Professional Documents
Culture Documents
2008
Abdullah H. Al-Jedai
Contents
Page
CONTENTS…………………………………………………………………………2
LIST OF FIGURES………………………………………………………………….7
LIST OF ABBREVIATIONS……………………………………………………….10
ABSTRACT…………………………………………………………………………14
DECLARATION……………………………………………………………….......15
COPYRIGHT STATEMENT……………………………………………………….15
ACKNOWLEDGEMENTS…………………………………………………………16
Chapter one:
Introduction………………………………………..17
1.1.1 Haemopoietic stem cells (HSCs)………………………………..18
1.1.2 Regulation of haemopoiesis……………………………………...22
1.1.2.1 The stem cell niche………………………………………………………....23
1.1.2.1.1 Cell-ECM interaction………………………………………………..23
1.1.2.1.2 Soluble factors in the niche ………………………………………….24
1.1.2.1.3 Cell-cell interactions……………………………………….. ……….27
1.1.2.2 Genetic control of haemopoiesis ………………………………………….28
2
1.4 Possible role for Notch in CML……………………………………62
1.5 Research aims and objectives………………………………………64
Chapter 2
Material and methods…………………………65
3
2.3.5.1 Overview OF Real Time PCR……………………………………………..81
2.3.5.2 Real time PCR protocols…………………………………………………..82
2.3.5.2.1 Real time PCR using TaqMan®probes………………………………82
2.3.5.2.2 Real time PCR using SYBR® Green………………………………..82.
2.3.5.3 Data analysis…………………………………………………………..83
2.3.5.4 Validation of the 2 –ΔΔCT method………………………………………..83
2.3.6 Protein Analysis………………………………86
2.3.6.1. Protein extraction and determination of concentration…………………...86
2.3.6.2 SDS-PAGE and Western Blott……………………………………………87
Chapter 3
Investigating Notch signalling in chronic
myeloid leukaemia……………………………90
3.2 Results…………………………………………………………..91
3.3. Discussion……………………………………………………...108
Chapter 4
Investigation of BCR-ABL and Notch
cross-talk in cell line models
4.1 Introduction…………………………………………...115
4.2 Results…………………………………………………118
4.2.1 Validation of the P-crkl intracellular FACS assay in K562 cells…………118
4
4.2.2 The effect of cell passage number on the expression of
P-crkl in K562 cells……………………………………………………….120
4.2.3 Assessment of P-crkl expression in leukaemic cell lines………………….124
4.2.4 Assessment of imatinib mesylate efficacy in K562 cells
using the P-crkl assay………………………………………………………..126
4.2.5 Characterisation of Notch signalling in K562 cells…………………………130
4.2.6 Constitutive expression of Notch1 ΔE in K562 cells…………………….....133
4.2.7 The effect of Valproic acid on BCR-ABL and Notch signalling
in K562 cells ………………………………………………………………….135
4.2.8 The effect of GSI in K562 cells……………………………………………..140
4.2.9 Cross-talk between Notch and BCR-ABL in K562 cells…………………….142
4.2.9.1 The effect of imatinib induced BCR-ABL inhibition
on Notch signalling in K562 cells…………………………………………..142
4.2.9.2 The effect of Notch inhibition by GSI on BCR-ABL in K562 cells........142
4.2.10 ALL-SIL cell line as a model for ABL-Notch cross-talk…………………....146
4.3 Discussion………………………………………………….149
4.3.1 The FACS based P-crkl assay as a surrogate assay for ABL kinase activity…149
4.3.2 P-crkl expression in other leukaemic cell lines ………………………………151
4.3.3 Inhibition of p-crkl by imantinib mesylate in K562 cells……………………152
4.3.4 Notch signalling in K562 cells………………………………………………152
4.3.5 Cross-talk between Notch and BCR-ABL in K562 cells……………………154
4.3.6 Cross-talk between Notch and BCR-ABL in the ALL-SIL
cell line model system…………………………………………………………156
Chapter 5
5
mRNA levels of Hes1 ………………………………………………………171
5.2.4.3 Gamma secretase inhibitor (GSI) increases the kinase
activity of BCR-ABL in CD34+ CML cells…………………………………171
5.2.4.4 Gamma secretase inhibitor (GSI) decreased the kinase
activity of BCR-ABL in CD34+ CML cells from one CML patient…………172
5.3: Discussion…………………………………………………………179
6
Final word count: 52367
List of figures
Chapter 1
Fig.1.1 The hierarchy of haemopoiesis………………………………………..21
Fig. 1.2 Regulation of haemopoiesis…………………………………………..30
Fig.1.3 Structure of human Notch receptors …………………………………..33
Fig. 1.4 Structure of Notch ligands…………………………………………….34
Fig. 1.5 The CSL-dependent Notch signalling pathway………………………. 37
Fig. 1.6 Notch signalling during T and B cell development…………………..50
Fig. 1.7 The t(9;22)(q34;q11) reciprocal translocation…………………………54
Fig. 1.8.Signal transduction pathways associated with P210 BCR-ABL in
CML…………………………………………………………………………….59
Chapter 2
Chapter 3
7
Chapter 4
Fig 4.1. Validation of P-crkl intracellular flow cytometry assay in K562 cells…121
Fig 4.2. Comparison of four commercial anti rabbit secondary antibodies
used in the P-crkl assay…………………………………………………………..122
Fig. 4.3. The effect of cell passage number on the expression of P-crkl
in K562 cell line…………………………………………………………………123
Fig 4.4. Assessment of P-crkl expression in four leukaemic cell lines…………125
Fig. 4.5-a. Assessment of imatinib mesylate (IM) efficacy in K562 cells
using a flow based P-crkl assay.............................................................................127
Fig. 4.5-b. Dose dependant effect of imatinib mesylate (IM) on the
expression of P-crkl in k562 cells post 48h………………………………………128
Fig. 4.6. Effect of concentration of imatinib mesylates (IM) on
P-crkl protein levels………………………………………………………………129
Fig. 4.7 Expression of Notch1 and Hes1 genes in K562 cell line………………...131
Fig. 4.8. FACS analysis of Notch1 expression in K562 cells…………………….132
Fig. 4.9. Constitutive expression of N1ΔE in K562 cells…………………………134
Fig. 4.10 Hes1 expression in K562 cells post valproic acid (VPA) treatment……136
Fig. 4.11. Effect of Valproic acid (VPA) on BCR-ABL activity in K562 cells…..138
Fig. 4.12. Effect of Valproic acid (VPA) on erythroid differentiation
in K562 cells……………………………………………………………………..139
Fig. 4.13. Inhibition of Notch signalling by a gamma seretase inhibitor
(GSI) in K562 cells………………………………………………………………141
Fig. 4.14. Expression of Hes1 in K562 cells post 48h treatment of
imatinib mesylate (IM)…………………………………………………………144
Fig. 4.15. The effect of Notch inhibition on BCR-ABL activity
in K562 cells……………………………………………………………………145
Fig. 4.16. Evaluation of the ALL-SIL cell line as a model for
ABL-Notch cross-talk………………………………………………………….147
Fig. 4.17. Expression of Hes1 in ALL-SIL cells post 48h
treatment of imatinib mesylate (IM)……………………………………………148
Chapter 5
8
Fig. 5.9. Assessment of P-crkl in CD34+ CML cells following
inhibition of Notch by gamma secretase inhibitor (GSI)………………………174
Fig. 5.10. Assessment of P-crkl in gamma secretase inhibitor
(GSI) non responsive CD34+ CML cells………………………………………175
Fig. 5.11. P-crkl in CD34+ CML cells treated with gammas secretase
inhibitor (GSI)…………………………………………………………………176
Fig. 5.12. GSI treatment induced both Notch and BCR-ABL
inhibition in CD34+ cells from one CML sample………………………………….177
Fig. 6.1. Proposed model for Notch and BCR-ABL cross-talk in CML……………194
Fig.6.2. The cooperative model of activated Notch and BCR-ABL
signalling in chronic phase CML…………………………………………………...195
Appendix1 …………………………………………………………………………215
9
Abbreviations
10
DMEM Dulbecco's Modified Eagle's Medium
DMSO Dimethylsulphoxide
11
ICSBP Interferon Consensus Sequence Binding Protein
IFN-γ Interferon gamma
IL-3 Interleukin-3
IL-4 Interleukin-4
IL6 Interleukin-6
IM Imatinib Mesylate
JAK2 Janus kinase 2
Lin Lineage specific antigens
LNR Lin 12/ Notch repeats
LSC Leukaemic Stem Cell
MAPK Mitogen-Activated Protein Kinase
M-CSF Macrophage Colony Stimulating Factor
MDS Myelodysplastic Syndrome
MM Multiple Myeloma
MNC Mononuclear Cells
MTor Mammalian target of rapamycin
NCR Notch CytokineResponse domain
NCS Newborn Calf Serum
NLS Nuclear Localization Signal sequences
NOD/SCID Non-Obese Diabetic/ Sever Combind Immuno Deficient
PB Peripheral Blood
PcG Polycomb Group
PCR Polymerase Chain Reaction
P-crkl Phosphorylated crkl
PE Phycoerythrin
PEST Proline-glutamate-Serine-Threonine-rich
(Ph)+ Philadelphia chromosome positive
PI3K phosphatidylinositol 3-kinase
PI Propidium iodide
PolyA PCR Poly Adenylated polymerase Chain Reaction
PPR PTH/PTHrP Receptors
PT⍺ Pre-T cell receptor ⍺
Ptc Patched
PTEN phosphatase and tensin homologue
12
RBP-Jκ Recombination signal sequence Binding Protein-J kappa
RT Room temperature
RT-PCR Reverse transcription polymerase chain reaction
SCF Stem cell factor
SCLC Small cell lung cancer
SDF-1 Stromal Derived Factor 1
SFEM Serum Free Expansion Media
Shh Sonic hedgehog
Su(H) Suppressor of hairless
STAT Signal Transducer and Activator of Transcription
TACE Tumour necrosis factor-Alpha Converting Enzyme
TAD Transcription Activation Domain
T-ALL T-cell Acute Lymphoblastic Leukaemia
TAN-1 Translocation-Associated Notch homolog-1
TCR T Cell Receptor
TGF β Transforming Growth Factor β
TNF-α Tumour Necrosis Factor-alpha
TPO Thrombopoietin
VLA-4 Very Late Antigen-4
VPA Valproic acid
VWF Von Willebrand’s Factor
Wnt Wingless-type MMTV integration site family
13
(Abstract)
Notch signalling is critical for haemopoietic stem cell self-renewal and survival.
Chronic Myeloid Leukaemia (CML) is a stem cell disease characterised by the
presence of the Philadelphia (Ph) chromosome, and subsequent expression of the
BCR-ABL oncogene. The well established role for Notch signalling in human T-cell
acute lymphoblastic leukaemia (T-ALL) and the reported interaction between Notch
and ABL in different developmental contexts in Drosophila raise the possibility that
Notch signalling may be dysregulated in CML. Therefore, this project aims to
investigate whether Notch signalling is altered in CML and to study possible cross-
talk between Notch signalling pathway and BCR-ABL in CML.
The gene expression patterns of all four human Notch genes and the Notch target
gene HES1 were studied in CD34+ stem and progenitor cells isolated from CML
patients. Poly-A PCR followed by real time PCR analysis was used to quantitate gene
expression levels in comparison with levels in equivalent populations isolated from
normal bone marrow (NBM). The expression of Notch1 receptor protein levels
expressed on the cell surface was also investigated by flow cytometry. Results
showed an up-regulation of Notch1 and Notch2 genes and the target gene Hes1 on the
most primitive CD34+ Thy+ subset of CML CD34+ cells as compared with NBM. In
addition, Notch1 receptor protein was expressed in distinct lymphoid and myeloid
progenitors within the CD34+ population of CML cells. These results suggest that
Notch signalling may be highly activated in CML primitive progenitors.
To investigate the possible crosstalk between Notch and ABL in vitro human cell line
model systems were assessed as possible models to study the interactions between
Notch and ABL signalling and the FACS based P-crkl assay was optimised as a rapid
method to assess ABL activity. The data showed that K562 and ALL-SIL cell lines
are sufficient model systems to investigate the cross-talk between the Notch and ABL
signalling pathways. The imatinib induced inhibition of ABL activity in K562 and
ALL-SIL cells resulted in significant up-regulation of Notch activity as assessed by
Hes1 expression. Similarly, GSI inhibition of Notch signalling in K562 cells resulted
in hyperactivation of ABL kinase activity as assessed by P-crkl levels.
The antagonistic relationship between Notch and ABL signalling observed in cell
lines were further confirmed in CD34+ cells from chronic CML patients. Treatment
of CD34+ CML cells with imatinib led to significant up-regulation of Notch activity
whereas inhibition of Notch signalling with GSI in CD34+ CML cells resulted in
increased ABL activity.
14
investigate the biological consequences of the interplay between Notch and ABL
signalling in CML.
Declaration
No portion of the work referred to in the thesis has been submitted in support of an
application for another degree or qualification of this or any other university or other
institute of learning.
Copyright Statement
Copyright in text of this thesis rests with the author. Copies (by any process) either in
full, or of extracts, may be made only in accordance with instructions given by the
author and lodged in the John Rylands University Library of Manchester. Details may
be obtained from the Librarian. This page must form part of any such copies made.
Further copies (by any process) of copies made in accordance with such instructions
may not be made without the permission (in writing) of the author.
The ownership of any intellectual property rights which may be described in this
thesis is vested in The University of Manchester, subject to any prior agreement to the
contrary, and may not be made available for use by third parties without the written
permission of the University, which will prescribe the terms and conditions of any
such agreement.
Further information on the conditions under which disclosures and exploitation may
take place is available from the Vice-President and Dean of the Faculty of Life
Sciences.
