You are on page 1of 26

Molecular Aspects of Fragrance and Aroma in Rice

APICHART VANAVICHIT*,{,1 AND TADACHI YOSHIHASHI{

*Rice Gene Discovery, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Kamphangsaen, Nakhonpathom, Thailand { Rice Science Center and Agronomy Department, Faculty of Agriculture, Kamphangsaen, Nakhonpathom, Thailand { Postharvest Science and Technology Division, Japan International Research Center for Agricultural Sciences, Tsukuba, Ibaraki, Japan

I. 2-Acetyl-1-Pyrroline, a Potent Flavour Component of Aromatic Rice. . . . II. Aromatic Gene Discovery. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Mendelian Genetics of Grain Aroma ...................................... B. Genetic Mapping of Grain Aroma ......................................... C. QTL Mapping of 2AP ........................................................ D. Map-Based Cloning of the Gene Controlling Grain 2AP............... III. Molecular Mechanisms Regulating 2AP Biosynthesis . . . . . . . . . . . . . . . . . . . . . A. Isogenic Lines Revealed the Absence of the Os2AP Transcript........ B. Suppressing Os2AP by RNAi Makes Rice Aromatic.................... C. Overexpression of Os2AP Turns Aromatic Rice to Non-Aromatic Rice ........................................................... D. Alternative Mechanism of Regulating 2AP Biosynthesis ............... IV. Biochemical Functions of Os2AP and BADH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. The Os2AP Protein is an AMADH ........................................ B. Kinetic and Afnity Studies of Isolated Enzymes, Os2AP and BADH ......................................................... V. Formation Pathway of 2AP. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Chemistry Behind 2-AP Formation ........................................
1

50 51 51 51 52 52 54 54 55 58 58 58 58 59 60 60

Corresponding author: E-mail: tadashi@jircas.affrc.go.jp


0065-2296/10 $35.00 DOI: 10.1016/S0065-2296(10)56002-6

Advances in Botanical Research, Vol. 56 Copyright 2010, Elsevier Ltd. All rights reserved.

50

A. VANAVICHIT AND T. YOSHIHASHI

B. Source of Nitrogen in 2AP ................................................... C. Source of Acetyl Group in 2AP ............................................. D. Metabolic Disorder Makes Rice More Aromatic ........................ VI. Genetic Diversity and Origin of the Aromatic Gene. . . . . . . . . . . . . . . . . . . . . . . A. Genetic Diversity of the Aromatic Rice.................................... B. Naturally Occurring Allelic Variation of the Aromatic Gene .......... C. Origin of the Aromatic Gene ................................................ D. Ancestors of the Aromatic Gene ............................................ E. Evolutionary Relationship Among Plant BADH/AMADH Family ............................................... F. Deciency in AMADH Makes Aromatic Plants ......................... VII. Environmental Adaptability of Aromatic Rice . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

62 62 63 64 64 65 65 65 66 68 69 70

ABSTRACT
Grain aroma is the most attractive characteristic of high-quality rice, and demand for it is not only increasing in the Asian market but is also widely recognized in Europe and all over the world. Aromatic rice is rare and so precious that in some countries, it is considered a national asset and pride. The aromatic compound, 2-acetyl-1pyrroline (2AP) was discovered in rice in 1983 [Buttery, R. G., Ling, L. C., Juliano, B. O., and Turnbauhg, J. G. (1983). Cooked rice aroma and 2-acetyl-1-pyrroline. Journal of Agricultural and Food Chemistry, 823826.], but the gene controlling the accumulation of 2AP has only recently been identied by map-based cloning (Os2AP). The molecular genetics, biochemistry, and evolution of the aromatic gene have been elucidated in recent years as a consequence of the gene discovery. Aromatic rice has accumulated several natural mutations in an amino aldehyde dehydrogenase (AMADH) that oxidizes -amino butylaldehyde to -amino butyric acid (GABA). RNA interference against the cloned Os2AP generated aromatic from non-aromatic rice plants. A similar technique was used to achieve new aromatic soybean. Aromatic gene also shed new light on evolutionary and domestication aspects of the most important cereal of mankind. The time has come to review past achievements in the light of the recent discovery of the functions of aromatic genes in rice and other plant species.

I. 2-ACETYL-1-PYRROLINE, A POTENT FLAVOUR COMPONENT OF AROMATIC RICE


The fragrance of cooked rice consists of more than 200 volatile compounds such as hydrocarbons, alcohols, aldehydes, ketones, acids, esters, phenols, pyridines, pyrazines, and other compounds (Maga, 1984; Paule and Power, 1989; Tsugita et al., 1980; Yajima et al., 1978). A comparative study of the volatile components of aromatic and non-aromatic rice varieties showed that 2-acetyl-1-pyrroline (2AP), which contributed to specic avour in aromatic rice and has comparably lower odour threshold among rice volatiles, occurs at higher levels in aromatic rice varieties and at signicantly lower levels in

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

51

non-aromatic rice varieties (Buttery et al., 1983). Numerous studies have shown that 2AP is the only volatile compound in which the relationship between its concentration in rice and sensory intensity has been established (Maga, 1984; Paule and Powers, 1989; Tsugita et al., 1980; Yajima et al., 1978). The compound 2AP, usually described as a pop-corn or roasted avour compound, was also identied as an important attribute of processed foods such as wheat bread crust, rye bread (Buttery et al., 1982, 1983), popcorn (Schieberle, 1991), and wet milled millet (Seitz et al., 1993). Interestingly, 2AP was also identied in other plants and microbes, including pandan leaves (Pandanus amaryllifolius Roxb.) (Buttery et al., 1983), bread owers (Vallaris glabra Ktze.) (Wongpornchai et al., 2003), soybean (Fushimi and Masuda, 2001), Bacillus cereus (Romanczyk et al., 1995), Lactobacillus hilgardii (Costello and Henschke, 2002), and fungi (Nagsuk et al., 2003).

II. AROMATIC GENE DISCOVERY


A. MENDELIAN GENETICS OF GRAIN AROMA

Grain aroma was reported to be governed by a single recessive nuclear gene (Huang et al., 1994; Sood and Siddiq, 1978), with a few exceptions. So far, the inheritance of grain aroma has been reported to depend on the genetic background of the materials being studied. Grain aroma has also been reported to be governed by a dominant gene (Jodon, 1944), or found to be di- or trigenic (Dhulappanavar, 1976; Kadam and Patankar, 1938; Nagaraju et al., 1975; Reddy and Sathyanarayanaiah, 1980).

B. GENETIC MAPPING OF GRAIN AROMA

Several aromatic rice varieties were used for genetic mapping; some examples are aromatic japonicas including Della (Ahn et al., 1992), Azucena (Bourgis et al., 2008; Lorieux et al., 1996), Suyunuo (Chen et al., 2006; Shi et al., 2008), and Wuxianjing (Chen et al., 2006). Quantitative trait locus (QTL) mapping was also performed in such aromatic indica rice as Jasmine (KDML105) (Lanceras et al., 2000; Tragoonrung et al., 1996), Kyeema (Bradbury et al., 2005), and Wuxiangxian (Chen et al., 2006). Those results produced the consensus genetic map that conned grain aroma within 3.54.5 cM; this region was anked by two polymorphic SSR markers on chromosome 8.

