You are on page 1of 7

TECHNICAL NOTE

A real-time PCR-based amelogenin Yallele dropout


assessment model in gender typing of degraded
DNA samples
Kyung-Yong Kim & Younghyuk Kwon &
Munkhtsetseg Bazarragchaa & Ae-Ja Park &
Hyowon Bang & Won-Bok Lee & Junyoung Lee &
Kwang-Ho Lee & Bum-Joon Kim & Kijeong Kim
Received: 13 October 2011 / Accepted: 20 December 2011 / Published online: 12 January 2012
#Springer-Verlag 2012
Abstract Allelic dropout due to stochastic variation in de-
graded small quantity DNA appears to be one of the most
serious genotyping errors. Most methods require PCR rep-
lication to address this problem. The small amounts of
valuable samples are often a limitation for such replications.
We report a real-time PCR-based amelogonin Y (AMELY)
allele dropout estimation model in an AMEL-based gender
typing. We examined 915 replicates of AMELY-positive
modern male DNA with varying amounts of DNA and
humic acid. A male-specific AMEL fragment (AMELy)
dropped out in 143 genuine male replicates, leading to
gender typing errors. By graphing a scatter plot of the
crossing point versus the end cycle fluorescence of the
male replicates, a standard graph model for the estimation of
Electronic supplementary material The online version of this article
(doi:10.1007/s00414-011-0663-5) contains supplementary material,
which is available to authorized users.
K.-Y. Kim
:
A.-J. Park
:
H. Bang
Institute for Medical Sciences,
Chung-Ang University,
Seoul 156-756, South Korea
Y. Kwon
:
M. Bazarragchaa
Department of Microbiology,
College of Medicine and Medical School,
Chung-Ang University,
Seoul 156-756, South Korea
K.-Y. Kim
:
W.-B. Lee
Department of Anatomy, College of Medicine and Medical
School, Chung-Ang University,
Seoul 156-756, South Korea
A.-J. Park
Department of Laboratory Medicine, College of Medicine
and Medical School, Chung-Ang University,
Seoul 156-756, South Korea
H. Bang
Department of Physiology, College of Medicine and Medical
School, Chung-Ang University,
Seoul 156-756, South Korea
K.-H. Lee
Department of Life Science, College of Natural Science,
Chung-Ang University,
Seoul 156-756, South Korea
J. Lee
The Hun School of Princeton,
Princeton, NJ 08540, USA
B.-J. Kim
Department of Microbiology, College of Medicine,
Seoul National University,
Seoul 110-799, South Korea
K. Kim (*)
Institute for Medical Sciences, College of Medicine and Medical
School, Chung-Ang University,
221, Heukseok-dong, Dongjak-gu,
Seoul 156-756, South Korea
e-mail: kimkj@cau.ac.kr
K. Kim
Department of Microbiology, College of Medicine and Medical
School, Chung-Ang University,
221, Heukseok-dong, Dongjak-gu,
Seoul 156-756, South Korea
Int J Legal Med (2013) 127:5561
DOI 10.1007/s00414-011-0663-5
the AMELy allele dropout was constructed with the
dropout-prone and dropout-free zones. This model was
then applied to ancient DNA (aDNA) samples. Nine
samples identified as female were found in the dropout-
prone zone; with higher DNA concentrations, six were
shifted to the dropout-free zone. Among them, two female
identifications were converted to male. All the aDNA
gender was confirmed by sex-determination region Y
marker amplification. Our data suggest that this model
could be a basic approach for securing AMELy allele
dropout-safe data from the stochastic variation of degraded
inhibitory DNA samples.
Keywords AMELYalleledropout
.
Ancient bone
.
Real-time
PCR
.
Melting curve analysis
.
Amelogenin
Introduction
DNA analysis of degraded or ancient samples suffers from
reduced reproducibility due to DNA degradation, contami-
nation with other DNA, and the presence of PCR inhibitors
[1]. These conditions severely increase the probability of a
genotyping error [2]. Stochastic variation results in a loss of
the true signals: heterozygote peak imbalance and increased
stutter products and a gain of false signal; allele dropout and
contamination (drop-in) [3]. The most frequent error
reported is allelic dropout [4]. Contamination can be con-
trolled by following stringent laboratory protocols and the
inclusion of multiple negative controls. False alleles are
considerably less frequent and often show an unusual spec-
tral pattern. In contrast, an allele that has dropped out leaves
no trace of itself in the genotype data [5].
