condicin, en la cual hay una copia extra de todos los cromosomas (69 en total); los individuos con esta condicin pueden ocasionalmente sobrevivir hasta el nacimiento, aunque normalmente mueren antes. Por el contrario, la poliploida es muy frecuente en las plantas y constituye un rpido mecanismo para originar una nueva especie, ya que la produccin de individuos por multiplicacin del nmero de cromosomas da origen a nuevos y variados fenotipos.

Figura 17.14. Los claveles silvestres se han diversificado en los ltimos dos millones de aos gracias a la poliploida: han evolucionado progresivamente desde tener 30 cromosomas hasta llegar a 180.
Fuente: Rameshng, Wikimedia Commons.

Mutaciones por cambios en la estructura de los cromosomas


Las anomalas estructurales implican cambios en la estructura de uno o varios cromosomas. A continuacin describiremos los tres tipos ms comunes. Las deleciones implican la prdida de material de un solo cromosoma. Habitualmente los efectos son graves, puesto que hay prdida de material gentico. La figura 17.16 muestra un ideograma donde se observa una delecin en el cromosoma 16.

Figura 17.15. Delecin en el cromosoma 16 humano.

70

Las inversiones tienen lugar cuando se dan dos cortes dentro de un mismo cromosoma y el segmento intermedio gira 180 (se invierte) y se vuelve a unir, formando un cromosoma que estructuralmente tiene la secuencia cambiada.

Figura 17.16. Inversin en el cromosoma 10 humano.

Las translocaciones implican el desplazamiento de un segmento de un cromosoma a un nuevo lugar en otro cromosoma. El intercambio de segmentos entre dos cromosomas no homlogos es una translocacin recproca, como la que puedes ver en la figura 17.17 entre los cromosomas 4 y 20.

Figura 17.17. Translocacin recproca entre los cromosomas 4 y 20 humanos.

71

El sndrome de Down tambin puede ocurrir cuando hay una translocacin del cromosoma 21 (o un fragmento del mismo) a uno de los cromosomas del par 14. Aunque el nmero de cromosomas es normal, para efectos de informacin gentica existe un cromosoma 21 extra, por lo que se desarrolla el sndrome.

Figura 17.18. Translocacin del brazo largo del cromosoma 21 en uno de los dos cromosomas del par 14. Este es un cariotipo idealizado (que muestra la situacin para hombre o mujer), por eso se muestran a la vez los cromosomas XX y XY.

Las anomalas cromosmicas, tanto las numricas como las estructurales, se pueden dividir a su vez en dos categoras principales: constitutivas, aquellas con las que se nace, y adquiridas, las que surgen como cambios secundarios a otras enfermedades, tales como el cncer.
72

El Proyecto Genoma Humano ha descubierto otros mecanismos genticos


El genoma de una especie define la totalidad de la informacin gentica que posee esa especie. Por lo general, al hablar de genoma en los organismos eucariotas nos referimos slo al ADN contenido en el ncleo, organizado en cromosomas. En 1988 se lanz el Proyecto Genoma Humano, un esfuerzo internacional que se complet en 2004, como una gran tarea en la que participaron centros y laboratorios distribuidos por todo el mundo. Hemos estudiado hasta ahora las mutaciones causadas por cambios en un solo gen, y las originadas por alteraciones en el nmero o la estructura de los cromosomas. La informacin proporcionada por el Proyecto Genoma Humano ha permitido descubrir otros trastornos genticos que no encajan en estas categoras, pero que es importante que conozcas. Uno de estos mecanismos es la impronta gnica, que es la expresin diferencial de un gen de acuerdo con su origen parental. Por ejemplo, los sntomas de la enfermedad de Huntington se presentan durante la adolescencia si la herencia es paterna, pero no lo hacen hasta la madurez cuando la procedencia es materna.

Figura 17.19. Secuencia de ADN obtenida con una mquina secuenciadora en el Proyecto Genoma Humano. Se usan sustancias fluorescentes para detectar las bases A, T, G y C.
Foto: Museo de Ciencias, Reino Unido.

Sabas que...? El promedio en el mundo de pacientes con este mal es de uno por cada 10 mil habitantes. Sin embargo, en la isla de San Luis del estado Zulia, la incidencia se establece en uno por cada 1.000 habitantes. Se cree que durante la colonia un marino mercante con esta enfermedad dej descendencia en el sector, y debido a las condiciones de relativo aislamiento y al carcter dominante de la enfermedad, esta se extendi.

La enfermedad de Huntington, conocida popularmente como el Baile de San Vito, o Corea de Huntington es otra enfermedad autosmica hereditaria, que se hereda como carcter dominante. Se caracteriza bsicamente por el trastorno del movimiento -coreas- y la prdida sustancial de la memoria, debido a la destruccin progresiva de unas regiones especficas del cerebro llamadas ganglios o ncleos basales.

73

La enfermedad de Huntington es causada por la mutacin de un gen localizado en el cromosoma 4, que codifica una protena llamada Huntingtina (Htt). La protena normal posee un segmento que tiene entre 8 y 35 molculas del aminocido glutamina, codificadas por un segmento del gen que posee el triplete CAG repetido. La mutacin no es puntual; consiste en que las repeticiones de este triplete aumentan por encima de 35 (que se considera el umbral de la enfermedad), llegando incluso hasta ms de 50 repeticiones. Esta forma alterada de la protena Htt produce la muerte de las neuronas en algunas partes del cerebro. A veces se encuentran personas que tienen tanto lneas celulares normales como anormales. A estos individuos se los denomina mosaicos y a esta condicin, mosaicismo. En la inmensa mayora de los casos la lnea celular anormal tiene una anomala cromosmica numrica. Los mosaicos debido a anomalas estructurales de los cromosomas son muy poco frecuentes.

Figura 17.20. Mosaicismo en el pelaje de una gata. El gen que expresa el color del pelaje se encuentra en el cromosoma X.

Otro grupo de enfermedades genticas corresponde a mutaciones que tienen lugar en clulas somticas diferenciadas con particular importancia en el desarrollo de cnceres. Aunque no se heredan, pueden originarse en individuos con predisposicin hereditaria. Por ejemplo, las mutaciones heredadas de los genes BRCA1 y BRCA2 aumentan el riesgo de padecer cncer de mama.

Figura 17.21. Cuando el ADN de una clula se daa, por lo general se activa un factor o seal de terminacin que hace que se autodestruya. Si debido a una mutacin esta seal se inactiva, la clula se multiplica indefinidamente, originndose lo que conocemos como cncer.

74

Las clulas se transforman en cancerosas cuando, mediante acumulaciones de errores en su ADN, adquieren capacidades que permiten que sean seleccionadas por el entorno que las rodea. Algunas de estas capacidades son: Multiplicarse aun en ausencia de seales de crecimiento, e inclusive en presencia de seales que indiquen terminacin. Cuando esto ocurre, comienza la formacin de una neoplasia (o nuevo crecimiento, en el sentido literal). Estimular el crecimiento de vasos sanguneos alrededor de ellas. Crecer indefinidamente, al no responder a seales de terminacin. Invadir otros tejidos ya que poseen la capacidad de infiltrarse en el torrente sanguneo, viajar a travs de l para colonizar otros tejidos y formar nuevos focos de crecimiento (metstasis). Cuando esto ocurre, las clulas son malignas. Pero si no tuvieran la capacidad de invadir sitios distantes y provocar metstasis, se consideran benignas. Los diferentes tipos de cncer estn incluidos, junto a la diabetes y las enfermedades cardiovasculares, en un grupo de enfermedades para las cuales se han identificado genes asociados con la susceptibilidad o predisposicin a padecerlas. An no se sabe a ciencia cierta qu es lo que hace que estos genes se activen para que la enfermedad se desarrolle, o por el contrario nunca lo hagan.

Figura 17.22. Ciertas mutaciones pueden llevar a las clulas a transformarse en cancerosas.

75

El estudio de las mutaciones puede ayudarnos a mejorar nuestra calidad de vida


Hemos visto que muchas mutaciones son perjudiciales y pueden resultar letales o disminuir la calidad de vida al organismo que la presenta o a su descendencia. Pero tambin existe otro tipo de mutaciones (como la que origina el color de los ojos) que no reportan beneficios ni perjuicios al individuo que las posee, e incluso otras que pueden resultar beneficiosas, de modo que pueden llegar a reemplazar al fenotipo normal debido a la seleccin natural. Es por esto que las mutaciones son la principal fuente de variabilidad gentica y sin ellas no habra evolucin de las especies. Existen diversos mtodos artificiales que permiten obtener nuevas variedades genotpicas mutantes, en forma aleatoria o bien dirigida hacia genes de inters particular, con fines de investigacin cientfica y con aplicacin en la Biotecnologa. Por ejemplo, el maz con que se hace la arepa de tu desayuno es el producto de una seleccin intencional de diferentes mutantes que han surgido al azar, pero que durante milenios fueron escogidos y cultivados por los pueblos originarios de Amrica hasta lograr mazorcas grandes y con granos mayores y ms nutritivos.

Figura 17.23. El maz que comemos hoy es el resultado de miles de aos de seleccin humana de mutantes favorables.

Pero hoy da tambin puede dirigirse la seleccin a provocar mutaciones con fines determinados, incorporando genes de otro organismo (alimentos transgnicos). Esta posibilidad ha causado gran preocupacin, ya que puede causar impactos ambientales, cambios culturales y dependencia econmica (ya que estos organismos estaran patentados). Por eso es importante informarse y sopesar los pros y los contras de esta tecnologa. En el caso de mutaciones que dan origen a enfermedades genticas, actualmente se estn llevando a cabo investigaciones que cada vez nos arrojan ms luz para su comprensin y posible tratamiento. Los conocimientos generados a partir del genoma humano permitiran desarrollar tcnicas de diagnstico temprano para diferentes enfermedades, as como la prediccin de posibles sndromes relacionados con predisposiciones genticas. Esto provee una herramienta eficaz para la cura o el tratamiento dirigido especficamente a la causa de la enfermedad. Sin embargo, existe la preocupacin de que la informacin generada podra ser usada para la discriminacin de seres humanos por tener en sus genes predisposicin a alguna enfermedad. El aspecto tico es solo uno entre muchos otros que trae aparejado el Proyecto Genoma Humano.
76

En nuestro pas, la no discriminacin y la igualdad para todas y todos es un principio constitucional, pero no puede quedarse solo en el papel. Se ha comprobado que el tratar con equidad a personas con sndrome de Down, por ejemplo, les da no solo una mejor calidad de vida, sino que mejoran muchos de sus sntomas. Si bien sera muy bueno lograr algn da prevenir las enfermedades genticas, tambin lo es el respetar y tratar a las personas con estos padecimientos como seres humanos, iguales a ti.

Figura 17.24. Ser diferente no es un problema, el problema es ser tratado diferente.

Analizando cariotipos
Imagnate que trabajas en el Centro Nacional de Gentica Mdica Dr. Jos Gregorio Hernndez. Tu trabajo consiste en elaborar e interpretar cariotipos de personas que acuden a ti en busca de asesoramiento. En esta actividad, construiremos y analizaremos los cariotipos tres personas, las cuales esperan tus conclusiones. Pueden dividirse en equipos para repartirse los cariotipos y comparar sus resultados. Qu necesitan? Fotocopiadora, papel blanco, cartulina blanca, tijeras, lpiz, regla, pega en barra.
77

Cmo lo harn? Fotocopien el grupo de cromosomas que se encuentra en cada caso. Si es posible, pueden ampliarlo. Recorten cada cromosoma y agrpenlos de acuerdo con su tamao y forma. Identifiquen cada pareja de homlogos con ayuda del cariotipo ordenado de la figura 17.25.

Figura 17.25. Cariotipo de un hombre normal.

Dibuja en una cartulina blanca una plantilla vaca como la de la figura 17.26. Pega cada pareja en la plantilla para armar el cariotipo. Usa el centrmero como gua y colcalo sobre la lnea, con el brazo corto hacia arriba.

Figura 17.26. Plantilla para realizar los cariotipos.

78

Caso A. Se trata de un feto casi completamente desarrollado de una mujer de cuarenta aos. Los cromosomas fueron obtenidos de las clulas epiteliales.

Caso B. Es un hombre de 28 aos que est tratando de identificar la causa de su infertilidad.

Figura 17.27. Caso A.

Figura 17.28. Caso B.

Figura 17.29. Caso C.

Caso C. Es una adolescente de 13 aos cuya madre est preocupada porque aun no se ha desarrollado, por lo que es ms baja y tiene un aspecto ms infantil que sus compaeras de clase, lo que hace que se sienta diferente.

79

Cmo lo pueden interpretar? Analicen cada cariotipo y realicen un diagnstico en cada caso. Cul es el sexo del Caso A? Investiguen si existe una relacin entre la edad de la madre del Caso A y la anomala que diagnosticaron. Investiguen en otras fuentes acerca de uno de los sndromes diagnosticados y preparen un informe para la clase. Discutan entre ustedes qu consejo le daran a cada paciente.

Actividades de autoevaluacin

Elabora un cuadro con los tipos de mutaciones. Enuncia cuatro factores que aumentan la frecuencia de mutaciones espontneas. Tienen las mismas consecuencias las mutaciones que se producen en las clulas somticas que las que se producen en las clulas germinales? En las clnicas radiolgicas existen carteles que indican a las mujeres embarazadas o a las que creen estarlo, que antes de someterse a una exploracin radiolgica deben consultar a su mdico. Por qu? La secuencia de ADN que se muestra a continuacin pertenece al gen que tiene la informacin para fabricar un fragmento de la hemoglobina normal: GTGCACCTGACTCCTGAGGAG Utilizando la tabla del cdigo gentico (figura 17.30) escribe la secuencia de aminocidos que se sintetiza a partir de la hebra inferior del ADN. Transcribe la cadena correspondiente de ARNm. Escribe la secuencia de aminocidos correspondiente.

80

Figura 17.30. Cdigo gentico.

El fragmento de protena que figura a continuacin pertenece a la hemoglobina falciforme. Compara esta secuencia con la anterior e identifica el nucletido que sufri la mutacin responsable de la anemia falciforme: Val-His-Leu-Thr-Pro-Val-Glu Cul es el codn de ARNm alterado? Cul o cules bases cambiaron?

81

18
Terminado el primer tiempo de un juego de ftbol, entre la vinotinto y otro equipo, notas algn cambio en los jugadores con respecto al comienzo? El caminar, correr, ejercitarse ha generado en ellos una serie de manifestaciones (sudoracin, agotamiento) que evidencian que estamos en presencia de reacciones qumicas ocurridas en el organismo o reacciones a nivel biolgico. La qumica nos rodea, est dentro y fuera de nuestro organismo. Son muchos y variados los procesos qumicos que ocurren a nuestro alrededor, oxidacin de metales, quema de papel, eliminacin del sedimento en el sanitario o de la acidez estomacal, entre otros. Cmo podemos hablar acerca de ellos? Comunicarse es sensacional, para ello necesitamos conocer los trminos bsicos del tema que conversamos, la simbologa y las representaciones de los mismos. Lo dudas? Si ests disfrutando de uno de los partidos eliminatorios de ftbol de la Vinotinto y tu equipo anota un gol, cmo expresas lo ocurrido? Dices por ejemplo, que el jugador venezolano se acerc, a cierta distancia del arco logr ingresar el baln sin que el portero contrario pudiera evitarlo o exclamas Goool! As como el trmino gol, engloba un significado y una serie de pasos que conducen a la anotacin de un punto en el ftbol, cuando hablamos de reacciones qumicas, hacemos uso de unas ecuaciones que engloban informacin acerca de los procesos y transformaciones producidos en ellas. En esta lectura, podrs leer sobre las ecuaciones qumicas y cmo ellas facilitan la comprensin de los procesos ocurridos en las reacciones qumicas y la comunicacin.

Las reacciones son acontecimientos inusuales o cotidianos?


82

Describe las reacciones qumicas con smbolos y evidencias


Las Ciencias Naturales emplean representaciones que se han acordado universalmente y cuyos smbolos son independientes del idioma; ejemplo de ello son las ecuaciones matemticas y las frmulas qumicas, representadas mediante smbolos, letras y nmeros. En matemtica simbolizas las sumas de manera horizontal separando los sumandos mediante el smbolo de adicin + y previo al resultado escribes un smbolo de igualdad que se expresa como =, tambin pueden estar expresadas en forma vertical. Cuatrocientos diecisiete + ciento ochenta y tres = seiscientos 417 + 183 600 417 m + 183 m = 600 m 417m2 + 183 m2 = 600m2

Figura 18.1. Escritura de nmeros y ecuaciones matemticas.

En qumica, cuando dos o ms sustancias interaccionan entre s (reactivos) a travs de reacciones qumicas, obtenemos al cabo de cierto tiempo, una o ms sustancias, que llamamos productos. Este proceso lo podemos representar de manera parecida a la suma matemtica, es decir, expresamos los reactivos con sus smbolos, separados entre s con el smbolo +, luego colocamos una flecha ( ) dirigida hacia los productos, los cuales, representamos con sus smbolos tambin separados con el smbolo +. Observa la reaccin qumica ocurrida en la fotosntesis de la figura 18.2. Esta representacin organizada de las reacciones qumicas lo denominamos ecuacin qumica.

dixido de carbono + agua

glucosa + oxgeno

Figura 18.2. (a) Fotosntesis. (b) Ecuacin de la reaccin qumica ocurrida en la fotosntesis.

83

As como interpretas a diario las seales de trnsito (cruzando por el rayado, disminuyendo la velocidad cuando la luz del semforo cambia al color amarillo, ), las ecuaciones qumicas tienen significado, por lo tanto, ellas aportan informacin acerca de los reactivos, las condiciones de reaccin y los productos.

Figura 18.3. (a) Cruce en el rayado. (b) Interpretacin de smbolos viales.

Cuando las reacciones qumicas se llevan a cabo, producen una serie de hechos visibles que permiten identificar, inferir o descartar reactivos o productos segn su comportamiento. Los cambios de color u olor, aumento o disminucin de la temperatura, liberacin de energa en forma de luz, formacin de un precipitado o liberacin de un gas (fragancia, fetidez o inodoro) son las evidencias ms comunes cuando estamos en presencia de una reaccin qumica. Todas aquellas evidencias relacionadas con las cualidades y naturaleza de elementos y compuestos sern consideradas cualitativas, mientras que aquellas que podemos o decidimos medir sern calificadas como cuantitativas. A continuacin vers la ecuacin qumica de una reaccin muy comn, la formacin del agua (H2O), a partir del oxgeno (O2) y del hidrgeno (H2) (Figura 18.4). En ella observars algunos de los smbolos ms comunes que la acompaan: el estado fsico de las sustancias, gaseoso (g), las condiciones de reaccin, la relacin entre las sustancias, los coeficientes estequiomtricos y los subndices que indican el nmero de tomos que conforman el compuesto. Estos smbolos son de gran utilidad ya que aportan informacin de inters. Vamos a conocer el significado de cada uno. Hidrgeno (gaseoso) + oxgeno (gaseoso) agua (gaseosa)

Figura 18.4. Elementos que conforman las ecuaciones qumicas.

84

Como viste antes y ahora en la figura 18.5, los elementos o compuestos que reaccionan se escriben del lado izquierdo de la flecha horizontal, denominados reactivos o reactantes, separados con signo positivo, +. Tambin podemos expresar las condiciones de temperatura, presin o proceso a travs del cual se produce la reaccin, stas se indican sobre o debajo de la flecha. Por ltimo, los productos se escriben del lado derecho tambin separados con el signo positivo, +. clorobenceno + hidrxido de sodio diluido en agua fenol

Figura 18.5. Reactivos, condiciones y productos en las ecuaciones qumicas.

Sabas que...? Cuando un vehculo colisiona de manera violenta, la bolsa de aire se expande con nitrgeno liberado como producto de la reaccin de descomposicin de la azida (NaN3). Unos 10g de este compuesto pueden generar 5L de nitrgeno gaseoso.

85

Adems de considerar los reactivos y productos, se emplean otros smbolos que aportan informacin: si se produce liberacin de un gas, indicado con una flecha apuntando hacia arriba ( ), o si se forman slidos con una flecha apuntando hacia abajo ( ). En la tabla 18.1 presentamos un resumen de los smbolos ms utilizados en las ecuaciones. Reactivos (s) (l) Slido. Lquido. Condiciones Produce o genera. Debe suministrarse energa. Debe suministrarse electricidad. Usar un catalizador. (s) (l) Productos Slido. Lquido.

, M

(g)

Gaseoso.

(g)

Gaseoso.

(ac) (aq) (conc)

Acuoso.

(ac) (aq)

Acuoso.

Concentrado.

273K 500psi

T P

Temperatura requerida. Presin requerida. Pasos a seguir en la sntesis. +

(dil) +

Diluido. Reacciona con

Formacin de precipitado. Liberacin de un gas. ms, y

1. T:340C, 170 atm 2. H3O

Tabla 18.1. Smbolos utilizados en las ecuaciones qumicas.

Vamos leer la siguiente expresin simblica de una reaccin qumica: sodio + nitrato de potasio xido de potasio + xido de sodio + nitrgeno

El sodio slido Na(s) reacciona con nitrato de potasio slido KNO3(s) cuando se suministra energa (), generando xido de potasio K2O(s) y xido de sodio Na2O(s), ambos en estado slido con liberacin de un gas, nitrgeno N2(g). El sodio (Na) es muy reactivo en medios acuosos y su manipulacin resulta peligrosa si no se toman las precauciones necesarias.

86

Lograr familiarizarse, comprender e interpretar los smbolos presentes en las ecuaciones qumicas, nos permitir describir y entender eventos cotidianos que nos rodean como la neutralizacin de la acidez estomacal, la corrosin del hierro, la oxidacin de cadenas, esclavas y anillos de plata, entre otros. La informacin cualitativa y cuantitativa contenida en las ecuaciones qumicas te permitir reconocer particularidades de los elementos que conforman los grupos de la tabla peridica. Por ejemplo, los elementos metlicos conocidos como alcalinos reaccionan con oxgeno para formar xidos bsicos. Para extraer mayor informacin de las ecuaciones, debes evocar conocimientos de lecturas previas, tal que sepas diferenciar: La simbologa empleada en las ecuaciones qumicas. Los estados de la materia (slido, lquido, gaseoso). Los elementos (metales, no metales o metaloides). El nmero de tomos en cada sustancia. Los tipos de reacciones qumicas. Sabas que...? Las Ciencias Naturales tienen una estrecha relacin con la administracin de justicia. Diversas pruebas de qumica forense son empleadas para corroborar o no las evidencias encontradas. Por ejemplo, obtener la huella gentica, rastros de incendios, identificacin de elementos de explosivos y de balas en las personas, pruebas toxicolgicas.

Agrupando las reacciones qumicas


Cotidianamente agrupamos alimentos, objetos, materiales e incluso a los seres humanos de acuerdo a criterios de clasificacin previamente definidos. Cul criterio de clasificacin usas cuando te agrupas para realizar actividades deportivas o recreativas? Cmo agrupas la informacin en la computadora? Los criterios ms comunes son la edad, el sexo, la cantidad, el tipo de elemento. El criterio usado para agrupar las reacciones qumicas, clasificarlas y as facilitar su estudio es su reactividad, es decir, la manera como interaccionan el o los reactivos para generar el o los productos, considerando la naturaleza y la cantidad de los elementos o compuestos que constituyen los reactivos y los productos.
87

Un elemento o compuesto ser capaz de combinarse, separarse, desplazar a otro elemento o intercambiarse? Los tipos de reacciones fueron descritas en el libro de Ciencias Naturales de segundo ao; a continuacin vers un resumen de la clasificacin ms general de las reacciones qumicas (Tablas 18.2 y 18.3).

Tipo de reaccin Caractersticas Ecuacin general Reacciones

Combinacin o sntesis Unin de dos reactivos para formar un producto nico.

Descomposicin o anlisis Separacin de un reactivo en dos o ms productos.

Ejemplo

xidos bsicos, Anhdridos u xidos cidos, Hidruros, Hidrcidos, Hidrxidos, cidos oxcidos. Oxidacin de metales.

Algunos xidos bsicos, nitratos y cloratos alcalinos Fermentacin de los hidratos de carbono.

Tabla 18.2. Descripcin general y ejemplificacin de las reacciones de combinacin y descomposicin.

Tipo de reaccin Caractersticas

Combinacin o sntesis Un elemento reemplaza a otro en un compuesto binario o ternario. Dos reactivos y dos productos.

Descomposicin o anlisis La ubicacin de los elementos metlicos es diferente en reactivos y productos. Dos reactivos y dos productos.

Ecuacin general C puede ser un radical, Ej. PO4-3 Reacciones Ejemplo Sales binarias y ternarias a partir de un metal y un cido. Limpieza de accesorios de plata con papel aluminio. A y C pueden ser elementos metlicos. Sales binarias y ternarias a partir de una base y un cido. Eliminacin de la acidez estomacal. Eliminacin del sarro en el sanitario.

Tabla 18.3. Descripcin general y ejemplificacin de las reacciones de desplazamiento y doble descomposicin.

88

A continuacin encontrars la descripcin de tres ejemplos mencionados en cada tipo de reaccin qumica: 1. Oxidacin de hierro a travs de una reaccin de combinacin. Se forma un xido metlico debido a la combinacin del hierro con el oxgeno gaseoso del aire en presencia de calor. hierro + oxgeno xido frrico

Figura 18.6. (a) Ecuacin de formacin del xido frrico. (b) Vehculo oxidado

2. Fermentacin de los hidratos de carbono a travs de una reaccin de descomposicin. Se descompone el hidrato de carbono mediante el uso de un catalizador (levadura) para formar etanol y dixido de carbono y generar calor. El dixido de carbono es el responsable del crecimiento del pan dentro del horno al expandir la masa. Hidrato de carbono etanol + dixido de carbono + calor

Figura 18.7 (a) Ecuacin de fermentacin hidratos de carbono al elaborar pan. (b) Pan horneado.

3. Neutralizacin del exceso de cido clorhdrico en los jugos gstricos del estmago a travs de una reaccin de doble descomposicin con un anticido, el hidrxido de magnesio. Se forma una sal binaria (MgCl2) debido al desplazamiento del hidrgeno en el cido clorhdrico provocada por el magnesio presente en el anticido.
cido clorhdrico + hidrxido de magnesio cloruro de magnesio + agua

Figura 18.8. (a) Neutralizacin de la acidez estomacal con Mg(OH)2. (b) Ecuacin de la reaccin de neutralizacin de la acidez estomacal.

89

Tericamente puedes escribir ecuaciones que no se llevan a cabo o que son tan lentas que parecieran no ocurrir. Las propiedades y la reactividad de cada elemento determinarn su capacidad de combinarse, descomponerse, desplazar a otro elemento o intercambiar los elementos constituyentes. Algunos experimentarn un tipo de reaccin, otros dos o ms. Conocer las propiedades de los elementos y el por qu de su ubicacin en la tabla peridica te permitir indagar acerca del tipo de reacciones que experimenta dicho elemento o compuesto. Observa las imgenes siguientes Notaste los cambios de coloracin debidos a la reaccin producida? En el primer caso se produjo una reaccin de combinacin y en el segundo una reaccin de desplazamiento, ambas con la aparicin de un color y con un reactivo en comn, el hierro slido. Aunque el cambio de coloracin no se simboliza en la ecuacin, extraeremos el resto de la informacin contenida en la ecuacin qumica de formacin del xido bsico (Tabla 18.4).

hierro + oxgeno

xido frrico

hierro + cido clorhdrico

cloruro ferroso + hidrgeno

Figura 18.9. Reacciones de combinacin y desplazamiento experimentadas por el hierro.

4 Fe (s) + 3 O2 (g)

2 Fe2O3 (s)

Informacin cualitativa Reactivos: hierro y oxgeno. Producto: xido frrico. El smbolo del xido frrico es Fe2O3. El smbolo del hierro es Fe y del oxgeno molecular es O2. El hierro es un elemento metlico, el oxgeno El xido frrico es un compuesto formado por es un no metal. hierro y oxgeno. (xido bsico) El estado del hierro es slido, mientras que el El xido frrico generado lo hace en forma oxgeno es gaseoso. slida. El hierro reacciona con el oxgeno. El producto est constituido por los elementos reaccionantes. Tipo de reaccin: Combinacin Es innecesario utilizar agentes externos que No hubo desprendimiento de gas. favorezcan las condiciones de reaccin. Informacin cuantitativa Disponemos de 2 reactivos. Obtenemos un 1 producto. La molcula de oxgeno est constituida por 2 Una molcula de xido frrico est compuesta tomos de oxgeno. por 2 tomos de hierro y 3 de oxgeno.
Tabla 18.4. Prototipo de la informacin que logrars extraer de las ecuaciones qumicas.

90

Concluimos que, lo cualitativo hace referencia a la identidad de la sustancia y lo cuantitativo, a las proporciones y cantidades. Respecto de esto ltimo podemos agregar ms informacin. Como estudiaste en lecturas previas, la masa molar atmica es un valor conocido y contenido en la tabla peridica. La masa molar atmica del hierro (Fe) es 56 g mientras que el oxgeno tiene una masa molar atmica (O) de 16 g y una masa molar molecular (O2) de 32 g. Cuatro tomos de hierro correspondern a 224 g (4 x 56g), mientras que las tres molculas de oxgeno (O2) correspondern a 96 g (3 x 32g). Su combinacin generar 320 g de producto (Fe2O3) correspondientes a dos molculas de xido frrico, 112 g de hierro (2x56g) y 48 g de oxgeno (3x16g). (Tabla 18.5) 4 Fe (s) + 3 O2 (g) 2 Fe2O3 (s)

Ms informacin cuantitativa 224 g de hierro se combinaron con 96 g de Se produjeron 320 g de xido frrico. oxgeno. 320 g de reactivo gener a travs de una reaccin completa 320 g de producto, xido frrico.
Tabla 18.5. Ms informacin cuantitativa sobre la reaccin qumica de la tabla 17.4.

Hay reacciones qumicas que parecen un evento de magia


La materia est en constante transformacin. Evidencias de ello las encontramos en los ciclos del carbono, nitrgeno, azufre, fsforo y oxgeno. Analicemos brevemente lo que ocurre en uno de estos ciclos, el del nitrgeno. La figura 18.10 ilustra cmo un elemento o compuesto se transforma en otro, una o varias veces, interactuando o acumulndose en las diferentes esferas de nuestro planeta, debido a reacciones qumicas. Y adems de formarse ms de un compuesto a partir del nitrgeno, ste vuelve a regenerarse al final del ciclo. La ilustracin refiere como el nitrgeno (N2) est presente en la naturaleza combinado con otros elementos, hidrgeno y oxgeno (NH3, NO2, NO3) y en dos esferas de la Tierra (gesfera y atmsfera). Se aprecia que el amoniaco produce compuestos formados por oxgeno pero con diferente nmero de tomos.
Figura 18.10. Reacciones qumicas en el ciclo del Nitrgeno. Las heces de un ser vivo contienen el elemento nitrgeno (N) que es transformado en nitratos (NO3) y nitritos (NO2), adems de ser desnitrificados son aprovechados por las plantas para su desarrollo. El nitrgeno depuesto como NH3 es liberado posteriormente a la atmsfera como N2 gaseoso.

91

As como en las recetas de cocina, se han establecido las proporciones adecuadas para los diferentes ingredientes, en la naturaleza existen cantidades fijas de elementos para formar cada compuesto. Cada compuesto formado obedece la ley de las proporciones definidas, la cual establece que: Cuando dos o ms elementos se unen mediante reaccin qumica para formar un nuevo compuesto, lo hacen en proporciones fijas de peso, es decir, la composicin de cada compuesto es constante. Vivimos en un planeta con ciclos que involucran la transformacin de muchos compuestos para su reaprovechamiento, de manera tal que vuelven a transformarse y as, la naturaleza garantiza la conservacin de la materia. Esto ocurre mediante etapas sucesivas e imperceptibles; pues aquellas reacciones que liberen y formen gases transparentes e inodoros pasan desapercibidos en nuestro da a da. Algunas veces podemos percibir el olor de alguno (fuga de gas domstico), sin embargo, sigue siendo invisible al resto de nuestros sentidos. En las tablas 18.6 y 18.7 se presentan valores representativos que permiten ejemplificar la relacin entre masas de los elementos que constituyen una sustancia, el nitrato (NO3). Para diferentes valores en masa de los componentes, la relacin entre ellas ser constante. Esta proporcin cambia de acuerdo a la sustancia formada.

Masa, m (g) Masa de O Masa de N Masa de N Masa de O

Nitrgeno (N)

Oxgeno (O)

Masa de nitrato (NO3) (g) (c)

24

24/7

7/24

31

14

48

24/7

7/24

62

28

96

24/7

7/24

124

Tabla 18.6. Relacin entre masas de los elementos que conforman el nitrato (NO3).

92

Analicemos la informacin contenida en la tabla 18.6. El nitrato (NO3) est constituido por un tomo de nitrgeno y tres de oxgeno. Para obtener una masa de 62 g de producto (NO3), tendremos 14 g de nitrgeno y 48 g de oxgeno. Estos 14 g corresponden a la masa molar atmica del nitrgeno (1 x 14g) mientras que 48 g corresponden a tres veces la masa molar atmica del oxgeno (3 x 16g). La relacin entre estos valores de masa, en gramos, arroja un valor constante de 24/7 7/24 segn que la relacin determinada, sea (m de O) / (m de N) o (m de N) / (m de O). En la obtencin de 31 g de producto (NO3) requerimos una masa de nitrgeno igual a 7 g, correspondientes a la mitad de la masa molar atmica del nitrgeno (1/2 x 14g) y una masa de oxgeno igual a 24 g, correspondientes a tres medios de la masa molar atmica del oxgeno (3/2 x 16g). Nuevamente obtenemos una proporcin de 24/7 7/24 segn la relacin que consideremos. Por lo tanto, independientemente del incremento o disminucin deseada en la cantidad de producto (doble, triple o fraccin), el valor resultante de la relacin de masas permanecer invariable. Masa, m (g) Masa de O Masa de N Masa de N Masa de O Masa de nitrito (NO2) (g) (c) 16/7 16/7 16/7 7/16 7/16 7/16 23 46 92

Nitrgeno (N) 7 14 28

Oxgeno (O) 16 32 64

Tabla 18.7. Relacin entre masas de los elementos que conforman el nitrito (NO2).

Veamos otro ejemplo (Tabla 18.7). El nitrito (NO2) est constituido por un tomo de nitrgeno y dos de oxgeno, y la proporcin entre las masas de estos dos componentes tiene que ser de 16/7 o 7/16 segn la relacin considerada. Al igual que en caso anterior, independientemente de la masa en gramos de nitrgeno o de oxgeno, la relacin de masas de los elementos constituyentes se mantiene constante para una determinada sustancia. Como el nitrito posee un tomo de oxgeno menos que el nitrato, la relacin entre las masas de los componentes es diferente; este valor vara de acuerdo a la sustancia. Esta relacin determina la proporcin fija de masa en la cual se combinan los elementos para formar un determinado compuesto, lo cual, como dijimos corresponde a la ley de proporciones definidas, planteada por el qumico frances Joseph-Louis Proust, en 1799, la cual tard en ser aceptada por otros cientficos.

93

La cantidad perfecta para reaccionar


Si quieres preparar una determinada cantidad de torta, la cantidad de ingredientes estar estipulada de forma tal que no haya prdida o deficiencia de dichos ingredientes. Si dispones de las cantidades adecuadas de azcar, margarina, leche, huevos, esencia pero solo tienes la mitad de la harina leudante. Podrs preparar la cantidad de torta deseada? Por experiencia sabes que tendrs que ajustar la cantidad de los otros ingredientes para mantener la calidad de la torta o conseguir la cantidad de harina que hace falta para que los dems ingredientes mantengan la proporcin adecuada. Todo debe haberse adicionado en las cantidades adecuadas para que su sabor, textura y aspecto sea apropiado y delicioso. As como realizamos ajustes a las recetas, es necesario ajustar las ecuaciones qumicas.

Figura 18.11. Reaccin qumica con la levadura producto del calor en el horno de la cocina.

Este ajuste consiste en igualar el nmero de tomos de cada elemento en los reactantes y los productos, cumpliendo de esta manera con otro patrn, la ley de la conservacin de la masa. Cmo lo hars? Haciendo uso de los coeficientes estequiomtricos Recuerdas los nmeros que estn antes de cada elemento o compuesto en las ecuaciones qumicas que te hemos presentado? Estos pueden ser nmeros enteros o fraccionarios y estn ubicados antes del smbolo que representa a una sustancia pura, sin que alteren su frmula molecular. Estos coeficientes operan de manera semejante a la propiedad distributiva aprendida en matemticas, de manera tal que su valor afecta a todos los subndices de los elementos constituyentes de la frmula molecular. En la tabla 17.8 puedes realizar una comparacin entre la propiedad matemtica y lo que ocurre en una frmula molecular.
94

Tabla 18.8. Aplicacin de la propiedad distributiva desde el rea de matemticas hacia la qumica.

Qu concluyes respecto a la aplicacin de la propiedad distributiva en el rea de qumica? Exacto! Hay similitud. En matemtica, la constante multiplica los coeficientes de cada variable, mientras que en qumica, el coeficiente estequiomtrico multiplica cada subndice de los elementos en la frmula molecular. En el rea de qumica, interpretamos que los subndices de cada elemento que constituyen a los compuestos, se incrementan tantas veces como la magnitud del coeficiente estequiomtrico. El resultado del producto en cada elemento, representa un aumento en el nmero total de tomos del cada uno, pero la frmula molecular permanece intacta. Otra aplicacin de la propiedad distributiva al balancear una ecuacin qumica es cuando se ha formado una sal ternaria del tipo: Metaly (No Metal Oxgeno)x; Ejemplo: Ca3(PO4)2 Fosfato de Calcio. En este caso, y = 3 corresponde a la carga del fosfato (PO4)-3 y x = 2 corresponde a la carga del elemento metlico (calcio: Ca+2). Observa otro ejemplo en la figura 18.13.

Figura 18.12. Identificacin de los subndices en un compuesto (Bicarbonato de calcio).

95

Como viste, en la frmula de una molcula puedes tener subndices para grupos de elementos, adems de los subndices en cada elemento. Todo subndice ubicado fuera del parntesis lo denominaremos externo y aquellos ubicados junto al smbolo del elemento ser el subndice del elemento. Como seguro ya te diste cuenta, aquellos elementos que carecen de subndice numrico les corresponden la unidad, es decir, su valor ser uno (1). Recuerdas las ecuaciones matemticas donde se sobreentiende que 1X = X? Establece el mismo criterio!

Matemtica 1X + 6 = X + 6

Qumica MgCl2 = 1 tomo de Mg y 2 tomos de cl

Figura 18.13. Ubicando relaciones entre lo conocido y lo que ests por aprender.

Saber operar con estos subndices y los coeficientes estequimtricos es importante. En la tabla 18.9 presentamos dos procedimientos equivalentes para determinar el nmero de tomos totales de cada elemento que conforma el compuesto.

Tabla 18.9. Identifica el procedimiento que te permita visualizar con mayor facilidad el nmero de tomos de cada elemento en la molcula.

En estos casos, el coeficiente estequiomtrico multiplicar el nmero obtenido de la multiplicacin entre el subndice del elemento y el subndice externo; lo cual es equivalente a, multiplicar primero el coeficiente estequiomtrico con el subndice externo y usar el resultado de dicho producto para multiplicar con cada uno de los subndices contenidos dentro del mismo.

96

En ocasiones, es necesario utilizar un coeficiente estequiomtrico fraccionario que al multiplicarlo por el subndice del elemento, genere como resultado un nmero entero. La tabla 18.10 permite visualizar el procedimiento para diferentes molculas.

Tabla 18.10. Influencia del coeficiente estequiomtrico en las frmulas moleculares.

