You are on page 1of 12

Metallomics

PAPER
View Article Online
View Journal

Cite this: DOI: 10.1039/c3mt20217h

The BaeSR regulon is involved in defense against zinc toxicity in E. coli
Da Wanga and Carol A. Fierke*ab
Intracellular zinc homeostasis is regulated by an extensive network of transporters, ligands and transcription factors. The zinc detoxification functions of three transporters and a periplasmic protein regulated by the BaeSR two-component system were explored in this work by evaluating the effect of single gene knockouts in the BaeSR regulon on the cell growth rate, free zinc, total zinc and total copper after zinc shock. Two exporters, MdtABC and MdtD, and the periplasmic protein, Spy, are involved in zinc detoxification based on the growth defects at high cell density and increases in free (>1000-fold) and total zinc/copper (>2-fold) that were observed in the single knockout strains upon exposure to zinc. These proteins complement the ATP-driven zinc export mediated by ZntA in E. coli to limit zinc toxicity. These results highlight the functions of the BaeSR regulon in metal homeostasis.

Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs.rsc.org | doi:10.1039/C3MT20217H

Received 1st November 2012, Accepted 31st January 2013 DOI: 10.1039/c3mt20217h www.rsc.org/metallomics

1 Introduction
Zinc plays important catalytic, structural and regulatory roles in the cell. Hundreds of metalloproteins bind zinc as catalytic cofactors and/or structural elements.1,2 While zinc is an essential nutrient, excess zinc is toxic to the cell, possibly through inhibition of key enzymes and competition with other relevant metal ions.1,3 For these reasons, intracellular zinc is normally maintained at low ‘‘free’’ or readily exchangeable concentrations (pM levels)4,5 and regulated by an extensive network of transporters, ligands and transcription factors.6 In E. coli, zinc detoxification is primarily achieved by exporters. ZntA, a P-type ATPase, and ZitB, a cation diffusion facilitator, are two wellstudied zinc transporters.7 Previous studies have shown that ZntA is up-regulated under high zinc stress to effectively lower the intracellular zinc concentration, while ZitB is constitutively expressed to function as a first-line defense against zinc influx.7–9 Other transporters are also proposed to be involved in zinc detoxification, as the zntA knockout cells retain the ability to decrease the free and total zinc concentration, although more slowly.5 Potential additional zinc transporters that could function in zinc detoxification include the ZitB homolog Yiip and several amphiphilic transporters.10 Transcriptional analysis of cells after zinc shock demonstrated up-regulation of a number of

a

Department of Chemistry, The University of Michigan, 930 N University Ave, Ann Arbor, MI 48109, USA b Department of Biological Chemistry, The University of Michigan, Ann Arbor, MI 48109, USA. E-mail: fierke@umich.edu; Fax: +1 734 647 4865; Tel: +1 734 936 2678

transporter genes other than zntA, including acrD, mdtA, mdtC, mdtD, yfiK, and amtB, etc.11 Among these transporters, acrD, mdtA, mdtC and mdtD are all controlled by the BaeSR (bacterial adaptive response) two-component system,12 which suggests that the BaeSR regulon may play a role in zinc regulation. The BaeSR two-component signal transduction system is one of three extra-cytoplasmic stress response (ESR) systems in E. coli that control the adaptive responses to changes in the environment.13 BaeS is a membrane-bound histidine kinase that senses environmental changes and transduces the information to the cell by catalyzing phosphorylation of the transcription factor BaeR.12 BaeR activates the expression of eight genes, which encode three transporters, one periplasmic protein and both BaeS and BaeR12,14 (Fig. 1). These genes are involved in the envelope stress response, drug resistance, and metal resistance of E. coli and Salmonella. The BaeSR regulon responds to a wide range of environmental stresses, including spheroplasting, and exposure to indole, tannin, flavonoid, sodium tungstate, and high levels of zinc or copper.11,12 Previous studies have analyzed the role of the BaeSR regulon in conferring drug resistance, while the function of these proteins in zinc detoxification and homeostasis is still emerging.15 The transporters and the periplasmic protein on the BaeSR regulon are up-regulated upon exposure of cells to high concentrations of zinc,11 and Salmonella strains lacking genes on this regulon exhibit significant growth defects under high zinc conditions.15 Here we analyze the effects of single gene knockouts in this gene cluster on the cellular response to zinc toxicity. BaeS is an inner-membrane-bound histidine kinase containing a periplasmic sensing domain.16 BaeR is a cytoplasmic

This journal is

c

The Royal Society of Chemistry 2013

Metallomics

18.18 MdtB is not necessary for drug resistance as trans-expression of mdtA and mdtC are sufficient to induce this phenotype in E.15 Over-expression of MdtABC confers resistance to drugs such as novobiocin (16-fold) and deoxycholate (32-fold). leading to initiation of transcription of the entire regulon.24 Additionally.23 Exposure to zinc caused a 4. mdtD.to 6-fold increase in acrD transcription.22 that is a homologue to the well-known multidrug resistance transporter. or T). 5 0 -TTTTTCTCCATDATTGGC-3 0 (where D is G. 1 Schematic illustration of the BaeSR regulon.11.14 The mdtABC and acrD genes encode components of two RND (Resistance-NodulationCell Division)-type transporters. MdtABC requires TolC as an outer membrane factor to function.17 Under these conditions it is possible that the MdtB– MdtC heterotrimer may be replaced by an MdtC homotrimer in the transmembrane channel as MdtB shares B50% amino acid sequence similarity with MdtC.28 Recent findings suggest that Spy functions as a periplasmic molecular chaperone to suppress protein aggregation and enhance protein folding under envelope stress conditions. The regulators BaeS and BaeR are also up-regulated. MdtD belongs to the major facilitator family for metal transport.View Article Online Paper Metallomics Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. in the promoter regions of the mdtABCDbaeSR operon. the biological functions of the individual proteins are not clear. exposure of cells to high zinc resulted in an B2-fold increase in mdtD transcription. coli.29 Therefore. Spy is a periplasmic protein that exhibits ATP-independent chaperone activities in vitro. AcrB.to 50-fold upon exposure of cells to zinc. The membrane-bound BaeS senses environmental signals and transduces them to the transcription activator BaeR. mdtD encodes a putative transporter that belongs to the major facilitator superfamily (MFS). A. AcrD forms a trans-inner-membrane homotrimer which complexes with the membrane fusion protein AcrA and outer membrane channel TolC as an RND-type efflux pump.1039/C3MT20217H Fig. Similar to all RND-type transporters in E. Copper and zinc exposure lead to over-expression of Spy through regulation by CpxAR and BaeSR. Genetic studies revealed a consensus BaeR binding sequence. BaeS and BaeR.19 MFS transporters are single-polypeptide carriers capable of transporting small solutes in response to chemiosmotic gradients. and spy encodes a small periplasmic protein.11.19 acrD encodes an aminoglycoside efflux pump21. transcription factor that can be phosphorylated by BaeS. AcrD forms another RNDtype efflux system in complex with AcrA and TolC.17 MdtB and MdtC form a heterotrimeric proton– substrate antiporter across the inner membrane.20 They typically have 12–14 transmembrane domains. MdtB and MdtC form a RND-type trans-envelope efflux multiplex with the outer membrane pore protein TolC in E.15 The fourth gene on the MdtABCD-BaeSR operon.to 3-fold increase in the transcription levels of mdtA and mdtC via regulation of BaeSR. respectively. MdtA. is a small periplasmic protein that was first demonstrated to be up-regulated during spheroplasting. another gene product modulated by the BaeSR system. coli to 0. which up-regulates the expression of eight genes on this regulon including baeR and baeS. The BaeSR regulon encodes three transporters and one periplasmic protein.11 The transport mechanism and biological function of MdtD is unknown. Similar to mdtA/B/C.25 The transcription of Spy is upregulated 20. is also up-regulated.27. which is connected to the outer membrane protein TolC through the membrane fusion protein MdtA. Although the BaeSR regulon is up-regulated upon high zinc exposure. activated by BaeSR. The roles of the BaeSR-regulated transporters in protecting cells against high zinc stress were first studied in Salmonella enterica. coli. MdtABC forms a RND-type trans-envelope efflux complex with TolC. acrD gene and spy gene.15 The mutant strains DacrDDmdtABC and DbaeSR are much more sensitive to zinc and copper stress than Metallomics This journal is c The Royal Society of Chemistry 2013 . Spy may protect against zinc-induced protein denaturation and aggregation in the periplasm.2–1 mM zinc resulted in a 2. and there is no evidence that MdtD is involved in multidrug resistance. encodes a putative transporter that belongs to the major facilitator superfamily (MFS) based on sequence analysis.rsc. which increases the affinity of BaeR for DNA.org | doi:10. Although Spy has not been shown to bind zinc with high affinity. Like AcrB.26 homologues of Spy have been identified with bound metals. Activation of the BaeSR regulon results in a positive feedback loop as the expression of the two-component system. coli (except the copper transporter CusABC). forming a positive feedback loop to amplify the transcriptional response. denatured proteins and metal stress induce expression of Spy.15 Spy.17 Exposure of E.

