You are on page 1of 8

Botanical Journal of the Linnean Society, 2009, 159, 237–244.

With 4 figures

Genetic diversity among genotypes of Eryngium


viviparum (Apiaceae): a plant threatened throughout
its natural range
M. CARMEN RODRIGUEZ-GACIO1, JUAN DE JESÚS1, MARÍA I. ROMERO2 and
MARÍA T. HERRERA1*
1
Department of Plant Physiology, University of Santiago de Compostela, 15782 Santiago de
Compostela, Spain
2
Department of Botany, Faculty of Biology, University of Santiago de Compostela, 15782 Santiago de
Compostela, Spain

Received 22 May 2006; accepted for publication 27 June 2008

Eryngium viviparum (Apiaceae) is an endangered aquatic plant, listed as threatened in several European
documents. The genotypes are distributed patchily in various wetlands in the north-west of Spain and one is
located in north-west France. The study of the genetic diversity of a small population of a rare species is important
for conservation and studies aimed at recovery programmes. Random amplified polymorphic DNA (RAPD) markers
were used to assess the genetic diversity among five Spanish and one French genotype. This technique has
contributed to the knowledge of the genetic diversity in E. viviparum, showing a greater genetic distance between
the Spanish cluster formed by S1, S4 than the second cluster formed by S2, S3, S5 and the French genotype.
Mantel testing did not show a significant correlation between genetic and geographical distances, but a significant
correlation was found between altitude, habitat and genetic distance. The French genotype showed the highest
level of polymorphism (28.16) and the highest percentage of exclusive markers (32%). One of these was isolated,
purified, cloned and sequenced, revealing a high homology to a protein mainly expressed in roots. This could
represent, for the F genotype, an adaptation to a specific habitat near the sea compared with the Spanish genotypes
which grow inland. © 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159,
237–244.

ADDITIONAL KEYWORDS: conservation biology – endangered plant – habitat fragmentation – RAPD –


Umbelliferae.

INTRODUCTION This species is an Atlantic region endemic, with a


disjointed and fragmented distribution in the north-
Eryngium viviparum Gay (Apiaceae) is an endan-
west of Spain and France (Brittany) (Fig. 1), and was
gered aquatic plant, growing in flat and depressed
previously present in north-west Portugal (Dupont,
areas subjected to seasonal flooding for about 7–9
1962). At the present time, there is a single known
months of the year. It is listed as a threatened plant
population in France (Annezo, Lesouef & Riviere,
in most European publications [see Annex I of the
1995) and the remaining examples (more than 93% of
Berne Convention, 1979, and the Habitats Directive
E. viviparum of the world) are all located in north-
92/43/EEC (Annex II and IV)], and is considered as a
west Spain (Romero & Rubinos, 2003; Romero, Ramil
priority species in the World Conservation Union
& Rubinos, 2004).
guide, where it has been classified as Vulnerable
Human activities in the landscape, such as drain-
(Anonymous, 1983, 1997).
age or transformation into agricultural systems, have
an immediate and clear impact on populations, which
are either eliminated or fragmented into isolated
*Corresponding author. E-mail: mteresa.herrera@usc.es small-scale patches. All these events contribute

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244 237
238 M. C. RODRIGUEZ-GACIO ET AL.

12 8 4 0 4 8 14

54

50

F
46

S3
S5 S1
42
S4

38

Figure 1. Location of the collected genotypes of Eryngium viviparum included in the study (see Table 1 for sample
abbreviations).