Entonces, en una reaccin qumica los coeficientes estequiomtricos multiplicarn cada subndice presente en la frmula molecular de cada molcula, para determinar la cantidad de tomos totales para cada elemento de los reactivos, comparndolos luego con los tomos presentes en el otro lado de la ecuacin, en los productos, ambos valores tienen que resultar iguales. Estos coeficientes estequiomtricos hay que determinarlos para mantener la igualdad. Este proceso para ajustar la ecuacin la denominaremos balanceo.

Balanceando las ecuaciones qumicas


Ahora que sabes cmo determinar el nmero de tomos cuando es conocido el coeficiente estequiomtrico, te presentamos la secuencia de pasos que te permitirn balancear desde las frmulas ms sencillas en una ecuacin qumica hasta las de mayor dificultad por el mtodo del tanteo, es decir, por ensayo y error. Comenzars tanteando como lo dice su nombre, pero con la prctica desarrollars la habilidad de identificar el coeficiente correcto con una facilidad asombrosa.
Figura 18.14. Averiguando el ajuste necesario para balancear.

97

Antes de proponer cualquier coeficiente estequiomtrico es conveniente conocer el nmero de tomos presentes para cada elemento y cul es el dficit de tomos por cada uno? Una vez identificados analiza, en cul de los reactivos o productos conviene incorporar un coeficiente que permita equilibrar las cantidades? y qu nmero? Prueba con el coeficiente que crees conveniente realizando las operaciones que sean necesarias, tal como leste antes. Si consigues igualar el nmero de tomos para cada elemento, Felicitaciones! En caso contrario, repite el procedimiento con otro coeficiente. Con un poco de concentracin y prctica, lo logrars con facilidad!

Bicarbonato de Calcio

xido de Calcio (cal viva) + Dixido de Carbono + Agua

Primer paso: Identifica el subndice externo en caso de que haya parntesis en reactivos o productos. En el bicarbonato de calcio Ca ( H C O 3)2 el subndice externo es 2 Segundo paso: Determina el nmero de tomos de calcio, hidrgeno, carbono, y oxgeno presentes en el bicarbonato de calcio, considerando el subndice determinado en el primer paso. Compralo con el nmero de tomos totales que constituyen los productos. Reactivos (previo al balanceo) tomos de Calcio = 1 tomos de Hidrgeno: 2 x 1 = 2 tomos de Carbono: 2 x 1 = 2 tomos de Oxgeno: 2 x 3 = 6 Productos (previo al balanceo) tomos de Calcio = 1 tomos de Hidrgeno = 2 tomos de Carbono= 1 tomos de Oxgeno= 1+2+1 = 4

Como notars, el nmero de tomos de calcio e hidrgeno es igual en los reactivos y los productos pero el nmero de tomos de carbono y oxgeno en los reactivos es mayor que los contabilizados en los productos. Necesitas un tomo de carbono y dos de oxgeno en los productos para lograr igualar el nmero de tomos totales. Tercer paso: Plantea un coeficiente estequiomtrico que te permita aumentar el nmero de tomos de carbono en 1 unidad y los tomos de oxgeno en 2 unidades en los productos. Prueba con un coeficiente 2 en el primer producto de la ecuacin qumica.

98

Cuarto paso: Compara el nmero total de tomos en los productos con los reactivos. Reactivos (posterior al balanceo) tomos de Calcio = 1 tomos de Hidrgeno: 2 x 1 = 2 tomos de Carbono: 2 x 1 = 2 tomos de Oxgeno: 2 x 3 = 6 Productos (posterior al balanceo) tomos de Calcio = 1 tomos de Hidrgeno = 2 tomos de Carbono= 2 tomos de Oxgeno: 4+1+1 = 6

Las reacciones qumicas tienen que ser descritas mediante ecuaciones balanceadas, porque permiten establecer importantes relaciones cuantitativas (entre reactivos y productos), que determinan la composicin de productos farmacuticos, industriales, petroleros, entre otros.

El mol: el titn de la qumica


En la cotidianidad hacemos uso o adquirimos productos midindolos con unidades estndar. Ejemplo de ello son las verduras y granos que son medidos en diversos mltiplos y submltiplos del gramo. Esta unidad corresponde a medidas de masa. Tambin empleamos otras unidades para medidas de volumen. En el mbito de la ciencia se cre una unidad de medida para la cantidad de sustancia, la cual fue denominada mol, basada en una cantidad grande de partculas o entidades microscpicas (tabla 18.11). Nombre de la magnitud fsica Cantidad de sustancia Tipo de magnitud fsica Escalar Smbolo Unidades en el Sistema Internacional (SI) mol (mol) Equivalencia entre unidades en el SI

1 mol = 6,022 x 1023 partculas (tomos, molculas, iones, protones o electrones). Ocupa un volumen de 22,4 L, temperatura de T = 273K y presin de P = 1 atm. Masa de un tomo. Masa de 1 mol de tomos. Masas de 1 mol de molculas. Masas de 1 mol de unidades formulares.

Masa atmica Masa molar atmica Masa molar molecular Masa molar de un compuesto inico

Escalar Escalar Escalar Escalar

uma M M M

Unidad de masa atmica (uma) g/mol g/mol g/mol

Tabla 18.11. Descripcin de la magnitud, cantidad de sustancia. Escalar: un nmero ms una unidad fsica.

99

Independientemente del tipo de partculas a contabilizar (molculas, iones o electrones) se usa como referencia el nmero de tomos presentes en 0,012 kg de Carbono doce (C12). Este nmero de partculas es independiente de la naturaleza y composicin del compuesto, por lo tanto, podemos hablar de 1 mol de molculas de agua o 1 mol de tomos de oxgeno. Esta constante fue denominada como el nmero de Avogadro, en honor al qumico italiano Amedeo Avogadro que en el ao 1811 propuso esta idea, y se representa con el smbolo: L o NA La masa de 1 mol depende de la partcula a la cual se refiera. Cuando se trata de tomos hablamos de la masa molar atmica relativa y ser masa molar molecular relativa si nos referimos a molculas. Sabas que...? El nmero de partculas contenidas en 1 mol equivale a una tarjeta de memoria de 522325 exabyte (EB). La cual an no ha sido creada! 6,022 x 1023 = 522.325 EB 1EB = 1.0737.1824 GB (gigabyte) 1GB = 1.0737.1824 bytes

El valor de la masa molar atmica relativa es determinado a partir de las masas molares atmicas de cada istopo de un elemento (calculadas con la escala de pesos atmicos planteada por Dalton). Recuerda, que estos valores de masa molar atmica relativa, estn contenidos en la tabla peridica y corresponden al promedio de la masa molar atmica de los istopos, considerando su abundancia en la naturaleza. Veamos un ejemplo. En la tabla 18.12 presentamos las masas molares atmicas de los istopos de carbono y oxgeno; su abundancia en la naturaleza y una aproximacin a la masa molar atmica relativa. Elemento Istopos Masa molar atmica (g/ mol) Abundancia Masa molar atmica relativa C12 12,000 98,89 % Carbono C13 13,003 1,10 % 12,0112 g/mol C14 14,003 0,01 % O16 15,995 99,76 % Oxgeno O17 16,999 0,04 % 15,9996 g/mol O18 17,999 0,20 %

Tabla 18.12. Masas molares atmicas relativas para los tomos de carbono, oxgeno y magnesio.

100

La relacin que existe entre la masa molar molecular relativa expresada en gramos/mol y la cantidad de sustancia en mol, de un determinado compuesto, permite calcular la masa en gramos de dicho compuesto. Si por el contrario, los valores conocidos son la masa y la masa molar relativa del compuesto, puede reescribirse la relacin a travs del despeje aprendido en matemticas y determinar la cantidad de sustancia en moles.

Dnde ubicaras 6,022x1023 pares de zapatos? Cuntos aos de vida te llevara comer 6,022x1023 de galletas de avena? Tallaras 6,022x1023 rocas? En el mundo macroscpico estas cantidades son exorbitantes, pero a nivel atmico representan cantidades medibles macroscpicamente, por ejemplo, 6,022x1023 molculas de oxgeno pesan 32 gramos. En la figura 18.15 puedes apreciar que la cantidad de materia est relacionada con otras magnitudes de inters tal como el volumen que ocupara un determinado nmero de partculas en las condiciones de presin y temperatura especificadas.

Figura 18.15. Masa y volumen del nmero de partculas que constituyen un mol de sustancia.

101

El diminuto tamao de las partculas fue considerado a la hora de plantear esta unidad de cantidad de materia (mol). A nivel macroscpico, sera imposible disponer del espacio necesario para almacenar 6,022x1023 objetos, en cambio a nivel microscpico estas cantidades de sustancias ocupan su espacio imperceptiblemente. Tienes idea de cul sera la masa de una sola partcula atmica? Si 6,022x1023 tomos de hierro tienen una masa de 56 g, la masa de un solo tomo se obtiene dividiendo los 56 g entre el nmero de tomos en un mol (6,022x1023). El resultado es tan pequeo que resulta imposible medirlo con una balanza, masa de 1 tomo de hierro igual a 9,3 x 10-23 g. Analiza los datos suministrados en la tabla 18.13 y los planteamientos de esta lectura, qu te parecen estos valores de masas? Hierro (Fe) (mol) Nmero de partculas Mr (g/n) 1 602.200.000.000.000.000.000.000 56 150.550.000.000.000.000.000.000 56 1/56 18.818.750.000.000.000.000.000 56 10-18 602.200 56 1,66x10-24 1 56 Masa (g) 56 14 1 0,000000000000000056 Imposible medir

Tabla 18.13. Relacin entre el mol, nmero de partcula y la masa molecular relativa.

La reaccin ante las reacciones qumicas


Muchas son las reacciones cotidianas, recurrentes o excepcionales que se llevan a cabo con y sin nuestro consentimiento. Respirar es una eleccin? No, lo hacemos de manera inconsciente y sin poder influir en ello, exhalamos dixido de carbono (CO2). As como ocurren reacciones en la naturaleza, otras son inducidas por el hombre, unas en pro de la elaboracin de productos que incrementan el buen vivir, otras sin planificacin o control que van en contra del ambiente y por supuesto, de nosotros mismos. Por ejemplo, la corrosin de tuberas y contaminacin de las aguas por desechar aceite en el fregadero son acciones recurrentes que atentan contra el ambiente. Diversas reacciones qumicas provocadas por el hombre generan cantidades significativas de desechos que aunque son producto de la conservacin de la masa, alteran el equilibrio del planeta debido al tiempo necesario (dcadas y ms) para transformarlos en elementos o compuestos aprovechables en otros ciclos o reacciones, es decir, por su falta de degradabilidad. Mientras cientficos de diversas reas, en distintas universidades, estn realizando investigaciones sobre los combustibles y el uso de fuentes de energa alternativas, que ayuden a mantener el equilibrio de nuestro hbitat, tambin se investigan y crean nuevas tecnologas para desarrollar productos biodegradables, que reemplacen a aquellos que no lo son.

102

Aunque la actitud consumista cercena la construccin de tu propia identidad, se incita desmedidamente al consumo de productos, o a reemplazar productos, ya sea por desperfecto o por monotona, sin considerar las repercusiones o consecuencias, tanto a mediano como a largo plazo, para el ambiente. Actualmente, se hace un llamado a la conciencia sobre esta problemtica. A nivel mundial tenemos que exigir la manufactura de productos tiles, duraderos y ecolgicos. Cuando advirtamos el deterioro y los daos causados al planeta Tierra, aquel que nos brinda hogar y sustento, quizs sea muy tarde y la tecnologa avanzada de la cual dispongamos ser ineficaz para recuperarlo. As como mujeres y hombres investigan la mejor manera de resarcir los daos causados al ambiente durante dcadas de apata e inconsciencia, t puedes, en el da a da, con acciones sencillas aunque te parezcan insignificantes contribuir con el buen vivir y la vida del planeta. Concientizar que el impacto ambiental que observamos es generado por nuestras acciones cotidianas, permitir corregirlas y contribuir a una convivencia armnica y sensata con el ambiente y la comunidad. Contamos con tu apoyo para mejorar esta actitud social y asumir un compromiso personal. Reduce el consumo, clasifica tu basura, apoya el reciclaje y reutiliza aquello que an puedes aprovechar (papel), entre otros. Favorece el ciclo del altruista en bsqueda del buen vivir, el bien comn y el desarrollo sustentable.

103

Reacciones con alcohol


En el ttulo V, artculo 94 de la Ley de Trnsito Terrestre, la ingesta de bebidas alcohlicas al conducir un vehculo est penalizada con el 100% del salario mnimo urbano mensual ya que ello produce impacto en el buen vivir de todas y todos. Si un grupo de personas asiste a una reunin en la cual se ingiere alcohol, cul de ellos ser el ms apto para conducir el vehculo de regreso a casa? Este problema te lo proponemos para ser trabajado en un proyecto tecnolgico en grupo. Para ello pueden leer el tema 11 en el libro de 2do ao de esta serie. Analicen las circunstancias y las consecuencias que conlleva esta accin poco ciudadana. Inicien un debate a partir de planteamientos semejantes a los expuestos a continuacin: Qu importancia tiene la determinacin de la presencia de estas sustancias? Cul componente qumico de las bebidas alcohlicas determina el grado de alcohol que contiene? Clasificacin bajo la cual se agrupan las bebidas alcohlicas. Cmo distinguir entre las diferentes concentraciones de alcohol en la sangre? Existe relacin entre la cantidad de alcohol ingerido y la concentracin de alcohol en la sangre, el cerebro y en el aire exhalado? Qu efectos fsicos, psicolgicos, sociales y emocionales traen consigo la ingesta de alcohol, en particular cuando conducimos un vehculo? Qu concentracin de alcohol en el aliento estn permitidos para los conductores? Cul o cules metodologas se emplean en nuestro pas para conocer la cantidad de alcohol ingerida por aquellas personas que asumen la responsabilidad de conducir un vehculo particular o colectivo? A partir de una reaccin del tipo xido reduccin es posible determinar la presencia de alcohol en el aliento de una persona. Los reactivos son: dicromato de potasio, cido sulfrico y etanol, mientras que los productos son: sulfato de cromo (III), sulfato de potasio, cido actico y agua. Indaguen sobre la expresin simblica de ellos y escriban la reaccin de xido reduccin, terminen de balancearla e interprtenla: 2 _______ + 8 _____ + 3 ______ Diseen. - En funcin de lo anterior diseen un aparato que permita detectar la presencia de alcohol en el aliento de un individuo. Qu reaccin debe propiciar el aparato? Cmo lograrlo? Qu evidencias tendrn que apreciar y medir en la reaccin? Qu esperan observar si la cantidad de alcohol ingerido supera los valores permitidos para conducir? Qu materiales necesitaran? - Compartan y evalen el diseo con las y los docentes de ciencias, y con especialistas. Se animan a construirlo? Les deseamos xito.
104

_ __________ + _ ______ + _ ________ + _ ____

Actividad de autoevaluacin

1. Qu tipo de reaccin se llevara a cabo entre una roca caliza y unas gotas de cido clorhdrico? Plantea la reaccin, balancala e interprtala. 2. Compara la reaccin anterior con la reaccin que se lleva a cabo entre limn y bicarbonato de sodio. Identifica los reactivos y productos. 3. Qu tipo de reacciones se producen con la lluvia cida? Cules son los efectos que provoca la misma? 4. Ocurre algn tipo de reaccin cuando se forman las estalactitas y estalagmitas en la Cueva del Gucharo, ubicada entre los estados Monagas y Sucre o en La Cueva del Indio en Caracas? 5. Establece la diferencia entre las expresiones, ecuacin qumica y reaccin qumica. 6. Qu puedes informar sobre la reaccin que se produce cuando la azcar disuelta en agua tibia reacciona en la presencia de levadura? 7. Cul es la aplicabilidad e importancia de los coeficientes estequiomtricos? 8. Para la reaccin completa e incompleta de combustin del butano (C4H10) y oxgeno (O2), cules son los productos de reaccin? y cul es la relacin entre masas de los elementos que conforman dichos productos? 9. Selecciona cuatro acontecimientos cotidianos que reflejen los cuatro tipos de reacciones generales descritas en la lectura. 10. Analiza cada uno de los planteamientos siguientes y argumenta tu acuerdo o desacuerdo con el mismo: Todas las evidencias de la ocurrencia de una reaccin qumica estn definidas con un smbolo, el cul es utilizado en las ecuaciones qumicas. El trmino mol expresa una cualidad. Los reactivos son aquellas sustancias que se forman una vez que se produce la reaccin qumica. La Ley de la Conservacin de la Masa es inaplicable en las ecuaciones y reacciones qumicas. Las ecuaciones qumicas balanceadas permiten realizar clculos cualitativos. La cantidad de partculas tiene relacin con la cantidad de sustancia y sta a su vez con el volumen que ocupa en determinadas condiciones.

105

19
En la naturaleza ocurren diariamente sin percatarnos muchas reacciones qumicas, tambin encontramos muchos elementos y compuestos mezclados. Es frecuente que estos componentes sean aislados y posteriormente utilizados de otra manera por los seres humanos. Una de las reacciones ms comunes es la reaccin de combustin de la gasolina. Esta se lleva a cabo con una de las mezclas de mayor notoriedad en la cotidianidad, la gasolina. A su vez, para que se produzca la reaccin de combustin es necesario realizar una mezcla de aire y combustible. El aire tambin es una mezcla y uno de sus componentes es el oxgeno. Dependiendo de la proporcin de los componentes de la mezcla (aire-combustible) variar el tipo de reaccin que se llevar a cabo. La combustin completa de la gasolina generar como productos mayoritarios dixido de carbono (CO2) y agua (H2O). Sin embargo, la combustin incompleta promueve la formacin de monxido de carbono (CO) y agua (H2O). Por lo general, estos productos se mezclan con el aire. Dependiendo del estado fsico en que se encuentren los componentes de una mezcla (slido, lquido o gaseoso) y del tipo de mezcla (homognea o heterognea) tendrs que seleccionar uno o varios procedimientos adecuados cuando quieras separar algn componente. Por ejemplo, la gasolina es una mezcla de compuestos orgnicos obtenida del petrleo y requiere de procesos de separacin industrial. Mientras que el anlisis de muestras de sangre involucra otros procedimientos de separacin que son realizados en los laboratorios. En esta lectura analizaremos algunas tcnicas y procedimientos de separacin de mezclas cuyos componentes sufren transformaciones fsicas pero se mantienen sin reaccionar entre ellos.

106

Separa mezclas para formar otras nuevas

Hay variedad de mezclas! Cmo podemos distinguirlas?


Nuestro planeta est habitado por millones de seres vivos y diversidad de fauna, flora, entre otros. Te has preguntado cul es la importancia de clasificar todo lo que compone el universo? Nuestra curiosidad lleva a examinar exhaustivamente la naturaleza para poder plantearnos proyectos y estrategias que favorezcan la vida de los seres humanos y de las especies con las cuales compartimos el planeta.
Caimn de anteojos Caimn de la costa Caimn del Orinoco

Figura 19.1. Especies de caimanes provenientes de un mismo gnero.

As como animales y plantas son clasificados segn la especie, la materia la podemos clasificar con base en su composicin, ya que en su mayora est constituida por una o ms sustancias diferentes, las cuales cambian de estado fsico o se transforman en otra sustancia a travs de reacciones qumicas. La materia segn su composicin se clasifica en sustancias puras y mezclas. Conocer la composicin de las sustancias puras permitir emplear, predecir y proceder en su presencia. Por ejemplo, el aire est constituido por nitrgeno, oxgeno, argn, nen, helio, kriptn, hidrgeno, xenn, dixido de carbono. Aunque todas estas sustancias estn presentes, se mantienen sin reaccionar, por eso podemos utilizar el oxgeno para respirar sin asfixiarnos con la presencia de los otros componentes. Esto se debe a que el aire constituye una mezcla (gaseosa) y cada componente conserva sus propiedades sin reaccionar con los restantes. En la tabla 19.1 presentamos la composicin y caractersticas de la materia. Materia Sustancias puras Constituida(s) por Elementos y compuestos. Observaciones Sus propiedades son especficas y varan al cambiar de sustancia pura. Ejemplo Aluminio (Al), Bromo (Br2), Oxgeno (O2)

Mezclas

Sin reaccin Unin de dos (2) o ms qumica entre ellas, sustancias puras. conservando c/u sus propiedades.

Petrleo, suelo, leche, aire.

Tabla 19.1. Composicin de la materia. (SP: sustancia pura y M: mezcla).

107

Cuando dos o ms sustancias puras se combinan e interaccionan sin reaccionar para formar una mezcla, pueden hacerlo en proporciones variables. Habr proporciones en las cuales se combinen ciertos componentes para formar cuarzos y debido a la presencia de ciertos componentes (elementos) variar su coloracin, y la intensidad de la misma. Algunas mezclas son producidas por la naturaleza, otras son generadas por nosotros a partir de componentes previamente separados. Es por ello que resulta necesario en muchos casos, separar o descomponer las mezclas en sus sustancias puras. Cuando uno o ms de los componentes de una mezcla se encuentran en pequeas proporciones respecto al componente mayoritario, las consideramos impurezas presentes en trazas, indicando que su proporcin es muy pequea. En muchos procesos surge la necesidad de obtener la materia prima con un elevado nivel de pureza o puras, para lo cual se hace necesario purificarla mediante la separacin de las sustancias no deseadas, es decir, separar las mezclas. Es importante recordar que las mezclas se clasifican en homogneas y heterogneas. Esta clasificacin es independiente de la cantidad de muestra de la cual se disponga pues se basa en la uniformidad del color, en su aspecto y en la desviacin de un haz de luz incidente en ella (Efecto Tyndall til). La tabla 19.2 resume informacin referente a las sustancias puras y a los tipos de mezclas, estudiados en los aos anteriores. Tipos de sustancias puras 1. Elementos Constituida(s) por Una sola clase de tomos. Observaciones Clasificados como metales, no metales y metaloides. Ejemplo Sodio (Na), diamante (C). Carbonato de calcio (CaCO3). Ejemplo Aire, mayonesa.

2. Compuestos

Unin de dos o ms Cumplen la ley de las elementos mediante proporciones definidas. enlaces qumicos. Constituida(s) por Componentes indistinguibles. Soluto(s) y disolvente. Observaciones A simple vista o con microscopio, no sedimentan. Constituido por iones y molculas, no presentan efecto Tyndall.

Tipos de mezclas 1. Homogneas

Disoluciones

Caf con leche.

Coloides

Partculas diminutas Distinguibles con ultra Emulsin, gel, aerosol. desde 0,000 000 1 cm microscopio. Presentan hasta 0,000 01 cm. efecto Tyndall, no sedimentan.

108

Tipos de mezclas 2. Heterogneas

Constituida(s) por Componentes distinguibles. Partculas de gran tamao. Partculas finas y disolvente.

Observaciones A simple vista o con microscopio. Distinguibles a simple vista. Son opacas, permanecen suspendidas hasta sedimentar.

Ejemplo Ensalada, cuarzo.

Groseras Suspensiones

Granito. Agua de mar.

Tabla 19.2. Sustancias puras y mezclas: tipos y composicin.

El patrn de separacin lo estableces t!


En la naturaleza encontramos todos los elementos que puedas imaginar y ms. Por ejemplo: aluminio, azufre, nitrgeno, mercurio, nen, hidrgeno. Sin embargo, para poder disponer de aluminio (Al) para la elaboracin de utensilios, recipientes, barras, entre otras aplicaciones, es necesario extraerlo pues la naturaleza lo proporciona como parte de la bauxita (AlO3(OH)). Es por ello que surge la necesidad de separarlo de los otros componentes para procesarlo y obtenerlo como sustancia pura. Disponer de las sustancias para realizar reacciones qumicas (combinacin, desplazamiento, descomposicin, otras) o mezclas, implica la utilizacin de procesos fsicos o qumicos que conlleven a su aislamiento y separacin. De acuerdo con el uso o aplicacin posterior de las sustancias separadas, se plantear la estrategia que permita su obtencin.

Figura 19.2. Bauxita y aprovechamiento del aluminio procesado a partir de la bauxita.

109

Centraremos la atencin en las tcnicas de separacin de sustancias slidas, lquidas o gaseosas, mezcladas entre s o con otros componentes en el mismo estado de agregacin (slido/slido, slido/lquido, lquido/gas) Vamos a tomar conciencia de la aplicabilidad que stas tcnicas nos proporcionan en la cotidianidad. Aunque vers cada tcnica por separado, notars que es posible proponer su aplicacin sucesiva de acuerdo a la complejidad de la mezcla en cuestin. Conocer las propiedades y caractersticas de los componentes de la mezcla ser indispensable para el adecuado planteamiento de la tcnica o procedimiento a emplear para separar la o las sustancias deseadas. Las mezclas

se separan mediante Tcnicas y procedimientos fundamentos en Diferencias de

Tamao de partcula

Solublidad

Densindad

Magnetismo

Temperaturas de ebullicin

Figura 19.3. Propiedades fsicas ms comunes de los componentes consideradas para separar mezclas.

La recomendacin es identificar primero el estado fsico de los componentes que conforman la mezcla a separar. Si los componentes de la mezcla son slidos, puedes separarlos de diferentes maneras. Veamos a continuacin algunas. 1. Tamizado. Cuando ests aspirando para retirar el polvo de determinados objetos ests separando diminutas partculas de polvo de slidos de mayor tamao. Pero qu ocurre cuando el tamao de las partculas slidas difiere en menor proporcin o son muy similares dimensionalmente? Tal es el caso de la tierra o piedras de las caraotas antes de cocinarlas Cmo lo haces? Has visto tamizar rocas?

110

Figura 19.4. Separacin de mezclas de slidos mediante el tamizado.

El procedimiento que permite separar dos o ms slidos cuyos tamaos difieran lo denominamos tamizado. Los componentes se hacen pasar a travs de una malla o tamiz (tejido o red de pequeos anillos o hilos entrelazados, usualmente metlicos) para retener un slido y permitir el paso de los otros, logrndose distribuirlos de acuerdo a su tamao. Pueden ubicarse varios tamices apilados/dispuestos uno sobre otro, con variacin del dimetro de los orificios de la malla, tal que permita realizar la separacin de ms de dos slidos simultneamente o repetir la separacin para garantizar el desglose de los mismos. Cul crees que debe ser la ubicacin de los tamices cuando varas el dimetro de la malla? El tamiz con orificios de menor dimetro debe ubicarse en la zona inferior de la pila para retener los slidos ms pequeos al final de la separacin. Este procedimiento puede realizarse en seco o por va hmeda dependiendo del tipo de slido. Esta tcnica es muy usada en el trabajo con suelos arcillosos, limosos o arenosos para realizar ensayos de campo relacionados con la determinacin de su textura. Adems tiene aplicaciones en la seleccin de minerales, anlisis de polvos, repostera y otros.
Figura 19.5.Tamizacin.

111

2. Levigacin. Otra separacin de frecuente aplicacin es la separacin de residuos slidos en frutas y conchas de los granos antes de su coccin. En estos casos se hace uso de una corriente de agua que permita el arrastre o sedimentacin de los slidos ms livianos o pequeos, entre tanto, los slidos de mayor tamao permanecen intactos.

Separar dos o ms slidos mediante el arrastre de los slidos por una corriente de disolvente, normalmente agua, es el procedimiento denominado Levigacin. Los slidos ms livianos son arrastrados con ms facilidad que los ms pesados por el fluido y por accin de la gravedad se depositarn rpidamente en el fondo. Se conoce comnmente como arrastre por corriente de agua o lavado de slidos. Se aplica en la separacin del oro de la arena, el lavado de impurezas en reactivos slidos, la separacin microscpica de muestras paleontolgicas, entre otras.

Sabas que...? Existen tamices de dimensiones tan diminutas que son selectivos a nivel molecular y absorben lquido o gases, los cuales se conocen como tamices moleculares y actan como mallas moleculares. Estos son utilizados como agentes desecantes ya que pueden absorber humedad (H2O) en un porcentaje considerable de su peso. Los ms comunes son unos minerales conocidos como zeolitas, muy abundantes en la naturaleza.

Figura 19.6. Desperdiciamos agua cuando arrastramos las hojas y tierra usando la manguera.

En la figura 19.6 presentamos una de las inadecuadas aplicaciones cotidianas ms frecuentes de este procedimiento, el barrido usando una manguera y agua, desperdiciando gran cantidad de agua potable que debera ser aprovechada para el abastecimiento de las personas. Es un deber usar el agua con conciencia!
112

3. Imantacin. La presencia de sustancias como el silicio y el fsforo actan como impurezas del hierro mineral, siendo este ltimo separado magnticamente. El hierro, adems de ser un elemento metlico, tiene la propiedad de ser atrado por un imn. La imantacin permite separar sustancias que pueden ser atradas por un imn, de aquellas que no lo son. Su aplicacin general es para casos de metales con propiedades magnticas (hierro, acero, nquel) de otras sustancias que no lo son, por ejemplo arena, azufre, aluminio, compuestos orgnicos. Al acercar los polos del imn a la mezcla, estos atraern a la sustancias con propiedades magnticas, quedando en el recipiente las dems. Esta propiedad se emplea en los procesos de clasificacin de los desechos slidos, previos al reciclaje, ya que permite separar componentes magnticos de una mezcla cuando las otras sustancias no tienen esta propiedad.

Figura 19.7. Imantacin.

Los procedimientos planteados hasta ahora son tiles para separar mezclas de slidos cuyas diferencias de tamao de partculas y propiedades magnticas permiten su separacin. Sin embargo, en otras mezclas los tamaos de las partculas son tan similares que no podemos separarlas mediante los procedimientos antes descritos. Por ejemplo, si tienes una mezcla de yodo/azufre, ser necesario pensar en otros procedimientos que conlleven a su separacin. 4. La sublimacin separa slidos cuando uno de los componentes puede cambiar de slido a gas sin pasar por el estado lquido. Es un proceso reversible provocado al suministrar calor a la mezcla slida. Un componente es separado cuando pasa al estado gaseoso y posteriormente, por disminucin de su temperatura vuelve a su estado slido. Esta tcnica es utiliza en la purificacin de slidos. Sabas que...? El yodo es uno de los slidos que se sublima a temperatura ambiente. Este elemento es indispensable para: La agilidad mental. El crecimiento ptimo de uas, cabello, piel y dientes. Y su deficiencia: Afecta a nias y nios en el vientre materno. Disminuye la capacidad de aprendizaje y el rendimiento escolar y laboral.
Figura 19.8. Sublimacin.

Consmelo en la sal yodada, pescados, mariscos y sal marina.


113

5. Disolver una sustancia en otra es utilizado a diario en la cocina para generar una mezcla homognea (sal o azcar en agua) con la cual se preparar algn alimento, por ejemplo arroz o pasta. Este procedimiento resulta til en la separacin de los componentes de algunas mezclas y su aplicacin se basa en las diferencias de solubilidad de dichos componentes. La propuesta ideal es disolver un componente por adicin de un lquido y dejar los otros slidos insolubles para filtrarlos posteriormente. Este procedimiento se utiliza con frecuencia con la aplicacin de tcnicas de separacin como la filtracin y la decantacin, mencionadas posteriormente. En algunos casos, es necesario disolver un slido en un disolvente para luego aplicar la tcnica de cristalizacin y separarlo de sus impurezas insolubles. En otros, el disolvente empleado disuelve todos los componentes de la mezcla y para poder separarlos, se emplean tcnicas como la extraccin, tambin explicada ms adelante en esta lectura.

Papeln

Azufre

Disolucin

Figura 19.9. Disolucin de un componente de una mezcla slido-slido.

Otros mtodos para separar mezclas slido-slido, slido-lquido y lquido-lquido


Cuando colocas en un envase un poco de agua de mar Es incolora o cristalina? Normalmente es turbia, pero si dejas el recipiente en reposo, observars que la arena y otras partculas slidas se depositan en el fondo del mismo, as el agua se tornar ms clara. Esto se debe a que se deposita la arena y dems partculas transcurridos unos minutos. Dependiendo del tamao de la partcula, el proceso tardar ms o menos tiempo. A continuacin vers ms procedimientos tiles para separar no slo mezclas de slido/slido, sino tambin slido/lquido y lquido/lquido. 1. La decantacin es el proceso que consiste en separar un slido insoluble de un lquido o dos lquidos insolubles entre s. En la primera situacin planteada debe dejarse en reposo la mezcla, transcurridos unos minutos, se sedimentar el slido en el fondo del recipiente y el lquido podr descartarse o transvasarse a otro recipiente, tal como lo describimos antes para la arena en el agua de mar.

114

En la segunda situacin, dos lquidos inmiscibles, el lquido ms denso tiende a quedarse en el fondo, fenmeno que se aprovecha para separarlos. Para ello se emplea un embudo especial, de adicin o decantacin, que permite visualizar ambos lquidos, ubicados uno sobre otro, despus de unos minutos. Para retirar el lquido ms denso se abre la llave, controlando el flujo para que se mantengan separados. En ambos casos es necesario mantener el sistema en reposo (sin movimientos o agitacin) para que se produzca la sedimentacin del slido o la distincin de las capas lquidas.

Figura 19.10. a) sedimentacin de slidos, b) decantacin de lquidos en embudo de adicin.

2. Otro procedimiento es el de centrifugacin, que permite acelerar el proceso de sedimentacin y por ende la decantacin. Para ello ubicamos la mezcla dentro de un aparato que centrifuga, es decir, que somete la mezcla a un movimiento circular muy rpido. Una de sus aplicaciones es en la separacin de los componentes de la sangre. Como puedes ver, la decantacin y la centrifugacin son procedimientos relacionados entre s como mtodos de separacin ya que se complementan.

Figura 19.11. Centrifugacin de muestras sanguneas.

115

3. Una vez que el compuesto sedimenta o permanece insoluble y se aplica el procedimiento de decantacin o centrifugacin, es conveniente aplicar la filtracin. Esta tcnica es una de las ms familiares y comunes, nos permite colar caf e incluso filtrar el agua que llega a nuestros hogares. La filtracin es aplicada en la separacin de mezclas slido/lquido y su procedimiento consiste en hacer pasar la mezcla a travs de una barrera porosa (superficie con agujeros de diferentes dimetros, acordes al tamao de las partculas slidas), tal que, el slido permanece retenido en la superficie del filtro mientras el lquido lo atraviesa. Estos filtros son elaborados con un material poroso como papel de filtro, lana de vidrio, asbesto, algodn, tela, mallas, fibras y relleno slido. El dimetro del poro estar determinado por el tamao de la partcula a retener. En la figura 19.12 se mencionan varios tipos de filtracin. Dependiendo del tamao de las partculas a filtrar y de cules impurezas estn presentes se escoger el tipo de filtracin.

La filtracin por

Gravedad Permite

Succin Permite

Pliegues Permite

Eliminar impurezas insolubles. Retener los slidos finamente divididos en el papel del filtro.

Separar con mayor rapidez impurezas solubles. Obtener cristales ms secos.

Eliminar impurezas coloreadas. Mantener una velocidad intermedia entre gravedad y succin.

Figura 19.12. Variedad de embudos y papel de filtro usados para la filtracin.

116

En todas se utiliza papel de filtro y embudo, pero los usos y diseos varan. El papel de filtro lo encontramos: doblado en forma cnica y adherido a las paredes del embudo en la filtracin por gravedad; liso, sin arrugas y adherido a la superficie del embudo cuando se filtra por succin o doblado en pliegues cuando se filtra en caliente. Respecto a los embudos: lisos y con tallo mediano o largo para filtracin por gravedad, plano con orificios y un anillo de caucho exterior para la succin, o lisos y sin tallo o de tallo corto para filtracin por pliegues.

Figura 19.13. Filtracin de caf.

4. La evaporacin se emplea en la separacin de slidos solubles en un lquido, mediante el calentamiento de la disolucin hasta alcanzar la temperatura que permita la evaporacin del lquido, cambiando ste a vapor y quedando el slido depositado en el recipiente. Este procedimiento es til junto a otras tcnicas (filtracin, cristalizacin).

Figura 19.14. La evaporacin permite la deshidratacin de alimentos.

5. Por lo general, la separacin de los componentes de una mezcla slido/slido o slido/ lquido implica la aplicacin sucesiva de varios procedimientos, por ejemplo, la purificacin de slidos. Para ello se aplican de manera consecutiva varios procedimientos de los descritos en los prrafos anteriores. Esta tcnica se denomina cristalizacin y se puede lograr a partir de los tres procedimientos alternativos mencionados en el figura 19.15.

117

En general, su aplicacin propicia la separacin de un slido de sus impurezas tal que se obtenga en su forma cristalina, quizs quieras purificar un slido separado previamente mediante el tamizado de slidos. Para ello se requiere un lquido (disolvente) que en fro: disuelva poco al slido y deje insolubles las impurezas. Al calentar la mezcla, el slido debe disolverse y las impurezas permanecer insolubles. Una vez separadas las impurezas mediante filtracin, se aumenta la temperatura para evaporar de un tercio a la mitad del volumen de la disolucin y luego se disminuye su temperatura para inducir la precipitacin del slido en su forma cristalina.

La cristalizacin puede realizarse mediante Fusin de un Disolucin de un Slido Sublimacin de un

Figura 19.15. Procesos de cristalizacin en funcin de sus propiedades fsicas.

118

Algunas tcnicas a escala industrial


Para finalizar, describiremos tres tcnicas menos comunes en nuestros hogares pero con gran aplicabilidad en las industrias. 1. La primera de ellas permite separar dos lquidos con ms eficacia que la decantacin y es conocida como destilacin. La destilacin involucra el cambio de estado (lquido a vapor, vapor a lquido) en los constituyentes de una mezcla de lquidos miscibles. Mediante calentamiento se produce la evaporacin mayoritaria de un componente, el cual ser colectado al condensarlo. Como puedes notar estn involucrados dos procesos de cambios de estado: evaporacin y condensacin. Estos procedimientos se realizan controlando las temperaturas en los equipos y las torres de destilacin. Los equipos utilizados para la destilacin varan de acuerdo a las temperaturas de ebullicin de los componentes, clasificndose la tcnica en destilacin simple, fraccionada y al vaco (presin reducida).

Figura 19.16. a) Equipo de destilacin a escala de laboratorio, b) Torre de destilacin: industria petrolera.

119

La destilacin separa dos o mas Lquidos

Miscibles de acuerdo a Diferencias de temperatura propensos a Descomponerse cuyas tal que cuando sea
Mayor que o igual a 100 C (T 100C)

tal que cuando sea

Temperatura de ebullicin Son disminuidas al aplicar Presin reducida

son elevadas

Menor que 100 C (T > 100C)

se denomina Simple Fraccionada

evitando su descomposicin

Figura 19.17. Tipos de destilacin.

El anlisis de aminocidos plasmticos permite detectar diferentes enfermedades.

Figura 19.18. Anlisis que involucran tcnicas de separacin (Cromatografa).

120

2. La cromatografa es una tcnica con diversas utilidades y de gran aplicabilidad en la actualidad ya que permite separar, identificar y cuantificar los componentes de la mezcla, a pequea y gran escala. Para ello se provoca en la mezcla una distribucin de los componentes en dos partes denominadas fases, una mvil y otra estacionaria (ver figura 19.19). En lneas generales, la fase mvil (habitualmente un gas o lquido) se desplaza por la superficie de la fase estacionaria, siendo esta ltima un slido inerte o un lquido soportado sobre un slido inerte, capaz de interactuar con los componentes a separar, retenindolos.

La cromatografa se basa en la distribucin de los componentes en la Fase Mvil Fase Estacionaria

Recorre la otra fase mientras desplaza los componentes a diferentes velocidades.

Retiene a cada componente de la mezcla con diferentes fuerzas.

Figura 19.19. Fases de la cromatografa.