exposure time 200 ms). and incubated at 37 1C overnight. we investigated the function of each component of the BaeSR regulon in the regulation of zinc homeostasis in E. maintaining low cellular zinc concentrations upon exposure to high extracellular zinc. The culture was then diluted 1 : 20 into fresh MOPS medium without antibiotics and incubated at 30 1C allowing the cells to recover and grow to the log-phase. OD600. The number of cells per OD600 (B1. The pellets were washed twice with 500 ml ice-cold MOPS medium without additional zinc and once with 1 ml ice-cold ddH2O. similar to the function of the RND-type copper transporter. coli cell of 2 mm length and 0. D(araD-araB)567. and diluted into 1 ml of RNeasy This journal is c The Royal Society of Chemistry 2013 Metallomics .3 at 30 1C then induced by addition of 1 mM isopropyl b-D-1-thiogalactopyranoside (IPTG). 10. 1 min) at various time points after addition of Zn. The induced cultures were incubated at 30 1C overnight allowing expression and maturation of the sensor. In situ calibrations of the sensors were carried out by incubating the cells with NTA-chelated zinc buffers plus digitonin and DPS. Each culture sample was repeated in 5 separate wells. Then excess DPS was removed and 100 ml MOPS medium was added.5  10À18 m3 was derived from the average dimensions of an E. At OD600 B 0. An aliquot (1 ml) of the cell culture was centrifuged (15 000  g.initial  2(t/TG) 2. The average IFRET/IFP ratio was compared to the in situ calibration curve of the sensor to calculate the intracellular free zinc concentration. Images were acquired at room temperature on a Nikon TE2000U inverted fluorescence microscope from two channels: FRET channel (Ex 350 nm/Em 620 nm. coli strains from the Keio Knockout Collection were obtained from the E.30 To test this. coli K-12. as measured by OD600. DmdtC (JW2061-3).31 The parent strain of this single knock-out collection. rph-1. while no changes in drug resistance were observed. BW25113 {F-. cooled for B20 min to room temperature (B25 1C).View Article Online Metallomics the wild type strain.3 before a final concentration of 50 mM ZnSO4 was added to the flask.5  10À18 m3) by the total number of cells. The CA_TagRFP genes were sequenced at the University of Michigan Sequencing Core facility. The total cell volume was derived by multiplying the estimated average cell volume for E. Before imaging. DacrD (JW2454-1). hsdR514} was derived from E. A 0. 2. coli Genetic Stock Center of Yale University. 11 ml of various 10 ZnSO4 stock solutions were added to the imaging medium to make the final total zinc concentrations (0. coli (0.5 mm diameter33 (all of the strains have similar cell dimensions as observed by light microscopy).1 E. DmdtD (JW2062-1).5 These data provide clear evidence that multiple components of the BaeSR regulon are involved in the regulation of intracellular zinc homeostasis. coli cells were cultured in MOPS minimal medium supplemented with thiamine (1 mg mlÀ1) and uracil (20 mg mlÀ1) at 25 1C.4 mRNA preparation and quantification Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. and the total zinc concentration per cell was The intracellular free zinc concentration was measured using carbonic anhydrase-based zinc sensors as described previously with slight modifications. and a maximum of 2 images was taken from each well to limit photobleaching.5 The sensor expression vectors pTH_CA_TagRFP and pTH_H94N_CA_TagRFP were constructed by inserting the DNA sequence of wild type CA_TagRFP or H94N CA_TagRFP fusion genes between the restriction sites NcoI and KpnI after the trc-lac promoter on the vector pTrcHisa (Invitrogen). The volume per cell of 0.1039/C3MT20217H E.3 in MOPS medium without antibiotics at 37 1C. the free zinc concentration increases dramatically after zinc shock. 50.5 ml sample of the cell culture was collected at various times. in copper resistance. Furthermore. and is considered ‘‘wild type’’ in this work. The total metal content in these samples was measured using inductively coupled plasma mass spectrometry (ICP-MS). & lambdaÀ. The mutant strains in this collection (DmdtA (JW5338-1). exposure time 500 ms) and FP channel (Ex 530 nm/Em 620 nm.5 2. CusABC. and 100 mM) were added. We demonstrate that individual deletions of mdtC. DbaeR (JW2064-3). coli. coli cells transformed with the plasmid pTH_H94N_CA_ TagRFP (see Section 2. D(rhaD-rhaB)568. 10. DbaeS (JW2063-1).rsc.3. mdtD and spy in E. The pellets were then dissolved in 200 ml of 35% ultra pure nitric acid.t = OD600.8 and grown at 25 1C to OD600 B 0. 50.31 E. and 100 mM) for the zinc shock experiments.2 Measurement of intracellular total zinc (1) E. coli strains and growth conditions E. coli cells with the plasmid pTH_H94N_CA_TagRFP were grown to OD600 B 0. as described previously.3 Measurement of intracellular free zinc 2 Methods and materials 2. Paper calculated by dividing the total metal content by the total cell volume. samples (2 ml) of the culture were placed on a poly-L-lysine-coated 96-well glass bottom plate (Matrical) and incubated with 100 ml 2 mM dapoxyl sulfonamide (DPS)34 in MOPS medium for 20 min at room temperature.32 The doubling time (TG) for growth of these cells was determined by a fit of eqn (1) to the growth curves (OD600 versus time). E. These results suggest that the BaeSR regulon may play an important physiological role in metal homeostasis. coli both decrease the growth rate at high cell density in the presence of high zinc and lead to a significant increase in the total zinc concentration after zinc shock. and Dspy (JW1732-1)) were constructed from BW25113 by replacing the target gene with a kanamycin insert. DmdtB (JW2060-1).3 for plasmid construction) that encodes a carbonic anhydrase-based zinc sensor were diluted 1 : 50 from an overnight culture grown in MOPS minimal media with 100 mg mlÀ1 ampicillin into MOPS medium without antibiotics. as measured by an expressed carbonic anhydrase-based excitation ratiometric fluorescence resonance transfer zinc sensor.3  109) was calibrated by plating the cells and counting the colonies. and then various concentrations of ZnSO4 (0.org | doi:10. coli cells chemically transformed with one of these expression vectors were grown in MOPS minimal medium with 100 mg mlÀ1 ampicillin to OD600 B 0. DlacZ4787(::rrnB-3).