towards the loss of plant biodiversity (Heywood & required. In comparison with microsatellite analysis,
Iriondo, 2003). there are some limitations and shortcomings of
Biological conservation, assessing and maintaining RAPD, such as marker allele dominance (Lynch &
genetic diversity in both nature and germplasm Milligan, 1994) and sometimes low reproducibility,
banks, is an important task in saving endangered which may have discouraged many investigators from
plants. In spite of the interest in the maintenance of using RAPD. However, under carefully controlled
the genetic resources in E. viviparum, its exact dis- reaction conditions, reproducible and interpretable
tribution and the nature of its genetic variability are RAPD banding patterns can be obtained (Sun &
unknown. Wong, 2001; Jover et al., 2003). Potentially, this tech-
Random amplified polymorphic DNA (RAPD) nique is useful in the conservation context for rare
methods aid in this assessment, and are useful in and endangered species, such as E. viviparum,
studies of natural plant populations (Bussell, 1999; because only small quantities of biological material
Nybom & Bartish, 2000). RAPD analysis has certain are required (Rossetto, Weaver & Dixon, 1995;
advantages: it can potentially provide a large number Cotrim, Chase & Pais, 2003).
of reproducible marker loci and high levels of poly- The aim of this study was to examine the genetic
morphism, costs much less, and is faster and easier to variations among six E. viviparum genotypes by the
perform than microsatellite analysis, because no prior RAPD technique. The sample size was limited by the
DNA sequence information for the target species is actual size of the natural populations. Similar prob-

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
GENETIC DIVERSITY IN ERYNGIUM VIVIPARUM 239

Table 1. Origin and location of plant materials collected for random amplified polymorphic DNA (RAPD) survey in
Eryngium viviparum

Latitude Longitude Altitude


Country Province Site of collection (N) (W) (m) Code

Spain (NW of Iberian Peninsula)


Ayoó de Vidriales, Congosta 42°8′ 6°7′ 905 S1
A Espiñeira, Lagoa de Cospeito 43°10′ 7°32′ 380 S2
Melide 42°53′ 7°59′ 449 S3
Otero de Bodas 41°56′ 6°11′ 810 S4
S. Martín de Lamas, Veiga das Insuas 43°15′ 7°32′ 400 S5
France (Brittany)
Brest 47°34′ 3°15′ 12–15 F

lems with this size of sample were found by Sun & the samples were amplified using 35 cycles (94 °C,
Wong (2001), Thomas, Sreejayan & Kuriachan (2001) 15 s; 34 °C, 2 min; 72 °C, 2 min), followed by a final
and Ghany & Zaki (2003). extension of the PCR products for 5 min at 72 °C.

FRAGMENT VISUALIZATION
MATERIAL AND METHODS Amplification products were resolved electrophoreti-
PLANT MATERIAL cally on 1% agarose gels, run at 60 V for 210 min in
Eryngium viviparum plants were obtained from six 1 ¥ Tris-acetate-EDTA (TAE) buffer, and visualized by
genotypes of this species: five were located in Spain staining with ethidium bromide. Lambda DNA
and one in France. The Spanish samples were col- digested with EcoRI and HindIII, ranging from 500 to
lected in the north-west of the Iberian Peninsula and 21 000 bp, was used as a size marker.
one sample was obtained from the only French geno- Imaging gel bands were captured by a Versadoc
type located in Brittany (Table 1). Each Spanish plant scanner (BioRad) and the sizes of all RAPD fragments
was collected in the field and chosen at random from were estimated using Quantity One Software
the small group of plants. The French sample was (BioRad). Only those bands consistently reproduced
obtained from a micropropagated plant, which was in different analyses were considered. Each RAPD
derived from seeds supplied by the Conservatoire reaction was performed at least three times for each
Botanique National de Brest (France). primer.
In vitro cultures of the plants were prepared from
the seeds and grown in Murashige and Skoog (MS) CLONING AND SEQUENCING OF PCR PRODUCTS

