You are on page 1of 43

TRANSCRIPCIÓN DEL DNA:

Copia de una secuencia de DNA a RNA


Tipos de RNA dentro de la Célula

Tipo de RNA Función

mRNA codifica proteínas

rRNA forma parte de la estructura del ribosoma


y participa en la síntesis de proteínas

tRNA utilizado en la síntesis de proteínas como un


adaptador entre el RNA y los aminoácidos

RNA pequeños participan en la maduración del mRNA


precursor, el transporte de las proteínas
hacia el ER y en otros procesos celulares
RNA polimerasa
señal de terminación
promotor
para RNA polimerasa
Transcripción
• La transcripción es llevada a
doble hélice de DNA cabo por la RNA POLIMERASA
ABERTURA DE LA sitio de iniciación de transcripción
DOBLE HÉLICE DE DNA
• La RNA polimerasa se une a
una secuencia especial llamada
INICIACIÓN DE LA PROMOTOR, que está en el
HEBRA DE RNA POR
UNIÓN DE DOS lado
RIBONUCLEÓSIDOS
TRIFOSFATO 5’ (“río arriba”) del gen que
será transcrito.

• La doble hélice de DNA es


desenrrollada (alrededor de
10 nucleótidos) y la síntesis
ELONGACIÓN DE LA la hebra de RNA
HEBRA EN DIRECCIÓN es contínuamente
de RNA procede en la
5’Æ
5’Æ3’ POR ADICIÓ
ADICIÓN desplazada por región corta de dirección 5’ Æ 3’
DNA, reformando la
DE RIBONUCLEÓ
RIBONUCLEÓSIDOS doble hélice de DNA hélice DNA/RNA
TRIFOSFATO
• La síntesis finaliza cuando la
TERMINACIÓN Y LIBERACIÓN RNA polimerasa encuentra una
DE LA POLIMERASA Y LA
HEBRA DE RNA TERMINADA señal de terminación de
transcripción. Se liberan la
polimerasa y la hebra de RNA
terminada.
Estructura de Promotores de Procariontes

secuencia –10
secuencia –35 (Caja TATA) sitio de inicio

Transcripción
hebra de DNA templado

La RNA polimerasa se une a dos secuencias del promotor, que se encuentran 10


nucleótidos río arriba (posición –10 aproximadamente) y 35 nucleótidos río arriba (-
35), respectivamente, del sito de inicio de la transcripción. El RNA es sintetizado a
partir del sitio de inicio (nucleótido +1), utilizando como templado la hebra
complementaria a la cual se encuentra el promotor.
Polimerización por la RNA Polimerasa
sitio para el ribonucleósido
trifosfato entrante
hebra de RNA
desplazada

doble hélice de DNA

sitio de
sitio de desenrollamiento
reenrollamiento
región corta de
doble hélice DNA/RNA

La RNA polimerasa desenrolla contínuamente la doble hélice de DNA delante del sitio de polimerización,
mientras va reenrollando las dos hebras de DNA detrás de este sitio, desplazando a la hebra de RNA
recientemente sintetizada. Por lo tanto se forma transitoriamente una región corta de doble hélice
DNA/RNA y el producto de RNA final es liberado como una copia de simple hebra de una de las hebras
de DNA.
Hebra de
DNA templado
Hebra de Reacción de Elongación
RNA creciente
por la RNA Polimerasa

El ribonucleósido trifosfato
entrante es seleccionado
por apareamiento con la
hebra templado de DNA; un
ribonucleósido monofosfato
es adicionado al extremo 3’-
OH de la hebra creciente de
RNA (flecha roja) y se libera
pirofosfato(átomos rojos).
La nueva hebra de RNA
crece, por lo tanto, un
nucleótido a la vez, en la
dirección 5’ Æ 3’ y es
complementaria a la hebra
templado del DNA.