coli in MOPS minimal medium is below the detection limit of this sensor (o1 nM). The PCR primers for the target genes and the housekeeping gene rrsD (16S ribosomal RNA of rrnD operon) were designed using the software Primer3. mRNA transcripts of the mtdC. DbaeS. acrD and spy genes were quantified by RT-PCR. 3). in the late growth phase addition of zinc leads to slower growth rates compared to WT (TG = 142 Æ 19 min) for the following single knockout strains (Fig. The wild type and knockout BW25113 E. coli in the presence or absence of high zinc. These primers clone a B200 bp DNA sequence within each gene (listed in Table 1). after zinc shock a transient increase in the intracellular zinc concentration is observed where the maximal free zinc concentration varies with the extracellular zinc concentration.8 the readily exchangeable zinc concentration in wild type E.2 Free zinc changes after zinc shock in Bae regulon deletion strains To examine whether the BaeSR regulon components play a role in regulating intracellular zinc concentration.1 into MOPS minimal medium without additional zinc or with 300 mM ZnSO4. The mixture was vortexed for 5 s. baeR. The total mRNA concentration was measured using the NanoDrop spectrophotometer (Thermo Scientific) and an extinction coefficient of 27 (ng mlÀ1)À1 cmÀ1. DacrD.org | doi:10. coli strains (DbaeR. no significant difference in the growth rate was observed between WT and any of the single knockout strains in either the early or late growth phase (Fig. On-column DNase I treatment was conducted to eliminate the residual DNA during the extraction. and then gradually subsided to a level below the detection limit 3 Results 3. DbaeS (TG = 243 Æ 35 min). 2(b)): DbaeR (TG = 205 Æ 34 min). 2(b)). DmdtC. the doubling time at low cell density (OD600 o 0. coli strains exhibit biphasic growth in MOPS minimal media (as shown in Fig.View Article Online Paper Table 1 0 Metallomics Primers for quantification of gene transcripts by RT-PCR Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. The single knockouts DmdtB and DacrD do not exhibit significant growth defects relative to the wild type strain even upon addition of 300 mM zinc.8 Consistent with previous observations. Under these conditions.1039/C3MT20217H rrsD-5 : CTCAAAGGAGACTGCCAGTGATAA rrsD-3 0 : ACGATTACTAGCGATTCCGACTTC mdtA-5 0 : TTAATAATCAGGATGATGCGCTGT mdtA-3 0 : CACCACTTTCTGACTGTCCTGAAT mdtB-5 0 : CGGTTATGGTGTTTCTCGATTTTT mdtB-3 0 : AGGTCAGCGAGATAATGGTAAAGC mdtC-5 0 : TCCAGACCAATGATGAGCTAAAAA mdtC-3 0 : TGTCAACCGTCTGGATAATATTGG mdtD-5 0 : AGATTGACGGTGATGAAAATCGTA mdtD-3 0 : GTAGTTCGGCATTAACAGCAATGT baeR-5 0 : GAGTTACCAATCGACGAAAACACA baeR-3 0 : CAGGGAGCATCAGATCTAACAGG acrD-5 0 : ACTTCACCCATGAAAAAGACAACA acrD-3 0 : CGATAACGCGAGCTTCTTTAATTT spy-5 0 : AGGACATGATGTTCAAAGACCTGA spy-3 0 : ATGTTAGCTTTGCGCTGTTCTTC Bacteria Protect (Qiagen) solution. Addition of 300 mM zinc to the medium decreases the growth of both the wild type and the deletion strains in the early growth phase by B2-fold. DmdtB may not exhibit a growth phenotype due to this functional complementation by MdtC.rsc. These results indicate that the proteins encoded by the Bae regulon enhance cell viability under zinc stress exacerbated by nutrition and energy constraints.1 Growth rates of Bae regulon knockout strains To evaluate the role of the Bae regulon in zinc homeostasis we first examined whether single gene knockouts affect the growth rate of E. DbaeS. Total mRNA was extracted from the cell pellets using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. DmdtD. and Dspy) were diluted to OD600 B 0. This is not surprising given that the Bae regulon is primarily responsible for the cell’s adaptive response to environmental stress conditions and therefore may not be essential under normal growth conditions. DmdtC. The maximal concentration of intracellular zinc after the 50 mM zinc shock is dramatically increased (to >200 nM which is beyond the dynamic range of the sensor) in the single knockout strains DmdtA. but not in the DmdtB. we monitored the intracellular free zinc changes upon zinc shock in these single knockout strains using the expressible H94N CA_TagRFP sensor.8) is B50 min which increases to B130 min at higher cell density. This sensor quantifies intracellular free zinc concentrations in the range of 1–200 nM. The purified total RNA was then re-incubated with DNase I for 30 min using the DNA-free DNase treatment and removal reagents (Ambion). and centrifuged for 10 min at 5500 Â g.19 Therefore. The initial high zinc concentration dropped significantly within 20–40 min. respectively. DmdtA (TG = 253 Æ 26 min). 2(a)). Metallomics This journal is c The Royal Society of Chemistry 2013 . However. and Dspy. Furthermore. DmdtB. B50 ng of the synthesized first strand cDNA was used as template in the 20 ml RT-PCR reaction. and the average doubling time was calculated from the time-dependent increase in OD600 using eqn (1). The cell pellets were flash frozen in a dry ice–ethanol bath. DmdtA. Template cDNA was synthesized using the SuperScript III Reverse Transcriptase Kit (Invitrogen) with total mRNA as the template and random hexamers as the primers. Overnight cultures of the wild type (WT) and single gene knockout E. One explanation for these results is that these proteins may alleviate zinc stress by complementing other energydependent zinc detoxification mechanisms that are less functional at this growth stage. The lack of a growth defect observed with the strain DacrD suggests that AcrD does not play a significant role in protection against metal stress. Previous experiments have demonstrated that MdtB can be replaced by an MdtC in the transmembrane heterotrimer. The RT-PCR experiments were set up in triplicate and conducted using the SYBR Green qPCR SuperMix (Invitrogen) on a Mastercyclers ep realplex real time PCR machine (Eppendorf). to wild type E. and DbaeR strains. DmdtD. 3. DmdtC (TG = 264 Æ 33 min). and then stored at À80 1C. coli (Fig. incubated at room temperature for 5 min. DmdtD (TG = 263 Æ 43 min) and Dspy (TG = 209 Æ 17 min). peaking at B10 nM and B50 nM intracellular zinc for addition of 10 mM and 50 mM zinc.

