You are on page 1of 90

UNIVERSITÀ DEGLI STUDI DI VERONA

Scuola di Dottorato in Scienze Biomediche Traslazionali

Indirizzo di Biologia e Applicazioni Cliniche delle Cellule

Staminali

PhD THESIS

Characterization of a novel stem cell population with

neuronal differentiation potential residing in the

leptomeningal niche

Relatore: Dr. Mauro Krampera

Dottorando: Dr. Francesco Bifari

XXI Ciclo - Anno Accademico 2008-2009

Background pg. 4

1. Stem cells with neuronal differentiation potential pg. 4
2. 1.1 The stem cell concept pg. 4
1.2 Stem cells with neuronal differentiation potential pg. 5
1.2.i Development of the central nervous system pg. 7
1.2.ii Adult neurogenesis and adult neural stem cells pg. 11
1.2.iii Other somatic stem cells with neuronal /neuronal-like pg. 14
differentiation potential

2. Stem cell niche pg. 21
2.1 Neural stem cell niche pg. 24
2.2 Leptomeninges pg. 29
2.2.i Anatomy pg. 29
2.2.ii Embriology pg. 33
2.2.iii Role of the leptomeninges in corticogenesis pg. 34

Aims of the study pg. 36

Materials and Methods pg. 41

Results pg. 49

Discussion pg. 76

Conclusion pg. 83

References pg. 84

2

Background

1. Stem cells with neuronal differentiation potential

1.1 The stem cell concept

Stem cells are immature cells that are uniquely capable of both differentiation, thus

producing mature daughter cells that carry out particular tissue functions, and self-

renewal, thus sustaining and replenishing tissue stem cell pool. Stem cells play a critical

role in the establishment of embryonic/foetal tissues during development and in some

cases are retained into adulthood, where they support ongoing replacement of short-lived

mature effector cells, as well as injury-induced repair of degenerating or damaged

daughter cells (Boiani and Scholer, 2005; Slack, 1985). Thus, the adult vertebrate body

retains populations of stem cells that can produce both more stem cells and a population

of cells that can undergo further development (Slack, 1985). The formation of tissue-

specific stem cells is an aspect of organogenesis (Weissman, 2000). Regional

specialization in embryonic development proceeds as a hierarchy. Starting from the

blastula (or blastoderm, or epiblast, depending on the species), any particular tissue

rudiment or cell type is formed by a sequence of developmental decisions. Different

concentrations of the inducing factor will result in the activation or repression of genes

encoding different transcription factors, and therefore the adoption of different

developmental pathways (Tavian and Peault, 2005). Tissue-specific stem cells will be in

a state of developmental commitment similar to that of the embryonic rudiment that

produced them. There is clear evidence of the presence of pluripotent cells in the

postnatal tissues. Such cells are reported to have a developmental potency much wider

than that of tissue-specific stem cells and in some cases resembling embryonic stem cells

(ESC). For example, mesenchymal adult progenitor cells (MAPCs) are cells isolated

3

rat. However.. neurons are one of the most highly specialized. and sperm cells in males is a steady-state equilibrium. or human bone marrow that can be expanded indefinitely and differentiate into most cell types of the body (Jiang et al. Marrow-isolated adult multilineage inducible (MIAMI) cells are a cell population from human bone marrow that may form neurons and pancreatic islet–like structures.5 grams of skin cells through sloughing and about 1011 red blood cells through spleen hemocateresis. Each day. cellular turnover.from the mesenchymal stem cell (MSC) pool of mouse. post-mitotic cells with a wide variety of shape. 1. cannot be replaced if they are damaged or lost. as well as the usual mesenchymal progenitors (D'Ippolito et al. If pluripotent cells do not exist in vivo in the normal postnatal organism. The turnover of blood cells. 2002). intestinal crypt cells. 2008). However. 2004). which allow efficent processing and transmission of cellular signals anywhere in the CNS. at present there is no definitive evidence that such cells exist in vivo. stem cells can produce either more stem cells or more differentiated cells if body equilibrium is stressed by injury or environment perturbation. and neurons under suitable conditions. adipose tissue. there are several tissues in which cells are constantly dying and replaced. neuronal differentiation occurs in the embrionic stem cells of 4 . Most neurons and bones..2 Stem cells with neuronal differentiation potential Among differentiated cells. and electrochemical properties. size.. it would be necessary to label one cell in situ and show that it gives origin to many tissue types. we lose and replace about 1. In most cases. Pluripotent stem cells (PSCs) can be isolated from many mouse tissue (Howell et al. Many adult tissues have slow. To this purpose. During development of the CNS. in which cell production balances cell loss (Sassone-Corsi. for instance. epidermal cells. 2003) and differentiate into muscle. then they must arise at least during in vitro culture. if any.

obtained from the inner cell mass (ICM) of the blastocyst. even if this process was not complete. cellular cross talk.. 2008). retinal progenitor cells and neural crest-derived stem cells. the typical morphology (dendrites and axon) and functions (pre. i. action potentials) (Sieber-Blum and Hu. including neuronal differentiation potential (Schwartz et al.and postsynaptic components.e.the neuroepithelium of the neural tube. the induced pluripotent stem (iPS) cells are cells that have been reprogrammed to a state similar to that of ES cells by the introduction of a small number of specific transcription factors (Maherali and Hochedlinger. Neurogenesis occurs in vivo in two regions of the adult mammalian brain. Mesodermal and endodermal organs-derived stem cells have been successfully induced to differentiate into neuronal lineage. In vitro. 2008). such as olfactory mucosa stem cells. and eventually interactions between the growing organism and the 5 .. NSCs can be in vitro expanded and then differentiated into neurons (Temple. including stem cells of neuro-ectodermal derivation. Finally.. Other kinds of somatic stem cells with remarkable plasticity can differentiate into neuronal lineages. persist and proliferate giving rise to new neurons throughout life. These cell types generate neuronal differentiated cells. 2001a).2i Development of the central nervous system The complex architecture of the adult brain is the final product of genetic information. have been shown to give fully differentiate cells with neuronal phenotype both in vitro and in vivo (Daadi et al. 2008. 1. called neural stem cells (NSCs). Hong et al. All the pluripotent cells isolated from the postnatal organism have shown neuronal differentiation potential (Howell et al.. 2008). i. 2008). iPS cells can be expanded and exibit pluripotency.e. neurotransmitters and their receptors. Here somatic adult stem cells. 2003). the hippocampus and the subventricular zone. In vitro cultured ESCs. with most of the highly specialized neuronal features.

the initial generation of neurons from undifferentiated precursor cells. 2001): the lateral margins of the neural plate then fold inward. Neural crest cells migrate away from the neural tube along specific pathways that expose them to additional inductive signals that influence their differentiation. Specific inductive signals cause the differentiation of a subset of neuroectodermal cells into neural precursor cells. which then give origin to the various organ systems of the body. including the neurons and glia of the sensory and visceral motor (autonomic) ganglia. As results of major cell movements (invagination and spreading) during gastrulation. These early events include the establishment of the primordial nervous system in the embryo. As a result. a third population of cells emerges in the region where the edges of the folded neural plate join together. when the cells are typically arranged to form a hollow sphere. The part of ectoderm immediately above the notochord is called neuroectoderm and originates the entire nervous system. Gastrulation involves the drastic remodelling of the blastula cells into the three germinal layers: ectoderm.external world. neural crest cells give rise to a variety of progeny. At the most dorsal limit of the neural tube. These processes make possible the subsequent formation of axon pathways and synaptic connections. eventually transforming the neural plate into a tube. the notochord. 2000). Neurulation (Colas and Schoenwolf. is formed and comes to define the embryonic midline. a distinct cylinder of mesodermal cells. the formation of the major brain regions. is followed by the transformation into gastrula. mesoderm and endoderm. the 6 . and the migration of neurons from the sites of generation to their final sites (Doe and Sanes. CNS development begins from the very early phases of the embryo development: the gastrulation and the neurolation. Gastrulation (Altmann and Brivanlou. 2001): the stage of blastula. These neuroectodermal cells proliferate into a distinct columnar epithelium called the neural plate. this set of precursors is called the neural crest. Because of their location.

diluted by the production of restricted progenitors and differentiated cells. the generation and differentiation of the permanent brain neurons and glia begin. Except for a few specialized areas (i.neurosecretory cells of the adrenal gland. The analysis of adherent clone production suggests that stem cells are prevalent at early stages. and the neurons of the enteric nervous system.5 mouse anterior neural plate cells make neurospheres (Roszko et al. all generated over the course of only a few months from a small population of precursor cells. 2002). They also contribute to a variety of non-neural structures such as pigment cells. Once the neural tube has developed into a rudimentary brain and spinal cord. in spinal cord it drops to 10% at E12 and 1% at postnatal day 1 (P1) (Altman and Bayer. Notably. the entire neuronal population of the adult brain is produced during a time window that ends before birth (Gage. and bone. over 50% of the viable cells at 24 hours are stem cells (Fontaine-Perus et al. stem cells seem to be much rarer using neurosphere assay: only 0.. In telencephalon from E10 mouse. subventricular zone and olfactory bulb). Perhaps neurosphere-generating cells are a subpopulation of early stem cells. 2007). But the frequency of stem cells declines rapidly. are dividing stem cells that simmetrically produce more precursors. 7 . 1977). In spinal neural tube from embryonic day 8 (E8) rat.000 new neurons are generated each minute at the peak of cell proliferation during gestation. 1989). 1996). for example. known as neural precursor cells. or perhaps stem cells at this age are more prevalent in spinal cord than in anterior regions.e. cartilage. In the subventricular zone there is an extraordinary mitotic activity: it has been estimated that about 250. Most of the pre-migratory neural crest consists of stem cells. The mature mammalian brain contains about 100 billion neurons and many more glial cells.3% of E8. Cells of the neural tube. estimated stem cells range from 5 to 20% (Caviness et al. hyppocampus...

Scott F.In the rodent cerebral cortex. inserire nel testo il riferimento a figura Figure 1. 6th Edition (2000). In early stage of development (E14) the pre-plate splits into a superficial layer (MZ prospective I layer) and an underling layer (sub-plate) (Bayer and Altman. neurons are generated from embrionic day 12 (E12) to E20 while glia is generated post-natally (Altman and Bayer. Gilbert. Massachusetts. 4) The neural folds are brought into contact with one another. ISBN 0-87893-243-7). Cerebral cortex is formed within a cell-dense layer. leaving the neural tube separate from the epidermis.B. 2) The neural folds are elevated as presumptive epidermis continues to move toward the dorsal midline. (B. 8 . (D. N. 3) Convergence of the neural folds occurs as the dorsolateral hinge point (DLHP) cells become wedge-shaped and epidermal cells push toward the center. The neural crest cells then disperse. (Developmental Biology. Sunderland. 1990). (C. while the presumptive epidermal cells move towards the center. Folding begins as the medial neural hinge point (MHP) cells anchor to notochord and change their shape. and the neural crest cells link the neural tube with the epidermis. 1977). called cortical plate (CP). Publishers.

. Although they express the astrocyte marker GFAP.2ii Adult neurogenesis and adult neural stem cells Adult neurogenesis Neurogenesis in the brain of adult mammals occurs throughout life and has been clearly demonstrated at two locations under normal conditions: the subventricular zone (SVZ) of the lateral ventricles and the subgranular zone (SGZ) of the dentate gyrus in the hippocampus. Type 2 Sox2-positive cells can self-renew and give rise to neurons and astrocytes. These cells express nestin. Two types of neural progenitors can be identified in the SGZ according to their specific morphology and expression of unique sets of molecular markers. 2004). which 9 . the differentiation and fate determination of progenitor cells. Adult neurogenesis is finely tuned at all levels. maturation.1. Sox2 (Fukuda et al. Type 1 hippocampal progenitors have a radial process spanning the entire granule cell layer and ramify in the inner molecular layer. and the Sry-related HMG box transcription factor. 2008). which is important for learning and memory processes (Kempermann and Gage. Garcia et al. glial fibrillary acidic protein (GFAP). and integration of new neurons (Kokovay et al. 2003. including the proliferation of adult NSCs or progenitors. these cells may be required for certain forms of brain function involving the olfactory bulb and the hippocampus. 1999). Neurons developed in the adult SGZ migrate into the granule cell layer of the dentate gyrus and become dentate granule cells. but direct evidence proving this relationship is still lacking. 2008).. Recent studies also showed that newborn neurons in the adult brain integrate into the existing circuit and receive functional input (Zhao et al... Furthermore. Type 2 hippocampal progenitors have only short processes and do not express GFAP. these cells are morphologically and functionally different from mature astrocytes. Type 2 cells may arise from type 1 cells. and the survival. Neurons developed in the adult SVZ migrate over a great distance through the rostral migratory stream and become granule neurons and periglomerular neurons in the olfactory bulb.

SVZ (D). NeuN. (2008). inserire nel testo il riferimento a figura Figure 2. and inset in (E) is a high- magnification view of the area indicated by the arrow in (E). 2007). Neurons generated in the SVZ migrate through the rostral migratory stream and are incorporated into the olfactory bulb. Colors indicate the following: red. (Zhao. rostral migratory stream (C). Insets are high-magnification views of the cells indicated by arrows. and dentate gyrus (E). Mechanisms and functional implications of adult neurogenesis. NeuN. blue. a thin cell layer N.B. (F and G) Newborn neurons in the olfactory bulb and dentate gyrus labeled by retrovirus-mediated expression of green fluorescent protein (GFP). Neurogenesis in the Adult Rodent Brain (A) Depictions of sagittal and coronal views of mouse brain in areas where neurogenesis occurs.provided the first in vivo evidence of stem cell properties of hippocampal neural progenitors (Suh et al. Johansson 10 . Colors indicate the following: red. etal. C.. BrdU. Red areas indicate the germinal zones in the adult mammalian brain: the subgranular zone (SGZ) of the dentate gyrus in the hippocampus and the subventricular zone (SVZ) of the lateral ventricles. (B–E) Neurogenesis revealed by BrdU incorporation in the olfactory bulb (B). Inset in (C) is a sagittal view of rostral migratory stream before reaching the olfactory bulb. GFP. The SVZ is located next to the ependyma. Cell 132. green. green.) that lines the lateral ventricles of the brain. 2009. Ependymal cells have been suggested to be the adult NSCs responsible for neurogenesis in the SVZ (Carlen et al.. 645-660. DAPI.

. by which they can be recognized. Isolated adult SVZ-NSCs proliferate in the presence of the mitogenic epidermal growth factor (EGF) to form spheres of proliferating undifferentiated neural cells (neurospheres) (Reynolds et al. 1992). Adult neural stem cells The discovery of NSCs in the adult mouse brain was allowed by the creation of a novel culture system subsequently termed ‘neurosphere assay’ (Reynolds and Weiss. type C transit amplifying cells and type A migrating neuroblasts. cell culture remain one of the most reliable methods to study neural development. but type C and A cells can also be identified by bromodeoxyuridine (BrdU) and 3H- thymidine labelling and by specific molecular markers. Cells within the SVZ contribute to long-term neurogenesis in the olfactory bulb (Consiglio et al.. 1999). Doetsch et al. The identification of SVZ progenitors was mainly based on morphological analysis by electron microscopy. Type B GFAP-positive neural progenitors in the SVZ are less susceptible to antimitotic treatment and may be relatively quiescent (Doetsch et al. doublecortin (DCX) and the polysialylated neural adhesion molecule (PSA-NCAM). NSC functions. This progression can be examined in vivo or in vitro (Chojnacki et al. 1999). that ependymal cells are quiescent and do not have the properties of NSCs in vitro (Capela and Temple.. 2002. Unique markers or specific selection criteria do not exist for adult periventricular NSCs yet.et al. These results demonstrated the two functional attributes that define stem cells: self-renewal and multipotency. cells express different antigens. such as Dlx2. 1992).. These neurospheres could be either serially tranferred to form further neurospheres or differentiated both in vitro and in vivo into neuronal and glial cell types (Chojnacki and Weiss. 1999). Three types of precursor cells exist in the SVZ: type B GFAP- positive progenitors. 2004). however. 2008).. Along the NSC lineage. 11 . Several studies have shown. Thus.. 2009).

2003. Suslov et al. Rietze et al. 2002. which contain a mixture of stem cells. 1998).. neurosphere formation does not conclusively indicate that in vivo NSCs have been isolated or that one neurosphere arises from one NSC. Fibroblast growth factor (FGF-2) plus epidermal growth factor (EGF) supported expansion of a distinct subset of progenitor cells attached to tissue culture plastic in a defined basal media.. 1990. Ying et al.. 2005). Over the years. Actively proliferating progenitors also generate neurospheres in vitro and the calculated frequency of bona fide stem cells in culture is low (Capela and Temple.2iii Other somatic stem cells with neuronal/neuronal-like differentiation potential Embryonic stem cells NSC can be derived from embryonic stem cells (ESC) differentiated into heterogeneous neuroepithelial progenitors in adherent monolayer culture (Cattaneo and McKay. although down-modulating the expression of Sox1. They may represent a pure stem cell source with experimental advantages comparable with ES cells. Adherent NSCs appear to be clonogenic. NSCs can be cultured also as monolayers (Pollard et al. Instead. 2001). thus overcoming the complexity of neurosphere cultures. 2006). However. These cells lost the heterogeneous morphology and marker expression of the primary neuroepithelial population (Li et al.plasticity and therapeutical potential.. 2002). apparently homogenous and symmetrically expandable. over several passages. and differentiated cells (Bez et al. Adherent NSC lines from adult forebrain have been established (Conti et al. some of these allow the generation of mature cells through an intermediate step represented by progenitor cells capable of growing for some time in 12 .. the cultures acquired a homogeneous morphology and uniformly expressed nestin and Sox2. 2003). committed progenitors. several in vitro systems have been described for the derivation of neural progeny from ES cells... Only a neurosphere generated from a single isolated cell can truly be considered to be clonally derived. Notably. 1.

NSCs-ESC become electrophysiologically active neurons and acquire the typical features of maturing neuronal cells (Lundberg et al. neural differentiation of NSC-ESC cells initially includes the conversion to a transient Sox1-positive pan- neural progenitor cell population. Tropepe et al. 1997). 2003. retinal neurogenesis ends by the early postnatal period (Reh and Fischer. 2000). 2006). Rakic.vitro and generating differentiated progeny upon changes in culture conditions (Dhara and Stice. such as astrocytes. containing a subpopulation of cells that maturate into a specific Sox1-negative step without differentiating. 2008). 2000. GABAergic and dopaminergic neurons. providing an accessible source of 13 . and Pax6 (Gotz.. olfactory mucosa. and then may be stably maintained and expanded using EGF plus FGF-2. In vitro. NSCs-ESC display many hallmarks of radial glia as for morphology and molecular markers. in vivo progenitor cell proliferation and neuronal differentiation are no longer evident. RC2.. In mammals. Olfactory mucosa stem cell Neurogenesis continues throughout adult life in mammal. These protocols have been widely used to generate a variety of differentiated neural cell types. oligodendrocytes. 2003). When exposed to appropriate neuronal differentiating conditions. retinal progenitor cells (RPCs) may proliferate and originate all of the cell types of the neural retina (MacLaren et al. multipotent progenitor cells give rise to the neurons and Müller glia of the mature retina.. Although a small number of quiescent retinal stem/progenitor cells persists at the margin of the mature retina near the junction of the ciliary epithelium (Ahmad et al. and glutamatergic. including human. Retinal progenitor cells During retinal development. Thus. 2006).. GLAST. including brain lipid binding protein (BLBP).