Ribonucleósido trifosfato entrante

Dirección 5’ Æ 3’ de
crecimiento de la hebra
RNA Polimerasas de Eucariontes

Sens. α-
Nombre Tipo de RNA Sintetizado amanitina

RNA Polimerasa I RNAs ribosomales grandes (rRNA) -


RNA Polimerasa II RNA mensajero (mRNA) +
RNA Polimerasa III RNAs pequeños (rRNA 5S y tRNA) -/+

Los procariontes tienen una sola RNA polimerasa, que transcribe todos los tipos de
RNA. La de E. Coli está formada por 5 subunidades, α, β, β‘ y σ.
Comparación de mRNAs de Procariontes y
Eucariontes

Los mRNAs de procariontes


suelen codificar para más
de una proteína, es decir
son policistrónicos

Los mRNAs de eucariontes


son monocistrónicos
Maduración del RNA en Eucariontes

La transcripción de un gen eucarionte da origen a un RNA mensajero


(mRNA) que no está listo aún para ser traducido (pre-mRNA). Estos
son procesados para convertirlos en mRNAs maduros. Las
modificaciones que sufren son

• Adición del “cap” o caperuza en el extremo 5’ (iniciación de


síntesis de proteínas y protección del transcrito creciente de la
degradación).

• Adición de una cola de poli(A) en el extremo 3’ (exportación


del mRNA maduro hacia el citoplasma, estabilidad de mRNAs en el
citoplasma y sirve de señal de reconocimiento para el ribosoma,
requerida para una traducción eficiente.

• “Splicing” o corte y empalme (eliminación de intrones)


Síntesis de un Transcrito Primario de mRNA

RNA polimerasa II sitio de inicio del RNA


sitio de adición de poli(A)
DNA

transcrito naciente
de RNA Adición del cap (capping)
capping) La adición del cap ocurre
durante la transcripción por
RNA polimerasa II, sobre la
Elongación de la hebra hebra de RNA naciente.
Luego de que la hebra
terminada es cortada en el
extremo 3’, se produce la
adición de la cola de poli(A),
Elongación de la hebra completando el
TRANSCRITO PRIMARIO.

Adición de poli(A)

poli(A)

Transcrito primario de mRNA (precursor de mRNA)


Adición del Cap del Extremo 5’ de los mRNAs de Eucariontes
Extremo 5’ del mRNA naciente
7-metilguanosina Extremo 5’ del mRNA

fosfatasa

Enlace 5’ – 5’
Guanil trifosfato
transferasa

metil
transferasa

La 7-metilguanosina se une al
nuceótido del extremo 5’ del transcrito
por un enlace 5’-5’. La ribosa del
primer nucleótido del RNA transcrito
tiene una metilación en el 2‘-OH
Adición de la Cola de Poli(A)

10-30
nucleótidos
AAUAAA AAAAAAAAAAAAAAAA
Señal de Cola de Poli(A) (100-200)
Poliadenilación

El extremo 3’ de la mayoría de los transcritos de la RNA polimerasa II se define, no por


un evento de terminación de transcripción, sino por el corte del transcrito en un sitio
específico y la adición en el extremo 3’ cortado La señal para el corte es la secuencia
AAUAAA, localizada 10-30 nucleótidos río arriba del sitio de corte, llamada señal de
poliadenilación. Después del corte, la enzima poli-A polimerasa adiciona 100-200
residuos de A al extremo 3’ de la hebra de RNA para completar el transcrito primario
Estructura de Genes de Procariontes y
Eucariontes

Mientras que los genes de los procariontes son contínuos, es decir la secuencia del
mRNA maduro es la misma que el DNA templado, los genes de eucariontes suelen
tener secuencias internas que no son codificantes, por lo cual no existen en el
mRNA maduro y, por ello, deben ser removidos del transcrito primario antes de la
traducción. Estas secuencias que no codifican se llaman INTRONES y las
regiones codificantes se llaman EXONES.
Splicing de Transcritos Primarios
Transcrito primario de RNA