solid medium (Murashige & Skoog, 1962). Apical buds PCR products were excised from the agarose gels and
from plantlets were cultured on MS solid medium purified using a Gel Band Purification Kit (Amer-
supplied with zeatin (23 mM) and naphthalene acetic sham Pharmacia Biotech). The purified PCR products
acid (NAA) (0.54 mM). were then cloned in pGEM-T Easy Vector (Promega)
for subsequent transformation in Escherichia coli
strain DH5a. Plasmid DNA was isolated using
DNA EXTRACTION AND AMPLIFICATION Qiaprep Spin Miniprep (Qiagen). The DNA was
Genomic DNA from both indoor and outdoor cultures sequenced with an automated ABI PRISM 3100 DNA
(0.1 g from young, fresh leaves) was extracted using Sequencer (ABI). To minimize sequencing errors, at
the method of Doyle & Doyle (1987) modified because least two independent clones of each amplified RAPD
of the small quantity of plant material available. fragment were sequenced. The multiple DNA
Polymerase chain reactions (PCRs) (Table 1) were sequence alignment was carried out using CLUST-
performed using a Techne Genius thermocycler. ALW (Thompson, Higgins & Gibson, 1994). Sequences
Primers for PCR amplification were obtained from from the E. viviparum RAPD fragments were com-
Operon Technologies and Amersham Pharmacia pared with the EBML plant database information
Biotech. Each RAPD reaction (50 mL final volume) using FASTA algorithms (Pearson & Lipman, 1988).
contained 1.66 U of Taq polymerase (Bioline), 2 mM
MgCl2, 200 mM of each deoxynucleoside triphosphate STATISTICAL ANALYSIS
(dNTP), 0.2 mM of primer, formamide 0.2% and 1 ng of Amplified fragments were scored in terms of the pres-
genomic DNA. After initial heating for 2 min at 94 °C, ence (1) or absence (0) of homologous bands, and a

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
240 M. C. RODRIGUEZ-GACIO ET AL.

matrix of the different RAPD phenotypes was viviparum, an endangered and rare aquatic plant
assembled. We assumed that each band showed the which survives in the north-western part of Spain and
phenotype at a single biallelic locus and that RAPD France. One or two small leaves were used for DNA
markers represented dominant alleles (Williams extraction, thus minimizing the impact on the plants,
et al., 1990). The pairwise distance matrix was com- and so RAPD is likely to be appropriate for the study
puted based on Nei’s coefficient of similarity (Nei & of populations with relatively small sample sizes
Li, 1979) using NTSYS-PC 2.1 Software (numerical (Rossetto et al., 1995; Prathepha, 2000).
taxonomy and multivariate analysis system) (Rohlf,
2000), and a dendrogram was created with the
unweighted pair group method with arithmetic aver- RAPD ANALYSIS
aging (UPGMA). The same presence/absence data One hundred and ten arbitrary primers were
matrix was used to identify the unique markers of screened and 16 (Table 2) showed a high level (up to
E. viviparum which serve to characterize a specific 65%) of polymorphism; these selected primers gener-
genotype. ated 127 consistently well-amplified bands, ranging in
In order to investigate the relationships among size from 522 to 1799 bp, and 93 were polymorphic
genetic and geographical distances and altitude and (73.22%) for the six genotypes.
genetic distance among genotypes of E. viviparum, Table 3 shows the percentage of polymorphic bands
Mantel (1967) tests were computed. All the analyses obtained from a total of 742 bands in the six geno-
were performed at least three times. types: 42.72% were polymorphic. Genotype F, corre-
sponding to the French sample, showed the highest
level of polymorphism (28.16%), and genotype S5,
RESULTS
corresponding to one Spanish sample (Vega das
The results show the first attempt to use RAPD Insuas, see Table 1), showed the lowest percentage of
markers to characterize the genetic variations in E. polymorphic bands (12.53%).

Table 2. Primers and sequences of random decamers, base pair range scored, total bands, polymorphic bands and
percentage of polymorphisms for amplification profiles in Eryngium viviparum genotypes

Total number Number of Polymorphic


Primer Sequence 5′ → 3′ Size (bp) of bands polymorphic bands bands (%)