2000).... and oligodendrocytes in vitro. 2005). Neural crest-derived stem cells Neural crest is an embryonic cell population that seems to undergo a more stochastic type of differentiation. SKPs can be labelled by wnt1-Cre. as compared to other embryonic progenitor cells. Stem cells from postnatal periodontal ligament (PDL) have the characteristics of neural crest-derived stem cells. 2007). and therefore it is not surprising that some precursors of these cell types may persist up to the postnatal period (Toma et al.(BM). In the head of the mouse embryo.. 2007). There is evidence for the neural crest origin of at least two other cell types: skin-derived precursors (SKPs) and MSCs (Chai et al. The skin normally contains various neural crest cell types. Human olfactory NSCs can be grown as neurospheres. including melanocytes and Merkel cells. Moreover. glia.(AT) derived mesenchymal stem cells (MSCs) 14 . In addition human scalp tissue contains stem/progenitor cells with mesenchymal and neurogenic differentiation potentials (Shih et al. 2001). astrocytes. a marker of cranial crest. as they are capable of differentiating into both neural and mesodermal progeny including peripheral nerves. are multipotent. and they also retain expression of various crest-type genes.. and skeletal muscles (Techawattanawisal et al. as well as many non-neural cell types in vitro and in vivo (Murrell et al.. murine SKPs can differentiate into Schwann cells (SCs) and improve locomotion recovery in an animal model of spinal cord injury (Biernaskie et al. and differentiate into neurons. 2005).neuroblasts and stem cells (Roisen et al. Bone marrow. adipose tissue. 2000)..

.. 2005. The treatment of BM-MSCs with different molecules and growth factors induced very rapid morphological changes that are typical of neural cells. 2007. and neurons (Anghileri et al. including hepatocytes (Sato et al. However. 2006). 2006). 2000).. MAP-2. The ability to differentiate into multiple cellular phenotypes in vitro and in vivo.. When human BM-MSCs are injected into the dentate gyrus (DG) of the hippocampus in adult immunodeficient (ID) mice. 2003. such as nestin. 2008. Woodbury et al.. neurofilaments. morphological and phenotypic changes are not necessarily associated with definite electrophysiological properties of neurons (Wenisch et al. recent observations suggest that only small numbers of the cells engraft into injured tissues.. but also into tissues of endodermal and neuroectodermal lineages... Krampera et al. Wislet-Gendebien et al. These and other observations underlined the paracrine effects of MSCs (Caplan and Dennis. 2005). 2003. and neural differentiation of the endogenous NSCs (Munoz et al. or Neu-N (Bonilla et al. 2007... Woodbury et al. migration. but then they disappear quickly (Zietlow et al. epithelia (Kotton et al. 2001). Long et al. 2005. The beneficial effects of MSCs in neurodegenerative or ischemic models of brain injury may be explained with the enhanced neuroprotection 15 . Munoz-Elias et al. adipocytes. In fact.. however. together with the expression of neural markers. 2005. and chondrocytes). most of the cells disappeared within 1 week. Jiang et al. they enhanced proliferation. 2008). 2005). Bonilla et al. However. Krampera et al..BM-MSCs are multipotent non-hematopoietic progenitor cells capable of differentiating not only into various tissues of mesodermal origin (fibroblasts. make MSC interesting for regenerative medicine.. 2005.. the acquisition of neuron-like excitability has been observed after co-culture with mature neural cells or transplantation into the brain (Alexanian.. 2005). osteocytes. 2000)..

2004). Cord blood. and acquire electrophysiological properties (Anghileri et al.. neural-like differentiation of human MSCs obtained from spleen and thymus. Umbilical cord blood and cord stroma stem cells Umbilical cord blood is known to contain CD34+ or CD133+ stem cells.. (Deng et al. Ohtaki et al. intermediate filament M (Krampera et al.and CD45. such as endothelial progenitors. 2004). induced either with chemical factors or with co-culture with human Schwann cells has been described (Krampera et al. 2002). rather than with the increase of neurogenesis. which are very similar to those from the bone marrow (Chen et al. electrical excitability of the neurons-like cells) have not been clarified. Using a complex neurogenic differentiation protocol... 2007. 2002. NeuN. the extent of differentiation and functions of the differentiated cells (i.and modulation of inflammatory/immune responses. 2005). 2008). 2006. astrocytic.. In vivo injection of human AT- MSCs in ischemic rat brain showed enhancement of functional recovery (Kang et al. also contains other types of multipotent stem cells. 2004). When 16 . and oligodendroglial markers by retinoic acid (Jang et al.. 2003). CD133+ stem cells sorted out by flow cytometry could be induced to express neuronal.MSCs that could be isolated and propagated through adherent cultures (Lee et al. nestin. which can be used for bone marrow transplant (Rocha et al. 2004).. Kogler et al. express glial fibrillary acidic protein (GFAP). both murine and human AT-MSCs develop the neuronal phenotype. however. 2008).. 2007).. 2007). particularly CD34. Other types of progenitor cells.. Neural differentiation potential of cord blood-derived cells is more frequently associated with mesenchymal-like stem cells (Buzanska et al. However..e. Safford et al. Moreover... have also been isolated from cord blood (Nagano et al. 2006). Incubation of AT-MSC under neuroinductive conditions can create a cell population expressing the neuronal differentiation marker type III ß-tubulin (Romanov et al...

2004. Both mouse and human iPSC grow under the same culture conditions used for ESC maintenance (Akutsu et al. Oct4 and Sox2 linked with 2A peptides. Differentiated cells expressed neuronal. 2002). This transgene can be removed once 17 . Klf4 and Nanog) can reprogram permanently differentiated cells to pluripotency (Maherali and Hochedlinger.. astrocyte. c-Myc. Non-viral transfection of a single multiprotein expression vector. These cells could then be induced to different degrees of neural-like differentiation by using a combination of morphogens. 2002).. epidermal growth factor (EGF)... Sun et al. Klf4. such as nerve growth factor (NGF). Several attempts have also been made to examine the survival and fate of human umbilical cord blood-derived stem cells transplanted into rodent brains (Coenen et al. 2008). the overexpression of transcription factors known to be important in controlling the pluripotent state of ES cells (such as Oct4. Kogler et al.mononuclear cells from cord blood are cultured. Interestingly. 2002. such as retinoic acid. iPSCs can be differentiated into exitable cells with neuronal phenotype (Eminli et al. CD34. In similar conditions. as well as ion channels (Sanchez-Ramos. and oligodendrocyte markers (Buzanska et al.and CD45. and basic fibroblast growth factor (bFGF). and growth factors. The two arteries and the vein of the umbilical cord are sorrounded by an extracellular matrix of proteoglycan-rich connective tissue stroma called Wharton's jelly.. 2008). Endothelial and subendothelial cells can be isolated from umbilical cord vein and culture as fibroblast- like cells. 2003). Sox2. 2005).. 2005. Zigova et al. osteogenic and neurogenic potential (Mitchell et al. may reprogram both mouse and human fibroblasts.. iPS Under certain culture conditions. but contradictory results have been produced by different groups. these cells appeared multipotent in terms of adipogenic. which comprises the coding sequences of c-Myc.could be selected on the basis of their growth as adherent cells.. 2006).

reprogramming has been achieved. 18 .. minimizing the genome modification in iPS cells and enabling the complete elimination of exogenous reprogramming factors (Kaji et al. 2009) .

however.e. new hair follicles form in adult skin when Wnt signalling is upregulated (Andl et al. Crypts usually duplicate when the number of stem cells or stromal cells exceedes a critical threshold (Yen and Wright. it increases age. paracrine and even endocrine signals (Scadden. intestine and brain. excess of Hh signalling expands the size of the stem cell niche and may create new niches (Takashima et al. 2006). which are all integrated to provide the proper regulation and maintenance of the stem cell properties. and cell-to-ECM contact regulate the behavior of cells during development. The number of niches decreses during development and in response to environmental factors. In Drosophila ovary. such as growth factors. For example. in many tissues. there are many more gut crypts in adults than in newborns. 2008).. Despite tissue specificity. Stem cell signalling is based on direct interactions with resident niche cells or extracellular matrix molecules or soluble autocrine. proliferating committed progenitor cells.. which is essential to build organs and tissues during development and to mount localized tissue defense and repair in case of damage. hematopoietic tissue. cell-to-cell contact. Extrinsic signals. regenerative. The niche may influence indirectly also the spatial organization of stem cell progeny. For instance. Experimental manipulations show that certain signals may induce also de novo the production of niches. the different niche architecture shares many components. epidermis. 2008). Mammalian adult stem cell niches have been described in many tissues including the gonads (testis). including self-renewal and differentiation. as well as embryonic and adult stem cell biology (Morrison and Spradling. A niche consists of a local tissue microenvironment capable of hosting and maintaining one or more stem cells. 2006). i. Generative.2. The 19 . Stem cell niche Homeostasis is the process by which organisms survive and maintain a very complex dynamic equilibrium within their internal milieu. 2002). and immunological functions of tissue-specific stem cells implyes the proper localization (niche) of these precursors.

. in epidermal stem cells. although their relative contribution differs from niche to niche.. Willert et al.regulated expression of these signals controls the niche growth during development. ovary stem cells respond to nutritional levels (Ray et al. 2003. Hormonal cycles regulate the proliferation of stem cells in breast. They may regulate survival.. cell cycle kinetics. 2003). surviving stem cells are induced to divide equally into stem cells and spermatogonia (Judas et al. Wnt molecules act as hematopoietic stem cell growth factors (Reya et al. 1996). uterine epithelium. Niches also modify their regulatory properties in response to changing conditions to ensure that stem cell activity meets the needs for particular differentiated cell types. 2005). 2003) and promote proliferation of intestinal stem cells (Pinto and Clevers. the Wnt family of cytokines plays a critical role in self-renewal and differentiation. high levels of Wnt signalling generated by the 20 . They can also act as regulators of differentiation.. 2004). in addition. Stem cells proliferate in response to local wounding (Ito et al. 2005). The loss of BMP signalling due to receptor inactivation in the intestine increases the number of stem-cell containing crypts (He et al. 2008). After irradiation of the testis. Like BMPs. Growth factors that regulate stem cell behavior can originate from supporting cells within the niche or from stem cells themselves... and differentiation. Bone morphogenetic proteins (BMPs) were initially identified in Drosophila ovary: the BMP homologue decapentaplegic (dpp) secreted by neighboring cells maintains the germinal stem cell state (Xie and Spradling. 1998). BMPs have different roles in several mammalian stem cell niches.. Mice in which the BMP receptor type 1A has been inactivated show an increase in the number of haematopoetic stem cells resulting from an increase in the osteoblast population that forms part of the niche (Zhang et al. proliferation. Growth factors A common set of growth factors regulates stem cells.

Other growth factors have been implicated in stem cell proliferation. also appear to be important.. 1998).. In the hematopoietic system. 2005). either conditional deletion of the Notch receptor and ligand (Mancini et al. E-cadherin 21 . such as notch signalling. ensuring the proper architecture of the villus and the crypt (Madison et al. 2005). FGFs can be used to expand haematopoietic cells in culture (Kashiwakura and Takahashi. in vivo. ‘‘Stromal cell’’ niches develop regardless the presence of stem cells and maintain their morphology after stem cell loss (Xie and Li. 2008) do not affect adult HSC maintenance. Sonic hedgehog (Shh) is a mitogen for NSCs. Notch signalling (Calvi et al. Cell-cell interactions Niches involve interactions with multiple cell types. In Drosophila germline stem cells (GSCs).. One possibility is that redundant signals promote HSC self-renewal in vivo. Distinct ‘‘stromal’’ cell types initially guide niche morphogenesis and continue to interact with resident stem cells. 2005) or conditional deletion of β .. 2007). although it plays a critical role in the intestine. Notch and Wnt signalling may be physiologically necessary for recovery from certain stress conditions. Yet.and γ -catenin (Koch et al. The role of Shh in regulating stem cell behavior within non-neural niches remains poorly understood. Short-range interactions. but not for adult HSC maintenance under steady state conditions. the structure of the niche strongly relies upon cell–cell contact and drives symmetric and asymmetric division (Decotto and Spradling. Fibroblast growth factors (FGFs) are expressed by the stromal cells that provide trophic support for the HSCs.expression of a truncated β -catenin promote hair follicle formation (Gat et al.. so that tissue maintenance does not depend upon one single signal. therefore. 2003).. as well as by the stem and progenitors cells in the hematopoetic system. 2005). 2003) and Wnt signaling are sufficient to promote adult HSC self-renewal in culture (Reya et al.

Ephrin ligands and their corresponding Eph family of tyrosine kinase receptors also participate in cell–cell interactions within the stem cell niche. As EphB expression can be regulated by Wnts. Furthermore. 2002). 2000). the niche can further strengthen its ability to retain its precious residents. HSCs express the integrins α4β1 and α5β1. and the β-catenin homologue Armadillo (Arm). For instance. and members of the laminin family (Erickson and Couchman. Cell-to-ECM interaction Extracellular matrix (ECM)-rich basal lamina within many niches may provide both structural support in orienting the cells and a regulatory role in stem cell behavior. The protective niches are composed not only of stem cells but also of cells which secrete and organize a rich milieu of ECM and other factors that allow stem cells to display their unique intrinsic properties. Basement membranes are thin sheets of ECM that are composed of collagen IV. With ECM ligands for the integrin receptors on the surface of stem cells. integrins. perlecan.homologue. including the ability to self-renew by stopping differentiation programs. In the mammalian intestine. and dystroglycan.. with enteroendocrine and goblet cells in the villus above the stem/progenitor region (Batlle et al. Laminins are recognized by at least three major classes of cell surface receptors. nidogen. agrin.. are highly enriched at the interface of GSCs and cap/hub cells (Xie and Spradling. 2002). it appears that Eph/ephrin signalling provides a pathway by which the mitogenic effects of Wnts in the stem cell niche might be affected. the expression of integrins in many stem cell systems is high (Ivanova et al. immediately below the region containing stem and progenitor cells. syndecans. this cell adhesion through adherens and gap junctions maintains the GSC position in the niche. which bind to fibronectin and promote adhesion to the bone 22 . terminally differentiated paneth cells are in the bottom of the crypts. Shotgun (Shg). Intriguingly. 2000). collagen XVIII.

marrow stroma (Roy and Verfaillie. Adherens junctions in the hematopoietic niche anchor the HSC to the osteoblasts via N-cadherin and β -catenin (Zhang et al. In the male Drosophila gonad.. Cell adhesion molecules are also found in a variety of stem cell niches. the glycosylated form of the Upd.. 1999). but not in Cx 32 or Cx 40 knock-in mice (Plum et al. limiting its diffusion and suggesting that only neighboring cells can activate the STAT signalling pathway (Silver and Montell. 2001). 2003). play a role in the spermatogonial niches as revealed by germ cell defects in Cx 43 -/. 2000). Gap junctions. binds to ECM. formed by connexins and responsible for chemical and electrophysiological communication between adjacent cells. 23 . which activates the JAK–STAT pathway.mice.

the committed precursor cells (or basal progenitors) created by these asymmetric divisions migrate out of the VZ into an overlying secondary proliferative 24 . Within this zone. so that mitosis occurs at the ventricular surface and S phase at the abventricular surface. the precursor cells lose their connection to the outer surface and enter mitosis (the M stage). they enter a phase of DNA synthesis (the S stage).1 Neural stem cell niche Specific organization of adult NSC niche is critical for maintaining stem cell pool. NSC bodies are located within 70 µ m from the ventricular surface. At some point a precursor cell generates either another stem cell that will go on dividing and a daughter cell that will not divide further (that is. after the nucleus moves back to the ventricular surface (the G2 stage). Dividing precursor cells in the vertebrate neuroepithelium (neural plate and neural tube stages) are attached both to the pial (outside) surface of the neural tube and to its ventricular (lumenal) surface.2. During development. When cells are closest to the outer surface of the neural tube. By contrast. the two daughter cells extend processes back to the outer surface of the neural tube. with the basal process attached to the pial surface. Figure 3. When mitosis is complete. a neuroblast) or two postmitotic daughter cells. 1996) (Figure 3).. the nucleus shuttles up and down during the cell cycle. The nucleus of the cell translocates between these two limits within a narrow cylinder of cytoplasm. a process termed interkinetic nuclear migration (IKNM) (Takahashi et al. and the new precursor cells enter a resting (G1) phase of the cell cycle.

. Integrin α6β1 (one of the receptors for laminin) increases NSC 25 . 2007). Numb/Numb-like are important for repair and remodelling of the subventricular niche. AF-6. Numb. surface Notch1 is inherited by the differentiating daughter cell (Chenn and McConnell. perpendicular to the ventricular surface.. the precise cellular location of Notch ligands remains to be identified. is important to establish cell-cell junctions and cell polarity during mouse development (Luo et al. SVZ).. which allow the establishment of apical- basal polarity. drives symmetric division of the cell. indicating that one role of the ECM is to concentrate growth factors in the niche (Kerever et al. The apical side of the NSC faces the cerebrospinal fluid contained within the ventricles. 2006). where they may undergo another round of symmetrical division before the neurons migrate into the developing cortical plate. However. Such symmetric divisions are necessary during development to increase the brain size. To generate asymmetric divisions of NSCs. N-sulphate heparan sulphate proteoglycans (HSPG) binds FGF-2. The inhibitor of the Notch pathway. Vertical orientation of the mitotic spindle. 1995).region (the subventricular zone. 2006). 1996) and are also expressed in the adult CNS. The orientation of the mitotic spindle in the NSCs determines whether division is symmetric or asymmetric. giving origin to two equal progenitor cells. The ECM underlying the basal surface of NSCs has also been implicated in NSC regulation. Cell-cell contact is important in keeping NSCs close to the niche where they can receive polarizing signals. also plays an important role in generating asymmetric cell divisions during mouse cortical development. It has been shown that the Notch ligands Jagged and Delta1 are expressed in the ventricular zone of the embryonic neural tube (Lindsell et al. Direct cell-cell contact between NSCs can also be achieved through adherens junctions and tight junctions. In addition to provide a physical contact site. a putative RAS effector that has been shown to bind tight-junction protein ZO-1. and the loss of Numb results in detachment from the niche and increased neuroblast death (Hatakeyama and Kageyama.