Las propiedades de los componentes a separar, identificar o cuantificar determinarn el tipo de cromatografa. Por ejemplo, cuando la fase estacionaria es slida, la tcnica se denomina cromatografa de adsorcin debido a las interacciones superficiales entre las fases. En cambio, cuando la fase estacionaria es lquida, se denomina cromatografa de reparto o particin, ya que se producen interacciones cuando la fase mvil penetra la superficie de la fase estacionaria. En la Figura 19.20 se aprecia cmo el factor determinante en el fenmeno de separacin cromatogrfica es el estado fsico de la fase estacionaria.
121

El fenmeno de Adsorcin se produce cuando la fase Particin se produce cuando la fase

Estacionaria es Slida Lquida

Mvil es

Estacionaria es Lquida

Gaseosa

Figura 19.20. Clasificacin de la cromatografa de acuerdo al fenmeno de separacin.

Para efectos de este curso nos centraremos en la clasificacin de la tcnica, de acuerdo con los implementos utilizados para llevarla a cabo y su aplicabilidad, presentada en la figura 19.21. La comatofrafa de acuerdo al Implemento utilizado se clasifica en Capa fina siendo til en Anlisis cualitativos. Determinacin de las condiciones de separacin (disolventes). Identificacin de un compuesto. Monitorizar una reaccin o separacin. Columna siendo til en Seperaciones a pequea y gran escala. Purificacin de compuestos orgnicos. Papel siendo til en Anlisis de protenas, pigmentos y azcares. Identificacin de un compuesto. Seperacionesa pequea escala de diversos compuestos.

Figura 19.21. Clasificacin de la cromatografa de acuerdo los implementos a utilizar.

122

4. Cerraremos esta seccin mencionando la extraccin, tcnica que permite separar disoluciones (slido/lquido) o mezclas de slidos (slido/slido), basada en la distribucin de los componentes en dos lquidos inmiscibles. Por lo general, se emplea para aislar productos orgnicos de: fuentes naturales, mezclas de reaccin, disoluciones o suspensiones acuosas. En el caso de las disoluciones, debe agregarse otro disolvente, inmiscible con el primero, que conlleve a la distribucin del soluto en ambos lquidos, distribuyndose mayoritariamente en el nuevo disolvente, y logrando que muy poco soluto quede disuelto en el disolvente original de la disolucin. En el caso de una mezcla slido/slido, se requerir de la disolucin de los slidos con un disolvente, para luego agregar un segundo disolvente inmiscible con el anterior, que sea capaz de disolver slo a uno de los slidos (solutos) sin interactuar con el otro. De esta forma se produce la distribucin de los slidos en los diferentes lquidos. Estas separaciones normalmente se realizan aprovechando las propiedades cidas, bsicas y neutras de los compuestos. Una vez distribuidos los slidos en los dos lquidos inmiscibles, se deja en reposo el sistema para finalmente decantarlos.

Cloroformo Cloroformo ms violeta de cristal

Agua destilada

Agua destilada ms violeta de cristal

Figura 19.22. Extraccin de violeta de cristal disuelto en agua usando cloroformo.

Analiza la naturaleza de las sustancias que componen la mezcla y hazte preguntas que te lleven a decidir los procedimientos y tcnicas que conviene utilizar, por ejemplo Cmo proceder a la separacin? Ser necesario disolver? Si ambos componentes se disuelven Podr separarlos?
123

Contribuyendo y construyendo al mezclar y separar


La naturaleza proporciona elementos y compuestos mezclados entre s y cuando los separa o transforma a travs de algn procedimiento, cada componente y producto conserva el equilibrio ecolgico. En cambio, cuando el ser humano separa y sintetiza la sustancia deseada se forman productos o subproductos que no siempre favorecen al ambiente ni a s mismo y como consecuencia deteriora el planeta. Has notado que algunos vehculos emanan humo de color blanco o negro y que otros no lo hacen? Te has sentido asfixiada o asfixiado por estas emanaciones? Es desagradable percibir este humo con nuestros sentidos. Cierto? La revisin y chequeo del vehculo, sea de uso personal o transporte colectivo, permitir que se realice una buena mezcla airecombustible, logrando as que la combustin de la gasolina se complete, lo cual evita las emisiones de monxido de carbono (CO2) que nos afectan y favoreciendo las de dixido de carbono (CO2), el cual es menos txico. Mantener el vehculo en condiciones mecnicas ptimas es insuficiente como contribucin para evitar alterar la composicin natural de la mezcla del aire que respiramos. Aunque su uso nos brinda confort y acorta el tiempo necesario para desplazarnos de un lugar a otro, el dixido de carbono liberado (CO2) altera el equilibrio del Ciclo del Carbono al acumularse en la atmsfera, y afecta seriamente las condiciones climticas, evidentes en el presente a escala mundial. Caminar y desplazarte en medios de transporte ecolgico y deportivo (bicicleta) promueven bienestar, salud fsica y emocional a las personas y al ambiente. Pudieras realizar alguna accin que evite otros tipos de contaminacin? La mayora de nuestras acciones cotidianas renen sustancias que generan mezclas fciles de separar en el hogar y la oficina (desechos slidos), esto sera un buen comienzo. Cada elemento tomado de la naturaleza debera regresar a la misma sin repercusiones negativas, formemos equipos y revirtamos la tendencia del calentamiento global, seamos coherentes en nuestras acciones y concienticemos sobre la importancia de formar y separar mezclas con responsabilidad. Da ejemplo al colocar cada desecho en el lugar ms apropiado para su reaprovechamiento. Es necesario seguir organizndonos para poder exigir a las empresas que nos venden productos, que se hagan responsables y contribuyan con la recuperacin y conservacin de nuestro planeta.

124

Qu compone a cada tinta?


Tu grupo reciben tres bolgrafos diferentes de tinta negra y una nota de papel escrita con alguno de ellos, en la que dice: Averigen con qu tinta fue escrita esto. Los invitamos a debatir sobre este problema. Analicen el problema Plantense algunas preguntas para iniciar el debate como por ejemplo: Qu caractersticas o evidencias tienen para argumentar que la tinta es una mezcla? Qu tipo de mezcla es? Cmo pueden verificar esta respuesta? En qu estado fsico parece que se encuentran sus componentes? Cmo podemos saber cuntos componentes la constituyen? Comparen ventajas y desventajas de los procedimientos que podran ser tiles para separar este tipo de mezclas. Un procedimiento posible. A continuacin les proponemos la tcnica de cromatografa en papel para separar los componentes de la tinta. Propongan una hiptesis acerca de lo que esperan observar en cada caso al utilizar esta tcnica de separacin, si la tinta est compuesta por 2 o por 3 sustancias puras. Cada grupo puede trabajar con la tinta de un bolgrafo y luego integrar los resultados para dar respuesta a la tarea. Discutan como se realiza esta tcnica y que materiales necesitarn. Qu necesitan? En funcin de lo anterior preparen una lista con los materiales y bsquenlos. Cmo lo harn? Recorten el papel en tiras e ideen un modo para que queden colgadas en el recipiente. Dibujen uno o ms puntos de tinta separados entre s, tal que queden a una cierta distancia del borde inferior y lateral. En un recipiente transparente, agreguen el solvente (alcohol) de manera que la altura del lquido quede por debajo de los puntos aplicados al introducir las tiras.
125

Coloquen las tiras de papel con los puntos dibujados suspendido en el borde del recipiente, sin tocar sus paredes. Qu sucede? Retiren la tira del recipiente y dejen secarlas. Anlisis de las observaciones Qu sucedi con cada punto pintado en las tiras? Los puntos de las diferentes tintas se comportaron igual? Qu fenmeno o fenmenos explican este efecto? Cuntos componentes conforman cada tinta? Qu pueden hacer con la nota para saber con cul de las tintas fue escrita? Compartan los resultados con otros grupos y generen una conclusin general. Conversen adicionalmente sobre: Cules ventajas y desventajas pueden atribuirle a esta tcnica en la separacin? Ventajas y desventajas al emplear procedimientos alternativos.

Confeccionando instrumentos para separar mezclas Tal vez has ledo acerca de los derrames petroleros y el impacto ecolgico que tienen. Qu caractersticas tienen los componentes de esta mezcla? Cul o cules procedimientos de separacin utilizaras para separar el petrleo y el agua del mar? Qu caractersticas deben tener los lquidos a separar con el procedimiento de decantacin? Qu materiales necesitarn para llevar a cabo la separacin de estos dos componentes? Los invitamos a construir los embudos para el procedimiento de decantacin y a probarlos con una mezcla de aceite comestible y agua. Qu pueden usar? Recipiente plstico, objeto que permita perforar el plstico, inyectadora sin aguja, manguera o tubo de goma y gancho o pinza de ropa. Cmo lo harn? Considerando los materiales antes mencionados o algunos otros de los cuales dispongan o consideren ms apropiados, diseen un embudo de adicin con llave que permita controlar el flujo y otro sin ella. Comparen los embudos diseados y discutan la efectividad de cada uno para la separacin de una mezcla parecida a la de petrleo/agua de mar, el agua/aceite.
126

Planifiquen el procedimiento para evaluar la calidad de los embudos. Cul ofrece ms ventajas en la separacin de mezclas de lquidos? Cmo es el aspecto de los componentes de la mezcla antes y despus de la separacin? Influye el orden en el cual se adicionan los componentes para la preparacin de la mezcla a separar posteriormente?. Discutan acerca de la pureza de los componentes separados y la eficacia del procedimiento. Una vez separados los componentes de la mezcla cmo procedern a desechar los componentes. Pudieran ser reaprovechados? Servir este procedimiento para separar el aceite del agua en la caeras de los desages.

Actividades de autoevaluacin
1.Qu propiedades o caractersticas de los componentes de las mezclas podemos considerar para seleccionar el mtodo de separacin? 2. Adems de la separacin de las sustancias, qu otras aplicaciones tienen las tcnicas de cromatografa y cristalizacin? 3. Elabora un esquema con los procedimientos de separacin de acuerdo a alguna o algunas propiedades fsicas de los componentes de la mezcla a separar, distintas al estado fsico de los mismos. 4. De los siguientes materiales: petrleo, cuarzo, leche, leja, sangre, agua, oxgeno, gasolina, cules son mezclas? Qu tipo de mezclas son? Cules son las sustancias que componen a esas mezclas? Qu mtodo o mtodos de separacin se pueden emplear para separar sus componentes? 5. Elabora una lista de mezclas que para separar sus componentes involucren la aplicacin de un solo procedimiento, y otra lista de mezclas que puedan separarse mediante dos o ms procedimientos diferentes. 6. En las diferentes actividades productivas que se llevan a cabo en las comunidades (comercio, industria, construccin, residenciales, escolares, salud, otras), qu mezclas se emplean? Qu utilidad tienen? Qu tipo de mezclas son? Qu tcnicas de separacin de los componentes se emplean? 7. Establece las diferencias entre sustancias y mezclas; sustancias puras y compuestos; mezclas homogneas y heterogneas.

127

20

Concentrados en las disoluciones


128

El agua potable, el vinagre, los lquidos de limpieza, el alcohol de uso tpico, los sueros, los refrescos, el aire, el ocano, la parte lquida de las clulas vivas, son ejemplos de las mezclas homogneas que nos rodean. Algunas de ellas son cristalinas, incoloras o incluso inodoras, parecen una sustancia pura (el agua) an cuando son disoluciones. Estamos todo el tiempo expuestos a sustancias y disoluciones qumicas, por lo general, las preparamos y utilizamos sin preocuparnos por su concentracin. Por ejemplo, la disolucin de hipoclorito de sodio (NaClO) empleada en eliminar las impurezas y destruir los microorganismos del agua o para blanquear la ropa. Dependiendo de su concentracin puede representar riesgos respiratorios, cutneos o digestivos por exposicin, as como peligros cuando reacciona de manera violenta y produce gases nocivos. Las concentraciones a las cuales podemos exponernos mediante inhalacin, ingestin, y absorcin, considerando si dicha exposicin es en lugares abiertos o cerrados, si su duracin es corta, prolongada o repetida y si permanecemos o acudimos por razones de trabajo, estn reguladas por la Comisin Venezolana de Normas Industriales, COVENIN. Gran cantidad de los productos manufacturados resultan de la combinacin de los componentes en ciertas proporciones, esto determinar la concentracin y la efectividad de la disolucin resultante, as como, la posibilidad de que representen un riesgo para la salud, generando efectos adversos por exposicin. Por ello nos ser til aprender y familiarizarnos con los componentes, propiedades y caractersticas, y los factores que influyen en produccin de las disoluciones.

Los componentes necesarios en una mezcla


Cuando preparas una bebida instantnea en polvo, mezclas cierta cantidad del contenido del sobre con determinado volumen de agua, obteniendo una mezcla homognea (con sabor a naranja, por ejemplo) que corresponder a una disolucin slido-lquido. La indistinguibilidad de los ingredientes a simple vista o a travs de los mtodos analticos tradicionales las identifica como mezclas homogneas.
Figura 20.1. Disoluciones a partir de mezclas slido-lquido.

Las mezclas homogneas resultan de la disolucin de un componente en otro y pueden producirse entre sustancias con iguales o diferentes estados fsicos. Por ejemplo, algunas aleaciones resultan de la disolucin de un metal en otro (latn), tambin se producen disoluciones de lquidos en slidos (amalgama dental) y gases en slidos (iceberg) (Figura 20.2). Las disoluciones ms comunes estn formadas por dos componentes: el que se dispersa denominado soluto y el medio dispersante, denominado disolvente.

Figura 20.2. Disoluciones entre sustancias con diferentes estados fsicos.

An cuando las ms comunes son de dos componentes, podrs combinar ms de un soluto con uno o ms disolventes. Ejemplo de ello es el acero inoxidable, constituido por hierro (Fe: 73%), cromo (Cr: 18%), nquel (Ni: 8%) y carbono (C: 1%) (Figura 20.3).
129

Generalmente, las disoluciones utilizadas en laboratorios y a escala industrial estn formadas por slidos o lquidos dispersos en lquidos. El disolvente ms frecuente es el agua, a estas disoluciones se les denomina disoluciones acuosas.

Figura 20.3. Disolucin de acero inoxidable y sus componentes.

Indistintamente del estado fsico del o los solutos y del o los disolventes, la masa (m) y el volumen (V), (por lo general en g y cm3), de la disolucin se relaciona con sus componentes a travs de las expresiones planteadas a continuacin:

Masadisolucin = masasoluto + masadisolvente mdisolucin = msoluto + mdisolvente Volumendisolucin = volumensoluto + volumendisolvente vdisolucin = vsoluto + vdisolvente
La primera relacin establece que la masa de determinada disolucin es igual a la sumatoria de la masa del soluto y la masa del disolvente. As mismo, puede determinarse el volumen de la disolucin, mendiante la sumatoria del volumen del soluto y el volumen del disolvente. Para conocer la masa o volumen de la disolucin a partir de las masas y volmenes de sus componentes, bastar con utilizar estas relaciones, y para determinar la cantidad de soluto o de disolvente utilizada para determinada cantidad de disolucin, conociendo la cantidad de disolvente o soluto empleada, puedes despejarlas.

mdisolucin = msoluto1 + msoluto 2 + mdisolvente Vdisolucin = Vsoluto1 + Vsoluto 2 + Vdisolvente mdisolucin = msoluto1 + msoluto 2 + mdisolvente1 + mdisolvente 2 Vdisolucin = Vsoluto1 + Vsoluto 2 + Vdisolvente1 + vdisolvente 2
Figura 20.4. Ecuaciones que permitirn relacionar los componentes de la disolucin con ms de dos solutos o disolventes.

130

Otra propiedad importante es la de densidad, la cual corresponde a la proporcin entre la masa de una sustancia y el volumen que ocupa. Recuerda que la densidad es una propiedad caracterstica de las sustancias.

Densidad =

Masa Volumen mdisolvente Vdisolvente


Unidad en el Sistema Internacional (SI) Equivalencia entre unidades en el SI

disolvente =
Nombre de la magnitud Tipo de magnitud Escalar (un nmero ms una unidad fsica) Smbolo

Densidad

d,

kg/m3

103 kg/m3 = 1 g/cm3

Tabla 20.1. Descripcin de la magnitud densidad.

Una preparacin insuperable!


Cuntas veces has sentido que una bebida tiene un sabor indeseado? Muy aguado o muy espeso? Inspido, dulce o salado? Cuando vas a preparar alguna comida o bebida requieres adems de los instrumentos para su elaboracin (ollas, utensilios, licuadora, entre otras u otros), los alimentos que sern mezclados o cocidos. La textura o consistencia de un jugo depende de la cantidad de fruta que se emplea respecto al volumen de agua utilizada para el mismo. Dependiendo del gusto de cada persona podr realizarse la mezcla en diferentes proporciones fruta/agua para que sea ms o menos fuerte su sabor o ms o menos denso. Cuando queremos rendir el jugo o hacerlo ms fcil de tomar aumentamos la cantidad de agua, es decir, variamos su concentracin. En este apartado nos centraremos en algo parecido a lo descrito, en las cantidades de ingredientes (componentes) necesarios para preparar disoluciones (mezclas homogneas) slido-lquido o lquido- lquido, con especificaciones determinadas de cada componente tal que posean la consistencia, textura y sazn deseada (concentracin). Las disoluciones tienen aplicaciones tanto en la cocina, como en muchos otros quehaceres del hogar. Si verificas las etiquetas de algunos de los productos de limpieza, de alimentos disponibles en tu hogar e incluso en los medicamentos almacenados para primeros auxilios, notars que estn constituidos por dos o ms componentes, y que en ellos se refleja la cantidad de cada uno.
131

Figura 20.5. Algunas disoluciones de uso cotidiano.

Las disoluciones pueden clasificarse de acuerdo con diversos de criterios. El primero se basa en la cantidad de componentes que las constituyen, para nombrarlas se usan las palabras contenidas en la tabla 20.2. N Componentes 2 3 4 Trmino Binario Ternario Cuaternario N Componentes 5 6 7 Trmino Quinario Senario Septenario

Tabla 20.2. Trminos que indican el nmero de componentes de una disolucin.

Solubilidad, otro criterio de clasificacin de las disoluciones Otro criterio que conlleva a la clasificacin de las disoluciones es la cantidad de soluto que se aade al disolvente al preparar la disolucin. Segn la cualidad de cada soluto, este se disolver en mayor o menor proporcin (cantidad) en un determinado disolvente. Esta propiedad es caracterstica para cada soluto e invariable para un mismo disolvente a una temperatura determinada y se denomina solubilidad. En la tabla 20.3 observars los valores de solubilidad de algunos solutos en agua. En ella se presentan diferentes solutos en estado slido que se solubilizan en agua, sin embargo, cada uno lo hace en diferente proporcin. Si comparas los datos vers que todos los solutos fueron disueltos en la misma cantidad de disolvente, lo cual facilita visualizar cmo difieren sus solubilidades. Cuando estamos preparando alimentos notamos que tanto la sal como el azcar son solubles en agua y que ocurre un cambio en el sabor de la misma, sin embargo, ignoramos la diferencia de solubilidad que presenta cada una de ellas en la misma cantidad de agua.

132

Soluto C12H22O11 (Sacarosa, azcar) CH4N2O (Urea) NaCl (Sal comn) NaHCO3 (Bicarbonato de Sodio) H3BO3 (cido Brico)

Solubilidad en 100 cm3 agua 200,00 g 100,00 g 36,00 g 9,60 g 5,04 g

Tabla 20.3. Solubilidades de diferentes solutos en agua a 20 C. Como la densidad del agua es aproximadamente igual a la unidad (1 g/cm3), 100 g de H2O 100 cm3 de H2O.

Si comparas la cantidad de azcar que puedes disolver en 100 cm3 de agua respecto a la cantidad de sal, calcularemos que el azcar se disuelve cinco veces y media ms que la sal (5,5 veces aprox.). Observa de nuevo la tabla y notars que puedes disolver en el mismo volumen de agua: casi el doble (2) de bicarbonato de sodio que de cido brico; aproximadamente siete (7) veces mas de sal comparada con el cido brico; en el caso de la urea lograras disolver veinte (20) veces ms que de cido brico y la mitad la mitad respecto a la cantidad de azcar. En la figura 20.6 se representa esta relacin de solubilidades usando el cido brico como patrn de comparacin, siendo este ltimo el menos soluble y el azcar el soluto ms soluble en agua.

Figura 20.6. Proporcin de azcar, urea, sal y bicarbonato de sodio respecto al cido brico.

133

Estos valores de solubilidad son caractersticos para cada sustancia, ellos estipulan la cantidad mxima de soluto que puede disolverse a la temperatura de 20 C y permiten definir el segundo criterio de clasificacin de las disoluciones. La cantidad de soluto disperso en la disolucin permite clasificar las disoluciones en insaturada, saturada y sobresaturada. En general, podemos plantear que cuando la cantidad de soluto disuelto en gramos sea menor que el valor de solubilidad, la disolucin estar insaturada y cuando la cantidad supere dicho valor la disolucin se habr sobresaturado. Podemos contrastar la clasificacin anterior con la preparacin de una disolucin de sal comn en 100 cm3 de agua; cuando la cantidad de sal disuelta sea menor a 36 g, la disolucin ser insaturada, mientras que cuando la cantidad de sal disuelta sea mayor a 36 g ser una disolucin sobresaturada. En ambas circunstancias se est limitando o excediendo la cantidad de sal que puede disolverse a temperatura ambiente. Entonces, cuando la cantidad de soluto disuelta corresponda en magnitud con el valor de solubilidad (36 g/100 cm3) la disolucin estar saturada (Figura 20.7). Si pensamos nuevamente en el valor de solubilidad de la sal indicado en la tabla 20.2, (36 g de sal en 100 cm3 de agua), podemos inferir que los alimentos que preparamos se realizan en disoluciones acuosas insaturadas de sal, pues habitualmente la cantidad de agua es superior a 100 cm3 y la cantidad de sal es inferior a 36 g.

Figura 20.7. Tipos de disoluciones: insaturada, saturada y sobresaturada. Valores para sal y agua.

134

La tabla 20.4 contiene las solubilidades de tres solutos diferentes en disolventes distintos al agua, como notars, el valor de la solubilidad cambia al variar el disolvente (compara esta tabla con la anterior). La cantidad mxima de azcar que puede disolverse en 100 g agua es de 200 g, en cambio esa cantidad disminuy marcadamente a 0,9 g de azcar al disolverlo en 100 g de alcohol. En el caso de la urea se aprecia una disminucin menos drstica de la solubilidad al cambiar el disolvente. Sin embargo, en el caso del cido brico se aprecia un aumento en la solubilidad de cuatro (4) veces aproximadamente al cambiar el disolvente de agua a glicerina.

Soluto C12H22O11 (Sacarosa, azcar) CH4N2O (Urea) H3BO3 (cido Brico)

Disolvente CH3CH2OH (Alcohol etlico) CH3CH2OH (Alcohol etlico) C3H8O3 (Glicerina)

Solubilidad 0,9 g en 100 g 20,0 g en 100 g 22,2 g en 100 g

Tabla 20.4 Solubilidad de sacarosa y urea en alcohol etlico y de cido brico en glicerina.

Las disoluciones sobresaturadas se preparan aprovechando el aumento de solubilidad producido cuando incrementamos la temperatura. Sin embargo, una vez preparadas deben mantenerse sin perturbaciones ya que puede producirse la precipitacin del soluto disuelto en exceso, pasando a ser saturada. Alcanzar la sobresaturacin de una disolucin es ms complicado de lo que pareciera, ya que estas disoluciones son inestables y el exceso de soluto tiende a precipitarse generando la presencia de dos fases, una slida (soluto en exceso) y una lquida constituida por la disolucin saturada incapaz de disolver ms soluto. Recordemos que las disoluciones son mezclas homogneas y por lo tanto, solo tienen una fase, en estos casos lquida, al menos a simple vista (Figura 20.8).

Figura 20.8. Fases presentes en mezclas homogneas. Ejemplos con azcar y agua.

135

Variacin de la solubilidad con la temperatura del disolvente Para alcanzar la saturacin de una disolucin, por ejemplo agua con sal, debes agitar vigorosamente para favorecer el proceso y muchas veces toma ms del tiempo deseado. Si haces un poco de memoria recordars que para preparar atoles, arroz, pasta o granos, por lo general adicionas sal al agua. En qu momento de la preparacin la adicionas, cundo el agua est fra o caliente? En cul de estos dos casos observas que ocurre la disolucin con mayor rapidez? De igual forma, cuando adicionas azcar al agua fra notars que tarda ms tiempo en disolverse que cuando has calentado ligeramente el agua antes de su adicin, esto se debe a que normalmente, la solubilidad de los solutos se incrementa al aumentar la temperatura del disolvente.

Figura 20.9. Grfico de la cantidad de sal (g) disuelta en 100 g de agua en funcin de la temperatura, para diferentes sales (cloruro de sodio, NaCl; nitrato plumboso, Pb(NO3)2; nitrato potsico, KNO3; cloruro de potasio, KCl).

136

Algunas sustancias como el cloruro de sodio (NaCl) o el cloruro de potasio (KCl) aumentan poco su solubilidad al incrementar la temperatura del agua, otras como el nitrato plumboso (Pb(NO3)2) o nitrato potsico (KNO3) aumentan considerablemente su solubilidad en agua al aumentar la temperatura de la misma. Sin embargo, no en todos los casos es as. Hay solutos cuya solubilidad disminuye con el aumento de la temperatura del solvente, como podrs notarlo en la grfica de la figura 20.10; en ella se aprecia que hay gases como el helio (He) cuya solubilidad disminuye poco con el incremento de la temperatura y otros en donde, disminuye marcadamente al incrementar la misma, como por ejemplo el metano (CH4).

Figura 20.10. Grfico de la variacin de la cantidad de gas (g) en funcin de la temperatura, para un volumen constante de 1L, para cuatro gases diferentes. Metano (CH4), oxgeno (O2), Monxido de carbono (CO) y Helio (He).

137

Determinacin de la concentracin de las disoluciones Muchas preparaciones gastronmicas se realizan al ojo por ciento, es decir, modificamos las cantidades sugeridas sin preocuparnos de la solubilidad, de acuerdo a las necesidades o gustos. A escala de cualquier industria o laboratorio, es necesario conocer con precisin la concentracin de las disoluciones, por lo que las cantidades a combinar deben manejarse con rigurosidad. Por ahora, nos limitaremos a comprender cmo determinar la concentracin en trminos porcentuales para disoluciones binarias. Las ecuaciones que permiten calcularlas relacionan los valores de masa o volumen de soluto con los valores de masa o volumen de disolucin, tal como se muestra a continuacin: Concentracin masa-masa:

masa de soluto x 100 (sin unidades, expresado en %) masa de disolucin masa de soluto x 100 (g/cm3, expresado en %) volumen de solvente

Concentracin masa-volumen:

volumen de soluto Concentracin volumen-volumen: x 100 (sin unidades, expresado volumen de disolucin en %)
En estas relaciones se toman valores de disolucin fijos, por lo que se interpretan de la siguiente manera: El porcentaje masa (% m/m) seala cuntos gramos de soluto se disuelven en 100 masa g de disolucin.

masa (% m/v) expresa la cantidad de gramos de soluto que se volumen disolvieron en 100 cm3 de disolucin.
El porcentaje

volumen (% v/v) indica los centmetros cbicos de soluto disueltos en volumen 100 cm3 de disolucin.
El porcentaje Sabas que? Al consumir refresco descalcificas tus huesos, te predispones a padecer diabetes, anemia, alergias, te generas daos a nivel neurolgico, deterioras tu flora intestinal (afectando la coagulacin de la sangre). Una lata contiene 5 cucharadas de azcar, lo que representa el 60% del contenido y el 80% del consumo diario requerido de azcar por nuestro organismo.

138

Generalizamos estas unidades de concentracin como aquellas que relacionan la cantidad de soluto disuelto en 100 g o 100 cm3 de disolucin. Cada ecuacin relaciona implcitamente la cantidad total de soluto disuelto con la cantidad total de disolvente. Recordemos que la cantidad de disolucin es igual a la suma de las cantidades de soluto y disolvente, ya sea en medidas de masa o de volumen. Para aplicar con xito las frmulas de porcentaje debes preguntarte qu quieres determinar, cul es la finalidad del clculo y cules son los valores que conoces. As mismo debers recordar cmo despejar las frmulas, pues es innecesario que las aprendas todas, si sabes una de ellas, podrs deducir la que necesites. Los procedimientos para despejar que aprendiste en matemtica sern los mismos a emplear en ciencias. Aplcalos en cualquiera de las frmulas.

1. Hemos preparado una disolucin que sirve para el cuidado de la madera con 473 cm de aceite mineral y 2 cucharadas de vinagre (9,8 cm3), y queremos determinar su valor de concentracin para futuras preparaciones.
3

Anlisis: Para determinar la concentracin de esta disolucin, parece conveniente hacerlo en trminos del % v/v. Por qu? Para ello es necesario conocer el volumen de soluto y el de disolucin expresadas en centmetros cbicos. Componentes: 473 cm3 de aceite mineral y 9,8 cm3 de vinagre blanco (2 cucharadas). Identificamos el soluto, el disolvente y la disolucin.

Soluto vinagre blanco Disolvente aceite animal Disolucin preservativo de madera


Indicamos y determinamos la cantidad de volumen (con sus respectivas unidades) de cada componente de la disolucin, incluida la misma. Soluto: volumen: 9,8 cm3 Disolvente: volumen: 473 cm3 Disolucin: volumen: desconocido. El volumen de disolucin corresponde a la suma de los volmenes conocidos de soluto y disolvente:

Vdisolucin = Vsoluto + Vdisolvente

139

Entonces, Vdisolucin = 9,8 cm3 + 473 cm3 = 482,8 cm3 Determinamos ahora la concentracin de % v/v en la disolucin.

%v / v =

Volumensoluto x 100 Volumendisolucin

%v / v =

9, 28 cm3 x 100% 482,8 cm3

% v / v = 2, 03%

2. Una disolucin casera para repeler insectos est preparada con 1 cucharada de alcanfor, 1 cucharada de cloruro de calcio y taza de alcohol desnaturalizado. Queremos saber cul es la concentracin de los solutos en el disolvente para preparar otras cantidades. Anlisis: Como se plante en el ejercicio anterior, para determinar la concentracin en trminos del % v/v es necesario conocer el volumen de soluto y de disolucin. Para poder expresar el volumen de disolucin es necesario sumar el volumen de cada soluto con el volumen de disolvente. La unidad de volumen ms adecuada es el cm3. Sin embargo, solo pudimos obtener la medida de masa de la cantidad de los solutos, por lo que tenemos que determinar la concentracin con la relacin % m/v. Para obtener el volumen de soluto conocida su masa, es necesario utilizar los valores de densidad de cada soluto. Recuerdas como se relacionan masa y volumen en esta magnitud? Componentes: 15 g de alcanfor (1 cucharada), 15 g de cloruro de calcio (1 cucharada) y 120 cm3 de alcohol desnaturalizado (1/2 taza). (dcloruro de calcio = 2,16 g/cm3 y dalcanfor = 0,99 g/cm3) Identificamos los solutos, el disolvente y la disolucin.

Soluto alcanfor y cloruro de calcio Disolvente aceite desnaturalizado Disolucin repelente de insectos Indicamos y determinamos la cantidad de cada componente de la disolucin (con sus respectivas unidades), incluida la misma.
Soluto 1(alcanfor): masa: 15 g; volumen: desconocido. Soluto 2 (cloruro de calcio): masa: 15 g; volumen: desconocido. Disolvente: masa: desconocida; volumen: 120 cm3. Disolucin: masa desconocida; volumen desconocido. Como requerimos el volumen de la disolucin y necesitamos conocer los volmenes de ambos solutos, para ello buscamos el valor de la densidad de cada uno en los textos, con esto, la masa de ambos solutos y el concepto de densidad, los obtenemos:

Volumenalcanfor =

15 g = 15,15 cm3 0,99 g / cm3 15 g = 6,94 cm3 3 2,16 g / cm

Volumencloruro de calcio =
140

El volumen de disolucin se obtiene con:

Vdisolucin = Vsoluto1 + Vsoluto 2 + Vdisolvente Vdisolucin = 15,15 cm3 + 6,94 cm3 + 120 cm3= 142,09 cm3
As, determinamos el %m/v de alcanfor en la disolucin.

% m / valcanfor = % m / valcanfor =

masaalcanfor Volumendisolucin

x 100

15, 0 g x 100 (15,15 + 6,94 + 120 ) cm3

% m / valcanfor = 10,56
Determinamos el %m/v de cloruro de calcio en la disolucin.

% m / vcloruro de sodio = % m / vcloruro de sodio =

masacloruro de sodio Volumencloruro de sodio

x 100

15, 0 g x 100 (15,15 + 6,94 + 120 ) cm3

% m / vcloruro de sodio = 10,56

Figura 20.11. a) Conservacin de la madera. b) Control de plagas.

Concluimos entonces que, los criterios para clasificar las disoluciones se basan en el nmero de componentes que la forman y en la cantidad de soluto capaz de disolverse en un disolvente especfico. An cuando la mezcla se realice entre dos slidos, un slido y un lquido o dos lquidos, podr determinarse su concentracin o en su defecto, dar nociones acerca de su concentracin, es decir, de la cantidad del soluto de inters en relacin a la cantidad de disolvente en dicha mezcla.

141

Concentraciones en la cotidianidad
Recuerdas haber ido al mdico, ser diagnosticado y medicado? Algunas de las medicinas requieren para su compra la presentacin del rcipe, otras no. Indistintamente de la facilidad de su adquisicin, el rcipe indica la cantidad, concentracin y nmero de veces que debemos consumir un determinado medicamento para mejorar nuestra salud. Una vez que los medicamentos son ingeridos y comienzan a ejercer efecto, su concentracin en nuestro organismo, se mantiene constante siempre y cuando los tomemos en los horarios establecidos; excederse u obviarlo altera esa concentracin, disminuyendo su eficacia y generando efectos adversos. No solamente las dosis de medicamentos y sustancias qumicas nos puede afectar, tambin, algunos alimentos en ciertas proporciones o combinaciones pueden generan alteraciones de las concentraciones de azcar o grasa en nuestro torrente sanguneo. La ingesta de sal en exceso afecta la tensin arterial (problemas cardiovasculares) y el exceso de azcar conduce a la obesidad y te hace propenso a padecer diabetes. En nuestro organismo los minerales deben mantener su concentracin en un rango de valores establecido para que permitan su adecuado funcionamiento. La industria alimentaria regida por la norma COVENIN 910:2000 establece el listado de aditivos qumicos permitidos para la fabricacin, preparacin, elaboracin, tratamiento, envasado, empaquetamiento y conservacin durante el transporte y almacenamiento de alimentos. La cantidad de aditivos alimentarios que una persona puede ingerir sin riesgos apreciables para su salud, se denomina Ingesta Diaria Admisible (IDA), se expresa en mg/kg (normalmente para una persona de 60Kg). Otros aditivos son incorporados con una ingesta diaria admisible sin limitacin (SL), sin asignar (SA) o sin especificar (SE). Es necesario realizar mesas de trabajo e investigaciones que debatan sobre los efectos del uso de los colorantes artificiales, edulcorantes artificiales, estabilizadores, preservativos, saborizantes, entre otros aditivos alimentarios, en alimentos mayoritariamente de bajo valor nutritivo, es decir, usados casi exclusivamente en alimentos chatarra. As como, profundizar en el anlisis de las consecuencias del uso de fungicidas e insecticidas para el control de plagas, tal que su aplicacin considere las previsiones del caso y evite la contaminacin del producto alimenticio. Promover la disposicin final en forma racional y sostenible de dichos productos es vital, ya que stos pueden ser altamente nocivos, se acumulan y se concentran en los suelos, en los seres vivos e incluso en la cadena alimenticia. El estado venezolano, a travs de un equipo multidisciplinario, realiza acciones para controlar la produccin, uso, distribucin y manejo de productos qumicos peligrosos para la poblacin, tanto en las industrias como en otras actividades.

Aditivos en alimentos: cido ctrico y gelatina (SE); citrato de sodio, aspartame, acesulfame-K (SA); cido fumrico (6 mg/ kg), Azul N1 (12,5 mg/kg).

142

Preparando y cuantificando disoluciones

Conocer la concentracin de las disoluciones preparadas cotidianamente puede resultar til para facilitar su preparacin y repetir aquellas que resultaron efectivas o deliciosas. A continuacin, dispondrs de diferentes solutos y suficiente agua para preparar disoluciones acuosas usuales con precisin. Qu necesitan? Materiales 300 cm3 Agua. 160 cm3 Agua potable. 110 g Sal comn. 40 g Azcar. 6 Frascos de vidrio. Balanza. Plancha de calentamiento o Mechero, rejillay y soporte. Soluto alcanfor cloruro de calcio Beaker 250 cm3. Disolvente Pinza para beaker. aceite desnaturalizado Agitador o varilla de vidrio. Vidrio de reloj o papel aluminio. Disolucin repelente de insectos Cmo lo harn? Experiencia 1 La meta es preparar una disolucin de azcar al 40% m/v utilizando 100 cm3 de agua. Determinen la cantidad de soluto y solvente necesaria. Qu observan? Se disolvi completamente el azcar? (calentar de ser necesario). Experiencia 2 Preparar una disolucin de agua salada con la misma cantidad de disolvente anterior, tal que sea saturada. Qu observan? Se disolvi completamente el soluto? Se alcanza la disolucin total del soluto? Tapen el beaker con un vidrio de reloj o papel de aluminio y dejen en reposo hasta el prximo da. Anoten las observaciones acerca de la homogeneidad de la mezcla al terminar esta sesin.

143

Experiencia 3 Preparen una disolucin sobresaturada con el mismo soluto de la experiencia 2. Permitan reposar a temperatura ambiente. Una vez se alcance la temperatura ambiente, agiten la disolucin vigorosamente. Qu observaron durante el desarrollo de la experiencia? Qu ocurri cuando perturbaste la disolucin? Qu tipo de disolucin obtuviste despus de perturbar el sistema?

Mechero, rejilla, beaker y pinza para beaker. Frascos de vidrio.

Experiencia 4 Se emplearn 37 g de cloruro de sodio (NaCl) y 75 cm3 de agua potable para preparar una disolucin. La composicin porcentual de la disolucin obtenida es el doble de la deseada. Cmo proceder experimentalmente para disminuir la concentracin al valor deseado? Si han sido cuidadosos en las preparaciones de estas disoluciones, prueben las disoluciones contenidas en cada frasco y comparen su sabor. Qu concluyen? Para finalizar: Clasifiquen las disoluciones preparadas en trminos cualitativos. Comparen las observaciones obtenidas en la experiencia 2 y 3, en lo que se refiere a la disolucin del cloruro de sodio en agua.

144

Te identifico con un haz de luz!

Muchos lquidos de uso y consumo cotidiano estn constituidos por partculas tan pequeas que son indistinguibles al observarlas con un microscopio, en otras pueden diferenciarse a simple vista, por lo tanto corresponden a distintos tipos de mezclas. Tal vez te has preguntado. Cmo podemos distinguir entre los tipos de mezclas homogneas sin utilizar un microscopio? A continuacin proponemos una variedad de mezclas para clasificarles como disoluciones, coloides o suspensiones. Cul procedimiento consideran adecuado si no disponen de un microscopio? Qu necesitan?

Agua, leche, tmpera, pegamento, mayonesa, champ, yogurt. Sal, azcar, harina, azufre, gelatina en polvo. Beaker o recipientes de vidrio lisos y transparentes para contener las mezclas. Varilla de vidrio o tenedor plstico para agitar. Laser (es peligroso para la retina, puede cegar al iluminar el ojo). Una linterna con pilas de poco uso que generen luz con buena intensidad. Un cartn 10 x 10 cm con una base que permita ubicarlo en posicin vertical.

Cmo lo harn?

A continuacin proponemos la utilizacin de un haz de luz para diferenciar disoluciones de coloides y stos ltimos de suspensiones (agrpense). En caso de no disponer de un laser: Perforen el cartn generando un agujero en el centro. Ubiquen la linterna sobre una superficie estable. Modifiquen la distancia entre el cartn y la linterna (AB) para generar la mxima intensidad del haz de luz (pueden utilizar una lmina de color oscuro como pantalla para visualizar mejor el haz de luz). (Figura 20.12). Ubiquen el recipiente con la mezcla sobre una superficie estable tal que el rayo de luz atraviese la mezcla y detallen cmo es la trayectoria y el paso del haz de luz a travs de cada mezcla.