15
Acknowledgments
Special thanks are due to Dr. Nick Chadwick for his continuous help in experimental
design and excellent advice and help in molecular biology techniques. I am grateful to
Dr. Virginia Portillo for her constant support and help with flow cytometry, and Susan
Slack, for her help with cell culture. I also wish to express my Appreciation to my
colleagues Sarah Hoyle, for her help with Westerns and real time PCR, and Dr. Carl
Fennessy for his useful IT support and his help in the lab.
16
Chapter 1: Introduction
The study of the molecular and cellular mechanisms that control blood cell production
in the bone marrow is one of the rapidly developing fields in haematology. An
understanding of bone marrow niche elements and the regulatory signalling pathways
which dictate developmental fate decisions of haemopoietic cells in health and disease
is vital for both medicine and developmental biology. For instance, the discovery and
cloning of soluble haemopoietic growth factors (HGF), which are critical for blood
cells survival, proliferation, and differentiation, was a major breakthrough in medicine
and transplantation settings for the treatment of cancer. The importance of cell-cell
interaction in the bone marrow (BM) niche has been emphasised by the discovery of a
new role for sets of signalling molecules such as Notch and Wnt proteins which are
emerging as critical regulators of normal haemopoiesis.
17
It has been shown since then that Notch signalling is critical for haemopoietic stem
cell self-renewal and survival (Varnum-Finney et al. 2000; Stier et al. 2002) and in
cell fates specification during lymphopoiesis (Pear et al. 2003; Radtke et al. 2004).
Dysregulation of Notch activity has been shown to be associated with malignant
transformation in various organs including the haemopoietic compartment. The
contribution of Notch signalling to haematologic malignancies is well established in
T-ALL leukaemia (Bellavia et al. 2002; and Weng et al. 2004) and has been
suggested in other malignancies such as B-CLL (Hubmann et al. 2002), Hodgkins
lymphoma, and anaplastic large cell lymphoma (Jundt et al. 2002).
This chapter aims to review the main concepts of haemopoiesis and Notch signalling
pathway in the literatures, and to analyse how blood cells are affected by Notch
signalling during normal development and in the malignant transformation process.
This chapter aims also, based on recent findings, to establish a hypothesis of altered
Notch signalling in chronic myeloid leukemia (CML). An altered signalling activity
such as this would reveal part of the mysterious molecular mechanisms which drive
leukaemic transformation in CML and may provide a molecular target for therapeutic
strategies in CML.
18
as hierarchical with the rare HSCs at the top of the hierarchy giving rise first to
progenitors and then to precursors with single lineage commitment and ending in
differentiated mature cells of different lineages (Fig. 1.1). HSCs are stem cells that
reside mainly in the bone marrow and to a lesser extent in other tissues such as
peripheral blood and placenta. HSCs enjoy the unique properties of stem cells. First,
they are capable of producing the major haempoietic cell types as needed. Secondly,
HSCs self-renew to generate daughter stem cell to maintain enough HSCs pool in the
body to sustain the requirement of high numbers of specialised blood cells during
physiologically stressful conditions. Thirdly, HSCs have an extreme proliferation
potential which enable them to meet the high demands of haemopoiesis throughout
the normal adult life span (Szilvassy, 2003).
Although most HSCs remain quiescent and do not enter the cell cycle, HSCs undergo
cell divisions to self-renew and differentiate, or either, through asymmetric cell
division, to differentiate and generate more mature and specialised blood cells (Rao
and Mattson, 2000). A balance between the numbers of stem cells, committed
progenitors, and differentiated haemopoietic cells in the bone marrow is maintained
throughout an individual’s life. The fate of HSCs in the bone marrow is highly
regulated at the molecular level through complex sets of internal and external signals
that will be discussed below. The knowledge of these regulatory elements is essential
for the improvement of the current clinical use of HSCs for the treatment of patients
with haematological disordesr.
Human haemopoietic stem cells are extremely rare and difficult to identify. However,
several phenotypic and functional characteristics in vitro and in vivo have been used
to identify HSCs. Immunophenotypically, HSCs are characterized by the expression
of several antigens such as CD34, Thy-1 (CDw90), CD117 and the absence of co-
expression of HLA-DR or CD38 without expression of lineage specific antigens
(Lin). The more differentiated CD34+ haemopoietic progenitors are CD38+, Thy-1
negative, and might express one of lineage specific markers such as CD19 for B
lymphoid progenitors, CD7 for T lymphoid progenitors, CD33 for myeloid
progenitors, CD71 or glycophorin-A for erythroid precursors, and CD41 or CD61 for
megakaryocytic progenitors (Steidl et al. 2003). Interestingly, some reports have
described a small subpopulation of HSC that is CD34 - CD38- Lin- and there is
19
evidence that these cells can give rise to CD34+ HSCs (Zanjani et al. 1998, Bathia et
al. 1998).
20
In the last few years, several reports have demonstrated the non-lineage restricted
potentials of HSCs and their capacity to transdifferentiate into a variety of non
haemopoietic cell types such as neural cells, hepatocytes, cardiomyocytes, and
endothelial cells, a process termed as plasticity. However, other studies have
challenged the concept of stem cell plasticity and suggest that cell fusion, rather than
transdifferentiation may explain the acquisition of non-lineage phenotypes and
functions (Steidl et al. 2003). Despite the debate in the scientific literature on the
molecular mechanisms responsible for these observations, the accumulating data
suggests that new therapeutic potentials of haemopoietic stem cells can be used in
areas such as heart and brain degenerative diseases.
22
haemopoietic precursors is mediated by the availability of certain haemopoietic
cytokines in the niche and deprivation from cytokines induces apoptosis. Cytokines
show target cell selectivity in preventing apoptosis. For example, stem cell factor
selectively promotes survival of primitive hematopoietic cells, IL-3 inhibit apoptosis
in more committed progenitors, whereas Flt ligand is selective for progenitors
committed to the myeloid lineage (Wickremasinghe and Hoffbrand, 1999). Other
cytokines such as IFN-γ and TNF-α modulate haemopoietic cells survival in the bone
marrow by inducing apoptosis via increasing expression of FAS on the surface of
haemopoietic progenitors (Maciejewski et al. 1995).
In mice, adult haemopoietic stem cells (HSCs) reside in the bone marrow niche where
they traverse along the inner surface of the bone which is lined by osteoblasts. The
BM niche comprises osteoblasts, extracellular matrix (ECM), and marrow stromal
cells which are heterogeneous themselves comprising fibroblasts, reticular cells,
macrophages, adipocytes, and endothelial cells. The bone marrow niche is defined by
cell-cell interactions, cell-ECM interactions, and exposure to diverse soluble factors
including cytokines and various signalling molecules (Frisch et al. 2008).
23
1.1.2.1.1 Cell-ECM interactions
Extracellular matrix (ECM) is composed of three major classes of molecules:
structural proteins such as collagen and elastin, specialized proteins such as
fibronectin and laminin, and proteoglycans which consist of a protein core to which is
attached long chains of glycosaminoglycans (GAGs). The general effect of adhesion
of HSCs and progenitors to the marrow ECM is suppression of proliferation and
prevention of apoptosis (Arai and Suda, 2007).
Of particular interest, is the unique ability of a niche to retain its stem cells, a process
referred to as homing. This feature has been demonstrated in HSCs transplantation
studies in which the homing molecule VLA-4 was found to be vital for successful
engraftment (Craddock et al. 1997).
In vitro studies have shown that various cytokines and growth factors in the bone
marrow niche are secreted by cells adjacent to HSCs which, depending on their
24
concentration or specific combination, support survival, or proliferation and
differentiation of haemopoietic progenitors and stem cells.
Cytokines
Cytokines are low-molecular- weight regulatory proteins or glycoproteins secreted by
stromal cells, white blood cells, and other cells in response to different stimuli.
(Goldsby et al. 2003). Once secreted, they bind to specific receptors on the membrane
of target cells and trigger signal transduction pathways, which ultimately cause gene
activation and alter gene expression in the target cells. The haemopoietic growth
factors (HGFs) represent a group of cytokines with well-defined effects on the
haemopoietic system. The main biological function of HGF, is to act as means for
short-range intercellular communication that influences self-renewal, survival,
proliferation, and differentiation of haemopoietic cells at different stages of
haemopoietic maturation (Fetscher & Mertelsmann, 2002). Growth factors that are
secreted by stromal cells have been shown to enhance the proliferation of early
haematopoietic stem and progenitor cells are FLT3, SCF, erythropoietin, IL6 and
thrombopoietin (TPO) (Krause, 2002).
Chemokines
These are molecules in the bone marrow niche that regulate blood cell trafficking and
homing. β1-Integrins such as VLA-4 and VLA-5, which are expressed on CD34 + cells,
play a dominant role in adhesive interactions to mechanically tie HSCs in the niche.
Moreover, β1-Integrins regulate HSCs proliferation and survival through different
mechanisms, such as the inhibition of cell cycle dependent kinases (CDK’s) such as
P27 and the activation of the RAS/ MAPK signal transduction pathway, which result
in an increased expression of c-myc which is known to shorten the G1 phase of the
cell cycle (Steidl et al. 2003). The β2-integrin LFA-1 plays a similar role in adhesion
and trafficking of CD34+ haemopoietic cells and progenitor cells. L-selectins mediate
the initial contact of leukocytes with endothelium and might also be involved also in
homing of HSCs (Krause, 2002). The adhesion molecule CD44, which binds to
hyaluronic acid and fibronectin, has been shown to be highly expressed in CD34 +
cells in the bone marrow in steady state conditions as compared to CD34 + cells in
peripheral blood (Lataillade et al. 2005). This finding supports the notion of the
importance of CD44 in haemopoiesis and stem cell trafficking. Indeed, CD44
25
monoclonal antibodies against CD44 inhibit adhesion to bone marrow stroma and
stopp haemopoiesis in murine long-term bone marrow cultures (Christ et al. 2001).
Another key family of the growth factors in the HSCs niche is the transforming
growth factor β (TGF β) family, which is known to play a role in maintaining HSC in
a quiescent stem cell state. It has been shown that osteoblasts receive the TGF β signal
and respond by increasing their numbers and thus, indirectly promote HSCs stemness
by causing more stem cells to adhere to osteoblasts (Zhang et al. 2003). This indirect
mode of action of TGF β on mammalian HSCs is in contrast to the direct mode of this
niche factor on the GSC’s in Drosophila where DPP (member of the TGF β family) is
secreted by cap cells and bind directly to receptors on GSC’s to support their self
-renewal by suppressing the differentiation factor BAM (Fuchs et al. 2004).
Wnt proteins represent a growing family of secreted signalling molecules in the bone
marrow niche that have been shown to be critical for HSCs self renewal and
proliferation (Ryea et al, 2003). Wnt proteins bind to FZ-family receptors on HSCs
and trigger the Wnt-catenin signalling pathway which, ultimately leads to
accumulation of -catenin in the cytoplasm before it translocates to the nucleus and
facilitate transcription of target genes. Purified mouse HSCs that have been
transduced with the active form of -catenin showed high proliferation and
maintained the immature phenotype of HSCs in long-term cultures (Staal and Clevers,
2005).
26
The Hedgehog (Hh) pathway is another cascade that plays a crucial role in HSC
proliferation. Sonic hedgehog (Shh) is one of three trans-membrane proteins that
comprise the Hh family in humans and that mediates signalling through cell-to-cell
contact between adjacent cells expressing the Patched receptor (Ptch). Alternatively,
Hh ligands can be found as soluble molecules in the niche, where they can stimulate
cells in the niche that express the Ptc receptor .Shh, Ptc, and Smo (Smoothened,
another Hh receptor) are expressed in primitive human CD34 + CD38- Lin- cells as well
as in stromal cells which imply that both HSCs and marrow stromal cells can
transduce the Hh signals (Bhardwaj et al. 2001; Szilvassy, 2003). It has been shown
that the interaction between HSCs and Hh ligands is critical for HSCs survival and
expansion ex vivo. This effect is mediated via regulation of the bone morphogenic
protein (BMP)/ TGFβ superfamily (Kondo et al. 2003).
27
in the bone marrow niche is the interaction between Notch receptors on HSCs and
Notch ligands expressed by stromal cells. Notch signalling is known to be critical for
HSCs self- renewal and survival and will be discussed later in detail.
In addition, there are gene expression patterns that are specific for certain
haemopoietic lineages, which mean that cell cycle control genes are modulated during
haemopoiesis to control the differentiation and proliferation of haemopoietic cells.
Transcription factors also play a vital role in the differentiation of HSCs and
progenitor cells. Bmi-1, which is a member of the polycomb group (PcG) family of
genes, has been shown to be highly expressed in HSCs and declines during
haemopoietic development. Competitive repopulation studies have demonstrated that
Bmi-1 is crucial for HSCs self-renewal (Stein et al. 2004). The homebox (Hox) genes
exhibit distinct pattern of expression during haemopoietic differentiation (Stein et al.
28
2004). HoxB4, for example, is abundantly expressed in immature haemopoietic cells
including HSCs, but declines with lineage differentiation, which underlines a possible
central role of this transcription factor in early haemopoiesis. Another member of the
Hox transcription factor family, HoxA10, is critical for the regulation of myeloid
differentiation. Similarly, PU1 and GATA-1 transcription factors have been shown to
initiate myeloid differentiation (Steidl et al. 2003). Similarly, the Pax5 transcription
factor has been shown to be vital for the development of B cell progenitors (Nutt et
al. 2001). Other transcription factors have also been found to be indispensable for
other haemopoietic lineages proliferation and differentiation. These findings support
the notion that distinct expression patterns of transcription factors steer the balance
between self-renewal and commitment to differentiation of haemopoietic stem cells.
