You are on page 1of 12

UNIVERSIDAD POLITECNICA SALESIANA

Carrera: Ingeniera en Biotecnologa de los Recursos Naturales

CATEDREDA: BIOQUIMICA
Prof: Marcelo Carrillo

Capitulo v cidos nucleicos


1.- INTRODUCCION
Qumicamente, los cidos nucleicos son polmeros constituidos por la unin mediante enlaces qumicos de unidades menores llamadas nucletidos. Los cidos nucleicos son compuestos de elevado peso molecular, esto es, son macromolculas. FUNCIONES GENERALES Los cidos nucleicos, llamados as porque en un principio fueron localizados en el ncleo celular, su funcin son las molculas de la herencia y por lo tanto van a participar en los mecanismos mediante los cuales la informacin gentica se almacena, replica y transcribe. Sin embargo esta no va a ser su nica funcin, determinados derivados de estas sustancias: los nucletidos, van a tener otras funciones biolgicas, entre las que pueden destacarse, como ejemplo, la de servir de intermediarios en las transferencias de energa en las clulas (ATP, ADP y otros) o en las transferencias de electrones (NAD+, NADP +, FAD, etc.).

2.- LOS NUCLETIDOS


Los nucletidos estn formados por: una base nitrogenada (BN), un azcar (A) y cido fosfrico (P); unidos en el siguiente orden:

P - A - BN cido Fosfrico Azcar Base Nitrogenada


1
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

BASES NITROGENADAS
Son sustancias derivadas de dos compuestos qumicos: la purina y la pirimidina.

De la purina derivan las bases pricas. En los nucletidos vamos a encontrar, normalmente, dos base pricas: la adenina (A) y la guanina (G).

De la pirimidina derivan las bases pirimidnicas. Tres son las bases pirimidnicas presentes en los cidos nucleicos: la citosina (C), la timina (T) y el uracilo (U).

2
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los cidos nucleicos otras bases diferentes de estas cinco, por lo general derivados de ellas

EL AZCAR (GLCIDO)
El azcar que interviene en los nucletidos puede ser o la ribosa (R) o la desoxirribosa (dR). Ambas son aldopentosas y las encontraremos en los nucletidos como -furanosas. Conviene destacar que la nica diferencia entre ambas est en que en el carbono 2 de la desoxirribosa hay un hidrgeno (-H) en lugar del grupo alcohol (-OH).

LOS NUCLESIDOS El azcar y la base nitrogenada se unen entre s como se indica en las figuras formando un nuclesido. El enlace se forma entre el carbono anomrico del azcar y uno de los nitrgenos de la base nitrogenada, en concreto, el indicado en las figuras. En la unin se forma una molcula de agua. Este enlace recibe el nombre de enlace N-glicosdico.

3
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

ESTRUCTURA DE LOS NUCLETIDOS Los nucletidos son los monmeros que constituyen los cidos nucleicos. Se forman cuando se unen el cido fosfrico y un nuclesido. Es una unin fosfoster entre un OH del cido fosfrico y el OH situado en el carbono 5 del azcar, con formacin de una molcula de agua. Segn el azcar sea la ribosa o la desoxirribosa, tendremos ribonucletidos o desoxirribonucletidos. La timina nunca forma parte de los ribonucletidos y el uracilo no forma parte de los desoxirribonucletidos.

4
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

NUCLETIDOS O DERIVADOS DE NUCLETIDOS DE INTERS BIOLGICO. Algunos nucletidos cumplen funciones por s mismos. As, por ejemplo: Nucletidos que intervienen en las transferencias de energa: Se trata de molculas que captan o desprenden energa al transformarse unas en otras. As, el ATP desprende energa cuando se hidroliza, transformndose en ADP y fosfato inorgnico (Pi). Por el contrario, el ADP almacena energa cuando reacciona con el fosfato inorgnico y se transforma en ATP y agua. De esta forma se transporta energa (unas 7 kilocaloras por mol de ADP/ATP) de aquellas reacciones en las que se desprende a aquellas en las que se necesita.
Ejemplos de nucletidos transportadores de energa: - AMP (adenosina-5'-monofosfato) A-R-P - ADP (adenosina-5'-difosfato) A-R-P-P - ATP (adenosina-5'-trifosfato) A-R-P-P-P - GDP (guanosidina-5'-difosfato) G-R-P-P - GTP (guanosidina-5'-trifosfato) G-R-P-P-P

b) Nucletidos que intervienen en los procesos de xido-reduccin. Estas molculas captan electrones de molculas a las que oxidan y los ceden a otras molculas a las que a su vez reducen. As, el NAD+ puede captar 2etransformndose en su forma reducida, el NADH, y ste puede ceder dos
5
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

electrones a otras sustancias, reducindolas y volviendo a transformarse en su forma oxidada, el NAD+. As, se transportan electrones de aquellas reacciones en las que se desprende a aquellas en las que se necesitan. Ejemplos de nucletidos transportadores de electrones: -NAD+ /NADH respectivamente. (Nicotinamida-adenina-dinucletido) oxidado y reducido,