2004). 26 . which are a cellular component of the NSC niche. BMPs are important for fate decisions in the neurogenic niche.adherence to local endothelial cells and affects their proliferation. 2008). FGF-2 stimulates NSC proliferation. astrocytes also appear to be a cellular component of the niche like in the SVZ. Exogenous EGF can induce the differentiation of adult NSCs into glial cells in vivo (Doetsch et al. suggesting that Noggin is critical for neuronal differentiation of stem cells occupying the SVZ. 2008). suggesting the importance of the vasculature to proper NSC regulation (Shen et al.. EGF and FGF-2 are two important growth factors for the maintenance and proliferation of the neural niche. Soluble factors may be produced by endothelial cells. Furthermore. 2002).. 2006). Noggin inhibits the action of BMPs in the SVZ and favours differentiation of neurons over glial cells. as they provide neurogenic signals to NSCs (Jiao and Chen.. 2008). 2008).. as shown by the evidence that the vasculature regulates neurogenesis by VEGF signalling (Li et al. as exogenous FGF-2 restores the rate of neurogenesis in older mice to that found in the young adult (Ohkubo et al. this vascular niche may play an important role in the proper delivery of circulating small molecules affecting the identity of NSCs (Tavazoie et al.. However. On the contrary. Noggin was also shown to induce neuronal differentiation of NSCs when transplanted into the neighbouring areas of the brain (Bonaguidi et al..

Leptomeninges have multiple functions and anatomical relationships. 27 . Dura forms an outer endosteal layer in contact with the skull and spine bone and an inner layer strictly linked to the arachnoid mater.2 Leptomeninges 2. elsewhere leptomeningeal cells form desmosomes and gap junctions.2i Anatomy The organs of the central nervous system (brain and spinal cord) are covered by 3 tissue layers called meninges.2. Trabeculae of leptomeninges compartmentalize the subarachnoid space and join the pia to arachnoid mater (Figure 4). Figure 4 Schematic draw of meningeal layers in human brain. The outer parietal layer of arachnoid is impermeable to the cerebrospinal fluid (CSF) due to tight intercellular junctions. The meninges include the dura mater and the leptomeninges (arachnoid and pia mater).

replaced by neuroglia elements. 1988).The arachnoid consists of bundles of white fibrous and elastic tissue intimately joined. The pia mater is a vascular membrane. thus separating the perivascular and subpial spaces from the subarachnoid space (Hutchings and Weller. Leptomeninges that accompanies arteries into 28 . Pollock et al. The inner walls of the perivascular spaces seem covered for a certain distance by the mesothelial cells. 1993). at variable distance from that. held together by an extremely fine areolar tissue and covered by a reflexion of the mesothelial cells from the arachnoid trabeculae. including human. facial and accessory nerves. 1986. absent at the foramen of Majendie and the two foramina of Luschka and perforated in a peculiar manner by all the blood vessels as soon as they enter or leave the nervous system. are found in the arachnoid. An anatomical basis for the separation of the subarachnoid from the perivascular (Virchow-Robin) spaces has been established in several mammalian species.. It has been shown that the pia mater on the surface of the brain and spinal cord is reflected onto the surface of blood vessels in the subarachnoid space. Pia mater is reflected from the surface of the brain and spinal cord onto arteries and veins. reflected with the vessels from the arachnoid covering these vascular channels as they pass through the subarachnoid spaces (Kida et al. A few vessels of considerable size and a rich plexus of nerves derived from the motor root of trigeminal. Its outer surface is covered with a layer of low cuboidal mesothelium. consisting of a minute plexus of blood vessels... thus separating the subarachnoid space from the brain and cord (Nicholas and Weller. It is an incomplete membrane. 1997). the pia apparently enters as a mesothelial lining of the outer surface of the space. The inner surface and the trabeculae are covered by a cuboidal mesothelium which somewhere is flattened to a pavement type (Vandenabeele et al. these cells become unrecognizable and are apparently absent. 1996). In the perivascular spaces.

In the spine. An artery on the left of the picture is coated by a sheath of cells derived from the pia mater. 10. Diagram demonstrating the relationships of the pia mater and intracerebral blood vessels. leptomeninges form highly perforated intermediate sheets of arachnoid and delicate ligaments that compartmentalize the subarachnoid space. The layer of pial cells becomes perforated (PF) and incomplete as smooth muscle cells are lost from the smaller branches of the artery. The pial sheath finally disappears as the perivascular spaces are obliterated around capillaries (CAPS).the brain are involved in draining interstitial fluid that plays a role in inflammatory responses in the brain and appears to be blocked by amyloid-beta in Alzheimer's disease. Leptomeningeal cells also form channels in the core and apical cap of arachnoid granulations to drain CSF into venous sinuses. Perivascular spaces around the vein (right of picture) are confluent with the subpial space and only small numbers of pial cells are associated with the vessel wall (Pollock H et al. Perivascular 29 . the sheath has been cut away to show that the periarterial spaces (PAS) of the intracerebral and extracerebral arteries are in continuity. dentate ligaments anchor subpial collagen to the dura mater and stabilize the spinal cord (Figure 10).Subarachnoid space (SAS) separates the arachnoid (A) from the pia mater overlying the cerebral cortex. Fig. Specialized leptomeningeal cells in the stroma of the choroid plexus form collagen whorls that become calcified with age.

1980a). before CSF begins to flow around the CNS (Catala. Differentiation of the meninges. and the fourth (birth to postnatal day 15) includes addition of smooth muscle cells to 30 .) 2. the brain stem meninges from the cephalic mesoderm.191 (3):337-46. the meninges play a key role in regulating the growth of underlying nervous structures. Development of pia-arachnoidal membranes in the mouse occurs in four stages: the first (prenatal days 10-13) follows closure of the neural tube and is a period of initial vascularization of the developing telencephalon. In birds (and probably in mammals). and the telencephalic meninges from the neural crest.2ii Development In humans. the central cavity of the neural tube is formed during neurulation. 1990). This prevents free communication between the ventricular system and the amniotic cavity. J Anat. the second (prenatal days 14-16) is a period of delineation during which the limits of the subarachnoid space are defined. which occurs during the fourth gestational week. the spinal meninges are derived from the somitic mesoderm. The first milestone is occlusion of the spinal neurocele (the central canal in the neural tube) shortly after neurulation. the third (prenatal day 17 to birth) is a period of formation of pia-arachnoidal blood vessels. They induce the formation of the superficial glial limiting layer and stimulate the growth of precursors located in the superficial blastemas of the cerebellum and hippocampus (McLone. 1998). During ontogenesis.spaces in the basal ganglia of the human brain: their relationship to lacunes. The choroid plexuses are complex specialized structures that produce most of the CSF. The second milestone is development of the meninges. Their epithelium derives from the neural tube epithelium and their mesenchyma from the meninges (Keep and Jones. which involves formation of the subarachnoid space. occurs early. The embryonic origin of the meninges varies across species. which separate the CNS from the rest of the body. 1997.

Pial 31 . and a general increase in extracellular collagenous and elastic fibers.. Deletions of 10 of the current 14 laminin isoforms through inactivation of the laminin a1 chain resulted in the early lethal phenotype before neural tube formation (Smyth et al... The mesenchymal extracellular compartment is reduced in the periphery.2 iii Role of leptomeninges in corticogenesis The cortical plate of the mouse cerebral cortex develops between embryonic day 12 (E12) and E18 with the migration of neuroblasts from the ventricular layer to the pial surface. mice that lack the laminin a5 chain have an obvious brain phenotype and develop exencephaly (Miner et al. such as perlecan (Arikawa-Hirasawa et al. 2002). 1994) and after the targeted deletions of basement membrane constituents. The mutant mice die at birth because of impaired lung and kidney development. By the 15th postnatal day a subarachnoid space typical of the adult animal is established (McLone. 2..larger vessels. In the cortex. the basement membranes in kidney and lung alveoli are disrupted. however. the appearance of macrophages in the subarachnoid space. 1998). 1998. b1III4 (Willem et al. The organizing framework for cortex histogenesis is provided by the spindle shaped radial glia cells that serve as substrate for the migrating neuroblasts (Rakic. basement membranes are found in the pia and around blood vessels.. 2002): abnormal brain development has been observed after chemical ablation of the meningeal cells (Sievers et al. 1999). Graus-Porta et al.. The mesenchyme over the telencephalic surface in the 10-day fetus has a typically large extracellular space. 1980b). 1972). 1999) or receptors for basement membrane proteins (Georges-Labouesse et al. Several reports have implicated the pial basement membrane as important player in brain development (Halfter et al. By the 13th fetal day CSF begins to flow into and replace it. In case of targeted deletion of the nidogen-binding site within the laminin a1 chain. resulting in a compacted pia-arachnoidal tissue which limits the peripheral extent of the subarachnoid space. 2001)...

32 . Strands of gliovascular tissue extend from the surface into the depth of the cortex. where superficial neuroblasts migrate from the malformed cortical plate into the subarachnoid space through defects of the BM (Olson and Walsh. its disruption leads to the development of ectopic neuronal and glial cells in the subarachnoid space (Beggs et al.. leptomeninges contain astrocytes and are named gliovascular tissue. like cobblestones. resulting in a dysplastic cortical pattern (Bornemann et al.. 2002). Thus. In cobblestone lissencephaly the pial basal membrane is not necessarily smooth. but it frequently shows a broad smooth paving. Leptomeninges play an important role in the control of neuronal migration. 1997). following the spaces between microgyri and polipoid protrusions. 2003). because intact pial-basal membrane is absolutely required for proper cortical development. gliovascular tissue intersperses with islets of central nervous tissue.basement membrane of the b1III4-deficient mice disappers at early gestational stages and results in a disrupted neuronal migration. Here. Defects of the ECM have been suggested to be the primary cause of type II (clobbeston) lissencephaly.

Aims of the study

The discovery of NSCs in the adult was a paradigm shift. Although the main idea of

brain stability is still largely true, it is now accepted that NSCs in the CNS proliferate

and give rise to new neurons throughout life.

During recent years, embryonic and adult NSCs gained attention as major candidates for

regenerative and cell replacement therapies in various neurodegenerative diseases. In

this setting, stem cell-based therapies raised important ethical, technical and

immunological concerns (Li et al., 2008). The clinical application of adult NSCs, despite

their properties of self-renewal, neuro-glial differentiation potential and their possible

use in autologous setting, is still debated. Among the technical concerns, it is relevant

that NSCs are hardly accessible, are difficult to expand in vitro as homogeneous stem

cell population and show low rate of in vivo neuronal differentiation (Rosser et al.,

2007).

Both during development and in adulthood, neurogenesis from endogenous neural

stem/precursor cells occurs in discrete areas of the brain where complex micro-

environments, or niches, ensure a balance between proliferation and self-renewal

(Scadden, 2006; Xie and Li, 2007). NSCs have been found in the main neurogenic

regions of the brain, i.e. hippocampus, SVZ, olfactory bulb (Gould, 2007; Johansson et

al., 1999), and in some non-neurogenic regions, i.e. spinal cord (Kehl et al., 1997). In

SVZ, NSCs are present up to adulthood and are in tight contact with astrocytes,

neuroblasts, ependymal cells, endothelial cells, and growth factor-rich basal lamina

(Garcion et al., 2004; Palmer et al., 2000; Sirko et al., 2007; Temple, 2001a). Depending

on culture conditions, NSCs can be induced in vitro to replicate (Temple and Davis,

1994) or terminally differentiate (Roy et al., 2000). Moreover, when cell-cell contact is

coupled with soluble factors to favour the development of more suitable

33

microenvironment, neurogenesis from NSCs or other stem cells can be significantly

enhanced (Krampera et al., 2007; Song et al., 2002).

Whether neurogenesis occurs in areas of the adult mammalian brain other than SVZ and

SGZ remains controversial (Gould, 2007). Areas with reported lower levels of

proliferation, such as hypothalamus and amygdala, have been studied (Fowler et al.,

2008). Interestingly, cells with features of NSCs can be isolated and cultured from

regions outside the two main neurogenic zones, the DG and SVZ, including cortical

parenchyma and spinal cord (Kehl et al., 1997; Sohur et al., 2006). It is possible that

multipotent NSCs lie widespread throughout the mature CNS but are largely quiescent,

contributing to low levels of neuro- or gliogenesis; alternatively, stem cells can rarely

revert to this state. After cortical injury or infusion of growth factors such as BDNF,

CNTF, and Shh, new neurons appear in the parenchyma of cerebral cortex, adult

striatum, septum, thalamus and hypothalamus, some of which are thought to come from

endogenous progenitor cells (Kokoeva et al., 2005).

Our work hypotesis is based on the assumption that other brain sites could host

NSC niches. We were interested in exploring the region between leptomeninges and the

first layers of the cerebral cortex. In this region, spatial-temporal interactions amongst

environmental cells ensure the correct cortex development (Bystron et al., 2008; Halfter

et al., 2002). They are present since the very early embryonic stages of cortical

development, when columnar neuroepithelium is located between ventricle surface and

pial basal membrane. Leptomeninges are involved in multiple interactions among a large

number of molecular and chemiotactic factors (e.g., SDF-1/CXCR4, reelin, oxidative

state) (Borrell and Marin, 2006; Madhavan et al., 2006; Trommsdorff et al., 1999), cell

types (e.g. pia mater cells, radial glia, neural precursor cells, Cajal Retzius cells, glia

limitans cells) (Costa et al., 2001; Marin-Padilla, 1998), and extracellular matrices (e.g.,

laminin, collagen IV, fibronectin) (Duband et al., 1990; Grimpe et al., 2002; Haubst et

34

al., 2006) that ensure the correct cortical development. Abnormal function/structure of

leptomeninges causes altered cortical histogenesis, as shown in the case of cobblestone

lissencephaly (type II), where the fragmentation of pia mater basal membrane leads to

the formation of cortical neurons protruding into the subarachnoid space (Beggs et al.,

2003).

In adult brain, leptomeninges, which include arachnoid and pia mater, cover the entire

CNS and are filled with CSF produced by choroid plexi. All the major arteries supplying

the brain pass through leptomeninges and form branches while penetrating the cortex

(Reina-De La Torre et al., 1998). Interestingly, every parenchymal vessels inside the

CNS are surrounded by a perivascular space (Virchow-Robin space) formed by the

extroflexions of leptomeninges (arachnoid and pia mater) filled with CSF (Jones, 1970;

Rodriguez-Baeza et al., 1998). Thus, leptomeninges are widely spread inside the CNS

parenchyma, including the choroid plexus.

The peculiar spatial relationships of leptomeninges in CNS, their role in cortex

development and our discovery of nestin-positive cells prompted us in determining

whether leptomeninges could be a possible stem cell niche hosting stem/progenitor cells

with neuronal differentiation potential.

35

Material and Methods

Brain perfusion and immunofluorescence.

The animals were perfused with 4% paraformaldehyde in PBS. Brains were dissected,

fixed in 4% paraformaldehyde solution, then left in 10% and subsequently 30% sucrose

solution. By freezing microtome 30 µm thick coronal brain sections were cut and

processed by immunofluorescence was performed as previously described [28]. Briefly,

Brain slices were incubated for 2h in blocking solution (PBS/5%FCS/3%BSA/0.3%

Triton X-100). Slices were then incubated for 12 hs at 4°C in floating, with antibodies.

Primary antibodies were detected with appropriated secondary antibodies for 4h at 4°C

in blocking solution.

Antisera.

The following primary antibodies were used: mouse monoclonal antibodies anti-nestin,

anti-CD106 (VCAM-1), anti-CD90, anti-CD31, anti-CD45, anti-CD105 (endoglin), and

anti-BrdU (all from Pharmingen/Becton Dickinson); anti-EGFP (rabbit, 1:2000,

Invitrogen), MAP2 (mouse, 1:1000, Sigma), GFAP (mouse, 1:1000, BD Pharmigen),

Laminin (rabbit, 1:1000 Sigma), Nestin (mouse, 1:1000, BD Pharmingen), NG2 (rabbit,

1:500, Chemicon), Neurofilament 160 (mouse, 1:100, Sigma).

The following secondary antibodies were used: goat anti-mouse Ig/Alexa Fluor 488,

IgM/FITC, IgG/PE, and chicken anti-rabbit/Alexa Fluor 488 (all from Molecular

Probes), goat anti-mouse/Cy3, goat anti-rabbit/Cy3 (all from Amersham).

Cell cultures

Cells were harvested from the first cortical layers and overhead leptomeninges of

Sprague-Dawley rats or from enhanced green fluorescent protein (EGFP) transgenic rats
36

[29] at postnatal days 15 (n= 6 experiments, 10 animals each). Tissues were sampled

with stereo-microscope from brain coronal sections. Mechanically/enzymatically-

dissociated tissue extracts from first cortical layers of P15 rats were cultured in

neurosphere-inducing and adherent conditions.

- Neurosphere culture: tissue extracts were seeded into 6 well plate (Falcon) in 3 ml of

neurosphere culture medium. Medium supplemented with fresh growth factors was

added every 2-3 days. Neurospheres could be detected under phase optics after 7-10

days.

- Adherent culture: tissue extracts were seeded into culture flasks (Falcon) with growing

medium; after 72 hours, non-adherent cells were removed. In 10 days, clear colony

forming units could be detected. Differentiation was performed after 3-6 passages by

plating 1x105 cell/cm2 in poly–L-lysine (40 µg/ml, Sigma)-coated coverslip in the

differentiation medium.

Media

Neurosphere culture medium: Neurobasal Medium, (Gibco) containing 2% B27

supplements (Gibco), 1% N2 supplement (Gibco), 200 mM glutamine, 1% penicillin-

streptomycin plus 20 ng/ml EGF and 10 ng/ml bFGF.

Growing medium: Dulbecco modified Eagle medium (DMEM), with high glucose

concentration, GLUTAMAX I, 18% heat-inactivated fetal calf serum (FCS), 100 U/mL

penicillin, and 100 µg/mL streptomycin (all from GibcoBRL/Life Technologies, Milan,

Italy). Differentiation medium: Differentiating medium: Neuron Chow (Neurobasal

Medium, (Gibco) containing 2% B27 supplements (Gibco), 200 mM glutamine, 10 mM

glutamate and 1% penicillin-streptomycin-fungizole) plus 50 ng/ml brain-derived nerve

growth factor (BDNF).