52

A. VANAVICHIT AND T. YOSHIHASHI C. QTL MAPPING OF 2AP

Genetic mappings of grain aroma were reported as a qualitative trait based on sensory tests. However, volatile compounds of different aromatic rice varieties, particularly the amount of 2AP, varied quantitatively (Fitzgerald et al., 2008; Goufo et al., 2010; Hein et al., 2006; Itani et al., 2004). Due to costly analysis of 2AP, only limited QTL mapping experiments for grain 2AP content were reported so far. The grain 2AP-density was identied in three map locations (Lorieux et al., 1996). The major QTL mapped on chromosome 8 coincided with the consensus genetic map based on sensory test on chromosome 8 (Chen et al. 2006; Lorieux et al., 1996). In addition, two minor QTLs were localized on chromosomes 4 and 12 (Lorieux et al., 1996). Therefore, the 4.5 cM map interval between RG1 and RG28 on the chromosome 8 was considered a critical region for map-based cloning.

D. MAP-BASED CLONING OF THE GENE CONTROLLING GRAIN 2AP

The rst mapping of grain aroma took place in 1992 (Ahn et al., 1992), and the gene responsible for grain aroma was identied 12 years later, with the rst and only successful map-based cloning of the gene controlling 2AP (Fig. 1; Vanavichit et al, 2004, 2005). By taking advantage of within-family segregation for 2AP from the F6 to the F13 generations of the cross between Jasmine rice and a non-aromatic rice, the original 1.13-Mb region anked by RG1 and RG28 was effectively narrowed down to 82.8 kb, where three KDML105 Bacterial Articial Chromosome (BAC) clones were shotgun sequenced, and three candidate genes were identied (Vanavichit et al., 2005). ORF3, later named Os2AP, was determined to be responsible for grain aroma in aromatic rice, because double recombinations within ORF3 resulted in the disappearance of 2AP. Comparative sequence analysis of ORF3 between KDML105 and Nipponbare revealed that the 4.5-kb genomic sequence contained 15 exons of the 1512-bp coding sequence that translated into the 503 amino acid sequence in non-aromatic Nipponbare. In aromatic KDML105 and within the exon 7 of Os2AP, two important mutation events were found at positions 730 (A to T) and 732 (T to A), followed by the 8-bp deletion GATTAGGC starting at position 734 (Fig. 1). A second map-based cloning approach was also reported; in a cross between aromatic Kyeema and a cultivar of non-aromatic rice, grain aroma was mapped on chromosome 8 between the SSR markers RM515 and SSRJ07 (Bradbury et al., 2005). The in silico physical map consisted of four Nipponbare BAC clones spanning the 386 -kb anked SSR markers RM515 and SSRJ07. Re-sequencing one of the BAC clones revealed 17 genes. However,

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

53

A
700 kb 170 kb P0456B03_127.8 4440, 10L03_FW

F05_103.0

E11_44.5

E03_92.0

F05_21.6

CP04133

RM342

70I03 155L11 KDML105 contigs 71J18 68L13 10L03 20J11 167M23 173C14

82.8 kb
3920 01_5UTR 01_3UTR 1610 InG4 InAAT3 InTA2 In1

13790

B
2500

B03_129.8 B03_127.8

4510 3580

6720

0 KDML105 (control) 11H1 13E12 8F10 6H8 11H9 4B6

20 10 n = 1116F12 ISLs

30

40

50

60

70

80 82.8 2AP accumulation (ppm) 0.41 0.34 0.34 0.3 0.09 0.06 0

3540

KDML105

MCCase

Hypothetical protein

Os2AP

CT9993 Heterozygous KDML105-68L13

0.0

5.0

10.0 27.6 kb

15.0

20.0

25.0

D
67B 42W 73B

2AP accumulation (ppm) 0.28 0 0 8 bp deletion in exon 7 Non-aromatic TGCATTTACTGGGAGTTATGAAACTGGTAAAAAGATTATGGCTTCAGCTGCTCCTATGGTTAAG Aromatic TGCATTTACTGGGAGTTATGAAACTGGTATATA--------TTTCAGCTGCTCCTATGGTTAAG KDML105 Jao Hawn Nin (JHN)

Fig. 1. Map-based cloning of the aromatic gene in rice: (A) ne-scale mapping in the 700-kb region spanned by a KD BAC contig. Three KD BAC clones spanning a 170-kb region where the aromatic gene was expected were shotgun sequenced (B) high density mapping using 1116 F12 plants derived from a single F6 plant to narrow down the critical region to 27 kb in a single BAC. Six segregating F12 ISLs were graphically genotyped in the 82.8-kb region enriched by specic indel markers, (C) annotation of the genomic sequence of the KD BAC 68L13 found three ORFs similar to methyl crotonyl CoA lyase, hypothetical protein, the AMADH called Os2AP, a candidate

RM223

13050 11410

RM42

0210

2500

3540

54

A. VANAVICHIT AND T. YOSHIHASHI

signicant sequence variation was identied in only one clone, which was later identied as BAD2, a betaine aldehyde dehydrogenase (BADH) homologue. In the screening of 14 diverse fragrant and 64 non-fragrant rice varieties, the sequence variation of exon 7 was perfectly matched with grain aroma, but no transgenic evidence was provided. Based on their similarity at both the nucleotide and amino acid levels, Os2AP and BAD2 were considered the same gene. A third map-based cloning effort was reported using in silico physical mapping within the critical region by comparing only genomic BAC-end sequences of Nipponbare (Wanchana et al., 2005) and by comparing genomic sequences between Nipponbare and 93-11 (Chen et al., 2008). The restriction map surrounding the region of the three candidate genes, carbonic anhydrase (CA), methylcrotonyl CoA carboxylase (MCC), and aldehyde dehydrogenase (Os2AP), was used to screen BAC clones of a local Chinese aromatic japonica rice cv. Suyunuo and a Chinese non-aromatic indica rice cv. Nanjing11; three subclones of each candidate gene were used for functional analysis. The conclusion that BAD2 was the best aroma candidate locus identied in the Azucena japonica cultivar was also reached using ne-scale mapping using Azucena IR64 (Bourgis et al., 2008). Once the gene regulating 2AP content in rice was cloned, the next step was to understand its functions and the regulation of 2AP accumulation.

III. MOLECULAR MECHANISMS REGULATING 2AP BIOSYNTHESIS


A. ISOGENIC LINES REVEALED THE ABSENCE OF THE OS2AP TRANSCRIPT

Grain aroma is recessive to non-aroma. The 8-bp deletion in exon 7 found in aromatic rice varieties all over the world is the functional marker of aromatic rice. The rst approach investigating how the aromatic gene functions was achieved by comparing the isogenic lines A117 and NA10, which differ only in the 27-kb genomic region containing the aromatic gene Os2AP (Vanavichit et al., 2005). Transcription analysis of the Os2AP and anking candidate genes revealed the differential expression of Os2AP in all parts of the rice plant. The compound 2AP is naturally expressed starting from young

gene controlling 2-acetyl-pyrroline, (D) gene models of Os2AP showing a double recombinants identied in 177 F6 plants from the cross between KD and JHN that knock-out the gene function and as a result generating 2AP and (E) the sequence part of the exon 7 where 8 bp deletion causes the early stop codon that disrupts the gene function.