145

Figura 20.12. Montaje experimental.

Analicen las observaciones, reflexionen sobre preguntas como: Identifiquen el tipo de mezcla y el estado fsico de los componentes. Pueden apreciar el haz de luz a travs de la mezcla contenida en el recipiente de vidrio? Cmo es el haz cuando atraviesa las mezclas? Qu indica el cambio en el aspecto del haz? Concluyan con el grupo, cules son las caractersticas que diferencian las disoluciones de los coloides y estos ltimos de las suspensiones?

Actividad de autoevaluacin

1. Analiza cada uno de los planteamientos, y escribe tu argumento si ests de acuerdo o no con el mismo.

146

A partir de la masa de una disolucin y la masa del soluto, puedes determinar la masa del disolvente. Conociendo el volumen de la disolucin y su composicin porcentual (v/v) puede determinarse el volumen del soluto. La masa de la disolucin se puede obtener a partir de las masas de soluto y disolvente. Una disolucin sobresaturada es estable. Una disolucin diluida tambin es insaturada. La solubilidad de una sustancia determina la concentracin de la disolucin saturada. Toda disolucin est constituida slo por dos componentes.

2. Investiga los componentes de las sustancias indicas a continuacin y completa la tabla. Sustancias N de componentes Trmino asociado Edo. fsico de los componentes Tipo de mezcla Concentracin de los solutos

Alpaca Bronce Latn Nicrom Oro Blanco Peltre Zamak

MODELO

3. Qu aplicaciones tienen las disoluciones insaturadas, saturadas y sobresaturadas? 4. Analiza la composicin de 4 o 5 disoluciones existentes entre productos que encuentres en tu hogar, cules son los solventes y disolventes? En qu concentracin se encuentran los solutos? Cmo consideran que son esas disoluciones: insaturadas, saturadas y sobresaturadas?

147

21
Piensa por un momento en las cosas materiales que tienes en casa, encontrars: aparatos electrodomsticos, muebles, camas, lmparas, mesas. Estos objetos son perceptibles a simple vista, tienen una masa determinada y ocupan un lugar en el espacio, en sentido general los llamamos materia. No solo estos objetos se consideran materia, tambin, las rocas, el Sol, el mar, la tierra, el aire, las plantas, los animales e inclusive tu cuerpo lo son. En lecturas previas, conociste que la materia est constituida por partculas submicroscpicas como tomos (electrones, protones, neutrones y otras) y molculas. Cada una de ellas posee una determinada energa qumica caracterstica, que depende de la energa cintica y potencial de las partculas subatmicas que las componen.

Los inseparables compaeros: materia y energa


148

Esto quiere decir, que la energa es una propiedad inherente a la materia, es decir, son inseparables compaeras. Esta propiedad de la materia ha sido estudiada y aprovechada por la humanidad desde sus comienzos, en particular, la de los combustibles ya que esta al reaccionar con el oxgeno, libera mucha energa, la cual es aprovechada en los procesos industriales y en el funcionamiento de muchos transportes; as como tambin para cocinar alimentos y permitir que funcionen diversos aparatos en nuestro hogar. El mundo demanda grandes cantidades de energa que obtiene de los combustibles. Sobre todo los fsiles, sin embargo, estos son recursos no renovables. Adems, tienen un impacto negativo en el ambiente debido a la emisin de gases a la atmsfera, producto de la combustin. Si quieres conocer un poco ms acerca de la energa asociada a la materia que nos rodea, y responder interrogantes como: De dnde proviene la energa de la materia? Cmo se manifiesta en la naturaleza? Cuales son las fuentes energticas a nivel mundial? Te invitamos a continuar con esta lectura.

De dnde proviene la energa de la materia?


La energa es la fuerza vital del diario quehacer, de ella depende el funcionamiento de muchos de los aparatos que emplean en la vida cotidiana, desde el televisor, radio, telfono, computadoras hasta los carros, aviones, semforos, entre otros. La energa utilizada por todos estos artefactos es suministrada por alguna fuente: combustibles, agua, luz solar, biomasa, entre otros. En la naturaleza, tambin podemos observar algunos fenmenos en donde se manifiesta la energa, como es el caso de los relmpagos, las tormentas y el viento. Adems, la energa es fundamental para todas las actividades que realizamos cotidianamente; comer, caminar, correr, comunicarnos, entre otras. Incluso cuando lees esta pgina del libro, ests usando energa! En los diferentes sistemas que hemos mencionado, tanto los naturales como los creados por el ser humano, se observan cambios, transformaciones, movimientos, produccin de calor, sonido, luz, otros, que seran imposibles sin un aporte de energa. Por lo tanto, la energa en estos sistemas se presenta bajo diferentes formas; veamos algunos ejemplos: algunos hornos de la cocina de nuestras casas funcionan con gas (de la red de gas natural o envasado en bombonas), otros que se calientan con lea o electricidad; un tren de juguete se mueve con la energa elctrica que le proveen las pilas; la plancha se calienta con la energa elctrica de la red domiciliaria; un reloj de pulsera antiguo se pone en marcha dndole cuerda (con movimientos de rotacin de las perillas), mientras que los ms nuevos funcionan con pilas, luz solar o simplemente por el movimiento del brazo al caminar; a travs de la energa solar, las plantas transforman unas sustancias en otras ms energticas, que les sirven de alimento a ellas y a los otros seres vivos (Figura 21.1).

Figura 21.1. Ejemplos de la vida cotidiana sobre sistemas que requieren diversas formas de energa.

149

Si tomamos de los ejemplos anteriormente el tren de juguete, tenemos que la energa que est en la pila y que denominamos energa qumica, se puede transformar en energa cintica, la cual puede trasladar todo el conjunto, tren y vagones. En el horno de lea, la energa qumica en la estructura de la madera, al quemarse (combustin) genera calor permitiendo que la energa trmica se transfiera y cocine los alimentos. En las plantas, la energa lumnica que proviene del Sol, durante la fotosntesis, se transforma en energa potencial almacenada (energa qumica) en las sustancias que ellas fabrican. Como viste, la energa se manifiesta en nuestro entorno de maneras diversas, y unas formas de energa se pueden transformar en otras. Te invito a reflexionar acerca de las diferentes manifestaciones y transformacin de la energa que ocurre en tu entorno! La energa en general tiene dos formas, la energa cintica, asociada al movimiento de los objetos, y la energa potencial disponible para ser usada. Para obtener energa tenemos disponibles diversas fuentes, algunas ya fueron abordadas en otras lecturas de este libro. En esta oportunidad vamos a centrarnos en la energa qumica, la cual est asociada a la energa potencial elctrica almacenada en los tomos a travs de los enlaces qumicos. En la naturaleza todos los materiales que nos rodean estn conformados por molculas que se forman a partir de los enlaces qumicos entre los tomos (Figura 21.2). La energa de la unin de dos o ms tomos de cualquier tipo de enlace estable, es menor que la suma de la energa de esos tomos aislados; por lo tanto, cuanto mayor sea la disminucin de energa, como consecuencia de la unin entre tomos, mayor ser la estabilidad del enlace formado. De all que los tomos tienden a formar enlaces qumicos para lograr alcanzar una mayor estabilidad.

Figura 21.2. Representacin del enlace de la molcula de agua.

Vamos a imaginarnos ahora a dos tomos de hidrgeno que inicialmente estn completamente alejados y comienzan a acercarse uno al otro. En este proceso se producen interacciones electrostticas atractivas entre las partculas subatmicas; protones (cargas positivas) en el ncleo y los electrones (cargas negativas). As como tambin interacciones electrostticas de repulsin, tanto entre los electrones de los tomos como entre los protones de los ncleos.
150

Como podemos observar en el grfico (Figura 21.3) la energa neta resulta de las interacciones antes mencionadas, cuando los ncleos de los tomos de hidrgeno, estn muy separados las interacciones son de poca intensidad, por lo que la energa es casi nula. (Paso 1) a medida que se aproximan los tomos disminuye la distancia internuclear, (Paso 2) va aumentado la fuerza atractiva hasta alcanzar un valor separacin en el que la energa tienen su menor valor (mximo negativo). Nota que para este caso la distancia internuclear es de 0.74 , y la energa alcanza su valor ms bajo de -436 kJ/mol, lo cual le confiere estabilidad al enlace qumico. (Paso 3)

Figura 21.3. Energa de interaccin entre dos tomos de hidrgeno.

En general, para entender este hecho, tenemos que analizar las interacciones elctricas entre las cargas de los tomos. Imaginemos a dos tomos estn tan separados que no se ejercen entre s ninguna influencia; a medida que se aproximan, en los dos tomos empiezan a predominar las fuerzas elctricas atractivas, de las cargas positivas de los ncleos de unos, sobre los electrones de los otros, y viceversa, en particular, los que se encuentran ms alejados del ncleo, y como sabes se conocen como electrones de valencia. Si esta fuerza llega a ser lo suficientemente grande para mantener unidos a los tomos, se dice que se formado un enlace qumico. Por lo tanto, en los tomos se forman enlaces y con ello pasan a un estado de menor energa, lo cual les supone mayor estabilidad.

Cmo se manifiesta la energa qumica en la naturaleza?


Como ya se ha venido trabajando en la lectura, la energa qumica es una manifestacin ms de la energa potencial que se encuentra almacenada en la materia a travs de los enlaces qumicos que unen a los tomos, y desde este punto de vista, estamos sumergidos en el mundo submicroscpico de la materia. Por lo tanto, la energa qumica se hace evidente cuando la materia sufre una transformacin de sus componentes, es decir, ocurre una reaccin qumica. En este sentido, las reacciones qumicas involucran las transformaciones o cambios de unas sustancias en otras. El inters por este tipo de procesos se centra en la utilidad nuevos productos que obtenemos para la medicina, la industria o la vida. Tambin son importantes las reacciones en las que se libera gran cantidad de energa, como es el caso de la combustin de la gasolina o del carbn. En general, las reacciones qumicas llevan tanto cambios de los materiales como cambios energticos.
151

En cuanto a los cambios energticos, en una reaccin qumica, estos se pueden manifestar en forma de energa lumnica, elctrica, mecnica o trmica. Por ejemplo, los diferentes y brillantes colores que se pueden apreciar en los fuegos pirotcnicos, se deben a la energa liberada en forma lumnica a travs de la combustin de diversas sustancias, como sales de bario para originar color verde, sales de sodio productoras de luces rojas y blancas. Tambin, existen unos hongos (Neonothopanus garneri), de los ms grandes del mundo muy comunes en Brasil, que crecen al pie de las palmeras, conocidas popularmente como "flor de coco". Ellos emiten gran cantidad de luz, visible en las noches, como resultado de reacciones qumicas ocurridas en su interior.

Figura 21.4. Hongo Neonothopanus garneri de noche (izquierda) y de da (derecha).


Fuente: Universidad de Sao Paolo, Brasil.

Sabas que...? Existen unas barras de luz que al doblar o agitar, producen una luz fluorescente durante horas, sin necesidad de combustin o pilas. Ello se debe a una reaccin qumica que libera energa en forma de luz y se conoce como quimioluminiscentes. El activador perxido de hidrgeno est contenido en una cpsula de cristal pequea y frgil. Esta se encuentra dentro de la barra de polietileno que contiene un ter de fenil oxalato y un tinte fluorescente que da los diferentes colores que observamos. La luz de estas barras es temporal, ya que cuando los reactivos se agotan dejan de generar luz.

152

Las reacciones qumicas necesitan o liberan energa


El estudio de un proceso qumico, desde el punto vista energtico, es de gran importancia, la rama de la ciencia que se refiere al estudio de las relaciones entre la energa y los cambios qumicos se llama termodinmica. En este sentido, se conoce como sistema termodinmico a cualquier porcin del universo que sea objeto de estudio y que este separado del resto por una superficie cerrada, real (paredes de un depsito) o imaginaria. Ejemplos de estos sistemas, pueden ser un vaso de agua, el aire, la gasolina y el aceite de un motor, un ocano, una estrella e inclusive una reaccin qumica. Por otro lado, se encuentra el entorno (alrededores, exterior) que constituye el resto del universo que no constituye el sistema. Es por esto, que las reacciones qumicas, suelen ser consideradas como sistemas termodinmicos, ya que implican una transferencia de energa, que se lleva a cabo del sistema al medio o en sentido inverso. Si en la reaccin se libera energa del sistema al medio, se le denomina exotrmica. La combustin de la madera es un claro ejemplo de un proceso de este tipo (Figura 21.5). Una vez encendida la madera, la reaccin genera energa trmica, que es utilizada para diversos propsitos: cocinar, calefaccin, iluminar, entre otros. Por otra parte, si la reaccin necesita cierta cantidad de energa del medio al sistema, se le denomina endotrmica. Por ejemplo, la descomposicin del agua (H2O); en oxgeno e hidrgeno es una reaccin endotrmica porque sta no ocurre al menos que se le suministre energa, como mediante una corriente elctrica que circula a travs del agua. ste proceso se llama electrlisis, y se muestra en la figura 21. 6.

Figura 21.5. Reaccin exotrmica: Combustin de madera.

Otro ejemplo que se evidencia en la vida diaria sobre los procesos endotrmicos, es cuando el bicarbonato de sodio (NaHCO3) se mezcla con la masa para hacer galletas. Cuando estas se hornean, el bicarbonato de sodio recibe energa y se transforma en dixido de carbono (CO2), agua (H2O) y carbonato de sodio (Na2CO3). El dixido de carbono y el vapor de agua hacen que se esponjen las galletas. Entre otros de los procesos endotrmicos importantes en nuestro planeta, est la fotosntesis, que como sabes se lleva a cabo a travs de una serie de reacciones qumicas que reciben energa luminosa del Sol.

Figura 21. 6. Reaccin endotrmica: Electrlisis del agua.

153

Cmo interviene la energa en las reacciones qumicas?


Retomaremos el ejemplo del agua, para ilustrar la formacin y descomposicin de la misma. En este sentido, la ecuacin que representa la reaccin qumica de la formacin de agua a partir de hidrgeno y oxgeno gaseosos es la siguiente:

Esta reaccin cede una cantidad considerable de energa, bien sea de manera explosiva cuando se enciende una mezcla de hidrgeno y oxgeno ambos gaseosos, o en forma ms gradual; en cuyo caso, si los gases que reaccionan estn en una celda de combustible podemos emplear la energa liberada para producir energa elctrica. Resulta til pensar esta reaccin por pasos (imaginarios) de ruptura y formacin de enlaces. Como primer paso, imagina que se rompen todos los enlaces de las molculas reaccionantes (H2 y O2) para producir tomos individuales (Figura 21.7, paso 1), lo cual suele ocurrir cuando las molculas chocan de forma efectiva entre s, es decir, colisionan con suficiente energa cintica como para separar los tomos que estn unidos por las interacciones electrostticas, superando la energa potencial de esos enlaces qumicos. A esta energa cintica mnima que deben tener las molculas para que se produzca la ruptura y por ende la reaccin, se le conoce como energa de activacin.

Figura 21.7. Proceso de ruptura de enlaces, en un primer paso (molculas del hidrgeno y oxgeno gaseoso) y formacin de nuevos enlaces en un segundo paso (molcula de agua).

154

Por otra parte, el segundo y ltimo paso (Figura 21.7, paso 2) comprende la formacin de los nuevos enlaces necesarios para la constitucin de dos molculas de agua, proceso mediante el cual se desprende energa. Como la energa que se libera al formar enlaces de molculas de agua es mayor que la energa requerida para romper los enlaces de hidrgeno y oxgeno, la reaccin es exotrmica y esto se indica colocando la energa como parte de los productos en la ecuacin de formacin de agua mostrada antes. La descomposicin del agua (reaccin inversa). Esta es una reaccin endotrmica, necesita energa del entorno, y la ecuacin que la representa es la siguiente:

Como puedes observar la energa se halla del lado de los reactivos en la ecuacin, indicando que la reaccin requiere del entorno, energa para la descomposicin del agua. En este proceso, los enlaces de cada hidrgeno y el oxgeno (H-O) se rompen, lo cual requiere del suministro de energa y, por otro lado, la formacin de los nuevos enlaces (H-H y O=O) libera energa. Como se requiere suministrar una cantidad mayor de energa para romper los enlaces de la molcula de agua, en comparacin con la cantidad de energa que se libera al formar los enlaces de las molculas productos (hidrgeno y oxgeno), este proceso es endotrmico (Figura 21.8).

Figura 21.8. Proceso de ruptura de enlaces, en un primer paso (molcula de agua) y formacin de nuevos enlaces en un segundo paso (hidrgeno y oxgeno gaseoso).

155

De acuerdo con lo planteado anteriormente, la cantidad energa que se libera durante la formacin de un compuesto (por ejemplo, H2O), a partir de sus elementos, ser la misma cantidad de energa que se requiere para descomponer dicho compuesto en sus elementos. Este hecho se explica en un principio importante conocido como la ley de la conservacin de la energa, la cual permite establecer que durante una reaccin qumica, la energa no se crea ni se destruye, solo cambia de una forma a otra. Como se muestra en la figura 21.9, la cantidad de energa (286 kJ) que se libera en la formacin de agua, a partir de los elementos hidrgeno y oxgeno, es igual a la cantidad de energa (286 kJ) que se requiere durante la descomposicin de agua. Adems, en ese grfico se evidencia que en la reaccin exotrmica (formacin de H2O), los productos tienen menos energa que los reactivos, la diferencia es la energa liberada. Mientras que en la reaccin endotrmica (descomposicin del H2O) se requiere de energa, los productos tienen ms energa que los reactivos (Figura 21.9).

Figura 21.9. Representacin de la energa en los procesos, de formacin y de descomposicin del agua. La ubicacin de los productos respecto a los reactivos representa su cantidad de energa relativa.

Sabas que...? Cuando reciclas una lata de aluminio, ests ahorrando, entre otras cosas, energa. La produccin de aluminio requiere de grandes cantidades de energa, en especial energa elctrica debido a que el aluminio se produce por la electrlisis de su mineral principal, la bauxita. Por lo tanto, una buena razn para reciclar el aluminio es para conservar esa energa.

156

Cul es la principal fuente energtica?


Cuando hablamos de fuentes de energa, nos referimos a los recursos existentes en la naturaleza de los que podemos obtener energa, indiscutiblemente esencial para todas las actividades fsicas y biolgicas. Hoy en da, la energa se ha convertido en algo absolutamente necesario para la satisfaccin de cualquier necesidad bsica: acondicionamiento del ambiente, cocinar los alimentos, moldear los minerales, generar iluminacin, trasformar los elementos qumicos, multiplicar el esfuerzo fsico, vivir. Entre las fuentes de energa que seguramente ya conoces, se encuentran las siguientes: el viento, el agua, la radiacin solar, entre otras, (Figura 21.10).

Energa solar

Energa hidrulica

Energa elica

Figura 21.10. Fuentes alternativas de energa: solar, hidrulica, elica.

Por otra parte, los combustibles fsiles como el carbn, el petrleo y el gas natural, tambin son utilizados como fuentes energticas. La caracterstica principal de estos combustibles es que contienen gran cantidad de energa qumica, que puede ser liberada en reacciones qumicas de combustin. El combustible reacciona con un comburente, que suele ser el aire (oxgeno), produciendo agua y dixido de carbono (CO2) y liberando energa trmica. Esta liberacin de energa a partir de las diversas fuentes mencionadas es aprovechada para producir trabajo mecnico o para generar otras formas de energa. En cuanto a la produccin de trabajo mecnico, se realiza con la ayuda de motores de combustin de los que existen dos tipos principales, los motores de combustin interna y los de combustin externa, siendo la ms frecuente la interna, y son los que estn en los automviles; un motor con este tipo de combustin, transforma la energa qumica de la combustin en movimiento. Esto ha permitido el desarrollo y avance tecnolgico de diferentes medios de transporte, como se muestra en la figura 21.11.

Figura 21.11. Diferentes medios de transporte, que requieren de la energa que libera la combustin interna de los motores.

157

Por otra parte, la energa liberada desde las diversas fuentes citadas es utilizada para generar otras formas de energas; entre la ms importante para el mundo est la energa elctrica, ya que nos permite tener luz artificial por las noches, poner en funcionamiento los distintos artefactos de uso domstico, y facilitar la realizacin de distintas actividades a gran escala, como la industria, el transporte, las comunicaciones, entre muchas otras. Recuerda que disminuir el consumo de productos innecesarios para el buen vivir, reducir nuestro consumo elctrico a la que realmente necesitamos, no desperdiciar el agua, reciclar, reusar, son formas de contribuir al uso eficiente y responsable de la energa y de los recursos naturales del ambiente, los cuales son un bien comn. En este sentido, la sociedad actual requiere de grandes cantidades de energa elctrica, las cuales se llevan a cabo en centrales o plantas. En particular las centrales termoelctricas, (Figura 21.12) utilizan la energa qumica almacenada en los combustibles fsiles derivados del petrleo, los cuales son recursos no renovables. Adems, estas centrales, son una de las principales fuentes de emisin de gases; dixido de carbono, xidos de azufre y xidos de nitrgeno a la atmsfera, que causan el efecto invernadero y la lluvia cida. Por otra parte, la energa elctrica que utilizamos ha pasado por diversos procesos de transformacin antes de que llegue hasta nuestros hogares. Es por ello que te invitamos a que adoptes el papel de un detective de energa. En la prxima actividad para ir tras la pista de los tipos de energa
Figura 21.12. Central Termoelctrica Josefa Camejo, ubicada en el estado Falcn. Venezuela.

Los combustibles fsiles. Qu tan beneficiosos son?


La principal fuente de energa a nivel mundial radica en los combustibles fsiles derivados del petrleo. Ellos han permitido el desarrollo, crecimiento, avances tecnolgicos en nuestra sociedad. A travs de la energa generada con ellos funcionan muchas industrias, se mueve el transporte; automviles, aviones, barcos, as como tambin tenemos muchos beneficios para las comunidades y los hogares. A pesar de los beneficios que estos combustibles fsiles tienen en nuestra sociedad, los mismos tambin representan problemas, entre ellos, son recursos no renovables, esto quiere decir, que una vez que se consumen no vuelven a generarse de nuevo, por lo tanto se agotarn en un periodo de tiempo, debido a que ellos no son como los animales y plantas que si los cuidamos y mantenemos pueden reproducirse.
158

Por otra parte, generan numerosos efectos negativos sobre el ambiente. Se afecta tanto a la calidad del aire como a la salud pblica, adems del agravante problema del calentamiento global, lo cual ha ocasionado, derretimiento de grandes masas de hielo en las regiones polares, con la consecuencia de la elevacin del nivel del mar, y a futuro se prev que se desertificarn enormes extensiones de tierra y ampliarn las temporadas de sequa en zonas templadas, con los consecutivos efectos en el agro. De acuerdo con esta situacin, en Venezuela se ha implementado el uso racional y eficiente de la energa, como poltica de Estado. Sin embargo, necesitamos un cambio cultural en todas las venezolanas y los venezolanos en la forma como utilizamos nuestros recursos. Reducir las emisiones de gases txicos y controlar la huella ecolgica (indicador del impacto que ejercemos sobre el planeta) contribuir con el ambiente. Cmo puedes contribuir a reducir tu huella ecolgica en tu hogar o escuela?
159

Tras la pista de los tipos de energas

En tu hogar existen diversos aparatos elctricos, y como se ha venido trabajando en esta lectura su funcionamiento implica diversas transformaciones de energa. Es por esto que te invitamos a reflexionar acerca de las trasformaciones de energa que son necesarias para que puedas encender cualquier aparato elctrico de tu hogar. Qu necesitan? Cuaderno o una hoja en blanco y lpiz. Cmo lo harn? Indaguen los procesos de transformacin que intervienen en el proceso para que llegue la energa elctrica al hogar. Para ello los invito a responder las siguientes interrogantes: De qu planta proviene la energa elctrica que llega al hogar? Qu fuente de energa emplea? En qu otras formas de energa se emplean la energa elctrica en diversos equipos de tu casa? Cunta materia creen que se emplea para que una de esos aparatos funcione una hora? Indaguen sobre el uso de la energa en el hogar y reflexionen: Cunta energa se utiliza en el hogar en un da promedio? Cmo pueden decidir si utilizaron ms o menos energa de la necesaria? Cunta energa utilizan los diferentes electrodomsticos de la casa? Compartan los resultados con otros grupos y reflexionen al respecto. Por ltimo: Por qu hay que utilizar menos energa, es decir, solo la necesaria? Qu hacen y qu podran hacer para el uso eficiente y responsable de la energa?

Cmo dividir el agua en sus componentes ms simples?


En esta actividad te invitamos a formar equipos cooperativos para realizar un experimento que les permita separar el agua en oxgeno e hidrgeno. Recuerda que cada hidrgeno est unido a un oxgeno a travs de un enlace qumico, formando la molcula de agua (H2O).
160

Qu necesitan? Dos lpices de grafito afilado. 1 batera de 9 voltios. Un cable de 50 cm para una corriente de 15 amperios. 1 recipiente con agua. Papel, tijera y cinta adhesiva. Cmo harn? Los invito a debatir sobre las siguientes interrogantes, ellas los guiaran a desarrollar la actividad experimental: Qu tipo de reaccin est involucrada en la descomposicin del agua? Cul es la cantidad necesaria de energa para romper los enlaces de la molcula de agua? Cules son los mtodos para provocar la ruptura de los enlaces de una molcula de agua? Cules son los medios materiales requeridos para recoger el oxgeno y el hidrgeno? cmo podemos identificar cada gas? Para la descomposicin de la molcula de agua se sugiere el mtodo de la electrlisis, se pueden apoyar en esta imagen del montaje. Planifiquen la actividad experimental, disctanla con su docente y realcenla Cmo lo pueden explicar? Qu reaccin se lleva a cabo en este experimento? Es una reaccin exotrmica o endotrmica? qu evidencias tienen de la respuesta? Justifiquen sus respuestas, en funcin de la energa. Representen a travs de modelos de partculas el fenmeno estudiado, indicando las energas involucradas en la ruptura y formacin de los enlaces. Relacionen el proceso de descomposicin del agua (electrlisis) con algunas aplicaciones a nivel industrial como: los motores de hidrgeno.

161

1. En nuestra vida cotidiana ocurren diversas transformaciones de energa qumica a energa trmica. Explica por lo menos tres procesos, donde se pueda apreciar dicha transformacin. 2. Existen diferentes fuentes alternativas de produccin de energa, que han sido abordas en la lectura. De acuerdo a esto, selecciona una que no se haya mencionado en la lectura y que adems se utilice en la actualidad. Explica el proceso de produccin y transformacin de energa realizada con ella mediante un esquema, mapa o representacin grafica. 3. Realiza una mezcla con unas cucharadas de bicarbonato de sodio de uso domstico, en un recipiente de vidrio (un vaso o taza) que contenga vinagre de vino o de alcohol. Qu ocurre? Con cuidado toquen con sus manos alrededor del recipiente. Cmo sienten el vidrio? De acuerdo con lo observado responde: La reaccin qumica que se produjo entre el bicarbonato y el vinagre, fue de tipo exotrmica o endotrmica? Justifica la respuesta tomando en cuenta la informacin de la lectura.

162

4. Sabes que los combustibles fsiles son una de las principales fuentes energticas a nivel mundial. Sin embargo, son un recurso no renovable, que se agota en un periodo de tiempo determinado. De acuerdo a esto, elabora con tu grupo un proyecto que permita generar energa elctrica en tu comunidad basada en fuentes alternativas y con una reduccin del impacto sobre el ambiente.

163

22
A diario, experimentas a travs del sentido del tacto, fenmenos relacionados con el calor y la temperatura. Por ejemplo, cuando tocas los objetos, ingieres alimentos o bebidas, te expones a la radiacin solar, percibes el fuego, entre otras manifestaciones de estos fenmenos. Las palabras calor, calentar o enfriar, caliente o fro, forman parte de nuestro vocabulario desde que estamos pequeos; las usamos en la descripcin de situaciones del da a da, lo cual nos ha permitido construir alguna idea acerca de ellas. Sin embargo, el significado de estos trminos en la ciencia no coincide exactamente con las ideas que nos hemos formado en lo cotidiano. Desde la perspectiva de las Ciencias Naturales parece que las ideas de calor y temperatura estn asociadas a la idea de cambio en la materia, qu debe estar pasando al interior de la materia para estos fenmenos ocurran? Cules pueden ser los agentes causales de dichos cambios? En esta lectura, podrs aproximarte al significado cientfico de los conceptos de calor y temperatura. As mismo, conocers cmo fueron cambiando en el tiempo, cul es el modelo que en la actualidad usa la ciencia para hacer referencia a ellos? Cmo y con qu se miden? Cul es la diferencia entre ellos? Qu relacin tienen con el concepto de energa?

164

Calor y temperatura

De los cuatro elementos, al alcahesto, al calrico a la energa


Un ejemplo importante, lo constituye la energa proveniente de la radiacin solar. Desde tiempos remotos, la mujer y el hombre han usado esta fuente de energa natural para calentar e iluminar el espacio y las superficies que reciben las radiaciones, incluso, us esta energa para secar las maderas. Adems, se dio cuenta de que esta energa era factor necesario para hacer crecer las plantas, la comenz a usar para una actividad humana de suma importancia en todas la pocas de la humanidad, como lo es la agricultura. Estas radiaciones dan origen a la energa qumica en los vegetales, y en a la formacin de materiales vitales para el desarrollo como el carbn, el petrleo y el gas natural. En esa evolucin de la humanidad, descubri como producir el fuego, el cual us para calentarse por las noches y en las pocas de invierno, y cocinar los productos de la caza y de la pesca. En la actualidad, una sensacin muy sutil para nuestro sentido del tacto, la experimentamos cuando en pocas de fro tenemos la oportunidad de calentarnos con el fuego de una fogata. Incluso, esta actividad es tan amena que si estamos en grupo, todos se acercan al calor que produce el fuego y hay algn amigo o familiar que cuenta historias interesantes, lo que hace de la velada una experiencia inolvidable. De esta manera, la prctica de calentarnos con el fuego de una fogata, es quizs la manifestacin ms elemental del calor y fue motivo de inters de pocas remotas que saltan hacia atrs y nos colocan en la poca de Herclito en el 540 a.C. Este sabio sostena que el fuego era el origen primordial de la materia y que el mundo entero se encontraba en un estado constante de cambio, declarando al fuego como la sustancia primordial que colocaba a lo caliente y a lo fro como estados comunes de la materia. l llamaba a lo fro condensado o comprimido y a lo caliente raro o laxo.

Figura 22.1. Los atomistas griegos consideraban al fuego constituido por partculas pequeas, ligeras y sutiles, que tenan a su vez una enorme movilidad para penetrar en la materia lquida, slida o gaseosa. Esta sustancia, fuego, era indestructible e inmaterial y fue denominada calrico.

165

Entre los aos 384 y 382 antes de nuestra era, Aristteles, otro gran sabio griego, a las cualidades ya conocidas de caliente y fro, agreg dos ms: lo hmedo y lo seco. As, los cuatro elementos quedaron constituidos de la siguiente forma: el fuego es clido y seco, el aire es clido y hmedo, la tierra es fra y seca, y el agua es fra y hmeda. Si te fijas con detenimiento, estas cualidades son aun usadas en nuestro lenguaje cotidiano, a pesar de que en la ciencia como veremos ms adelante, se emplean de manera diferente. Estas ideas fueron cambiando a medida la ciencia mejoraba los modelos de la naturaleza, y entre 1577 y 1644, el cambio de los conceptos de caliente y fro fue radical. Van Helmont en 1620, al realizar observaciones acerca de la calcinacin del carbn y el azufre, encuentra una contradiccin entre la idea de los cuatro elementos y la experiencia, pues el fuego no poda ser un elemento, ya que era un factor de transformacin de las reacciones qumicas, y lo denomin alcahesto, pero permanece la idea de que era algo semejante a un fluido. En 1776, Lavoisier elabor un modelo de los gases, en el cual introduca un nuevo concepto que llam el calrico, de forma paralela surga otro concepto denominado temperatura con lo cual se empezaron a construir los primeros termmetros, para medir la frialdad de las cosas. En esa poca, la frialdad estaba relacionada con aquellos cuerpos que contenan poco calrico, y al introducir ms de este fluido al cuerpo, este se calentaba, hasta que finalmente el calrico se desbordara y fluyera en todas las direcciones. Esta era la razn por la cual la calidez de un objeto al rojo vivo se dejaba sentir a gran Sabas que...? Hace casi distancia; la radiacin del Sol por ejemplo, se 2000 aos que el griego Hern notaba a 150 millones de kilmetros. Todo construy un prototipo de maquina cuerpo que tuviera ms calrico contena trmica que llam bola de viento. Esta mayor temperatura. Con este concepto usaba como fuente caliente el fuego profueron tomando forma otros conceptos que ducido al quemarse la lea. Encima un deusamos en la actualidad como la dilatacin y psito sellado con agua que se calentaba la contraccin trmica. y evaporaba. El vapor suba por unos tubos a una esfera y sala por dos tubos doEn la actualidad, los conceptos de blado haciendo que rotara. calor y temperatura tras haber pasado por tantos cambios, tienen un significado que los relaciona directamente con el concepto de energa. Desde la teora mecnica del calor, la mecnica estadstica y la termodinmica, estos conceptos tienen una identidad propia que se relaciona directamente con la energa cintica o de movimiento de las molculas que constituyen los cuerpos. De ahora en adelante tomaremos este modelo, con el fin de tratar a estos conceptos lo ms cercano posible al conocimiento que actualmente maneja la ciencia.
166

A mayor energa mayor temperatura


A diario, experimentamos fenmenos como los siguientes: Cuando la luz solar del medioda incide directamente en una reja de hierro podra ser dificultoso abrirla, y si la tocamos sentimos que est muy caliente. Cuando calentamos el agua, vemos que despus de un rato sta comienza a evaporarse. Si dejamos en el congelador una botella de vidrio con agua, es posible que se rompa. Todos estos fenmenos se relacionan por medio del concepto, de temperatura, el cual, desde la visin macroscpica es una propiedad intensiva de los cuerpos, es decir, no depende de la cantidad de materia. Adems es susceptible de ser medida con aparatos calibrados denominados termmetros. Es decir, si medimos la temperatura de 1 litro de agua, al separar este volumen en varias partes y medir la temperatura de cada una, el volumen es diferente pero la temperatura es la misma. Desde el punto de vista microscpico, el modelo de partculas propone que la materia est formada en su interior por tomos y molculas, que estn en constante movimiento, es decir, cada una tiene cierta energa cintica; el promedio de la energa cintica de todas esas partculas se manifiesta macroscpicamente en todo el cuerpo en un estado que llamamos temperatura. Esta forma de entender lo que sucede al interior de la materia nos permitira explicar muchos fenmenos como los que mencionamos anteriormente: El por qu la reja aumenta su tamao (dilatacin), el por qu el agua se evapora (cambios de estado de la materia), y el por qu el vaso se rompe en el congelador (contraccin molecular).

Figura 22.2. Modelo de partculas para el estado: slido (a), lquido (b) y gas (c). Para todos los estados de la materia: las partculas se atraen entre s mediante fuerzas elctricas (en los slidos ms fuertes que en los lquidos y en stos ms que en los gases); si la materia recibe energa aumenta su energa cintica promedio, esto aumenta la temperatura.

167

Si aumenta la temperatura, aumentan las dimensiones


Al fenmeno de aumento de tamao de la reja lo conocemos como dilatacin. Es un hecho muy conocido que las dimensiones de los cuerpos aumentan cuando se eleva su temperatura. Salvo algunas excepciones (materiales hechos de polmeros) toda la materia independientemente de su estado slido, liquido o gaseoso, se dilataran cuando aumenta su temperatura. Considera el modelo de la figura 22.2, si analizas la estructura de interna de un slido, notars que las partculas que constituyen al slido ser encuentran distribuidas ordenadamente, lo cual origina una estructura denominada red cristalina. La unin de tales partculas (tomos) se logra por medio de fuerzas de naturaleza elctrica que unen a unas partculas con otras. Sin embargo, a una temperatura dada estas partculas estn en constante vibracin respecto de una posicin media de equilibrio. Cuando aumenta la temperatura del slido se produce un incremento en la agitacin de sus partculas, haciendo que al vibrar se alejen ms de la posicin de equilibrio. De esta forma, la fuerza que se manifiesta entre las partculas acta es tal que la distancia media entre ellas se vuelve mayor, ocasionando la dilatacin del slido. A continuacin te mostremos las formas en que se puede presentar dicha dilatacin.

Dilatacin lineal
En la dilatacin lineal predomina la variacin en una (1) dimensin de un cuerpo, es decir: el largo. Por ejemplo en la dilatacin en hilos o barras de cierta longitud inicial, Lo, se produce un incremento de longitud, L, que es proporcional a la longitud inicial Lo y al incremento en la temperatura T. Esto se representa simblica como: L=.L0.T. La letra griega (alfa) funciona en la expresin como un coeficiente de proporcionalidad y se denomina coeficiente de dilatacin lineal.

Figura 22.3. La barra metlica al calentarse se dilata, su longitud aumenta, L.

168

Coeficiente de dilatacin lineal Material Zinc Aluminio Cobre Vidrio comn Vidrio prex Acero Diamante (C-1) 25 x 10-6 23 x 10-6 17 x 10-6 9.0 x 10-6

Para entender porqu el coeficiente de dilatacin lineal difiere segn los materiales, recordemos que las fuerzas que unen a las partculas varan de un material a otro, haciendo que se dilaten de distinta manera. Este coeficiente ha sido determinado para distintos materiales midiendo la relacin que existe entre los valores de Lo, L, T. Algunos de sus valores se presentan en la siguiente tabla. Para interpretar estos valores, veamos que la unidad de medida es el inverso de una 1 unidad de temperatura .Por la relaC cin L = Lo T

3.2 x 10-6 11 x 10-6 0.9 x 10-6

Tabla 22.1. Coeficiente de dilatacin lineal de algunas sustancias slidas.

1 As, para el cobre =17 x 10-6 , lo que significa que una barra de cobre de 1 cm, 1 m, 1 C -6 km, aumenta 17 x 10 cm (o m, km) cuando su temperatura se eleva en 1 C.

Dilatacin superficial
En el estudio de la dilatacin superficial, es decir, el aumento del rea de un objeto producido por una variacin de temperatura, se observan cambios que siguen un comportamiento muy similar a la dilatacin lineal. Considera una placa de rea inicial S0 al elevar su temperatura en T, el rea sufre una dilatacin S. La representacin simblica matemtica del modelo que describe este comportamiento de la materia es: S = S0 T. El coeficiente (beta) se denomina coeficiente de dilatacin superficial. Su valor tambin depende del material del que este hecha la placa. Pero no es necesario elaborar tablas con valores de , pues se demuestra que para un material determinado se tiene: =2. Si deseamos saber por ejemplo, el valor de para el acero, consultamos la tabla de los coeficientes lineales, , y obtenemos:

= 2 = 2 x 11 x 10-6 (C-1)= 22 x10-6 (C-1)


Figura 22.4. Dilatacin superficial de un placa cuadrada, su superficie pasa de S0 a S.

169

Dilatacin volumtrica
De manera idntica comprobamos que la dilatacin volumtrica, es decir, la variacin del volumen de un cuerpo con un aumento T de la temperatura, sigue el mismo comportamiento que la lineal y la superficial. Por tanto, si un cuerpo de volumen inicial So tiene un aumento en la temperatura T,su volumen se incrementa S = Sf So. As se sigue el mismo modelo es cual se expresa en su forma simblica matemtica como: V = Vo T . El coeficiente (gamma) se denomina coeficiente de dilatacin volumtrica y para un material se puede demostrar que = 3.

Figura 22.5. (a) Representacin de un cuerpo de volumen inicial Vo el cual sufre una variacin V=V-Vo en su volumen. (b) La va del tren que est hacia los Valles del Tuy, estado Miranda, est constituida por carriles entre los que se deja una separacin (junta de dilatacin), que permiten su expansin y evita que las vas se levanten al aumentar la temperatura.