The magnitude of the increase in free zinc depends on the concentration of the external zinc concentration.org | doi:10. (a) Representative growth curves with the wild type and DmdtC strains. The temporal patterns for intracellular free zinc changes for the DmdtA. DbaeS. although the elevated free zinc does not always translate into growth defects as in the case of AcrD. MdtD and AcrD) and the periplasmic protein (Spy) are involved in limiting the intracellular free zinc concentration to various extents under zinc stress. coli strains were diluted into MOPS minimal medium without added zinc (left panel) or with 300 mM zinc (right panel). consistent with the growth effects of the single MdtA and MdtC knockouts in the previous section. DmdtD and Dspy strains exhibit slower growth rates (TG > 200 min) than WT (TG B 140 min) in the late stage. Although deletion of acrD does not affect cell growth in high zinc. (b) Doubling time of E. Cultures of E. implicating MdtD as playing a role in zinc transport. possibly by exporting zinc from the periplasm and/or the cytosol. although differential effects of zinc stress on the growth rates were not observed for these strains. the increase in free zinc in the DmdtD strain indicates that MdtD is involved in zinc detoxification upon zinc shock. However. the increase in the free zinc concentration is higher in the DmdtA strain compared to the DmdtC. OD600 was monitored over time and eqn (1) was fit to these data to calculate early and late stage average doubling time. and Dspy strains after zinc shock are comparable to the changes previously measured for deletion of ZitB. The transporter MdtABC plays a role in alleviating the free zinc spike in the cell after zinc shock. Under exposure to 300 mM zinc. At the 10 mM zinc shock. Similarly. These data are consistent with the growth defects of the mdtD knockout. These data clearly indicate that all three transporters (MdtABC. as the free zinc peak is lower at 10 mM ZnSO4 (15–70 nM) for all of the strains except Dspy where the duration of the elevated zinc concentration is decreased. The free zinc concentrations in the DmdtB strain after zinc shock are comparable to those observed for the wild type strain. DmdtC.View Article Online Metallomics Paper Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. the free zinc concentration in this strain increases significantly after zinc shock indicating that AcrD contributes to lowering free zinc content under these conditions. DmdtC. the DbaeR.rsc. consistent with the previous observations that the function of MdtB can be compensated by MdtC17 and no growth defects were observed in DmdtB.8 a cation diffusion facilitator important for zinc detoxification. coli cells with 300 mM zinc (bottom chart) and without (top chart) zinc. the transient intracellular zinc spike has the shortest duration for the AcrD knockout strain (o20 min) perhaps contributing This journal is c The Royal Society of Chemistry 2013 Metallomics . 2 Growth curves and doubling time of BaeSR regulon single gene knockout strains. These results indicate that MdtABC participates in zinc detoxification by lowering the initial intracellular free zinc concentration when the cells encounter zinc stress. within 1 h.1039/C3MT20217H Fig. DmdtA.

coli cells transformed with the plasmid pTH_H94N_CA_TagRFP were grown in MOPS minimal medium to the log phase (OD600 B 0. Two possible explanations for the free zinc changes in the Metallomics This journal is c The Royal Society of Chemistry 2013 . Interestingly. The effects on free zinc are consistent with the growth defects seen at high zinc.View Article Online Paper Metallomics Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. E. 3 Intracellular free zinc changes after zinc shock.rsc.3–0. Spy plays a remarkable role in regulating the intracellular free zinc concentration. even though there is no evidence that this protein is directly involved in zinc transport.1039/C3MT20217H Fig.3. The intracellular free zinc concentration is the highest (>200 nM) in the Dspy knockout strain. even at 10 mM ZnSO4 (Fig.org | doi:10. incubated with dapoxyl sulfonamide and imaged using a fluorescence microscope as described in Methods and materials 2.4). to the lack of an effect of deletion of AcrD on the growth rate. 3(g)) and the zinc remains elevated for a longer time than any of the other knockout strains tested here. These data suggest that AcrD may play a minor role in the cellular response to zinc toxicity. 10 mM (open circles) or 50 mM ZnSO4 (solid circles) was added to the imaging medium and intracellular free zinc concentrations were measured over time from the IFRET/IFP ratio compared to the in situ calibration curve of the H94N CA_TagRFP sensor (in situ apparent KD for zinc B9 nM).