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

55

seedling to the grain-lling period and accumulates in mature grains. The pattern of 2AP expression was consistent with the constitutive expression of functional Os2AP in all plant organs. However, one exception was in the roots, where some researchers have reported no expression (Chen et al., 2008). Other researchers detected 2AP and Os2AP transcripts at low levels from rice roots and culture media (Vanavichit et al., 2005). This inconsistent expression result needs detailed studies to explain how the nonsense mutation causes suppressive expression in the different plant parts. The reduction of Os2AP transcripts was highly signicant from 10 to 20 days after pollination (DAP) (Vanavichit et al., 2005; Fig. 2). In our laboratory, we illustrated the effect of reduced expression of Os2AP at the whole-genome level using the isogenic lines A117 and NA10 in the rice oligoarray version II Rice Array Database, http://www.ricearray.org/nsfarray/nsfarray.shtml, containing 20,190 unique gene-specic probes against total RNA isolated from plants harvested at 1020 DAP (Fig. 3). The results conrmed that Os2AP was overexpressed vefold, along with 72 other genes, in the non-aromatic NA10. On the other hand, only 17 genes were overexpressed in the aromatic line A117. In connection with the 8-bp deletion in exon 7 of the aromatic allele, the suppressive expression of Os2AP resulted from a premature stop codon at position 753, which shortened the full-length peptide to 252 amino acids in aromatic rice (Bradbury et al., 2005; Vanavichit et al., 2005). This short, incomplete peptide was reported to trigger nonsense-mediated decay (NMD) in several cases (Chang et al., 2007). The hypothesis postulated that NMD was operative in aromatic isogenic lines and in all aromatic rice.

B. SUPPRESSING OS2AP BY RNAI MAKES RICE AROMATIC

To conrm if the reduced expression of Os2AP was the genetic basis for 2AP accumulation, two transgenic approaches were applied. First, RNA interference (RNAi) was used to reduce the expression of the non-aromatic allele of Os2AP. The RNAi was constructed from the genomic sequence spanning exons 6 to 8 in the opposite direction from the corresponding cDNA. This allowed the transcript to create double-stranded RNA, resulting in NMD and aromatic Nipponbare that could accumulate 2AP in a range of 0.05 0.20 ppm (Vanavichit et al., 2005). In this experiment, the strongest RNAi expression gave the strongest suppression and the highest accumulation of 2AP, comparable to the 2AP content in Jasmine rice (Vanavichit et al., 2005). In an independent study, transgenic rice containing RNAi by an inverted repeat of cDNA encoding Os2AP accumulated 2AP in considerable amounts (Niu et al., 2008).

56

A. VANAVICHIT AND T. YOSHIHASHI

Aromatic ISL 10 Os2AP 3-methyl crotonyl CoA carboxylase Surface glycoprotein NBS/LRR disease resistance gene Disease resistance gene Hypothetical protein Carbonic anhydrase Total RNA 15

Non-aromatic ISL 20 10 15 20 DAP

Non-aromatic ISL

Non-aromatic ISL

Non-aromatic ISL

Os2AP Actin Stems Roots Leaves Seeds (15DAP)

Fig. 2. (A) Expression analysis of the Os2AP and other predicted coding sequences from the genomic sequence of KD. Total RNAs were isolated from 10, 15 and 20 days after pollination (DAP), from aromatic versus non-aromatic ISLs. (B) Expression analysis of the Os2AP and actin between the aromatic ISL versus nonaromatic ISL where the total RNAs were isolated from stems, roots, leaves and seeds, 15 DAP.

Non-aromatic ISL

Aromatic ISL

Aromatic ISL

Aromatic ISL

Aromatic ISL

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

57

Fig. 3. Differential expression proling using 21K oligonucleotide array (TIGR, 2005) against total RNA isolated during 1020 days after pollination. Signicant upregulated genes detected from both isogenic lines were compared. All raw data were listed in http://rice.kps.ku.ac.th/aroma-rice.html.

58

A. VANAVICHIT AND T. YOSHIHASHI C. OVEREXPRESSION OF OS2AP TURNS AROMATIC RICE TO NON-AROMATIC RICE

While RNAi against Os2AP allows non-aromatic rice to accumulate signicantly more 2AP, the question remained whether the overexpression of Os2AP would revert the aromatic to non-aromatic rice. The overexpression of various constructs of Os2AP, driven by a CaMV35S promoter, was compared in the transgenic aromatic rice cv. Wuxiangjing 9 (Chen et al., 2008). When comparing partial constructs of Os2AP, only overexpression from the intact one signicantly suppressed the accumulation of 2AP in plantlets (Chen et al., 2008). This suggests that the reduced expression of the Os2AP is the key regulatory step for 2AP accumulation. Therefore, the results from both the RNAi and overexpression of Os2AP conrmed that Os2AP determines the accumulation of 2AP in rice.
D. ALTERNATIVE MECHANISM OF REGULATING 2AP BIOSYNTHESIS

Some aromatic rice lines from isozyme Groups I and V in our laboratory did not show the 8-bp deletion. These aromatic rice lines have half the amount of grain 2AP compared to those with the 8-bp deleted lines. A multiple genomic sequence alignment among these aromatic lines identied a 3-bp addition in exon 13. This insertion is in frame with translation and adds a tyrosine into the peptide. In contrast to those 8-bp deleted aromatic lines, in these lines, Os2AP is expressed normally during seed development. The predicted threedimensional structure revealed that the additional tyrosine is perfectly situated in the NAD-binding pocket of the NAD-binding domain. To understand the effect of tyrosine addition, a full-length cDNA of the new aromatic allele was overexpressed in Escherichia coli for kinetic and binding studies. The isolated enzymes had lower enzyme activities than the wild type, perhaps because the proximity of the tyrosine addition may interfere with NAD binding. The two mutations, however, made the substrate 1-pyrroline more available for 2AP biosynthesis.

IV. BIOCHEMICAL FUNCTIONS OF OS2AP AND BADH


A. THE OS2AP PROTEIN IS AN AMADH

The Os2AP protein was localized immunologically in the cytoplasm with the C-terminal serine-lysine-leucine (SKL) signal peptide specic for targeting to the peroxisome (Chen et al., 2008). Western blot analysis using immunodetection against the Os2AP peptide revealed a 55-kDa peptide in all

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

59

non-aromatic rice varieties that was absent in all aromatic rice varieties. Once again, this result conrmed that the instability of the Os2AP transcript affects the protein stability at the post-transcriptional level in aromatic rice. The in vitro prediction of the two Os2AP alleles revealed the intact 55-kDa peptide in the non-aromatic allele, while 252 C-terminal residues were deleted in the aromatic allele. The signicance of the C-terminus was predicted to be the entire substrate binding and oligomerization domains of the Os2AP protein (Bradbury et al., 2005; Chen et al., 2008; Vanavichit et al., 2005). To understand the roles of the missing null allele in 2AP biosynthesis, the enzymatic activities and substrate specicity were studied by native gel electrophoresis. Extracts from aromatic rice gave only one band at 55 kDa, while those from non-aromatic lines gave two major bands at 54 and 55 kDa (Unpublished data). The partial amino acid sequences revealed the lower band to be amino aldehyde dehydrogenase (AMADH), the product of Os2AP; the upper band was the product of BADH, that is the orthologue of Os2AP located on chromosome 4. The activity gel conrmed that the 54kDa Os2AP was more specic to the -amino butylaldehyde ABL substrate, whereas the BADH had a broader specicity. It is interesting that the two orthologues both play roles in 2AP accumulation in rice. Substrate specicity was one of the major differences between the Os2AP and BADH, as revealed by activity gel electrophoresis. In the activity gel where Abal and Betald were used as substrates, the 54-kDa band showed only AMADH activity, while the 55-kDa band showed AMADH and BADH activities. As a result, the author suggested that BADH2 be renamed AMADH based on the specicity, because these results were conrmed by the partial amino acid sequence. These conclusions were in contrast with the Western blot results, which showed that the 55-kDa band was the product of Os2AP (Chen et al., 2008). However, all the non-aromatic rice varieties showed two faint bands similar to the activity gel; the upper band was common among several rice varieties. Considering the broader specicity of the enzyme, BADH could play important roles in interfering with 2AP accumulation in aromatic rice. To test this possibility, RNAi against BADH in either the aromatic or the non-aromatic background must be developed.
B. KINETIC AND AFFINITY STUDIES OF ISOLATED ENZYMES, OS2AP AND BADH

To obtain insights into the kinetics of both enzymes, the overexpression of the cloned Os2AP and BADH in E. coli was reported (Bradbury et al., 2008). The overexpressed Os2AP in E. coli showed moderate afnity towards Betald but higher afnity towards ABald (Bradbury et al., 2008).