Two models have been proposed for the genetic dictation of haemopoietic cells fate
decisions during haemopoiesis. The stochastic model argues that the developmental
fate of haemopoietic cells is predetermined by intrinsic genetic processes to occur in
certain sequence and timing and the external environmental signals then act to
modulate these genetic effects (Smith, 2003). The instructional model, however,
suggests that the external environmental signals may play a primary role in directing
cells toward various developmental fates by inducing the appropriate genetic change.
29
Extrinsic control by the niche
Genetic control
The phenotype of the Notch gene of Drosophila was discovered by Morgan in 1916
in a mutant fly with ‘notches’ in its wings, and the gene was found to be required for
the wing outgrowth (Simpson, 1998; and Lai, 2004). However, it was not until 1983
that the Drosophila Notch gene was cloned (Kidd et al. 1983; Artavanis-Tsakonas et
al. 1983). Notch has since been found to be a key player in a wide range of
developmental processes throughout different organisms, ranging from the fruit fly to
the human. Some 13 years after the cloning of Drosophila’s Notch gene, four
mammalian Notch genes were cloned, known as Notch 1-4. Notch 1 was the first
Notch protein to be identified in Human and was initially named TAN-1 – for
Translocation-Associated Notch homologue-1 – (Das et al. 2004). It was cloned as a
gene involved in the t(7;9)(q34;q34.3) chromosomal translocation found in a subset of
human T-cell leukaemia (Gridley, 2004).
31
the site known as S1 and yields a heterodimer cell surface receptor (Maillard et al.
2003; Baron, 2003).
Notch receptors consist of two domains, which remain non-covalently bound together
by a calcium-dependent interaction. The extra-cellular domain (ECN) consists of 29-
36 tandem epidermal growth factor (EGF-like) repeats that bind Notch ligands, and
three Lin 12/ Notch repeats which are crucial for maintaining Notch in a resting
conformation before ligand binding (Nam et al. 2002). The The Notch transmembrane
domain (NTM) consists of a transmembrane region and the intracellular Notch
domain (ICN). The intracellular Notch domain (ICN) contains a RAM domain, a cdc
10/ ankyrin-like repeats flanked by two nuclear localisation signal sequences (NLS),
and a c-terminal proline-glutamate-serine-threonine-rich (PEST) domain, which is
important for regulating protein stability (Fig.1.3). In the Drosophila Notch and
human Notch 1 and 2, the ICN also has a transcription activation domain (TAD),
which is absent in Notch 3-4. Moreover, the ICN has a Notch cytokine response
domain (NCR), which may be involved in cytokine signalling. Notch 4 has a shorter
intracellular domain that lacks one of the NLS and the whole NCR domain The RAM
domain and ANK repeats are binding sites for the downstream transcription factor
CBF-1/RBPJ, which is the human homologue of Drosophila Su(H) (Ohishi et al.
2003). Although the RAM domain is the primary binding site for the transcription
factor CBF-1/RBPJ, the ANK repeats facilitate this binding, and more importantly,
they are the binding sites of many important proteins that modulate Notch signalling,
such as Deltex and Mastermind (Kojika and Griffin, 2001; Fleming, 1998).
32
expressing cells (Fleming, 1998). It is also the EBD region of the ligand protein that
regulates ligand recognition and specificity by modulators such as a fringe gene
product. Next to the EBD domain and before the transmembrane domain (TM) lie the
EGF-like repeats (EGFR) and an additional cysteine-rich region, which is found only
in Serrate and Jagged related groups. Although it has been shown that the EGFR
domain is not essential for Notch signalling, missense mutation studies suggest that it
may be important for stabilising ligand / receptor interaction (Tax et al. 1994;
Fleming, 1998). The function of the cysteine-rich region is not clear, but it may be
important in ligand specificity since this domain is not found in delta-like ligands.
Moreover, it has been demonstrated that the TM domain and the cytoplasmic portion
of Notch ligands are crucial for Notch activation (Fleming, 1998). In Drosophila, it
has been found that endocytosis of ligands after binding Notch receptor is essential
for the activation of Notch signalling (Kojika and Griffin, 2001).
Proteolytic sites
S1 S2 S3
ICN
TM
Jagged/ Serrate
EBD
TM
34
1.2.3 Molecular mechanisms of Notch signalling
Physical interaction between specific EGF repeats in the DSL domain of a ligand and
the EGF repeats of the ECN receptor protein triggers two successive cleavages,
resulting in the release of ICN and its subsequent translocation into the nucleus. The
first cleavage, mediated by an ADAM metaloprotease (TACE in vertebrates, and
possibly Kuzbanian/SUP-17 in invertebrates), occurs external to the transmembrane
domain (S2 cleavage site), and releases the majority of the extra-cellular Notch
domain. The second cleavage occurs within the trans-membrane domain (S3 site)
(Fig. 1.3) and is mediated by-secretase, a multi-protein complex with secretase
activity whose components include presenilin, nicastrin, Aph1 and Pen2 (Fortini,
2002, Baron, 2003; Lai, 2004). This cleavage releases soluble ICN into the cytoplasm,
which then translocates to the nucleus..
Once in the nucleus, the ICN binds directly through its RAM and ANK domains to
the CSL transcription factor (CBF1 in vertebrates, Su(H)) in drosophila, or LAG-1 in
Caenorhabditis elegans), and converts it from a transcriptional repressor into a
transcriptional activator (Fig. 1.5). It has been shown that the binding of ICN to CSL
displaces co-repressor complexes from CSL (such as histone deacetylase (HDAC))
and recruits, through ANK and TAD domains of ICN, different transcriptional co-
activators such as mastermind in Drosophila (MAML1 in mammals) to convert CSL
into transcriptional activator. In this way transcription of Notch downstream target
genes (e.g. HES) which eventually control specific developmental decisions in
different cellular contexts (Mumm and Kopan, 2000; Lai, 2004; and Wu et al. 2002).
The most widely characterised mammalian Notch target gene is Hes1, although Hes5
is also known to be involved in Notch signalling (Kojika and Griffin, 2001).
35
terminus, which recruit transcriptional repressors such as Groucho in Drosophila or
its mammalian homologue TLE. The overall effect is the repression of the
transcription of downstream target genes, necessary for cell fate decisions in
processes such as myogenesis, somitogenesis, sex determination, vasculogenesis,
lymphocytes development and neurogenesis (Davis and Turner, 2001, Iso et al. 2003).
Despite the linear picture of the Notch signalling pathway described above, several
lines of evidence support the existence of CSL-independent Notch signalling
pathways in Drosophila and vertebrates (reviewed by Martinez Arias et al. 2002).
However, the exact mechanisms of these alternative pathways await further
explanation.
36
Receiving cell
Sending cell GSI
S1
S3
S2
Nucleus
Fig. 1.5 The CSL-dependent Notch signalling pathway. Notch receptor is present on the
cell surface as heterodimer. Upon binding with a ligand on adjacent cell, two proteolytic
cleavages at sites (S2) and (S3) occur which liberate the intra cellular domain of Notch (ICN)
in the cytoplasm. ICN translocates to the nucleus and binds to the transcription factor CSL,
which displaces co-repressors (CoR) and recruits co-activators (CoA) including MAML,
leading to transcriptional activation of downstream target genes including Hes1,Deltex, and
C-Myc. (Modified from Aster et al. 2008)
37
1.2.4 Modulators of Notch signalling
Notch signalling is finely regulated through several modulators that act at the extra-
cellular, cytoplasmic or nuclear levels. The EGF repeats on the extra-cellular domain
of Notch receptor undergo O-fucosylation and O-glucosylation which modulate
various activities of Notch such as Notch-ligand interaction and intracellular
trafficking of Notch (Acar et al. 2008). Examples of the extra-cellular modulators of
Notch signalling which influence receptor-ligand interaction may include fringe and
Ofut1. Fringe is a glycosyltransferase protein that controls the specificity of Notch-
ligand binding. In Drosophila, fringe physically interacts with the extra-cellular
domain of Notch and modifies O-linked fucose on specific Notch EGF-repeats;
including EGF repeat 12 (EGF12), to restrict Notch activation to the delta ligand
(Panin and Irvine, 1998; Schweisguth, 2004). Three vertebrate homologues of fringe
have been identified, (L fringe, M fringe, and R fringe – that control the specificity of
receptor-ligand binding in different cellular contexts (Kojika and Griffin, 2001). The
O-fucosylation of Notch is catalysed by a GDP-fucose protein O-fucosyltransferase
encoded by the Ofut1 gene. The regulation of the Ofut1 gene expression is vital for
normal Notch signalling, as over-expression of Ofut1 or loss of its function disturbs
ligand-Notch interaction and blocks Notch signalling (Schweisguth, 2004).
Interestingly, it has also been shown that ubiquitination of Delta ligand in Drosophila
up-regulates Delta signalling activity and promotes Notch activity through as yet
unrevealed mechanisms (Schweisguth, 2004). Recently, Acar et al (2008) isolated a
gene named rumi in Drosophila which encodes the O-glucosyltransferase protein
Rumi. The authors showed that Rumi is essential for Notch-ligand binding and
proposed that lack of O-glucosylation of Notch in rumi mutants results in a defect in
Notch folding and signalling.
38
acquiring the Numb protein adopts a fate different to its sister cell. Therefore, Notch
continues to function positively in the daughter cell that does not inherit Numb. It has
been demonstrated that Numb may influence cell fate by negatively regulating the
Notch signalling pathway (Guo et al. 1996). Numb inhibits Notch signalling by
preventing the intra-cellular domain of Notch from translocating to the nucleus.
Recently, it was shown that this was achieved in mammals through promoting the
ubiquitination of Notch1, leading to the degradation of the intracellular domain
following receptor activation (McGill and McGlade, 2003).
39
lymphoid, myeloid, and erythroid precursors. Notch1 hase been also detected in
peripheral blood T and B lymphocytes, monocytes and neutrophils (Milner and Bigas,
1999). The expression patterns of Notch-1 and 2 in different haemopoietic lineages
are distinct, ranging from low levels in CD34+ precursors to high levels in monocytes
(Ohishi et al. 2000; Walker et al. 2001; Singh et al. 2000, and Jonsson et al. 2001).
Moreover, the expression patterns of Notch 1-4 genes in various maturation stages of
T and B lymphocyte development have been studied recently (detailed in Saito et al.
2003).
Notch ligands have also been found in haemopoietic tissue including foetal liver, BM
and thymus, and in populations of haemopoietic cells. Jagged-1, Delta-1 and Delta -4
have been detected in bone marrow stromal cells, whereas Jagged-1 is expressed in
haematopoietic cells such as macrophages, megakaryocytes and mast cells (Ohishi et
al. 2003). These findings, and the evolutionally conserved role of Notch signalling in
cell fate decisions, suggest a role of Notch signalling in haemopoiesis.
40
Studies on Notch ligands have supported the notion of the crucial role of Notch
signalling in influencing HSCs fate decisions and suggested the potential use of Notch
ligands for ex vivo expansion of HSCs. When cultured with human Jagged-1, human
HSCs showed increased survival and expansion potential in vivo (Karanu et al. 2000).
A similar effect was reported when mouse Jagged-2 promoted the survival of murine
primitive haematopoietic precursors without exogenous cytokines (Tsai et al. 2000).
Moreover, the soluble form of human Delta-like-1 suppressed the acquisition of
differentiation markers by murine haemopoietic progenitor cells (Lin ) cultured in
vitro with cytokines, and promoted the self-renewal of the primitive haemopoietic
precursor cells (Han et al. 2000). Taken together, studies on Notch receptors and
ligands show that Notch signalling is critical for HSCs self-renewal and survival.
The exact mechanisms and pathways by which Notch regulates the developmental
fates of HSCs are still a mystery. However, such effects are most likely to be
mediated through cross-talk between Notch and various complex signalling pathways,
cell cycle modulators and secreted factors in the bone marrow niche. It has been
proposed that cytokines may play an important role in the effects of Notch on HSCs
(Kojika and Griffin, 2001). Cytokines may modify the Notch- induced self-renewal of
HSCs through their interaction with a specific region on Notch 1-3, termed the Notch
Cytokine Response region (NCR) (Bigas et al. 1998). Different modulators of Notch
may also modify the action of Notch on HSCs fate decisions, in response to various
physiological demands.
Interestingly, it has been shown that Wnt signalling contributes to the differential
expression of known Notch targets in HSCs, and that Wnt and Notch may work
together to promote self-renewal of HSCs (Duncan et al. 2005). One critical target
molecule of the Notch-1-induced self-renewal of HSCs is the transcription factor c-
myc. It has been demonstrated that the expression of c-myc is enhanced during Notch-
1-induced self-renewal of murine HSCs, and that Notch-1 activates the c-myc
promoter directly (Satoh et al. 2004). It is apperant, therefore, that Notch-1 inhibits
differentiation and promotes self-renewal of HSCs by up-regulating c-myc, which is
known to shorten the G1 phase of cell cycle and induce G1/S transition (Stein et al,
2004).
41
1.2.5.2. Notch signalling in myeloid development
The effect of Notch on the differentiation and proliferation of myeloid cells is still
controversial. Various in vitro studies using cell lines support the notion that Notch
may inhibit the differentiation of immature myeloid progenitors. For instance, the
constitutively activated ICN of mouse Notch-1 inhibited granulocytic differentiation
of the myeloid progenitor cell line 32D (Milner et al. 1996). In another study by the
same group, the inhibitory effect of Notch-1 and -2 on differentiation of myeloid cells
has been shown to be cytokines dependent and that this is controlled through the NCR
region of Notch. Notch-1 has been demonstrated to inhibit granulocytic differentiation
of 32D myeloid progenitor cells in response to G-CSF, and Notch-2 in response to
GM-CSF (Bigas et al. 1998). Interestingly, the expression of constitutively active
Notch-4 also inhibited differentiation of human myeloid leukaemia (HL-60) cells, and
caused their accumulation in the G0/G1 phases of the cell cycle (Ye et al. 2004).