Inicio de exón intrón término


traducción

~8000 nucleótidos

REMOCIÓN DE INTRONES
POR SPLICING

Inicio término

mRNA

TRADUCCIÓN

proteína
ovoalbúmina

Splicing del transcrito primario del gen de la ovoalbúmina de pollo. Se muestra la


remoción organizada de 7 intrones para la obtención de una molécula de mRNA
funcional. Los sitios de splicing 5’ (sitios donantes) son representados por D y los
sitios de splicing 3’ (sitios aceptores) por una A.
Mecanismo de Splicing
snRNPs
Sitio 5’ de splicing Sitio 3’ de splicing
Exón A Exón B
intrón
mRNA
precursor
Ensamblaje
del Spliceosoma

Paso 1
Formación del lazo
(lariat) y corte en
el sitio de splicing 5’

Paso 2
corte en el sitio de splicing
3’ y ligación de exones

Intrón liberado en
forma de lazo (lariat)

mRNA maduro
(exones ligados)

El splicing de mRNA es catalizado por el SPLICEOSOMA, formado por ribonucleoproteínas


nucleares pequeñas (snRNPs) y otros componentes. En un primer paso, el punto de ramificación
A, que se localiza cerca del extremo 3’ de splicing, produce un corte en el sitio 5’ de splicing,
generando un enlace covalente entre ambos puntos. En el segundo paso, el extremo 3’ libre del
primer exón, resultante de la reacción anterior, se une al primer nucleótido del siguiente exón,
cortando la molécula de RNA en el sitio de splicing 3’. Los dos exones quedan unidos entre sí,
liberando el intrón como un lazo (“lariat”).
Transcripción: Diferencias entre Procariontes y Eucariontes

Envoltura
nuclear

Transcripción

Transcripción
Ribosoma
Traducción
Maduración
Polipéptido de mRNA

Célula Procarionte

Ribosoma
Los procariontes (bacterias) no tienen Traducción
núcleo. La traducción ocurre
simultáneamente con la transcripción. Polipéptido

Los eucariontes segregan la


transcripción en el núcleo. El mRNA es Célula Eucarionte
procesado, exportado del núcleo y
traducido en el citoplasma.
Transcripción: Diferencias entre Procariontes y Eucariontes

Procariontes Eucariontes

Todas las especies de RNA son Tres RNA polimerasas son


sintetizadas por la misma RNA responsables de la síntesis de
polimerasa las diferentes clases de RNA

El mRNA es traducido durante El mRNA es procesado antes de


la transcripción ser transportado al citoplasma,
donde es traducido

Los genes son secuencias Los genes se encuentran


contínuas, equivalentes al interrumpidos por intrones, que
mRNA que será traducido a son removidos antes de la
proteína traducción

Los mRNA son a menudo Los mRNAs son monocistrónicos


policistrónicos
TRADUCCIÓN: Síntesis de una Proteína a partir de la
Secuencia de un RNA Mensajero
Código Genético

El DNA es una molécula informacional: las bases son A, C, G, T

Para codificar 20 aminoácidos se necesita una “palabra” de al


menos 3 letras
4 x 4 = 16 (2 bases no son suficientes)
4 x 4 x 4 = 64 (3 bases son suficientes)

Nos referimos a cada “palabra” como un CODÓN.

Por ejemplo, una proteína de 100 aminoácidos estará codificada por


un mRNA de 300 nucleótidos.

El código genético es UNIVERSAL: un codón en un organismo


especifica el mismo aminoácido en cualquier otro
molécula
de DNA

Gen 2
Gen 1

Gen 3

templado
de DNA

Transcripción

Traducción
Código Genético
SEGUNDA BASE

El código genético:

No es ambiguo: cada codón


codifica para un sólo aminoácido

PRIMERA BASE (extremo 5’)


Es Degenerado: un aminoácido

TERCERA BASE (extremo 3’)


puede ser codificado por más de un
codón. La variabilidad suele estar
en la tercera base del codón.