37

followed by incubation with the specific antibody at +4°C for 30 minutes. Italy) using Cell Quest software. and CD90. The coverslip were then placed onto a recording chamber. Cells were loaded with Fura2-AM for 30-45 minutes at 37°C. All image processing and analysis was performed using OpenLab software (Improvision) with an inverted Zeiss microscope. In addition. At least 10 000 events were analyzed by flow cytometry (FACScalibur. cultured cells were detached using trypsin/EDTA (ethylenediaminetetraacetic acid) for 5 minutes. Milan. 38 . CD106 (VCAM-1). Intracellular calcium imaging Intracellular calcium levels (Ratio 340/380) were evaluated by ratiometric imaging techniques. connected by a Tygon tube to a 1 ml syringe. we assessed the lack of endothelial cell (with anti-CD31 antibodies). hematopoietic (with anti-CD45 and -CD34 antibodies) and neuro-glial (with anti-MAP2 and anti-GFAP antibodies) marker expression. immediately washed with phosphate-buffered saline (PBS) to remove trypsin. The loading solution contained 5µM Fura 2-AM in HEPES buffered solution. Cell suspension (100 µL) was incubated at +4°C for 10 minutes with 15% FCS. Italy). Loading solution was removed and the culture was incubated another 10 minutes at 37°C in HEPES buffered solution to allow de-esterification of Fura2-AM. For immunophenotypic analysis.Flow cytometric analysis Cultured cells were analyzed by flow cytometry using monoclonal antibodies (MoAbs) specific for nestin. CD105 (endoglin). used for substance fast application. Wavelength of 340 and 380nm were used to excite Fura2 and the emitted light was collected at 510nm. Cells were washed with PBS. Becton Dickinson. and resuspended at 106/mL. All antibodies were purchased from Pharmingen/Becton Dickinson (Milan.

and 10 mM a-glycerophosphate (Sigma Immunochemicals). Cells immunofluorescence Cells on coverslips were immunostained as previously described [31].4- diazabicyclo[2. every single cell-colony with more than 50 cells was considered as CFU. preparations were mounted on anti-bleaching 1. Adipocyte differentiation was achieved after 3-week culture of cells with adipogenic medium (AM).2.2% bovine serum albumin and 0. secondary antibodies were applied for 1 h.2]octane (Sigma) in PBS containing 50% glycerol. After 14 days of culture. CFU assay was performed every following passage. Milan. Cells were permeabilized for 30 min in PBS containing 0. CFUs were stained with May-Grunwald Giemsa and then counted (mean ± SD of two different cultures). by plating cells at four different concentrations. von Kossa. containing 10–6 M dexamethasone. P8. were used to identify adipocytes and osteoblasts. 10 µg/mL insulin. Mesodermic differentiation assay Adherent grown leptomeningeal-derived cells and MSCs were tested for their ability to differentiate into adipocytes and osteoblasts. Osteoblast differentiation was achieved after 2- week culture with osteogenic medium (OM) containing 10–7 M dexamethasone. Oil- red-O. Italy). After final washing steps in PBS. and 100 µg/mL 3-isobutyl-L-methylxantine (all from Sigma Immunochemicals.2% Triton X-100 (PBS/BSA/TRITON). Neurons were incubated with primary antibodies in PBS/BSA/TRITON for 90 min at room temperature. P15 and Adult were plated at five different cell concentrations. P0. After rinsing in PBS/BSA/TRITON. respectively.Colony Forming Unit (CFU) assay Dissociated tissue extracts from E20. Slides were 39 . 50 µg/mL ascorbic acid. Briefly. cells were fixed for 20 min with 4% paraformaldehyde and 4% sucrose in PBS buffer and subsequently rinsed in PBS.

1N B4Na2 (pH 8. were loaded in a Hamilton syringe connected with a Tygon tube (ID 0.060mm.5% Triton X- 100 at room temperature.3mm. Paxinos and Watson).020mm. and the reaction were neutralized with 0. incisor bar 3. 5-bromo-2-deoxyuridine (BrdU) labelling Cells were incubated for 12h with BrdU (3 µM) before starting the differentiation protocol. Five of serial coronal sections (30 µm) of 40 . For 488 nm excitation.5). After differentiation. L 2. Kopf Instruments) lowered to Hippocampus (AP -2. Male Sprague Dawley adult rats (Harlan. Plastics One) was stereotaxically (stereotaxic frame. cells were fixed on coverslips with 4% paraformaldehyde and rinsed with PBS. Italy) (n=8) were anesthetized and a guide cannula (26G. Either cell suspension or vehicle (PBS).2 mm. OD 0.0 below horizontal line. Plastics one).observed by using a Zeiss LSM 510 confocal microscope equipped with argon (488 nm) and helium/neon (543 nm) excitation lasers. V 3.4mm.116/92. Transplanted cell counts Frequency estimation of transplanted EGFP+/MAP2+ leptomeningeal cells were performed in hippocampal slices of 4 rats injected with EGFP+ leptomeningeal cells and one not-injected rat as negative control. emission was selected with a 510–530 nm bandpass filter. Cells were then treated for 15 minutes in 2N HCl/0. The needle was inserted in the guide cannula. Saint-Gobain PPL Corp) and with a needle (33G. Stereotaxical surgery in brain All in vivo experiments were in accordance with the Italian Legislative Decree N. A volume of 1µl (3x103 EGFP+cells) was then infused with a syringe pump over 5 minutes and left in place for additional 5 minutes. whereas for 546 nm excitation emission was selected using a 560 nm longpass filter.

GCTGGTGAAGACCTCGACGT. GCTCATAGGCTTGTCCTGAGCT. After a starting denaturation for 10 minutes at 95°C. The number of MAP2-positive injected cells were expressed as percentage of EGFP-positive cells examined. Rn00565046_m1 for Mtap2. Rn00667869_m1 for Actb. CGCCGAGTGGAAACTTTTGT. 0. Rn00578849_m1 for Cspg4. 1x Power SYBR Green I Master Mix or Taqman Universal PCR Master Mix (Applied Biosystems). CGGAAGGCACAAGCTGGA. Smad4. Eng GGACAGCCTCTCCTTCCAGC. Col1a1 GCAGATTGAGAACATCCGCAG. Five random fields for each slice were acquired with a 40X objective in confocal microscopy. TGTGAACCGGCCAGTAATGTC. 40 PCR cycles (15s 95°C and 1 min 60°C) were carried out on ABI PRISM 7900HT SDS instrument (Applied Biosystems). CTGGCTGAACACCTTTCCAAA. Pou5f1. 96 bp. Rn00564394_m1 for Nes. 106 bp.4 µ M primers forward and reverse or 1/20 Taqman probe. GGCCTGACTCAGAAGGGCTC. 75 bp. TGCCCCATACTGGAAGGTTTC. Klhl1. Quantitative real-time RT(reverse transcription)-PCR analysis (qPCR) Total RNA was purified with Trizol reagent (Invitrogen) and retrotranscribed to cDNA by reverse transcriptase AMV contained in the First Strand cDNA Synthesis Kit (Roche). GCCAAGCTGCTGAAACAGAAG. Nanog.hippocampus were randomly selected and stained with antibodies against EGFP and MAP2. Sox2. Forward and reverse 5’-3’ primer sequences and PCR product lengths were as follows: Tdgf1. CCAGTACTCTCCGCTCTTCCA 106 bp. 126 bp. The Taqman assays (Applied Biosystems) were as follows: Rn00566603_m1 for Gfap. CGCGGCCGGTATTTATAATC. EGFP-positive cells and MAP2/EGFP double-positive cells were then counted. TGCTCACCTGTACGAAGCCC 101 bp. 106 bp. GCTTGGCTTCACAGACATCG-3'. 41 . 111 bp. GCACTACCACCTGGACTGGAA. qPCR reactions were carried out in 20 µ l total volume containing 10 ng of cDNA (RNA equivalent).

Unsupervised hierarchical clustering of qPCR data Purified RNAs from undifferentiated and differentiated cells samples were analized as described above.0 software (De Hoon MJ)42. 42 . The relative expression level was calculated using transcript level of Actb as endogenous reference. Kit GGCATCACCATCAAAAACGTG. CAGTGTGACGGTTGGGTAAGTC 113 bp. The Ct value used for subsequent calculation was the average of three replicates. Fgfr3 CAAGGTGTACAGCGACGCAC. Fgfr1 AAATTCAAATGCCCGTCGAG.Cd44 CAACGCTATCTGTGCAGCCA. Cd34 CACCAGCCATCTCAGAGACCA. and a cycle threshold (Ct) was taken significantly above the background fluorescence. The resulting cluster tree was visualized by the 1. when indicated.05 was considered statistically significant. As unsupervised hierarchical clustering procedures. Results were expressed as mean ± SD or SEM. Data analysis was done according to the comparative method following the User Bulletin #2 (Applied Biosystems). Log2-transformed gene expression values were analyzed by Gene Cluster 3. GGCGTAACGAACCTTGTAGCC 111 bp. P value <0.0 version of Java TreeView software. CTTGACTGGAAGTCGCCCAT 126 bp. GTGGTGTTAGCTCCTGCAGTCTT 126 bp. The probe signal was normalized to an internal reference. Fgfr2 TTGGCAGCCAGAAATGTGC. we used centered Pearson correlation as similarity measure and complete linkage. Differences between experimental conditions were analyzed using two-tail Student t-test. GGGATAGCTTTGATGGCTGC 131 bp. Statistical analysis Data were analyzed using GraphPad Prism4 software.1. CAAGAGGAGCTGAGGCATTGA 101 bp.

+8 (P8) (C) and +15 (P15) (D). postnatal day +1 (P1) (B). P8. (F) Subventricular zone (SVZ) of P15 rats as positive control and choroid plexus. and adults (E). Scale bar 50 µm. animals at different postnatal days (P1. 43 . Figure 11. Distribution of nestin-positive cells in rat cortex at different ages Confocal images of coronal sections of parietal cerebral cortex: rats at embryonic day 20 (E20) (A). Immunolabelling with the anti-nestin (red) antibody. P15) and in adulthood.Results Charachterization of Leptomeningeal niche Distribution of nestin-positive cells in rat cortex during development up to adulthood Immunofluorescence confocal microscopy with anti-nestin antibodies was used to identify potential stem cell sites in coronal sections of rat brain cortex at different stages of development. Figure 11 shows that nestin-positive cells were present in peripheral cell layers of the parietal cortex of brains obtained from embryos (embryonic day 20 - E20).

DAPI staining was used to visualize cell nuclei. we first analyzed the distribution of this marker in comparison with that of laminin (a specific marker of pia mater) (Borrell and Marin. Characterization of the nestin-positive cell layer To better define and characterize this population of nestin-positive cells. anti-laminin (green). Figure 12 was obtained from P15 rat brains and shows that the nestin-positive tissue was a layer of densely packed nucleated cells residing outside the pia mater boundary of the cortex. As previously described by several groups. 44 . in the leptomeninges. Interestingly. Localization of nestin-positive cells in leptomeningeal tissue Coronal section of the parietal cortex of P15 rat.The distribution of nestin-positive cells within the cortical layers decreased over time but persisted in the superficial layer covering the cortex up to adulthood. 1995) (positive control). Figure 12. stained with DAPI (blue). nestin-positive cells were also present in choroid plexus. Scale bar 50 µm. nestin-positive cells were present at high density in the SVZ at all the developmental stages and in adults (Zerlin et al.. and anti-nestin (red) antibodies. 2006).

e. As shown in Figure 13 g.h. P15 and adult rat brains.f) and located outside the pia mater boundary of the cortex.e.. Scale bars 50 µm.f) or -NG2 (g.j) antibodies.e. Figure 13 shows P1.j the pattern of distribution of NG2 positive cells indicates that the nestin-positive cell population does not include vascular cells.We then assessed whether the nestin-positive cell population included glial fibrillary acidic proteins (GFAP)-positive astrocyte and NG2 (integral membrane chondroitin sulphate proteoglycan. similar results were obtained at different ages and show again that the nestin-positive layer of densely packed nucleated cells is separated from glia (Figure 13 d. 1991) in P0. This strongly suggests that nestin-positive cells are present in the leptomeningeal compartment. Cspg4)-positive smooth muscle cells (Ozerdem et al.. 45 .h) z- stack reconstruction assembled from 10 serial 2 µ m confocal sections.c) or -GFAP (d. Cell types description in leptomeningeal tissue Sections of parietal cortex from P1. stained in red with anti-nestin antibodies and in green with anti-laminin (a. (b. 2001) and microvascular pericytes (Schrappe et al.h. None of these markers co-localizes with nestin. P15 and adult rats. Figure 13. P15 and adult brains.b.

46 .. since this protein is expressed also by a selected class of oligodendrocyte precursors (O-2A progenitor cells) (Dawson et al.Scattered NG2-positive cells were also found in deeper layers of the cortex (Figure 13) as expected. 2000).

10 animals each) to quantify the proportion of living nestin-positive cells in the tissue 47 . Colony forming unit (CFU). an index of stem cell number in the tissue. Bars represent the number (mean of 5 different dilution) of CFU/million of extracted cells ± SD. Cell rate growth was higher for P1 cells than for P15 and adult rats.6 x105cells/cm2 and split at 70-80% confluence. (b) Colony Forming Unit (CFU) derived from nestin-positive cells at different ages. Scale bar 250 µm.In vitro expansion of the nestin-positive cell population derived from leptomeninges Tissue sampling Samples from leptomeningeal sections of the parietal cortex were obtained from brains at the different post-natal stages P1. CFU number was high starting from P1 cells and decreased with rat age (Figure 14b). Leptomeninges were stripped from brain surface of P15 rats (n=6 experiments. Figure 14a shows that dissection was limited to the outer layers of the cortex. P15 and from adult rats (n=15 brains for each experiment). Figure 14. at different ages. no more than 14 days after plating. Dissociated cells could be cultured in basal conditions for several passages when seeded at density >2. Tissue sampling (A) Hematoxylin/eosin staining of a coronal section of P15 rat brain to show (arrows) the site and the extent of the biopsy. was calculated after 14 days of culture in basal conditions.

physical properties. in X-axis.extract. described as side scatter (SSC) of cells after tissue dissociation.3%). were gated and. Mechanically-dissociated tissue extracts contained living nestin-positive cells (40. nestin-positive cells (red 40. 48 . stained with Syto16.3%) or negative (black) are shown. Fluorescence intensity of PE-coniugated anti-nestin antibody in Y-axis. Figure 15. Immunophenotypic characterization of tissue extracts FACS analysis of tissue extracts from P15. as shown by FACS analysis (Figure 15). among them. Viable cells.

cells were present as early as 5h after plating (approximately 90% of attached cells). non-adherent cells were removed and the medium completely changed. Only a minority of cells from the whole tissue extract adhered and gave rise to colony forming units (CFU).cells in adherent culture at 5 hours. Figure 16. 4. Time course experiments were performed to assess whether a cell population of nestin+/GFAP-/NG2-cells (similar to what found in vivo in the leptomeninges) was present in the culture. 8 and 12 days after plating. From day 8 nestin+/GFAP-/NG2- cell colonies were detectable. In 1-3 weeks. After 48h. 1. 49 . cell colonies could be recognized.Cell culture The whole tissue extract was plated in flasks with growing medium (see Materials and Methods). Non-adherent cells underwent apoptosis or were removed by medium change. As shown in Figure 16 nestin+/NG2. Time course experiment Confocal image of Nestin+/ NG2. Similar results were obtained with GFAP staining (data not shown).

since CFU were present at each passage (Figure 17). Bars represent the CFU number/million of plated cells ± SD. 50 . of adherent leptomeningeal cells.All the adherent cells proliferating after several days derived from CFU and displayed a homogeneous immunophenotype. nestin (red). (B) May-Grunwald Giemsa staining of a single colony of leptomeningeal adherent cells. This cell population was expanded for several passages and was clonogenic. In vitro expansion of the tissue extract in adherent cells culture conditions (A) CFU derived from leptomeningeal cells at different passages. FACS analysis showed that in vitro expanded cells always retained nestin positivity. Figure 17. (C) Transmitted light and (D) immunofluorescence. did not express markers of either neuronal (MAP2)/glial (GFAP) or hematopoietic (CD45.

2006) (Figure 18).CD34) (Krause et al. Interestingly. a similar population of nestin-positive cells could be extracted and in vitro expanded also from choroid plexi. 1994) /endothelial (CD105. 2005) lineages. FACS analysis of expanded cell population 51 . Immunofluorescence microscopy confirmed that expanded cells were a homogeneous population of nestine-positive cells (Figure 17D) that did not express neuronal (MAP2).. 2006)(data not shown).. Figure 18. a non-specific marker of neural cells and stromal cells (Gupta et al. oligodendrocytic and pericytic markers (NG2) (Dore-Duffy et al. CD31.. a tissue devoid of neural elements (data not shown). glial (GFAP).. CD106) (Khan et al. and were positive for CD90.

GFAP. and hematopoietic stem cell markers (CD34).(E) FACS analysis. leukocyte (CD45). endothelial (CD31. shows high expression of nestin and CD90. carried out on expanded cells obtained from adult rats. CD106). In vitro expanded cell population does not express neuro-glial (MAP2. 52 . and O4).

A B C Figure 19. Confocal image of neurospheres stained with MAP2 (green). scale bar 100 µm. we first cultured these cells in the same conditions used to expand SVZ-NSCs. we decided to name these cells Leptomeningeal Stem/progenitor Cells (LeSC). In vitro expansion of the tissue extract in neural stem cell growth conditions. neuronal MAP2-positive cells and glial GFAP-positive (Chojnacki and Weiss. (A) Transmitted light of leptomeningeal- derived neurosphere. Flotting neurospheres were obtained. cells from tissue extract generated floating neurospheres in 9-11 days (Figure 19A). For each sample. 2008) (Figure 19 B-C). At this point. Neurospheres could be expanded in vitro up to several months (data not shown). including nestin-positive cells.. 2003). expression levels of different genes were normalized to levels of beta-actin mRNA.Comparison of Leptomeningeal-derived nestin-positive cells with other known somatic stem cell populations Standard neural stem cell growth condition To assess whether cells with neural differentiation potential were present in the tissue extracts from this region. with morphology and phenotype comparable to those of SVZ-NSC derived neurospheres. or MAP2 (red) and GFAP(green) (C). In NSC medium (see Materials and Methods). 53 . The bars show fold change ± SD in transcription of normalized mRNA expression levels measured for leptomeninges-derived neurosphere compared to SVZ-NSC derived neurosphere. Similarly to SVZ-derived neurospheres (Bez et al. Nestin (red) and DAPI (blue) (B). leptomeninges-derived neurospheres consisted of different cell types. (D) Relative gene expression analysis.

insulin. and indomethacin. Adipogenesis was indicated by the accumulation of neutral lipid vacuoles that stain with Oil-red-O (Figure 20A). thus excluding that LeSC are MSC-like cells residing in leptomeninges. and such changes were not evident in the LeSC (Figure 20C). The adipogenic and osteogenic differentiation potential of cells from leptomeninges were compared to that of BM-MSC. 54 .Mesodermic differentiation of adherent cultured cells Cultured cells were tested for the ability to differentiate in vitro into mesodermal lineages. which was not seen in the LeSC (Figure 20D). the expanded cells (LeSC or BM-MSC) were stained with appropriate dyes. After 3 weeks in lineage-specific culture conditions. Adipogenic differentiation was induced in the expanded cell cultures by treatment with 1-methyl-3-isobutylxanthine. Thus. Osteogenesis was indicated by the increase in alkaline phosphatase (Figure 20B) and calcium deposition. dexamethasone. We use standard BM-MSC culture condition to induce adipogenic and osteogenic differentiation (see Material and Methods). no evidence of adipocyte and osteocyte differentiation was achieved in LeSC with the standard protocols used for BM-MSC.