15 However. coli cells grown at the log phase were exposed to 50 mM ZnSO4. 4). 4 Total zinc changes after zinc shock. highlighting its importance in metal homeostasis. it is interesting that exposure to external zinc can cause a significant increase in the intracellular copper homeostasis in these single knock-out mutants. that compensate for the impairment of the Bae regulon function. including DmdtC and Dspy. 3(h)) compared to the wild type strain. a modest increase in total copper (B50%) is observed after zinc shock. such as increased expression of zntA or zitB. In contrast. and total cellular metal concentrations were measured by ICP-MS. Previous studies have demonstrated that the Bae regulon can be up-regulated by addition of Cu(II) as well as zinc. in the DmdtC cells the intracellular total copper content increases by 2. and that the DmdtABCDacrD and DbaeSDbaeR mutants grow much more poorly than wild type in the presence of high copper in the medium. resulting in higher initial zinc.org | doi:10. which then decreases to the initial level at 90 min. Although the expression of mdtABC. DmdtC and Dspy showed increases in both total zinc and copper compared to the wild type strain after zinc shock (Fig. acrD.to 3-fold and Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. In the DmdtC strain. Total zinc (c) and copper (d) also increased dramatically (>10-fold) in the Dspy strain compared to WT. and spy are upregulated under zinc stress11 (see Fig. the total zinc concentration increased by 2-fold at B20 min which then subsided to a level similar to that of wild type at 30 min (Fig. as described in Section 2.1039/C3MT20217H Fig. The increased intracellular total copper levels may contribute to the growth defects observed under zinc stress conditions. E. reducing the initial zinc influx catalyzed by zinc transporters in the plasma membrane. No significant alterations in total iron. even though the growth rates of the DbaeS and DbaeR strains are slower in high zinc medium. calcium and magnesium contents were observed in these strains (data not shown). 4(a)).8 In the WT cells. and (ii) Spy may bind to and thereby decrease the free zinc concentration in the periplasm. environmental zinc shock. the baeS and baeR knockouts have a minimal effect on the intracellular free zinc concentration after zinc shock (o10 nM) (Fig.View Article Online Metallomics Dspy strain are: (i) Spy may function as a molecular chaperone to enhance the activity of some of the zinc exporters so in the absence of Spy the constitutive metal transport system is less effective. perhaps due to competition between zinc and copper for binding to metal transporters and buffering proteins.rsc. 3. This result suggests that the basal level of expression of the various components of the BaeSR regulon is sufficient to serve as the first line of defense against the transient. This journal is c The Royal Society of Chemistry 2013 Metallomics . deletion of baeS and baeR may result in overexpression of other protective mechanisms against metal stress. Both total zinc (a) and copper (b) levels are much higher in the DmdtC strain than that of WT. 5). Alternatively.2. This increase in total zinc is much smaller than the increase in free zinc (o1 nM to >200 nM) reflecting the larger zinc buffering capacity of the cell.3 Total metal changes after zinc shock in Bae regulon deletion strains We then measured the total metal changes upon zinc shock at 50 mM ZnSO4 using ICP-MS in the wild type and knockout strains that exhibited both late stage growth defects and Paper substantial intracellular free zinc increases upon zinc shock. mdtD.

and 7-fold. As suggested previously. Two genes on the mdtABCD-baeSR operon. 4(b)). However.15 where the increase in transcription was shown to be primarily through regulation of BaeR.11. 3. 5 Transcriptional response of the BaeSR regulon upon exposure to zinc.1039/C3MT20217H Fig.11 implying that the cells need to export copper under high zinc stress. The mRNA of spy (c) and acrD (d) exhibited biphasic increases up to 48-fold and 17-fold at 30 min. Therefore.15 Here we monitored the time course of the transcription of mdtC. mdtC and baeR. The maximal intracellular zinc peak occurs at B20 min and then decreases while the mRNA levels increase after 30 min. 3 and 5). and baeR genes on the regulon to gain further insight into their functions. was previously reported to be significantly up-regulated upon exposure to zinc.4 Transcriptional response to zinc shock of Bae regulon deletion strains The Bae regulon had previously been shown to be up-regulated upon exposure to high zinc stress. and interestingly exhibit two distinct peaks. the time course of the changes in the mRNA levels does not correspond to that of free zinc changes. The transcript levels peak at B10 min after zinc shock. It is worth noting that the copper efflux system.rsc.15 The transcription levels of spy and acrD increase more significantly (up to 50-fold and 17-fold at 30 min). In the Dspy knockout strain. and then decline afterwards at 15 min. coinciding nicely with the increases in intracellular free zinc levels (Fig. and the transcript levels of each gene were measured by RT-PCR at various time points after zinc exposure. but not other metals such as Ca and Mg (data not shown).View Article Online Paper remains B2-fold higher than the baseline level even after 90 min (Fig. acrD. CusABC. dramatic increases in both total zinc (B10-fold) and copper (B12-fold) were observed at B20 min (Fig.org | doi:10. respectively) Metallomics 30 min after exposure to high zinc. The elevated copper levels in the MdtABC knockout suggest that this protein may export both zinc and copper. unlike the transcription of zntA that plateaus or decreases as the free zinc level subsides8 a second phase of increasing transcript level is seen with spy and acrD. increasing to the highest level at 30 min. Wild type E. respectively. respectively. coli cells were exposed to 10 mM and 100 mM ZnSO4. The observed increases in transcription are consistent with previously published results11. it is possible that the BaeSR system directly senses and responds to changes in intracellular free zinc levels. Spy could function either (or both) as: (i) a molecular chaperone to protect the membrane and periplasmic proteins against zinc and copper stress to limit uptake or enhance export and/or (ii) a metal binding protein to decrease the concentration of zinc and copper in the periplasm and limit metal uptake. Metallomics This journal is c The Royal Society of Chemistry 2013 . spy. as the transcriptional response was abolished in a DbaeSR strain. The transcription level of mdtC (a) and baeR (b) increased to 7-fold and 2-fold at 30 min. are moderately up-regulated (2. Interestingly. 4(d)) with a similar temporal pattern. a RND-type transporter. Two possible explanations for this second phase of transcriptional increase are: (i) the BaeSR two-component system may sense tertiary stress signals that escalate overtime under prolonged exposure to high zinc concentrations to trigger the stress response transcription. These data indicate that the loss of Spy affects both copper and zinc homeostasis. and (ii) the second phase of transcriptional increase could result from the intrinsic positive feedback loop of the BaeSR system. in which BaeS/baeR are up-regulated Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs.

