You are on page 1of 23

Tecnología Del DNA Recombinante

DNA Recombinante: Una molécula de DNA formada por la unión de segmentos de


DNA de distintos orígenes. Los DNAs recombinantes son utilizados en el clonamiento
de genes, en la modificación genética de organismos y como herramienta general en
biología molecular.

Algunas técnicas utilizadas:

• Corte de DNA en secuencias específicas por endonucleasas de


restricción (enzimas de restricción)

• Hibridización o Hibridación de ácidos nucleicos: permite encontrar una


secuencia específica de DNA o RNA sobre la base de la
complementariedad de bases

• Clonamiento de DNA: una molécula de DNA puede ser copiada para


generar muchas copias idénticas de ella

• Amplificación de segmentos de DNA por la reacción en cadena de la


polimerasa o PCR.
Endonucleasas o
Enzimas
de Restricción

Permiten generar un mapa o patrón de restricción


Análisis de DNA Digerido con
Enzimas de Restricción
DESNATURACIÓN Y RENATURACIÓN (HIBRIDACIÓN DEL DNA)

calor frio

pH elevado Baja del pH

dsDNA Desnaturación a Renaturación a


cadenas simples cadenas dobles

calor frio

pH elevado Baja del pH

SONDA
DNA unido a sonda
la membrana

3’ ACCAGAGCCTAGC 5’
5’ ACTGCTCGATGCTCTCGGATCGCTCTGATTCG 3’
Nitrocelulosa

Southern blot
Cervical Intraepithelial Neoplasia II & HPV
20 X 40 X

RNAmtnc sentido II RNAmtnc sentido II

20 X 40 X

RNAmtnc sentido I RNAmtnc sentido I


Reacción en Cadena de la Polimerasa (PCR)
(polymerase chain reaction)
Hebras de DNA complementarias separadas por calor El primer ciclo de la
reacción en cadena de la
polimerasa (PCR) para
amplificar secuencias
específicas de DNA. El
Partidores
DNA aislado de células es
definidos calentado para separar
sus hebras
complementarias. Estas
hebras son hibridizadas a
dos fragmentos de DNA
Síntesis de DNA de hebra simple
(oligonucleótidos), que
han sido sintetizados
químicamente. Estos dos
oligonucleótidos sirven
como partidores
específicos para la
síntesis de DNA por la
DNA polimerasa, la cual
copia el DNA que se
encuentra entre las
regiones de unión de los
partidores.
Región amplificada
DENATURACIÓN: HIBRIDACIÓN: ELONGACIÓN:

PARTIDORES PARTIDORES

Cada ciclo tiene 3 etapas: denaturación (separación de hebras), hibridización


(unión de partidores al templado) y elongación (polimerización de
desoxirribonucleótidos para sintetizar DNA sobre el templado).
La cantidad de DNA producido se duplica en cada ciclo, lográndose una amplificación
exponencial del fragmento deseado, a partir de poca cantidad de DNA. La enzima utilizada
para amplificar DNA en el PCR es la de la bacteria Thermus aquaticus (Taq Polimerasa).
Este organismo vive en ambientes de temperaturas muy altas (géiseres), lo cual permite
que su DNA polimerasa resista las temperaturas requeridas para la amplificación por PCR
Early Exponential
Phase CT
Log-Linear
Phase

Linear Ground Phase


M 10fg 100fg 1pg 10pg 100pg 1ng 10ng control
RT-PCR EN TIEMPO REAL (SYBR Green)

• SYBR Green I binds dsDNA


λ λ • SGI fluorescence increases
when bound to dsDNA
• As dsDNA accumulates, more
λ λ SGI binds the DNA and the
PCR fluorescence increase
Reaction
Progression
λ
λ
λ

λ λ λ
λ
λ
λ λ
λ λ
RT-PCR EN TIEMPO REAL (TaqMan)

• Target specific hybridization probe


• 5’ reporter and 3’ quencher
• Utilizes FRET quenching

Light*
Light

Energy
R Reporter
R Q
Q Quencher

* heat for BHQs


RT-PCR EN TIEMPO REAL (TaqMan)

λ
1. During PCR, probe hybridizes
to target sequence

R 2. Probe is partially
R Q
Taq Taq displaced during extension
3. Probe cleaved by 5’- 3’
nuclease activity of polymerase

4. Illuminated free reporter


exhibits unquenched fluorescence
iScript qRT-PCR Standard Curve Comparison:

cDNA serial dilution vs. total RNA serial dilution

40

HeLa, β-actin 35
cDNA Standard
Total RNA Standard
T
30

25

20

cDNA total
15 Slope -3.394 -3.382
Corr. Coef. 0.999 0.999
y Intercept 38.91 38.09
10 PCR efficiency 97.1% 97.6%
e

5
1 2 3 4 5 6 7 8 9
d
u Log Starting Quantity
(femtograms of input RNA)
Note: 1/10th of cDNA reaction used for PCR
RESUMEN

• Corte con enzimas de restricción DNA

• Hibridación de ácidos nucleicos DNA (Southern)


RNA (Northern)
(Hibridación in situ)

• Clonamiento de DNA: una molécula de DNA puede ser copiada para generar
muchas copias idénticas de ella (bacterias y levaduras)

• Amplificación mediante PCR DNA (PCR)


RNA (RT-PCR)

Amplificación de punto final o de tiempo real


FIN