BM-MSC could differentiate properly into the adipogenic (Adipo). and osteogenic (Osteo) lineages (A. Mesodermal differentiation potential Adherent expanded cells (Leptomeningeal-derived and BM-MSC) differentiate to mesenchymal lineages. 20. B). whereas Leptomeningeal-derived cell population did not (C. 55 . D).Fig.

Mtap2) (Jiang et al.. Sox2 (Avilion et al.. BM-MSC and SVZ-NSC were performed.Gene expression analysis Quantitative gene expression assay was performed to analyze self-renewal regulators (Pou5f1/Oct4 (Nichols et al. Nanog (Loh et al. 56 . adherent cultured Leptomeninges-derived cell.05) were observed for differentiation genes Gfap and Mtap2 only. Data were normalized for beta-actin expression level and were shown as ratio between the two population.. A tight correlation between the gene expression pattern of SVZ-NSC-derived neurosphere and the leptomeninges-derived neurospheres was observed. Gfap. 1998). In Figure 21 gene expression of SVZ. and genes related to neural differentiation (Klhl1... 2002). genes related to the undifferentiated state maintenance (Tdgf1/Cripto-1. 2006). 2003). 2007). Smad4 and Nestin) (Ramalho-Santos et al. Statistically significant differences (p<0.and leptomeninges-derived neurospheres are shown. Comparison of gene expression between SVZ- and leptomeninges-derived neurospheres.

we found that nestin-positive cells from leptomeninges displayed a different pattern of expression as compared to MSC. Neurospheres relative gene expression analysis For each sample. expression levels of different genes were normalized to levels of beta- actin mRNA.Figure 21. The bars show fold change ± SD in transcription of normalized mRNA expression levels mesured for letomeninges-derived neurosphere compared to SVZ-NSC derived neurosphere We then studied by quantitative RT-PCR the expression of different MSC markers (see Table I). Table I 57 .

By contrast. Cripto-1. Adherent/expanded leptomeninges- derived cells showed higher stemness-related gene expression. we analyzed gene expression analysis by unsupervised hierarchical clustering. Letomeningeal-derived nestin+ cells and BM-MSCs fold changes in transcription. such as Pou5f1/Oct4. Finally. gene expression analysis was performed to compare the stemness molecular signature and neural differentiation pattern of LeSC with that of other known stem cell types derived from P15 rats. As panel of stemness-related genes was analyzed Oct4. Nanog. as compared to adherent cultured SVZ-NSCs. normalized to actin mRNA. Figure 22.01).Moreover. such as Mtap2 (MAP2) and Gfap as compared with adherent cultured SVZ-NSC (Figure 22). All these stem cell types were cultured in the same adherent condition. Nanog and Sox2. This findings were in line with data obtained by FACS and immunofluorescence and suggested a homogeneous phenotype of adherent/expanded leptomeningeal cells. such as NSC from SVZ and BM-MSC. Adherent cultures relative gene expression analysis Relative gene expression analysis. have been shown compared to SVZ-NSCs. 58 . Cspg4 (p<0. Tdgf1 (Cripto-1). adherent/expanded leptomeningeal cells expressed lower neural differentiation genes.

c-Kit. such as Mtap (MAP2). and adherent cultures from SVZ-NSCs. These findings show the homogeneous phenotype of adherent/expanded leptomeningeal cells. we observed a tight correlation between the gene expression pattern of SVZ-NSC- derived neurosphere and the leptomeningeal cell-derived neurospheres. CD133. 59 .Prom1. c-Kit and Nestin. such as Pou5f1/Oct4. By contrast. We identified two main cell groups: cultured neurosphere from SVZ-NSCs and Leptomeninges. in line with data obtained by FACS and immunofluorescence. as observed in neurosphere cultures and SVZ-NSC adherent cultures (Figure 23B). as compared with adherent cultured SVZ-NSC and BM-MSC. BM-MSCs and leptomeninges (Figure 23A). Tdgf1 (Cripto-1). Gfap and Klhl1 (MRP2). Moreover. As growth factor receptors and molecules involved in cell interaction was analyzed Fgfr1. Fgfr2. Thus. adherent/expanded leptomeninges-derived cells showed higher stemness-related gene expression. Smad4. Notch and Nestin. Smad4. CD34. Fgfr3. adherent/expanded leptomeningeal cells did not express genes of neural differentiation. Nanog.

In vitro neural differentiation of expanded leptomeninges-derived cells 60 . Among the adherent cultured cells. c-Kit and Smad4. SVZ-NSC. indicating an heterogeneous mixture of differentiation in these culture conditions. Nanog.Figure 23. Unsupervised hierarchical clustering (A) Two main groups of samples: the LeSC and SVZ-NSC derived neurospheres and the adherent cultured cell (LeSC. Both LeSC and SVZ neurospheres showed similar gene expression. By contrast. Tdgf1/Cripto- 1. such as Pou5f1/Oct4. such as MAP2. BM-MSC). LeSC show high expression of many stemness-related genes. GFAP and MRP2. NSC-SVZ and neurosphere cultures show high expression of these differentiated markers. adherent coultured LeSC do not express neural differentiated markers (B).

61 . Figure 24. Neuro-glial differentiation potential of the Leptomeningeal-derived expanded population Expanded cells after differentiation from P0 . astrocytes (GFAP).Neuro-glial differentiation To determine whether the in vitro-expanded cells had neuro-glial differentiation potential. P15 and adult rats are shown. As shown in Figure 24 all the three cell types were present. leptomeninges-derived nestin-positive cells were cultured with differentiating medium for at least one month. oligodendrocytes (O4). stained with antibodies against MAP2 (red). For the efficient differentiation. and then stained with antibodies against markers of neurons (MAP2). P15 and adult rats. GFAP.or O4-positive cells (green) from P0. an appropriate cells density of 105/cm2 was necessary.

The bars show fold change ± SD of normalized mRNA expression levels measured before and after differentiation.6 and 14 fold the value found in non-differentiated cultures. GFAP and O4 significantly increased (38. Gfap.04 fold the basal value. respectively) (Figure 25). and Mrp2) were normalized to levels of beta-actin mRNA. 62 .The presence of the neuronal phenotype following differentiation was confirmed by Real time-PCR. 0. Stem cell markers. Cspg4. Mtap.6. 1. Analysis of gene expression by real-time PCR in expanded Leptomeningeal-derived cells before and after neural differentiation For each condition. expression levels of different genes (Nes. respectively). such as nestin and NG2 significantly decreased after differentiation in culture (0. whereas the expression of neuro-glial markers such as MAP2. Figure 25.2 and 0.

Moreover. thus indicating that these neurons derived from replicating cells. A fraction of the differentiated MAP2-positive cells also expressed the GluR2 subunit of the ionotropic AMPA-glutamate receptor and the glutamate decarboxylase (GAD67). cells were incubated with BrdU for 9 hours before the induction of differentiation. we forced the neuronal differentiation potential of leptomeningeal adherent/expanded nestin-positive cells. MAP2-positive cells showed other features of neuronal phenotype. Immunofluorescence analysis showed that cells differentiated in cultures into MAP2-positive neurons with high efficiency (30-50% of cells. 63 . including distinct neuritic arborization. Figure 26 A and B). To determine whether the neurons found in differentiated cultures originated from replicating cells or from residual adult cells from tissue extract. marker of GABAergic neurons (Figure 26 F and G).Specific in vitro neuronal differentiation of expanded leptomeninges-derived cells Based on neural differentiation data. MAP2-positive cells were also stained with anti-BrdU antibody. Most of MAP2- negative cells were nestin-positive cells (data not shown). n=6 experiments. dendritic spines (arrows in Figure 26B) and the expression of presynaptic protein synaptophysin (Figure 26E). As shown in Figure 26C.

Scale bars 50 µ m. Arrows in (C) indicate dendritic spines. MAP2-positive cells also expressed components of the synaptic apparatus. Response reached peak level after 9. Stimulation with 55mM KCl caused increase of the intracellular calcium concentration indicated by the shift of the 340/380 ratio. was sustained and reversible (Figure 27A). stained with antibodies against MAP2 (red). glutamate decarboxylase (GAD67) (F) and the glutamate ionotropic receptor subunit GluR2 (G). Specific neuronal differentiation potential Differentiated cells. (D) BrdU staining (green) indicates that the MAP2-positive cells (red) derived from replicating cells.Figure 26. including the presynaptic marker synaptophysin (E). Responses to depolarizing agents were analysed by calcium imaging after Fura-2 loading. Fast application of 55mM KCl (approximately 40sec) produced a significant response in 77% of the cells studied (n=36).9 seconds of KCl application.7±1. Similar data were obtained from primary 64 .

Calcium imaging analysis of in vitro neural differentiated leptomeningeal cells (A) Changes in intracellular free calcium are indicated by variation of 340nm/380nm fluorescence ratio in Fura-2-loaded cells. These data suggest that leptomeningeal cells in vitro differentiated into neurones are excitable and express functional voltage dependent calcium channels. 65 .neuronal culture (Figure 27B). *** P< 0.E.M.) expressed as peak and baseline values in differentiated cells and in primary neuronal cultures. Figure 27. Depolarization induced by 55mM KCl led to increase of 340/380 ratio in all the cells present in the field.001. (B) Average responses (mean ± S.

EGFP+/GFAP+ and EGFP+/NG2+ double positive cells were rarely detected (Figure 28D.. Most of the transplanted cells at the injection site expressed nestin (Figure 28C). Real time-PCR confirmed that EGFP expression was restricted to injected rats (data not shown). expanded leptomeningeal nestin-positive cells were derived from EGFP-transgenic rats (Okabe et al. 1997). Cells were stereotaxically injected into the hippocampus of adult rats (n=8). Immunofluorescence analysis with anti-EGFP antibody revealed the presence of EGFP+ cells in hippocampus 4-8 weeks after transplantation (Figure 28). EGFP+ cells close to the injection point were surrounded by abundant GFAP-expressing astrocytes (Figure 28B). EGFP+ cells were not detected in the control rat (non-injected adult rats or rats injected with vehicle only). 30 µm thick sections were analyzed by confocal microscopy following immunostaining with anti-EGFP antibody and markers for either undifferentiated cells (nestin) or neurons (MAP2) or astrocytes (GFAP) or oligodendrocyte precursors (NG2). E).In vivo transplantation of Leptomeninges-derived cells In vivo neuronal differentiation assay Transplantation studies were performed to determine whether adherent/expanded cells derived from leptomeninges of P15 rats could generate neural cell types in vivo. To recognize injected cells. The injection needle track was recognizable in the CA2-CA3 hippocampal region (Figure 28A). 66 . To evaluate the differentiation of engrafted cells.

Most EGFP+/MAP2. scale bar 50µm. (D) Colocalization of GFP+ cells with GFAP (yellow signal) near the injection site. 49. In this site. Confocal images of injection site of transplanted leptomeningeal cells (A) GFP+ cells (green) into the injection site in CA2 hippocampal region stained with nuclear marker DAPI (blue). B. Most of the EGFP+ cells were located in the CA1 region (Figure 29A. EGFP+/MAP2+ engrafted cells were detected in the pyramidal layer and in the stratum 67 .cells were nestin+. D). C. Sixty days after injection. some of the grafted cells displayed complex morphology resembling the pyramidal neurons of the hippocampus (Figure 29B’).9% of the EGFP+ cells found in the hippocampus were also MAP2 -positive (n=4. see Materials and Methods). (C) Colocalization of GFP+ with nestin in the injection site (yellow signal).Figure 28. scale bar 100µm. (B) GFP+ cells in the injection site surrounded by glia (GFAP red signal). scale bar 50µm. scale bar 100µm. (E) Colocalization of GFP+ cells with NG2 (yellow signal). undifferentiated cells.8±17. scale bar 200µm.

Confocal images of in vivo leptomeningeal cells neural differentiation (A) Transplanted EGFP+cells (green) are localized in CA1 region. even if they displayed neuronal morphology and appeared to be well integrated within the CA1 (Figure 29 D.oriens (Figure 29C). EGFP (green)/MAP2 (red)/DAPI (blue)-positive cells in CA1 pyramidal layer. Transplanted EGFP+ cells (green) co-expressing MAP2 (yellow) in subgranular 68 . (B’) high magnification. E). C’’. (C) z-stack reconstruction assembled from 10 serial 1. Transplanted cells displaying distinct neuronal morphology and MAP2 expression were also found in the hilus and in the subgranular zone (SGZ) of the dentate gyrus. C’’’ confocal images pointing single cell (arrowhead) co-localizations (yellow) of EGFP (green) and MAP2 (red). (Figure 29F). (B) EGFP+cells (green) showed complex phenotypes mimicking the pyramidal neurons of the hippocampus (CA1 pyramidal cell layer). scale bar 100 µ m. scale bars 20 µ m. Not all the EGFP+ cells observed in this layer also expressed MAP2. Figure 29. C’. scale bar 20 µ m. EGFP+ cells co-localizing with MAP2 (yellow) (D) or not (E). scale bar 100 µ m. scale bar 50 µ m.63 µ m confocal sections. scale bars 20 µ m.

zone (SGZ) and hilus of the dentatus gyrus. 69 . scale bar 50 µ m. (F’) high magnification. scale bar 200µ m (F).

These cells where mainly negative for both nestin and the neural markers analyzed (MAP2. NG2). These cells appear to be well integrate with resident nestin-positive cells. GFAP. although some EGFP+/MAP2-positive cells were found. We found GFP+/nestin+ cells in leptomeninges (Figure 30). Figure 30. Morover. 70 . were stereotaxically injected into the third ventriculus of adult rats (n=3). Homing of intra-ventricular injected cells were analyzed 4 weeks after transplantation. scale bar 20 µ m. derived from EGFP-transgenic rats. Interestingly.Homing of leptomeningeal adherent/expanded nestin-positive cells Expanded leptomeningeal nestin-positive cells. EGFP+ cells were found along blood wassels (Figure 31). Homing of intra-ventricular injected GFP+/leptomeningeal cells in leptomeninges Confocal images of transplanted EGFP+cells (green) co-localizing with nestin (red) in the leptomeninges of adult brain recipient. we found EGFP+ cells spreading in the cortex.

Figure 31. Note the close proximity of individual dividing cells and proliferating cell clusters to blood vessels. and the lumen of vessels (Figure 32). Discussion 71 . Intra-ventricular injected GFP+/leptomeningeal cells follow the brain vessels Confocal image of transplanted EGFP+cells (green) and MAP2 (red) in the adult brain cortex. delimiting the blood-brain-barrier. between astrocyte extroflexions. GFP+ cells appeared to be located in the perivascular space. Figure 32. In particular. Intra-ventricular injected GFP+/leptomeningeal cells in the perivascular space Confocal image of transplanted EGFP+cells (green) and GFAP (red) in a transverse section of brain vessel. EGFP+ cells are closed but separate from GFAP+ astrocyte extroflexions.

A deep characterization of gene expression and in vitro and in vivo neuronal differentiation potential was carried out from post-natal P15 rats.e. Indeed. at P15 the cortical development was complete. On the other hand. Previous studies described the distribution of stem cell markers inside the brain (Lein et al. Data on CFU indicate that extraction efficiency was higher in younger animals and decreased with rat age. Number and distribution of the nestin-positive cells declined during development and become restricted to the leptomeninges from post-natal day 15.. we found that: i) nestin-positive cells are present in the leptomeningeal compartment at the embryonic stages and persist up to adulthood. This prevented possible contamination by other potential sources of stem cells. dentate gyrus and olfactori bulb (Gould. iv) expanded nestin-positive cells can be induced to differentiate in vitro with high efficiency to generate excitable neurons. Other nestin-positive cells were abundant at known loci of neurogenesis. iii) leptomeningeal nestin-positive cells can be cultured as adherent cells and expanded in vitro as homogeneous population of nestin-positive cells that highly express many of the stemness-related genes. In this study we report data from P0. To avoid any contamination with other cell types. 2007). In this work we analyzed the leptomeningeal compartment of the rat brain to assess whether a stem cell population with neuronal differentiation potential is present in this structure. but there was no evidence so far that leptomeninges could be a stem cell niche. These cells were neither glial nor muscle cells or pericytes. we carried out a 72 . nestin-positive cells appeared as a layer associated to the leptomeninges and in contact but distinct from the pia mater. SVZ. P15 and adult rats. Nestin-positive cells were seen in the most superficial portion of the rat brains in embryos and post-natal animals. 2007). v) expanded cells can differentiate into neurons when injected into brains of living rats. i. ii) leptomeningeal nestin-positive cells can be extracted and cultured as neurospheres with features similar to the NSC-derived neurospheres. At this age.

the nestin-positive cell population did not display any other linage-specific marker. we can reasonably exclude that the stem cell population we have characterized could arise from any known site of neurogenesis (Zhao et al. these cells are endowed of neural differentiation potential (Dore-Duffy et al. Moreover. Thus.precise sampling of the very superficial portions of the cortex in the rats at all developmental stages. such as CD34 and CD45 (hematopoietic stem cells) (Krause et al. both in vivo and after expansion in vitro. Real-time PCR was used to show that leptomeninges-derived neurospheres had gene expression and multipotent differentiation potential comparable to those of SVZ-NSCs. CD31 and CD106 (endothelial progenitor cells) (Khan et al. This was confirmed by morphological examination of the stripped brains showing that SVZ. cell 73 . 1994).nor GFAP-positive cells.. thus further confirming that the newly identified population of cultured nestin-positive cells did not originate from brain parenchyma. The newly identified population of nestin-positive cells extracted from the leptomeninges were neither NG2... It is interesting to note that a similar population of nestin-positive cells could be extracted from choroid plexi. The nestin-positive cell population grown in vitro originated from the nestin-positive cells present in the stripped tissue and not from a process of transformation occurring in vitro. the number of cells that could be obtained from the biopsies of P15 rats was large enough to conduct extensive characterization of the leptomeningeal cells. Floating neurospheres are heterogeneous cultures containing multipotent stem cells.. dentate gyrus and olphactory bulb remained intact. 2006). 2008). 2005) The extracted cells could be expanded as neurospheres or adherent cultures. a site devoid of neural cells. This was shown by the presence of the nestin signal in cells as early as the cells become adherent to the flask following extraction. In addition. Previous work had shown that cells extracted from the whole brain express both NG2 and nestin antigens in vitro.

they could differentiate into MAP2 positive neurons with distinctive morphology. Smad4 and Nestin. are down- regulated during differentiation culture. Moreover. cells grew as an homogeneous cell population of nestin-positive/lineage-negative cells. This may pave the way towards large scale-production of replicating nestin-positive cells. Nanog. This cell population showed high levels of stemness-related genes. We used a different culturing protocol and extracted cells were grown as an adherent layer. Real time PCR further supports these findings: stem cell genes. adherent/expanded leptomeninges-derived cells showed higher stemness-related gene expression as compared with adherent cultured SVZ-NSC and BM-MSC. Interestingly. characterized by clonogenicity and differentiation potential. we identified two main cell groups of gene expression: neurosphere cultures from SVZ-NSCs and Leptomeninges and adherent cultures from SVZ-NSCs.progenitors and many neuro-glial differentiating cells (Bez et al. such as Oct4. a procedure with interesting implications for stem cell- based therapies. by switching medium. Under differentiating conditions. Thus. such as nestin and NG2. 2003. the expression of differentiation 74 . P15 and adults showed neural differentiation potential. The procedure that we established allows a clear-cut differentiation between proliferative and differentiative stages of the cultured cells. the cells can then be induced to differentiate in vitro. Cripto-1. At difference from the floating neurospheres. including dendritic spines. we observed a tight correlation between the gene expression pattern of SVZ-NSC-derived neurosphere and the leptomeningeal cells-derived neurospheres. Leptomeninges-derived cells can be expanded and maintained in undifferentiated stage for up to several months. but it did not express differentiated neural genes. GFAP-positive astrocytes and O4-positive oligodendrocytes. c-Kit. expanded nestine-positive cells from P1. Chojnacki and Weiss.. By unsupervised hierarchical clustering. 2008). BM-MSCs and leptomeninges. by contrast.