etc. including AcrB. neither deletion of mdtD nor over-expression affects cellular drug resistance. it is possible that MdtABC exports zinc in a ligand–complex form from the cytosol and/or the periplasm to lower the total zinc content.19 The DmdtC knockout produced a growth defect in the late phase (Fig. These results demonstrate that the RND-type transporter MdtABC plays an important role in the cellular response to metal stress. Since no known MFS family members transport divalent cations. 2) and a significant transient increase in cytosolic free zinc (Fig. as extrapolated from the observed drug resistance in cells over-expressing MdtABC. total zinc and total copper levels (Fig. transporting a wide range of molecules from inorganic phosphate to organic drug compounds.17. TolC. and MdtF (28%. together with the fact that BaeSR regulon is up-regulated under exposure to zinc. as MdtC cannot form a trans-envelope complex with TolC to efficiently extrude zinc ions to the outside.19 Growth defects and increases in cytosolic free zinc in DmdtA were similar to that of DmdtC (Fig. Past explorations of the function of MdtABC have focused on its role in multidrug resistance.View Article Online Metallomics to amplify the stress signal and activate additional transcription.17. DmdtA. which transports Cu(I) into the cell employing a stepwise shuttle mechanism via a series of methionine pairs. coli drug efflux and metal efflux RND-type transporters.21 These analyses indicate that MdtABC may employ a different transport mechanism than other types of RND transporters.19 MdtC is the trans-inner-membrane antiporter that drives efflux of a substrate into the periplasmic space through proton exchange. 2(b) and 3(c)). the sequence similarities among AcrB. This indicates that loss of mdtC leads to accumulation of zinc and copper in the cell which presumably accounts for the lower doubling time under higher energy constraints when it is more difficult for the cell to alleviate the metal stress by other mechanisms.18 In contrast. MdtC does not share high sequence identity with other known RND-type multidrug resistance transmembrane proteins (except for MdtB) in E. Whether MdtABC exports zinc in the form of free ions or in a ligand complex is unclear. These results indicate that MdtD is involved in zinc homeostasis under metal stress conditions.12. DmdtB. Overall. doxycycline and cholates.16 MFS members are functionally diverse. Additionally. and therefore plays an important role in cell survival under high zinc stress.1039/C3MT20217H This journal is c The Royal Society of Chemistry 2013 Metallomics . and dramatically increased the intracellular free zinc concentration after zinc shock (Fig. The mdtD knockout moderately decreased the growth rate in the presence of zinc at higher cell density (Fig. 3(e)). Additionally.17 Bioinformatic analysis indicates that the function of MdtABC may be different from both E. respectively). MdtD is an uncharacterized member of the major facilitator superfamily (MFS) of transporters. coinciding with the proposed function of each component based on previous studies. since the transcript level of baeR did not significantly increase until after 20 min (Fig. higher periplasmic zinc levels correlate with higher intracellular zinc levels due to enhancement of zinc influx via transporters and the cytosolic zinc could limit cell growth.20 Although proposed as a putative multidrug transporter. Although MdtABC is classified as a hydrophobic and amphiphilic efflux RND-type (HAE-RND) transporter. that is proposed to be involved in coping with osmotic pressure changes and regulation of cell volume.17.35 Interestingly. Here we explored the functions of these transporters and periplasmic protein in zinc homeostasis by analyzing the effects of single knockouts of the genes of the BaeSR regulon in E. the observation of a dramatic increase in intracellular free zinc content in the DmdtC and DmdtA knockout strains suggests that MdtABC reduces the intracellular free zinc concentration by a net extrusion of zinc ions from the cytosol. exhibit different patterns in growth rates. Nonetheless. to facilitate efficient extrusion of substrates to the outside of the cells.18 Here we showed that MdtD is involved in the zinc stress response in E. coli. Loss of MdtA could potentially reduce the cell’s ability to lower the zinc concentration in the periplasm. The three knockout strains. coli on the cellular response to zinc shock. and DmdtC.rsc. MdtC also has low sequence homology with the heavy metal efflux RND-type transporter CusA (23%). Paper (Fig. This exporter transports several structurally unrelated amphiphilic molecules (novobiocin. 2(b) and 3(b)).20 it is likely that zinc is co-transported in a complex with other ligands that are substrates of MdtD. especially under energy constraint and zinc shock conditions. and free and total zinc changes. SDS. and 30%.36 Therefore. 2(b)).15 On the other hand.14 However. MdtA is a membrane fusion protein that links the trans-inner-membrane trimer with the outermembrane pore.15. AcrD may also be implicated in alleviating zinc stress in addition to its function in drug resistance.17–19 This is similar to other drug resistance RND-type transporters that have nonspecific substrate binding sites. which is consistent with the previous proposal that the MdtB–MdtC heterotrimer can be substituted with MdtC homotrimer without a significant loss of function. No significant growth defects or changes in cytosolic free zinc were observed in DmdtB Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. 4(a) and (b)). the functions of each of its components remain unclear. over-expression of MdtABC only provides a minor enhancement in drug resistance compared to other drug resistance associated transporters. these results reveal that the MdtABC transporter lowers the cellular zinc content after zinc shock. led to the proposal that the BaeSR regulon may play important roles in the cellular resistance to metal stress. CvrA. AcrF. in Salmonella knockout of mdtABC/acrD or BaeSR dramatically reduced the cells viability under zinc and copper stress.15 This observation. This buildup of periplasmic zinc can be toxic by interfering with periplasmic metalloproteins or osmotic levels. it is unlikely that the positive feedback loop was responsible for the second phase of transcription increase. AcrF.org | doi:10. coli. MdtC shares 73% identity with a putative cation/protein antiporter.13 however. 3(d)). and the DmdtABC knockout strain did not alter the cellular drug resistance profile. AcrD and MdtF are fairly high (60–80%).12.17. 5(b)).19 However. 29%. AcrD shares 66% 4 Discussion The BaeSR regulon is responsible for envelope-related stress responses.).