En el caso de los lquidos, estos tambin se dilatan mostrando un comportamiento muy similar al de los slidos. nicamente debes tomar en cuenta que como los lquidos no tiene forma propia, sino que adoptan la forma del recipiente que los contiene, el estudio de sus dilataciones lineal y superficial no es importante.
170

Fundamentalmente, lo que interesa es el conocimiento de su dilatacin volumtrica, por ello, en el caso de los lquidos nicamente se tabulan sus coeficientes de dilatacin volumtrica . En la tabla 22.2 tienes valores de este coeficiente de dilatacin volumtrico para diversos materiales lquidos.

Coeficiente de dilatacin volumtrica Material (C-1) 1,1 x 10--3 Alcohol Disulfuro de Carbono Glicerina Mercurio Petrleo 1,2 x 10-3 5,1 x 10-4 0,18 x 10-3 9 x 10-4

Sabas que...? Algunas sustancias, en determinados intervalos de temperatura, presentan un comportamiento inverso, es decir, disminuyen de volumen cuando su temperatura se eleva. El agua es un ejemplo, cuando su temperatura aumenta entre los 0C y 4C, su volumen disminuye. Por encima de los 4C se dilata normalmente.

Tabla 22.2. Coeficiente de dilatacin volumtrica de algunos lquidos.

Cuidado con calentar el frasco de mercurio?


Problema: Un frasco de vidrio, cuyo volumen es exactamente 1.000 cm3 a 0C, est completamente lleno de mercurio a 0C. Cuando el conjunto se calienta hasta 100 C, se derrama un volumen de 15,0 cm3 de mercurio. Cul fue la dilatacin real del mercurio? Solucin: Segn lo que leste, la dilatacin volumtrica del mercurio (lquido) se representa por el siguiente modelo: VHg = Hg Vo T. En este caso, el volumen inicial es de 1.000 cm3 y el aumento de temperatura vale T=100 C. El coeficiente del mercurio lo puedes ubicar en la tabla 18.2, es: 0,18x10-3(C-1). Luego entonces: VHg = 0,18x10-3 (C-1) x 1.000 cm3x 100 C = 18 cm3. Este es el valor del volumen de mercurio derramado. Advertencia! El mercurio es una sustancia txica y en estos aspectos relacionados con su dilatacin se deben tomar cuenta para evitar derrames.

171

La temperatura: su control es importante en la vida cotidiana


La medicin y el control de la temperatura, en la actualidad desempean un papel muy importante. En la industria, en los laboratorios cientficos, en la medicina, y aun en tu propia casa, constantemente se emplean termmetros para medir y controlar la temperatura de una gran variedad de objetos y en las ms diversas circunstancias. Fjate que el fenmeno de la dilatacin est relacionado de manera directa con el cambio de temperatura que experimentan los objetos. Un ejemplo de aplicacin de este fenmeno a la industria, es el diseo de termmetros. Los termmetros se construyen considerando que alguna propiedad cambie con el aumento o disminucin de la temperatura, a esta propiedad se le llama termomtrica. Entre las ms comunes estn: el volumen, la presin, el voltaje y el color. Aunque muchos son los tipos de termmetros, el de uso frecuente en nuestros hogares es el termmetro corporal de mercurio, en estos la propiedad termomtrica que cambia con la temperatura es el volumen. Su diseo consiste en un depsito de vidrio o bulbo, en comunicacin con una varilla hueca muy delgada (capilar) del mismo material. El mercurio llena el bulbo y parte del capilar, el cual al aumentar la temperatura experimenta una dilatacin en su volumen y sube por el bulbo. Te habrs dado que cuenta mides tu temperatura corporal, despus de un rato la columna de mercurio alcanza una cierta altura y se estabiliza, esto ocurre porque entre tu cuerpo y el mercurio se ha alcanzado un estado de equilibrio trmico, es decir, un estado fsico en donde ambos sistemas (el mercurio y el cuerpo) alcanzan la misma temperatura. La escala que usamos en este tipo de termmetro es la escala centgrada, que se establece tomando dos puntos fijos de referencia el cero y el cien. La diferencia entre ambas temperaturas se divide en cien partes iguales, denominadas divisiones de la escala del termmetro. Cada divisin equivale a un grado centgrado o grado Celsius (C) en honor a su inventor.

Figura 22.6. Dos tipos de termmetros: corporal de mercurio (izquierda); ambiental digital (derecha).

172

Como el volumen del mercurio varia al cambiar la temperatura, la columna de mercurio que llena parte del capilar alcanzar una altura mayor o menor, segn sea la temperatura. Para la medida de temperaturas ligeramente inferiores a 0C o superiores a 100 C, se continan trazando divisiones del mismo tamao en la escala. La temperatura que marca el termmetro debe leerse alineando en direccin horizontal, nuestros ojos con el extremo de la columna de mercurio (Figura 22.7).

Figura 22.7. a) Termmetro de mercurio en C. b) Posicin correcta para hacer la medida de temperatura en el termmetro. c) Procedimiento de medida que producen datos no confiables.

En el mbito cientfico, la unidad de medida para la temperatura adoptada por el SI, es el Kelvin, pero se aceptan otra unidades como el C o el F. Nombre de la Tipo de magnitud fsica magnitud fsica Temperatura Escalar Smbolo Unidades en el Sistema Internacional (SI) kelvin (K) Equivalencia entre unidades 0 K= -273 C 1 K= -272C 273 K= 0C 373 K=100C

Figura 22.8. Distintas escalas de temperaturas usadas y sus equivalencias. Algunos productos electrnicos importados, recetas para preparar alimentos, termmetros, estn en otras unidades.

173

Los termmetros los usamos para medir la temperatura de los objetos y los seres vivos. Estas mediciones son tiles porque nos permite diferenciar los cuerpos calientes (que nos parece que estn a mayor temperatura que nuestro cuerpo) de los cuerpos fros (que nos parece que estn a menor temperatura que nuestro cuerpo). Si alguien tiene fiebre y nos basamos solo en la percepcin que experimentamos al tocar con la mano su frente, esta percepcin que tenemos tendra poca precisin por lo que correramos el peligro de que la fiebre pudiera aumentar tal que sera daino para nuestro organismo. As resulta mas adecuado, conocer con cierta precisin la temperatura que alcanza nuestro cuerpo cuando tenemos fiebre midindola con un termmetro, si est por encima de 37C (grados centgrados) podemos tomar las indicaciones mdicas ms adecuadas para controlarla.

Figura 22.9. a) Medicin de la temperatura como un termmetro digital, cuya propiedad termomtrica es el voltaje. b) La propiedad termomtrica del termmetro de mercurio es el volumen.

En diversas situaciones son usados otros tipos de termmetros, por ejemplo el control de altas y bajas temperaturas en los laboratorios de investigacin cientfica, el control de temperaturas en las actividades industriales como la agrcola, aeronutica, automotriz, calefaccin, refrigeracin y aire acondicionado, metalurgia, entre otras. Prcticamente para cada rea encontramos un tipo de termmetro que se adapta a las necesidades de la actividad. Entre los que podemos encontrar estn: Termmetros de gases. Los cuales se basan en la variacin de la presin y del volumen de los gases y se utilizan en medidas de alta precisin que van desde los -263 C hasta 1. 000 C. Termmetros de resistencia elctrica. Ofrecen una alta precisin, los ms comunes usan una resistencia de platino. Son los ms recomendados para medir temperaturas muy bajas entre 0,2 K y 50 K. Termmetros de termopar. Son de los ms importantes en la actualidad, de uso muy frecuente en la industria para registros continuos y control de temperatura. Se basan en la medida del voltaje generado en las uniones de cables metlicos de naturaleza diferente, el cual depende de las temperaturas de las uniones.
174

Termmetros de radiacin. Se basan en contrastar el color del cuerpo con el de un alambre caliente. Se utilizan, principalmente, para medir temperaturas muy altas, y ofrecen la ventaja de medir, a distancia y sin contacto del termmetro, con el objeto cuya temperatura se necesita determinar. Con l se pueden medir temperaturas de gases ionizados, como por ejemplo la de una estrella.

Sabas que...? La capa exterior visible del Sol se llama la fotsfera y tiene una temperatura cerca de 6.000C y es por esto que el Sol es amarillo; si su superficie fuera ms caliente se vera ms azul y si fuera ms fra se vera ms roja.

Termmetro magntico. Se sustentan en la medicin de las propiedades magnticas de determinados materiales, que varan con la temperatura. Los termmetros de este tipo se utilizan sobre todo, para medir temperaturas inferiores a 1 K.

Figura 22.10. Diversos termmetros (a) para medir temperatura de mquinas en funcionamiento; (b) temperatura del suelo para actividades agrcolas o de conservacin, (c) en la preparacin de alimentos.

175

Esquema conceptual sobre temperatura

El calor: no es un fluido ni una forma de energa es un proceso


En pocas de fro la mayora de las personas usan un abrigo. En cierto momento, es posible que te hayas preguntado: el abrigo me quita el fro, ser que contiene calor? Es muy comn en nuestro vocabulario decir: tengo calor, y expresiones como esta nos hacen pensar que los cuerpos tienen calor, y si esto es as, el calor sera una propiedad fsica de los cuerpos. Entonces qu es lo adecuado, desde las ideas de la ciencia, decir: hace calor o tengo calor? Existe una predisposicin a pensar que el calor es algo sustancial, una especie de fludo, una sensacin o una forma de energa, incluso llegamos a suponer que podemos meter calor a los cuerpos o que los cuerpos contienen calor. La frase tengo calor, es un ejemplo de ello. A diferencia de la temperatura, la energa, el volumen, la cantidad de materia, la presin, la velocidad, la aceleracin, la carga elctrica o el nmero de moles, el calor no es una propiedad de los cuerpos. Aunque tenga una ntima relacin con la energa, no es energa ni una forma de ella, el se considera calor a una transferencia de energa entre dos cuerpos, o entre un cuerpo y su entorno debido a una diferencia de temperatura entre ellos.

176

Figura 22.11. El recipiente con agua inicialmente est a una temperatura mayor que el entorno, por lo que hay una transferencia de energa (calor) desde l hacia el exterior, al cabo de un tiempo su temperatura es igual a la ambiental. En el entorno no se percibe el aumento de la temperatura por tener un volumen muy grande comparado con el del recipiente.

Comnmente, en el lenguaje cientfico se usa la frase: el calor es un mecanismo de transferencia de energa, es energa en trnsito. Ambas frases son adecuadas, porque en ellas se considera que el calor es un proceso asociado al trabajo promedio realizado por un agente externo para variar la energa interna de la materia; al igual que el trabajo (concepto que ya estudiaste) es una forma de transferir energa a los cuerpos. Los cuerpos no contienen calor ni trabajo, por lo que la frase tengo calor no expresa el significado de la ciencia actual, por el contrario est asociada a las ideas antiguas, pero que prevalecen en el lenguaje cotidiano. El trabajo es una transferencia de energa debida a la accin de fuerzas desde el punto de vista macroscpico. Cuando cuerpos de temperatura diferente que se ponen en contacto, las colisiones entre sus molculas provocan una transferencia de energa desde el cuerpo de mayor temperatura al de menor; el calor es el trabajo promedio realizado desde el punto de vista molecular (por eso se considera un proceso).

Figura 22.12. En la figura se observa que una fuente de calor transfiere energa al agua, la cual aumenta su temperatura tal que el agua en el depsito se calienta hasta evaporarse. Este vapor viaja por la tubera empujando el pistn. Esta fuerza realiza trabajo sobre el pistn el cual pone en movimiento el cilindro por medio de un cambio de la energa cintica del mismo. Vemos que en este proceso, los conceptos de calor, temperatura, trabajo y energa se relacionan para poder dar una descripcin cientfica del funcionamiento de la mquina.

177

Transferencia de energa mediante el proceso de calor


Entre los fenmenos que estn relacionados con este proceso de transferencia de energa, se encuentra la conduccin, la conveccin y la radiacin. Hay que tener cuidado al hablar de estos, porque los tres son fenmenos de transferencia de energa mediante el proceso de calor. Supn que sostienes una barra metlica por uno de sus extremos, y que pones el otro extremo en contacto con una llama, por ejemplo la de la cocina de tu casa. Las partculas (tomos) del extremo calentado por la llama, adquieren una mayor energa de agitacin debido al calentamiento, el cual provoca un aumento de la temperatura en la barra. Parte de esta energa se transfiere a las partculas de la regin ms prxima a dicho extremo, y entonces la temperatura de esta regin tambin aumenta. Este proceso se trasmite a lo largo de la barra, y despus de cierto tiempo, percibirs una elevacin de la temperatura en el extremo por donde lo sostienes. Este proceso de transmisin de energa se denomina conduccin. Otro fenmeno que est relacionado con la transferencia de energa por el calor, es el que est asociado a la conveccin. Imagina que colocas en la llama de la cocina de tu casa una olla con agua. La capa del fondo del agua le es transferida energa por conduccin, por consiguiente la energa interna del agua aumenta y el volumen de esta capa aumenta, y por tanto su densidad disminuye, haciendo que se desplace hacia la parte superior del recipiente para ser reemplazada por agua ms fra y densa, proveniente de la regin superior. Has observado este movimiento en el agua cuando esta calentndose? El proceso continua, con una circulacin continua de masas de agua ms caliente hacia arriba, y de masas de agua ms fra hacia abajo, movimiento que se denominan corrientes de conveccin. Este mismo modelo se puede usar para otros fluidos como los gases, por ejemplo, en el aire que est en nuestro entorno. Ahora imagina lo siguiente, tienes una lmpara elctrica dentro de una campana de vidrio y le sacar el aire de su interior, tal que se haya hecho un vaco. Qu crees que suceder? Si colocas un termmetro ambiental prximo a la campana, indicar una elevacin de la temperatura, mostrando que existe una trasferencia de energa a travs de la campana. Esta transmisin no pudo haberse efectuado por conduccin ni por conveccin, ya que estos procesos ameritan de un medio material a travs del cual se pueda transferir la energa. Cmo piensas que se realiz la transferencia? En este caso, la transferencia de energa se lleva a cabo mediante el proceso denominado radiacin trmica.

Figura 22.13. En esta situacin hay tres fenmenos de transferencia de energa, conduccin a travs de la barra, conveccin por la masas de aire y radiacin desde la fogata.

178

Todos los cuerpos calientes emiten radiacin trmica cuando sta incide en otros objetos provoca en ellos un aumento de su energa interna, producindose un aumento de su temperatura. Estas radiaciones, as como las ondas de radio, la luz visible, los rayos X, entre otras., son ondas electromagnticas capaces de propagarse en el vaco a la velocidad de la luz, y las cuales transportan energa ms no materia. De manera general, cuando una persona est cerca de un cuerpo caliente, la transferencia de energa por el calor como proceso llega a hasta ella de las tres formas: conduccin, conveccin y radiacin, como se muestra en la figura 22.13. Tanto mayor sea la temperatura del objeto emisor o fuente, mayor ser la energa transferida hacia otros objetos, como sucede cuando te acercas a un horno o a una fogata.

Cmo obtener la cantidad de energa transferida


Intuitivamente se sabe que cuanto mayor sea la energa Q transferida a un cuerpo, mayor ser su variacin de temperatura T, esto se expresa en la siguiente expresin: Q = m c T Si observas esta expresin con detenimiento, vers que ella representa de forma muy aproximada los fenmenos que vives a diario. Por ejemplo, la energa transferida del cuerpo hacia el exterior o del exterior hacia el cuerpo, depende directamente de la masa (m), es decir, si calientas una olla con 5 litros de agua y una con 2 litros, la cantidad de energa que necesitars para cambiar la temperatura T de la de 5 litros ser mayor.
Figura 22.14. Una calora es la cantidad de calor que se necesita para elevar en 1C la temperatura de 1 g de agua.

La constante C en la expresin, es una propiedad de naturaleza fsica de los cuerpos denominada calor especfico, y es como una especie de resistencia que estos presentan a cambiar su temperatura. Por ejemplo, para dos cantidades iguales de aceite y agua, podrs comprobar que para calentar el agua se necesita transferir mayor cantidad de energa que para el aceite. Es decir, el aceite presenta menor resistencia a sufrir cambios en su temperatura. Algunos de estos valores estn en la tabla 22.3.

Calores especficos Materia o sustancia Agua Aluminio Vidrio Mercurio Plomo cal /g C 1,00 0,55 O,20 0,033 0,031

tabla 22.3. Calores especficos de algunas sustancias.

179

Analizando la tabla puedes ver que el calor especfico del agua es mucho mayor que los calores especficos de los otros materiales y sustancias. Esto significa que el agua es la sustancia que presenta mayor oposicin a cambiar su temperatura cuando se le transfiere energa, es por esta razn que el agua se enfra ms lentamente que otras sustancias. Fjate que el mercurio tiene un calor especfico muy bajo. Esto significa que su temperatura vara con facilidad al calentarse, esta es otra de las razones por la cual se utiliza en la construccin de termmetros. Imagnate un termmetro cuya sustancia termomtrica sea el agua, el tiempo de espera para registrar una variacin de la temperatura sera muy largo, y por supuesto muy poco funcional como termmetro. El calor se expresa en las siguientes unidades: Nombre de la Tipo de magnitud magnitud fsica fsica Calor Escalar Smbolo Unidades en el Sistema Internacional (SI) Joule (Jl) Equivalencia entre unidades 1 cal = 4,18 J

Observa en el cuadro, que el calor tiene una equivalencia que ya habas estudiado, las caloras tambin se pueden medir en joules. Esto no es una casualidad, si recuerdas el calor es un mecanismo de transferencia de energa, por lo tanto dada esta relacin entre calor y energa, es normal que el calor se pueda medir en unidades de energa. Esta equivalencia se la debemos al gran cientfico britnico James Prescott Joule, en 1840. Tambin se le debe una contribucin importante a la teora mecnica del calor, y en cuyo honor la unidad de la energa en el sistema internacional recibe el nombre de Joule o Julio.

Sabas que...? Los trabajos de investigacin ms importantes de Joule fueron los relativos a las distintas formas de energa; con sus experimentos verific que al paso de una corriente elctrica a travs de un conductor, en ste se produce un incremento de la temperatura. Has notado que los cables de electricidad se calientan cuando por ellos est circulando corriente?

El calentamiento global
Diariamente somos protagonistas de repentinos cambios del tiempo atmosfrico; fundamentalmente cambios por un fenmeno denominado por la ciencia calentamiento global. Cambios que sin duda alguna son de preocupacin mundial y que solo generan desesperacin por su acelerado avance en todas las naciones del mundo. Lo preocupante y alarmante es que el ser humano no ha encontrado an freno alguno, que detenga y contrarreste esta variacin de las condiciones climticas mundiales. Por cultura general, se dice que lo que ocasiona dicho calentamiento global, es el efecto invernadero, fenmeno que es generado por la abrumante contaminacin existente en nuestro medio. En s, este consiste en la retencin de la radiacin ultravioleta emitida por el Sol que llega a nuestro planeta, debido a que no pueden salir de la atmsfera con facilidad, por la presencia de una capa densa de dixido de carbono, CO2, producida de la contaminacin ambiental.
180

Como premisas de ello son algunas consecuencias las que generar este terrible calentamiento: 1) La prdida total de los polos Antrtico y rtico, lo que a su vez generar un incremento de agua en el mar; provocando inundaciones, prdida de especies y grandes extensiones de tierra. 2) Fatdicos deshielos de nevados, montaas, las cuales apuntaran a la desaparicin de ros, lagos, eliminado toda clase de vida natural. 3) Pestes y graves problemas de salud de muchas personas, en especial: ancianos y nios. 4) Extincin de muchas especies en diversas partes del mundo. 5) Escasez de recursos de primera necesidad, en particular, el agua potable. Sequas y grandes extensiones de terrero agrcolas convertidos en desiertos. 7) La hambruna comenzara aparecer, Ser problema mundial sin solucin y noticia comn de todos los das. No obstante, se espera que lo antes mencionado y puesta en vista, nos lleve a la reflexin y a la toma absoluta de conciencia. A modo de crtica: el estilo de vida impuesto y los modos de desarrollo que predominan son parte responsable de este terrible desajuste ambiental, as que lo ms indicado es que a travs de la conciencia individual y colectiva con las organizaciones comunitarias, regionales, nacionales y mundiales se promueva una solucin factible ha dicho problema. Abre los ojos! Pues tambin, los das estn contados para seres que no tienen la culpa de vivir en un planeta manejado injustamente Propongamos soluciones, es el camino que nos queda para subsistir en este hermoso planeta.

Glaciar Perito Moreno, Argentina.

181

Caliente o fro?
Te proponemos a continuacin evidenciar el proceso de transferencia de energa (calor) entre sistemas a diferentes temperaturas. Qu necesitan? 3 vasos de precipitados, agua caliente, agua fra y agua templada. Prepara el vaso A con agua caliente, el vaso B con agua fra y un tercer vaso C con agua templada que obtendrs al mezclar la misma cantidad de agua caliente y de agua fra. Midan la temperatura del agua contenida en los recipientes A, B, C.. Introduce el dedo ndice de la mano izquierda en el vaso con agua caliente y el dedo ndice de la mano derecha en el vaso con agua fra. A continuacin introduce ambos dedos en el recipiente con agua templada.

Registra la sensacin percibida en cada dedo. a. Que explicacin das a estas sensaciones? b. Comprtelas con tus compaeras y compaeros, difieren? Por qu? c. El sentido del tacto es un criterio fiable para distinguir cuerpos calientes y fros? Ensayen otras opciones, por ejemplo pasando el dedo de la fra a la caliente, y discutan sobre le resultado Necesito un termmetro mejor Supn que tu compaero posee un termmetro comn de poca sensibilidad, es decir, que con l solo se pueden percibir variaciones de temperatura de 1C. Tu compaero se propuso, construir otro ms preciso. Disea un plan para ayudarlo a lograr el objetivo. Realiza una discusin acerca de los diversos diseos.
182

Transferencia de energa de dnde a dnde? Echa agua del grifo en un vaso de vidrio resistente al calor. a. Mide su temperatura y antala. Temperatura del agua, T = ______ b. Toma un objeto, por ejemplo, una esfera de hierro, y chala en el vaso anterior, mide de nuevo su temperatura y antala. Temperatura del agua, T1 = ______ c. Observas alguna variacin de temperatura? Construye una explicacin de este resultado. d. Con una pinza metlica, saca la esfera de hierro. Ahora con cuidado, calintala en una llama (mechero, cocina de gas, ) e introduce la esfera lentamente en el agua. Inmediatamente, y al cabo de un rato, mide la temperatura del agua y anota su valor. Temperatura del agua con esfera de inmediato, T2 = _____ Temperatura del agua con esfera despus de un rato, T3 = _____ e. Explica razonadamente tus observaciones f. Describe otras situaciones en los que se observe la elevacin de la temperatura de un objeto y explica el proceso que lo gener. Te damos pistas: Cmo hacan antiguamente los seres humanos para encender el fuego? Qu sientes en tu cuerpo cuando te pones al Sol? Cmo calientas la leche de tu desayuno? Qu notas cuando tocas una bombilla que lleva un tiempo encendida?

183

Actividades de autoevaluacin
1. Supn de que dispones de dos termmetros de mercurio, idnticos uno de ellos graduado en escala Celsius y otro en la escala de Fahrenheit. Si los usas para medir la temperatura de un mismo lquido. La altura de la columna de mercurio que indica la temperatura en el termmetro Celsius es mayor, menor o igual a la altura correspondiente del termmetro Fahrenheit? Por qu? Analiza con tu grupo las diversas explicaciones. 2. Cuando introducimos dos cucharas, una de madera y otra de metal, en chocolate caliente, notamos que al cabo de un cierto tiempo al agarrar las cucharas de nuevo, la de metal est ms caliente que la de madera. Si ambas cucharas estn calientes en el extremo que est sumergido en el chocolate, por qu la de metal est ms caliente que la de madera en el extremo por donde las has agarrado? 3. Algunos anuncios comerciales de refrigeradores suelen pregonar las ventajas de estos productos, y se dicen cosas como: Nuestro refrigerador no deja entrar en calor, ni deja escapar el fro. En esta afirmacin hay un error desde las ideas de la ciencia. Cul es? 4. Si en un recipiente de vidrio calientas agua a la que le has echado aserrn muy fino, observars que se producen en la parte inferior, ms prxima a la fuente de calor, unos torbellinos. Elabora una explicacin ayudado de diagramas para explicarle a un grupo de nios lo sucedido. 5. En el pramo, los das de enero tienden a ser los ms fros. Normalmente se observas en la calle mucha gente que lleva abrigos y chaquetas. Dos jvenes tienen un conflicto, uno dice que el abrigo lo calienta y la otra dice que el abrigo no lo calienta. Con quin ests de acuerdo? Por qu? 6. En un recipiente echamos 100 g de agua a la temperatura de 50 C y 200 g de agua a 20 C. Calcula la temperatura final de la mezcla de los dos lquidos.

184

7. Se ha calentado agua hasta la ebullicin mediante un mechero, durante el proceso se han tomado datos de temperatura y energa que vers representados mediante la grfica de la figura. Interpreta la grafica mediante el modelo de partculas que estudiaste antes.

En cada una de las siguientes actividades, qu procesos de transferencia de energa ocurren? a. Calienta un clavo de hierro. b. Enciende una bombilla. c. Orienta una lupa de tal manera que puedas enfocar los rayos del Sol sobre un papel de seda. Cuando te expones al Sol, notas que te calienta.

185

23
Si piensas por un momento, en un mundo en el cual no existan los aparatos elctricos, es decir, un mundo sin computadoras, sin celulares, sin equipos electrodomsticos, ms aun, sin electricidad. Un mundo como este sera muy extrao para nosotros ya que el uso masivo de la energa elctrica se generaliz a partir de la segunda mitad del siglo XX, siendo en la actualidad, el motor de muchas de nuestras actividades de trabajo e incluso de entretenimiento. Por tal razn, hoy en da, un mundo sin energa elctrica nos obligara a readaptarnos a una nueva condicin de vida. Sin embargo, deberamos preguntarnos, de donde viene toda esa energa, cmo se hace para obtenerla, transformarla y utilizarla? las respuestas estn, tal vez, en siglos de estudio e investigacin que condujeron al desarrollo de saberes, cuyas aplicaciones hoy en da disfrutamos y que al parecer merecen las mismas explicaciones de fenmenos naturales, como el relmpago o la atraccin que hace la piedra de mbar sobre hojas secas cuando sta es frotada. En esta lectura compartiremos algunas de esas ideas que te llevarn a comprender el fenmeno elctrico, tales como: carga elctrica, corriente elctrica, potencial elctrico, resistencia elctrica, potencia elctrica, entre otros trminos que forman parte del lenguaje que se utiliza en el estudio de dicho fenmeno. Tambin te plantearemos algunas actividades de investigacin, creacin o innovacin para que participes en la magia creativa de aprender haciendo.

186

La corriente elctrica en la comunidad

Fenmenos elctricos
Probablemente hayas observado los siguientes fenmenos: una regla de plstico cuando la frotamos con seda puede atraer una bolita de anime, un peine se electriza cuando se frota contra el cabello y luego puede atraer a este, la ropa de nailon tambin se electriza al friccionarse con nuestro cuerpo, los automviles en movimiento adquieren electrizacin por el rozamiento con el aire, un globo al ser frotado con el pelo se acerca de nuevo al pelo y este se atrae. En la actualidad, todos estos fenmenos estn relacionados con un comportamiento que presentan todas las sustancias y que es muy similar al observado por William Gilbert en el ao 1600. Este gran cientfico observo de manera sistemtica, que algunos otros cuerpos se comportan como el mbar al frotarlos, y que la atraccin que ejercen se manifiesta sobre cualquier otro cuerpo, aun cuando no sea ligero. Estos fenmenos de atraccin no tendran sentido atribuirlos a la propiedad masa que presentan los cuerpos. Para dar una explicacin a esta otra propiedad que presenta la materia, nos podemos hacer las siguiente pregunta: estarn relacionados estos fenmenos con la propiedad carga elctrica que presentan los cuerpos en su estructura interna? La respuesta es s, ya que la materia que observamos cotidianamente por lo general es elctricamente neutra debido a que tiene igual nmero de protones y electrones, pero cuando por alguna razn este balance se rompe, ya sea porque tiene mayor o menor nmero de electrones, decimos que la materia, aparte de poseer la propiedad masa, adquiere una propiedad adicional llamada carga elctrica. Esto es lo que hacemos, por ejemplo, con el globo o la piedra de mbar cuando lo frotamos, es decir, provocamos un intercambio de electrones entre los objetos que interactan.

Figura 23.1. Al frotar un globo o una piedra de mbar, estos cuerpos adquieren la propiedad carga elctrica que le permite interactuar con otros cuerpos.

Como la interaccin que mantiene a los electrones unidos al tomo es de menor intensidad que la que mantiene a los protones unidos al ncleo del tomo, es ms fcil que un tomo pierda o gane electrones que protones, por eso se dice que cuando la materia gana electrones adquiere una carga neta negativa y cuando pierde electrones adquiere una carga neta positiva.
187

Por esta razn se afirma que la carga elctrica de un cuerpo est cuantizada porque depende del valor fundamental de la carga del electrn, solo puede tener o faltarle cantidades enteras de electrones.

Carga de un cuerpo = N x carga del electron Q = ( + ) nqe Diversos experimentos realizados demuestran que el valor actualmente aceptado de la carga del electrn es igual a 1,602176487x10-19 Coulomb, siendo este el mismo valor de carga para el protn. Se ha establecido la convencin de que la carga del electrn es negativa y la del protn positiva.
Nombre de la magnitud fsica Carga elctrica Tipo de magnitud Escalar (un nmero ms una unidad fsica) Smbolo Unidades en el (SI) [C] (Coulomb) Equivalencia entre unidades

Sabas que...? Hay un estado de la materia llamado plasma que aparece en forma parecida a la de un gas, pero est formado de partculas cargadas que se han separado de los tomos, esta separacin ocurre a muy altas temperaturas. El plasma es el menos comn de los estados en la vida cotidiana, pero es el ms comn en el universo, porque es el estado predominante en estrellas como el Sol y material intergalctico que se encuentra a altsimas temperaturas.

Interacciones elctricas
Se puede comprobar que cuando los cuerpos estn cargados elctricamente de forma diferente se atraen y si estn cargados de la misma forma se repelen. Es decir, entre estos objetos se est dando una interaccin o accin mutua, llamada interaccin elctrica. Y eso ocurre estando las cargas en reposo o en movimiento.

Figura 23.2. Se evidencia que las cargas de igual signo se repelen y las cargas diferentes se atraen.

188

Fue Charles Coulomb quien en 1785, estableci la naturaleza de esa interaccin, sealando que las cargas elctricas se atraen o se repelen en la lnea que las une, con una fuerza que es directamente proporcional al producto de las cargas e inversamente proporcional al cuadrado de la distancia. Matemticamente, la intensidad de la fuerza elctrica se puede representar de la siguiente manera: K q1 q2 Fe = d2 Siendo K la constante de permeabilidad elctrica en el vaco y su valor es de:

K = 9 109

N m2 c2

Debido esta fuerza elctrica, podemos darle explicacin a los niveles de organizacin de la materia en tomos, molculas, clulas, tejidos, otros. Que forman parte de la mayora de las estructuras, fsicas, qumicas y biolgicas conocidas.

Comparemos la fuerza gravitacional con la fuerza elctrica de un tomo de hidrgeno

Consideremos el modelo de tomo de hidrgeno propuesto por el fsico dans Niels Bohr, formado por un ncleo que tiene un protn y un neutrn y que alrededor del ncleo se mueve de forma circular un electrn.

Considerando para ese tomo los siguientes valores:

m proton = mneutron = 1, 67 1027 kg mnucleo = 3,34 10 27kg


melectron = 9,11 1031 kg qelectron = q proton = 1, 6 1019 C r = 5 1011 m, radio promedio del tomo de hidrgeno.
6, 67 1011 FG =
9 109

N m2 1, 67 1027 kg 3,34 1039 kg kg 2

( 5 10

11

m)

= 1, 48 1047 N

Fe =

N m 1, 6 1019 C 1, 6 1019 C C2 = 0,92 107 N 2 11 ( 5 10 m )

Se puede apreciar que la fuerza gravitacional es significativamente de menor valor comparada con la fuerza elctrica. Es por ello que se considera de acuerdo a este modelo, que la fuerza que hace que el electrn se mueva alrededor del ncleo es la fuerza elctrica. Es este sentido se afirma que en el mundo de las pequeas partculas cargadas es la fuerza elctrica la que gobierna.
189

Cmo se genera una corriente elctrica?


Es probable que hayas tenido la oportunidad de tener evidencia de la existencia de la corriente elctrica. Cuando conectas algunos aparatos a una batera o a un toma corriente, observas que ocurren fenmenos internos que te permiten activar motores, generar seales de audio y video, entre otras. Una corriente elctrica se genera cuando los electrones o protones, o cualquier objeto cargado elctricamente llamados portadores de carga, son movidos a travs del espacio, se mide por el nmero de portadores de carga que pasa a travs de un medio conductor por unidad de tiempo.

Figura 23.3. Modelo de corriente elctrica. En un conductor existen partculas cargadas que tienen cierta libertad para desplazarse y producir una corriente. Como convencin, se toma como sentido de la corriente, la direccin que seguiran las cargas positivas (representadas por crculos rojos), an cuando se muevan cargas negativas (representadas por crculos azules) en sentido contrario.

Intensidad de corriente =

nmero de portadores de carga tiempo

I=

q t

La magnitud que se utiliza para determinar este fenmeno con mayor precisin se denomina intensidad de corriente y se mide con instrumentos llamados ampermetros. Segn la definicin anterior, la unidad de medida de corriente elctrica en el Sistema Internacional es: Nombre de la Tipo de magnitud fsica magnitud Intensidad Escalar de corriente (un nmero ms elctrica una unidad fsica) Smbolo Unidades en el (SI) A (Ampere) Equivalencia entre unidades

Para que se produzca una corriente elctrica es necesario que en un medio existan partculas cargadas que tengan cierta libertad de desplazarse. Estas partculas cargadas pueden ser electrones, iones (positivos o negativos), o partculas que tengan como condicin una carga neta.

190

La intensidad de la corriente es el factor ms relevante en las sensaciones y consecuencias de los choques elctricos. Estudios precisos de este fenmeno permitieron obtener los siguientes valores aproximados:
Intensidad de la corriente elctrica 1mA a 10 mA 10 mA a 20 mA Entre 20 mA y 100 mA Entre 100 mA y 200 mA Sensacin Hormigueo. Dolor. Graves dificultades respiratorias. Extremadamente peligrosas, pueden causar la muerte de la persona, provoca contracciones rpidas e irregulares del corazn (fibrilacin cardiaca). No causan fibrilacin; sin embargo, dan origen a graves quemaduras y conducen al paro cardiaco.

Mayor que 200 mA

El modelo de corriente elctrica presentado, nos permite hacer una tipificacin, si el sentido de la fuerza elctrica se mantiene constante, el sentido de la corriente tambin se mantendr inalterado; es decir, las cargas se desplazarn continuamente en un mismo sentido en el material metlico o conductor. Una corriente establecida as, se denomina corriente elctrica continua. Esta se representa por el smbolo CC o CD (corriente directa). Los generadores de energa que proporcionan este tipo de corriente son las pilas, bateras o acumuladores.

El otro tipo de corriente se denomina corriente alterna (CA) la cual se establece cuando las cargas elctricas en el material conductor no mantienen un solo sentido de desplazamiento, es decir, la direccin de la fuerza elctrica cambia de sentido de forma peridica. Este efecto, provoca que las cargas elctricas oscilen, desplazndose unas veces en un sentido y otras en sentido contrario. Este tipo de corriente es la que comnmente encontramos en las tomas de nuestra casa. Esta corriente posee las siguientes especificaciones: una frecuencia de 60 Hertz; es decir, que las cargas elctricas oscilan en el conductor 60 veces por segundo, puede ser suministrada con un voltaje de 120 V o 220V. Sin embargo, es importante mencionar que algunos equipos como por ejemplo, el monitor de una computadora, la CA se tiene que transformar en CC para hacer uso de ellos. Esto se hace por medio de dispositivos denominados rectificadores. La corriente elctrica resultante de esta transformacin se denomina corriente rectificada.

Figura 23.4. Modelos de tipos de corriente. La flechas el sentido de la corriente.

191

La diferencia de potencial mueve a las cargas elctricas


Al saber que la corriente elctrica se produce por el movimiento de portadores de carga, cabe la pregunta acerca de Qu es los que produce dicho movimiento? En este desplazamiento la fuerza elctrica estar realizando un trabajo que vamos a designar como TAB. Este trabajo representa la cantidad de energa que la fuerza elctrica imparte a la carga q en su desplazamiento de A hacia B. En el estudio de los fenmenos elctricos hay una cantidad muy importante que se relaciona con este trabajo, la cual se denomina diferencia de potencial entre los puntos A y B y se representa por VA- VB. La diferencia de potencial se define como la relacin entre el trabajo realizado por la fuerza elctrica sobre la carga, por unidad de caga, esto se expresa como: VA- VB = TAB/q En el rea de la tecnologa, la diferencia de potencial suele denominarse como voltaje o tensin elctrica.

Figura 23.5. En los tres casos para mover los portadores de carga fue necesario aplicar una diferencia de potencial, la cual fue suministrada por una batera.

Observa que como TAB y q son magnitudes escalares, la diferencia de potencial es tambin un escalar. De esta expresin, se puede deducir que el potencial en un punto tiene como unidad en el SI: Nombre de la magnitud fsica Potencial elctrico Tipo de magnitud Escalar (un nmero ms una unidad fsica) Smbolo Unidades en el (SI) V (voltio) Equivalencia entre unidades 1V = 1 J C

192

Es importante que a partir del concepto de diferencia de potencial que acabas de estudiar, tomes reflexiones acerca de estos casos: 1) el concepto de voltaje es usado con frecuencia en nuestra vida diaria, por ejemplo, en las casas existen tomas de corriente de 110 V, esto se interpreta que 110 V es igual a 110 J/C, es decir, que si un aparato elctrico se conecta a uno de estos tomacorriente, cada carga de 1 C que se desplace entre los dos puntos de la toma, recibir 110 J de energa que a su vez se transmitir al aparato. 2) Si el toma corriente es de 220 V, podemos concluir que cada carga de 1 C recibir 220 J de energa al desplazarse de un terminal a otro para ser transformada. 3) De la misma manera, cuando decimos que la batera de un automvil tiene un voltaje de 12 V, habr una energa de 12 J para ser impartida a cada carga de un coulomb a fin de que vaya de un terminal a otro (borne o polo) de la batera.