Despite many methods introduced to overcome these
problems [1, 6, 7], exaggerated stochastic sampling effects
still occur [8]. This stochastic fluctuation makes interpreta-
tion of the data problematic. When PCR inhibition is sus-
pected, dilution of the extracts is often an undesirable
application involving the highly degraded or otherwise
low-copy templates and is sometimes impossible due to
further reduction of the template amounts [9]. In this study,
we present a comprehensive real-time PCR-based approach
to estimate the amelogonin Y (AMELY) allele dropout in
degraded and low amount DNAs with PCR inhibitors. We
introduce a laboratory standard graph model plotted with
two variables, crossing point (CP) and end cycle fluores-
cence (ECFL), for dropout. The CP is defined as the point at
which the fluorescence rises appreciably above the back-
ground fluorescence. The ECFL is defined as the fluores-
cence at the final cycle of amplification. The standard model
will be a useful guide for the quick tracing of allele dropout
data and securing dropout-safe results in AMEL-based gen-
der typing of degraded samples.
Materials and methods
Modern and ancient human DNA samples
A total of 50 modern DNA samples and 100 ancient DNA
(aDNA) samples were used in this study. The aDNA was
extracted twice from different fragments of ten ancient hu-
man bones excavated from Mongolia and Korea and aged
10010,000 years (ESM 1). Single extractions were carried
out for 90 ancient human bones excavated from Mongolia,
Korea, and Uzbekistan and aged 105,000 years (ESM 1).
We strictly followed a previously described protocol for
aDNA extraction [1, 10].
Real-time PCR
Gender was determined based on the melting temperature
(T
m
) difference of AMEL amplicons produced using pri-
mers that co-amplify large fragments of AMELX (184 bp)
and AMELY (190 bp) and a small Y-specific fragment of
AMELY (AMELy, 92 bp). AMELy binds specifically to a 6-
bp insertion present only in Y-DNA (Table 1). Real-time
PCR was performed using the LightCycler system (version
2.0) (Roche). Reactions were performed with at least dupli-
cate samples in 5 l reaction mixtures containing 2 l
template DNA, 1 l 5x LightCycler FastStart DNA Master-
PLUS SYBR Green I reagent (Roche), 0.15 M AMEL-
specific forward primer (F_amXY), 0.8 M AMELY-
specific forward primer (F_amY), 0.8 M AMEL-specific
reverse primer (R_amXY), 0.9 mg/ml BSA (Ambion), and
DNA/DNase-free deionized water. A 3-l aliquot of the
master mix was placed in the capillaries using an elec-
tronic pipet, and 2 l template DNA was added and
slowly mixed three times. Cycling conditions were pre-
incubation for 15 min at 95C and 45 cycles of 10 s at
95C, 20 s at 56C, and 30 s at 72C. Melting curves
were generated by measuring the fluorescence signal
while raising the temperature as follows: 10 s at 95C,
1 min at 70C, and an increase from 70C to 90C at a
rate of 0.05C/s. The T
m
was measured using Light-
Cycler software V 4.05. T
m
s of AMEL amplicons pro-
duced from modern male and female DNA templates
were estimated by calculations with LC PDS (version
2.0) software before real-time PCR (Table 1).
To quantify the number of amelogenin DNA mole-
cules in the DNA samples, tenfold serial dilutions (from
510
6
to five copies) of purified male (195 and 201 bp)
and female (195 bp) amelogenin PCR products that
were quantified by a NanoPhotometer (IMPLEN) were
tested to generate a standard curve. The PCR conditions
have been described previously [10]. Standard curves
showing trendline correlation coefficients greater than
0.95 were used (ESM 2).
56 Int J Legal Med (2013) 127:5561
Plotting an allele dropout estimation model with CP
and ECFL
To test the sensitivity and reproducibility of the real-time
PCR method, modern male and female DNA samples were
serially diluted with different amounts of humic acid. A total
of 915 male and 135 female DNA replicates were tested. By
graphing a scatter plot of CP versus ECFL values of the
male replicates, a model of AMELy drop-out prone and
drop-out free zones was constructed.