Moreover, in vitro co-culture experiments have shown that the soluble forms of
human Notch ligands Jagged-1 and Delta-1 inhibit the differentiation of myeloid
progenitors in 32D cells and in mice (Li et al. 1998; Han et al. 2000).
Theses in vivo studies lend further support to the concept that Notch signalling in
myeloid differentiation is of promoting rather than inhibitory nature. Myeloid
42
differentiation was not shown to be repressed in transduced haemopoietic progenitors
that express activated Notch (Ohishi et al. 2003).
Notch signalling has been investigated in monocytes and it has been found that
immobilised Delta-1 induced apoptosis in monocytes in response to M-CSF, and
inhibited monocytes from differentiation into macrophages in response to GM-CSF
(Ohishi et al. 2003). In the same study, Delta-1 promoted the differentiation of
monocytes into dendritic cells in response to GM-CSF and IL-4. Notch signalling has
also been found to regulate myeloid differentiation along erythroid and
megakaryocytic lineages. It has been reported that Notch-1 inhibits the differentiation
43
of erythroid/megakaryocytic cells by inhibiting GATA-1 activity in the
erythroid/megakaryocytic cell line K562 (Ishiko et al. 2005). However, only erythroid
differentiation has been shown to be inhibited in K562 cells by activated Notch (Lam
et al. 2004). Further studies with careful experimental designs, which take into
consideration all of the possible sources of discrepancies mentioned above, are needed
in order to reach a final model for the role of Notch in myeloid cell development.
Radtke et al provided the first evidence that Notch signalling regulates B Vs T lineage
specification (Radtke et al. 1999). Radtke et al used transgenic mice expressing a
conditional Notch1 knockout allele to demonstrate that loss of Notch-1 caused a block
in T-cell development, and promoted B-cell development that derive from thymic
precursors. The block in T cell development has been found to occur at or before the
earliest intrathymic precursor stage (defined as lineage negative
CD44+CD25−CD117+) (Wilson et al. 2001).
Gain of function studies lent further support to these findings, in which enforced
expression of constitutively active Notch1, (ICN1) in murine HSC, led to ectopic T
cell development in the bone marrow that was thymus independent, while inhibiting
B-cell development at the earliest stages (Pui et al. 1999). Collectively, these studies
suggest that at the level of CLPs, Notch-1 signalling has to be kept inactive in the BM
compartment to allow B cell development, and to inhibit ectopic thymic-independent
T cell development. At the same time Notch1signalling is necessary and sufficient for
T cell fate specification once a CLP enters the thymus (Pear et al. 2003).
44
Since Notch receptors and ligands are expressed in normal bone marrow, certain
regulatory mechanisms must exist to modulate Notch signalling and allow normal B
cell development in the bone marrow (Radtke et al. 2004). For instance, it has been
shown that the B lineage commitment factor, Pax5, inhibits transcription of Notch1,
providing a possible mechanism that allows B cell development in the BM, despite
expression of Notch-1. Other possible mechanisms that antagonise Notch signalling
and allow B cell development in the bone marrow may include Notch inhibitory
modulators such as Fringe (Koch et al. 2001) and Deltex1 (Izon et al. 2002), as
demonstrated by enforced expression studies.
The Notch signalling effects on T cell development have been shown to be mediated
by the CSL transcription factor since an inducible deletion of CSL produced a
phenotype which is similar to that shown in Notch-1 conditional knockout mice (Han
et al. 2002). However, the molecular mechanisms by which Notch influences
lymphoid commitment remain largely unknown. One possible mechanism is that
Notch blocks B cell commitment through the inhibition of the E47 function, which is
the gene product of E2A. E2A is an important transcription factor during early stages
of B cell development (Pui et al. 1999; Kojika and Griffen, 2001). Furthermore, it has
been suggested that Notch-1 may promote T-cell development by upregulating
expression of T-cell specific genes, such as pre T-cell receptor ⍺ (pT⍺), which
encodes a critical component of pre-TCR (Reizis and Leder, 2002).
45
The role of Notch signalling in the CD4/CD8 fate choice remains largely unresolved.
Initially, it has been proposed that Notch1 promotes the development of CD8 + T cells
at the expense of CD4+ cells (Robey et al. 1996). Another group who used transgenic
mice expressing slightly longer form the ICN reported maturation of both CD4+ and
CD8 + T cells (Deftos et al. 2000).
A more recent study showed that both transgenic mice used by the two groups display
a decrease in mature CD4+ T-cells and an increase in mature CD8 + T cells, suggesting
that Notch1 signalling does indeed influence the CD8 versus CD4 lineage choice
(Fowlkes and Robey, 2002). To make things more complicated, loss of functions
experiments in which the Notch1 gene was inactivated in mice, did not show any
developmental skewing toward CD4+ T cells, suggesting that Notch1 is dispensable
for the CD4/CD8 lineage decision (Wolfer et al. 2001). Whether the CD4/CD8
lineage choice is regulated in normal lymphopoeisis by other Notch receptors in a
redundant fashion, remains to be confirmed in order to validate the loss of function
experimental findings. Collectively, there is no consensus as yet on the Notch-1
instructive role in the CD4/CD8 decision.
46
Several questions regarding the role of Notch signalling in lymphoid development are
still to be answered. For example, what are the downstream target genes that mediate
the effects of different Notch receptors and what is the role of different Notch
modulators in haemopoiesis. Of importance also is which ligand specifically triggers
different Notch functions in vivo and whether Notch receptors operate in the
haempoietic compartment in a redundant fashion. Finally, the interactions between
Notch signalling and other signalling pathways, such as NF-B and the ras/MAPK
pathway, during T cell development are not well established and might be a focus for
future investigations (Allman et al. 2002).
Notch-3 alterations have been associated with non-malignant human diseases such as
‘cerebral autosomal dominant arteriopathy with subcortical infarcts and
leukoencephalopathy’ (CADASIL) syndrome, a neurodegenerative disease (Joutel et
al. 2000). However, the first example of the involvement of Notch in malignant
transformation in humans was described in a subset of T-cell acute lymphoblastic
leukaemia (T-ALL), carrying the t(7;9) (q34;q34.3) translocation in which a
constitutive expression of ICN was involved in the leukaemogenesis process (Ellisen
et al. 1991). Direct proof of oncogenic potential of activated Notch-1 was obtained in
bone marrow transplant assay (BMT), in which retroviral expression of activated
ICN1 in HSCs induced T-ALL in mice (Pear et al. 1996).
47
(Weijzen et al. 2002) and in human cervical cancer (Talora et al. 2002). Interestingly,
Notch deficiency, rather than activation, can also contribute to cancer development.
For example, it has been shown that Notch1 loss of function resulted in basal-cell-like
carcinomas, or squamous cell carcinomas, in mice (Nicolas et al. 2003).
Despite the ability of activated Notch1 to induce T-cell leukaemia in mice, less than
1% of human T-ALLs exhibit the t(7;9) translocation. However, activating mutations
in NOTCH1 independent of t(7;9) have been identified in the heterodimerization (HD)
48
and PEST domains of Notch1 in most Notch-dependent T-ALL cell lines, and in
approximately 55% of primary T-ALLs (Weng et al. 2004). Activating mutations in
Notch1 have since been reported in mouse models of T-ALL (O'Neil et al. 2006)
The importance of Notch signalling in T-ALL has been further elucidated by the
finding that Notch3 is expressed in almost all T-ALL cases in humans (Bellavia et al.
2002). In this study, Notch3 was consistently expressed in a sample of 30 human T
cell acute leukaemias, and the expression was dramatically reduced or absent in
patients in clinical remission. Furthermore, Notch-3 expression in those patients was
associated with the expression of its target gene, HES1, and of the gene encoding pTα.
The combined expression of the genes encoding Notch3, pTα and HES1 in human T-
ALL suggests that a signalling defect at a specific stage in T-cell development, the
pre-TCR checkpoint, is responsible for T-cell leukaemogenesis (Screpanti et al.
2003). It has been suggested that the altered Notch-3 signalling disrupts the normal
interaction between pre-TCR signalling and NF-κB signalling in T-cell development.
This in turns is thought to lead to the disruption of differentiation of early thymocytes
and results in the development of T cell leukaemia (Bellavia et al. 2003).
The precise mechanisms by which Notch contributes to T-cell leukaemias are not
fully understood. However, it is postulated that several signal-transduction pathways
might co-operate in Notch-induced leukaemogenesis. For instance, pre-TCR
signalling has been shown to be essential for Notch-1 and Notch-3 induced
leukaemogenesis (Allman et al. 2001; Bellavia et al. 2002). However, whether pre-Tα
is a direct Notch target is controversial (Zweidler-McKay and Pear, 2004). It has been
proposed that pre-TCR signalling may promote Notch-induced leukaemia through
inhibition of E2A, a gene that is critical in T and B cell development and which acts
as a tumour suppressor (Bellavia et al. 2003). Another pathway that may co-operate
with Notch signalling in T-ALL leukaemogenesis is the NFκB pathway. This notion
was supported by the findings that Notch3-IC transgenic mice exhibited constitutive
NFκB activity (Bellavia et al. 2000), and that truncated Notch-1 expression resulted
in up-regulation of NFκB2 in T cells (Oswald et al. 1998). Collectively, Notch
signalling may contribute to T-ALL leukaemogenesis through its co-operation with
pre-TCR signalling to inhibit the E2A tumour suppression gene and by activation of
NFκB, which regulates apoptosis and proliferation of T-cells.
49
Fig. 1.6 Notch signalling during T and B cell development. Notch signalling
has been shown to promote T cell over B cell commitment and favour the
commitment towards the ⍺β lineage. Signalling through the Notch1 receptor has
been shown to be involved in regulating V-DJ rearrangement of the TCR β locus.
Finally Notch signalling has been proposed to influence lineage decisions when
DP (CD4+CD8+) thymocytes must choose between the CD4+ (CD4+CD8−) and
the CD8+ (CD4−CD8+) cell fates. Notch signalling should be kept inactive in the
B cell progentitors in the bone marrow to allow B cell development (Adopted from
Pear and Radtke, 2003).
50
with down-regulation of Notch-2 and CD23 expression (Duechler et al. 2005).
Moreover, Jundt et al (2002), using cell lines and primary cells, have demonstrated
that Notch-1 is highly expressed in B- and T-cell derived tumours of Hodgkin’s (HD)
and anaplastic large cell lymphoma (ALCL). In this study, mRNA expression of the
Notch1 ligand, Jagged1, was highly expressed in neighbouring cells of Hodgkin’s and
Reed-Sternberg cells in vivo, which suggest that Jagged1-induced Notch-1 signalling
might contribute to the pathobiology of HD. This notion was further supported by the
overexpression of Hes-1, target gene of Notch signalling, following in vitro culture of
HRS and ALCL cells in the presence of Jagged1 (Jundt et al. 2002).
The role of Notch signalling in myeloid leukaemias is not yet known. However, high
expression of Jagged1 has been reported recently in 20 primary AML samples
(Chiaramonte et al. 2004). Jagged1 expression in AML samples was significantly
higher than its expression in the T-ALL or B-ALL patients. In light of the finding that
only low levels of Notch1 and its target genes were detected in this study, a possible
autonomous role of Jagged1 in supporting AML growth has been proposed. This is in
line with the finding that expression of acute myeloid leukaemia (AML) PML/RAR
and AML1/ETO fusion proteins results in activation of Jagged1/Notch signalling in
blasts derived from AML patients (Alcalay et al. 2003). This has been suggested to
confer self-renewal properties to leukaemic blasts in AML. Interestingly, the gene
expression profiling of stem cells in myelodysplastic syndrome (MDS), AML, and
51
CML has revealed a selective expression of the gene encoding Delta-like Notch
ligand in MDS patients (Miyazato et al. 2001).
During the chronic phase, which lasts about 3-5 years, the only chromosomal
abnormality present on leukaemic stem cells and myeloid progenitors is the t(9;22)
(q34;q11). However, the progression into the accelerated and blastic phases is
accompanied by the acquisition of additional genetic abnormalities in most cases,
which may involve the loss of tumour suppressors or the activation of many proto-
oncogenes in the bone marrow microenvironment (Ren, 2005).
52
The new fusion protein has five-fold higher tyrosine kinase activity than the normal c-
ABL protein, an activity that has been shown to be essential for its transforming
potential (Clarkson et al. 1997). In addition, the new location of the constitutively
active ABL kinase in BCR-ABL oncoprotein may provide access to novel substrates
and interactions. It appears that the BCR-ABL fusion protein binds various substrates
in the cytoplasm to activate various signalling pathways in CML stem cells and
primitive progenitors and co-operates with cytokines to induce self-renewal,
proliferation and survival of leukaemic stem cells (Clarkson et al. 2003).
53
Fig. 1.7 The t(9;22)(q34;q11) reciprocal translocation. (A) The t(9;22) translocation
results in the formation of a shortened chromosome 22 (the Philadelphia chromosome)
carrying the BCR–ABL fusion gene. In addition, the translocation results in a longer
chromosome 9 that carries the ABL–BCR fusion gene. The fusion of BCR sequences to
ABL during the t(9,22) translocation, increases the tyrosine activity of ABL and leads to
constitutive tyrosine kinase activity in the BCR-ABL protein but not in the ABL-BCR
protein. (B) Locations of the breakpoints in the ABL and BCR genes. Exons are shown as
boxes, and breakpoints are indicated by arrows. Splicing at the m, M, or µ breakpoints in
BCR produces three distinc proteins. These three BCR-ABL variants are named P190 (e1a2
junction), P210 (b2a2 or b3a2 junction), and P230 (e19a2 junction). Most CML patients
express the P210 BCR-ABL. (Taken from Smith et al (2003) and Inokuchi (2006)).
