You are on page 1of 14

10/25/2008

Outline
2

DNA computing applications — 1 Introduction


— 2 Background
— 3 Definition
BY: R. SAICHARAN
— 4 Category
— 5 Summary

Saicharan/BSBE/UNit VIII/ DBT/SNIST

1 Introduction Background
3 4

— An overview and categorization of existing research — The practical possibility of using molecules of DNA
in DNA based computation, different computational as a medium for computation was first demonstrated
methods, and applications that will serve the by Adleman in 1994
creation of a working Biomolecular Computer. — He successfully solved a directed Hamiltonian path
problem using the tools of biomolecular engineering

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

1
10/25/2008

About Adleman Cool picture


6

Leonard Max Adleman born


December 31, 1945, is a computer
scientist and molecular biologist at
the University of Southern California.

http://www.usc.edu/dept/molecular-
science/fm-adleman.htm

Saicharan/BSBE/UNit VIII/ DBT/SNIST


5 Saicharan/BSBE/UNit VIII/ DBT/SNIST

What is DNA computing Why DNA computer?


7

— DNA computing is a form of computing which uses


DNA and biochemistry and molecular biology,
instead of the traditional silicon-based computer — Massively Parallel
technologies. Processing
¡ the ability to handle
— DNA computing is fundamentally similar to parallel millions of operations in
computing in that it takes advantage of the many parallel.
different molecules of DNA to try many different
possibilities at once.

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 8

2
10/25/2008

In detail 4Category
9 10

— Perform millions of operations simultaneously; — DNA computing research can be described following
— Generate a complete set of potential solutions; three general categories:
— Conduct large parallel searches;
— Efficiently handle massive amounts of working
memory.

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

Classic Natural
11

— Applications making use of "classic" DNA computing


schemes
¡ classic computational problems, combinatorial problems, — Applications making use
cryptography, playing games, DNA storage systems of the "natural"
capabilities of DNA
¡ natural computing,
nanotechnology, smart
drugs

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 12

3
10/25/2008

Contributions to fundamental research Applications of classic DNA computing


13 14

— Contributions to fundamental research within both — Classic computational problem <<


computer science and the physical sciences, and — Cryptography
especially biomolecular chemistry. — Game play
¡ computing devices, DNA chips, self-assembly
— DNA storage systems

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

Applications of classic DNA computing


16

classic computational problems — Classic computational problem


— Cryptography <<
— Try to solve NP-
— Game play
complete and other hard
computational problems — DNA storage systems
using DNA computing
tools
¡ Hamiltonian Graph
problem

Saicharan/BSBE/UNit VIII/ DBT/SNIST


15 Saicharan/BSBE/UNit VIII/ DBT/SNIST

4
10/25/2008

Cryptography Solution
17 18

The problem: — DNA-Stenography


— Communication between two users in a secure manner
— User A is transmitting a message to user B such that any Stenography = hiding data among other data; the
other user C can’t decipher actual message is not modified
— DNA-Cryptography
— use of a private key to encode the message
Cryptography = makes a reversible change on the
— only the users that posses the private key can decode the message à ciphertext
message

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

DNA-Stenography Example
19 20

— GOAL: Hide the message within DNA — Message: “HELLO”


— Each letter è 3 bases
— Algorithm: HELLO = CGC GGC TGC TGC GGA
÷ Encode the message as a DNA strand Add 20 bases before and after
÷ Attach two primers before and after
CTGCTGGCACCCTTACGTCGCGGCTGCTGCGGACGAATCGAATTTGC
¢ These primers will act as private key CCAT
÷ Add other “junk DNA” — Add “junk DNA” to this sequence
÷ The decoder will use the primers to get back the message — Private key (CTGCTGGCACCCTTACGT,CGAATCGAATTTGCCCAT)
¡ the task of finding the right DNA sequence is “hard” if one — Finding the sequence without knowing the primers è need to analyze
doesn’t know the primers 420 primers è brute force on the DNA

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

5
10/25/2008

Cryptography algorithm
22

Cryptography — A key k is used only once to encrypt/decrypt.


— It is unbreakable.
Algorithm:
Sender : Use k to encrypt the plaintext then destroy k
Receiver: Use k to decrypt the plaintext then destroy k
— Drawback: The users must know what key are using

Saicharan/BSBE/UNit VIII/ DBT/SNIST


21 Saicharan/BSBE/UNit VIII/ DBT/SNIST

Cryptography algorithm cont. Applications of classic DNA computing


23 24

— Classic computational problem


— Cryptography
— Game play <<
— DNA storage systems

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

6
10/25/2008

Game theory computation


25

— In a game, players make finite sequences of choices Game strategy


restricted only by a set of rules.
— A game strategy must
provide decisions for every
— Players receive payoffs depending on their choices possible game situation.
and the choices of others, including chance events.
— A strategy may use
deterministic decisions (a
pure strategy) or, more
generally and more
powerfully, probabilistic
decisions

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 26

Poker game rule Poker game


27 28

— 1. Each of the three players starts by contributing a euros to the pot.


— 2. Each player is dealt a hand consisting of one card, with high and low
— cards being equally probable.
— 3. The players take turns in rotation.
— 4. The game ends if all players pass or when one player has bet (putting
— b euros into the pot) and each of the other players have chosen to call
— (putting b euros into the pot) or to fold (no additional cost).
— 5. Antes are retrieved if all players have passed.
— 6. Otherwise, the pot is divided equally among the highest hands of all
— players who have not folded.