This does not appear to be the case for leptomeningeal cells since up to 50% the engrafted cells express the neuronal MAP2 antigen. leptomeningeal cells were extracted and expanded from enhanced green fluorescent protein (EGFP) transgenic rats (Okabe et al. we further characterized the neuronal differentiation potential of leptomeningeal-derived expanded cells from P15 rat. our data suggest that nestin-positive stem/progenitor cells extracted from leptomeninges may have capability of neural differentiation also in vivo.. We cannot exclude that the EGFP+ engrafted cells may fuse with resident neurons. we tested their neural differentiation potential in vivo. These data suggest that the nestin-positive stem/progenitor cells extracted from leptomeninges and grown in vitro. Following intra-brain transplant. In one month. As a further step of characterization of the newly identified cell population. 2005). up to half of the cell population differentiated into MAP2-positive cells showing many features of terminally differentiated neurons. none of these cells appeared to be multinucleated. As we observed a high efficiency of neuronal differentiation. In conclusion.genes such as MAP2. including dendritic spines. receptors for neurotransmitters. presynaptic proteins. 1997). 75 . This was done by injecting expanded nestin- positive cells in hippocampus and following their fate for up to 60 days. GFAP and O4 increased. 2003). in addition. the EGFP-positive cells persisted for up to 60 days into the hippocampus when approximately half of the transplanted cells in the hippocampus were MAP2-positive and had the morphological aspect of differentiated neurons. enzymes involved in neurotransmitter synthesis and depolarization-induced changes of [Ca2+]i (Rowe et al. Fusion of stem cells with resident neurons has been shown to occur in some experimental setting when in vivo differentiation is rare (Alvarez-Dolado et al. have the potential to generate cells with several of the properties that identify mature and functional neurons. To distinguish injected from resident cells...

In addition. this region is strictly associated with pia mater cells that secrete important chemotactic factors. Thus. as well as several extracellular matrix components endowed of trophic functions (Erickson and Couchman. At this site. further supporting the concept that leptomeninges have the peculiarities of a stem cell niche. 2001b). were integrated inside leptomeninges and retained nestine-positivity. are surrounded by a perivascular space (Virchow-Robin space) formed by 76 . adult neurogenic niches play a role in directing neuronal production. Interestingly. Indeed. transplantation into SVZ. injected EGFP+ leptomeningeal nestin-positive cells seem to reside in the perivascular spaces of the brain vessels. EGFP+ cells. capable of capable of hosting stem/precursor cells. Injected MSCs and NSCs in the CFS of the sub-arachnoideal space can migrate through the perivascular space inside the CNS parenchyma (Satake et al.The discovery that stem/progenitor cells are present in leptomeninges is new but not surprising. after intra-ventricular injection. EGFP+ cells followed the blood vessel distribution inside the brain parenchyma. 2006). Moreover. preliminary data are consistent with the presence of GFP+/newly generated neurons in cerebral cortex (data not shown). In our in vivo experiments. All the brain vassels. Leptomeningeal- derived nestin-positive cells retain stem cell features when located in the leptomeninges. Long-term maintenance of stem cells requires their migration and engraftment within supportive stem cell niches.. 2000). RMS or SGZ can generate neurons specific to that region (Temple. such as as SDF-1 (Borrell and Marin. Stem cell homing. while they can differentiate into neurons in the brain parenchyma. This structure is a potentially favourable microenvironment. 2004). including coroid plexus. As described for other NSCs derived from non-neurogenic regions. or niche. it may be in contact/communication with other known neural stem cell niches such as the ventricular zone mediated by the cerebrospinal fluid. trafficking and interstitial migration are processes by which stem cells recognize and interact with microvascular endothelial cells or with extravascular tissue-specific structures.

leptomeninges are wide spreading in the whole brain. stroke) localized in the perivascular region of the main neurogenic regions. Tavazoie et al. Although it was not demonstrated for sure. They frequently adhere to the vascular structures in areas lacking astrocyte extroflexions and pericytes. Replicating stem cells and their progeny are tightly in contact with SVZ blood vessels both during homeostasis and regeneration. Adult SVZ-NSC niche contains an extensive planar vascular plexus that has specialized properties. Jiang et al.. but also in the leptomeninges (Gu et al..the extroflexions of leptomeninges (arachnoid and pia mater) filled with CSF (Hutchings and Weller. 1997).. Pollock et al. Therefore. we cannot exclude that leptomenigeal nestine-positive cells could migrate inside the brain and in choroid plexus through perivascular spaces.e.. a modification of the blood-brain barrier peculiar of the SVZ. 1986. Shen et al. In mammals. The proximity of unique structures.. Interestingly. new neurons originate next to blood vessels in the angiogenic foci of the hippocampus (Palmer et al.. neurogenesis in the brain occurs in close proximity to blood vessels and may be associated with angiogenesis. such as meningeal projections and the CSF. 2001. 77 . 2008. 2000. diffusible signals from endothelial cells promote NSC self-renewal in vitro (Shen et al. 2000). Both regions are enriched in ECM proteins and a prominent basal lamina as well as perivascular connective tissue including macrophages and fibroblasts have been described in the SVZ. 2004). Proliferating cells (BrdU+) were found after brain damage (i.. are probably important sources of signals. Indeed. 2008) (Figure 33).

Tropepe et al. and open arrows indicate newly born endothelial cells double labeled for PECAM-1 (green) and BrdU (purple).. (B) High-magnification confocal image showing that newly born neuroblasts localize in a region of newly born endothelial cells at day 7 after stroke.Figure 33. 2005. however. MSCs appear to reside in multiple human organs as perivascular cells (Crisan et al. as compared to all the other known somatic stem cells.. 2000). Scale bar.e. our data show that leptomeningeal nestin-positive cells are different from NG2-positive perivascular MSC and have different localization. 2007). 25um.. and not related to NSC have been previously described (Ahmad et al. 2000. Filled arrows indicate newly born neuroblasts double labeled for DCX (red) and BrdU (purple).. A transient wave of MSCs originates during embryogenesis from Sox1+ neuroepithelium (Takashima et al.. In adulthood. 2008. Murrell et al.. (A) Projection of Z stack images of the anterior SVZ in a whole-mount preparation double immunostained for the cell proliferation marker Ki67 (green) and endothelial marker CD31 (red). formation of neurospheres in liquid culture and neuronal differentiation. The origin and identity of the stem/progenitors cells we described is still unknown so far. i. Shechter et al. 2008. 78 .. Other somatic stem cells displaying some of the characteristics of leptomeningeal nestin- positive cells. 2008). Murrell et al.

their proliferation capability in vitro.Conclusions Further studies are needed to establish the in vivo role of leptomeningeal nestin-positive cells in embryonic. Finding factors that may expand migration. and their differentiation potential into neuronal cells in vitro and in vivo.. replication and differentiation properties of the resident population of stem cells may be relevant for the improvement of regenerative therapies for brain diseases. as a new entity (Bifari et al. As leptomeninges cover the entire CNS surface and also follow vessels into the brain parenchyma. Because of the persistence of these cells up to adulthood. post-natal and adult CNS. as well as their potential usefulness in the treatment of neurological diseases when used as source of NSC-like population. 79 . Further characterization of LeSCs in normal and pathological conditions may help to better understand the cortical neurogenesis. it is possible that the adult CNS has the potential to host regenerative stem cells over a large proportion of its volume. we have suggested to name them Leptomeningeal Stem/progenitor Cells (LeSC). 2009).

Batlle. Development of layer I and the subplate in the rat neocortex. 501-514. and Parati..K.. Beggs. M..J.. and Melton. Fumagalli. 872-884. M.. Gaddapara... O. J. H. and Altman. Skin-derived precursors generate myelinating Schwann cells that promote remyelination and functional recovery after contusion spinal cord injury. Time of origin and distribution of a new cell type in the rat cerebellar cortex. T. Altman. 265-274. Watanabe. E. Neurosphere and neurosphere-forming cells: morphological and ultrastructural characterization. Nicolis. Zang. Perlecan is essential for cartilage and cephalic development. and Tetzlaff. et al. Cell 111. Pardal..R. Anghileri.E. J. Lee. Gorski. and Yamada... FAK deficiency in cells contributing to the basal lamina results in cortical abnormalities resembling congenital muscular dystrophies... Goebbels. Novel stem/progenitor cells with neuronal differentiation potential reside in the leptomeningeal niche. 447-482. and Millar. I. J... Genes Dev 17. Bayer.E. Pawson. Methods Enzymol 418..F.. Nat Rev Mol Cell Biol 6. L. Liu. G.. M.. Bez. A. (1999). C. Alexanian. Schahin-Reed.. H. Jones. Robertson. B. M. Sparling. Pignatelli.. and Lovell-Badge. Alvarez-Dolado.. L. Marconi. J. S. and Pham.A.A. (2008). 383-391. V.. Multipotent cell lineages in early mouse development depend on SOX2 function. Henderson.. 517-521.. References Ahmad. 354-358.. Exp Cell Res 310. T.. 9545- 9559. E. Sbarbati. Boiani. Exp Brain Res 29.M. (2003). Garcia-Verdugo. (2000).. (1990).. H.. J. A. Plemel. Hassell. Neural patterning in the vertebrate embryo. (2003). A. Reddy.T. (2003). Andl... Neuron 40. H. A. (2003). (2006). H. 643-653.. A. F.R. 909-916.. Neural stem cells induce bone-marrow-derived mesenchymal stem cells to generate neural stem-like cells via juxtacrine and paracrine interactions. S. Lisi. Biernaskie. R. S... A. K. K. Curti. (2001).. J. (2002).. C.. Identification of neural progenitors in the adult mammalian eye. Fike. Nicosia. J.. and Alvarez-Buylla. Sancho.A. T. Meeldijk. Shannon. C. Huls. Bifari. R.R. Human embryonic stem cells..H. J. (2005). and Brivanlou. J Neurosci 27.A. 126-140. N. Sretavan. 251-263.. Stem Cells Dev 17.T. Bonetti. Krampera. 80 ... Malpeli. Neuronal differentiation potential of human adipose- derived mesenchymal stem cells. Akutsu. Cowan. L. Tang..M.. H. Avilion.. L.. cardiomyocytes and hepatocytes.. E. Int Rev Cytol 203. G. 968-973.S.. and Reichardt... (1977). D.D.O. Arikawa-Hirasawa. M. S. S... A. van den Born.. Johansson. J. G. A.. S. J. et al. Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB. K. Exp Neurol 107.. B. Fusion of bone-marrow-derived cells with Purkinje neurons. Nature 425. S.A. Biggiogera.R.. Nat Genet 23. Biochem Biophys Res Commun 270.. Y. Lois.R. R.. Nave.. I.. M. and Bayer. G. 78-92.. C... J. J. Dev Cell 2. E..R. Cifelli. D. J. Pizzolo.. Brain Res 993. Belluzzi.H. Beghtel. Corsini. P. 18-29.R.F. E. S. (2007). J Cell Mol Med. (2009). S. WNT signals are required for the initiation of hair follicle development. Pevny. Xie...P. Bersan. D. E.. D.A. Morrison. H. van de Wetering. Decimo. Perez. Y.. (2002). H. and Scholer. Takami.. (2005). E. Chiamulera. Galie. Altmann...F. and Bonetti... Colombo. J.. W. 48-62. F. Pfeffer. Miller. Regulatory networks in embryo-derived pluripotent stem cells.. K. M. Vivian. C. Pagano..

Transplantation of human umbilical cord blood-derived adherent progenitors into the developing rodent brain.. Yeung. (2000). Exp Neurol 137. 935-940.. Bystron.. Han. C. and Kessler. S. J Neuropathol Exp Neurol 64. Geijo. and Sucov. E. Carlen. (1996). Y. (2006). Adams.. 357-366. P. (2002).. LeX/ssea-1 is expressed by adult mouse CNS stem cells. H... and Temple.. D. Jr..H. Gobeske. L. Chojnacki.. J. Nat Neurosci 12.. T. 85-95. Divieti. Bringas.. (2001).. 1649-1657. (2009). X. M. Rowitch. McMahon.. P. McGuire..S... Knight. Catala. et al.. Cell 82. 841-846. G... J.Bonaguidi.. Development 127. Development of the human cerebral cortex: Boulder Committee revisited.. Pojda. Chen. Cleavage orientation and the asymmetric inheritance of Notch1 immunoreactivity in mammalian neurogenesis.. (2003).A. Meninges control tangential migration of hem-derived Cajal-Retzius cells via CXCL12/CXCR4 signaling.P. P. (2008). J Cell Biochem 98. 9194-9204... V. P. Dev Dyn 221. (1995). Osteoblastic cells regulate the haematopoietic stem cell niche.. A.Y.M.K. Takahashi.M. Olson. Amendola. A. (1998). R.. Mak. and Rakic... 762-765.. C. and Marin. Jiang. Coenen.. ependymal cells or both? Nat Rev Neurosci 10.I. Aigner. Embryonic and fetal development of structures associated with the cerebro-spinal fluid in man and other species. M.C..E. G.L.K.. Tanigaki. Ito. and Weiss. Towards a cellular and molecular understanding of neurulation.. R.. V. Falciglia.M. Regulation of normal proliferation in the developing cerebrum potential actions of trophic factors. Naldini. Schipani. and Brustle. Neuroscience 133..B. 110-122.W. E. Y. 1284-1293. J. G. 153-169.. Meletis... and Weiss... 1671-1679. Bornemann. T. K. (2008). 631-641. A. Chojnacki. Jr.. Darsalia. Capela. Functional neural stem cells derived from adult bone marrow... J. 681-688.. Goritz. Bringhurst. Garcia-Verdugo. G. Chenn.. Y. J.K. S. Noggin expands neural stem cells in the adult hippocampus.Y. Bonilla. O. Nat Protoc 3. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Human cord blood-derived cells attain neuronal and glial features in vitro.. and Domanska-Janik. S. V. Proliferation and differentiation of neuronal stem cells regulated by nerve growth factor. M. and Delalle. K.A. B. Silva. Part I: The ventricular system.. K. F. (1997). S. Mesenchymal stem cells as trophic mediators. identifying them as nonependymal.S. meninges and choroid plexuses.C. and Martinez. and McConnell. Chai. (2006). and Dennis. astrocytes and oligodendrocytes from mammalian CNS stem cells. A.M. 117-145.. Arch Anat Cytol Pathol 46. Nature 347. Calvi.. Nature 425.P. T. P. I. Wernet. M.. 259- 267. S.. (2006).T. S.. J Cell Sci 115. M. Production of neurons. E.. Weber. G.. (2005). Czeisler.. 1076-1084. Teng. A. Z... and Tang. 865-875. and Kirchner. (2002). Peng. C. Caviness. J. (2009). 153-163. et al. Blakemore.. (1990).. L. Cell Mol Life Sci 63. and McKay. A. M.R. 81 . J Neurosci 28. Barnabe-Heider. Identity crisis for adult periventricular neural stem cells: subventricular zone astrocytes.F. Cattaneo.. K. Nowakowski. K. Neuron 35. D. S. Acta Neuropathol 93. Kogler. and Schoenwolf. B. Zablocka. Coaxing bone marrow stromal mesenchymal stem cells towards neuronal differentiation: progress and uncertainties. Colas. Borrell. 173-177. A. Nat Neurosci 9. F. (2008). Evergren. C. (2005). M. Weibrecht. T.K. F. E. Machaj. O...P. Buzanska. Spatial and temporal development of the gliovascular tissue in type II lissencephaly. Forebrain ependymal cells are Notch-dependent and generate neuroblasts and astrocytes after stroke..S.. A. 2131-2138. L.. Martin. L. E. Miyama. R. Caplan. Nat Rev Neurosci 9. I. Soriano. Valdes..