Mucha energa se transforma: potencia elctrica


De manera muy general puede decirse que los aparatos elctricos son dispositivos que transforman energa elctrica en otra forma de energa. Por ejemplo, en un motor elctrico la energa elctrica se transforma en la energa mecnica de rotacin de la maquina; en un calentador, la energa elctrica se transforma en energa trmica que caliente el agua; en una lmpara, la energa elctrica se transforma en energa luminosa, otros. Para que entiendas mejor estas transformaciones, supongamos que un aparato se conecta a un tomacorriente. Como ya lo viste, entre los terminales de la toma de corriente se establece una diferencia de potencial a la cual llamamos VAB . Esta produce un trabajo sobre los portadores de carga, as, una corriente elctrica pasar desde A hasta B, a travs del aparato. Las cargas elctricas que constituyen la corriente pasarn de un punto en donde poseen mayor energa elctrica (A) a un punto en donde las cargas tendrn menos energa elctrica (B). Esta diferencia de energa en las cargas obviamente no desaparece: ella ha sido transferida al aparato y aparece como otra forma de energa, por eso las cargas se mantienen con igual energa cintica. La forma de energa en la cual se transformar la energa elctrica cedida depender del aparato que este conectado entre A y B (bombillo, plancha, motor, entre otros). La cantidad de energa elctrica que se transfiere al aparato conectado entre los puntos A y B se puede calcular como se explica a continuacin. Considerando la corriente i que pasa por el aparato durante un intervalo de tiempo t, tendrs una carga q que se desplaza de A hacia B, la cual de acuerdo con la definicin de corriente elctrica podemos expresar como:

q = it
Recordando la definicin de diferencia de potencial, estas cargas recibieron una cantidad de energa debido al trabajo que se realiz para moverlas, por lo cual esta energa est dada por la siguiente expresin:

E = q VAB = i t VAB

193

Como no hay aumento en la energa cintica de la carga, podemos concluir que la energa recibida por la carga ser transferida al aparato. Generalmente, se desea conocer la potencia P, desarrollada por el aparato elctrico, y como viste en la lectura referente a energa y trabajo esta potencia es la relacin de la energa por unidad de tiempo y se expresa como:

P = E t
Por lo tanto, para este caso tenemos que la potencia elctrica sera el producto de la intensidad de corriente que circula entre dos puntos por la diferencia de potencial entre ellos, lo cual se expresa como:

P = i t VAB t = iVAB
Esta relacin nos permite concluir que al ser sometido un aparato elctrico a una diferencia de potencial, por este circula una corriente, entonces, la potencia desarrollada en el aparato est dada por:

P = iVAB
De acuerdo con esta expresin tenemos que la potencia elctrica tiene las misma unidades indicadas en lecturas previas para potencia, que es: Nombre de la magnitud fsica Potencia elctrica Tipo de magnitud Escalar (un nmero ms una unidad fsica) Smbolo Unidades en el (SI) W (vatio) Equivalencia entre unidades 1W= 1 J = 1.V.A s

Cunta potencia desarrolla la batera de un automvil?

La batera de un automvil aplica una diferencia de potencial entre sus bornes de 12 V, a los terminales de su motor de arranque, generndose una corriente de 50 A. Cul es, entonces la potencia desarrollada por dicho motor elctrico? Esta potencia ser:

P = iVAB = ( 50 A ) (12V ) = 600W

Este resultado se puede interpretar de la siguiente manera: en cada segundo, 600 J de energa elctrica se transformarn en energa mecnica de rotacin del motor (despreciando las prdidas por calentamiento en esta mquina)

194

Cunto se paga de energa elctrica por un bombillo incandescente?


Si tienes bombillos incandescentes de 40 W, 60 W y 75 W que funcionan con 120 V. Determina la energa que en cada bombillo se transforma en una hora de funcionamiento continuo. Determina con la tarifa de electricidad actual, cunto hay que pagar por el servicio de energa elctrica en ese tiempo?

Desarrolla potencia, disipa energa: efecto Joule


Has podido ver que en el fenmeno de transferencia de energa, la carga elctrica gana y cede energa cintica, dependiendo de cual sea la naturaleza del elemento. En la realidad ocurre un trabajo realizado dentro del material (calor) que produce un incremento de su temperatura, es decir, todos los dispositivos y equipos que funcionan con corriente se calientan, a este efecto se le denomina efecto Joule. Hay casos donde se observa el efecto contrario, esto es, obtenemos corrientes a partir de diferencias de temperatura, a este efecto se le llama termoelctrico, el cual se utiliza para medir la temperatura, como por ejemplo en los motores de los automviles. El efecto Joule tiene diversas aplicaciones, entre ellas: radiadores, parrillas, planchas, hornos elctricos, secadores de pelo, los cuales consisten esencialmente en un material conocido como la resistencia, la cual se calienta al ser recorrida por la corriente. Los filamentos de tungsteno de los bombillos incandescentes, al ser recorridos por una corriente, se calientan alcanzando altas temperaturas (casi 2.500 C), emitiendo una gran cantidad de luz.

Figura 23.6. El dispositivo de la figura es un calentador de bebidas. Internamente, cuando la corriente elctrica pasa por la resistencia arrollada en forma de espiral en la base del dispositivo, se calienta y transfiere energa al recipiente y el lquido que se desea calentar, aumentando su temperatura.

Adems de las aplicaciones del efecto Joule mencionadas, tambin estn los fusibles. Estos son elementos de circuitos que se emplean para limitar la corriente que pasa por una conexin elctrica, es decir, si la corriente que circula por el circuito es superior a un cierto valor, el filamento del fusible se quema, abrindose el circuito. Estos elementos son utilizados en automviles, circuitos de la casa, aparatos elctricos, entre otros. Con los fusibles se evitan los famosos cortocircuitos. A pesar de la utilidad de este efecto Joule, tambin representa para el campo de la ciencia y la ingeniera un problema fundamental, debido a que en muchos casos se tiene que emplear sistemas de refrigeracin, para que los equipos funcionen sin recalentarse.
195

Relacin entre la corriente elctrica y la diferencia de potencial: Ley de Ohm


Para realizar el estudio de circuitos de corriente continua en las Ciencias Naturales dispone de una ley simple, que a principios del siglo XIX, enunci Georg Simon Ohm (1789-1854), fsico alemn, al darse cuenta que en los circuitos elctricos la intensidad de la corriente elctrica, en muchos conductores era directamente proporcional a la diferencia de potencial aplicada. Diferencia de potencial elctrico intensidad de corriente V I Quiere decir que al aumentar el valor de la diferencia de potencial aumenta el valor de la intensidad de corriente en la misma proporcin, matemticamente se cumple que el cociente entre las cantidades debe ser una constante:

V = Constante I
Esa constante es precisamente la resistencia elctrica (R) del material:

R=

V V = RI I

Es importante mencionar que exactamente esta no es una ley, es decir, no se cumple para todos los materiales en general. Ms bien es una expresin que representa la caracterstica de algunos materiales. A los materiales que cumplen con esta relacin los conocemos como materiales hmicos.
Figura 23.7. a) En el circuito simple CC tenemos que la intensidad de corriente I, depende de la diferencia de potencial de la batera y la Resistencia del resistor b) Grafica que seala la relacin directa que hay entre la intensidad de corriente y la diferencia de potencial, la pendiente de la recta es la contante de proporcionalidad y corresponde a la resistencia del material.

Todos los materiales incluyendo los metlicos presentan la propiedad de la resistencia elctrica. Esta propiedad, la podemos definir como la mayor o menor dificultad que opone un material conductor al paso de la corriente elctrica.
196

La resistencia de un material conductor depende de las caractersticas del material: su resistividad, la longitud y la seccin transversal del conductor. Estos parmetros se relacionan a travs de la expresin:

R=

l A

En donde R es la resistencia, la resistividad del material, la cual es una propiedad natural del mismo, l la longitud y A es la seccin del material. A mayor longitud mayor ser la resistencia ya que ms oposicin tendr los portadores de cargas para pasar a travs del conductor, y a mayor rea de la seccin transversal, menor ser la resistencia porque los portadores de cargas tendrn ms espacios por donde pasar a travs del conductor. Nombre de la magnitud fsica Resistencia elctrica Tipo de magnitud Escalar (un nmero ms una unidad fsica) Smbolo Unidades en el (SI) ohmio () (Ohm) Equivalencia entre unidades
1Ohm = (1Ohm m ) 1Ohm = 1Voltio 1 Ampere 1m 1m2

Si quisiramos contrastar cmo circula la corriente elctrica por el interior de distintos conductores, podramos modelar el fenmeno con un diseo conformado por mangueras trasparentes por las cuales circula agua. En este caso el agua es el anlogo del flujo de electrones y las mangueras del conductor. Si estas mangueras presentan distinta rugosidad en su interior, pudisemos comprobar que cada tubo ofrece una resistencia distinta al paso del fluido en funcin de sus caractersticas internas. Esto es similar a lo que sucede en el conductor y que denominamos resistividad. De igual forma, veramos que el fludo circula mejor por mangueras de menor longitud y de mayor seccin transversal, tal como ocurre con los conductores. A continuacin mostramos una tabla con los valores de resistividad de distintos materiales: De acuerdo a esta propiedad fsica de permitir el paso de los portadores de carga, los materiales se pueden clasificar en: Conductores: materiales a travs de los cuales la corriente fluye con relativa facilidad. Metales como plata, cobre, oro y aluminio se cuentan entre los mejores conductores. Aisladores: materiales que no conducen electricidad. Cermica, vidrio, plstico, goma, papel seco, caucho Segn la escala de aplicacin tecnolgica tambin son muy tiles los semiconductores y los superconductores.
197

Semiconductores: materiales como el silicio o el germanio, que son pobres conductores de la electricidad. Cuando le son agregadas pequeas cantidades de otros materiales como arsnico, fsforo o boro, pasan a ser semiconductores, estos se utilizan para construir dispositivos como diodos, leds y transistores. Superconductores: materiales que a temperatura ambiente son malos conductores, si se ponen a muy bajas temperaturas resultan muy buenos conductores, es decir, ofrecen poca resistencia al paso de la corriente. Se han encontrado mltiples aplicaciones en el transporte con trenes de levitacin magntica, en la medicina para la resonancia magntica, entre otras.

El nico problema que presentan los superconductores, es que esta propiedad de superconducir corriente se logra a temperaturas extremadamente bajas comparadas con las que experimentamos de forma cotidiana, por lo que, su estudio y aplicacin se ha logrado en laboratorios muy sofisticados cuyas condiciones ambientales estn muy alejadas a las reales. La investigacin contina para poder tener materiales que conduzcan corriente con resistividad casi cero, lo cual nos permitira poder construir conductores que accedan a su vez crear mquinas en donde la produccin de calor por la resistencia del material sea muy baja, aumentando en un nivel significativo su capacidad de realizar trabajo. Te imaginas lo til que sera tener cables, motores circuitos, que no transforman electricidad en energa trmica. Sabas que...? El doctor H. Kamerlingh Onnes (1856-1926) de la Universidad de Leiden en Holanda, a principios del siglo XX investig las propiedades de la materia a baja temperatura. Con ello logr producir helio en estado lquido en 1908, y descubrir que en materiales, como el mercurio a bajas temperaturas (-296C) se puede generar la conduccin de corriente elctrica con mayor efectividad que en los metales. Esto le vali el premio Nobel de Fsica en 1913. Una de las aplicaciones tecnolgicas actuales de los superconductores se realiza en trenes de alta rapidez, denominado popularmente tren bala.
198

Los circuitos elctricos


Un circuito elctrico es un conjunto de elementos unidos de tal forma que permitan el paso de la corriente elctrica para conseguir algn efecto til (luz, calor, movimiento, entre otros). Por lo que todo circuito elctrico debe disponer como mnimo de 3 elementos imprescindibles: generadores, conductores y receptores. Los receptores en general son resistencias comerciales o aparatos elctricos, los conductores son cables y los generadores son pilas, bateras, acumuladores, entre otros. Funcin de las pilas en un circuito. Ya hemos mencionado que para establecer una corriente elctrica en el interior de un conductor se deben conectar sus extremos a los bornes de una pila elctrica o batera. Esta diferencia de potencial entre dichas terminales, se mantiene gracias a las reacciones qumicas que se producen en su interior. En una pila seca comn (de las que usan las linternas, radios porttiles), el borne positivo (+), tiene un potencial ms alto que el del borne negativo (-) de la pila. En general, el polo positivo de estas pilas es una barra de carbn, y el polo negativo es una envoltura de zinc. La diferencia de potencial que se mantiene entre estos polos es debida a la energa liberada gracias a las reacciones electroqumicas. La diferencia de potencial proporcionada por una pila seca es aproximadamente de 1,5 V. Si conectamos el terminal positivo de una pila al negativo de otra, hablamos de una conexin en serie. Con esto conseguimos una diferencia de potencial mayor entre los extremos libres, tal como puedes apreciar en el interior de una linterna, radio u otros equipos elctricos que funcionan con estas pilas. El voltaje total conseguido con la conexin se calcula:

VTotal de la conexin = N Vuna sola pila , N representa el nmero de pilas en la conexin.

Figura 23.8. a) Conexin de 3 pilas en serie para obtener una diferencia de potencial ms elevada (4,5 V). b) Smbolo internacional que se utiliza para expresar una conexin en serie.

Con la batera y los otros dos elementos: el conductor y el receptor, conectados uno a continuacin del otro, cerramos el circuito. Este voltaje que se aplica entre los extremos del circuito genera una corriente elctrica, cuyo sentido es del polo positivo hacia el negativo. Cuando la corriente llega al polo negativo, las cargas son obligadas, debido a la diferencia de potencial, a desplazarse en el interior de la batera, pasando haca el polo positivo, lo cual completa el circuito. Al proseguir en su movimiento, las cargas seguirn desplazndose por el conductor, yendo nuevamente del polo positivo hacia el polo negativo. Mientras se mantenga la diferencia de potencial entre los polos de la batera, tendrs una corriente que circular en forma continua de la manera que te describimos antes.
199

Asociacin en serie de receptores


Muchas veces, en los circuitos elctricos se observan receptores o resistencias conectadas una despus de la otra. Cuando esto sucede, decimos que tales elementos, al igual que en el caso anterior de las pilas, estn conectados en serie. Por ejemplo, los bombillos que se emplean para adornar los rboles de navidad, generalmente, se hallan conectados de esta manera (Figura 19.9.a). Si entre los extremos de la asociacin se aplicara una diferencia de potencial, por la conexin pasara una corriente elctrica. El nmero de cargas que pasa por un punto del circuito ser el mismo que pasa por otro punto en este mismo tiempo. Con lo cual podemos concluir que la intensidad de corriente tiene el mismo valor en todas las secciones de este circuito. Por tanto, las resistencias, representadas en este caso por los bombillos (figura 23.9.b) seran recorridas por la misma corriente, incluso si estas tuviesen distintos valores de potencia.

Figura 23.9. (a) En la iluminacin de un rbol de navidad, los bombillos generalmente se encuentran conectados en serie. (b) Circuito conformado por tres bombillos (resistencias) conectadas en serie; un generador (pila), conductores y un interruptor, el cual sirve para dejar pasar la corriente por todo el circuito.

Como en las asociaciones en serie la corriente es la misma en cualquier seccin del circuito tenemos: I1 = I 2 = I 3 = I . Adems, la diferencia de potencial suministrada por el generador al circuito se distribuye entre los receptores, de forma que el voltaje en cada receptor variar segn su resistencia, de esta forma, el voltaje total aplicado por el generador es la suma de los voltajes en cada receptor, lo cual se expresa como: VT = V1 + V2 + V3 . . Por razones prcticas en los circuitos se suele representar la diferencia de potencial solo con la letra V. De lo que leste en la seccin de ley de ohm, y como por cada receptor circula una corriente I, y est bajo un voltaje V, ste se puede expresar como: V = IR, siendo R su resistencia. De esta forma en la relacin de voltaje total sustituimos el voltaje que corresponde a cada resistencia, obteniendo: IRT = IR1 + IR2 + IR3 La resistencia total se obtiene entonces, sumando algebraicamente todas las resistencias conectadas en el circuito, simblicamente: RT = R1 + R2 + R3 En general, en estos circuitos en serie, en la resistencia que tenga mayor valor se observar una mayor voltaje, debido a que por todas circula la misma corriente.
200

Asociacin en paralelo de receptores


Otra forma de conectar a las resistencias es en paralelo o derivacin, como se puede apreciar en la figura 23.10. Ejemplos de estas asociaciones son los faros de un automvil y las lmparas y aparatos elctricos de una casa.

Figura 23.10. (a) Esquema de un circuito de bombillos (resistencias) en paralelo. La corriente que pasa por cada una de ellas es distinta, contrario al caso de la asociacin en serie, y depende la resistencia. (b) Dos lmparas conectadas en paralelo, con un interruptor.

A diferencia de algunas instalaciones de bombillos del arbolito navideo, que al desconectar una se apagan las otras debido a que el circuito quedo abierto, los faros de un automvil funcionan de manera independiente, es decir, si uno se daa el otro contina iluminando; lo mismo ocurre con las lmparas de una casa, si apagas una no surge ningn efecto sobre las dems. Esto ocurre porque en cada resistencia el voltaje es el mismo e independiente, as: V1 = V2 = V3 = Vt . Debido a que cada resistencia esta sometida al mismo voltaje, la intensidad de corriente que circula por cada uno depender de su resistencia; por la resistencia de menor valor circular la corriente de mayor intensidad. Por tanto, la corriente que entra al paralelo se distribuye, y esto se puede expresar como: I = I1 + I 2 + I 3 . Esta distribucin se debe a que el flujo de electrones al llegar al punto del circuito en donde se realiza la conexin de las resistencias (nodo) se divide dependiendo de la resistencia en cada lnea. Anlogamente a este fenmeno podemos pensar en una conexin de tuberas por donde fluye agua. Si la conexin no encuentra ningn impedimento el flujo de agua viajara sin interrupcin ni desviacin con el mismo caudal, pero si las tuberas se encuentran conectadas a un codo que las divida en dos, tres, cuatro secciones la intensidad del flujo de agua se distribuir. Tal como en las conexiones en serie, de lo que leste en la seccin de ley de ohm, y dado que en cada receptor el voltaje es el mismo y las corrientes son diferentes, tenemos que para cada uno:

l=

V R

201

De esta forma sustituimos en la relacin anterior de corrientes y resulta que la relacin entre las resistencias queda de la siguiente forma:

1 1 1 = + + R R1 R2

1 Rn

Si analizas esta expresin encontrars que el valor de la resistencia equivalente para este circuito es menor que la menor de las resistencias utilizadas. En las conexiones de nuestra casa, como los receptores estn conectados en paralelo, cuanto mayor sea el nmero de los mismos tanto menor ser la resistencia equivalente del conjunto, adems, la intensidad de corriente total aumenta con el incremento de los receptores. Esta es la razn por la cual no podemos agregar ms ramas al circuito paralelo, pues si la corriente aumenta mucho se pueden quemar, como ya viste para evitar esto se emplean fusibles o breaket. Si en nuestras casas los elementos no se encuentran conectados en paralelo y los tuviramos conectados en serie, la interrupcin de la corriente en cualquier seccin del circuito hara que el flujo de electricidad se interrumpa en todos los elementos del circuito, apagndolos.

Anlisis de circuitos en serie y en paralelo

En este problema podrs analizar los cambios que sufren los valores del voltaje, resistencia equivalente y corriente cuando las conexiones de resistencias se hacen de maneras distintas, en serie y en paralelo. Las resistencias se representan en los esquemas de los circuitos con el smbolo: 1. En el circuito de la figura sabemos que el generador es de 4,5 V, y las resistencias tienen un valor de R1 = 30 , R2 = 70 y R3 = 50 . Queremos calcular la resistencia total o equivalente del circuito, la intensidad de corriente que circular por l cuando se cierre el interruptor y el voltaje en cada una de las resistencias.

El dibujo del esquema representa el circuito: Los datos suministrados por el ejercicio los organizamos en una tabla y los sealamos con un color (rojo). Identificamos en el circuito los puntos A y B en la salida del generador. Resistencia 1 Valor () 30 Voltaje, V (V)
202

2 3 AB 70 50 4,5

El circuito total esta formado por tres resistencias en serie, al sumarlas obtenemos la resistencia total del circuito: RT = R1 + R2 + R3 = 150 Con el valor del voltaje total 4,5 V, calculamos la intensidad de corriente total en el circuito dividiendo este voltaje entre la resistencia total, en este caso ser:

l=

V 4,5V = = 0, 03 A RT 150

Esta corriente es igual por todas las resistencias. Ahora, podemos conocer el voltaje en cada elemento resistivo: V1 = I R1 = 0, 03 A 30 ? = 0,9 V

V2 = I R2 = 0, 03 A 70 ? = 2,1 V V3 = I R3 = 0, 03 A 50 ? = 1,5 V
En la tabla inicial, vamos agregando columnas para las asociaciones, y filas para los valores del voltaje y la corriente que hemos obtenido, destacndolos con otro color, para este problema nos queda lo siguiente: Resistencia 1 2 3 Valor () 30 70 50 Corriente, 0,03 0,03 0,03 I(A) Voltaje, V (V) 0,9 2,1 1,5 AB 150 0,03 4,5

Cules seran los valores en la tabla si las resistencias se conectan en paralelo?

Montaje y estudio de circuitos bsicos de CC


Para realizar esta actividad experimental van a necesitar dos pilas secas comunes, tres bombillos de linterna con su respectivo soporte (ms o menos de 3 V cada uno). As como cables delgados. a. Monta un circuito con un bombillo, y una pila. Observa el brillo, probando los tres bombillos. b. Monten un circuito en serie con dos bombillos y las pilas en serie. Observen el brillo de cada bombillo. (Figura 23.9) c. Abran el circuito e introduzcan el tercer bombillo en serie, cierren nuevamente el circuito. Observen el brillo de los bombillos. Qu pueden decir de la corriente en el circuito, aument, disminuy o no cambio? qu indicador tienen para su respuesta? Cmo es la resistencia total del circuito debido a la introduccin del tercer bombillo? d. Desconecten uno de los bombillos y observen Cmo explican lo sucedido e. Si es posible midan el voltaje en los extremos de cada bombillo y la corriente en la lnea con un voltmetro-ampermetro. Determinen la resistencia equivalente. Analicen lo que sucede al conectar los 3 bombillos en paralelo. Expliquen sus observaciones. (Figura 23.10)
203

Hacia la toma de conciencia


A lo largo de la historia, el ser humano ha ido utilizando la energa en sus diversas formas de manifestarse, el fuego por ejemplo permiti disponer de alimentos cocidos, iluminacin, calefaccin natural; la energa hidrulica para obtener harina en los molinos y tablones de madera en los aserraderos; la energa producida por el vapor para la industria y los medios de transporte. Estas y muchas otras actividades se realizan en la actualidad, mediante el uso de la energa elctrica, aumentando la produccin y la calidad de las mismas por un lado, y disminuyendo el esfuerzo muscular que el hombre tena que realizar para su desarrollo. Se ha vuelto comn en nuestros das todo lo referente al consumo de energa elctrica. El uso que hacemos de ella influye de forma directa en el ambiente. Esta influencia se manifiesta en todas las fases del proceso, tanto por el tipo de fuente de energa que se utilice en su generacin, como durante su transporte, distribucin, transformacin y consumo. Dadas las campaas llevadas a cabo en casi todo el mundo, el uso razonado de la energa est calando cada vez ms en nuestros hbitos de consumo y conciencia, causando efectos positivos en muchos aspectos. La eleccin correcta de materiales de construccin, el usos de equipos elctricos, la puesta en prctica de dispositivos de ahorro de energa son algunos de los parmetros con lo que podemos contribuir en el ahorro energtico y as cambiar nuestra conciencia hacia el uso responsable que le demos a uno de los inventos que cambiaron al mundo, la electricidad.

204

Actividades de autoevaluacin
1. Dos hojas de un mismo tipo de papel son frotadas entre s. Quedarn electrizadas? Y si frotramos dos barras hechas de un mismo tipo de plstico? Discute con tus grupo-clase las respuestas. 2. En las industrias textiles o de papel, estos materiales se encuentran en constante friccin con las piezas de las mquinas de produccin. Para evitar incendios, el aire del ambiente es humedecido continuamente. A qu se debe este proceso? 3. Dos cargas puntuales negativas, de valores y , estn situadas en el aire y separadas una distancia de . Construye una figura en donde se represente las fuerzas que se ejercen entre las y . Cul es el valor de la fuerza entre ellas? 4. Usando un papel de aluminio (por ejemplo, de un chocolate) hagan una esferita y culguenla del extremo de un hilo de coser, en un soporte aislante (en lo alto del marco de madera de una puerta, o en un gancho de ropa de plstico); as obtendrn un pndulo elctrico. Frotando un peine para electrizarlo, acrquenlo a la esferita. Observen que esta es inicialmente atrada por el peine, pero despus de hacer contacto con l, es rechazada; comprueben esta repulsin tratando de aproximarle otra vez el peine. Por qu la esferita fue atrada por el peine? Por qu, despus de tocar a este ltimo, fue repelida? 5. Un estudiante posee un radio que funciona con un voltaje constante de 6 V. a. Cuntas pilas secas de 1,5 V debe conectar y cmo lo debes hacer? b. Representa en un diagrama la disposicin de las pilas en el aparato. 6. En un laboratorio, un conductor lo sometimos a diversos voltajes. Al medir los valores del voltaje y de la corriente, obtuvimos los siguientes resultados: V (V) I (A) 5,0 0,20 10 0,40 15 0,60 20 0,80

a. Construye una representacin grfica del voltaje en funcin de la corriente. b. Este conductor es un material hmico? Justifica tu respuesta. Cul es el valor de la resistencia? 7. Supn que en tu casa cuya instalacin elctrica es de 120 V , nicamente est encendida una lmpara de resistencia igual a 240 . a. Cul es la intensidad de la corriente que pasa por este elemento? b. Si enciendes una segunda lmpara, idntica a la primera la resistencia elctrica de la instalacin de a casa aumentara o disminuira? Por qu? c. Con ambos receptores encendidos, cunto vale la corriente que pasa por el medidor de consumo elctrico de la casa?
205

24

El sonido: cuando algo vibra, algo suena


206

Vivimos rodeados de una inmensa variedad de sonidos. Desde los ruidos de vehculos, sirenas y gritos en la calle que nos resultan molestos y llegan a generar la contaminacin snica, hasta los ms agradables de la voz humana o la msica suave y armoniosa que nos resultan placenteros. En nuestras manifestaciones culturales encontramos diversos instrumentos diseados por los fenmenos del sonido. Hoy en da, segn el tipo de instrumento encontramos por ejemplo: percusin, furruco, curbata, cumaco; cuerda, cuatro, arpa llanera, mandolina; viento, guarura, carrizo, flauta; y todo vibra, maracas, quitipls, charrascas. El sonido es una onda mecnica que viaja a travs de medios materiales y las podemos evidenciar en variados contextos o circunstancias. Diversos fenmenos asociados a estas ondas, los experimentamos en nuestras comunidades y en el ambiente. Por ejemplo, animales que emplean la reflexin de las ondas para conseguir los alimentos y protegerse; las olas que se mueven en la superficie del agua. Conocer estos fenmenos permite, entre otros, facilitar la comunicacin, evitar el derrumbe de edificios o puentes por efecto de la resonancia de las ondas. A continuacin encontrars informacin sobre este tema y respuestas a preguntas como: De qu se trata las vibraciones y las ondas, en particular, el sonido? Cmo se producen? Cmo se propagan? Qu caractersticas tienen? Qu puede sucederles cuando viajan? Tambin, tendrs actividades para que utilices estas ideas y valores su efecto en diversos contextos sociales y productivos.

Lo que vibra perturba al medio


En el ambiente nos podemos encontrar con muchos objetos que tienen un movimiento de vaivn. Por ejemplo, un pndulo, algo colgando de un resorte, el cuero tenso de un tambor, las cuerdas vocales, las partculas del agua cuando hay oleaje. Este tipo de movimiento es lo que llamamos vibracin. Para darnos cuenta de este fenmeno, necesitamos observarlo durante un cierto tiempo. Seguramente, has jugado con cuerdas tensas, tal como lo muestra la figura 24.1. Al subir y bajar un extremo de la cuerda, observamos que cada trozo de la cuerda, tambin sube y vuelve a bajar, mientras que a lo largo de ella se mueve una perturbacin que conocemos como onda impulsiva o pulso. Desde la fuente vibrante (la mano), la energa se propaga por la cuerda mediante la onda. Al paso de la onda, la materia sube y baja, sin avanzar.

Figura 24.1. Al mover una cuerda tensa con la mano, hacia arriba y hacia abajo, se produce una onda impulsiva que avanza a lo largo de ella.

Veamos ahora un pulso que se propaga en un resorte estirado sobre el piso como en la figura 24.2. Un estudiante lo comprime y lo estira dos veces; de esta forma, cada espira hace un movimiento hacia adelante y hacia atrs. As se transfiere la energa de una espira a la siguiente. Observa que en cada instante hay un grupo de espiras juntas y otro grupo de espiras que estn ms separadas, de manera alterna. Entonces, el pulso avanza a lo largo del resorte.

Figura 24.2. Ondas impulsivas que se propagan en un resorte bajo tensin.

207

Cuando la onda se repite continuamente, tal que la perturbacin ocurre de manera armnica, como en la figura 24.3; podrs ver una representacin donde se repite el vaivn de la mano (fuente de perturbacin), en este caso hablamos de onda peridica.

Figura 24.3. Al mover una cuerda tensa con la mano, hacia arriba y hacia abajo, de manera repetida se propaga en ella una onda peridica.

Tipos de ondas
Al comparar la direccin de propagacin de la onda con la del movimiento de las partculas del medio, podemos distinguir dos tipos de ondas. Cuando la vibracin de las partculas del medio ocurre en la misma direccin de propagacin de las ondas, decimos que son ondas longitudinales; como en el caso de la onda en el resorte de la figura 24.2. Tambin podemos producir ondas longitudinales en el aire. Cuando vibra el cuero de un tambor, escuchars un sonido mientras vibra. Esto ocurre debido a que las partculas del aire alrededor del cuero, se perturban y oscilan. A su vez, estas perturban a sus vecinas, y as, sucesivamente. De esta manera, en el aire se propaga una onda, que traslada una cantidad de energa de un lugar a otro. Cuando la onda sonora llega hasta un detector, ste empieza a vibrar, como ocurre en el interior de nuestro odo. En cambio, como se muestra en la cuerda de la figura 24. 3, puede suceder que las ondas viajen en direccin horizontal, hacia la derecha, mientras que los distintos trozos de cuerda vibran verticalmente; es decir, la materia oscila en direccin perpendicular al movimiento de la onda. A estas las denominamos ondas transversales. Algunas ondas que encontramos en la naturaleza, no son de ninguno de estos dos tipos. Tal es el caso de las ondas en la superficie del agua, donde el movimiento de las partculas de agua es una combinacin de vibraciones en direccin longitudinal y transversal. Como puedes ver en los casos descritos, para crear una onda necesitamos una fuente vibrante y un medio material para propagarse. El medio tiene que ser elstico para permitir la vibracin de sus partculas. Es importante resaltar que partculas del medio oscilan, no se trasladan en la direccin de la onda. Adems, estas necesitan de un medio material para propagarse, bien sea slido, lquido o gaseoso, en general, las llamamos ondas mecnicas. Cabe destacar que existe otro tipo de ondas como las electromagnticas que pueden propagarse en el vaco.
208

Recuerda que las vibraciones son fundamentales para la creacin de las ondas mecnicas, su transmisin en un medio elstico y su deteccin por parte de otro medio. Las ondas mecnicas son un efecto que observamos a lo largo del tiempo y en el transcurso de espacio. Estamos rodeados de ondas mecnicas, como las ondas sonoras, las ondas ssmicas, las ondas en el agua y muchas ms.

Sabas que...? Nuestra voz en una grabacin la percibimos extraa debido a que las ondas sonoras que se generan en las cuerdas vocales, son detectadas en el odo por dos vas: externa, trasmitidas por el aire, e interna, conducidas por estructuras seas de la cabeza.

Explorando con las ondas, aprendemos

Prepara un recipiente ancho y poco profundo (ponchera cuadrada) con agua hasta ms o menos 5 cm de profundidad. Coloca unos trozos pequeos de corcho para que floten. Introduce un lpiz, unos 2 cm en el centro y scalo Describe la onda que observas. Repite el proceso cada 2 s. Describe los cambios. Qu sucede con los trozos de corcho? Si lo haces ms rpido, qu suceder? Explica lo observado y construye un modelo grfico de cada del tipo mostrado en las figuras anteriores.

Caractericemos las ondas


Las ondas mecnicas peridicas varan en el tiempo de manera armnica, las partculas del medio oscilan en el espacio, y asi la onda se trasmite. A continuacin, estudiaremos tres caractersticas relacionadas con estas dos variaciones de las ondas. 1. Amplitud. Esta tiene que ver con la mxima perturbacin de las partculas del medio producida al paso de la onda. (Figura 24.4). Una onda con mayor amplitud lleva mayor energa.
Figura 24.4. (a) Una onda transversal armnica que se propaga en la cuerda. (b) Forma de la cuerda en un instante dado. (c) Grfico de la posicin de un punto de la cuerda que sube y baja peridicamente en funcin del tiempo.

209

La amplitud inicial de la onda est determinada por la potencia de la fuente, es decir, con la energa por unidad de tiempo que esta trasmite. Sin embargo, la amplitud va disminuyendo a medida que se propaga por el medio, porque, por lo general, parte de la energa se transfiere a las partculas del medio por el calor. En el caso del sonido, el volumen o intensidad dependen fuertemente de la amplitud de las vibraciones del cuerpo que lo produce. 2. Longitud de onda. En la figura 24.4b, destacamos la distancia entre dos posiciones seguidas de la cuerda con la mxima perturbacin que denominamos longitud de onda. En general, la longitud de la onda es la distancia entre una partcula ubicada en una cierta posicin y la siguiente partcula en una posicin equivalente. Ahora observa una representacin de ondas sonoras trasmitidas en el aire (Figura 24.5). En este caso, la distancia entre dos zonas de mayor (o menor) densidad de partculas del aire seguidas corresponde a la longitud de la onda.

Figura 24.5. Un diapasn que vibra trasmite ondas sonoras en el aire; se generan zonas con muchas partculas (compresin) y zonas con pocas partculas (rarefaccin). La distancia entre regiones adyacentes con igual densidad de partculas corresponde a la longitud de onda.

3. La frecuencia: Cuando la onda se propaga por la cuerda cada punto de la misma ejecuta un nmero de vibraciones por unidad de tiempo que denominamos frecuencia de la onda. Esta caracterstica de la onda est determinada por la frecuencia de la fuente que la produce. En la Figura 24. 4, el punto azul de la cuerda vibra peridicamente al paso de la onda. El movimiento de la partcula est representado en el grfico c. El tiempo que tarda en ocurrir una vibracin completa es lo que llamamos perodo. Te diste cuenta que el perodo es el inverso de la frecuencia.
Frecuencia = Nmero de vibraciones Intervalo de tiempo N f= t Frecuencia = 1 Perodo f= 1 T

Magnitud Frecuencia Perodo


210

Tipo Escalar Escalae

Smbolo f T

Unidad en el SI Hertz (hercio) (Hz) Segundos (s)

Equivalencia 1 Hz = 1vibracin/1s

Hay sonidos que no puedes or


Aunque los seres humanos tengamos un odo estupendo, nuestra audicin est restringida slo a sonidos en un rango de frecuencias aproximado entre 20 Hz y 20.000 Hz. Por debajo de 20 Hz estn los infrasonidos. Estas ondas no podemos orlas pero algunos animales como los elefantes las emplean para comunicarse. Los sonidos de frecuencia superior a los 20.000 Hz se les llama ultrasonidos. Diversos animales como el murcilago los emplean como una especie de radar para identificar los obstculos.

Figura 24.6. El sonido segn su frecuencia, desde los infrasonidos hasta los ultrasonidos. Frecuencias de sonidos que perciben algunos animales.

Probando la audicin del grupo

Exploren el rango de frecuencias de la audicin de las personas (Figura 24.6), recuerden que con la edad perdemos esta capacidad y el rango se va reduciendo. Utilicen generadores de sonidos disponibles en la web, como el video: http://www.youtube.com/watch?v=4G60hM1W_mk Utilizando audfonos, vayan incrementando poco a poco la frecuencia, manteniendo un volumen fijo. Registren la frecuencia a partir de la cual ya no logran escuchar nada. Comparen los resultados de todos los del grupo.
211

Rpido o lento? Depende del medio


Hemos visto que desde una fuente de vibracin hasta un receptor, se transfiere energa a travs de un medio mediante una perturbacin que viaja, la onda. Por tal razn, hablamos de la rapidez de propagacin de la onda. Esta rapidez depende de algunas propiedades del medio. Por ejemplo, en el aire a 20C, el sonido viaja con una rapidez aproximada de 344 m/s. Te imaginas? El sonido en el aire recorre un kilmetro en apenas tres segundos! Es por esto que no te das cuenta de su demora al llegar desde la fuente hasta tus odos. Imagina que a un determinado lugar llegan dos ciclos de una onda en cada segundo, cuya longitud de onda es 1 m. Con qu rapidez viaja esta onda? Veamos, como una onda recorre una distancia igual a la longitud de onda en un tiempo equivalente al perodo, entonces su rapidez es: v = 2 m/s.

Sabas que...? Durante una tormenta elctrica en la atmsfera, habrs notado que primero ves el relmpago y unos segundos despus, escuchas el sonido. Esto es debido a que las ondas sonoras (mecnicas) son ms lentas que las ondas luminosas (electromagnticas).

Aprendamos a resolver un problema

Situacin problema: Una estudiante amarra una cuerda larga y algo tensa como la mostrada en la figura 24.1. Produce en ella una onda mecnica y sugiere saber cul es la frecuencia de la onda? y cul es su rapidez? Para ello, un compaero toma fotos a alta velocidad. Con las fotos observan que la cuerda oscila 3 veces cada segundo y la longitud de la onda es de 20 cm. Vers como lo resolvieron.

212

Hay dos metas: Conocer la frecuencia y la rapidez de la onda. Y hay dos condiciones: oscila 3 veces por segundo y la longitud de onda es 20 cm. Recuerda el significado de los conceptos y sus relaciones mediante el anlisis del mapa (Figura 24.7). Fjate que la primera condicin se refiere a la frecuencia y permite responder a la primera pregunta:

Frecuencia =

Nmero de vibracin Intervalo de tiempo

t - 3 - 3Hz 1s
Figura 24.7. Mapa de conceptos, referido al problema.

Analiza el mapa de nuevo; vers que con la frecuencia y la segunda condicin medida (longitud de onda) es posible determinar la rapidez de la onda: Rapidez de la onda = Frecuencia x Longitud de la onda v - 3hz x 0.20m - 0.6 m s

Resuelve otros casos

1. Un emisor de ultrasonidos para espantar insectos ejecuta 4.000 vibraciones en 0,1 s. Cul es la frecuencia de las ondas? Cul es el perodo? 2. La nota do mayor de la escala musical tiene una frecuencia de 262 Hz. Si esta nota viaja en el aire a 340 m/s. Cul es su longitud de onda? 3. Un pescador observa que por su bote anclado pasan las crestas de las olas cada 5 segundos. Si la distancia entre dos crestas es de 10 metros, a qu velocidad viajan las ondas en la superficie del agua?

213

Cmo se comportan las ondas?


Los fenmenos que vamos a describir en esta seccin son comunes a todas las ondas, sin embargo, haremos especial nfasis en ejemplos relacionados con las ondas sonoras. 1. Reflexin. Habrs notado que las ondas que se generan en la superficie del agua de una piscina, al llegar a la paredes se regresan. En general, cuando las ondas se propagan por un medio, lo ms probable es que encuentren barreras y se devuelvan hacia la zona de donde venan. Este fenmeno lo conocemos como reflexin de la onda. En espacios abiertos, en el caso de las ondas sonoras suele suceder que si encuentran un obstculo, la onda reflejada no la percibimos, ya que tiene poca intensidad. Sin embargo, en espacios cerrados como una cueva o un gran saln vaco, las ondas viajan con mayor intensidad; y al reflejarse en las paredes, las percibimos con claridad y las distinguimos de las que vienen directamente de la fuente. Esto es lo que conocemos como un eco.

Figura 24.8. El gacharo emite ondas sonoras que llegan a la pared y se reflejan. Este efecto, llamado eco, lo emplean estos y otros animales, para orientarse y alimentarse.

Sabas que...? Una de las aplicaciones ms conocidas de los ecos, es la ecografa. Por ejemplo, podemos observar el interior del cuerpo humano mediante imgenes construidos a partir de ultrasonidos reflejados (ecos) por la estructura corporal.