60

A. VANAVICHIT AND T. YOSHIHASHI

Surprisingly, the BADH showed no afnity towards Betald but moderate afnity towards ABald (Bradbury et al., 2008). Similar results were reported on the low afnity of both Os2AP and BADH towards Betald, while the afnity towards ABald was higher. However, the in vitro and in vivo enzyme specicities were quite different. From the native gel activities, the 54 kDa Os2AP was expressed only in non-aromatic varieties, and Os2AP bound only to ABald. Trossat et al. (1997) (21) reported that transgenically expressed BADH from Beta vulgaris showed AMADH activity, and they suggested that AMADH from Avena sativa, Pisum sativum, Setaria italica, and Vicia faba should be the same enzyme as BADH. However, recent studies demonstrated that a homogenous AMADH showed no BADH activity (Sebela et al., 2000); overexpressed BADH also showed no AMADH activity in higher plants (Hibino et al., 2001). Since BADH and AMADH share a high level of similarity at the genomic and amino acid levels, AMADH could have been misidentied as BADH even though their substrate specicities were different. The differences between in vitro and in vivo enzyme specicities must be studied further. One possible experiment would be creating a post-transcriptional modication to interfere with the substrate binding site.

V. FORMATION PATHWAY OF 2AP


A. CHEMISTRY BEHIND 2-AP FORMATION

The compound 2AP was isolated and characterized from the basic fraction of a steam distillation extract of aromatic rice. Thus, 2AP should be considered a basic compound. Its six-membered ring analogue, 6-acetyl-1,2,3,4tetrahydropyridine (6-ATHP), which has organoleptic properties similar to those of 2AP, is known as its tautomer and is shown in Fig. 4A. Grimm et al. (2001) and Yoshihashi (2002) also reported similar tautomerism of 2AP, by the observation of a tautomer peak in a GC chromatogram. The compounds 4-aminobutanal and 1-pyrroline, which are considered biological intermediates of 2AP by Os2AP disruption, are in equilibrium and can interconvert spontaneously Fig. 4(C). The compound 1-pyrroline was reported as 1-pyrroline trimer in neat form; however, it was also reported as 1-pyrroline in the gas phase by GC-FTIR analysis (Baker et al., 1992). Due to the prototropic tautomerism of these compounds, the tautomeric equilibria could affect the results of analysis, especially in aqueous solution. Thus, the quantication of these compounds must be carefully investigated, as a result could be inuenced by a strong matrix effect of these

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

61

A N O C H2O H2N CHO +H2O N H

B N O O N H

N N N

TCA cycle Succinate 2-Oxoglutarate

Proline biosynthesis Succinate semialdehyde Glutamate

GABA shunt

GABA AMADH (Os2AP) ??

P5C

2AP

Aromatic varieties

4-aminobutanal

Proline

Putrescine

Ornithine

Spermidine Polyamine synthesis and catabolism

Arginine

Fig. 4. Tautomeric equilibria of 6-ATHP (A), 2AP (B) and 4-aminobutanal (C). Formation pathway of 2AP in aromatic rice. The pathway drawing is based on the literature cited. The detailed pathway from P5C to 4-aminobutanal was not reported yet. Aromatic varieties lack AMADH enzyme activity, which convert 4-aminobutanal to GABA, to yield 2AP.

equilibria. Another problem was the extraction method, as mentioned by Adams and De Kimpe (2006) regarding 2AP in B. cereus; they reported that the use of a non-thermal extraction method is essential to obtain

62

A. VANAVICHIT AND T. YOSHIHASHI

reliable results on the biological formation of these Maillard avour compounds. Therefore, the interpretation of the results must consider these constraints.
B. SOURCE OF NITROGEN IN 2AP

Yoshihashi (2002) reported that additions of glutamate and its related amino acids ornithine and proline induced 2AP formation in rice calli of an aromatic rice variety, Khao Dawk Mali 105; the addition of proline dramatically increased the 2AP content. From tracer experiments with 15N-labelled proline, it was also concluded that the pyrroline ring of 2AP originated from proline. Native AMADH, which is encoded by the Os2AP gene, was considered to act in polyamine catabolism because of its substrate specicity. The enzyme commonly converts 4-aminobutanal into 4-aminobutyrate (GABA); however, this catabolic reaction did not occur in aromatic rice varieties, and 4-aminobutanal was accumulated. The 4-aminobutanal was formed through the oxidation of putrescine by Cu-diamine oxidase via a non-reversible reaction. Yoshihashi et al. (2002) reported that the 4-aminobutanal content observed by GCMS for aromatic rice callus content was stable even when proline was added. Since only 4-aminobutanal was observed as 1-pyrroline from the GC analysis, the non-enzymatic formation of 2AP in aromatic rice could arise from 4-aminobutanal. Huang et al. (2008) reported the formation of 2AP from pyrroline-5-carboxylic acid (P5C) by the up-regulation of P5C synthase 1 and 2 (P5CS1 and 2). They mentioned 1-pyrroline as the intermediate to 2AP formation although the detailed formation pathway from P5C to 1-pyrroline was not then described. QTL analysis of 2AP (Lorieux et al., 1996) determined not only that Os2AP is located on chromosome 8 but also that other loci could be related to 2AP formation. Therefore, it can be hypothesized that P5CS1 and 2 were the genes controlling 2AP formation by controlling the 4-aminobutanal content. In conclusion, both studies of nitrogen source point to 4-aminobutanal or 1-pyrroline as the source of the pyrroline ring of 2AP in aromatic rice.
C. SOURCE OF ACETYL GROUP IN 2AP

Yoshihashi (2002) also performed a tracer experiment using 1-13C labelled proline and concluded that the acetyl group of 2AP did not originate from proline. Model studies on the thermal formation of 2AP with proline and ornithine revealed that the acetyl group of 2AP originated from 2-oxopropanal, which is a sugar degradation product of a deformylation reaction (Schieberle, 1995). Further model studies with isotopically labelled

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

63

compounds also showed that 2-acetylpyrrolidine could be the intermediate of 1-pyrroline and 2-oxopropanal; however, the reaction also resulted in 6-ATHP (Hofmann and Schieberle, 1998). The compound 2-oxopropanal could react with ornithine and proline under thermal conditions and produce 2AP and 2AP and 6-ATHP, respectively. Detailed analysis of 2AP formation in L. hilgardii DSM 20176 showed that the catabolism of lysine and ornithine led to the formation of 2,3,4,5-tetrahydropyridine and 1-pyrroline, which then served to form 6-ATHP and 2AP, respectively (Costello and Henschke, 2002). Thus, acetyl-CoA or acetoaldehyde was proposed to induce the acylation of these intermediates to yield 6-ATHP and 2AP. However, 6-ATHP was not reported or observed in aromatic rice avour; therefore, detailed studies of the introduction of the acetyl group into 4-aminobutanal are required to understand 2AP formation. In addition, Huang et al. (2008) proposed 2-oxopropanal as the precursor of the acetyl group, even in nonthermal conditions. In organisms, 2-oxopropanal is common because it is the intermediate of glycolysis; the reaction of 4-aminobutanal always produces 6-ATHP. It is not clear whether the same pathway as thermal formation occurred in aromatic rice. We should also mention that 2-oxopropanal is known for its high cytotoxicity and high reactivity and also as the most important glycation agent to DNA and proteins.
D. METABOLIC DISORDER MAKES RICE MORE AROMATIC