Los codones especiales son:


AUG Æ codón de inicio y
metionina
UAA/UGA/UAG Æ codones de
término
(codones sin sentido)
Código Genético
Marcos de Lectura

Dependiendo de la base
donde comience la
traducción, el marco de
lectura puede ser
diferente.

Un marco de lectura
abierto es aquel que
comienza en un codón
AUG de inicio, continúa
con una extensión de
codones codificantes y
termina en un codón de
término
Traducción

El mRNA es traducido en el
ribosoma a proteína. Cuando
el ribosoma se une al sitio de
inicio en el mRNA, comienza a
tRNA con leerlo, 3 nucleótidos a la vez
aminoácido
unido
(codones).

El ribosoma no adiciona
aminoácidos libres, sino que
los aá se encuentran unidos a
un RNA especial llamado
RNA de Transferencia
(tRNA), que posee una
región complementaria al
codón, llamada anticodón.
Comparación entre Ribosomas de Eucariontes y Procariontes

Subunidad Subunidad Subunidad


mayor menor menor
Subunidad
mayor

RIBOSOMA PROCARIÓTICO RIBOSOMA EUCARIÓTICO


Los componentes de los ribosomas se designan por su valor “S”, que define la
velocidad de sedimentación en una ultracentrífuga. A pesar de la diferencia en los
tamaños y cantidad de sus componentes, ambos tipos de ribosomas tienen
prácticamente la misma estructura espacial y funcionan de manera muy similar.
RNA de Transferencia (tRNA)

Sitio de Sitio de
unión de unión de
aminoácidos aminoácidos

Enlaces de
hidrógeno

La estructura de “trébol” del tRNA. Existen muchas moléculas diferentes de tRNA, incluyendo
al menos una para cada aminoácido. Aunque difieren en secuencia, todas poseen 3 horquillas
más un brazo aceptor de aminoácidos. El tRNA mostrado corresponde a fenilalanina, por lo
cual se representa como tRNAPhe. En todos los tRNA, el aá se encuentra unido a la A de la
secuencia CCA del extremo 3’. Un tRNA con un aminoácido unido se llama aminoacil-tRNA. La
aminoacil tRNA sintetasa adjunta un aminoácido específico a un tRNA específico.
Estructura de un Aminoacil-tRNA

aminoacil-tRNA

El extremo
carboxilo terminal
del aminoácido
forma un enlace
éster con el 3’-OH
de la ribosa de la
A terminal. Se
dice que el
aminoácido en
esta estructura se
encuentra
ACTIVADO.
aminoácido
Formación de un Enlace Peptídico

peptidil-tRNA unido al
extremo carboxilo- aminoacil-
terminal tRNA
de la cadena molécula de
polipeptídica tRNA liberada
creciente de su unión
al polipéptido
nueva molécula de
peptidil-tRNA unida al
extremo carboxilo-terminal
Incorporación de un aminoácido a una proteína. Una de
cadena polipeptídica crece por la adición secuencial de la cadena polipeptídica
creciente
aminoácidos a su extremo carboxilo-terminal.
Etapas de la Traducción
Iniciación Elongación Terminación

el ribosoma se une al la cadena polipeptídica es elongada por la cuando aparece un


codón de inicio del mRNA sucesiva adición de aminoácidos codón de término, el
polipéptido es liberado y
el ribosoma se disocia
Iniciación de la Traducción
Existe un tRNA iniciador especial que tiene
unida una metionina.
tRNA de inicio
El ribosoma se ensambla en el sitio de
inicio con la ayuda de factores de
iniciación

Hay 3 sitios en el ribosoma que unen


aminoacil-tRNAs:
A = acepta un nuevo tRNA
subunidad menor
sitio de unión de mRNA P = aquí se forma un enlace
peptídico
E = sitio de salida para tRNAs
“vacíos”
subunidad mayor