214

2. Refraccin. Como ya leste, la rapidez del sonido en el aire vara con su temperatura, por ello cuando en nuestro entorno, el aire cercano al suelo tiene una temperatura menor que el aire que est ms arriba, observamos que los sonidos disminuyen su rapidez y se desvan hacia abajo (Figura 24.9). Cuando hay un cambio en las caractersticas del medio en que se propaga una onda, se observa que la onda se transmite con una rapidez diferente y por ello cambia de direccin. Este fenmeno es conocido como refraccin. Este fenmeno de refraccin tambin sucede cuando la onda pasa de un medio a otro, por ejemplo, del aire al piso o al agua de una piscina. Alguna vez has pegado tu oreja al suelo para escuchar un sonido lejano que no escuchas por el aire?

Figura 24.9. Las ondas al propagarse en un medio que vara sus condiciones, cambian de rapidez y de direccin, cuando esto sucede decimos que se refractan.

3. Interferencia: A un mismo lugar pueden llegar ms de una onda al mismo tiempo. Por ejemplo, si dejas caer simultneamente gotas sobre la superficie del agua, las ondas que cada una produce, pueden llegar a combinarse en cada punto de la superficie. Esto genera lo que se conoce como un patrn de interferencia parecido al de la figura 24.10.

Figura 24.10. Patrn de interferencia por ondas en la superficie del agua.

215

En la figura anterior, vers que cuando la cresta (parte alta) de una onda se superpone a la cresta de otra, los efectos individuales se refuerzan, resultando una onda de mayor amplitud, por lo que lo llamamos interferencia constructiva y decimos que estas ondas estn en fase. En cambio, cuando la cresta de una onda se superpone con la parte baja de la otra (que llamamos valle) las ondas estn fuera de fase; los efectos individuales se neutralizan y hablamos de interferencia destructiva. 4. Difraccin: La longitud de una onda sonora audible puede tener entre unos pocos centmetros y unos cuantos metros. Cuando estas ondas encuentran los bordes de un obstculo o un orificio cuyo tamao es parecido al de su longitud de onda, tienden a desviar la direccin de su camino, sin devolverse. Este fenmeno lo conocemos como difraccin y es el que nos permite escuchar los sonidos que se producen en otro saln, o el que se produce detrs de las esquinas en una construccin.

Figura 24.11. Las ondas se difractan cuando su longitud de onda es del mismo orden del tamao del obstculo u orificio que encuentran.

5. Resonancia: Los edificios, los autos, los puentes, los columpios, los tomos, son entre muchos otros, objetos elsticos que vibran. Cada uno de ellos, tiene una o varias maneras especficas de vibrar, por ello hablamos de sus frecuencias naturales de vibracin. Estas dependen de la composicin de la materia y de su grado de elasticidad. Bajo ciertas condiciones estos objetos que vibran pueden perturbarse unos con otros. Cuando la frecuencia natural de vibracin de uno de ellos coincide con alguna de las frecuencias naturales del otro, se produce un fenmeno conocido como resonancia.
216

Veamos de qu se trata. Fijemos una copa de vidrio con cierta cantidad de agua dentro, y con un dedo mojado empezamos a frotar su borde, hasta hacer que vibre segn su frecuencia natural. Si a su lado tenemos otra copa de igual frecuencia natural; veremos que al cabo de un tiempo esta empieza a vibrar al mismo ritmo, y poco a poco, va aumentando la amplitud de sus vibraciones inducidas. Recuerdas otros casos de resonancia? Sabas que...? Una copa de cristal delgado puede romperse por resonancia, al emitir un sonido de alta energa que tenga su misma frecuencia natural. Una voz como la de una soprano con gran intensidad puede lograr este efecto. Esto tambin puede ocurrir en los edificios, si su frecuencia natural de vibracin es igual a la de las ondas producidas en un sismo, es posible que colapsen.

6. Efecto Doppler: Observa la figura 24.12, en el centro hay una fuente fija de ondas sonoras, las cuales se propagan en todas direcciones como lo representan los crculos azules. De esta forma, las ondas van llegando al odo de las personas a su alrededor, quienes las perciben con la misma frecuencia que la de emisin.

Figura 24.12. Una fuente sonora fija emite un sonido hacia todo el espacio, que es percibido con igual frecuencia por dos personas a ambos lados.

217

Qu suceder con las ondas que llegan al odo si la fuente sonora se acerca o se aleja de l? Seguramente has escuchado que el sonido de la sirena de una ambulancia o camin de bomberos cuando se acerca al sitio donde te encuentras es diferente al que percibes cuando se aleja. Esto es debido a que la frecuencia del sonido se modifica al estar en movimiento la fuente que lo genera. En la medida en que la velocidad de la fuente emisora sea mayor, el efecto es ms acentuado. Este fenmeno lo conocemos como efecto Doppler. Si la fuente se acerca al odo, las ondas llegarn con menor longitud de onda y se perciben con mayor frecuencia. Mientras mayor sea la velocidad de acercamiento de la fuente, mayor ser la frecuencia de las ondas que se reciben. Por el contrario, si la fuente se aleja del receptor, su longitud de onda ser mayor y la frecuencia de la onda que se recibe ser menor que la emitida (Figura 24.13).

Figura 24.13. Efecto Doppler. La persona de la derecha percibe un sonido de frecuencia mayor que el emitido por la fuente, y la que est en la izquierda, percibe un sonido de frecuencia menor que la de la fuente.

Midiendo la velocidad del sonido en el aire

Para medir la velocidad de un objeto requerimos medir la distancia recorrida y el tiempo invertido en ello. La meta es medir la velocidad del sonido en el aire, que como sabes es ms o menos 344 m/s. Este es un trabajo en equipo. Porque hay que determinar el tiempo que tarda el sonido en ir y volver por un largo camino.

218

Qu necesitan? Dos palos de madera (entre 20 cm y 30 cm) Una cinta mtrica larga. Varios cronmetros. Un lugar de gran longitud (como una piscina olmpica, 50 m) poco ruidoso con una barrera que permita producir ecos. Qu harn? Produzcan ecos en el lugar escogido y verifiquen que perciben el sonido emitido y el reflejado con claridad. Identifiquen la distancia de 50 m desde la barrera. Uno del grupo golpea un palo contra el otro para generar el eco. Los otros miembros de grupo (por lo menos 10) miden el tiempo que transcurre entre el sonido emitido y el sonido reflejado. Para tener una mejor medida, al or un eco golpeen los palos para producir otro eco, as produzcan una serie de por lo menos 10 ecos repetidos con ritmo. Practiquen. Midan el tiempo entre un sonido emitido y el dcimo eco recibido.

Este mtodo nos permite suponer que esto equivale a un sonido que recorre 50 metros de ida ms 50 metros de vuelta, diez veces, cuntos metros son en total? Evalen las medidas de tiempo en los 10 cronmetros; repitan las medidas de ser necesario. La medida es precisa? La podemos aceptar como vlida? (Revisen la lectura 11 del libro de 2do. ao de esta serie) Obtengan el promedio de las medidas de tiempo y calculen la velocidad del sonido. Comparen el resultado con el valor de referencia. Evalen la precisin y la exactitud de este mtodo. Indaguen acerca de otros mtodos para determinar la rapidez del sonido.

219

Trabajando con simulaciones


Baja a tu computador la simulacin Ondas Acsticas (Sound.es.jar) de la pgina web: http://www.colorado.edu/physics/phet. Realiza las siguientes actividades: Varia la frecuencia y escucha el sonido; con cada frecuencia vara la amplitud. Cmo es el sonido de frecuencias altas comparado con el de frecuencias bajas? Cmo vara la longitud de la onda con la frecuencia? Cmo percibes la amplitud? Qu representan las zonas oscuras y las claras? Por qu a medida que se propagan las ondas, las ves ms claras? Qu escucha el oyente al acercarlo y alejarlo de la corneta? En la seccin Mida, usando la regla y el contador de tiempo, determina la velocidad de la onda para dos o tres frecuencias (baja, media, alta). En la seccin Escuche con presiones de aire que varan: Cmo explicas que al quitar el aire de la campana que encierra a la corneta, dejas de escuchar el sonido? Depende esto de la frecuencia y la amplitud de la vibracin de la fuente? En la seccin Interference por reflexin, emite un pulso y observa la direccin del pulso emitido y la del pulso reflejado. Reptelo cambiando el ngulo de la pared. Establece algn patrn entre la direccin del pulso incidente y el reflejado. Elabora un reporte con todas las observaciones y explicaciones de cada caso. Comprtelo con tus compaeras y compaeros.

Un mapa de ruidos de la comunidad


Problema: en tu comunidad es probable que existan lugares con alto nivel de ruido. Resulta valioso hacer un mapa de ruidos de la zona y proponer alternativas para mejorar la calidad snica.
220

Con la lectura 2 de este libro y las lecturas sobre saberes para investigar de 1ro y 2do ao de los libros de esta serie, planifica con tus compaeras y compaeros este proyecto. Preparen un plan de trabajo.

Identifiquen los lugares ruidosos y algunas personas que habitan o trabajan en ellos. Diseen una encuesta para indagar acerca de: fuentes de ruido, pocas u horas de mayor ruido, efectos que sienten debido al ruido, formas que consideran pueden disminuir el ruido. Procesen y analicen los datos. Complementen el anlisis de la encuesta con observaciones de los lugares. Si es posible midan la intensidad de sonido. Preparen un mapa de ruidos de la zona estudiada. Consulten con sus docentes y otras personas de la comunidad que los puedan ayudar a disear un plan de intervencin para alguno de los lugares, con el fin de disminuir los niveles de ruido. Adems, planteen preguntas e indaguen sobre aspectos como: Cmo pueden lograr que el sonido de un lugar disminuya o no perturbe a los vecinos? Es posible eliminar todas las vibraciones generadas por el sonido? Qu materiales son adecuados para insonorizar los ambientes? Qu patrones de conducta debemos modificar para disminuir la contaminacin snica? Cmo afectan los ruidos y sonidos a alto volumen a los diferentes seres vivos? Cmo podemos tomar conciencia de este problema? Socialicen con la comunidad, el mapa de ruidos y su plan de intervencin.
221

Beneficios y riesgos con las ondas sonoras


El sonido es vital para muchos seres vivos. Algunos animales como los murcilagos, gucharos, entre otros, emplean para conseguir los alimentos, protegerse y moverse (ecolocalizacin). Emiten sonidos y perciben el eco que proviene de los objetos u otros seres vivos que estn a su alrededor. Tambin, las personas invidentes pueden desarrollar esa capacidad. Conocer, describir y explicar la naturaleza de las ondas mecnicas y los fenmenos observados en ellas, han permitido desarrollos importantes para el buen vivir. Entre los muchos beneficios que podemos citar, tenemos: Comprender el funcionamiento sonoro de los instrumentos musicales, la produccin de melodas, la voz humana, entre otros, ha enriquecido nuestras vidas y la creacin humana. Cabe mencionar a los lutiers, artesanos acuciosos, dedicados a construir hermosos y armoniosos instrumentos, muy preciados por los intrpretes. Tambin estn los avances en la construccin de edificaciones con calidad acstica, para teatros, conchas acsticas, viviendas, entre otros. Otro de los usos, quizs muy conocido, es en el diagnstico mdico con ultrasonido. Los tejidos (piel, msculos y huesos) reflejan las ondas sonoras que se le envan; con estos ecos se construyen imgenes para evaluar desde el exterior el estado de los mismos, evitando el uso de otras ondas dainas y otros mtodos de diagnstico invasivos. Este tema puede servir de inspiracin para que lleven a cabo nuevos proyectos de investigacin. Por ltimo, queremos alertarlos sobre el uso indiscriminado de los sonidos, en todo su espectro. Ya que puede resultar perjudicial para la salud integral de los seres vivos y el ambiente. La contaminacin snica es un problema de los tiempos modernos que debemos conocer y controlar por el bien comn. Aprendamos a escucha y disfrutar del silencio.

Figura 24.14. Orquesta juvenil Simn Bolvar. Deleite sonoro nacional.

222

Actividades de autoevaluacin

1. Un gucharo emite sonidos, clics, con una frecuencia promedio de 7 kHz desde un cierto lugar. El pjaro est en una cueva, donde una pared tiene un hueco de 14 cm de profundidad. Unas ondas recorren una cierta distancia hasta la pared, mientras que otras llegan hasta el fondo del hueco. Cunto tiempo despus llegan al gucharo, las ondas reflejadas en el fondo del hueco? (Rapidez del sonido en el aire: 340 m/s) Si la cueva en vez de aire, se llena con otro gas Ocurrir lo mismo? 2. Explica mediante diagramas y palabras cmo se puede medir la profundidad de un mar o lago, mediante un sonar. Que otros usos tiene este aparato? 3. Nuestro sistema de audicin permite discriminar una onda sonora de otra con un intervalo de tiempo de 0,1 s. A qu distancia debe estar una barrera, para poder distinguir el sonido emitido del eco cuando se propaga en el aire a 344 m/s? Cambiara esta distancia si estamos en el pico Bolvar? Por qu? 4. Cuando estamos sumergidos en una piscina o laguna, es difcil que escuchemos los sonidos que se producen afuera, en el aire. Si el sonido viaje tanto en el aire como en el agua, construye una explicacin a este hecho. 5. Qu sucede cuando una fuente sonora se mueve con una velocidad mayor que la del sonido? Te invitamos a indagar acerca de romper la barrera del sonido y onda de choque. 6. Dos sistemas de comunicacin: Montaje: 1. Pasa por el fondo de dos vasos plsticos, una cuerda de ms o menos 2 m; anuda en sus extremos un trozo de palillo para que haga contacto con el fondo de los vasos. 2. Sobre la parte estrecha de dos embudos caseros, encaja bien una manguera de 2 m a 3 m de largo. Establezcan una conversacin con cada montaje. Cmo perciben el sonido en cada caso? Qu diferencias encuentran en los sonidos? Comparen los medios de propagacin. Elaboren un diagrama que represente cada situacin sonora. Introduzcan variantes como: variar la tensin de la cuerda; echen aire caliente en la manguera o pngala en la nevera un rato, entre otros. Observen y expliquen.

223

25

Sin luz es imposible ver


224

As como las ondas sonoras nos deleitan con sus armoniosas y expresivas melodas musicales, la luz es otro mundo vibracional de nuestro entorno, que a diario disfrutamos en una diversidad de coloridos paisajes que nos ofrece la bella naturaleza. La fuente de luz que nos acompaa desde siempre y que sustenta toda forma de vida sobre la Tierra, es el Sol. Durante miles de aos el Sol y la llama del fuego fueron los nicos medios de que se vali el hombre para alumbrarse. La luz, como el sonido, son ondas que se propagan en el espacio y tienen algunos comportamientos similares. Sin embargo, las ondas luminosas son de una naturaleza diferente. Se trata de una onda electromagntica que tiene su origen en saltos cunticos de cargas elctricas en la intimidad de la materia; estas ondas generadas pueden propagarse, sin necesidad de ningn medio material, es decir, en el vaco. Con al ingenio, la creatividad y los saberes construidos por mujeres y hombres, hoy en da disponemos de una variedad de fuentes artificiales de luz, como tubos de nen, bombillos incandescentes, leds, lseres, entre otros. El sentido de la visin junto con la luz permite que veamos los objetos y color. Sin luz todo sera negro. Qu suerte que no es as! Gracias a la luz podemos vivir, recrearnos y beneficiarnos de muchas maneras. En esta lectura nos proponemos dar respuesta a algunas cuestiones relacionadas con la luz: Cmo modelamos su naturaleza? Cmo se propaga? Por qu vemos los objetos? Por qu a veces percibimos con la visin cosas que no son reales? Qu es el color? Cmo explicamos las imgenes que vemos en un espejo? Qu son las lentes y cmo se utilizan en los instrumentos pticos? Esperamos despertar tu curiosidad por el tema y te motivamos a que sigas indagando.

El misterio de la luz: Onda o partcula?


Cmo es que podemos ver los objetos? Qu es eso que llamamos luz? Son preguntas que han intrigado a la humanidad desde siempre. Hace unos 2.500 aos, filsofos griegos formularon diversas hiptesis contrapuestas. Una propona que de los ojos salan filamentos que viajaban en lnea recta, y al caer sobre los objetos producan el efecto luminoso que permita verlos. Otra hiptesis planteaba que cuando observan los objetos, desde estos emanaba algo, luz, por lo que unos pensaban que la luz eran como pequeas pelotas que luego viajaban en lnea recta y llegaban a nuestros ojos, y otros pensaban que podra ser una onda.

Figura 25.1. Modelos de la luz en la cultura griega hace unos 2.500 aos. (a) Filamentos de luz salen de los ojos; (b) Los objetos emiten pequeas pelotas que llegan a los ojos.

Mucho despus, en el siglo X, el cientfico rabe Alhzen esclareci el dilema entre ambas hiptesis. Estableci que, como los ojos se irritaban al observar el Sol de manera directa, ellos tenan que ser receptores y no emisores. Adems, la luz que hay en el ambiente proviene del Sol; y cuando llega a algunos objetos, rebota, nos da la impresin de que ellos tambin iluminan, como sucede con la Luna. De manera que, la luz que viene de los objetos, llega a los ojos y permite que los veamos. Adems, sin luz resulta imposible que podamos verlos. Alhzen tambin dio explicaciones a otros fenmenos asociados con el comportamiento de la luz, como su propagacin rectilnea, la reflexin y la refraccin. Este cientfico combin la construccin de ideas tericas, modelos geomtricos y posibles explicaciones con el trabajo experimental y controlado. Su modo de investigar al parecer influy en cientficos posteriores de la Edad Media como Leonardo Da Vinci, Francis Bacon y Galileo Galilei. En el siglo XVII, surgieron dos modelos sobre lo que sera la luz: Isaac Newton la imagin como pequeas partculas que viajan en lnea recta a gran velocidad (teora corpuscular) y construy explicaciones mecnicas de algunos fenmenos luminosos. Sin embargo, su teora no permita explicar fenmenos como la difraccin. A la par, Christiaan Huygens, holands, consider a la luz como una onda mecnica y explic los otros fenmenos que el modelo de partcula no permita, como el por qu la luz se desviaba al pasar por una rendija muy fina y por qu al encontrar dos rendijas finas muy prximas, se formaba un patrn de franjas oscuras y claras alternadas. En el siglo XVIII, esta teora de luz como onda fue ampliada por Thomas Young. En el siglo IXX se concluye que la luz es una onda electromagntica.
225

La idea de la luz como partcula retorn. Desde comienzos del siglo XX se acepta que la luz puede ser descrita de manera dual: a veces puede ser considerada como onda, electromagntica, y en otras ocasiones como partcula (fotn). Algo as como si tuviera doble personalidad y su comportamiento dependiera de las circunstancias que estamos observando. Cundo la luz se comporta como onda? Esto ocurre por ejemplo, cuando dos ondas llegan a un mismo sitio y se combinan, reforzando o anulando sus efectos y dando como resultado un patrn de interferencia (Figura 25.2.a). Algo parecido a lo que viste en la lectura anterior con las ondas mecnicas en la superficie del agua. Cundo se manifiesta la luz como partcula? Esto ocurre por ejemplo en el efecto fotoelctrico, en el cual las partculas de luz interactan con los tomos de un metal, golpendolos para arrancarle electrones segn la energa con al que incide (Figura 25.2.b). A esa partcula que golpea, Einstein la consider como un pequeo paquete de energa que llam cuanto de luz o fotn.

Figura 25.2. La luz dualidad onda-partcula. a) La luz como onda, experimento de interferencia de doble rendija. b) La luz como partcula (fotn), experimento del efecto fotoelctrico.

Figura 25.3. Fotones de luz emitidos del interior de un tomo al caer los electrones desde una orbita superior a una inferior (saltos cunticos).

Sobre el origen de la luz... Si nos centramos en las fuentes luminosas, como el Sol, una vela, un bombillo, las lucirnagas, entre otras, encontramos que en todas ellas, los tomos de la materia son los encargados de la emisin de luz. A grandes rasgos, podemos imaginar un tomo con sus electrones girando en torno al ncleo en determinados orbitales de energa. Estos tomos pueden recibir energa por distintos mecanismos, como calentando el material o por una reaccin qumica, con lo cual sus electrones pueden ser excitados para pasar a ocupar un orbital de nivel superior, por breves instantes. La energa extra que adquiri el electrn es liberada al volver a niveles de energa inferior (ms prximas al ncleo), esta emisin se piensa como paquetes de energa, fotones (Figura 25.3).

226

La luz en movimiento
Sabas que...? Entre los seres vivos que pueden emitir luz propia mediante reacciones qumicas (bioluminiscencia), est la lucirnaga o cocuyo. El macho intercambia con la hembra destellos de luz para atraerla, ella responde si lo percibe adecuado, ser amor a primera luz? Tambin emplean la luz para defenderse. Durante siglos se pens que la luz llegaba de manera instantnea desde la fuente al receptor. La idea de que la luz tiene una rapidez finita y que se puede medir comienza en el siglo XVII. Galileo intent medir la rapidez de la luz a partir del tiempo que le tomaba a sta desplazarse una distancia conocida entre la cima de dos colinas. El tiempo fue tan corto que su nica conclusin fue la rapidez de la luz es extremadamente alta. El primer valor de rapidez de la luz del que se tiene informacin, lo obtuvo Ole Roemer (ao 1676) siendo 214.000 km/s. Despus se hicieron nuevos ensayos, siendo el ms aceptado, el experimento de Michelson, en 1926, quien obtuvo un valor de 299.520 km/s. Posteriores experimentos han confirmado que la rapidez de la luz es una constante universal, lo cual sirvi de base para que A. Einstein desarrollara la famosa teora de la relatividad. La propagacin de la luz es el fenmeno fsico ms rpido que conocemos. En la actualidad, se acepta que la rapidez de la luz en el vaco tiene un valor de 299.793 km/s ( 300.000 km/s). Te imaginas, la luz tarda apenas un par de nanosegundos en llegar desde un bombillo hasta una pared en un cuarto.

La luz tambin es una onda electromagntica


En el siglo IXX, James C. Maxwell, escocs, sintetiz en la teora electromagntica, anteriores observaciones, experimentos y leyes, lo cual le permiti calcular la velocidad de ondas, como las de radio. l obtuvo un valor igual al que se haba obtenido experimentalmente para la luz. Como ya antes se haba mostrado que la luz era una onda, esta afortunada coincidencia permiti concluir que tanto la luz como las otras ondas conocidas para la poca eran de un mismo tipo: la combinacin de dos ondas, una elctrica y otra magntica, que viajan en direccin transversal a estas dos perturbaciones. Hoy en da aceptamos que las distintas ondas electromagnticas conocidas, solo se diferencian en su longitud de onda (o frecuencia). Existe un amplio espectro que se extiende desde longitudes de onda tan pequeas como los rayos gamma ( 10-14 m), hasta longitudes de onda mucho ms grandes como las ondas de radio ( 103 m).

227

Figura 25.4. Las diferentes ondas del espectro electromagntico (EM). Todos son de la misma naturaleza, y solo se diferencian en sus longitudes de onda (y frecuencia).

Como puedes notar en la figura 25.4, el rango de luz visible apenas ocupa una pequea porcin de este amplio espectro. Las longitudes de onda de la luz visible estn comprendidas ms o menos entre 0,400 milsima de milmetro para la luz roja y 0,750 milsima de milmetro para la luz violeta. Vimos antes que los fotones emitidos en los tomos por los saltos cunticos de los electrones, son paquetes de energa. Algunos de estos saltos producen la luz visible, la cual en nuestros ojos es percibida con diversos colores. Sabemos hoy que existe una relacin directa entre la energa que transporta un fotn y su frecuencia como onda EM: a mayor energa mayor ser su frecuencia; y menor su longitud de onda, ya que como ocurre con las ondas mecnicas, la rapidez, v, de las ondas EM es el producto de su frecuencia, f, por su longitud de onda, 1, (v = f ). Sabas que...? Recibir radiacin ultravioleta (UV) en cantidades pequeas, resulta beneficioso para la salud ya que contribuye con la produccin de vitamina D, el desarrollo de los huesos, entre otros. Sin embargo, una prolongada exposicin a las ondas UV se asocia con alteraciones de la salud como: cncer de piel, quemaduras de sol envejecimiento prematuro de la piel, diversas enfermedades oculares y disminucin de la eficacia del sistema inmunolgico. Reduccin la capa de ozono aumenta la incidencia de ondas UV sobre la Tierra. Alerta

Los tomos pueden emitir muchsimas radiaciones que no podemos ver. Entre estas luces invisibles para nosotros, est la luz infrarroja, con longitudes de onda mayores a la luz roja, como la que emiten los tomos de objetos calientes. Al otro lado del rango visible est la luz ultravioleta, de menor longitud de onda que la luz violeta.
228

La luz se propaga en lnea recta


Una de las evidencias frecuentes que nos permite afirmar que la luz viaja en lnea recta es que un objeto opaco colocado en el camino de la luz forma una sombra, es decir una zona donde la luz no llega. Esta sombra conserva la misma forma del objeto. Las sombras chinescas que seguramente has visto o producido con tus manos, datan de la antigedad y se basan en esta propiedad de la luz.

Figura 25.5. Frentes de onda esfricos de la luz. Los rayos son perpendiculares a los frentes de onda.

Recuerdas cmo sueles representar a la luz cuando dibujas? De igual forma, la figura anterior nos sugiere que podemos utilizar lneas rectas con flechas para indicar la direccin y sentido de propagacin de la luz. A estas lneas las llamamos rayos. Los rayos se dibujan perpendiculares a las superficies que representan las crestas o valles de las ondas, las cuales avanzan en una cierta direccin separadas entre si por una distancia que equivale a una longitud de onda. Estas superficies son llamadas frentes de ondas (Figura 5).

Veremos mas adelante que el trazado de estos rayos nos permitir simplificar el anlisis geomtrico de los fenmenos luminosos. Es por ello que solemos hablar de ptica geomtrica.
229

Los cuerpos frente a la luz


Hasta ahora hemos conversado acerca del origen de la luz, su naturaleza y su propagacin en el vaco. Ahora bien, qu sucede cuando la luz encuentra materia en el camino? En la figura siguiente, una persona que est dentro de un ambiente observa como la luz que proviene desde el Sol distante, llega por varios caminos. Cules caminos puedes identificar tu en esa foto? Algunos de los recorridos de la luz del Sol que podemos describir en la foto son: Luz que entra directamente e incide sobre el florero, las frutas y otros objetos que estn en el interior; desde ellos es desviada hasta la persona. Luz desviada por diversos objetos que estn afuera que llega hasta sus ojos; razn por la cual los puede ver. Hay luz desde el exterior que atraviesa el vidrio de la ventana penetrando a todo el ambiente o encuentra objetos que no le permiten pasar.
Figura 25.6. Foto de un ambiente iluminado por la luz del Sol que penetra en forma directa y a travs del vidrio de una ventana.

En estos y otros recorridos podemos identificar que hay una fuente de luz, objetos con los que sta interacta y un receptor. Entre los objetos con los que interacta la luz, podemos distinguir: Objetos en los que la mayor cantidad de luz incidente se devuelve, por lo que parece que brillan, estos los llamamos reflectores. Tal es el caso de la Luna cuando la luz del Sol incide sobre una regin y se refleja, en los espejos. Hay otros materiales, como el agua o el vidrio, en los que casi toda la luz incidente pasa a travs de ellos. Esto los hace poco visibles o transparentes. Alguna vez te has pegado con una puerta de vidrio? Los materiales altamente transparentes dejan pasar la luz sin dispersarla en su interior, de manera que podemos ver con claridad a otros objetos a travs de ellos. Tambin hablamos de materiales traslcidos, estos dejan pasar la luz pero en su interior parte de ella se dispersa, por ello, los objetos que estn al otro lado se ven borrosos o difusos. Observa este efecto en algunas zonas de la cortina de la figura 25.6. Cuando los cuerpos no dejan pasar la luz en absoluto decimos que son opacos; como la pared de tu saln y muchos otros materiales a tu alrededor.
230

Una explicacin para esta interaccin es que la energa electromagntica transportada por las fotones de la luz al interaccionar con la materia, hace que los electrones de sus tomos salten a orbitales de energa superiores. Como los electrones tienen permitidos ciertos saltos entre orbitales segn los tomos de cada material, es probable que parte de los fotones que inciden sean re-emitidos, mientras que otros son absorbidos por el material. Estos ltimos, provocan un aumento en su temperatura. Esta es la razn por la cual, cuando estamos expuestos a la luz del Sol podemos sentir nuestro cuerpo cada vez ms caliente.

Fenmenos luminosos
La luz, al igual que las ondas sonoras, se refleja, se refracta y es absorbida. Tambin, en algunos medios, puede ocurrir que la luz se descompone en sus distintos colores. A continuacin analizaremos estos fenmenos luminosos, haciendo uso de la ptica geomtrica, para lo cual representaremos a la luz mediante rayos.

La luz que se devuelve: la reflexin


Viste que en muchos materiales la luz incidente es devuelta, esto es, se refleja. Gracias a que los objetos reflejan luz es que podemos verlos. El porcentaje de energa (luz) reflejada puede variar. En superficies muy pulidas, como los espejos la cantidad reflejada es muy alta comparada con la incidente. Adems, los rayos (perpendiculares a los frentes de onda) que inciden paralelos salen paralelos despus de reflejarse, decimos entonces, que ocurri una reflexin especular. En cambio, en superficies rugosas, como una pared o una hoja de papel, los rayos de luz se reflejan en mltiples direcciones y hablamos de reflexin difusa (Figura 25.7).

Figura 25.7. (a) En una superficie pulida ocurre reflexin especular, la luz sale en una sola direccin. (b) En una superficie rugosa ocurre reflexin difusa, la luz sale en varias direcciones.

231

Como viste en la figura anterior, la reflexin especular sigue un patrn que puedes verificar en tu casa utilizando un espejo plano, un lser y un transportador. Esta regularidad la resumimos a continuacin: El rayo de luz incidente, la perpendicular a la superficie en el punto de incidencia y el rayo de luz reflejado estn en un mismo plano. El ngulo de incidencia (i) es igual al ngulo de reflexin (r), i = r

Reflexin especular y espejos


Los espejos son objetos que tienen una superficie muy pulida y producen reflexin especular de la luz. Estas superficies pueden ser de forma plana o curva. Cuando se coloca un objeto iluminado enfrente de un espejo plano, los rayos de luz que provienen de l, llegan al ojo del observador despus de reflejarse en el espejo. El ojo interpreta como si los rayos provienen desde puntos imaginarios que estn ubicados detrs del espejo (Figura 25.8). Este tipo de imagen recibe el nombre de imagen virtual para diferenciarla de una imagen real, como la que vemos proyectada en los cines, donde los rayos de luz provienen realmente de la pantalla. Observa que en la imagen, las letras de la camisa del joven aparecen invertidas lateralmente. Ser esto un error del dibujante? T qu piensas?.

Figura 25.8. Trazado de rayos de luz incidentes en un espejo plano: uno que viene desde los pies, llega al espejo, se refleja en l de manera especular segn el patrn i = r y llega al ojo y, uno que viene desde la cabeza, llega al espejo, se refleja en l de manera especular con el mismo patrn y es recibido por el ojo. Los rayos que llegan al ojo prolongados por detrs del espejo, permiten trazar la imagen (virtual) de la persona. Esta imagen tiene el mismo tamao que el objeto.

232

Tambin existen espejos curvos, como los de los retrovisores de los carros. Hay dos tipos de espejos curvos: los cncavos que estn curvados hacia adentro, y los convexos que estn curvados hacia fuera (Figura 25.9). Habrs notado que las imgenes en los espejos curvos lucen deformadas y pueden ser de mayor o menor tamao que el objeto.

Figura 25.9. Formacin de una imagen en espejo curvo. Los rayos de luz en estos espejos siguen el mismo patrn de reflexin que en el espejo plano, i = r.

Estos curiosos efectos los puedes comprobar tu mismo con un cucharn de cocina muy pulido. Su superficie exterior te podr servir como espejo convexo y, como espejo cncavo su superficie interior. Si alejas tu cara del lado convexo del cucharn, vers primero tu imagen derecha, y a partir de cierta posicin empezars a verla boca abajo (invertida). Haz la prueba con los dos lados del cucharn.

La luz que atraviesa y se desva: la refraccin


Alguna vez, has mirado a travs de un frasco de vidrio redondo lleno de agua? Habrs notado que los objetos que estn dentro parecen deformados y como si estuviesen en una posicin que es diferente a la real. Qu observas en esta foto? Seguramente, te dars cuenta del efecto de los palitos que parecen quebrarse en la frontera entre el agua y el aire, adems parece que se agrandan dentro del agua. Estos efectos visuales son debidos a que cuando la luz llega a una superficie que separa dos medios diferentes, se produce un cambio en la rapidez de la luz como consecuencia ocurre un cambio en la direccin, este fenmeno lo denominamos refraccin. Esto ocurre cuando los rayos luminosos tienen que atravesar diferentes sustancias, en este caso del agua al aire.

Figura 25.10. Palitos de madera en un vaso con agua. Los efectos pticos observados son debidos al fenmeno de refraccin de la luz al pasar del agua al aire.

233

En realidad, cuando la luz llega a la superficie que separa dos medios trasparentes, se producen simultneamente los fenmenos de reflexin y de refraccin, por lo general, la mayor cantidad de luz (energa) se refracta, pasa de un medio a otro. Si tomamos como referencia que la rapidez de la luz en el vaco tiene su valor mximo (c 300 km/s), y la comparamos con su valor en otros medios, podemos definir el ndice de refraccin (n). Rapidez de la luz en el vaco Rapidez de la luz en otro medio C Vmedio

ndice de refraccin =

n=

Sustancia Aire Agua (20 C) Alcohol etlico Aceite comestible Vidrio (medio) Diamante

Rapidez de la luz (km/s) 299.7 224.9 220.2 203.5 189.6 124,0

ndice de Refraccin 1.00 1.33 1.36 1.47 1.58 2.42

Tabla 25.1. Rapidez de la luz e ndice de refraccin de diversas sustancias.

En la figura 25.11 ilustramos dos situaciones diferentes. Cuando la luz pasa de un medio a otro en que se propaga a una velocidad menor (n2 > n1), ejemplo del aire al agua, el rayo refractado se desva acercndose a la lnea perpendicular (normal) a la superficie. Al contrario, el rayo de luz se aleja de la normal cuando n2 es menor que n1, como al pasar del agua al aire.

Figura 25.11. (a) Refraccin de un rayo de luz que pasa del aire al agua (n2>n1) donde i >r. (b) Refraccin de un rayo de luz que pasa del agua al aire (n2 < n1 y i <r).

234

Imagnate que colocamos una linterna debajo del agua y apuntamos el haz de luz hacia la frontera con el aire. Qu crees que suceder? En principio podemos pensar que se debe observar algo de reflexin pero que predomina la refraccin. Ciertamente, sin embargo en estos casos, la refraccin solo ocurrir hasta cierto valor crtico del ngulo de incidencia C. En efecto, al aumentar el ngulo de incidencia por encima de este valor, toda la luz se reflejar quedando atrapada en el agua, este fenmeno lo conocemos como reflexin total interna (Figura 25.12).

Sabas que...? En la industria alimenticia y qumica, en la construccin de lentes correctivos y en muchas otras actividades de la vida, determinar el ndice de refraccin de las sustancias es importante para reconocer el tipo de compuesto.

Entubando la luz, la reflexin total interna

Figura 25.12. (a) Diagrama de rayos de luz que pasan del agua al aire para diferentes ngulos de incidencia i. ; la reflexin total interna ocurre para ngulos de incidencia mayores a C. b) Representacin de un rayo de luz en una fibra ptica.

Este fenmeno de reflexin total interna permite dirigir la luz, desde un lugar hacia otro lejano o inaccesible al ojo. Con este principio de han producido desarrollos tecnolgicos como la fibra ptica (Figura 25.12-b), la cual es muy usada en telecomunicaciones y en medicina, donde permite ver rganos internos para intervenciones quirrgicas.

Sabas que...? Una fibra ptica consiste de filamentos de vidrio o plstico, ms delgados que un cabello humano (dimetro = 10-5m), recubierto con una capa fina de otra sustancia cuyo ndice de refraccin es menor al de la fibra. Permite la reflexin total interna de la luz (onda EM) de manera repetida a lo largo de la fibra, con muy poca disminucin de energa.

235

La luz blanca: Una mezcla de diferentes colores


En el espectro de ondas EM que viste anteriormente (figura 25.4), la luz visible corresponde a un rango de longitudes de onda (4x10-6 m 7,5x10-6 m). Cada una de estas ondas equivale a un color luz. La luz que proviene del Sol casi siempre nos parece blanca, sin embargo, en ella estn viajando juntas ondas de diferentes longitudes de onda. Cmo podemos distinguirlas? Un mtodo conocido que se le atribuye a Newton, consiste en hacer pasar un haz fino de luz blanca por un prisma de vidrio. La rapidez de las diferentes ondas que componen ese haz, en el vidrio disminuye y cambia su direccin con un ngulo de refraccin diferente, segn su longitud de onda, . As, los colores (ondas de distinta ) se separan, y al abandonar la otra cara del prisma se hacen visibles formando un bello espectro continuo, como el arcoiris (Figura 25.13). Observa que la luz que ms se desva es la violeta ( = 0,40 m) y la que menos lo hace es la roja ( = 0,75 m). Las sustancias en las que esta separacin de las ondas se hace evidente son conocidas como medios dispersivos.

Figura 25.13. Arriba: un haz de luz blanca incide en una cara de un prisma y se dispersa al salir por la otra cara, despus de refractarse dos veces. A la izquierda, la luz del sol incide en la cara superior de una prisma de agua, y al salir por la otra cara, se observa el espectro de luz visible.

Podemos concluir entonces que el blanco no es en realidad un color luz. La luz blanca procedente del Sol y de la mayora de las fuentes de luz artificial es la unin de diferentes colores (ondas con distintas ).
236

As mismo, el color que percibimos de los objetos depende del color luz que incide sobre ellos y de los colores luz que ellos reflejen. Si hacemos incidir luz blanca sobre un objeto, su color es el resultado de la o las ondas (fotones) de luz que se reflejan, las otras se absorben dentro de la materia; por esto lo llamamos absorcin de la luz. Por ejemplo, si vemos algo rojo, es porque refleja la onda de ese color luz y absorbe el resto. Los objetos que vemos blancos es porque reflejan ondas de todos los colores. Al contrario, un objeto que absorbe todas las ondas de luz, no refleja luz, lo vemos negro.

Figura 25.14. El color de un objeto es el de la luz (onda, fotn) que refleja. Un cambur es amarillo o una patilla es roja porque sus respectivas pigmentaciones reflejan las componentes amarillo o roja de la luz blanca que reciben y absorben todas las dems.

Mezcla con un trompo

Con una metra, un CD desechado y un crculo con varios colores puedes hacer un trompo que baila ms fino. Qu colores tiene cuando est quieto? Y cuando est bailando? Construye una explicacin argumentada para esta experiencia y comprtela.

237

Lentes e instrumentos pticos


Las lentes son piezas de materiales transparentes, como el vidrio, que tienen curva al menos una de sus caras. Ellas nos permiten producir imgenes cuando son atravesadas por la luz procedente de los objetos. Adems, son la base del funcionamiento de aparatos pticos como: cmaras fotogrficas, microscopios, telescopios y tambin las utilizamos para corregir nuestros defectos visuales. Una pieza de vidrio que tiene sus dos caras curvas con los bordes ms estrechos que el centro permite que los rayos de luz paralelos que inciden sobre ella, se desvan hacia el centro al atravesarla, convergen en un punto, a esta pieza la llamamos lente convergente. Esto ocurre porque en el centro de la lente, la luz se retrasa al viajar una distancia mayor a menor rapidez que en los bordes. A cada lado de la lente podemos identificar estos puntos de convergencia de los rayos y los llamamos focos. Puedes probar a colocar un trozo de papel cerca del foco de una lupa, para concentrar all los rayos del Sol, y as logrars calentarlo. Cuidado que puedes llegar a quemarlo. A veces los incendios forestales son producidos por vidrios de desecho que tienen esta forma.