Department of Molecular.. Mitra and B. T.37 Our results showed that intracellular free zinc concentration is higher in the DacrD knockout compared to the wild-type strain upon zinc stress (Fig. AcrD transports aminoglycosides in vitro in the presence of the membrane fusion protein AcrA. A. T. unlike these proteins. 103–111. D. FEMS Microbiol. Biophys. the impact of deletion of these transporters on cell growth and zinc content is more substantial that the impact of deleting ZitB. Deletion of key components of this regulon renders the cells more sensitive to zinc toxicity. K. ACS Chem. Bozym. 087011. a periplasmic zinc-dependent molecular chaperone that requires zinc for its activity and is up-regulated upon zinc exposure. Multiple regulatory mechanisms maintain zinc homeostasis in Saccharomyces cerevisiae. The zntA gene of Escherichia coli encodes a Zn(II)-translocating P-type ATPase. However. D. 291–311. a more dramatic increase than the transcription level of mdtC (7-fold) (Fig. Biometals. A. 16. Spy shares a structural homology with ZraP. is also implicated in a cellular response to metalassociated stresses. 1993. Spy is also aggressively up-regulated upon zinc exposure. Spy possibly acts as a periplasmic chaperone to facilitate the folding of the newly synthesized zinc detoxification machinery. Opt. however. R. Vallee and D. B.18 Furthermore. similar to the function of ZitB. 239–249. previous data demonstrated that Spy does not bind tightly to iminodiacetic acid agarose equilibrated with zinc.1039/C3MT20217H Acknowledgements We thank Dr Ursula Jakob and Wei-Yun Chen at the University of Michigan. there is no evidence that Spy binds zinc with high affinity. 14. Biomed.8 a known constitutive metal transporter. J. 2001. mediated by the BaeSR system. coli’s defense against high zinc stress. these attributes contribute to their functions in zinc detoxification.39 Spy also shares superficial structural similarity to the copperbinding transcriptional regulator Mycobacterium tuberculosis CsoR (copper-sensitive operon repressor) and CnrX. making them responsive to metal stress. Blencowe and A.42 Therefore. 2003. E. 5 D. especially under high cell density with energy constraints. Genetically encoded ratiometric biosensors to measure intracellular exchangeable zinc in Escherichia coli. A. J. 5(a)). similar to ZntA. P. Thompson and C. 2003. 2 B.rsc. Stoddard and C. and total zinc/ copper upon zinc shock (Fig. up-regulation of AcrD could be responding to a high cellular cysteine level. 3(f)).25 However. Overall. The Dspy knockout strain exhibited a slower growth rate under high zinc stress (Fig. 5–19. an inducible ATP-dependent zinc exporter. 27. Rosen. Acta.22. 4 R.. P. Physiol.. the periplasmic metal sensing domain of an ECF-type sigma factor involved in cobalt and nickel resistance. One clue is that AcrD is involved in L-cysteine efflux from the cell. these transporters are also up-regulated upon zinc exposure. 2003. 2(b)).9 Therefore. 6 D. Biol. constitutive defense network that functions to lower the intracellular metal content upon zinc shock. We thank Dr Richard Thompson at the University of Maryland School of Medicine for his help with the fluorescence microscopy. AcrB and AcrF. 2011. Rev. K. 1763.View Article Online Paper and 63% sequence identity with the well-known drug resistance transporters. 2006.. Bacterial zinc transporters and regulators. H. these data demonstrate that MdtABC and MdtD are an important part of a first-line. possibly in the form of a small molecule–zinc complex. Fierke. highlighting their functions in defense Metallomics against zinc that are complementary to the ATP-driven exporters. Dineley. an ATP-independent molecular chaperone in the periplasm. Auld. Measuring picomolar intracellular exchangeable zinc in PC-12 cells using a ratiometric fluorescence biosensor. Hantke. Biochim. Morby.org | doi:10. 1992.38 and exposure to high zinc could lead to over-production of cysteine. the role of Spy in relieving zinc stress may be to facilitate the folding and to protect the integrity of transmembrane and periplasmic transporters that function in zinc export. 85. S. Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs.41 Previously published data indicate that Spy functions as a periplasmic molecular chaperone. K. Notes and references 1 B. as shown in a previous study. Thompson. we have shown that the BaeSR regulon plays an important role in E. Hurst. L. Active zinc binding sites of zinc metalloenzymes. Fierke. The transcription of acrD increases in a biphasic manner up to 17-fold after zinc shock. this increased concentration is not sufficient to cause negative effects on the cell growth rates (Fig.40 Both proteins have been reported to bind transition metals and involved in metal resistance. L. R. One speculation is that up-regulation of AcrD may be a response to secondary effects caused by elevated zinc levels. Votyakova and I. and large temporary increases in free zinc (Fig. Zinc inhibition of cellular energy production: implications for mitochondria and neurodegeneration. Neurochem. J. 563–570. the specific function of Spy in zinc homeostasis is unclear. Reynolds. A. We acknowledge the support of National Institute of Health and National Institute of General Medical Sciences for project grant R01 GM040602. However. Falchuk. J. such as ZntA. 133. 2006. The MdtABC and MdtD transporters are not the primary transporters important for metal detoxification since deletion of these genes does not have as significant an effect on cell growth after zinc shock as deletion of zntA. The MdtABC and MdtD transporters are involved in the initial efflux of zinc. J.27. Eide. Furthermore. the crystal structure of Spy revealed a long kinked hairpin-like structure of four a-helices that form an antiparallel dimer with no identifiable signature zinc binding motifs. Overall. B.26 Also. Cellular and Developmental Biology for their help with the RT-PCR experiments. Zinc transporters and the cellular trafficking of zinc.. Rev. Metallomics This journal is c The Royal Society of Chemistry 2013 .. V. 2(b)). 1532S–1535S.. The biochemical basis of zinc physiology. Eide. 79–118. 4(c) and (d)). K. Therefore. Zn(II) metabolism in prokaryotes. 3(g)). 711–722. 3 K. 1. Rensing. Vallee and K. 1. J. The implication of this increase in transcription is unclear. B. Matrix Suppl. Spy. Wang. 73. 7 C. Nutr.