E-01 CCCAAGGTCC 550–2225 9 6 66.67


E-12 TTATCGCCCC 770–2264 6 4 66.67
E-15 ACGCACAACC 536–1781 9 6 66.67
E-19 ACGGCGTATG 419–2387 13 11 84.62
K-03 CAGAGGTCCC 523–1518 7 5 71.43
K-14 ACGGGAGCAA 443–1525 8 7 87.50
K-26 TGCGAGAGTC 412–1564 8 6 75.00
K-30 ACGGATCCTG 448–2379 7 6 85.71
L-13 ACCGCCTGCT 603–1298 6 4 66.67
L-18 ACCACCCACC 541–2040 9 6 66.67
M-02 ACAACGCCTC 643–1401 5 4 80.00
M-03 GGGGGATGAG 393–1330 8 6 75.00
M-07 CCGTGACTCA 595–1616 4 3 75.00
M-16 GTAACCAGCC 545–2159 6 4 66.67
P-08 ACATCGCCCA 558–2230 15 10 66.67
P-19 GGGAAGGACA 373–1076 7 5 71.43
Total 16 127 93
Average 522–1799 73.27

Table 3. Average percentage of polymorphic bands obtained for the six genotypes of Eryngium viviparum

Sample S1 S2 S3 S4 S5 F

Polymorphic bands (%) 25.47 18.32 20.21 25.20 12.53 28.16

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
GENETIC DIVERSITY IN ERYNGIUM VIVIPARUM 241

Figure 2. Dendrogram of genetic distances among six Eryngium viviparum genotypes derived from random amplified
polymorphic DNA (RAPD) marker data.

DIVERGENCE AT THE GENOTYPE LEVEL


The genetic distances among the six genotypes of
E. viviparum, estimated through RAPD analysis,
showed different values for each sample. The greatest
genetic distance was obtained for the Spanish geno-
types S1 and S5 (0.289) and the closest genetic dis-
tance was obtained for S3 and S5 (0.173). The French
genotype showed intermediate values.
The dendrogram generated from the genetic dis-
tance matrix (Fig. 2) grouped all the genotypes into
two clusters: the first cluster included S1 and S4
with a genetic distance of 0.19; the second cluster
grouped the French genotype with the Spanish 982bp
samples S2, S3 and S5, which constituted a sub-
cluster inside the second cluster. These genotypes
grouped the former samples at 0.25. Thus, from the
clustering of the genotypes, it was shown that the
Spanish samples S2, S3, S5 showed less genetic dis-
tance to the French sample than to the other
Spanish samples (S1, S4).
Mantel’s test was used to observe the relationship Figure 3. Random amplified polymorphic DNA (RAPD)
between genetic and geographical distances by com- profile produced by Eryngium viviparum using the primer
paring pairwise among E. viviparum; the results L-18. The molecular size marker is phage l, and S1, S2,
revealed a nonsignificant correlation (P > 0.05) S3, S4, S5 (Spanish) and F (French) correspond to the
between RAPD and geographical distances (r = 0.233, different genotypes. The arrow indicates the size of the
P = 0.403). Similar results were obtained by Freitas & unique marker (bp) for sample F.
Brehm (2001). Mantel’s test was also useful for study-
ing the relationship between genetic distance and
altitudinal habitats. The French genotype originates and genetic distance revealed a significant correlation
from a low altitude, almost at sea level (12–15 m), (P > 0.05) between them (r = 0.535, P = 0.018). Similar
whereas the genotypes S2, S3 and S5 as a group are results were found by Thomas et al. (2001). Altitudi-
from an intermediate average altitude of 409 m, and nal habitats permitted the classification of the geno-
S1 and S4 are from a high average altitude of 857 m types into three groups, which were the same as those
(Table 1). A comparison of these altitudinal habitats obtained from the dendrogram (Fig. 2).

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
242 M. C. RODRIGUEZ-GACIO ET AL.