Figura 25.15. Lentes convergentes y divergentes, con su foco y la distancia focal indicadas.

Tambin podemos moldear una pieza transparente de forma inversa, es decir, hacer que sus bordes sean ms anchos que el centro. As, los rayos de luz paralelos que inciden sobre la pieza, al atravesarla se separan entre s, alejndose del centro, es decir, divergen. Las ondas en el centro tardan menos en salir que en los bordes. Esta pieza es conocida como lente divergente (Figura 25.15).

238

Cmo se forman las imgenes con una lente? En la figura 25.16 puedes observar dos casos de formacin de imgenes: una en lente convergente y otra en lente divergente. Cuando la imagen se forma mediante la interseccin de los mismos rayos que han sido refractados, decimos que es una imagen real. Por el contrario, cuando se construye mediante la prolongacin imaginaria de rayos refractados, decimos que es una imagen virtual.

Figura 25.16. Formacin de imgenes con lentes convergentes y divergentes. Para construir las imgenes basta con usar dos o tres rayos de luz especiales que salen de un punto del objeto: rayo azul , incide en la lente pasando por el foco y se refracta en direccin paralela al eje; rayo verde, incide pasando por el centro de la lente y no se desva; rayo naranja, incide en direccin paralelo al eje y se refracta pasando por el foco.

La conocida lente de aumento o lupa no es ms que una lente convergente de corta distancia focal, de modo que permita formar una imagen ampliada de un objeto colocado detrs de ella (Figura 25.17).

Figura 25.17. Trazado de rayos e imagen en una lupa. Ojos de una nia con lupa frente a uno de ellos.

239

Cuando la imagen que produce una lente es usada como objeto de una segunda lente, logramos efectos especiales. Este es el fundamento de los diversos instrumentos pticos. En la figura 25.18 ilustramos el principio ptico de un microscopio.

Figura 25.18. Principio de funcionamiento de un microscopio.

Una cmara fotogrfica funciona de manera parecida al ojo humano. Recuerdas el cristalino del ojo, este tiene forma de lente convergente. Los rayos de luz que le llegan, se refractan en l, as se forma la imagen en la retina. El ojo humano ajusta el grosor de la lente, si el objeto est lejos, el centro del cristalino se adelgaza, y cuando est cercano, se engrosa. Adems, el iris regula la cantidad de luz que entra cambiando el dimetro de la pupila. En la cmara es posible hacer ajustes de la posicin de la lente y regular la cantidad de luz que le entra.

Figura 25.19. Diagrama ptico de la formacin de imgenes en un ojo humano y con una cmara fotogrfica sencilla.

240

El valor de la luz
A lo largo de esta lectura habrs encontrado que hay muchos aspectos de nuestra vida relacionados y dependientes de la luz, de su energa. Ella representa mucho ms que una propiedad que nos permite ver los objetos que nos rodean. La luz, considerada como onda o como fotn que transporta energa, es la fuente de vida de los seres que habitamos en el planeta Tierra y de diversos procesos de la dinmica de las gesferas. Razn por la cual, desde sus inicios la humanidad se ha interesado por comprender qu es y cmo se comporta la luz. Sabemos que lo que llamamos luz corresponde a un pequeo rango de longitudes de onda dentro del espectro EM, y que justamente debido a esa magnitud los humanos podemos verla. Sin embargo, hay otras luces, ondas, que son visibles para otros seres vivos. Por ejemplo, la luz ultravioleta puede ser percibida por mltiples insectos y aves. Los fotones las ondas EM de frecuencia mayores que los de la luz (ultravioleta, rayos X y gamma) transportan mayor cantidad de energa; adems, pueden penetrar en las estructuras moleculares orgnicas y romper sus enlaces. Este hecho puede resultar beneficioso, por ejemplo cuando se emplea en diagnstico o tratamiento mdico, en tareas de esterilizacin, purificacin de agua, entre otros. Sin embargo, puede ser daino para la salud provocando enfermedades y alteraciones en el ambiente; nuestra atmsfera es un escudo protector para muchas de estas radiaciones, por eso debemos protegerla para que no se destruya. Por el otro lado, las ondas EM de frecuencia menores que la luz visible (infrarrojo, ondas de radio y de TV), transportan menor cantidad de energa; de ms est decir cmo las utilizamos diariamente. Volviendo a la importancia de la luz para las comunidades tenemos que en muchas de las actividades humanas como: las expresiones artsticas, la vida de los seres vivos, el comportamiento de los elementos abiticos, el anlisis de muchas sustancias bioqumicas, la iluminacin de las calles y espacios comunes en general, la ubicacin de las lmparas en ambientes de trabajo, estudio o descanso, y muchsimos ms, requieren de conocimientos acerca de ella.
Fuente: http://amantesartesvenezolanas.blogspot.com/

Obra de Fidel Santamara.

Por ltimo, vivimos inmersos en un mar de ondas EM, no solo de luz visible, como todas son energa transportada por ondas o fotones, tenemos que cuidarla y utilizarla de manera eficiente y responsable, para evitar riesgos no slo para las personas, sino tambin para el ambiente en general.
241

Oh! Cuantas imgenes!

A un compaero se le ocurri unir un par de espejos planos por un borde con tirro. Esto le permiti variar el ngulo entre ellos; y al colocar un patito entre ellos, observ sorprendido que se formaban varias imgenes, por eso tom una foto como la anexa. l quiere saber, cmo variar la cantidad de imgenes en funcin del ngulo entre los espejos? Para ayudarlo pueden hacer una investigacin experimental.

Qu necesitan? Dos espejos planos de ms o menos 20 cm x 15 cm, tirro, hojas blancas, un objeto pequeo, un transportador circular impreso (opcional). Qu pueden hacer? Con la aprendido sobre la reflexin especular y la formacin de imgenes en espejos planos, analicen mediante el trazado de rayos lo que muestra la foto. Discutan acerca de lo que suceder al ir aumentando el ngulo entre los espejos. Preparen un montaje parecido al de la foto y registren el nmero de imgenes que se forman para una serie de ngulos. Construyan un grfico con los resultados de las variables asociadas. Elaboren una respuesta a la pregunta y comparen con lo que esperaban que ocurriera. Elaboren explicaciones individuales y evalen su consistencia. Qu caractersticas tienen las imgenes observadas? Son virtuales o reales? Si los espejos estuviesen uno frente al otro (ngulo cero), cuntas imgenes se formaran? Construyan un diagrama de rayos de esta ltima situacin. Qu aplicaciones prcticas pueden tener estos montajes de espejos?.

242

Jugando con simuladores de lentes

Bajen el archivo en espaol geometric-optic, de la siguiente direccin web: http:// phet.colorado.edu/en/simulation/geometric-optics. As lo podrn utilizar sin tener conexin a internet. Organcense en grupos de 2 o 3 e interaccionen con la simulacin para que se planteen preguntas relacionadas con caractersticas de las lentes, de los objetos y de las imgenes en las lentes delgadas. Cmo vara la distancia focal de la lente con: la el radio de curvatura; el ndice de refraccin o el dimetro? Para cada lente: En qu regin debe estar ubicado el objeto para que la imagen sea virtual? Y para que sea la imagen sea real? En qu condiciones se produce una imagen mayor que el objeto? Y menor? Puede ser la imagen del mismo tamao del objeto? En dnde tiene que estar el objeto? Cmo es la imagen del objeto cuando ste se encuentra en el foco de la lente? Qu pueden hacer? Es importante familiarizarse con los elementos de la simulacin y explorar las diversas variables que se pueden escoger (radio de curvatura de la lente, ndice de refraccin del material, forma del objeto, entre otras). Revisen, discutan y replanteen las preguntas iniciales. Propongan posibles respuestas argumentadas antes de interactuar con la simulacin y mantngalas como hiptesis. Identifiquen las variables que van a estudiar y varen una a la vez, controlando el resto. Observen y registren las variables que se afectan en cada caso y cmo cambian. Elaboren conclusiones, para ello consideren las preguntas que se hicieron y otras que puedan surgir durante la actividad. En qu empleamos las diferentes lentes? Qu tipo de lente sern las que usan nuestros familiares y vecinos?

243

Si tapamos la mitad de la lente, qu veremos?


Tenemos una lupa que tiene la mitad inferior tapada Cambiar su funcin? Cmo? Necesitarn: Una lupa, un regla de un metro, un objeto-fuente de luz de ms o menos 3 cm de alto, puede ser un bombillo con una marca oscura que sustituya al objeto, montada en un scate y conectado a una fuente elctrica, una pantalla, algn sistema de soportes para mantener los elementos alineados.

Construyan un montaje parecido al que se indica en la foto. Exploren cmo varan las caractersticas de la lente en la pantalla cambiando la posicin relativa entre el objeto y la lente. Determinen la distancia focal de la lupa. Tapen la mitad del crculo inferior de la lente, exploren y comparen lo observado con lo anterior. Elaboren conclusiones y comparen resultados entre grupos. En qu se diferencia la actividad experimental de la actividad simulada anterior?

244

Actividades de autoevaluacin

1. Construye un modelo explicativo usando un frente de ondas para explicar por qu la direccin de la luz se acerca a la lnea perpendicular en el punto de incidencia, cuando pasa de un medio donde viaja con mayor rapidez a otro donde viaja con menor rapidez. 2. Construye un diagrama de rayos de luz que explique un eclipse de sol y un eclipse de luna. Elabora un modelo tridimensional de cada caso y prepara una explicacin para otros grupos del liceo. 3. Todos los das te ves en el espejo. Ahora lo vas a hacer marcando en el vidrio la parte mas alta de tu cabeza y tu mentn. Compara esa altura (H) con la altura de tu cabeza (H). Sorpresa, elabora una explicacin a este resultado mediante trazado de rayos de luz y conocimientos de geometra.

4. Imagina que un grupo de productores ha creado una nueva sustancia y te piden determinar el ndice de refraccin y el ngulo a partir del cual ocurre la reflexin total interna en ella. Para eso te dan una muestra de la sustancia, un recipiente cbico de vidrio y un laser. Disea un plan para resolver el problema. 5. Si en una ventana de vidrio trasparente e incoloro es atravesada por luz solar, colocamos hojas de papel celofn de distintos colores. Qu crees vers en cada caso si incide sobre una hoja blanca? Y al incidir sobre papel de color? Realiza la experiencia y contrasta tus hiptesis. Construye un explicacin. Puedes hacer un hermoso vitral para una ventana. 6. Con pinturas de tres colores: verde, azul y rojo, realiza mezclas a pares de las tres sustancias. Qu color ves en cada mezcla? Ser igual la mezcla de colores pigmento que la mezcla de colores luz. Qu sucedera si sobre cada mezcla incide algn color luz? Verifica tus respuestas tentativas de manera experimental. Puedes usar linternas potentes cubiertas con papel celofn de colores. Construye una explicacin para estos resultados considerando la luz (onda o fotn) que se refleja en cada pigmento y en cada mezcla al incidir luz blanca o de color. 7. Con los diferentes fenmenos que has conocido en esta lectura prepara con el grupo una charla con demostraciones en vivo sobre la luz. La pueden presentar en el liceo o en algn lugar de la comunidad, hogar de adultos mayores, centros de educacin inicial, una reunin de cumpleaos, otros. Vers que divertido es.
245

246

Algo ms para saber sobre ciencia y tecnologa

Fruto vivas: una arquitectura ecolgica y social


Qu interpretas en cada una de las siguientes expresiones? - Yo hablo decoexistir con la naturaleza, sin que seamos ms importante que la flor de mastranto o una mariposa. O salvamos los rboleso desapareceremos del planeta. - Ms importante que crear ciudades, es crear hombres libres . - Sueo con el da de la limpieza comunitariay los techos de zinc convertidos en jardines. - Los centros comerciales estn diseados para acabar con los comercios pobrespara enriquecer a un pequeo grupo de gente. - Hay que hacer espacios donde la gente viva, que los nios jueguendonde tengan calidad de vida. Es mi trabajo, crear ciudades humanas. A cul de estas o estos profesionales corresponder cada expresin? - Maestra(o) - Poltica(o) - Cientfica(o) - Arquitecta(o) - Ambientalista - Sociloga(o) En realidad, todas esas expresiones son de un excepcional venezolano que, por ms de 55 aos, ha hecho importantes aportes en el rea de la arquitectura urbana. Su visin integral de los saberes favorece respuestas alcanzables para resolver necesidades arquitectnicas de grupos numerosos, con una tecnologa y un arte de la construccin que procura mantener un equilibrio entre la naturaleza y el ser humano, integrando lo sencillo y lo popular. Nos referimos a Jos Fructoso Vivas, mejor conocido como Fruto Vivas. Este cono de la construccin poco convencional ha creado un sistema de arquitectura de masas, que algunos llaman popular, por la accesibilidad de los materiales que propone, as como la fcil comprensin de la tecnologa para la construccin. Vivas naci en el estado Tchira, en el ao 1928. Se gradu como arquitecto en la Universidad Central de Venezuela en 1956, y fue activista de la lucha poltica clandestina durante la dcada de los aos 60. Uno de los elementos socio-tecnolgicos ms extraordinarios de su propuesta es la idea de conformar el pueblo constructor, un concepto acorde con los procesos de organizacin y protagonismo de las comunidades, promovida por nuestra Constitucin. Ha planteado ideas para superar la pobreza y crear mejores condiciones de vida a travs de diversos medios pedaggicos, tales como: la capacitacin de la poblacin en reas productivas; la enseanza de tcnicas para asegurar la resistencia de viviendas inestables, en casos de sismos; la creacin de centros, administrados por la comunidad, para producir materiales de construccin basados en tcnicas sencillas e insumos poco convencionales y de la localidad, como barro, bamb y madera; la fabricacin de artefactos asociados a lasviviendas, como taladros, soldadores, zcalos, pilas, y muchos ms.
247

Como puedes inferir, su genio creativo-tecnolgico tiene un marcado acento social para atender las necesidades y el derecho a una mejor vivienda de las personas de bajos recursos econmicos. Sin embargo, otros sectores socioeconmicos de la poblacin tambin se han beneficiado de su talento arquitectnico. Como sello de identidad, propone desarrollar las ciudades latinoamericanas con base en la herencia cultural indgena, rabe y romana. Ha ideado el concepto arquitectnico de estructura lmite, que busca lograr la mayor eficiencia en las construcciones empleando los materiales justos y necesarios, sin que nada falte ni nada sobre. Vivas es autor del libro titulado Las casas ms sencillas con 11 captulos donde sintetiza su experiencia e investigacin en el arte de hacer viviendas, para ponerla al servicio del pueblo, para ayudarlo a construir y crear su vivienda para el buen vivir. Fruto Vivas ha venido ejecutando una propuesta arquitectnica, desde 1994, que ha llamado rbol para vivir. Se trata de mdulos habitacionales a cierta altura desde el suelo, cuya distribucin arquitectnica y materiales se conjugan con las condiciones climticas y geogrficas del lugar donde se construye. Un ejemplo de esta propuesta esttica es la serie de edificios bioclimticos en Puerto La Cruz, estado Anzotegui, o en el barrio Los Aguacaticos, en La Vega, Caracas. Dentro de su visin arquitectnica, de carcter humanista, popular y ecolgica, este extraordinario artista sostiene que busca la felicidad urbana representada por una ciudad familiar, que se adapte a las necesidades de las personas, no a las necesidades rentistas o de lucro de pequeos grupos. Fue galardonado con el Premio Nacional de Arquitectura en el ao 1987. En el 2000, dise el exitoso Pabelln de Venezuela para la Exposicin Universal de Hannover, Alemania. Esta imponente estructura que denomin Una flor para el mundo est inspirada en los tepuyes de la Gran Sabana, estado Bolvar y la orqudea, flor nacional; consta de 16 ptalos con un dimetro de 39m que pueden abrirse para permitir el paso de la luz al pabelln. Su altura es de 25m con los ptalos abiertos y tiene tres niveles. Esta hermosa obra se encuentra actualmente en la ciudad de Barquisimeto, estado Lara, no solo para el ornamento sino para el provecho de la comunidad. Fruto Vivas lleva ms de 50 aos formando arquitectas y arquitectos en la Universidad Central de Venezuela. Ha sido reconocido nacional e internacionalmente por su obra arquitectnica y adems por su postura crtica y su actitud de permanente educador.
248

Arstides Bastidas: pionero del periodismo cientfico en Venezuela


Arstides Bastidas, yaracuyano, del pueblo San Pablo, naci en el seno de una familia humilde en el ao 1924. Apenas logr estudiar hasta el primer ao de bachillerato pues la necesidad econmica lo oblig a incorporarse al campo de trabajo para ayudar a cubrir las necesidades bsicas familiares. A los 21 aos, Bastidas incursiona en el periodismo en forma autodidacta. Para 1950 se encuentra cubriendo noticias cientficas de la Federacin Mdica Venezolana y luego, en 1952, escribe sobre las convenciones anuales de la Asociacin Venezolana para el Avance de la Ciencia (ASOVAC). Fue cofundador de la Asociacin Iberoamericana de Periodismo Cientfico en el ao 1969. A partir de 1971 comienza a publicar una columna fija, La ciencia amena, en un diario de cobertura nacional. Con ello, y con los programas radiales que haca, tomaba auge en el pas el periodismo cientfico, especialidad que permite dar a conocer, interpretar y opinar, de forma amena, temas cientficos, tecnolgicos, sociales y culturales. Su estilo estaba impregnado de matices pintorescos, anecdticos, humorsticos y hasta poticos: la ciencia y la tecnologa tienen la misma procedencia que la poesa y el arte. As la gente recibe el conocimiento cientfico, sin darse cuenta, justificaba. Cabe destacar que para ese momento histrico el periodismo cientfico era escasamente cultivado en el pas y el inters por el desarrollo y alcance de la ciencia y la tecnologa, poco favorecido para los sectores populares. La mayor parte de su vida Arstides Bastidas sufri de reumatismo, enfermedad que lo mantena reducido a una silla de ruedas y, durante 17 aos, hasta su muerte, estuvo invidente. Su dolor lo transformaba en energa positiva para su trabajo y para contagiar a sus discpulos, quienes compartan su excepcional capacidad de anlisis, sntesis y memorstica. Fue un hombre de pensamiento crtico y de convicciones democrticas lo que demostr formando parte de la resistencia contra la dictadura de Marcos Prez Jimnez. Profesaba un gran sentido de justicia social para con las comunidades necesitadas; el amor al prjimo y el deseo de hacerle bien era, para l, una manera tica de vivir.
249

Su perseverancia, seriedad y compromiso con la misin educadora, a travs del periodismo cientfico, lo hizo merecedor de diversos reconocimientos y premios nacionales e internacionales, como el Premio Kalinga para la divulgacin cientfica, otorgado por la UNESCO, en 1981; Para que tengas una idea de su relevancia, este premio es, para el periodismo, como el Premio Nobel para otros campos. Recibi dos veces el Premio Nacional de Periodismo. Tambin recibi el Premio Latinoamericano Cientfico John Reitermeyer y varias veces el Premio Municipal de Periodismo. Su contacto con la ciencia, las cientficas y los cientficos le permiti construir una posicin acerca de la importancia de la investigacin en este campo para el pas: Yo creo en la ciencia bsica como algo fundamental de la cultura humana y algo necesario para el enriquecimiento interior del hombre... pero, a largo plazo, la ciencia est destinada a ayudar al hombre a mitigar sus calamidades... Un pas que cultiva la sola ciencia aplicada est comprometiendo su porvenir... Por lo dems, la ciencia bsica es indispensable para la docencia... Pero no se puede hacer nicamente ciencia pura, pues la sociedad necesita de las aplicaciones de la ciencia, la demanda y es por ella que est dispuesta a pagar. Horas antes de fallecer, el 23 de septiembre de 1992, conoci del Premio Capire para el Futuro Creador que le otorgaba la Universidad de Florencia, Italia. A continuacin incorporamos una de sus escritos divulgativos cientficos. Esperamos que su lectura te motive a buscar y disfrutar de otros trabajos del autor. En especial, y en relacin con este texto, te recomendamos las crnicas relacionadas con el tomo.

El azufre es inocente del vnculo que le atribuyen con el diablo: eso es invento de la ingratitud
La S con que los qumicos simbolizan el azufre dista mucho de la de Santo. El azufre no es un explosivo como la dinamita, pero se comporta como un nio travieso que si lo dejan de su cuenta, tumba una casa entera. Ese elemento tiene el nmero 16 en la Tabla de Mendeleyev y posee particularidades que lo hacen apreciable. Al secarse las piedras las disparbamos contra las aceras para complacernos con las detonaciones que producan al rebotar en el pavimento. No lo saba, pero de ese modo la sustancia haca gala de sus propiedades. El azufre es considerado el metal del diablo. Tamaa injusticia! No podra serlo por la sencilla razn de que no es un metal, es metaloide. Aunque es slido y ostenta un color amarillo est ms emparentado con el oxgeno que es un gas, que con el plomo o la plata. El azufre era ampliamente conocido en la antigedad. Es aludido por los profetas bblicos Isaas y Ezequiel, en los libros de los Salmos y el Apocalipsis. No es un pecador, y por eso es extrao que en las Sagradas Escrituras lo mencionen para describir el juicio de Dios y los tormentos del infierno. El pobre azufre se preguntar siempre qu hizo de malo para que lo vincularan con asuntos tan solemnes. Los chinos lo emplearon. Eso sigue siendo posible porque el azufre puede imitar la conducta asomada del oxgeno que se combina con todo el mundo. Y como l, acta de comburente o de celestino del fuego en unin de los metales y de los no metales; y adems, se vuelve combustible como la gasolina, cuando se junta con los halgenos, que tal es el apellido de una familia que se las da de taquititaqui, constituida por el cloro, el flor, el bromo y el yodo. Los beneficios mdicos del azufre han sido aplicados desde tiempos inmemoriales. Sus compuestos estaban indicados contra la sarna y an se les usa contra el acn juvenil y otras alteraciones de la piel.
250

En dosis exageradas es un purgante muy activo. Se dice que Nern lo ingera en pequeas porciones como laxante, a fin de neutralizar los excesos de la mesa, slo comparables a los de la alcoba. La intervencin de los fsforos o cerillas tuvo en el azufre un aliado imprescindible. Hoy se le dan los ms diversos destinos industriales. Durante siglos, Sicilia tuvo en sus minas de azufre un factor importante de su prosperidad. El estado de Loussiana, en Norteamrica, le saca provechos imponderables a sus yacimientos de este metaloide. Y en Venezuela las circunstancias nos obligaron a desulfurar los petrleos pesados, porque si no lo hacamos, la municipalidad de Nueva York se negaba a comprarlo, aduciendo justificadamente que al quemarlo para calentar los hogares, contaminaba el ambiente. Esa presin, condujo a Lagovn y Maravn a aislar el azufre de sus hidrocarburos pesados en Amuay y Cardn. La venta de ese elemento nos otorga ahora ganancias adicionales. El azufre es uno de los integrantes del cuerpo humano. Quiz sea el responsable del demonio que a veces nos acompaa. En efecto, una persona de setenta kilos tiene ciento cuarenta gramos en su organismo. Ese azufre es estable, o sea, que no se desintegra emitiendo radiaciones, como el de las manecillas de los antiguos relojes luminosos. El cido sulfrico es caracterstico de los huevos descompuestos, pero no es exclusivo de ellos. Estn presentes tambin en carnes y otros compuestos orgnicos cuando se echan a perder. Se debe a que el azufre se combina con el hidrgeno y entre ambos urden una conspiracin contra el olfato humano. Puede decirse en su descargo que sirve para alertar a buitres, hienas y zamuros sobre la presencia de restos de animales con el objeto de que vayan a consumirlos haciendo de paso una encomiable labor sanitaria. Por otra parte, este gas le comunica su olor tpico a las aguas termales como las de San Juan de los Morros, y es de nuevo buen amigo cuando se incluye en los medicamentos para enfermedades de la laringe y la fabricacin de anilina. Si se le quema se despoja de su mal olor y muestra una llama potente de un fascinante color azul. (Fuente: Bastidas, A. El tomo y sus intimidades. Alcasa del Orinoco).

251

Mesas tcnicas de agua: escuelas de corresponsabilidad


Corresponsabilidad es responsabilidad compartida. Significa que debes participar y decidir en la solucin de tus problemas y los de tu entorno familiar y comunitario. Las dificultades del mundo moderno exigen de tu aporte y contribucin, como ha sucedido en nuestro pas con las llamadas Mesas Tcnicas de Agua (MTA), una particular forma de organizacin creada en el seno de las comunidades para solucionar, con las tcnicas y los tcnicos de las empresas hidrolgicas, las problemas relacionados con el servicio de agua potable y saneamiento. Atendiendo a los principios de corresponsabilidad y participacin enunciados en la Constitucin de la Repblica Bolivariana de Venezuela (1999), en los artculos 70, 184 Y 304, que promueven la construccin protagnica del poder popular para la toma de decisiones, muchas ciudadanas y ciudadanos han asumido su papel transformador al crear las MTA. Las personas que han trabajado en dichas mesas, saben abordan un tema trascendental, porque el agua, como el aire que respiras, es un elemento esencial para la vida humana y para el funcionamiento de cada clula de tu organismo y de todo en el ambiente. Quienes participan en las MTA buscan la resolucin de sus problemas de suministro de agua potable y de saneamiento de aguas servidas o residuales Las MTA son una de las vas de fomentar el uso y aprovechamiento sustentable de los recursos hdricos. Han generado redes de abastecimiento de agua potable y de saneamiento en los vecindarios, mediante proyectos, que parten de un diagnstico de necesidades y se ejecutan con la transferencia directa de recursos por parte del Estado venezolano, bajo el ejercicio de la contralora social e institucional. Hoy en da, en Venezuela, existen ms de nueve mil MTA. Han motorizado la construccin de 52 plantas de agua potable, la ampliacin o rehabilitacin de 35 plantas. Y lo ms importante, la construccin de acueductos donde no los haba, construccin de tanques de almacenamiento para el abastecimiento comunitario y el diseo y creacin de sistemas para el saneamiento: cloacas, alcantarillado y 25 plantas de tratamiento de aguas residuales. Todo ello para cubrir el servicio potable o de tratamiento del agua de los sectores comunitarios a los que pertenecen. De esta manera, las MTA han sido verdaderos espacios educativos y creativos. En ellas, diversas comunidades han aprendido a ejercer el poder sobre los recursos hdricos, y han asumido la revisin y unificacin de numerosos reglamentos de agua, lo que se constituy en la base de la Ley Orgnica de Prestacin de los Servicios de Agua Potable y Saneamiento (LOPSAPS), aprobada en el 2001. Esta ley redefine la estructura del llamado sector de agua potable y saneamiento (APS), y ocasiona el aumento en el pas del acceso al agua potable a un 96%, cifra que para 1998 alcanzaba el 80%. En consecuencia, alcanzamos la meta del milenio relativa al acceso de agua, aprobada por la Asamblea General de las Naciones Unidas (ONU) en el ao 2000. Este logro favorece, adems, un desarrollo humano sostenible, mediante un enfoque ecolgico humanista que armoniza el ciclo hidrolgico con el ciclo social, y auspicia la corresponsabilidad del hombre con el ambiente, con su comunidad y consigo mismo.
252

Impactante ha sido la influencia de las MTA. Han propiciado la creacin del Fondo de Proyectos Comunitarios de Agua, y programas educativos como: Las Mesas Escolares de Agua, los Encuentros de Saberes del Agua y el Fiesta del Agua. Sus iniciativas se han proyectado internacionalmente. En el 2008, los gobiernos de Venezuela y Paraguay, que adopta la figura de las Mesas Tcnicas de Agua, suscriben una Carta de Intencin. Las naciones de la Alianza Bolivariana para los Pueblos de Amrica y el Caribe (ALBA) organizacin conformada por Venezuela, Cuba, Nicaragua, Bolivia, Honduras, Antigua y Barbuda, Ecuador, Dominica, San Vicente y las Granadinas han asumido el lema el agua que nos une. Asimismo, se han firmado convenios de cooperacin, dotacin e intercambio de asistencia tcnica, equipos y suministros con Nicaragua y Cuba. Las MTA nos recuerdan que el saber y la organizacin del poder popular son una buena opcin para la preservacin de la vida en el planeta. Son organizaciones comunitarias que se transforman en intercambio y creacin de saberes populares y tcnico-cientficos. Con una mentalidad belicista, se ha afirmado que las prximas confrontaciones mundiales sern por el agua. Con una mentalidad pacifista, pensamos que las confrontaciones mundiales llegarn a su fin por el agua, porque todos la necesitamos para la subsistencia, porque es un recurso no renovable, cuyo idioma, como afirma Pablo Neruda, fue enterrado y las claves se perdieron o se inundaron de silencio. Todos vivimos en una misma cuenca hidrogrfica, estamos unidos por el agua. Lo que hagamos o dejemos de hacer afecta nuestra cuenca y nos afectar a todas y todos. La nueva conciencia alcanzada por las personas que participan en las mesas tcnicas basada en el conocimiento de su realidad concreta es la va para su transformacin.

253

Fuentes de consulta para las estudiantes y los estudiantes


________ (sf ) Mezclas y sustancias. (Documento en lnea). http://www.slideshare.net/alealmeida73/ elementos-compuestos-y-mezclas Azuaje, J. y Andrs, M. M. (edts) (2012). Serie Ciencias Naturales. Coleccin Bicentenario. Educacin Media. Primer Ao. Segundo Ao Caracas: MPPE Barrientos, H., Tello, J. y otros (s/f ). Purificacin de agua por medio de filtros lentos de arena en la comunidad de Kuychiro. [Documento en lnea] Disponible: http://perusolar.org/16-spes-ponencias/ PURIFICACION [Consulta: 2012, julio] Batista, L. (2011). A segunda Lei das... Ervilhas? Disponible en: http://www.pontociencia.org.br. Carpi, A. (2003). Propiedades del agua. Visionlearning Vol. CHE-2 (1s). [Documento en lnea] Disponible: http://www.visionlearning.com/library/modulo_espanol.php?mid=57&l=s&c3= Ecured. (s/f ). Gregorio Mendel. Disponible en: http://www.ecured.cu/index.php/Gregorio_Mendel Edu.car. El portal educativo del estado argentino. Ncleo terico: Estado del arte. [Pgina web en lnea] http://aportes.educ.ar/biologia/nucleo-teorico/recorrido-historico/ Fernndez, N. (coord) (sf ) [Recursos de fsica y qumica en lnea] Disponible: http://www.portaleso.com Fruto Vivas. [Documento en lnea] Disponible: http://www.frutovivas.net/ [Consulta: 2012, julio] Fundacite Lara. Revista elctronica Bariqui Cuadernos de Ciencias. http://www.fundacite-lara.gob.ve/ index.php/revista-bariqui/publicaciones-bariqui?task=view Fundacite Lara. Revista electrnica Equis. Ciencia y tecnologa con y para la gente. http://www.fundacitelara.gob.ve/index.php/revista-equis-3/publicaciones-equis-3?task=view Gaite, M. (sf ) Iniciacin Interactiva a la material. (Animacin en lnea) http://concurso.cnice.mec.es/ cnice2005/93_iniciacion_interactiva_materia/curso/index.html Gil, S. y Rodrguez, E. (2012). Fsica re-creativa. [Ciberpgina en lnea]. Ver especialmente: Vnculos a sitios relacionados, Ciencia para nios y adolescentes. [Recurso en lnea] Disponible: www.fisicarecreativa. com/sitios_vinculos/ciencia/children.html Hewitt, P., (2005) Conceptos de Fsica. Mxico: Limusa, S.A Icarito (2012). La clula. (Documento en lnea). Disponible en: http://www.icarito.cl/enciclopedia/ articulo/ segundo-ciclo-basico/ciencias-naturales/estructura-y-funcion-de-los-seres-vivos/2009/12/60-79209-la-celula.shtml Junta de Castilla y Len. Aprendiendo la tabla peridica de forma divertida. (Recurso en lnea). [Consulta: 2012, mayo] http://revistas.educa.jcyl.es/revista_digital/index.php?option=com_content&view=artic le&id=730:aprendiendo-la-tabla-periodica-de-forma-divertida&catid=8:propuestas-didacticas Lacueva, A. (2002). Ms de 400 Ideas para actividades y proyectos estudiantiles de investigacin. Caracas: Laboratorio Educativo Material de apoyo para Enseanza Media sobre Biologa Molecular. [Consulta: 2012, mayo] http:// labvirtuales.med.uchile.cl/index.html McDonald, D. (2008). Citogentica bsica (traducido por ngel Herrez de Cytogenetics Information Site). [Pgina web en lnea]: http://www2.uah.es/biomodel/citogene/dynacare/geninfo.htm#cariotipo Ministerio del Poder Popular para el Ambiente. Hidrocapital. (sf ) (Recursos varios sobre tema de agua, en lnea) http://www.hidrocapital.com.ve/internet/index.php?option=com_content&view=section&lay out=blog&id=4&Itemid=19 Ministerio del Poder Popular para la Energa. (sf ) Sobre petrleo. (Recursos en lnea) http://www.pequiven. com/pqv_new/kids%20web.swf Organizacin Panamericana de la Salud. Gua latinoamericana de tecnologas alternativas en agua y saneamiento (1997). [Documento en lnea] Disponible: http://www.col.ops-oms.org/saludambiente/ guia-print.htm# [Consulta: 2012, junio] Pea, C (sf ) E+educaplus.org. (Recursos varios de Ciencias Naturales) http://www.educaplus.org/ RENA. (2000). Reacciones qumicas. Velocidad de las reacciones qumicas. Catalizadores [Recurso en lnea] Disponible: http://www.rena.edu.ve/TerceraEtapa/Quimica/ReaccionesQuimicas.html [Consulta: 2012, enero] RENA. (2000). El agua potable. [Recurso en lnea] Disponible: http://www.rena.edu.ve/SegundaEtapa/ ciencias/aguapotable.html Simulador de sistema de control elctrico. (Recurso en lnea) http://www.ree.es/educacion/controla/ Vlez, J. Intercambio de sustancias en clulas (Documento en lnea) : http://academic.uprm.edu/~jvelezg/ lab7.pdf Vivas, F. (2012). Las casas ms sencillas. Caracas: El Perro y la Rana. Van Cleave, J. (2010). Fsica para nios y jvenes. Mxico: Limusa, S.A. Vargas, L. (2006). Actividades de fsica y su aplicacin en la vida cotidiana. Caracas: Fundacin CENAMEC. Animaciones para temas de fsica y qumica: (Recurso en lnea) http://perso.wanadoo.es/ cpalacio/30lecciones.html 254

Interactive Simulations. (2011) Universidad de Colorado. [Pgina web en lnea] http://phet.colorado.edu/ en/simulations/category/new. Simulaciones sugeridas: Densidad. (Density) / Concentracin. (Concentration) / Reactantes, productos y residuos. (Reactants, products and leftovers) / Balanceando ecuaciones qumicas. (Balancing chemical equations) / Construir un tomo (Build an atom) / Visin del color (Color vision) / Ondas acsticas (Sound) / Propiedades de los gases (Gas properties) / Efecto invernadero (Green house) / Kit de construccin de circuitos CC (circuit construction kit DC) / Circuitos de resistencias (Battery resistor circuit) Sales y solubilidad. (Salts & solubility) / Soluciones de azcar y sal. (Sugar and salt solutions) Video en lnea sugerido [Pgina web en lnea]: Cambios qumicos: http://www.youtube.com/watch?v=VZ8SWIRs2Bg Lectura: calor y temperatura: http://www.youtube.com/watch?v=Zv0_ZVzZ3E0 Corriente elctrica: http://www.youtube.com/watch?v=ApCu6mVBSs0 Corriente elctrica: http://www.youtube.com/watch?v=ySYeSiAEpiY Energas alternativas: http://energiaslibres.wordpress.com/2011/08/16/un-video-sobre-la-energiaque-deberia-ver-todo-el-mundo-por-favor-compartan/ Bosque de aspirina. [Pgina web en lnea] http://www.youtube.com/watch?v=lsCuNFXtd9c&feature =related

Referencias para las educadoras y los educadores


____________ (sf ) 100cia Qumica. (Recursos varios en lnea) http://www.100ciaquimica.net/temas/ tema3/index.htm Barberil, E. (1998) El pozo ilustrado. Cuarta edicin. Caracas: Ediciones FONCIED Brown, T.; LeMay, H. y Bursten, B. (2001). Qumica. La ciencia central (7ma ed.). [Libro en lnea] http://cwx.prenhall.com/bookbind/pubbooks/blb_la/ Consejo Argentino para la Informacin y el Desarrollo de la Biotecnologa (ArgenBio). El Cuaderno El boletn didctico del Programa Educativo. Por qu biotecnologa. (Recurso en lnea) http://www. porquebiotecnologia.com.ar/index.php?action=cuaderno&opt=5 Franco, A. (2010) Curso Interactivo de Fsica por Internet. (Recurso en lnea) http://www.sc.ehu.es/sbweb/ fisica/default.htm Fundacin CIENTEC. (2008) Biologa. Disponible en: http://www.cientec.or.cr/ciencias/experimentos/ biologia.html Hernndez, F. (2000). Los proyectos de trabajo: la necesidad de nuevas competencias para nuevas formas de racionalidad. Educar. 26: 39-51. Disponible: ddd.uab.cat/pub/educar/0211819Xn26p39.pdf Herrera, E. y Snchez, I. (2009). Unidad didctica para abordar el concepto de clula desde la resolucin de problema por investigacin. Paradigma, vol. 30, no.1, p. 63-85. Lacueva, A. (2008). Proyectos estudiantiles en la escuela y el liceo. Caracas: Laboratorio Educativo. National Human Genome Research. Institute del Mapa a Usted http://www.genome.gov/12511467 Ramos, M., Muoz, P. y Muoz, M. (2010). Gua metodolgica de biologa. Mxico: Benemrita Universidad Autnoma de Puebla. Mxico. Disponible en: http://www.portal.buap.mx/portal_pprd/work/sites/ forobachillerato/resources/LocalContent/25/2/GUIA%20DE%20BIOLOGIA.pdf Vera Ramrez, N. y Bojorquez, G. (comp.) (2011). Manual de prcticas de gentica. Ciudad Jurez: Universidad Autnoma de Ciudad Jurez. Mxico. (Documento en lnea) http://www.uacj.mx/ICB/ cqb/licenciaturaenbiolog%C3%ADa/Documents/Manuales/avanzado/GENETICA.pdf Victoria, V. (sf ) El blog de profesor jano. (Recursos de ciencias en lnea). http://profesorjano.org/fisiologiay-anatomia/genetica-molecular/ Visionlearning (2012) (Documentos en lnea) http://www.visionlearning.com/library/cat_view. php?cid=49&l=s Videos en lnea sugerida [Pgina web en lnea]: Clasificacin de la materia y mtodos de separacin de mezclas http://www.youtube.com/ watch?v=ndA5gKlpWbc Tcnicas bsicas de laboratorio: destilacin. 2012 http://www.youtube.com/watch?v=cocwhLBtJGg Tcnicas bsicas de laboratorio: extraccin. 2012 http://www.youtube.com/watch?v=ixSj9Tx3Fvo Tcnicas bsicas de laboratorio: filtracin. 2012 http://www.youtube.com/watch?v=CYezaEehK-E Tcnicas bsicas de laboratorio: centrifugacin. 2012 http://www.youtube.com/watch?v=LWZMmCg C5rQ&feature=relmfu Introduccin a la qumica: tipos de reacciones. (Introducing Chemistry: types of chemical change) [Pgina web en lnea] http://www.youtube.com/watch?v=VZ8SWIRs2Bg Tcnicas bsicas de laboratorio: reacciones qumicas. 2012 http://www.youtube.com/watch?v=P4Gd Cd0OyYY&feature=relmfu La importancia de los enlaces qumicos. http://www.youtube.com/watch?v=wDnTVxN4vy0 255

Este libro fue impreso en los talleres de Grficas XXXXX El tiraje consta de 450.000 ejemplares En el mes de agosto de 2012 Repblica Bolivariana de Venezuela

256