The AMADH disorder in aromatic rice disrupts Os2AP and results in the formation of 2AP through the accumulation of 4-aminobutanal (Fig. 4B). This metabolic disorder in polyamine catabolism can be considered to improve rice quality. The product of the AMADH reaction, GABA, is accumulated in plants under stress conditions such as drought, cold, and salinity (Aurisano et al., 1995; Kinnersley and Turano, 2000). The accumulation pathway, consisting of glutamate decarboxylase (EC 4.1.1.15), GABA transaminase (EC 2.6.1.19), and succinate semialdehyde dehydrogenase (EC 1.2.1.16 or 24), is known as the GABA shunt (Fig. 4B), and it bypasses two steps of the TCA cycle. The accumulation of GABA through the GABA shunt is predominant; however, Turano et al. (1997) reported signicant GABA ux from putrescine through AMADH. Since rice AMADH did not accept betaine aldehyde as its substrate in the native state, aromatic rice varieties under stressed conditions could enhance their polyamine content, resulting in a higher 2AP content. Yoshihashi et al. (2004) analyzed the 2AP content of various aromatic rice samples from Thailand and found that samples from irrigated areas had a lower 2AP content than those from drought-stricken and rain-fed areas. The Os2AP disruption and the

64

A. VANAVICHIT AND T. YOSHIHASHI

aromatic phenotype could be a genetic predisposition, but the formation of 2AP as a phenotype could also be regulated by environmental conditions. The genetic difference in Os2AP may be benecial for breeding new aromatic rice varieties. However, detailed studies on environmental conditions, especially on stress conditions with potential effects on GABA formation through AMADH, are needed to improve the quality of aromatic rice from paddy elds.

VI. GENETIC DIVERSITY AND ORIGIN OF THE AROMATIC GENE


A. GENETIC DIVERSITY OF THE AROMATIC RICE

Traditional aromatic rice varieties are classied into three isozyme groups, namely Group I (indica), Group V (indica), and Group VI (tropical japonica) (Glaszmann, 1987). The aromatic cultivars belonging to Group I are Jasmine and include several cultivars from Thailand, Cambodia, Vietnam, and Southern China; those in Group V are Basmati and comprise several cultivars from India, Myanmar, Iran, Pakistan, Afghanistan, Bangladesh, and China; and those in Group VI are Azucena and encompass several cultivars from Indonesia and the Philippines (Khush, 2000). To investigate the allelic variation among these diverse aromatic germplasms, 478 aromatic rice varieties were assessed for variation in the 8-bp deletion in exon 7 and grain 2AP content (Fitzgerald et al., 2008). The majority of the aromatic lines contained the 8-bp deletion, with approximately 10% of aromatic varieties accumulating signicant amounts of 2AP containing no 8-bp deletion (Fitzgerald et al., 2008). The possibility that the other loci control 2AP accumulation was reported in two QTL mapping experiments (Amarawathi et al., 2008; Lorieux et al., 1996). The most likely location of the second QTL was reported on chromosome 4 but showed a much smaller effect. Data mining into the QTL ch4 localized the Os2AP ortholog, BADH, within the region (Lorieux et al., 1996). Additional small QTLs were found on chromosomes 3 (Amarawathi et al., 2008) and 12 (Lorieux et al., 1996). So far, no genetic validation has been reported for the existence and roles of these smaller QTLs in the biosynthesis and accumulation of 2AP. The discovery of other naturally occurring mutations in Os2AP has also been explored recently.

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

65

B. NATURALLY OCCURRING ALLELIC VARIATION OF THE AROMATIC GENE

To explore allelic variation in Os2AP, a large collection of aromatic and nonaromatic rice with distinct geographic and genetic origins was analyzed for Single Nucleotide Polymorphism (SNP) variation within the Os2AP region (55 SNP) and across 5.3 Mb (78 SNP) of the anking region (Kovach et al., 2009). The diverse germplasm pool consisted of 280 accessions of Oryza rupogon, 242 cultivated accessions collected from 38 countries, and 26 aromatic accessions lacking the 8-bp deletion (Fitzgerald et al., 2008). Based on gene-specic SNP variations, the rice germplasm was classied into 10 haplotypes, where the badh 2.1 haplotype and the 8-bp delection in exon 7 were the most common aromatic haplotype (Kovach et al., 2009). The less frequent haplotype groups consisted of exon 14 insertions (badh 2.7) and exon 13 SNP (badh 2.8) and associated with the highest 2AP content. Four out of eight mutations were predicted to cause truncated Os2AP transcripts and abolish protein functionality (Kovach et al., 2009). Interestingly, three other mutations in found in rice from Bangladesh (Group I) and Myanmar (Group V) resulted in one amino acid addition (Kovach et al., 2009). Despite several reports of mutations in Os2AP, two other rice varieties exhibiting elevated 2AP levels lacked any known non-functional allele. In addition, SNP haplotypes were found in BADH gene and it seems to be associated with quantitative variation of 2AP content (Singh et al., 2010). Until the new gene is found, Os2AP remains the only known major regulator of 2AP in aromatic rice.
C. ORIGIN OF THE AROMATIC GENE

More aromatic alleles were found in Group V than in any other rice variety, indicating that aromatic rice may originate from Group V and might have been transmitted to other indica varieties via cross-hybridization. Identifying the donor of the aromatic gene to traditional aromatic rice would be very interesting. (The presence of MITE at position 51 was associated with fragrant japonicas and indicas; Bourgis et al., 2008.)
D. ANCESTORS OF THE AROMATIC GENE

Annual wild rice species such as O. rupogon, Oryza nivara, and Oryza spontaneous are believed to be the ancestors of cultivated rice. It may be that aromatic gene can be transmitted to cultivated rice. If it is true that these are the ancestors and that the aromatic gene came from this source In that case, aromatic wild species must be found in natural habitats. Eleven wild

66

A. VANAVICHIT AND T. YOSHIHASHI

rice species sampled from a germplasm bank were analyzed for the 8-bp deletion in Os2AP. The aromatic wild species were rst identied in our laboratory using the 8-bp functional marker for screening (Vutiyano, 2009). However, the aromatic marker allele was found in only two wild species, O. rupogon and O. nivara. Moreover, the 8-bp aromatic allele was also identied at a low frequency (0.23) in 229 natural wild rice accessions, of O. rupogon, collected in Thailand (Prathepha, 2008). From the latter study, the author concluded that the aromatic allele already existed in wild rice. However, in 280 accessions of the wild rice species O. rupogon and O. nivara, the 8-bp deletion was mostly absent, but one sample was heterozygous (Kovach et al., 2009). Because the heterozygous wild rice exhibited several characteristics of cultivated species, the author concluded that the aromatic allele did not originate from the wild species themselves but from a recent introgression of the aromatic allele from cultivated rice. The authors concluded that the aromatic gene was rst domesticated within japonica-type cultivars before it was transmitted through indica-type cultivars; this was in line with their SNP diversity survey over the 5.8 kb across the Os2AP. To test this hypothesis, several hundred aromatic rice varieties from the Southeastern Asia Greater Mekong Subregion including Myanmar, Thailand, Cambodia, and Laos were collected.