TACCACCCACCTTASGTAGATTGTTGASCTTAATAGATCGTASTTGAAAGAGTGATATGG 60

TATTTCCAGAAGTAGCAACAATATTATTCTCCTCCCTGACAACCTCTTCCAACAAAGGAC 120

AATCGTCAACTATTAACTTTTCGAGTTGATGGASATTCTTAMAGACMGAACWMGARGACA 180

GAGCATRTACTCCGCARCTGTTAASTTCAACAACCTTTAACCTTTGGAAACTTAAACTTG 240

GGKAAGGATTTATTAAAAACTGCCCAACATTATGTATTCCGCAGATCCTGATGAGTCCAA 300

TCCCCTCCGAGATGATCCCTCTCGTATCGGCTGCCTGTCCNAGCTCCACGTCWCCTGAAA 360

TGGAATGCCACAGAGAGCCAGGTGGCCCTGGKAAACCTCGGSTGWKASGATGAGTAACAG 420

TAACANTGGTGGGAAGCTTTTTGTGAGAGAGAASACGGTGAGAANGGTATATCGYGASTG 480

YATGTGYGTGTGWGAATASYATGTGCGTAACCSTTTCCATCGGGGAANGGGGGCTTTNAT 540

AKKACCTGNKAGCGTGCTCGTACTCTTACCGNASAAMCGTGMGGTGATATGATGGGAAG 599

TAGTGGAACTTGGACAATTACCGCAGTCAGCACTTTCACATGTGCTGCTAYTAANAGCG 658

YACCGCMTCTGMNAGGTGGTCGTTACAGGNCGAATTCTSTMCCCGWGGCCANCGMNGNC 717

NGTACTTGNAMCACNGMRTCAGYGATTCTCGTYTWGGCWTTTGCRTGAC 766
Figure 4. DNA sequence of the unique marker obtained from primer L-18 in the French (F) sample. Nucleotide
nomenclature: R = A or G; Y = C or T; K = G or T; M = A or C; S = G or C; W = A or T; N = any nucleotide.

MOLECULAR ANALYSIS OF AN EXCLUSIVE MARKER DISCUSSION


From the 110 primers tested, 67 unique markers This study provides the first characterization of the
were detected for the six genotypes. Of these, the molecular genetic DNA diversity among genotypes
French sample showed the largest number (32%), of E. viviparum, an endangered aquatic plant, using
with genotypes S1–S4 displaying values ranging the RAPD technique. RAPD was developed in the
between 9% and 26%; S5 did not show any specific last decade of the 20th century and has become
marker. a successful tool. It has several applications, such
One of the unique markers from the French sample as the characterization of genetic resources in
(Fig. 3) was 982 bp in size. This band was isolated, plants and the identification of species when mor-
cloned and sequenced. The sequenced band was phologic characteristics are not discernible among
766 bp in size (Fig. 4). This was analysed with FASTA individuals (Transue et al., 1994; Wolff & Morgan-
software using EMBL plant database information, Richards, 1998; Nebauer, del Castillo-Agudo &
revealing that it produced high DNA sequence homol- Segura, 2000).
ogy (94%) with the gene At1g80070.1 located on chro- RAPD represents an efficient technique for the gen-
mosome 1 of Arabidopsis thaliana (L.) Heynh. The eration of molecular data with a small amount of
soluble protein encoded by this gene in Arabidopsis is biological material, which is very important in endan-
a splicing factor Prp8, related to a 278.12 kDa band, gered and rare species, such as E. viviparum. It has
located mainly in the plastids and involved in the the capacity to detect a high level of polymorphism.
mitotic cell cycle and cell cycle control. The expression Thus, the average value of the polymorphic bands
of the protein is observed in several parts of the plant, found was 73.27% (Table 2), similar to data obtained
such as the leaves, seeds, siliques and seedlings, but by other authors, including Coletta-Filho et al. (1998)
the protein is mainly expressed in the roots (16%) in mandarins (Citrus spp.), Irwin, Kaufusi & Banks
(data not shown). (1998) in taro (Colocasia esculenta) and Bekessy et al.

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
GENETIC DIVERSITY IN ERYNGIUM VIVIPARUM 243