54
functions (such as the nonreceptor tyrosine kinase Fes or the phosphatase Syp), and
proteins associated with organisation of the cytoskeleton and cell membrane (such as
paxillin and talin) (Ren, 2005; and Deininger et al. 2000).
55
2000). BCR-ABL may inhibit apoptosis by inhibiting the activation of caspases by
blocking the release of cytochrome C from the mitochondria (Amarante-Mendes et al.
1998). In addition, BCR-ABL has been shown to up-regulate the anti apoptotic
proteins Bcl-2 and BclxL (Deininger et al. 2000). Moreover, BCR-ABL may inhibit
apoptosis through the phosphorylation of the pro-apoptotic protein Bad (Neshat et al.
2000) and the down-regulation of ICSBP tumour suppressor protein (Hao et al. 2000)
(Fig. 1.8).
56
The adaptor protein Crkl is the most prominent tyrosine-phosphorylated proteins in
CML and appears to play a key role in mediating the oncogenic activities of the BCR-
ABL oncoprotein (Oda et al. 1994; Singer et al. 2006). BCR-ABL binds and
phosphorylates CrKl directly through the SH3 domain. The phosphorylated CrKl (P-
crkl) interacts with specific target proteins and mediate the formation of signal
transduction pathways. For example, the BCR–ABL-dependent activation of the PI3K
pathway has been shown to be mediated by BCR–ABL interaction with Crkl (Sattler
et al. 1996a). CrkL has also been found to be the linking protein between Bcr-Abl and
Stat signaling (Rhodes et al. 2000). In addition, Crkl, can also activate the Ras
signalling pathway in fibroblasts as well as in haemopoietic cells (Deininger et al.
2000; and Arai et al. 2002). CrKL is also involved in the regulation of cellular
motility of CML cells and in integrin-mediated cell adhesion by association with other
cytoskeleton proteins such as paxillin, the focal adhesion kinase Fak (Sattler et al.
1996b).
Interstingly, it has been shown that that tyrosine-phosphorylation of Crkl is a direct
consequence of BCR-ABL expression and that phosphorylation of Crkl could be used
as a diagnostic indicator for BCR-ABL activity in Ph+ leukaemia (ten Hoeve et al.
1994).
57
There is evidence that normal haemopoietic stem cells (HSCs) are relatively well
preserved in newly diagnosed CML patients, but tend to rapidly decline with time
(Frassoni et al, 1999). However, the leukaemic stem cells (LSCs) seem to be more
predominant than normal HSCs in CD34+ CD38- / CD34+ Thy-1 + cell populations
in chronic phase of CML. Maguer-Satta et al (1996) demonstrated the presence of
BCR-ABL mRNA in about 80% of the CD34+ CD38- cells in patients with chronic
phase CML. In line with this, Grand et al (1997) found that the majority of CD34+
CD38- cells were Ph+ and express BCR-ABL transcript. Similar findings were
reported in five (out of nine) CML patients in presentation (Holyoake et al. 2001).
Recently, FISH analysis of 10 CML chronic phase patients showed that the majority
of the primitive CD34+ CD38- cells, both before and following IM exposure, were
BCR-ABL positive (Copland et al, 2006). Contradictory to previous reports, others
found that normal HSCs frequently outnumber the LSCs in the chronic phase of CML
(Dube et al, 1984).
Interestingly, it has been shown that CML stem cells can be traced at least to
haemangioblast like cells, earlier than the pluripotent HSCs (Fang et al, 2005).
MAPK AKT
RAF C-MYC
P
STAT5
JNK ICSBP
ERK
NFkB
C-JUN
BCL-x BCL2 BAD
58
Proliferation and transformation Anti apoptosis Proliferation
Figure 1.8.Signal transduction pathways associated with P210 BCR-ABL in
CML. Tyrosine phosphorylation of BCR–ABL substrates results in the
consequent activation of multiple signal transduction pathways. Ras activation in
is mediated by BCR–ABL interaction with the adaptor molecules Grb2 or the
adaptor protein Crkl. Activation of signalling pathwas downstream of the RAS
pathway results in promoting proliferation and transformation of BCR-ABL+
cells. Proliferative signals are also gained by the BCR-ABL induced expression
of IL3 and GM-CSF cytokines. BCR-ABL has also been shown to bind and
phosphorylate the GAB2 protein, which then recruits and activates the (PI3K)
signalling pathway which interacts with downstream pathways including AKT
and NFkB to inhibit apoptosis. Protection from apoptosis can also occur through
the activation of STAT signalling pathway via interaction with Crkl adaptor or
following direct phosphorylation of STAT proteins by BCR-ABL. Direct or
Crkl mediated binding of BCR-ABL to actin and phosphorylation of a number
of neighboring cytoskeletal proteins including FAK and paxillin alter normal
adhesion of BCR-ABL+ cells to the stroma.
59
ABL as well. However, the inhibition of normal c-ABL function was only reported in
cardiomyocytes (Kerkela et al. 2006).
In 2001 the United States Food and Drug Administration (FDA) approved the drug
for the treatment of Philadelphia chromosome positive chronic phase CML (400
mg/d) and blastic phase CML (600 mg/d) after failure of interferon-α therapy. Clinical
trials showed that imatinib was highly effective in newly diagnosed chronic phase
CML patients, in which the drug induced greater than 90% haematologic response
and greater than 80% cytogenetic response. However, CML patients in accelerated
and blastic phases showed less sensitivity to imatinib (Druker et al. 2006).
60
other signalling proteins does not represent a good model for CML disease. This is
simply because certain BCR-ABL domains and signalling proteins are functionally
vital in fibroblast transformation, but not in haemopoietic cells (Deininger et al.
2000). Therefore, BCR-ABL+ haemopoietic cell lines such as K562 and BV173 may
provide a CML model that overcomes the limitations of fibroblast cell lines.
However, one limitation of haemopoietic CML cell lines is that they are derived from
blast crisis and thus, are not ideal models for the chronic phase of CML. The
importance of BCR-ABL+ cell lines remains that they contributed to our
understanding of the basic biology of CML, and that the BCR-ABL tyrosine kinase
activity can be turned off with imatinib mesylate (STI571 or Gleevec) to study
activity of other signalling pathways in CML.
61
oncogene in haemopoietic cells which produced a myeloproliferative disease (MPD)
that was similar to the chronic phase of human CML with high efficiency (Ren,
2005).
The problems with some animal models are that they either produced other
haemopoietic neoplasms in mice or failed to yield a similar disease at frequency
sufficient to utilise it in the study of CML pathogenesis (Petzer and Gunsilius, 2003).
Another limitation in CML animal models is the difficulty of ruling out disease
modification by host factors (Deininger et al. 2000).
Jamieson et al (2004) have shed new light on the interaction between leukaemic stem
cells in CML and Wnt signalling pathways, which is important for normal HSC self-
renewal, as discussed above (Ryea et al, 2003). Granulocyte-macrophage progenitors
(GMP) from patients with CML in blast crisis have been shown to have elevated
levels of -catenin, the major effector of Wnt signalling pathway, which resulted in
enhanced self-renewal capacities of GMP and thus acquisition of stem cell phenotype
(Jamieson et al. 2004). Notch signalling integrates with Wnt signalling pathway to
confer self-renewal capacities to HSCs, since intact Notch signalling was required for
Wnt-mediated maintenance of undifferentiated HSCs (Duncan et al. 2005). Moreover,
fusion oncoproteins PML/RAR and AML1/ETO in AML have been associated with
activation of Notch signalling which may confer self-renewal properties to leukaemic
stem cells in AML (Alcalay et al. 2003).
62
Transcriptional targets of Notch signalling, such as c-myc, which is essential in
Notch-mediated self-renewal potential of HSC (Satoh et al. 2004) and for Notch1
oncogenic role in T-ALL (Girard et al. 1996), also play a critical role in the malignant
transformation mediated by ABL in CML (Afar et al. 1994). Furthermore, signalling
pathways such as RAS, which is involved in the transformation process in CML and
activated by BCR-ABL fusion protein (Ren, 2005), has been shown to activate Notch
signalling (Weijzen et al. 2002). Taken together, Notch may also be involved in the
self-renewal potentials of leukaemic stem cells in CML.
The fact that Disabled protein has been shown to interact directly with Notch1 in
CML CD34+ cells in humans (Ostrowska et al. unpublished) justifies the hypothesis of
possible interaction between ABL fusion protein in leukaemic stem cells in CML and
Notch receptor via the Disabled adaptor protein. Although ABLl-Notch interaction in
Drosophila has been shown to be only CSL-independent (Crowner et al. 2003), it is
possible that Notch-ABL interaction, if proven, might be either CSL-dependent or
CSL-independent in human. This is simply because ABL protein in Drosophila shows
no nuclear localisation unlike the mammalian ABL which can translocate to the
nucleus (Saglio and Cilloni, 2004). All the previous findings and the notion that
Notch co-operates with several signal-transduction pathways to induce
leukaemogenesis make it possible for Notch to be integrated with the BCR-ABL
fusion protein in leukaemogenesis of CML.
63
1.5 Research aims and objectives
The overall aims of this project are to determine whether there is a role for altered
Notch signalling in chronic myeloid leukaemia (CML). Currently, the role of Notch
signalling in CML is not yet established. However, several clues raise the possibility
that Notch might be involved in CML as detailed in section 1.4. In a nutshell, CML is
a clonal disease, which originates from transformed haemopoietic stem cells and
Notch is essential in the self-renewal of these haemopoietic stem cells. In addition, the
hallmark of CML leukaemogenesis is the presence of BCR-ABL fusion protein, and
the ABL protein has been shown to co-operate with Notch in Drosophila. The
hypothesis of this project therefore is that Notch signalling might be altered in CML
and that Notch may interact with ABL protein expressed in CML cells.
To test this hypothesis, the expression of Notch receptors in CML samples and normal
control HSCs will be determined using monoclonal antibodies and flow cytometry.
The expression of Notch1-4 at the message level will be investigated using PCR
technique. The expression of Notch target genes Hes1 and Herp1-2 will be measured
using PCR to determine the activity of Notch signalling in CML. The possible cross-
talk between Notch and BCR-ABL will be investigated in cell line models as well as
in primary CML CD34+ cells.
64
fetal bovine serum (FBS - Sigma), 2 mM L-glutamine (Invetrogen) and 0.1 mg/ml
penicillin and streptomycin (Invetrogen) at 37 °C with in 5% CO2. The K562 cells
were not used beyond passage 20 before returning to a stock of low passage number
stored in liquid nitrogen.
JURKAT cells are human T-ALL suspension cells which are negative for the BCR-
ABL fusion gene. They grow singly or in clumps in suspension. JURKAT cells were
maintained in RPMI 1640 (Sigma) supplemented with 10% (v/v) fetal bovine serum
(FBS - Sigma), 2 mM L-glutamine and 0.1 mg/ml penicillin and streptomycin at 37 °C
with in 5% CO2.
65
K562 and JURKAT cell lines were sub-cultured every 3-4 days and transferred to
fresh media to maintain long phase growth. Due to differences in doubling time the
splitting ratio was 1:9 for K562 cells and 1:3 for the JURKAT cells. The NALM-1
and ALL-SIL cells were sub-cultured every week by splitting the cells at 1:2 ratio
with fresh media.
Viable cell numbers were determined by using the trypan blue exclusion method. A
cell suspension was diluted 1:1 with a 0.4% solution of trypan blue (Sigma). Viable
cells were counted using a haemocytometer.
1x107 cells ml-1 were slowly re-suspended in FBS (Sigma) with 10% (v/v) Dimethyl
sulphoxide (DMSO) (Sigma) and added to cryogenic vials in 1 ml aliquots (Corning).
These were then frozen at -20 °C for 1 hour, kept at -80 °C overnight before being
cryopreserved in liquid nitrogen for long-term storage.
.
2.1.2.1 Thawing of cryopreserved CML cells
A special thawing solution referred to as ‘DAMP’ solution was used for thawing of
cryopreserved CD34+ CML cells from liquid Nitrogen. DAMP thawing solution was
prepared in total volume of 500 ml by using the following recipe:
66
Dulbecco’s PBS (magnesium/calcium free) to 500 mL
Frozen CD34+ CML cells were thawed quickly by immersing in a 37 C water bath
before being opened under sterile conditions and transferred into a sterile 10 ml
Falcon tube. 10 ml of warm thawing solution were added dropwise to the cells over
10 minutes and centrifuged at 389g for 5 minutes. The washing step was repeated
twice with DAMP thawing solution before the cells were filtered by a cell strainer
(BD) and counted. 1 x 10 6 / ml CD34+ cells were cultured overnight in a 24 well
culture plate in serum free expansion medium (SFEM) supplemented with a five
growth factor cocktail (see 2.1.2.2) at 37 C in 5 % CO2. This initial 24h culture helps
the cells to revive and expand before they are being subjected to any treatment or used
in future experiments.
CD34+ cells were cultured in serum free expansion medium (SFEM) (StemCell
Technologies) supplemented with 1% glutamine (100 mM) and 1% penicillin–
streptomycin (100 mM). SFEM was further supplemented with a five growth factor
cocktail comprising 100 ng/ml Flt3- ligand, 100 ng/ml stem cell factor, 20 ng/ml each
of interleukin (IL)-3, IL-6 and granulocyte colony stimulating factor (GCSF) (all from
R&D systems). To prepare a ready to use cytokine cocktail, cytokines were combined
together and diluted in phosphate buffered saline (PBS) containing 0.1% BSA/PBS to
create a 100x working stock solution which was stored at 4 C for up to 3 weeks.