E. EVOLUTIONARY RELATIONSHIP AMONG PLANT BADH/AMADH FAMILY

Rice is not the only plant producing 2AP. Pandan, breadower, soybean, coconut, etc., are among well-known aromatic plants. Identication of aromatic gene in rice emerged as a new tool to create desirable aromatic plants. Phylogenic relationship among orthologous sequences related to Os2AP (AMADH) and BADH plants was recently reported (Arikit et al., 2010). Os2AP/BADH homologous sequences retrieved from several dicots, monocots, and non-owering plant genomes were analyzed and shown in Fig. 5. Two distinct clades, the monocot and dicot, were clearly dened in owering plant genomes (Fig. 5). Within the monocot clade, two orthologous subgroups were distinctively dened as Os2AP-like or BADH-like sequences. For most of the dicot clade, two distinct paralogous subgroups were dened after speciation. These results suggested a gene duplication event in the monocot. Analysis of NAD-dependent aldehyde dehydrogenase protein domain, an aldehyde dehydrogenase cysteine active site, revealed two major groups according to two concensus domains (Fig. 6).

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

67

Monocot BADH-like

Monocot Os2AP-like

Dicot AMADH

Fig. 5. BADH gene family was analyzed following a phylogenomic approach. A set of protein sequences homologous to rice Os2AP was obtained by FlowerPower tool (http://phylogenomics.berkeley.edu/cgi-bin/owerpower/input_owerpower.py) using Uniprot proteins as database (http://www.pir.uniprot.org). The homologous proteins were aligned following multiple sequence alignments using MUSCLE program (http://phylogenomics.berkeley.edu/muscle/). A phylogenetic tree was constructed according to the multiple sequence alignments by using SCI-PHY tool (http://phylogenomics.berkeley.edu/cgi-bin/SCI-PHY/input_SCI-PHY.py). Protein domains of these homologous proteins were predicted by Prosite program (http:// au.expasy.org/prosite/). Sequences of rice BADH (SwissProt O24174), Os2AP (SwissProt Q84LK3) and E. coli (SwissProt P77674) were used. The BLAST 2 (BLOSUM 62 matrix) search engine was used to create sequence alignments, whereas Clustal W1.83 enabled the alignment of multiple sequences.

68
A
Rice BADH

A. VANAVICHIT AND T. YOSHIHASHI

E. coli BADH

Rice AMADH/Os2AP

B
BADH (rice) Q6BD95 (Zoysia tenuifolia) Q6BD93 (turf grass) Q94IC0 (barley) BADH (barley) Q5KSN8 (leymus) Q43829 (Sorghum) FaNAGQVCSATS FaNGGQVCSATS FaNGGQVCSATS FfNGGQVCSATS FfNGGQVCSATS FfNGGQVCSATS LpNAGQVCSAAS Os2AP (rice) BADH (spinach) Q6BD3 (turf grass) Q6BD88 (turf grass) Q94IC1 (barley) Q53CF4 (maize) Q6BD99 (zoysia tenuifolia) Q8LGQ9 (wheat) Q4H1G7 (sugar beet) BADH (sugar beet) O9STS1 (Arabidopsis) FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS FwTNGQICSATS

[FYLVA] . x . {GVEP} . {DILV} . G . [QE] . {LPYG} . C . [LIVMGSTANC] . [AGCN] . {HE} . [GSTADNEKR]

Fig. 6. Homology modelling of the BADH and Os2AP protein structure and comparison of structures. The three-dimensional structure of the rice BADH enzyme and Os2AP enzyme were modelled by comparative protein modelling methods using the program SWISS-MODEL in the optimized mode. The structure of the enzyme was modelled on the basis of its structural similarity with the E. coli BADH (Protein Data Bank entry 1WNB). The degree of identity between the template and the E. coli BADH sequence were 37.23% and 38.65%, respectively, which enabled a preliminary model to be generated by SWISS-MODEL. The sequence alignment was then improved manually; Swiss-PdbViewer 3.7 was used to produce a structure-based alignment and SWISS-MODEL was used in the optimized mode to minimize energy. The nal model was evaluated with PROCHECK, and Swiss-PdbViewer 3.7 was then used to analyze and visualize the structures.

F. DEFICIENCY IN AMADH MAKES AROMATIC PLANTS

As a result of high homology in the protein sequences, it is possible that all 2AP accumulators may utilize similar mechanism as rice. To prove the concept, natural aromatic soybean was used as a case study. Several aromatic soybeans such as Yuagari musume and Kaori hime accumulated seed 2AP in a range of 300500 ppb. In aromatic soybean, loss of GmAMADH2 activity was detected in maturing seeds (Arikit et al., 2010). This suggested that

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

69

similar suppressive mechanism is similar to rice. The GmAMADH2-RNAi was transformed into two non-aromatic soybean varieties, CM60 and Jack. The result showed that the expression of GmAMADH1 was not affected by GmAMADH2-RNAi. Contents of 2AP in CM60-RNAi and Jack-RNAi were detected in a range of 324350 ppb. In conclusion, it is possible to generate aromatic plant varieties by suppressing seed-specic Os2AP-like gene (Fig. 5).

VII. ENVIRONMENTAL ADAPTABILITY OF AROMATIC RICE


Most types of aromatic rice, such as Jasmine, Basmati, and Azucena, are landrace varieties. Breeding high-yielding aromatic rice has been attempted in many countries, but with little success. So far, the high-yielding aromatic rice cultivars developed have shown less intensity of the aromatic compound 2AP than the traditional ones. Is aromatic rice less productive than nonaromatic rice? In light of the biosynthesis of 2AP (Fig. 2), 2AP is the end product of the polyamine pathway in aromatic rice. In non-aromatic rice, -aminobutyraldehyde is converted to GABA and subsequently back to the TCA cycle via succinate. Considering the loss of two nitrogen atoms from a molecule of -aminoaldehyde for the biosynthesis of one molecule of 2AP, aromatic rice seems plausibly less productive than non-aromatic rice, especially under stress conditions. To investigate the latter phenomenon, RNAi and wild-type rice were compared for traits related to productivity (Niu et al., 2008). The results showed reduction of plant height, 1000-grain weight, and overall productivity in aromatic RNAi rice compared to the wild type. Under high-salinity conditions, seedling growth rates were more severely affected by different salt concentrations compared to the wild type. However, the germination of aromatic rice seedlings was unaffected by various salt-stressed conditions. To further investigate salt sensitivity, several aromatic and non-aromatic cultivars were compared for productivity when grown under 22-mM salt solution from 11 weeks post-planting (Fitzgerald et al., 2010). The seed set was severely affected by such salinity conditions in aromatic rice. The authors concluded that Os2AP plays important roles in resistance to salt stresses. However, under salt stress conditions, the ratio of BADH to Os2AP transcripts was high, suggesting that BADH, and not Os2AP, was responsible for salt responses from a molecule of -aminoaldehyde (Fitzgerald et al., 2008). At this end, it is a beginning of new chapters for understanding functional roles of aromatic gene.