(2002) in the monkey puzzle tree (Araucaria arau- REFERENCES


cana). RAPD markers were also useful among various Ahmad F. 1999. Random amplified polymorphic DNA (RAPD)
species of Cicer for genetic fingerprinting purposes analysis reveals genetic relationships among the annual
(Ahmad, 1999). Cicer species. Theoretical and Applied Genetics 98: 657–663.
Using genetic distances, we were able to recon- Annezo N, Lesouef JY, Riviere G. 1995. Eryngium vivi-
struct a phylogenetic tree for the six genotypes; parum Gay. In: Olivier L, Galland J-P, Maurin H, eds.
their genetic distances were in the range 0.219– Livre rouge de la flore menacée de France. Paris: Institut
0.25. The Spanish genotypes S1 and S4 showed a d’Écologie et de Gestion de la Biodiversité/Muséum National
larger genetic distance from genotypes S2, S3 and d’Histoire Naturelle, 181.
S5 than from the French genotype. This could be Anonymous. 1983. Liste des plantes rares, menacées et
because the former samples grow in an area shared endémiques en Europe. Strasbourg: Council of Europe.
with another species, E. galioides, and crosses .Anonymous. 1997. Red list of threatened plants. Gland/
between these two species cannot be discounted. In Cambridge: IUCN – The World Conservation Union.
this respect, the position of S1 and S4 is interesting, Bekessy SA, Allnutt TR, Premoli AC, Lara A, Ennos RA,
because these genotypes showed the highest level of Burgman MA, Cortes M, Newton AC. 2002. Genetic
specific markers in the Spanish samples, with 18% variation in the vulnerable and endemic monkey puzzle
for S1 and 26% for S4, and at the same time tree, detected using RAPDs. Heredity 88: 243–249.
showed the highest percentage of polymorphic bands Bussell JD. 1999. The distribution of random amplified poly-
(Table 3). The French genotype has the greatest morphic DNA (RAPD) diversity amongst populations of
Isotoma petrea (Lobeliaceae). Molecular Ecology 8: 775–789.
genetic independence from the others, because it
Coletta-Filho HD, Machado MA, Tragón ML, Moreira
has the greatest number of unique markers (32%)
MC, Pompeu J. 1998. Analysis of the genetic diversity
(data not shown); similar data were obtained by
among mandarins (Citrus spp.) using RAPD markers.
Cotrim et al. (2003).
Euphytica 102: 133–139.
The French genotype also had a representative Cotrim HC, Chase MW, Pais MS. 2003. Silene rothmaleri P.
exclusive marker which was isolated and sequenced. Silva (Caryophyllaceae), a rare, fragmented but genetically
This band showed a high homology (94%) to the gene diverse species. Biodiversity and Conservation 12: 1083–
At1g80070 of Arabidopsis thaliana which codes for a 1098.
plastid protein involved in the control of the cellular Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure
cycle, expressed mainly in roots. This finding is for small quantities of fresh leaf tissue. Phytochemical Bul-
important because of the different habitats of the letin 19: 11–15.
French and Spanish genotypes. The former grows at Dupont P. 1962. La flore Atlantique Européenne. Introduc-
sea level close to the seashore, which may mean an tion á l’étude du secteur Ibéro-Atlantique, Vol. 1. Toulouse:
adaptation to a specific habitat located close to the C.N.R.S. Faculté des Sciences, 414.
sea for this population, whereas the Spanish geno- Freitas H, Brehm A. 2001. Genetic diversity of the Macaro-
types are found at higher altitudes (400–900 m) with nesian leafy liverwort Porella canariensis inferred from
different conditions. RAPD markers. The American Genetic Association 92: 339–
In conclusion, our results indicate that RAPD is 345.
informative and sufficiently powerful to assess the Ghany AA, Zaki EA. 2003. DNA sequences of RAPD frag-
genetic variability in E. viviparum. The genetic varia- ments in the Egyptian cotton Gossypium barbadense.
tion reported provides a basis for the in situ conser- African Journal of Biotechnology 2: 129–132.
vation of genetic resources in this species. With a Heywood VH, Iriondo JM. 2003. Plant conservation, old
problems, new perspectives. Biological Conservation 113:
knowledge of the available genetic structure, an
321–335.
appropriate strategy for the sampling and propaga-
Irwin SV, Kaufusi P, Banks K, de la Pena R, Cho JJ.
tion of E. viviparum may be easily formulated when
1998. Molecular characterization of taro (Colocasia escu-
ex situ conservation is required.
lenta) using RAPD markers. Euphytica 99: 183–189.
Jover MA, del Castillo-Agudo L, Garcia-Carrascosa M,
Segura J. 2003. Random amplified polymorphic DNA
ACKNOWLEDGEMENTS assessment of diversity in the western Mediterranean popu-
lations of the seagrass Posidonia oceanica. American
We are grateful to Jean Yves Lesouef from the Con- Journal of Botany 90: 364–369.
servatoire Botanique National de Brest (France) for Lynch M, Milligan BG. 1994. Analysis of population genetic
providing seeds for the French population, and to structure with RAPD markers. Molecular Ecology 3: 91–99.
Pablo Ramil (University of Santiago de Compostela) Mantel NA. 1967. The detection of disease clustering and a
and Patricio Bariego (Junta de Castilla y León, Con- generalized regression approach. Cancer Research 27: 209–
sejeria de Medio Ambiente) who provided companion- 220.
ship and helped with the fieldwork. Murashige T, Skoog F. 1962. A revised medium for rapid