200 µl of 50 µg/ml Retronictin (TaKaRa) was added to each well of a 24 well plate
before being placed at 4 °C overnight. The following day, the Retronectin solution
was removed before 1 ml of 1% (w/v) bovine serum albumin (BSA- Sigma) in 1x
PBS to each well for I hour at RT to reduce non-specific binding. Next, the
supernatant was removed, prior to 1 x 105 K562 cells in log phase growth were mixed
with 1 ml of retroviral supernatant which contain either Notch1ΔE or the empty
vector pmX (Chadwick et al. 2008). Cells were then placed in duplicate onto the
67
Retronectin coated wells and centrifuged for 45 minutes at 1000 xg at 20 °C before
being incubated at 37 °C in 5% CO2 overnight and left for 48 hours. The cells were
then harvested and the GFP positive cells were FACS sorted and cultured in the K562
cells media [2.1.1.1].
Isolation of mononuclear cells from blood samples was done using ficoll-paque
(Amersham Pharmacia Biotech) density gradient separation under sterile conditions.
Samples were diluted 1:1 with sterile Hanks Balanced Salt Solution (HBSS)
supplemented with 5% Newborn Calf Serum (NCS) (Invitrogen). 20 ml of the diluted
blood was then carefully layered onto 10 ml Ficoll in a 50 ml falcon tube and
centrifuged at 1500 rpm (389 g) for 30 minutes at room temperature (RT). Next, the
mononuclear cells were harvested from the interface layer and transferred into a new
tube and washed twice with 50 ml HBSS / 5% NCS by centrifugation at 1500 rpm
(389 g) at RT for 7 minutes and cell count and viability were done between washes.
The pellet was then re-suspended in known volume of HBSS / 5% NCS for FACS
sorting, or processed for liquid nitrogen freezing.
Haemopoietic progenitor cell populations from normal cord blood and CML samples
were isolated by positive selection for CD34 expressing cells using StemSep™ kit
(StemCell Technologies) according to the manufacturers’ instructions. In summary,
the isolated MNC were re-suspended in HBSS / 5% NCS and incubated with 100 µl
selection cocktail per ml of cells on ice for 10 minutes. 60 µl magnetic colloid /ml
cells were then added to the cells and incubated on ice for 10 minutes. Cells were then
washed with 3 ml HBSS/5% NCS and resuspended in 2 ml HBSS/5% NCS. Next, a
MidiMax column (Miltenyi) was washed with 2ml HBSS/5% NCS and cells were run
through column in 1ml aliquots, the column was then washed with 2 ml HBSS/ 5%
NCS. The magnet was then removed and the bound cells were eluted from the column
with a plunger in 2 ml HBSS/ 5% NCS. The eluted CD34 cells were then pooled and
viability assessed before cells were pelleted and then re-suspended in 100 µl
68
containing 1:20 CD34-APC, 1:20 Thy-PE and 1:20 lin-FITC cocktail. After
incubation for 20 minutes at 4 °C in the dark, cells were washed with 2 ml HBSS/5%
serum and re-suspended in 1 ml HBSS/5% serum for sorting. Cells were sorted into a
24 well plate using a FACS Vantage (Becton Dickinson) flow cytometer. Sorted cells
were then transferred into RNAse free eppendorf tubes.
In order to study the expression patterns of Notch1 on CML cells, the mononuclear
cells from frozen samples were stained with EA1 monoclonal antibody, which
recognises the extra-cellular domain of Notch1, as well as with a set of antibodies that
identify different myeloid and lymphoid haemopoietic progenitors. First, cells were
washed twice in HBBS/5% NCS and filtered with nylon mesh filter before 10 5 cells
were transferred to a FACS tube and pelleted at 389 g (1500 rpm) for 5 minutes at
4°C. After removing the supernatant, the cells were re-suspended in 50 µl EA1 or IgG
primary antibodies at the optimum dilution (see table 2.1) and incubated in the dark at
4°C for 20 minutes. The cells were then washed in 2 ml HBBS/5% NCS and
centrifuged at 1500 rpm (389 g) for 5 minutes at 4°C. The supernatant was discarded
and the cells were re-suspended in 50 µl secondary antibody and incubated in the dark
for 20 minutes at 4°C. Cells were then washed as before, and pelleted at 1500 rpm
(389 g) for 5 minutes before the supernatant was removed and the conjugated
antibody at appropriate dilution was added. After another 20 minutes, incubation
period, the cells were washed in 2 ml HBBS/5% NCS, pelleted and re-suspended in
300 µl diluted propidium iodide (PI) for analysis. CD34 antibody was added in all
tubes in order to limit the study of Notch1 and other surface molecules expression to
CD34+ population in normal blood and CML samples. IgG1 hybridoma supernatant
was used as isotype control for all surface markers studied. Flow cytometric analysis
was performed on a FACS Vantage (Becton Dickinson) flow cytomter, and
CellQuest® software was used for data analysis.
69
antibody according to the same staining protocol described in 2.1.3.1. The EA1
primary antibody was used at 1:100 dilution (stock conc. is 2 mg/ml), the IgG1
hybridoma supernatant at equivalent concentration to the primary antibody was used
as an isotype control. Because K562 cells are negative for CD34 surface antigen the
analysis gate used here included all live K562 cells.
Crkl is a prominent substrate of the BCR-ABL oncoprotein in CML and binds to both
BCR-ABL and c-Abl. Crkl is prominently and constitutively tyrosine phosphorylated
in CML cells and is not phosphorylated in normal haemopoietic cells (Oda et al.
1994). The levels of phosphorylated crkl (P-crkl) were measured by intra-cellular
FACS technique and the P-crkl expression was utilised as a marker for ABL kinase
activity in this project. Cells from various cell lines or from primary CD34+ CML
cells were harvested from culture media and washed once in 3 ml HBBS/5% FBS. At
70
least 1 x 105 cells were resuspended in 100 µL fixing reagent (Caltag Laboratories)
and incubated at RT for 15 minutes. The cells were then washed once with 3 ml
HBBS/ 5% FBS and centrifuged at 389 g for 5 minutes. The supernatant was removed
and the cells were resuspended with 25 µl permeabilizing reagent (Caltag
Laboratories) and 2.5 µl of P-crkl primary antibody (New England Biolabs) was added
directly to this buffer. The cells were then vortexed and incubated at RT for 40
minutes before being washed twice with 3 ml HBBS/ 5% FBS. After resuspending the
cells in 100 µl buffer the secondary antibody was added directly at appropriate
dilution and the cells were mixed and incubated at RT for 30 minutes in the dark.
Next, the cells were washed twice and analysed by flow cytometry. The P-crkl results
were reported as the mean fluorescence intensity (MFI). The isotype control used in
the P-crkl assay was rabbit IgG at a concentration equivalent to that of the primary
antibody. Positive and negative controls for the P-crkl assay were K562 and JURKAT
cells respectively. The secondary antibody used for measuring the P-crkl levels in cell
lines was the pre-diluted PE F(ab')2 Donkey anti-Rabbit IgG (BD biosciences)
whereas the FITC monoclonal mouse anti-rabbit antibody (Sigma) was used at 1:20
dilution to assess P-crkl expression in CD34+ CML cells.
71
CD90 (Thy-1) PE Primitive HCs 1:20 pharmingen
Table 2.1 Monoclonal antibodies and the dilutions used in flow cytometric staining
experiments. (HCs: Haemopoietic cells, BD: Becton Dickonson, DSHB: The
Developmental Studies Hybridoma Bank
2.3 Molecular at the university
biology techniques of IOWA).
Using RNAse and DNAse free filter tips, sorted cells were transferred to DNAse and
RNAse free eppendorf tubes in a laminar flow cabinet and centrifuged for 3 minutes
at 3000 rpm (1840g) at 4 °C. The supernatant was then removed and the pellet was re-
suspended in 200 µl RNAzol B (Biogenesis) before being vortexed and kept on ice
for 5 minutes. 20 µl of chloroform (Sigma) was then added, and the solution was
vortexed and spun at 13 000 rpm (12470 g) at 4 °C for 15 minutes. Next, the upper
aqueous layer was aspirated into a new eppendorf tube. An equal volume of
72
Isopropanol (Sigma) was added, mixed, and then incubated at -70 °C for two hours
(up to 1 week). The samples were thawed and pelleted at 13 000 rpm at 4 °C for 30
minutes, before the supernatant was removed and the pellet washed twice with 70%
ethanol (molecular biology grade Sigma) for 10 minutes at 4 °C. The supernatant was
then removed and the pellet was air dried for 1-2 hours before re-suspended in 10 µl
sigma water.
cDNA reaction
A first strand buffer was freshly prepared by mixing 192 µl lysis buffer with 4 µl
Rnase inhibitor (Fermentas) and 4 µl primer mix freshly diluted 1:4 with water
(Sigma). 10 µl of this buffer was then transferred to fresh tube and 0.5-1 µl RNA (up
to 100 ng) was added to it. The mixture was then heated for 1 minute at 65 ºC before
it was allowed to cool for 3 minutes at 18 ºC. After cooling on ice, 0.5 µl AMV
Reverse Transcriptase (Roche) was added to each sample, and incubated at 37 ºC for
15 minutes and then heat inactivated at 65 ºC for 10 minutes and placed on ice.
73
cDNA tailing reaction
Poly-A PCR
A PCR mix was prepared using the following ratios: 40 µl MMM : 2.7 µl Not1 dT
oligonucleotide (MWG Biotech): 1.5 µl Taq Polymerase (Roche). The final
concentrations of all PCR solution components were as follow:
10 µl of the PCR mix was added to 5 µl tailed cDNA and amplified using the
following cycle profile:
25 cycles consisting of 1 minute at 94 ºC, 2 minutes at 42 ºC, and 6 minutes at 72 ºC
linked to another 25 cycles consisting of 1 minute at 94 ºC, 1 minute at 42 ºC, and 2
minutes at 72 ºC.
The globally amplified cDNA, from the previous step, was diluted 1:100 using sigma
water. Next, a 25 µl reaction was prepared by mixing the following: 1µl of the 1:100
diluted global cDNA, 19 µl sigma water, 2.5µl of 10x Taq Buffer (+MgCl 2), 2.5 µl of
2.5 mM dNTPS (Roche), 0.25 µl of 150µM NotI Oligo-dT (MWG Biotech), and 0.25
µl 5U/µl Taq Polymerase (Roche). Samples were then run on a PCR program with
the following conditions: 25 cycles consisting of 1 minute at 94 ºC, 1 minute at 42 ºC,
and 2 minutes at 72 ºC. To determine the efficiency of the PCR reaction, 1µl of the
PCR product was run on 1.5% w/v agarose gel.
74
Solution Contents Supplier Final concentration
75
Primer mix -800 l TaKaRa 2.5 mM dNTPs. - TaKaRa - 2.5 mM.
- 24 l dT24 (200uM) - 5.8 µM
MMM Buffer -1000 µl 10X Taq Buffer. - Roche. - 25.94 mM Tris-HCl pH 8.3.
- 129.7 mM KCl
3’ 5’
Tailed cDNA1 AAAAAA TTTTTT
(4) Amplification
77
minutes at 25 ºC, followed by 2 hours at 37 ºC. All procedures were done using
DNase/ RNase free filtered tips and all reagents were kept on ice during the
preparation of the PCR reaction mix.
Kit Component
Table 2.3. Amplification Volume cDNA
reaction mixture from the High Capacity (µl) Kit
10X RT Buffer 2.5
25X dNTPs 1.25
10X Random Hexamers 2.5
Reverse transcriptase (20 U ml-1) 1.25
Sigma H2O 12.5
2.3.4.1 Primers
For each gene studied, PCR primer pairs were designed to be directed towards the
mRNA sequence present within 280-300 bases of the poly-A tail. Table 2.4 shows the
sequences of the set of primers used in the gene expression studies. Most of the
primers were designed with the help of the Primer3 program at
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi. All primers were
resuspended in H2O (Sigma) to a stock concentration of 100 µM, and used at a
working concentration of 10 µM after further dilution with H2O (Sigma).
To optimize the annealing temperatures for each set of primers gradient PCR was
performed using an Eppendorf Mastercycler gradient PCR thermocycler. The gradient
PCR thermocycler is capable of producing a gradient across the block for the
annealing temperature. Gradient PCR was performed in 10 µl reactions consisting of
5 µl PCR ReddyMix (ABgene), 0.5 µl of forward and reverse primers, 3 µl water
(Sigma) and 1 µl of human genomic DNA diluted 1:500 (Promega). The following
cycle parameters for gradient PCR were used: 5 minutes at 95 ºC linked to 30 cycles
consisting of 1 minute at 94 ºC, 1 minute at gradient annealing temperature between
5-65 ºC, and 1 minute at 72 ºC. This was followed by final cycle for 5 minute at 72
ºC.
78
2.3.4.3 PCR reaction
In a PCR hood, using dedicated pipettes and filter tips, primers were diluted down to a
working dilution of 10µM and a master mix was prepared at 4ºC using the following
recipe in 10µl Reaction:
Next, 9 µl of the mastermix was aliquoted into PCR tubes or wells (if using a PCR
plate) and 1 µl of cDNA was added. The reaction was then amplified using the
following cycle parameters: 5 minutes at 95 ºC linked to 28-30 cycles consisting of 1
minute at 94 ºC, 1 minute at specific primer pair annealing temperature (table 2.4),
and 1 minute at 72 ºC. Water (Sigma) was used as negative control.