. J Cell Biochem 105.. Dev Cell 9. 2467-2474. Costa. A. A. B. Menei. Toselli. and Van Buren.H. C. Caille.. The instructive role of fibronectins in cell migrations during embryonic development. e1644. A. Bordignon. M. Neural differentiation of human embryonic stem cells.K..D. 613-624. P.K.A.. Curr Opin Neurobiol 10. Liu.. Reitano. C. Adherent self-renewable human embryonic stem cell-derived neural stem cell line: functional engraftment in experimental stroke model. S.L. Gage. e283. (2008). E. Still more complexity in mammalian basement membranes. Cereb Cortex 11. J. 342-351. J.. Levine. Deng. Robust in vivo gene transfer into adult mammalian neural stem cells by lentiviral vectors. G. and Spradling. A. Ying.. et al. Erickson. Doetsch. J... 31. T.. Cattaneo. T.C. Implantation of BM mesenchymal stem cells into injured spinal cord elicits de novo neurogenesis and functional recovery: evidence from a study in rhesus monkeys. J Histochem Cytochem 48. Harding.. X. J. Sanzone. PLoS ONE 3. Brain Res Rev 57. a unique population of postnatal young and old human cells with extensive expansion and differentiation potential.L. L. PLoS Biol 3. Neuronal migration defects in the Dreher (Lmx1a) mutant mouse: role of disorders of the glial limiting membrane...A. D. D'Ippolito.. 273-280. Neuron 36. Zheng. B. A..M. 633-640. (2005). Stem Cells 26. (2005). S. J. I.Q.Q. and Rothman. 82 . Fontaine-Perus. Katychev. Yap. L. Casteilla. (2008). 2971-2981... G. and Alvarez-Buylla.A. Z. Pollard.M. Ann N Y Acad Sci 588. P. and Reynolds. R. Daadi. Liu. Marrow-isolated adult multilineage inducible (MIAMI) cells.. Doetsch. S..D.. L.. A. NG2-expressing cells in the central nervous system: are they oligodendroglial progenitors? J Neurosci Res 61.G. Decotto. C. (2008). Dhara.J. Y..S. and Sanes. Corselli.. F. F. Y. N. Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. 413-422. S.L. Dolcetta. Dufour. Gorba.. P. Crisan. M.... S. (1999). Garcia-Verdugo. R.M... Cell 97.C. 210-214. Wang. X. A perivascular origin for mesenchymal stem cells in multiple human organs. Y. Q. Sun. L.P. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. G. Development: neural development at the millennium. Andriolo. D.B. 1021-1034. and Thiery... Dore-Duffy. G. (2002). A. K. S. (2000).W. and Copp. Development 107. Cell Stem Cell 3. (2001).. Cytotherapy 8. (2004).. Le Douarin. and Wang. Petreanu. (1990). J Cereb Blood Flow Metab 26.C. Liu.. Fowler. and Schiller. Maag. I.. 501-510..R.L. The Drosophila ovarian and testis stem cell niches: similar somatic stem cells and signals. Liu. M.C.. Gritti.... Gershon. A. CNS microvascular pericytes exhibit multipotential stem cell activity.. and Steinberg. G. EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. C. F.. Mitogenic effect of muscle on the neuroepithelium of the developing spinal cord. Doe. Caille. Dawson. M. B.P. (2004). Y. Chen. Lim. et al. E. L.. S... S.. Park... J Cell Sci 117. C. and Naldini. (2008). Zhang. E.L. Jaenisch.. 1291-1306. M. Sun.. T. A. A. (2000). Conti. J. X. Z. 498-505.. and Alvarez-Buylla. A. and Couchman. E. Diabira. Eminli. Liu... B. 471-479. Biella. and Stice. Proc Natl Acad Sci U S A 101. Estrogen and adult neurogenesis in the amygdala and hypothalamus. Follenzi. (2006). and Zhou..Consiglio.. G...... (2000).M.M. Duband. Utikal.. Chanconie. 703-716. Howard. M.. 301-313.R. (2006).M. J. J..G. Vescovi.. Arnold. (2008).L. Reprogramming of neural progenitor cells into induced pluripotent stem cells in the absence of exogenous Sox2 expression. 14835-14840.. Roos... K... J.R. M. and Hochedlinger. Garcia-Verdugo. (1989).

Grimpe. C. J.. O. Scoville. Schittny. 3144-3160. L. (2003). (1986).T.. Georges-Labouesse.. 316-325. M. 481-488. Brannstrom. W. U. Isolation and characterization of kidney- derived stem cells. R. W. Jiang.. Glial cells generate neurons--master control within CNS regions: developmental perspectives on neural stem cells. and Gotz.. Blackstad.H. Beta1-class integrins regulate the development of laminae and folia in the cerebral and cerebellar cortex.. 3245-3254.. S. Haubst... J. F. E. Lee. Essential role of alpha 6 integrins in cortical and retinal lamination. E. (2000). Anatomical relationships of the pia mater to cerebral blood vessels in man.C. K. Z. Nat Genet 36. 9357-9366. Basement membrane attachment is dispensable for radial glial cell fate and for proliferation..G. M. U. Imura. M. Gat. 605-614. Orban. Georges-Labouesse. Dong..P. E. 83 . J Neurosci 22. Hatakeyama. Mayer. Littlewood-Evans. J Cereb Blood Flow Metab 20.. T.. et al. C. and Muller. DasGupta. T. 612-613. M. Hutchings. Heremans. X....O.. F. P.D. Cortical neurogenesis in adult rats after reversible photothrombotic stroke..J. Curr Biol 8. and Srour. Notch1 expression is spatiotemporally correlated with neurogenesis and negatively regulated by Notch1-independent Hes genes in the developing nervous system. 158-173. (1998). Gould.. J. (2003). N.. S. J. Y. J Am Soc Nephrol 17. A.S. (2008). Development 131.. Faissner.. (2003). Cereb Cortex 16 Suppl 1. Chmielewski. K.. A. U. X. M. Nat Neurosci 7.. 1233-1241. 3423-3432. Damsky. and Kageyama. He. Tozuka. D. Degenstein.B. J Neurosurg 65. Doan. A critical function of the pial basement membrane in cortical histogenesis. Halilagic. J.V. Y. Gupta.. Two distinct subpopulations of nestin-positive cells in adult mouse dentate gyrus. GFAP- expressing progenitors are the principal source of constitutive neurogenesis in adult mouse forebrain.. W. M.. Messaddeq. Doller. P. Gage. and Mayer. W. Mark. S. J. E. E. How widespread is adult neurogenesis in mammals? Nat Rev Neurosci 8. Ross.. Y.. Kang. Tawfik.. M. J. C. A. and Fuchs. Hong.. Yoder.. A.. Yamaguchi. Halfter. and Wester. Generation of an environmental niche for neural stem cell development by the extracellular matrix molecule tenascin C.Fukuda. Development 133. 6029-6040. 3028-3040. M. Y. Gotz. Morrison.H.. R. and Kim. X... K. Dong. and Hisatsune. S.. T...C. Bush. Malouf. Huang. He. The critical role of basement membrane-independent laminin gamma 1 chain during axon regeneration in the CNS. (2004).F. Connaire. A.. Neuroscientist 9. including dopaminergic neurons. Wiedemann. (2004). M. et al.. Cell 95.. Tong. Ann N Y Acad Sci 996. Yip. 316-324.. D. D. Garcia... and ffrench-Constant. Howell... 1117-1121. S.C. C.. Gu.. 983-986.. L.. i132-137..C.. (2006). Klein.. J Neurosci 23.. Senften.... J Neurosci 22.. J Neurochem 104. J Neurosci 22.. J.. Neuron 31. Tian. Neurogenesis in the adult brain. (2002). Verfaillie. 367-379. B.. S. Kren. Eidman. Pluripotent stem cells identified in multiple murine tissues.H. T. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. M. U.. Y..M. Neural precursors derived from human embryonic stem cells maintain long-term proliferation without losing the potential to differentiate into all three neural lineages. (2002).G. Zeng. Temple.. (2001). Garcion. R. Kato. O. (2002). Isacson. Blaess. Lund.. Graus-Porta. Zhong.. 379-397. (2006). Zhang. (1998). Q. R.. N. 1166-1173. (2006). A.. P. N... (2004). and Weller. but affects positioning of neuronal subtypes. S.. and Gansmuller. E. Miyamoto. Willem. and Sofroniew. A. U. De Arcangelis. (2007). De Novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. T. and Silver.

. Kaji. R. (2007)... R. J. Jiang. Jr. 41-49. K.. Seng.S. Ortiz-Gonzalez. Ichikawa.. Process elongation of oligodendrocytes is promoted by the Kelch-related protein MRP2/KLHL1.D. Lund. Y.. Keep.M. Vellinga. T. Improvement of neurological deficits by intracerebral transplantation of human adipose tissue-derived stromal cells after cerebral ischemia in rats.. E. and Kim. C. 573-584. Chen. 1351-1354. and Avraham. and Wilcox. 47-53.B.M. and Woltjen. T. Neuroectodermal differentiation from mouse multipotent adult progenitor cells. A. Blackstad. 84 . Brannstrom. Y. S.F. (2004). and Takahashi. Fu. S.L. M. and Verfaillie. Science 276. L. (1970).. A stem cell molecular signature.. Lee... and Lemischka. D.U.. K. Nature 418. Y.. Yang.. G. G. D. Dimos. (2003). Y. H. Virus- free induction of pluripotency and subsequent excision of reprogramming factors. Yang. M. Rosqvist. Momma... P. Proliferative response of mouse spermatogonial stem cells after irradiation: a quantitative model analysis of experimental data. Nature. (1999).. Experience-dependent regulation of adult hippocampal neurogenesis: effects of long-term stimulation and stimulus withdrawal. Solomon.B.Y.. Reyes.H. Hippocampus 9. (1996). Bentzen.. Proc Natl Acad Sci U S A 100 Suppl 1.. and Frisen. M. C.. (2002). P. T. Cell Prolif 29. S. J.. Morris. (1997). and Cotsarelis.. Moore. Park.K. (2005). M. and Overgaard. Liang.. Nat Med 11.. Laughlin.E. E.C. Pluripotency of mesenchymal stem cells derived from adult marrow. S.. Schnack. Stem Cells 26. Khan. Paca. Risling..G. Jahagirdar. and McCoy. K. I. Nguyen. Brain Res Dev Brain Res 56. A morphometric study on the development of the lateral ventricle choroid plexus. J.S. Lenvik.P. et al.A. Hansen. Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis.. 25-34. Yoon..K.J. and Mercier. Baik. and Wester.A. J.R. I. Y. Cortical neurogenesis in adult rats after transient middle cerebral artery occlusion. Y. J. (2003). F. J Biol Chem 282. C.. S... Detection of circulating endothelial cells and endothelial progenitor cells by flow cytometry. and Jung. Miller. Keene. (1990). J.K. 1201-1207. Neurogenesis in postnatal rat spinal cord: a study in primary culture. Kashiwakura... Kehl. 507-520.S. Bae.. Judas.C. 1221-1230. 12319-12329.A. Norrby. (2007).K. J. W. H. Cell 96. X. R... Stem Cells 25. R.... G. Mohseni. B. N. P. (2008). Jones. T. Jiao. (2009).. (1999).J. J. K. Schwartz. H... 321-332. Lee... S.J. Stroke 32.. Schaniel. Avraham. Mileikovsky. S. Jiang. Kang.. A..T. 2146-2157.. Ivanova. and Jones.. F.L.F. N.. T. Retinoic acid-mediated induction of neurons and glial cells from human umbilical cord- derived hematopoietic stem cells. Gu. (2002).R... and Chen. Cytometry B Clin Cytom 64.. R.T. J. D.. C...Ito. Reinhardt... (2001). Exp Neurol 183.. J Neurosci Res 75.. 355-366..H... M.. 11854-11860. A. Liu. Jang.A. 329-333. Moon.. L... Henderson.F. D. U. On the mode of entry of blood vessels into the cerebral cortex... 1-8.. D. Fairbanks. 73-87.L. W. S. Johansson. B. Novel extracellular matrix structures in the neural stem cell niche capture the neurogenic factor fibroblast growth factor 2 from the extracellular milieu.. Jiang. and Gage. J. Kerever.V. Science 298. S. Yang.N. Arikawa-Hirasawa. 601-604.. M.H. Blackstad. Hackney. 586-589. Identification of a neural stem cell in the adult mammalian central nervous system.C. S. Lendahl. choroid plexus capillaries and ventricular ependyma in the rat. Jiang. Induction of neurogenesis in nonconventional neurogenic regions of the adult central nervous system by niche astrocyte-produced signals. R. Kim.M. Kempermann. M. M. Clarke.A. F. C. (2005).E. Efird.. C. (2005).. J. Z. Fibroblast growth factor and ex vivo expansion of hematopoietic progenitor cells. Leuk Lymphoma 46. J Anat 106. Y.

A. Shen.. R. and differentiation of neural stem cell lines after transplantation to the adult rat striatum. Kemler. Krause. G. Blood 111. J.. Galie. 5181-5188... Li. et al. A. M. Kokovay. 1669-1675. Neuron 60. E. (1994).. R. J Exp Med 200.D. J. Pasini. Nat Genet 38.M. et al. W.J... T.. Andreini. K. Bourque.. Nature 444. Brain Res 1110. Douglas. Sensken. Luo. Feldhahn. R. L.C. Modeling the neurovascular niche: VEGF.. Kuo. Lovell-Badge. M. Swaroop.. S. C. J.. Kotton.. Hawrylycz. Christophersen. M.. (2005). A. Y. Stem Cells Dev 14.. Wu. M..H... Cobas... and Flier... Sowden. R. Yin.D. Expression patterns of Jagged. 123-135. Lovato. 420-429. Cardoso.. Fukuhara. Perivascular cells act as scavengers in the cerebral perivascular spaces and remain distinct from pericytes.S. G. A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiation potential.. F. Steart. and Ali. Neural cell differentiation in vitro from adult human bone marrow mesenchymal stem cells.. Zhang. Ayres. M.. Lavik.. Q. R.. 55-63. Williams. 168-176. 1656-1668. O. J.. M. W. (2008). T. H. L. Simultaneous loss of beta.. Characterization of murine CD34.E. 971-974. Leong.A. McKay. Blood 103. A. E. (2001).R.. S. Generation of purified neural precursors from embryonic stem cells by lineage selection. G. Hsieh. B.K. E. Boguski.. S. M. MacNeil.. (1998).and gamma-catenin does not perturb hematopoiesis or lymphopoiesis. microglia and macrophages.. Ito.. E. Blood 84. T. E. S. Trends Neurosci 31.. fat. (1996). and Weinmaster..E. J. (2004). Sanderson. A. G... Science 310. integration. Bone marrow-derived cells as progenitors of lung alveolar epithelium.....H. Tinelli. 203-207.L. Exp Neurol 145. R... M. A. spleen and thymus. M.S. Mosna.J. Notch1. 646-652. Neurogenesis in the hypothalamus of adult mice: potential role in energy balance. (2004). Collector. Q.A. Rigotti. Genome-wide atlas of gene expression in the adult mouse brain. W. X.. Airey.L. W. a marker for hematopoietic progenitor and stem cells..S. MacLaren. 691-701. Li.. (2006). Byrnes. J.. M.. Koch.K. R. Retinal repair by transplantation of photoreceptor precursors. (2006). Bernard. George.Y. Macdonald. (2006).. 342-360. Fackler.. Long. D. M. C. R. Boe. and Kletzel. Boulter. Fischer. Olszewski. The incredible elastic brain: how neural stem cells expand our minds. and Radtke. Mol Cell Neurosci 8.. N. Notch2. T. A. Lundberg. H. Chen.. E..C.. Nature 445.. and Madri. Delta1. Muschen. Zhang. Trapp. Kogler... Akimoto.. M.I. (2005). and Weller. Kokoeva. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Cattaneo. Expression of JAM-A... Lee. Sharkis. A. L. M. and Notch3 genes identify ligand-receptor pairs that may function in neural development. S. Wilson. Salt. M...S. Huang. V. K..A.A. Summer.. Survival.and BDNF-mediated cross-talk between neural stem cells and endothelial cells: an in vitro study. Liu.V. and Rizzolo.. J. (2008). AF-6.Kida.. C.N.. 85 .V. 160-164.. Curr Biol 8.M. Bone 40. Lee. M.S. et al. (1993).. Loh. Pevny... Lein. D. Martinez-Serrano. A.R. V.C. D..H. Induction of neural-like differentiation in human mesenchymal stem cells derived from bone marrow.Y.J. 65-69. Weitzman.T.. Chen.J. B. Acta Neuropathol 85.S. Anghileri. Pearson. E... S.. G. Lindsell. A. Rosenbaum. Ma. Li. and May. J. Vega... (2007).V.J... Hall. M. R.... Isolation of multipotent mesenchymal stem cells from umbilical cord blood.. O.. M. M... Gossler. and Chen.S.. Critical issues of clinical human embryonic stem cell therapy for brain repair. (1997). 382-390..B. (2008). Bensinger.S. Marconi. Krampera.. (2007). Soulet. T.. and Bjorklund. P.. J. 146-153. 679-683. Q. Ford. Brockway. and Fine. E.. and Brundin.. Chew. Y. W. X. and Temple. Ao..B.F. F.O. M.. (2006). S. A. R. et al. and Smith. 14-27.E. P.. PAR-3 and PAR-6 during the assembly and remodeling of RPE tight junctions.. N. U. Development 128. Sorg.. N. J.V. Smith. diSibio. 431-440. A. Liedtke. J Neurosci Res 84. A.

McLone. Scholer. Mancini.. Human stem/progenitor cells from bone marrow promote neurogenesis of endogenous neural stem cells in the hippocampus of mice.. 151-160. T.. 437-448.L. Marin-Padilla. Shioda.G. B. (2005). and neuronal differentiation: stem cell and precursor functions. H. Braunstein. Ohkubo. Marrow stromal cells..E.B. B. J. F. S. (2005)... T. Matrix cells from Wharton's jelly form neurons and glia. mitosis. Donnellan.. I. J. A. McLone.. Meedeniya.Madhavan.R. I. Morales.J.L... Niwa. Feron.. (2008). Ohneda...G. H. Shin. Cell 95. K. Kimura. (2005).R. W. F. J. Nagano.. (2007). D.. (1998). T... 598-611. A... 379-391. 2183-2192. D... and Vaccarino... R. Cunningham. Reger. M. Bianco. Epithelial hedgehog signals pattern the intestinal crypt-villus axis. and Mackay-Sim.. G. J Neurosurg 69. Woodbury.T..... Spees. Increased "vigilance" of antioxidant mechanisms in neural stem cells potentiates their capability to resist oxidative stress..M. 496-515.O.. A. A. Zevnik. J.R.. Klewe-Nebenius. V. A. Kesby. Madison.. K. Proc Natl Acad Sci U S A 102. Miner. Jagged1-dependent Notch signaling is dispensable for hematopoietic stem cell self-renewal and differentiation.. M.. G.M.J.. 276-282. J. and Hochedlinger. Suter.J. Partanen.. M. A. N.. H. 6057-6069. E. M.C. Multipotent stem cells from adult olfactory mucosa.. syndactyly. Bellette. Ylostalo.. K. S. K. Lee. Development 132. and Gumucio. and placentopathy in mice lacking the laminin alpha5 chain. Murrell. and Ohneda.. Splatt. H.L. Weiss. S. (2004). B. K.. The fine anatomy of the human spinal meninges.. and Weller. Blood 105. Perry.P.. B. R. B. P. H.. 595-605. Mitchell. and Ourednik. J. 86 . A.B. Hildreth. 50-60. Mantei. Perry. Cell 132.. (2008).O. Roles for laminin in embryogenesis: exencephaly. L.. J. X. Martin. Childs Brain 6. O. Burne. 1713-1723. Chambers. J.. (1998). K. Olfactory mucosa is a potential source for autologous stem cell therapy for Parkinson's disease. Portman.H.E. Stem cells and niches: mechanisms that promote stem cell maintenance throughout life. M. D.. K.. and Radtke... (2003). Hamada. L. A.... Beerenstrauch. B. Yoshikawa. Y.. D. Davis. Robinson. U. Foraker. Anastassiadis.S.. H... Nichols. Nicholas. Morrison. Dev Dyn 233. C.P. J Neurosci 24. Feron. Murrell.. J Cell Biol 143. J.. D.. (1980b). J. and Prockop. and Black. A. 18171-18176. Wetzig. (2008). Ourednik. K. Cell Stem Cell 3. P. F. Abou-Easa.. Stoutenger. C. K. T. F. J. A. Development of the limiting glial membrane of the brain.. Nakagawa. (1998). (1988). Helwig. Stem Cells 26. 279-289. D. Identification of functional endothelial progenitor cells suitable for the treatment of ischemic tissue using human umbilical cord blood. D. Ohtaki... A light and scanning electron microscopy study. J. M. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cajal-Retzius cells and the development of the neocortex. Shibuya. Mitchell. Uchida. Kuizon. Munoz-Elias. W. Fibroblast growth factor receptor 1 is required for the proliferation of hippocampal progenitor cells and for hippocampal growth in mouse. Blood 110. D. D..J.. (2008). N. Stem/progenitor cells from bone marrow decrease neuronal death in global ischemia by modulation of inflammatory/immune responses. Childs Brain 6. 113-130.. (2003). Bianco. Stem Cells 21. Robinson. Cameron. MacDonald. Dumortier. Trends Neurosci 21. (2005). and Smith. Yamashita... Guidelines and techniques for the generation of induced pluripotent stem cells. Wetzig. 64-71. Munoz. 2110-2119. The subarachnoid space: a review... Stem Cells 21. and Prockop.H.R.. J. Stem Cells 24. Qiao.. et al. N. (1980a). (2006). Proc Natl Acad Sci U S A 105. 150-162. 14638-14643.L.. 2340-2342. and Sanes... Silburn. and Spradling. et al. D. Maherali.