Table 1 Primers used for the detection of amelogenin fragments and calculated melting temperatures (T
m
s) of products
Primer
a
Product
Name Sequence (53) T
m
(C)
b
Target Size (bp) T
m
(C)
b
F_amXY GGTTATATCAACTTCAGCTATGAG 56.6 AMELX 184 79.1
AMELY 190 79.5
F_amY GGATTCTTCATCCCAAATAAAGT 57.1 AMELy 92 77.7
R_amXY GCCAACCATCAGAGCTTAAAC 60.8 AMELX
AMELY
AMELX large fragment of amelogenin gene on X chromosome, AMELY large fragment of amelogenin gene on Y chromosome, AMELy male-
specific small fragment of amelogenin gene on Y chromosome
a
Kim et al. [1]
b
Calculated by using LC PDS software (version 2.0)
68.3%
46.7%
Humic acid 0 ng
0%
20%
40%
60%
80%
100%
100-1000 50 20 10
Template (pg)
Failed
y-dropout
y + X/Y
60 60 0 6 0 6
23.3%
Template 50 pg
0%
20%
40%
60%
80%
100%
0 200 300 400
Humic acid (ng)
Failed
y-dropout
y X/Y
30 30 5 1 0 6
Template 20pg
0%
20%
40%
60%
80%
100%
0 25 50 100 150 200 300 400 500
Humic acid (ng)
Failed
y-dropout
y X/Y
15 30 5 1 0 6 60 0 6 0 6 60 60
Template 10pg
0%
20%
40%
60%
80%
100%
0 25 50 100 150 200 300 400 500
Humic acid (ng)
Failed
y-dropout
y X/Y
15 15 5 1 0 6 60 5 1 0 6 30 30
30%
30%
Fig. 1 Amelogenin real-time PCR sensitivity in male gender determi-
nation with different amounts of male DNA templates and humic acid
(HA). The male-specific small amelogenin amplicon (y) dropped out
with template amounts less than 50 pg for about 30% of the replicates
without HA and for about 18% with HA. PCR failures often occurred
with the smallest amounts of templates or the largest amounts of HA.
X/Y, large amelogenin amplicon of X chromosome and/or Y chromo-
some; y, male-specific small amelogenin amplicon
Int J Legal Med (2013) 127:5561 57
Gender determination of aDNA samples
Gender determination using amelogenin could be erroneous
[1115]. We determined gender by three independent meth-
ods, the amelogenin real-time PCR, a sex-determination
region Y (SRY) PCR [16], and a method using an ABI
PRISM 310 automatic sequencer with AmpFlSTR Mini-
filer

PCR Amplification Kit (ABI). Single extracts of 90


aDNA samples were analyzed at least in duplicate by real-
time PCR and SRY PCR.
Results and discussion
The CP and ECFL values obtained from the AMEL
real-time PCR with male DNA samples were used to
graph a standard scatter plot with experimentally iden-
tified gender and to delineate the Y allele dropout-free
and dropout-prone zones. When a test sample generated
a female result with a CP/ECFL value entering the Y
allele dropout-prone zone of the standard graph, the
gender determination was considered unreliable. The
real-time PCR with a more concentrated sample DNA
could shift the CP/ECFL spot from the unreliable zone
to the reliable zone; this might convert the female
identification to male.
T
m
s for gender determination and AMELy dropout
Only a single distinct T
m
(79.980.5C) of the large
AMELX fragment was identified for 120 female replicates
by real-time PCR (ESM 1; ESM 2). The clear differentiation
of T
m
s of AMELX/Y (80.080.6C) and AMELy (77.9
Humic acid 0 ng
0
5
10
15
20
25
30
35
40
45
1000 100 50 20 10
Template (pg)
C
P
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
E
C
F
L
CP
ECFL
(30/30)
(30/30)
(60/60)
(59/60)
(46/60)
Template 50 pg
0
5
10
15
20
25
30
35
40
45
0 200 300 400
Humic acid (ng)
C
P
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
E
C
F
L
CP
ECFL
(30/30)
(30/30) (15/15)
(0/15)
Template 20 pg
0
5
10
15
20
25
30
35
40
45
0 25 50 100 150 200 300 400 500
Humic acid (ng)
C
P
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
E
C
F
L
CP
ECFL
(59/60)
(58/60)
(25/30)
(58/60)
(59/60)
(6/15)
(57/60)
(58/60)
(0/15)
Template 10 pg
0
5
10
15
20
25
30
35
40
45
0 25 50 100 150 200 300 400 500
Humic acid (ng)
C
P
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
E
C
F
L
CP
ECFL
(46/60)
(10/15)
(10/15)
(52/60)
(52/60)
(7/15)
(25/30)
(25/30)
(0/15)
Fig. 2 Crossing point (CP) and end cycle fluorescence (ECFL) values
produced by replicated real-time PCR with various amounts of tem-
plate DNA and humic acid. CP was inversely proportional to DNA
amount but was directly proportional to HA amount. ECFL values
were inversely proportional to the amount of HA
Fig. 3 A standard graph model for the estimation of AMELy dropout
of unknown DNA samples (a) and its application to ancient DNA
samples (b). a Values of CP versus ECFL of the gender data deter-
mined by real-time PCR from the male replicates were plotted to define
the dropout-prone (shaded) and dropout-free (not shaded) zones. b The
female gender of nine aDNA samples (20 replicates) was located in the
dropout-prone zone based on this model, and the concentration of six
unreliable samples shifted the coordinates to the dropout-free zone.