Agarose gel electrophoresis was used to resolve and visualise DNA bands. 1.5 %
agarose was prepared by adding 1.5 g high gel agarose (Sigma) to 100 ml of 0.5
xTBE. The agarose was dissolved by heating in a microwave. Once dissolved and
cooled 5 µl of 1:20000 diluted Vistra Green (Amersham Pharmacia) was added as the
staining agent. The gel was allowed to set before it was placed in an electrophoresis
tank filled with 0.5 X TBE buffer. Next, 5 µl of the PCR product was loaded into the
wells and run for 30-45 minutes at 120 volts. PCR products not amplified with
ReddyMix were first diluted 1:6 with Orange G loading buffer. The size of the
products was determined by loading the GeneRuler 100bp ladder (Fermentas) along
with the samples. Finally, the resulting gel was observed on a Typhon 8600.
79
hN1F GTGAGGGACGTCAGACTTGG 20
Notch1 166 58
hN1R AACATCTTGGGACGCATCTG 20 ºC
hN2F AAAGCATCTGTCAAATAGGAAAC 23
Notch2 205 58
hN2R TAAGGAATGTTACAAACCAATCA 23 ºC
hN3F CAAGCTGGATTCTGTGTACCTAGT 24
Notch3 202 56
hN3R CCCCAGCAAGGCTATGGAACA 21 ºC
hN4F ATATTTATTGGGCACCTACTAATG 23
Notch4 166 58
hN4R ATAGCAATAGCAGTGGCTAGAAG 23 ºC
Hes1F GTATTAAGTGACTGACCATG 20
Hes1 140 54
Hes1R TCAAACATCTTTGGCATCAC 20 ºC
Herp1F TCATTTCTCTACTGTGTGGAG 21
Herp1 155 60
Herp1R GTGGTATGTAAAGACTCTTGC 21 ºC
Herp2F CTAATTTTCCTGGGACTGCC 20
Herp2 216 60
Herp2R TCAAACCCAGTTCAGTGGAG 20 ºC
GAPDHF CCAGCAAGAGCACAAGAGGAAGAG 24
GAPD 180 56
H GAPDHR AGCACAGGGATACTTTATTAGATG 24 ºC
TCCACTCAGCCACTGGATTTAA 22
BCR-ABL F
BCR-ABL 60
TGAGGCTCAAAGTCAGATGCTACT 24 ºC
BCR-ABL R
Real time PCR is the ability to monitor the progress of PCR in real time. Real time
PCR technique uses the fluorogenic 5´ nuclease chemistry (TaqMan®) or SYBR®
Green I dye chemistry to allow for the quantification of gene expression in the early
phase of PCR reaction. This is in contrast to the conventional PCR method which uses
Agarose gels for detection of PCR amplification at the end-point of the PCR reaction.
This difference in principle of detection makes real time PCR far more sensitive
approach to use in gene expression studies than the traditional PCR method. Gene
quantification by real time PCR can be performed by absolute or relative
80
quantification. The absolute gene quantification is used to measure the input copy
number of a target gene by using a standard curve. The relative gene quantification is
used to analyze changes in gene expression in a given sample relative to another
reference control sample.
Real time PCR experiments were performed using either TaqMan® probes or SYBR®
Green. TaqMan® probes are specific sequences of DNA that recognise and bind the
target DNA between the primers. Each probe is labelled with a reporter, fluorescein-
5-carboxamide (FAM) at the 5’ site, and a quencher, carboxytetramethylrhodamine
(TAMRA) at its 3’ site. While the FAM and TAMRA molecules are attached to the
same probe, FAM fluorescence is quenched by TAMRA. During the real time PCR
reaction the 5’ exonuclease activity of Taq polymerase releases the reporter (FAM)
from the probe so its fluorescence in no longer quenched by TAMRA and as a result
FAM emits a fluorescence signal as the real time PCR reaction progresses.
Fluorescence from FAM is measured after each PCR cycle and correlate to the
amount of the PCR products formed during the PCR reaction. SYBR® Green is a
minor-groove DNA binding dye that fluoresces upon binding to double stranded
DNA. As the DNA amplification proceeds in the real time PCR reaction SYBR®
Green dye binds to each new copy of double-stranded DNA and the result is an
increase in fluorescence intensity proportional to the amount of PCR product
produced. Because the SYBR Green binds to any double-stranded DNA, it can also
bind to nonspecific double-stranded DNA sequences including primer dimmers.
Therefore, it was necessary to run a dissociation curve for each amplification to
ensure no non-specific amplification has occurred (Fig. 2.2).
2.3.5.2 Real time PCR protocols
This method was used to measure Notch1, Notch2, and Hes1 genes on cDNA samples
from CML patients as well as normal bone marrow samples. The primers used in real
time PCR are listed in table 2.5. cDNA samples were diluted 1:100 with H2O (Sigma).
Each reaction was made up to a total volume of 25 μl, with 10 μl of diluted cDNA,
12.5 μl of 2x Power SYBR® Green master mix and 0.5 μl of each 10 μM primer and
0.05 μl of 100 μM probe. This mixture was added to a 96 well plate (Bioplastics) and
sealed with StarSeal 96 well plate sealant (STARLAB) and the plate was then
81
centrifuged to ensure reagents were at the bottom of the wells. The ABI 7300 PCR
machine (Applied Biosystems) was used for data collection and analysis. The analysis
software was set up to ignore SYBR® Green and only look for amplification
involving the TaqMan® probe. The cycling parameters used were 95 °C for 10
minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. To
minimize contamination, filtered tips were used and plates and reagents were kept on
ice at all times.
This method was used to measure Hes1 gene expression on cell lines and on primary
CML samples following treatment with IM, GSI, and VPA drugs. cDNA samples
were diluted 1:50 with H2O (Sigma). Each reaction was made up to a total volume of
15 μl, with 5 μl of diluted cDNA, 7.5 μl of 2x Power SYBR® Green master mix and
0.3 μl of each 10 μM primer and 1.9 μl of sigma H2O. The reaction mixture was
added to 96 well plate and analysed by the ABI 7300 PCR machine as described
above [2.3.5.2.1]. Following the PCR amplification the PCR plate were re-run to
obtain a dissociation curve to ensure no non-specific amplification has occurred (Fig.
2.2)
2.3.5.3 Data analysis
The real time PCR data in this project were analysed using the relative gene
quantification method to study changes in gene expression. The relative change in
gene expression was determined using the 2 –ΔΔCT method (Livak and Schmittgen,
2001) which is also known as the Comparative CT method. The CT value is the cycle
number at which the level of fluorescence exceeds the level of background
fluorescence and passes the fixed threshold. The CT value is indicative of the relative
amount of the target gene in a sample because samples with a low starting amount of
template require more PCR cycles to produce a fluorescence signal above the
background level, and therefore have a high CT value whereas samples with a high
amount of template require fewer cycles to reach the fixed threshold and therefore
have a low CT. In the 2 –ΔΔCT method, the CT (Cycle threshold) values of a sample are
compared to those of a biological calibrator sample such as a non-treated sample or
RNA from normal tissue. The CT values of both the calibrator and the sample of
82
interest are normalised to an appropriate endogenous housekeeping gene such as
GAPDH to ensure that similar levels of total cDNA found in each sample.
Using the 2 –ΔΔCT method in experiments where the change in gene expression was
studied in a sample following a drug treatment, the data are presented as the fold
change in gene expression normalized to an endogenous reference gene (GAPDH)
and relative to the untreated control. Comparison of gene expression between treated
and untreated cells was derived from subtraction of untreated cells DCt values from
treated cells DCt values to give a DDCt value, and relative gene expression was
calculated as 2 –ΔΔCT. For the untreated control sample, DDCt equals zero and 20 equals
one, so that the fold change in gene expression relative to the untreated control equals
one, by definition. For the treated samples, evaluation of 2 –ΔΔCT indicates the fold
change in gene expression relative to the untreated control.
83
at how ΔCT varies with template dilution. If the plot of cDNA dilution versus ΔCT is
close to zero, it implies that the efficiencies of the target and housekeeping genes are
very similar. This was calculated for Hes1 and GAPDH primers prior to their use with
SYBR® Green PCR and the obtained value was 0.021 indicating the 2 –ΔΔCT method
can be used to generate relative quantitative data using the Hes1 and GAPDH primers.
84
(B) PCR dissociation curve
85
Reagent Concentration Supplier
Tris-Chloride (PH 7.4) 20 mM Sigma
Sodium Chloride 150 mM Sigma
EDTA 5 mM Sigma
Nonidet P40 (NP-40) 1% (w/v) Sigma
Protein separation
86
Glass plates were washed with ethanol and assembled. The running gel solution
(Table 2.8) was made with TEMED added last and then the solution was poured into
the glass plates. After approximately 15 minutes the stacking gel (Table 2.8) was
prepared and added with a comb being inserted to form wells. The protein samples
where diluted with sigma water in order to have the same protein concentration in all
samples. Protein samples were then boiled in 2x sample buffer and H2O in a volume
of 15 μl for 5 minutes, briefly centrifuged. Once the gel had set, the plates were
moved to the tank, which was filled with 1x running buffer (Table 2.8) containing 1%
SDS (v/v). Protein samples were loaded onto the gel along with 3 μl Precision Blue
marker (BIO-RAD). Electrophoresis was carried out at 150 v until the marker reached
the bottom of the gel.
87
instructions, before being placed in an autoradiography cassette with a piece of Kodak
Biomax film and developed in a Fuji film FPM800A automated developer.
2.4 Statistics
88
Acrylamide Sigma 330
Stacking gel 6.8 M Tris pH 6.6 Melford 400
0.5% (v/v) SDS Sigma 400
H2O Self 870
TEMED Sigma 2
10% (w/v) APS in H2O Sigma 10
1 M DTT Sigma 1000
2x Sample Buffer 10% SDS (w/v) Sigma 2000
1 M Tris pH 6.8 Melford 800
1% Bromophenol Blue (w/v) Sigma 100
Glycerol Amersham 1500
Distilled H2O Self 4600
Material Supplier Preparation
10x Running Buffer
Tris (30.2 g) Melford PH adjusted to 8.3 and made
up to 1 l. For SDS-PAGE, 5
BDH
ml of 10% SDS was added to
Glycine (144 g)
495 ml of 1x buffer.
Chapter 3
3.1 Introduction
The role of Notch signalling in normal haemopoiesis and in malignant transformation
is well established. It was originally found that the Notch1 receptor gene is expressed
in human CD34+ hematopoietic precursors, including the more primitive CD34+ Lin-
cell subset (Milner et al. 1994). Subsequently it was shown that Notch1 is also
89
expressed in lymphoid, myeloid, and erythroid precursor populations, as well as in
more mature progentors (Milner and Bigas, 1999) suggesting that Notch functions in
multiple lineages and at various stages of haemopoiesis. The expression of the Notch
ligand Jagged was also reported in human bone marrow stroma and Jagged1-Notch
signalling was shown to promote the cell survival of human CD34+ cells (Walker et
al. 1999).
The link between Notch signalling and leukaemia has been established in T-ALL in
which the t(7;9) breakpoint translocations involving the Notch1 gene results in
expression of constitutively activated intracellular Notch1 protein which has been
shown to induce T-ALL in a mouse transplantation model (Pear et al. 1996). The role
of dysregulated Notch signaling in T-ALL has been further emphasized by the finding
that more than 50% of human T-ALLs have activating mutations that involve the
extracellular heterodimerization domain and/or the C-terminal PEST domain of
Notch1 (Weng et al. 2004).
The role of Notch signalling in chronic myeloid leukaemia is not well characterised.
Notch signalling activity has been reported to be downregulated in the blastic phase of
CML as compared to the chronic phase of the disease (Sengupta et al. 2007).
However, this study was limited in that Notch signalling was only investigated in the
total CD34+ cells rather than in the leukaemic stem cells in the chronic phase of
CML. It also did not evaluate Notch signalling activity in the chronic phase of CML
90
The aim of this chapter is to investigate Notch signalling in the CD34+ cells in the
chronic phase of CML by measuring the gene expression levels of Notch receptors
and their target genes by conventional and real time PCR. The expression of Notch1
3.2 Results
3.2.1. Gene expression analysis
Poly-A cDNA samples derived from both normal bone marrow samples and CML
samples were used to study the expression patterns of Notch receptors and Notch
target genes by conventional semiquntitative PCR. The results of these experiments
were further quantified by real time PCR studies. In all gene expression studies,
GAPDH was used as a housekeeping gene.
Notch1 was expressed in all normal samples and in all three haemopoietic CD34+,
Thy+, and Thy- subpopulations. One exception was the CD34+ population in NBM4
which was surprising since both the Thy+ and Thy- subsets expressed Notch1. This
was also the case for the CML samples with no clear evidence of differences in the
91
expression between the CD34+, Thy+, and Thy- subpopulations were seen (Figure
3.1).
Notch2 was weakly expressed in normal and CML samples and in all three CD34+
subpopulations (Figure 3.1). The initial PCR analysis was done at 28 cycles and
showed very weak bands in normal cDNA samples so the number of amplification
cycles was increased to 30 cycles in order to visualise clearer bands. The annealing
temperature for Notch2 primers was also adjusted after determining the optimum
annealing temperature to be 58 °C by gradient PCR. Under these conditions weak
bands could be seen in all samples.
The study of Notch3 on normal and CML samples did not reveal any message using
the PCR conditions and the set of primers described here (results not shown). This
was repeated and the activity of Notch 3 primers was confirmed on human genomic
DNA, as a positive control, where PCR showed clear bands under the same
experimental conditions.
Notch4 was not constantly expressed and was seen in 2/4 normal CD34+ and in 2/4
CML CD34+ samples (Figure 3.1).
In order to determine whether there were any quantitative differences between the
Notch expression seen in normal BM and CML CD34+ populations real time PCR
was performed. Data from Real time PCR experiments showed no significant increase
in Notch1 expression in CD34+ CML samples as compared to normal bone samples.
Similarly there was no difference in Notch1 expression in the CD34+ Thy-
subpopulation. However, a 3-4 fold increase was seen in CD34+ Thy+ cell subset. A
Mann-whitney statistical test showed that this upregulation was only significant in the
most primitive CD34+ Thy+ cell subset (Figure 3.2).