Grass. J.View Article Online Metallomics Proc. Waditee.. M.. Hagedoorn. J. 187. J. 2005. 2001. Tsai. B. Exploring the microbial metalloproteome using MIRAGE. V. Hosteen and C. 114.. A. Long. S. 17–22.. M. T. Bacteriol. P. Ara. 193. Rensing. 2005. W. Novel members of the two-component signal transduction genes in Escherichia coli. C. Jr. 177.. Mol. Maliwal and H. K. Biol. R. 19822–19829. FieF (YiiP) from Escherichia coli mediates decreased cellular accumulation of iron and relieves iron stress. V. A.org | doi:10. 184. 4161–4167. W. 3367–3375. Yamamoto. Ishihama.. Leblanc. Wanner and H. J. E. 2073–2076. Nakamura. Yamaguchi. J. 187. Petrukhin and S. H. Kobayashi. Bacteriol. J. M. Y. 2002. Hagenmaier. 62. Raffa and T. Bacteriol. MdtABC. E. H. Bloch and D. W. Appia-Ayme. T. Inorg. Genome-wide analyses of Escherichia coli gene expression responsive to the BaeSR two-component regulatory system. Biol. J. A new periplasmic protein of Escherichia coli which is synthesized in spheroplasts but not in intact cells. Zinc biosensing with multiphoton excitation using carbonic anhydrase and improved fluorophores. T. 14326–14331. 2005. C. B. 2012. 3. Otto. Mol. Nikaido. Bacteriol. Rev. M. D. Fricke. Fukuhara. S. Bacteriol. Mizuno. Biol. Biomed. Ishihama. Ogasawara and A. D. 2. 2011. Nikaido. S. Rosen. 367. 1999. Lutsenko. Sci. Takabe and Paper T. Mol. H. Y. revealed a possible role of YJAI protein in balancing zinc in Escherichia coli. Thompson. I. 5803–5812. L. Hall. Analysis of a complete library of putative drug transporter genes in Escherichia coli. R. 45. G. P. D. L. M. N. Patrick. M. T. R. 1754–1756.. 173–181. 279. 1998. Datsenko. J. 2012.. C. K. Culture medium for enterobacteria.. Bolla. H. Nishino. M. 183. Growth phasedependent variation in protein composition of the Escherichia coli nucleoid. Okumura. Mori. Noll. L. 273. Oshimi. M. S. F. is an additional zinc transporter in Escherichia coli. F. J. Saier. K. The baeSR two-component regulatory system activates transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and increases its resistance to novobiocin and deoxycholate. 181. 2004. H. 2006. Ho. 2005. D. Yamaguchi. 189. Arch. Opt. J. 184.. B. Biol. C. Ma and H.. Med. Pinkse. P. Verhaert. Identification of a novel transcription regulator from Proteus mirabilis. Su. 21393–21401. M. 6333–6340. 2001. J. 2000. Rosenberg. Regulation of multidrug efflux systems involved in multidrug and metal resistance of Salmonella enterica serovar typhimurium. Bacteriol. A. Nikaido and A. K. 6361–6370. 111. Raivio.. Barrett and R. Iwata. Fierke. R. Quan. Poole. J. S. K. 6791–6797. 4168–4176. 94. M. Bacteriol.. L. 187. 119. 281. J. Nikaido. S. Bacteriol. J. Structure and mechanism of the tripartite CusCBA heavymetal efflux complex. Microbiol... K. 2001. Takai. Transcriptional response of Escherichia coli to external zinc. T. S. Baba. Yu. D. PMTR. C. London. J. Trans. Microbiol.. Yamaguchi. Ishihama. Neidhardt. Bacteriol. Chem. E. Biol. F. Biochem. Oates and T. Clarke and G. H. J.. 133. Hagen and P. K. Bacteriol. W. 2002. Acad. Dietary zinc supplementation inhibits NFkappaB activation and protects against chemically induced diabetes in CD1 mice. Stierhof and U. T. C. J. Nishino and A. 2011. Lee. 17173–17180. Bacteriol. 2006. Microbiol. J. 1974. Ishige and T. J. Chem. Nies and C. Nagakubo.. Akerlund. N. 4664–4667. S. L. S. Hasegawa. Pao. 183. T. 9–18. A third envelope stress signal transduction pathway in Escherichia coli.. 85–93. Elkins and H. 226. Ser. S. 196–200. O. 2000. 1997. Lai and T. Haney. S.rsc. A. K. 1324–1330. Ali Azam.. Natl.. A. U. 350–357. J. H. Bernander. Substrate specificity of the RND-type multidrug efflux pumps AcrB and AcrD of Escherichia coli is determined predominantly by two large periplasmic loops. T. Wang. 9066–9075. Lei. Bacteriol. Biochem. Nishimura. 103–111. Nagasawa. Thermodynamic studies of the mechanism of metal binding to the Escherichia coli zinc transporter YiiP.. 1124–1134. Construction of Escherichia coli K-12 in-frame. B. Potassium/proton antiport system of Escherichia coli. Matsuzaki. Bacteriol.. 1993. Fu. single-gene knockout mutants: the Keio collection. Chem.. Biol. Y. L. J. S. J. Hirata and A. Philos. Rensing. Involvement of multiple transcription factors for metal-induced spy gene expression in Escherichia coli. 182.0008.. K. Paulsen and M. 2007. K. Yamaguchi. Sevcenco. 736–747.1039/C3MT20217H 25 26 11 12 27 13 28 14 29 15 30 16 31 17 32 33 18 19 20 21 34 This journal is c The Royal Society of Chemistry 2013 Metallomics . 6490–6498. Fan. ZraP is a periplasmic molecular chaperone and a repressor of the zinc-responsive two-component regulator ZraSR. 2008. Nishino. K. Soc. P. ZntR-mediated transcription of zntA responds to nanomolar intracellular free zinc. Bacteriol. AcrD of Escherichia coli is an aminoglycoside efflux pump. C. J. Genome-wide transcriptional response of chemostat-cultured Escherichia coli to zinc. Munkelt. A. B. Baranova and H. Y. H. 2002. ZitB (YbgR). D. 179. Y. Tomita. Radchenko. A. 442. Nishino. Y. T. G.. 1599–1611. 1995. 2012. Rajadurai. B. Smith. E. Bacteriol. T. 1763–1772. Syst. R. 184. Tanaka. J. J. Baba. Henning.. 1997. The putative response regulator BaeR stimulates multidrug resistance of Escherichia colivia a novel multidrug exporter system. Chao and D. Biotechnol. R. 2002. H. Yamamoto and A. T. B. Biochem. C. Wolterbeek. Bray. a member of the cation diffusion facilitator family. Do and E. A. K. Zeng. Y. 183.. G. J. Rowley. K. 2006. 1047–1058. 22 8 23 9 24 10 Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. Grass. W. A. 5. A. Franke. Ueda and A. Analysis of cell size and DNA content in exponentially growing and stationary-phase batch cultures of Escherichia coli. Honda and A.. Characterization of the induction and cellular role of the BaeSR twocomponent envelope stress response of Escherichia coli. Metallomics. Exp. 1–34. Raivio. Major facilitator superfamily. Nordstrom and R. Nies and D. 1998. J..

Buelow. Foit. Yamada. Kwon. D. Appl. Mol.. P. 769–781. Chem. Chem. Biol. Ma. Morikawa. D. 19. Kim. 2006. Protein Sci. 2011.. E.. N. 18. Kitamura.. Biol. M.. Yamaguchi and H. Koldewey. Girard. 2011. H. de Rosny. 60–68. 2252–2259. L. Sacchettini and D. Bacteriol. Nishino.. J. S. Arthur. Takagi. Hirano. Bacteriol. 2149–2157. K. Iguchi. P. L. S. T. R. Fukada.. Kirsch. Awano. Kim. Structural basis for metal sensing by CnrX. H. Switch or funnel: how RND-type transport systems control periplasmic metal homeostasis. L. Toll-like receptor-mediated regulation of zinc homeostasis influences dendritic cell function. L. C.org | doi:10. Edwards. T. M. Biochim. G. Ruane. A. Z. 2011. D. Inubushi. Maillard. J. Y. Nakamori.1039/C3MT20217H Metallomics This journal is c The Royal Society of Chemistry 2013 . 193. 1123–1134. 2009. A. Yamasaki. E. C. Liu. T. L. R. S. Yamashita. Hofmann. Genetic selection designed to stabilize proteins uncovers a chaperone called Spy. G. Environ. E. 2381–2387. Zhang. H. 36 H. George. Structure of the periplasmic stress response protein CpxP. H. S.. Ramesh. 2010. Kaisho. 193. 4735–4742. U. K. Coves. C. Murakami and T. 37 T. A. A. Metallomics 39 G. J. 2006. M. Mol. D. Nies. Glover. Hirano. 38 S.. Pfizenmaier. Kahn and J. Hojyo. McEvoy and C. Maeda. Fukada. H. S. Quan. M. M. Nishida. The crystal structure Escherichia coli Spy. 72. Ren. S. Downloaded by University of Missouri at Columbia on 15 March 2013 Published on 27 February 2013 on http://pubs. Ward. P. 42 S.View Article Online Paper 35 E. Shi. Akira. Xu. 41 E. Z. M. Kamon. Nat. S. 971–977. Biol. Mechanisms of RND multidrug efflux pumps. Biol. R. Biophys. Struct. 3. J. N. CsoR is a novel Mycobacterium tuberculosis copper-sensing transcriptional regulator. A. N. 2011. 2007. R. 2011. Acta. 7. J. J. Rensing. M. Nikaido and Y. I. Wong. Nat. Microbiol. Takatsuka. Effect of drug transporter genes on cysteine export and overproduction in Escherichia coli. D. Zinc homeostasis and signaling in health and diseases: zinc signaling. C. K. PetitHaertlein. Raivio and J. N. Immunol. Trepreau. Murakami and T. Kim. Cygler and J.rsc. K. Gross. 1794. 262–269. Thede. J. A. Tapley. Giedroc. Inorg. K. Gross and K. J. 408. 40 T. 766–779. J. Talaat. 16. Jakob. T. K. M. Bardwell. Nat.