-FAD/FADH2 (Flavina-adenina-dinucletido), oxidado y reducido. c) Nucletidos reguladores de procesos metablicos. Algunos nucletidos cumplen funciones especiales como reguladores de procesos metablicos, por ejemplo el AMPc (adenosina-3',5'-monofosfato) o AMP cclico, en el que dos OH del fosfato esterifican los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto qumico acta en las clulas como intermediario de muchas hormonas.
LOS POLINUCLETIDOS

Dos nucletidos van a poder unirse entre s mediante un enlace sterfosfato (fosfoster). Este enlace se forma entre un OH del cido fosfrico de un nucletido y el OH (hidroxilo) del carbono nmero 3 del azcar del otro nucletido con formacin de una molcula de agua. La unin de otros nucletidos dar lugar a un polinucletido. Es de destacar que en toda cadena de polinucletidos el nucletido de uno de los extremos tendr libre el OH del azcar en posicin 3, ste ser el extremo 3' de la cadena. El cido fosfrico del nucletido que se encuentre en el extremo opuesto tambin estar libre, ste ser el extremo 5'. Esto marca un sentido en la cadena de polinucletidos. Toda cadena podr considerarse bien en sentido 3' habr que indicarlo. 5' o en sentido 5' 3' y as

6
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

7
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

ADN Y ARN: DIFERENCIAS A NIVEL QUMICO El ADN (cido desoxirribonucleico) sus nucletidos tienen desoxirribosa como azcar y no tiene uracilo. - El ARN (cido ribonucleico) tiene ribosa como azcar y no tiene timina.

EL ADN (DNA) Caractersticas: Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. As, por ejemplo: el genoma humano est formado por 3x109 pares de nucletidos. Esto hace que sean molculas de una gran longitud; (2,36 m si sumamos todo el ADN de todos los cromosomas de una clula humana.) El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empez a conocer su estructura. Se encuentra en el ncleo de las clulas eucariotas asociado a protenas formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la informacin gentica. Tambin hay ADN en ciertos orgnulos celulares (por ejemplo: plastos y mitocondrias).

8
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

ESTRUCTURA DEL ADN Se pueden distinguir 3 niveles estructurales: -Estructura primaria: La secuencia de los nucletidos. -Estructura secundaria: La doble hlice. -Estructura terciaria: Collar de perlas, estructura cristalina, ADN sper enrollado. ESTRUCTURA PRIMARIA DEL ADN. Es la secuencia de nucletidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucletidos en la hebra o cadena de la molcula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotdica. As, por ejemplo:

5' ACGTTTAACGACAAGGACAAGTATTAA 3'


La posibilidad de combinar cuatro nucletidos diferentes (A, T, C, G) y la gran longitud que pueden tener las cadenas polinucleotdicas, hacen que pueda haber un elevado nmero de polinucletidos posibles, lo que determina que el ADN pueda contener el mensaje biolgico o informacin gentica y explica la diversidad del mensaje gentico de todos los seres vivos. ESTRUCTURA SECUNDARIA DEL ADN. WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN el modelo de doble hlice. Este modelo, adems de explicar cmo era el ADN, sugera los mecanismos que explicaban su funcin biolgica y la forma como se replicaba. El modelo de la doble hlice de WATSON y CRICK establece: 1) El ADN estara constituido por dos cadenas o hebras de polinucletidos enrolladas helicoidalmente en sentido dextrgiro sobre un mismo eje formando una doble hlice.

9
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

2) Ambas cadenas seran anti paralelas, una ira en sentido 3' inverso, 5' 3'.

5' y la otra en sentido

Los grupos fosfato estaran hacia el exterior y de este modo sus cargas negativas interaccionaran con los cationes presentes en el nucleoplasma dando ms estabilidad a la molcula.

4) Las bases nitrogenadas estaran hacia el interior de la hlice con sus planos paralelos entre s y las bases de cada una de las hlices estaran apareadas con las de la otra asocindose mediante puentes de hidrgeno.

10
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

5) El apareamiento se realizara nicamente entre la adenina y la timina, por una parte, y la guanina y la citosina, por la otra. Por lo tanto, la estructura primaria de una cadena estara determinada por la de la otra, ambas cadenas seran complementarias. La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia se replica- para ser trasferido a las clulas hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la sntesis de una nueva cadena complementaria. ESTRUCTURA TERCIARIA DEL ADN. Las grandes molculas de ADN de las clulas eucariotas estn muy empaquetadas ocupando as menos espacio en el ncleo celular y adems como mecanismo para preservar su transcripcin. Como hemos visto, en las clulas eucariotas el ADN se encuentra en el ncleo asociado a ciertas protenas: nucleoprotenas, formando la cromatina. En la cromatina, la doble hlice de ADN se enrolla alrededor de unas molculas proteicas globulares, las histonas, formando los nucleosomas.

Cada nucleosoma contiene 8 histonas y la doble hlice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no est ms empaquetado an, forma una estructura llamada collar de perlas.

11
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.

Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Segn el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.

En tanto que la fibra selenoide sigue enrollndose sobre si misma en sucesivos niveles hasta adoptar la forma de un cromosoma que corresponde al ltimo nivel de compactacin.

12
Ingeniera en Biotecnologa de los Recursos Naturales/Materia: Bioqumica

| U.P.S.