70

A. VANAVICHIT AND T. YOSHIHASHI

REFERENCES
Adams, A. and De Kimpe, N. (2006). Chemistry of 2-acetyl-1-pyrroline, 6-acetyl1,2,3,4-tetrahydropyridine, 2-acetyl-2-thiazoline, and 5-acetyl-2,3-dihydro4H-thiazine: Extraordinary Maillard avor compound. Chemical Reviews 106, 22992319. Ahn, S. N., Bollich, C. N. and Tanksley, S. D. (1992). RFLP tagging of a gene for aroma in rice. Theoretical and Applied Genetics 84, 825828. Amarawathi, Y., Singh, R., Singh, A. K., Singh, V. P., Mohapatra, T., Sharma, T. R. and Singh, N. K. (2008). Mapping of quantitative trait loci for basmati quality traits in rice (Oryza sativa L.). Molecular Breeding 21, 4965. Arikit, S., Yoshihashi, T., Wanchana, S., Uyen, T. T., Huong, N. T. T., Wongpornchai, S. and Vanavichit, A. (2010). Deciency in the amino aldehyde dehydrogenase encoded by GmAMADH2, the homologue of rice Os2AP, enhances 2-acetyl-1-pyrroline biosynthesis in soybeans (Glycine max L.). Plant Biotechnology Journal 11310.1111/j.1467-7652.2010.00533.x. Aurisano, N., Bertani, A. and Reggiani, R. (1995). Anaerobic accumulation of 4-aminobutyrate in rice seedlings; causes and signicance. Phytochemistry 38, 11471150. Baker, J. D., Heath, R. R. and Millar, J. G. (1992). An equilibrium and stability study : of ipyrroline. Journal of Chemical Ecology 18, 15951602. Bourgis, F., Guyot, R., Gherbi, H., Tailliez, E., Amabile, I., Salse, J., ` re, A. (2008). Characterization Lorieux, M., Delseny, M. and Ghesquie of the major fragrance gene from an aromatic japonica rice and analysis of its diversity in Asian cultivated rice. Theoretical and Applied Genetics 117, 353368. Bradbury, L. M. T., Fitzgerald, T. L., Henry, R. J., Jin, Q. and Waters, D. L. E. (2005). The gene for fragrance in rice. Plant Biotechnology Journal 3, 363370. Bradbury, L. M. T., Gillies, S. A., Brushett, D. J., Waters, D. L. E. and Henry, R. J. (2008). Inactivation of an aminoaldehyde dehydrogenase is responsible for fragrance in rice. Plant Molecular Biology 68, 439449. Buttery, R. G., Ling, L. C. and Juliano, O. B. (1982). 2-Acetyl-1-pyrroline: An important aroma component of cooked rice. Chemical Industry (London) 12, 958959. Buttery, R. G., Ling, L. C., Juliano, B. O. and Turnbauhg, J. G. (1983). Cooked rice aroma and 2-acetyl-1-pyrroline. Journal of Agricultural and Food Chemistry 31, 823826. Chang, Y. F., Saadi, I. J. and Wilkinson, M. F. (2007). The nonsense-mediated decay RNA surveillance pathway. Annual Review of Biochemistry 76, 5174. Chen, S., Wu, J., Yang, Y., Shi, W. and Xu, M. (2006). The fgr gene responsible for rice fragrance was restricted within 69 kb. Plant Science 171, 505514. Chen, S., Yang, Y., Shi, W., Ji, Q., He, F., Zhang, Z., Cheng, Z., Liu, X. and Xu, M. (2008). Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component of rice fragrance. The Plant Cell 20, 18501861. Costello, P. J. and Henschke, P. A. (2002). Mousy off-avor of wine: Precursors and biosynthesis of the causative N-heterocycles 2-ethyltetrahydropyridine, 2-acetyltetrahydropyridine, and 2-acetyl-1- pyrroline by Lactobacillus hilgardii DSM 20176. Journal of Agricultural and Food Chemistry 50, 70797087. Dhulappanavar, C. V. (1976). Inheritance of scent in rice. Euphytica 25, 659662.

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

71

Fitzgerald, M. A., Hamilton, N. R. S., Calingacion, M. N., Verhoeven, H. A. and Butardo, V. M. (2008). Is there a second fragrance gene in rice? Plant Biotechnology Journal 6, 416423. Fitzgerald, T. L., Waters, D. L. E., Brooks, L. O. and Henry, R. J. (2010). Fragrance in rice (Oryza sativa) is associated with reduced yield under salt treatment. Environmental and Experimental Botany 68(3), 292300. Glaszmann, J. C. (1987). Isozymes and classication of rice varieties. Theoretical and Applied Genetics 74, 2130. Goufo, P., Wongpornchai, S. and Tang, X. (2010). Decrease in rice aroma after application of growth regulators. Agronomy for Sustainable Development doi:10.1051/agro/2010011. Grimm, C. C., Bergman, C., Delgado, J. and Bryant, R. (2001). Screening for 2-acetyl-1-pyrroline in the headspace of rice using SPME/GC-MS. Journal of Agricultural and Food Chemistry 49, 245249. Hein, N. L., Yoshihashi, T., Sarhadi, W. A. and Hirata, Y. (2006). Sensory test for aroma and quantitative analysis of 2-acetyl-1-pyrroline in Asian aromatic rice varieties. Plant Production Science 9(3), 294297. Hibino, T., Meng, Y., Kawamitsu, Y., Uehara, N., Matsuda, N., Tanaka, Y., Ishikawa, H., Baba, S., Takabe, T., Wada, K., Ishii, T. and Takabe, T. (2001). Molecular cloning and functional characterization of two kinds of betaine aldehyde dehydrogenase in betaine accumulating mangrove Avicennia marina (Forsk.) Vierh. Plant Molecular Biology 45, 353363. Hofmann, T. and Schieberle, P. (1998). 2-Oxopropanal, hydroxy-2-propanone, and 1-pyrrolines important intermediates in the generation of the roast- smelling food avor compounds 2-acetyl-1-pyrroline and 2-acetyltetrahydropyridine. Journal of Agricultural and Food Chemistry 46, 22702277. Huang, N., McCouch, S. R., Mew, T., Parco, A. and Guiderdoni, E. (1994). A rapid technique for scent determination in rice. Rice Genetics Newsletter 11, 134137. Huang, T. C., Teng, C. S., Chang, J. L., Chuang, H. S., Ho, C. T. and Wu, M. L. (2008). Biosynthetic mechanism of 2-acetyl-1-pyrroline and its relationship with 1-pyrroline-5-carboxylic acid and methylglyoxal in aromatic rice (Oryza sativa L.) callus. Journal of Agricultural and Food Chemistry 56, 73997404. Itani, T., Tamaki, M., Hayata, Y., Fushimi, T. and Hashizume, K. (2004). Variation of 2-acetyl-1-pyrroline concentration in aromatic rice grains collected in the same region in Japan and factors affecting its concentration. Plant Production Science 7(2), 178183. Jodon, N. E. (1944). The inheritance of ower fragrance and other character in rice. Journal of American Society Agronomy 27, 910921. Kadam, B. S. and Patankar, V. K. (1938). Inheritance of aroma in rice. Indian Journal of Genetics and Breeding 40, 327329. Khush, G. S. (2000). Taxonomy and origin of rice. In Aromatic Rices, (R. K. Singh, U. S. Singh and G. H. Khush, eds.), pp. 513. Oxford and IBH Publishing Co. Pvt. Ltd, New Delhi, Calcutta. Kinnersley, A. M. and Turano, F. J. (2000). Gamma aminobutyric acid (GABA) and plant responses to stress. Critical Reviews in Plant Sciences 19, 479509. Kovach, M. J., Calingacion, M. N., Fitzgerald, M. A. and McCouch, S. R. (2009). The origin and evolution of fragrance in rice (Oryza sativa L.). PNAS 106 (34), 1444414449. Lanceras, J. C., Huang, Z. L., Naivikul, O., Vanavichit, A., Ruanjaichon, V. and Tragoonrung, S. (2000). Mapping of genes for cooking and eating qualities in Thai jasmine rice (KDML 105). DNA Research 7, 93101.