The genders of three replicates were converted from female to male
(big arrow)
b
58 Int J Legal Med (2013) 127:5561
Int J Legal Med (2013) 127:5561 59
78.5C) for the male identification was possible regardless
of the amount of humic acid. Humic acid decreased the
AMEL T
m
s only slightly. The T
m
of AMELy was detectable
even though those of AMELX/Y were not detected at higher
levels of humic acid. A blind gender test of all 50 modern
human DNAs showed consistent results with the phenotype
(ESM 2).
AMELy dropout began to occur in male templates with
less than 50 pg DNA and at a CP range higher than 34,
regardless of the amount of humic acid (ESM 1; Fig. 1). For
10- and 20-pg male DNA without humic acid (120 repli-
cates), AMELy dropped out in 37 male replicates, and thus,
the gender was falsely determined as female. There was no
significant change in the rate of AMELy dropout for varying
amounts of humic acid. Frequent AMELy dropouts and
PCR failures were observed for the decreased amounts of
DNA.
AMELy allele dropout estimation model
The CP was inversely proportional to the amount of DNA
but was proportional to the amount of humic acid; ECFL
was inversely proportional to the amount of humic acid
(Fig. 2 and ESM 2). The CP was also proportional to the
AMELy dropout rate in the male templates (ESM 1). When
humic acid was added to the templates, the CP ranges in
which the AMELy dropout was not observed were expand-
ed (ESM 1). These data suggested that humic acid increased
the reliable range of CP. For example, the female gender
results with 20 pg DNA and CP 35 were not reliable if the
template had no humic acid but were reliable if the template
contained 25 ng humic acid (ESM 1). It thus appeared that
the amount of humic acid, which could be estimated by
ECFL, should be considered to determine the reliable range
of CP.
We used CP and ECFL values to build a novel standard
graph model for the estimation of the male-specific allele
dropout in the gender determination of unknown aDNA
samples (Fig. 3a). The dropout-prone zone of the plot was
delineated by the CP/ECFL values of the false-positively
determined female data due to the AMELy dropout from
male DNA replicates. The dropout-free zone was deter-
mined by those of the correctly determined male data with-
out the AMELy dropout. This model may be used for the
prediction of AMELy allele dropout of an unknown sample
with the given CP and ECFL values.
Gender determination of aDNA samples with the model
The AMEL real-time PCR gender data from the duplicate
extracts of nine aDNA samples except for one sample
(MN128) were all within the dropout-free zone (ESM 1
and ESM 2). There were no conflicting results among the
three gender typing methods (ESM 1). Low ECFL values of
aDNA samples indicated a large amount of PCR inhibitors.
The CP did not reflect the aDNA amount because of the
interference of PCR inhibitors. Supposing that there was no
PCR inhibition in these ten aDNAs, the copy numbers
would range from 0.9 to 87.3. The real-time PCR-based
gender of one aDNA sample (MN128) showed both genders
from each extract. The female CP/ECFL spots were in the
dropout-prone zone. The results of the other methods were
also inconsistent. Real-time PCR of the concentrated sample
shifted the spots to the dropout-free zone, converting it from
female to male; the SRY marker was also amplified.
From single extractions of 90 ancient human bones,
female identification of nine aDNA samples was unreliable
because their CP/ECFL spots were in the dropout-prone
zone. Upon concentration, the spots of six aDNA samples
shifted to the reliable range, and two were identified as male
(Fig. 3b).
To our best knowledge, this study is the first report of
gender determination based on a melting curve analysis and
of an allele dropout estimation standard model, which can-
not be achieved with conventional PCR. At present, the
recommended way to solve the stochastic variation problem
is simply based on replicated PCR. The advantages of our
method come from real-time PCR technology, which is
rapid, sensitive, quantitative, and DNA- and labor-saving.
Our method, however, has some limitations. First, it
depends on the PCR product T
m
s, so the gender determina-
tion could be difficult for aDNAs with an ambiguous T
m
s. In
these cases, probe-based methods or nested PCR methods
can be used. Second, each laboratory should set up its own
model with CP and ECFL if other real-time PCR conditions
are used. Third, the sizes of AMELX/Y fragments might be
too big for the degraded DNA analysis. However, they are
not larger than the maximum size in the STR analysis kits
developed for the degraded DNA samples. Lastly, gender
determination is based on the amelogenin locus, which is
reported to be unreliable. Therefore, the sole use of our
method is not appropriate for gender determination.