.. Reh. Klueber. T. Nature 423. 4565-4574. J. FEBS Lett 407. Scherer. K. W. (1992). A. D. 1083-1091. 19- 32.A. Merzlikina. J Neurosci 12.C. A. Ortega-Sanchez.J. P. Abarbanell. 409-414. Lu. Mol Med 14. S. Smooth. W.. 313-319. F.. 'Green mice' as a source of ubiquitous green cells. J Anat 191 ( Pt 3). Dombrowski.T.. Pinto...L. Methods Enzymol 419. M.Okabe. Palmer.B.. and Buravkova. Plum.. Retinal stem cells. Conti. Magin. A role for Wnt signalling in self-renewal of haematopoietic stem cells.... Sanz.C. A... Duncan. A. Pollard. R. Y. and Nishimune.. K. Rocha. Y. Domen. M. Umbilical cord blood transplantation. P. Nakanishi. J.. Science 255. and Stallcup. Willert. T. T. A. and Clevers. (2001). G. F.. (1992). Science 298.A.M.. N.. F.. Ozerdem. K.A.. Elusive radial glial cells: historical and evolutionary perspective. T. Rietze. 176-184. Hutchings. E. Lahm.J.W. Matsuzaki. C. Hintz.. C. Crisostomo.O. J Comp Neurol 145. T.H.. (2002). D. 87 . W. and Weissman. G. L..R. Reina-De La Torre. C. (2000)... (2005). Anat Rec 252. Nature 412. E. Hallas.L.. 597-600.... Perivascular structures in corrosion casts of the human central nervous system: a confocal laser and scanning electron microscope study. Nusse. Dev Dyn 222. J.F. Vascular niche for adult hippocampal neurogenesis. Hatcher. (2004).. 218-227.D. M.F.. 138-143. (1998). E... (2006). F.N. Brooker. N... U. Reynolds. et al. A. Perivascular spaces in the basal ganglia of the human brain: their relationship to lacunes.. Wnt control of stem cells and differentiation in the intestinal epithelium. L. Lamers. Monosov. Ramalho-Santos. Ikawa. Curr Opin Genet Dev 12. rough and upside-down neocortical development. Kim. and Gluckman. (2003).A. Purification of a pluripotent neural stem cell from the adult mouse brain. (1998). Tetzlaff... R. H. and Bartlett.. C. Voss. Olson.. Cereb Cortex 16 Suppl 1.R. (2001). (2001). A. Dozier. Rakic. Novotny. Grako.. 736- 739. (1997). Weller. Goffredo. (1972). 337-346.. V. Shields. Ailles. R.V. (2003). R. P. and Sahuquillo-Barris.. 1707-1710. (2005). L... Reina-De La Torre. and Zhang. Curr Opin Hematol 11.. S. 320-327. K. D. G. D. M.R. B. Morphological characteristics and distribution pattern of the arterial vessels in human cerebral cortex: a scanning electron microscope study. A. Wolpert.. Mode of cell migration to the superficial layers of fetal monkey neocortex...C. and Fischer. 52-73.. and Weiss. (2000). Rakic.M. Adult human olfactory stem cells. F. B.B. and Smith. M. and Walsh. Rodriguez-Baeza. 375-385.A.. J. 493-501. M.. Hagendorff. Thomas.. Yoon.B. Reynolds. D. 87-96.A. and Weiss.L. and Maguire. Sex steroids and stem cell function. Romanov. Bull Exp Biol Med 140. characterization. 479-494. T. (2002). L. H. K. S.. S... and Meldrum.. 11-22... i112-120. Exp Cell Res 306. Reya. S. (2006). and differentiation potentialities. and Melton. Pollock. Rodriguez-Baeza. H. Anat Rec 251. Roisen. Y. I.. P. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. E. NG2 proteoglycan is expressed exclusively by mural cells during vascular morphogenesis. Valcanis.. J Comp Neurol 425.A. Schumacher.. L. Darevskaya. and Sahuquillo-Barris. Y..H. A.M.K.. and Gage. (2008). Sun. Curr Biol 10. Ray. R. Mesenchymal stem cells from human bone marrow and adipose tissue: isolation.. Adherent neural stem (NS) cells from fetal and adult forebrain. Kominami.. A.. Unique and shared functions of different connexins in mice. T. 61-83.M.. 357-363. "Stemness": transcriptional profiling of embryonic and adult stem cells.. A. Willhoite. Brain Res 890. Evert. B. A. Dahlin-Huppe. A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. (1997). Glia 43. Mulligan..

W.D. and Dunnett.. N. Zietlow. Differentiation of neural lineage cells from human pluripotent stem cells. Toll-like receptor 4 restricts retinal progenitor cell proliferation. Karanth. D. Q. B. T. 831-841. S.. K. Bakalash. M.W. M...D. Stem cell transplantation for neurodegenerative diseases. Epidermal neural crest stem cells (EPI-NCSC) and pluripotency.S. Spine 29..G.. Tsai.. (2002). L.. M.M. Endothelial cells stimulate self-renewal and expand neurogenesis of neural stem cells.. Meningeal cells organize the superficial glia limitans of the cerebellum and produce components of both the interstitial matrix and the basement membrane. D.. (2000). H. M. and Temple.. J. Abramova. S.. F. Jin. Cell Cycle 7. W. P. 1044-1049.T. Lee. Scadden. 271-277. Roy.. 1338-1340.W. Y. C. Stem Cells 23. (2005). S.. Safford. Shen.B. Cancer Res 51. A. (1991).. R. E. Kawaguchi. Jeftinija.... Couldwell.. Sievers.. Goderie. Huang. J Neurocytol 23. D. D. Reisfeld.C. N. S. and Schwartz. Halvorsen. C. Silver. W. and Rice. cord blood and bone marrow hematopoietic progenitors: implications for anatomical localization and developmental stage specific regulation of hematopoiesis.. 289-300. (2006). Vincent. M. Sieber-Blum. (2004). Schwartz. S...C. 1971-1979. 256-260. S. P. 4986-4993. Brick.. F. H.. and Verfaillie. Okano.. Miyanishi. (2005). 756- 763. Q. Shen. Schrappe.. Rowe. Takahashi. Stem Cells 23.T. Stem Cell Rev 4. Kawano. S. Neurogenic differentiation of murine and human adipose-derived stromal cells.. A. T.L. Stover. Chen. (2008).C..G. 688-692. Young. Jeftinija. Paracrine signaling through the JAK/STAT pathway activates invasive behavior of ovarian epithelial cells in Drosophila. Curr Opin Neurol 20. London. Fraser. 3491-3492. 232-245. Araki. Nat Med 6. A.. Benraiss.. Development of functional neurons from postnatal stem cells in vitro.. Roszko.J. and Hu. Rolls... Safford. Gimble. J. Lou.. N. Correlation of chondroitin sulfate proteoglycan expression on proliferating brain capillary endothelial cells with the malignant phenotype of astroglial cells.. Wang.. D. Shih. Biochem Biophys Res Commun 294.. Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue.. Jiang. (2008).C.. I.. D.. K. Y.. and Berry..E. V. and Chiu. Gude. A. Goderie. D. Shen.. 880-893. J. Migration of mesenchymal stem cells through cerebrospinal fluid into injured spinal cord tissue. (2005). E. M. Neural cells derived from adult bone marrow and umbilical cord blood. Roysam.A. 88 . M.Y. Harrison-Restelli.J. S. C.M.. Sato.Rosser. Hicok.. S. Spiro. Nature 441. R. A. In vitro neurogenesis by progenitor cells isolated from the adult human hippocampus.. A. (2001)... (2007). J Cell Biol 183. Kang. Kokovay. P. Cell Stem Cell 3. Takayama. Sun. Wilkison.H. Sassone-Corsi. Faure. K.. K.M. Pehlemann. J Neurosci Res 69. S.K. 135-149... Kobune.. S. and Montell. Adult SVZ stem cells lie in a vascular niche: a quantitative analysis of niche cell-cell interactions. 1012-1020. K. Methods 45....K.. 142-158. Kato. T. and Mathis. L. F.A. C.T. 393- 400. S.. E.. Stem cell growth becomes predominant while neural plate progenitor pool decreases during spinal cord elongation.. G. R. J. The stem-cell niche as an entity of action. Tsai. Lin. R. Roy.. Klier.L.M. Satake.T. K..J.A. and Lenke. H.. Waltz.. Dev Biol 304. Y. Sato. (2007). Shechter. Chuang. and Muller. Expression and function of cell adhesion molecules on fetal liver. L. J.E. Y. and Gladson... (2002). 302-312.R.. R..C..T. (1999). and Temple.O. Loring... et al. Exp Hematol 27. (2008). Sanchez-Ramos. Y. and Jeftinija. (1994).F.M.. L. 1075-1079. 371-379. Cell 107. R. Stem cells of the germline: the specialized facets of their differentiation program. Blood 106. Y. A. Pumiglia. Science 304. Nakamura. et al. C.. J. (2008).. K. J. Wang. (2004).. (2008). Ronen. Human mesenchymal stem cells xenografted directly to rat liver are differentiated into human hepatocytes without fusion.J.Y.E.. P..

M. and Peault.. (1985). precursors and stem cells. and Hartenstein. Nature 414. 279-288.Sirko. N. Murray.E. 14506-14511. Takashima... Temple. Sun. P. F..J.. Methods Mol Med 105.. 112-117. Smith. 151-160. L. Takagi. 2727-2738.. J. Era. and Herz.. Proc Natl Acad Sci U S A 99. 513-520. M. R.N. (2000). S. Astroglia induce neurogenesis from adult neural stem cells. Buzanska. 651-655. A.S.. 7648-7656. O.. D'Amour. and Morita.N. Louissaint.... J. Takashima. D.. (2008). Isolation of multipotent stem cells from adult rat periodontal ligament by neurosphere-forming culture system. T. von Holst. Garcia-Verdugo. M. 39-44. H.. D. Ignatova. R. M. Jr.. Tavazoie. Analysis of hematopoietic development during human embryonic ontogenesis. and Caviness. F... Absence of basement membranes after targeting the LAMC1 gene results in embryonic lethality due to failure of endoderm differentiation. Cell 97. and Gage. V. C. 463-490. Salvi. Neuroepithelial cells supply an initial transient wave of MSC differentiation. Development 120. U. (2005). Cell 129. J. 1377-1388. (2008)... F. Kukekov. Smyth.S. B. Suslov. and Nishikawa. M. Nat Rev Neurosci 2. Younossi-Hartenstein.. Kondo.H.. Mitchell.A.. (2007). 689-701. S. Barnabe-Heider. (2005).. A. A. Vatansever.. A. Slack. Zaidi.. B. Nature 417. Wizenmann. Trommsdorff. B. M. K.G. Adult neurogenesis and cellular brain repair with neural progenitors. Van der Veken. (1994).H. Song.G. H. M. Gotthardt. Nature 454.A. S. Philos Trans R Soc Lond B Biol Sci 361. Paulsson..A.... Frie. Hammer. (2001a). El-Bizri..D. M. (1999). T... and Macklis. Silva-Vargas. S. Kasuga. 999-1008.. Sawai. Nowakowski.. and Stachowiak... (2007). Nimpf. M. Tavian. (2001b). Toma. L. S. and Faissner. K. T. Takahashi. 515-528. J Neurosci 16. Stevens.. (1999).R.. Stockinger.. and Davis.A. In vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2+ neural stem cells in the adult hippocampus. Gotz. Shelton. F... (2002). M. Cell Stem Cell 1.D. Temple. (2006). H. and Miller..M.. (1996). Techawattanawisal. 917-923. A specialized vascular niche for adult neural stem cells. Merriam.M. J.. W..S. Colonna.F. 89 ... 5762-5776. and Gage... Biochem Biophys Res Commun 357. Stem cell plasticity--building the brain of our dreams. Interkinetic and migratory behavior of a cohort of neocortical neurons arising in the early embryonic murine cerebral wall. J. R. Consiglio.. T. Meyer. J. (2007). The development of neural stem cells.. J Cell Biol 144. Mkrtchyan. radial glia cell differentiation and neurogenesis in neural stem/progenitor cells. and Steindler. R. Ray. Komaki.. S. F.. Y. Nakahama. and Doetsch.. Aloyz. Emsley. Voltage-sensitive and ligand-gated channels in differentiating neural stem-like cells derived from the nonhematopoietic fraction of human umbilical cord blood. Homoeotic transformations in man: implications for the mechanism of embryonic development and for the organization of epithelia. Cell Stem Cell 3.. M. J.. Domanska-Janik.. K. Suh. Hiesberger. I. J. M. J. Nakao. M. W. J.K.D.. 413-424. Abe. Sohur. L. Isolated rat cortical progenitor cells are maintained in division in vitro by membrane-associated factors. V.S. 1477-1497. Reeler/Disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Richardson. J Theor Biol 114. Neural stem cell heterogeneity demonstrated by molecular phenotyping of clonal neurospheres. Y. Development 134. A. K. A..G.G. The behaviour of Drosophila adult hindgut stem cells is controlled by Wnt and Hh signalling.. S.. Evidence that helix-loop-helix proteins collaborate with retinoblastoma tumor suppressor protein to regulate cortical neurogenesis. Temple. H. Stem Cells 23.... V. C. (2002). W. J. A.. T. (2007). J Neurosci 20. 931-945. Chondroitin sulfate glycosaminoglycans control proliferation. V. and Edgar.

. 3rd. (2006). A.B.. S... W. S.R. (2003). R. Cell Transplant 11. R. Timpl. M. Science 287. W.. Chiasson...L.. morphogenesis. Stem cells: units of development. and van der Kooy. (2000). Zhang. Xie. Stem Cell Rev 2. I. Zerlin. T. A. X. 911-921... N. Ultrastructure of the human spinal arachnoid mater and dura mater. J Neurosci 15. A. Willem.. (2000). S.. J.. Alt. units of regeneration. Stem Cells 23. Wenisch. Coles. J. Wislet-Gendebien.. J. M. Creemers. Klisch. Bone 38.Q. and Smith. M.... 417-430. Deng.... Reya. (2003).. Smyth. Q.. Li.. 392-402. Huang. Song.. T.L. and units in evolution.D. Rigo. E... T. Lane. M. Jannetti. D. Stavridis.. Willert. B. Ross. Newman. and Wright. Yates. Mechanisms and functional implications of adult neurogenesis. C. 157-168. Miosge... Zietlow.. and Rogister. Xie. et al.M. (1996).. Nature 423. F. G. I.. Specific ablation of the nidogen-binding site in the laminin gamma1 chain interferes with kidney and lung development.C. (2002). Meissl. Vandenabeele.E. D. Wnt proteins are lipid-modified and can act as stem cell growth factors. (2007).B. Heiss. decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Stem cells and their niche: an inseparable relationship. Trinkaus. Human stem cells for CNS repair.. Weissman. I. A. B.J. B. C.. V. Griffiths. (1995). N... J. J.G.W. Feng.Tropepe.J.B. Niu.. and Schnettler.R. Science 290. Xie. 645-660. A. Human umbilical cord blood cells express neural antigens after transplantation into the developing rat brain. D.. W. Hild.. C.. 203-212.. and Lambrichts. I. L. and Nusse. N.. C. J. Adult rat and human bone marrow stromal cells differentiate into neurons. Plasticity of cultured mesenchymal stem cells: switch from nestin-positive to excitable neuron- like phenotype. and Gage. L..E. A.C. 2032-2036. H. E. The gastrointestinal tract stem cell niche.. (2008).E.E. D. Halfter. Hudson... Cell Tissue Res 331. 265-274. M. T. Zigova. J Anat 189 ( Pt 2).. 90 .. U. Schwarz.L. R. T. E. Burghart. V. (2008).. (2002). Hans. Willing. T. Ye. J Neurosci Res 61. Woodbury. K. Cell 132.. (2006)..L.. D. P. Levison. 251-260. Early patterns of migration. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. G. Hose. K.. Tong. 183- 186. I. (2005).W. 2001-2006. J. and Spradling. Moonen. Immunochemical.R. Saporta. E. ultrastructural and electrophysiological investigations of bone-derived stem cells in the course of neuronal differentiation. Weissman. Sanchez-Ramos.H. Haug.. T. Danenberg. 7238-7249. and Mayer. S. He. Development 134.. R. A niche maintaining germ line stem cells in the Drosophila ovary. Cell 100. H. Cell 94. J. S. and intermediate filament expression of subventricular zone cells in the postnatal rat forebrain. Yen. Leprince..J. F. and Rosser.. 364-370. S. Nat Biotechnol 21.. and Goldman. (2003).. 2711-2722. Nature 425.. 448-452.. J. D. Ying. Brown. 328-330. 301-322.. Zhao.. Horsford. Identification of the haematopoietic stem cell niche and control of the niche size.A.. P. Prockop. and Sanberg. (1998). (2000).. R.L.. J.J. Dunnett. Duncan. Johnson... Development 129. Retinal stem cells in the adult mammalian eye. J. 836-841. and Li. A.. A..J.H. and Black. Elia. McInnes. and Spradling. (2000).