Sitio P (unión de
peptidil-tRNA) Sitio A (unión de
Sitio E
(salida de aminoacil-tRNA)
tRNA vacío)
Subunidad Mayor
Sitio de
unión de Subunidad Menor
mRNA
Iniciación de la Traducción en EUCARIONTES
Iniciación de la Traducción en PROCARIONTES

Secuencia de Shine-Dalgarno

En procariontes, la subunidad menor del ribosoma, unida al tRNA de inicio, reconoce una
secuencia específica de hasta 6 nucleótidos, el sitio de unión de ribosomas, también llamada
Secuencia de Shine-Dalgarno. Esta se ubica 4-7 nucleótidos río arriba del AUG de inicio y es
reconocida por el ribosoma por su apareamiento con una región del rRNA 16S. En procariontes, el
aminoácido de iniciación es siempre formil-metionina (fMet).
Reconocimiento del Codón de Inicio en Procariontes y Eucariontes

Secuencia de Shine-Dalgarno

desplazamiento (scanning)
de la subunidad menor del
ribosoma
Elongación: Un Ciclo de Traducción

Extremo amino-terminal
del polipéptido

Reconocimiento del codón:


Un aminoacil-tRNA
Ribosoma listo para el
entrante se une al codón
siguiente aminoacil-tRNA
en el sitio A

Translocación: El tRNA en
el sitio A es translocado al
sitio P, llevando consigo el
mRNA. Mientras tanto, el Formación del enlace
tRNA en el sitio P se va al peptídico: El ribosoma
sitio E, siendo liberado cataliza la formación de un
finalmente del ribosoma. El enlace peptídico entre el aá
mRNA ha cambiado su nuevo y el extremo carboxilo-
posición en el ribosoma en terminal del polipéptido
un codón. creciente.
Terminación de la Traducción

polipéptido
Factor de liberación libre

codón de término
(UAA, UAG, UGA)

La unión de un factor de liberación a un codón de término pone fin a la traducción. El


polipéptido es liberado y el ribosoma se disocia en sus dos subunidades.

El factor de liberación es una proteína. Los codones de término no codifican para aminoácidos.
Ejercicio:

Suponiendo que la siguiente secuencia corresponde a un


mRNA completo, ¿de cuantos aminoácidos constará la
proteína resultante de su traducción?

5’ CAGUCAUGCCAGUCGGAUAGACGUAGAUGAUCC 3’

Met Pro Val Gly Stop

4 aminoácidos No codifica para


aminoácidos
DNA
Transcripción
RNA transcrito
desde Resumen
templado
de DNA RNA Transcripción y
polimerasa

Procesamiento RNA
Traducción en
Eucariontes
RNA
en eucariontes, el transcrito
transcrito de RNA
(pre-mRNA) es
procesado y
modificado para
producir mRNA, que
migra al citoplasma.

el mRNA abandona
el núcleo y se asocia
con el ribosoma. Activación del aminoácido
cada aminoácido se
une a su propio
tRNA con la ayuda
de una enzima
específica y ATP

Traducción
sucesivos tRNAs
agregan sus aá a la
cadena polipeptídica
mientras el mRNA
se desliza por el
ribosoma, un codón
a la vez. Cuando se
completa, el
polipéptido se libera
del ribosoma
Polirribosomas
Una molécula de mRNA
puede ser traducida
simultáneamente por una
serie de ribosomas, tanto
unidos a membranas
como en forma libre. Estas
estructuras se llaman
polirribosomas o
polisomas. Ocurren tanto
en eucariontes como en
procariontes.
La Transcripción
y la Traducción
están Acopladas
en Procariontes
En los eucariontes, la
envoltura nuclear
mantiene la transcripción
separada de la traducción.
Pero en procariontes, el
mRNA es accesible a los
ribosomas mientras se va
sintetizando. Por lo tanto,
los ribosomas
comenzarán a sintetizar
un polipéptido en el
extremo 5’ de una
molécula naciente de
mRNA y seguirán su
síntesis detrás de la RNA
polimerasa, a medida que
ésta completa la cadena
de mRNA.