In conclusion, we have developed a method and model
applicable to the assessment of the AMELy allele dropout
potential for degraded DNAs with/without PCR inhibitors.
Further study is required to examine the possible use of our
strategy for estimating the allele dropout in short tandem
repeat genotyping assays.
Acknowledgments We thank Jehyeok Lee and Yeong-mi Chang for
their kind assistance in administration work and purchase of laboratory
materials. We also thank Jee-hyun Yoon for the maintenance of the
real-time PCR system. This research was supported by the Basic
Science Research Program through the National Research Foundation
of Korea (NRF) funded by the Ministry of Education, Science and
Technology (2010-0021367).
60 Int J Legal Med (2013) 127:5561
Ethical standards All sampling was done according to Korean laws
and ethical standards.
Conflict of interest The authors declare that there is no conflict of
interest.
References
1. Kim K, Kim KY, Jeon E, Togloom A, Cho YO, Lee MS, Lkhag-
vasuren G et al (2008) Technical note: improved ancient DNA
purification for PCR using ion-exchange columns. Am J Phys
Anthropol 136:114121
2. Taberlet P, Friffin S, Goossens B, Questiau S, Manceau V, Escaravage
N, Waits LP, Bouvet J (1996) Reliable genotyping of samples
with very low DNA quantities using PCR. Nucleic Acids Res
24:31893194
3. Cowen S, Debenham P, Dixon A, Kutranov S, Thomson J, Way K
(2011) An investigation of the robustness of the consensus method
of interpreting low-template DNA profiles. Forensic Sci Int Genet
5:400406
4. Gagneux P, Boesch C, Woodruff DS (1997) Microsatellite scoring
errors associated with noninvasive genotyping based on nuclear
DNA amplified from shed hair. Mol Ecol 6:861868
5. Miller CR, Joyce P, Waits LP (2002) Assessing allelic dropout and
genotype reliability using maximumlikelihood. Genetics 160:357366
6. Hanson EK, Ballantyne J (2005) Whole genome amplification
strategy for forensic genetic analysis using single or few cell
equivalents of genomic DNA. Anal Biochem 346:246257
7. Strom CM, Rechitsky S (1998) Use of nested PCR to identify
charred human remains and minute amounts of blood. J Forensic
Sci 43:696700
8. Budowle B, Eisenberg AJ, van Daal A (2009) Validity of low copy
number typing and applications to forensic science. Croat Med J
50:207217
9. King C, Debruyne R, Kuch M, Schwarz C, Poinar H (2009) A
quantitative approach to detect and overcome PCR inhibition in
ancient DNA extracts. Biotechniques 47:941949
10. Kim K, Brenner CH, Mair VH, Lee KH, Kim JH et al (2010) A
western Eurasian male is found in 2000-year-old elite Xiongnu
cemetery in Northeast Mongolia. AmJ Phys Anthropol 142:429440
11. Jobling MA, Lo IC, Turner DJ et al (2007) Structural variation on the
short armof the human Ychromosome: recurrent multigene deletions
encompassing amelogenin Y. Hum Mol Genet 16:307316
12. Cadenas AM, Regueiro M, Gayden T, Singh N, Zhivotovsky LA,
Underhill P, Herrera RJ (2007) Male amelogenin dropouts: phylo-
genetic context, origins and implications. Forensic Sci Int
166:155163
13. Kumagai R, Sasaki Y, Tokuta T, Biwasaka H, Aoki Y (2008) DNA
analysis of family members with deletion in Yp11.2 region con-
taining amelogenin locus. Leg Med (Tokyo) 10:3942
14. Yong RY, Gan LS, Chang YM, Yap EP (2007) Molecular charac-
terization of a polymorphic 3-Mb deletion at chromosome Yp11.2
containing the AMELY locus in Singapore and Malaysia popula-
tions. Hum Genet 122:237249
15. Mitchell RJ, Kreskas M, Baxter E, Buffalino L, van Oorschot RA
(2006) An investigation of sequence deletions of amelogenin
(AMELY), a Y-chromosome locus commonly used for gender
determination. Ann Hum Biol 33:227240
16. Drobni K (2006) A new primer set in a SRY gene for sex
identification. Int Congr Ser 1288:268270
Int J Legal Med (2013) 127:5561 61