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244
244 M. C. RODRIGUEZ-GACIO ET AL.

growth and bioassays with tobacco tissue cultures. Physi- Taxones prioritarios. Madrid: Ministerio de Medio
ologia Plantarum 15: 473–497. Ambiente–Tragsa, 694–695.
Nebauer SG, del Castillo-Agudo L, Segura J. 2000. An Rossetto M, Weaver PK, Dixon KW. 1995. Use of RAPD
assessment of genetic relationships within the genus analysis in devising conservation strategies for the rare and
Digitalis based on PCR generated with RAPD markers. endangered Grevillea scapigera (Proteaceae). Molecular
Theoretical and Applied Genetics 100: 1209–1216. Ecology 4: 321–329.
Nei M, Li W. 1979. Mathematical model for studying the Sun M, Wong KC. 2001. Genetic structure of three orchid
genetic variation in terms of restriction endonucleases. Pro- species with contrasting breeding systems using RAPD and
ceedings of the National Academy of Sciences of the United allozyme markers. American Journal of Botany 88: 2180–
States of America 74: 5267–5273. 2188.
Nybom HI, Bartish V. 2000. Effects of life history traits and Thomas G, Sreejayan JL, Kuriachan P. 2001. Genetic
sampling strategies on genetic diversity estimates obtained variation and population structure in Oryza malam-
with RAPD markers in plants. Perspectives in Plant puzhaensis Krish. et Chand. endemic to Western Ghats,
Ecology, Evolution and Systematics 3: 93–114. South India. Journal of Genetics 80: 141–147.
Pearson WR, Lipman DJ. 1988. Improved tools for biologi- Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL
cal sequence analysis. Proceedings of the National Academy W: improving the sensitivity of progressive multiple
of Sciences of the United States of America 85: 2444–2448. sequence alignment through sequence weighting, position-
Prathepha P. 2000. Detection of RAPD variation in a forest specific gap penalties and weight matrix choice. Nucleic
tree species, Melientha suavis Pierre (Opiliaceae) from Thai- Acids Research 22: 4673–4680.
land. Science Asia 26: 213–218. Transue DK, Fairbanks DJ, Robinson LR, Andersen
Rohlf FJ. 2000. NTSYS-PC. Numerical taxonomy system and WR. 1994. Plant genetic resources. Crop Science 34: 1385–
multivariate analysis system, v.2.1. New York: Exeter Soft- 1389.
ware. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA,
Romero MI, Ramil P, Rubinos M. 2004. Conservation Tingey SV. 1990. DNA polymorphisms amplified by arbi-
status of Eryngium viviparum Gay. Acta Botanica Gallica trary primers are useful as genetic markers. Nucleic Acids
151: 54–64. Research 18: 6531–6535.
Romero MI, Rubinos M. 2003. Eryngium viviparum Gay. Wolff K, Morgan-Richards M. 1998. PCR markers distin-
In: Bañares A, Blanca G, Güemes J, Moreno JC, eds. Atlas guish Plantago major subspecies. Theoretical and Applied
y libro rojo de la flora vascular amenazada de España. Genetics 96: 282–286.

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244