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

7
10/25/2008

Find game strategy Solution with DNA computing


29 30

— DNA computing can be useful for seeking strategies We show DNA can be used to address these aspects of game
that maximize expected payoffs. theory computations:
— (1) Strategies can be individually encoded, yet pair off with
opponents in game tournaments
— In particular, the strategies we seek depend on the
— (2) Decisions discriminating among many alternatives can
strategies of the other players, who have no incentive be made
to reveal them. — (3) Massive populations of strategies offer special
advantages for game theory.

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

Applications of classic DNA computing


31

— Classic computational problem DNA storage systems


— Cryptography
— DNA is a good medium
— Game play
for storing information
— DNA storage systems << an a compact and stable
way.

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 32

8
10/25/2008

Advantage
33

— In a standard silicon-based chip, information DNA storage systems cont.


processing is limited by the distance between units
that process and store information. — Double stranded DNA is
quite stable, contains
redundancy, and can be
maintained in vitro with
— With DNA scaffolding, we can lay out devices closely, error correcting enzymes
so the interconnections are very short and the
— When acting as a static
performance very high. storage medium, double
stranded DNA tends to
maintain its integrity. It is,
though, vulnerable to
hydrolysis reactions.

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 34

Error rate Why DNA storage

— When DNA is amplified by A gram of DNA


PCR it is subject to errors à 1021 DNA bases =
when being duplicated by 108 terra-bytes
polymerase. Taq polymerase,
commonly used in PCR has
an in vitro error rate of (1 terabyte = 1 024GB)
1/9000
— This error rate is still ¡ A few grams of DNA can
reasonable, A compact disc hold all data stored in the
with scratches on the surface world
has a much much larger
18 terra-bytes hard drive
error rate than this
Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST
35 36

9
10/25/2008

4.2 Applications of Natural DNA computing Nanotechnology


37 38

— Nanotechnology << — Nanotechnology is a field of applied science and


— Smart drugs technology covering a broad range of topics.

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

DNA Nanomachines DNA motors


39 40

The following applications are based on DNA — DNA motors can be used to pick up molecules and
nanotechnology: move them around on microscopic computer chips
1. Smart scissors, to cut DNA
2. Small DNA “Robots” which can perform several
tasks
3. DNA Motors

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

10
10/25/2008

4.2 Applications of Natural DNA computing


42

DNA motors — Nanotechnology


— Smart drugs <<
— The motor looks like a pair of
tweezers.
— The tweezers are made up of two
strands of DNA that are
attached at one end by a third
strand that acts as a hinge. At
the other end, the two strands
each have a single-stranded
handle.
— Scientists open and close the
tweezers by adding another
strand of DNA that fuels the
device. The fuel strand attaches
to the handles, pulling the two
strands together

Saicharan/BSBE/UNit VIII/ DBT/SNIST


41 Saicharan/BSBE/UNit VIII/ DBT/SNIST

Smart drugs
43

— One of the most impressing applications for DNA Smart drugs


computing
— Imagine having a nanoscaled
— DNA computer based smart drugs would be inserted
intelligent “doctor” sitting
into body and automatically recognize and treat inside every cell in your body
diseases and other malfunction waiting for things to go
wrong.
— As soon as something goes
wrong, the doctor diagnoses
the problem and has the
intelligence to take
appropriate action, such as
releasing a drug.

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 44

11
10/25/2008

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST


45 46

DNA chips
47

— Definition By wikipedia Example


— A DNA microarray (also commonly known as gene or
genome chip, DNA chip, or gene array) is a collection of — Example of an
microscopic DNA spots attached to a solid surface, such as approximately 40,000
glass, plastic or silicon chip forming an array for the probe spotted oligo
purpose of expression profiling, monitoring expression microarray with
levels for thousands of genes simultaneously, or for enlarged inset to show
comparative genomic hybridization. detail.

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 48

12
10/25/2008

Usage Demo
49 50

— DNA chip is relevant to many areas of biology and — http://www.sumanasinc.com/webcontent/anisampl


medicine, such as studying treatments, disease, and es/majorsbiology/dnachips.html
developmental stages.
— For example, microarrays can be used to identify
disease genes by comparing gene expression in
diseased and normal cells.

Saicharan/BSBE/UNit VIII/ DBT/SNIST Saicharan/BSBE/UNit VIII/ DBT/SNIST

Self-assembly
51

— Definition Example tiling


Simply put, we're talking about collections of objects
that put themselves together — The idea of algorithmic
self-assembly arose
from the combination of
DNA computing
(Adleman, 1994), the
theory of tilings

Saicharan/BSBE/UNit VIII/ DBT/SNIST


Saicharan/BSBE/UNit VIII/ DBT/SNIST 52

13
10/25/2008

Conclusion
54

demo — similarities and differences between "classic" and


"natural" areas of DNA computing
— many areas computer science, mathematics, natural
science, and engineering

Saicharan/BSBE/UNit VIII/ DBT/SNIST


53 Saicharan/BSBE/UNit VIII/ DBT/SNIST

Saicharan/BSBE/UNit VIII/ DBT/SNIST 55

14