72

A. VANAVICHIT AND T. YOSHIHASHI

Lorieux, M., Petrov, M., Huang, N., Guiderdoni, E. and Ghesquiere, A. (1996). Aroma in rice: Genetic analysis of a quantitative trait. Theoretical and Applied Genetics 93, 11451151. Fushimi, T. and Masuda, R. (2001). 2-acetyl-1-pyrroline concentration of the aromatic vegetable soybean Dadacha-mame. In Proceedings of the Second International Vegetable Soybean Conference, (T. A. Lumpkin and S. Shanmugasundaram, eds.). Washington State University, Pullman, Washington, USAp. 39. Maga, J. A. (1984). Rice product volatile: A review. Journal of Agricultural and Food Chemistry 32, 924970. Nagaraju, M., Choudhary, D. and Balakrishna Rao, M. J. (1975). A simple technique to identify scent in rice and inheritance pattern of scent. Current Science 44, 599. Nagsuk, A., Winichphol, N. and Rungsarthong, V. (2003). Identication of 2-acetyl1-pyrroline, the principal aromatic rice avor compound, in fungus cultures. In Proceedings of the 2nd International Conference on Medicinal Mushrooms & International Conference on Biodiversity and Bioactive Compounds, pp. 395400. Pattaya Exhibition Center, Cholburi, Thailand. Niu, X., Tang, W., Huang, W., Ren, G., Wang, Q., Luo, D., Xiao, Y., Yang, S., Wang, F., Lu, B.-R., Gao, F., Lu, T. and Liu, Y. (2008). RNAi- directed downregulation of OsBADH2 results in aroma (2-acetyl-1-pyrroline) production in rice (Oryza sativa L.). BMC Plant Biology 8, 100. Paule, C. M. and Powers, J. J. (1989). Sensory and chemical examination of aromatic and nonaromatic rices. Journal of Food Science 54, 343346. Prathepha, P. (2009). The fragrance (fgr) gene in natural populations of wild rice (Oryza rupogon Griff.). Genetic Resources and Crop Evolution 56, 1318. Reddy, P. R. and Sathyanarayanaiah, K. (1980). Inheritance of aroma in rice. Indian Journal of Plant Breeding 40, 327. Romanczyk, J. R. L. J., McClelland, C. A., Post, L. S. and Aitken, W. M. (1995). Formation of 2-acetyl-1-pyrroline by several Bacillus cereus strains isolated from cocao fermentation boxes. Journal of Agricultural and Food Chemistry 43(2), 469475. Schieberle, P. (1991). Primary odorants in popcorn. Journal of Agricultural and Food Chemistry 39(6), 11411144. Schieberle, P. (1995). Quantitation of important roast-smelling odorants in popcorn by stable-isotope dilution assays and model studies on avor formation during popping. Journal of Agricultural and Food Chemistry 50, 24422448. Sebela, M., Brauner, F., Radova, A., Jacobsen, S., Havlis, J., Galuszka, P. and Pec, P. (2000). Characterisation of homogeneous plant aminoaldehyde dehydrogenase. Biochimica et Biophysica Acta 1480, 329341. Seitz, L. M., Wright, R. L., Waniska, R. D. and Rooney, L. W. (1993). Contribution of 2-acetyl-1-pyrroline to odors from wetted ground pearl millet. Journal of Agricultural and Food Chemistry 41(6), 955958. Shi, W., Yang, Y., Chen, S. and Xu, M. (2008). Discovery of a new fragrance allele and the development of functional markers for the breeding of fragrant rice varieties. Molecular Breeding 22, 185192. Singh, A., Singh, P. K., Singh, R., Pandit, A., Mahato, A. K., Gupta, D. K., Tyagi, K., Singh, A. K., Singh, N. K. and Sharma, T. R. (2010). SNP haplotypes of the BADH1 gene and their association with aroma in rice (Oryza sativa L.). Molecular Breeding 26, 325338. Sood, B. G. and Siddiq, E. A. (1978). A rapid technique for scent determination in rice. Indian Journal of Genetics and Plant Breeding 38, 268271.

MOLECULAR ASPECTS OF FRAGRANCE AND AROMA IN RICE

73

Tragoonrung, S., Sheng, J. Q. and Vanavichit, A. (1996). Tagging an aromatic gene in lowland rice using bulk segregant analysis. Rice Genetics III, IRRI, pp. 613618. Trossat, C., Rathinasabapathi, B. and Hanson, A. D. (1997). Transgenically expressed betaine aldehyde dehydrogenase efciently catalyzes oxidation of dimethylsulfoniopropionaldehyde and !-aminoaldehydes. Plant Physiology 113, 14571461. Tsugita, T., Kurata, T. and Kato, H. (1980). Volatile components after cooking rice milled to different degrees. Agricultural and Biological Chemistry 44, 835840. Turano, F. J., Thakkar, S. S., Fang, T. and Weisemann, J. M. (1997). Characterization and expression of NAD(H)-dependent glutamate dehydrogenase genes in Arabidopsis. Plant Physiology 113, 13291341. Vanavichit, A., Kamolsukyurnyong, W., Wanchana, S., Wongpornchai, S., Ruengphayak, S., Toojinda, T. and Tragoonrung, S. (2004). Discovering genes for rice grain aroma. In Proceedings of the 1st International Conference on Rice for the Future, 31 August3 September, 2004, pp. 7180. Kasetsart University, Bangkok, Thailand. Vanavichit, A., Tragoonrung, S., Theerayut, T., Wanchana, S., Kamolsukyunyong, W. (2005). Transgenic rice plants with reduced expression of Os2AP and elevated levels of 2-acetyl-1-pyrroline. United States Patent, Patent No. US 7,319,181 B2 Vutiyano, C. (2009). Identication of wild species carrying aromatic allele in rice (Oryza spp.) Kasetsat University, Thailand: Ph.D. Thesis in Philosophy (Tropical Agriculture). Wanchana, S., Kamolsukyunyong, W., Ruengphayak, S., Toojinda, T., Tragoonrung, S. and Vanavichit, A. (2005). A rapid construction of a physical contig across a 4.5 cM region for rice grain aroma facilitates marker enrichment for positional cloning. Science Asia 31, 299306. Wongpornchai, S., Sriseadka, T. and Choonvisase, S. (2003). Identication and quantitation of the rice aroma compound, 2-acetyl-1-pyrroline, in bread owers (Vallaris glabra Ktze). Journal of Agricultural and Food Chemistry 51, 457462. Yajima, I., Yanai, T. and Nakamura, M. (1978). Volatile avor components of cooked rice. Agricultural and Biological Chemistry 42, 1229. Yoshihashi, T. (2002). Quantitative analysis on 2-acetyl-1-pyrroline of aromatic rice by stable isotope dilution method and model studies on its formation during cooking. Journal of Food Science 67(2), 619622. Yoshihashi, T., Nguyen, H. T. T. and Inatomi, H. (2002). Precursors of 2-acetyl-1pyrroline, a potent avor compound of an aromatic rice variety. Journal of Agricultural and Food Chemistry 50, 20012004. Yoshihashi, T., Nguyen, H. T. T. and Kabaki, N. (2004). Area dependency of 2-acetyl-1-pyrroline content in an aromatic rice variety, Khao Dawk Mali 105. Japan Agricultural Research Quarterly 38, 105109.