Notch2 was shown to be overexpressed in all CML samples and in all different
subpopulations investigated here by real time PCR (n=4) (Figure 3.3). There was
more than a 100 fold increase in Notch2 expression in the CD34+ Thy+, CD34+
Thy- , and in the total CD34+ cell subsets as compared with NBM samples. However,
the increased level of expression was only significant in the CD34+ Thy+ and in the
92
total CD34+ cell subsets (P value= 0.02 for both cell subsets). Although real time
PCR showed an upregulation of Notch2 in the CD34+ Thy- cell subset, this was not
statistically significant by the Mann-Whitney test (P value= 0.057).
Quantitative real time PCR analysis demonstrated that that Hes1 was overexpressed in
CML. A greater than 100 fold change increase in the Hes1 expression was observed
in all CML samples and in all the CD34+ cell subsets studied (n=4) (Figure 3.5). The
Mann-Whitney statistical
GAPDH Notch1 test
Notch2showed
Notch4 that the overexpression of Hes1 in the CD34+
GAPDH Notch1 Notch2 Notch4
Thy+ and total CD34+ cell subsets was highly significant (P= 0.007) and significant
Thy+ Thy+
NBM9
(P= 0.0.2) respectively. On the other hand, the upregulation of Hes1 in the CD34+
CML1
Thy - Thy -
Thy- cell subset was just outside the biological level of significance (P= 0.057).
CD34+
CD34+
Thy+ Thy+
NBM4
CD34+ CD34+
Thy+ Thy+
NBM2
CD34+ Thy -
CML3
CD34+
Thy+
Thy -
NBM1
Thy+
CD34+ Thy -
CML4
CD34+
HGDNA
93
Figure 3.1. Notch expression of receptor genes in CD34+ populations
isolated from normal bone marrow (NBM) and CML samples. PCR
reactions are shown for four normal bone marrow samples on the left panel and for
four CML samples on the right panel. For each sample the expression within each of
the CD34+, Thy-, Thy+ subpopulation is shown. The gene expression profiles for
Notch1, Notch2, and Notch4 are shown. Notch3 is not shown as no gene expression
was seen in any of the NBM and CML samples. The housekeeping gene GAPDH was
used as a control to assess the quality of cDNA in each sample. The number of PCR
amplification cycles was 28. Lower left panel shows human genomic DNA (HGDNA)
which was used as a positive control for each set of oligonucleotides.
7
Relative gene expression
5 N1-CML
4 N1-NBM
0 94
CD34 + Thy+ CD34 + Thy- CD34+
Figure 3.2. Real time PCR analysis of Notch1(N1) expression on
CD34+ cell subsets from NBM and CML patients. Gene expression was
normalised to the GAPDH house keeping gene and represented as DCt values. For
each sample the mean DCt value was calculated. Comparison of gene expression
between NBM and CML samples was derived from subtraction of NBM DCt values
from CML DCt values to give a DDCt value, and relative gene expression was
calculated as 2-DDCt. Significant upregulation was observed in the CD34+ Thy+ cell
subset (P≤ 0.05). Statistical significance was calculated using Mann-Whitney test. (* =
P ≤0.05).
95
100000
*
Relative gene expression 10000
*
1000
N2 -CML
100
N2-NBM
10
0.1
CD34 + Thy+ CD34 + Thy- CD34+
Figure 3.3. Real time PCR analysis of Notch2 expression on CD34+ cell
subsets from NBM and CML patients. Gene expression was normalised to the
GAPDH house keeping gene and represented as DCt values. For each sample the mean
DCt values was calculated. Comparison of gene expression between NBM and CML
samples was derived from subtraction of NBM DCt values from CML DCt values to
give a DDCt value, and relative gene expression was calculated as 2-DDCt. Results
showed an upregulation of Notch2 in CD34+ CML cells. This upregulation was
significant in both the CD34+ Thy+ and in the total CD34+ cells (P≤ 0.05). The
expression of Notch2 in the CD34+ Thy- was very close to significance (P= 0.057).
Statistical significance was calculated using Mann-Whitney test. (* = P ≤0.05).
Thy+ Thy+
NBM9
Thy - CML1
Thy -
CD34+
CD34+
Thy+ Thy+
NBM4
CD34+ CD34+
Thy+ Thy+
NBM2
CD34+
Figure
Thy+ 3.4. Expression of Notch target genes in CD34+ populations
isolated
Thy - from NBM and CML samples . PCR reactions for HES1, HERP1, and
NBM1
Thy+
HERP2 are shown for four different normal bone marrow samples (NBM) (left panel)
CD34+
and four different CML samples (right panel). The number of PCR amplification
Thy - cycles
CML4
was 28 except for HES1 where the PCR reaction was carried out at CD34+ 32 cycles. All
samples were run in duplicates and the house keeping gene GAPDH was used to assess
the quality
HGDNAof each cDNA sample. The lower left panel shows human genomic DNA
(HGDNA) which was used as a positive 96control for each set of oligonucleotides.
1000000
*
100000
Relative gene expression
10000
**
1000
CML
100
NBM
10
0.1
0.01
CD34 + Thy+ 97 + Thy-
CD34 CD34+
Figure 3.5. Real time PCR analysis of Hes1 expression on CD34+ cell
subsets from NBM and CML patients. Gene expression was normalised to the
GAPDH house keeping gene and represented as DCt values. For each sample the mean DCt
values was calculated. Comparison of gene expression between NBM and CML samples
was derived from subtraction of NBM DCt values from CML DCt values to give a DDCt
value, and relative gene expression was calculated as 2-DDCt. Results showed an
upregulation of Hes1 in CD34+ CML cells. This upregulation was significant in both the
CD34+ Thy+ cell subset (P≤ 0.01) and in the total CD34+ cells (P≤ 0.05). The expression
of Hes1 in the CD34+ Thy- cell subset was very close to significance (P value = 0.057).
Mann-Whitney statistical test was used here to compare the difference in Hes1 expression
between CML and NBM samples. (* = P ≤0.05, ** = P ≤0.01).
The gene expression studies in section 3.2.1 showed that Notch1 and Notch2 were up-
regulated at the message level in the CD34+ Thy+ population in CML patients in
chronic phase. This finding along with the observation of elevated levels of Hes1 in
CD34+ populations including CD34+ Thy+ susbset suggested that Notch signalling
may be overactivated in CML patients. This observation raised the possibility that
98
Notch1 may be also over-expressed at the protein level. To address this question,
mononuclear cells from three CML patients in chronic phase were stained with EA1,
a monoclonal antibody produced in the Buckle lab that recognises the extracellular
domain of Notch1 (Dr. V. Portillo, personal communication, Appendix 1).
Initial FACS staining experiments demonstrated the presence of Notch1 on the cell
surface of live CD34+ population from CML patients. When FACS profiles were
compared to those in normal cord blood samples, broadly similar staining profiles
were seen. The analysis of expression of Notch1 in CML was then expanded to cover
a wide range of primitive stem cell populations, myeloid, and lymphoid committed
cells using lineage specific surface markers expressed within the CD34+
compartment. These markers were selected to demonstrate the expression of myeloid
progenitors (CD33, CD14, CD15, CD16), B-cell lymphoid progenitors (CD19), T-cell
lymphoid progenitors (CD3, CD7), and the more primitive Thy-1 (CD90)
haemopoietic stem cell marker. Another primitive cell discriminator used was CD38,
as stem cells are enriched in the CD38- subset of the CD34+ compartment.
Using multi-parameter flow cytometry, triple colour stainig was used with a CD34
monoclonal antibody, a lineage/ primitive cell marker, and the EA1 antibody included
in all tubes. All antibodies were of the IgG1 isotype. To correct for background
fluorescence in each FACS tube, a mouse IgG1 hybridoma supernatant, which was
tested to be negative for Notch1 protein (Dr. V. Portillo, personal communication),
was used as an isotype control for the EA1 antibody. Since cryopreserved CML
samples were used in the analysis, thawed cells were filtered by nylon mesh filter to
remove large clumps of dead cells. Dead cells were also excluded from the analysis
by staining cells with propidium iodide (PI) and acquiring only live cells.
FACS analysis showed that the percentage of CD34+ population varied between 7 %
and 30 % out of the total mononuclear cells in the CML samples examined here. From
this CD34+ population, 35 % (± 1.8) of cells expressed Notch1 (n=4) (Fig. 3.6).
99
There was no or little expression of B-lymphoid (CD34+ CD19+) and of the T-
lymphoid (CD34+ CD3+) progenitors but CD34+ CD7+ progenitors could be found.
Interestingly 24.5 % ± 9.6 of the CD34+ CD7+ progenitors expressed Notch1 (n=4)
(Fig. 3.7). Finally the presence of Notch1 in the very primitive haemopoietic CD34+
Thy+ and CD34+ CD38- progenitors was assessed (Figure 3.8 & Figure 3.9). The
A B
initial staining of EA1 in CD34+ Thy+ cells 4.5
showed a diagonal pattern of staining
± 2.1
IgG1 which seems non-specificEA1
and could not be corrected using the software compensation
tool during acquisition of cells before analysing the expression pattern. Therefore, the
staining was repeated with an extra step of blocking with purified mouse IgG to
prevent non-specific binding in the reaction which was successful in improving the
pattern of staining and produced well compensated FACS plots (Figure 3.9). The data
C CD14 D CD14
obtained from three CML samples showed that Notch 1 was expressed in 21.6 % of ±
9 ± 6.6
2.3 of the CD34+ Thy+ population (Figure 3.10).
Table 3.1 indicates percentages of Notch1 expression among different CD34+ cells
subsets in CML samples as compared with expression on cord blood (Cord blood data
provided by Dr. V. Portillo).
CD15
CD15
E F 0.5 ± 0.5
CD16 CD16
H 33.5 ± 19.9
G
CD33 CD33
I K 35 ± 1.8
100
CD34 CD34
Figure 3.6. Notch expression on CD34+ myeloid progenitors in
CML. Mononuclear cells from CML samples were stained with CD34, specific
myeloid lineage markers and the anti extra cellular Notch (antibody EA1).
Staining for CD34 gated cells is shown. Panels A, C, E, and G show costaining
with lineage marker and isotype control. Panels B, D, F, and H show costaining
with lineage marker and the EA1 antibody. Panel I shows costaining with CD34
and isotype control and panel K shows costaining with CD34 and EA1.IgG1
hybridoma supernatant was used as an isotype control. Data shown is from one
experiment representative of three different patient samples.
101
A B
3.6 ± 1.4
IgG1 EA1
CD3 CD3
C D
24.2 ± 9.6
CD7 CD7
E F
1.6 ± 1.6
CD34
(B)
103
CD34
Figure 3.8. CD34 gating strategy and the Notch expression in
CD34+ CD38- cell subset in CML. Mononuclear cells from CML samples
were costained with CD34 and anti Notch1 antibody (EA1).and the stem cell
markers CD34, and CD38. The first plot (A) shows the CD34 gating strategy used in
all FACS plots in this study. The expression of Notch1 in the total CD34+
population in CML is shown in the right hand plot on (A) as compared to the isotype
control IgG1 in the middle plot. Panel B shows the Notch1 expression in the
primitive CD34+ CD38- cell subset which is enriched for stem cells. The percentage
of Notch1 in the CD34+ CD38- is 15.3 ± 2.1 (n=3).
A
IgG1 EA1
104
Thy-1
Figure 3.9. The problem of EA1 non-specific binding within the
CD34+ Thy+ cell subset. The expression of Notch1 in the CD34+ Thy+
cell subset showed a nonspecific diagonal pattern of staining (panel A) before it
was corrected by including extra blocking step in the reaction (panel B). After
staining with EA1 antibody, cells were incubated with purified mouse IgG1 for
10 minutes before the addition of CD34 antibody in the final step of the reaction.
Because both EA1 and CD34 were mouse antibodies, the blocking step seems to
be necessary to prevent nonspecific binding of CD34 antibody. This approach
was repeated twice in two different CML samples.
Thy
CD34 CD34
21.6 ± 2.3
Thy Thy
IgG1 Ea1
105
Figure 3.10. The expression of Notch1 in the CD34+ Thy+ cell
subset.
Mononuclear cells from CML samples (N=3) were costained with EA1 and the
stem cell marker thy-1. The upper panel shows the gating strategy where only cells
positive for both CD34 and Thy-1 antibodies where used in the analysis of EA1
expression. The lower panel shows that Notch1 is expressed in the primitive
CD34+ thy+ population in CML. The percentage of EA1 in CD34+ Thy+ cells is
Mean
21.6 ± 2.3 (n=3). IgG1ofhybridoma
expressionsupernatant
of EA1 in wasMean ofan
used as expression of EA1 in
isotype control.
Cell subset CML (±SEM) CB (±SEM)
A study of Notch receptor genes N1-4 was carried out in four CML patients in chronic
phase in order to investigate the status of the Notch signalling pathway in CML. Since
107
CML is a disease that originates in the haemopoietic stem cell compartment, cDNA
from CD34+ cells were used in order to have data representative of the progentitor
compartment. The study of Notch signalling in CML was restricted to the chronic
phase of the disease where the only known genetic abnormality is the BCR-ABL
fusion gene. Since cells acquire several and complex genetic changes beside the BCR-
ABL fusion gene as they transform to blast crisis phase, it becomes more difficult to
interpret interactions between Notch signalling components and the BCR-ABL.
The expression pattern of the Notch receptor genes has not been studied in CML
before. The conventional PCR data showed that there was no preferential expression
of the gene in the three fractionated cell subsets studied. It appeared that the
expression of Notch1 during the chronic phase of CML can be traced at least to the
very primitive CD34+ Thy+ haemopoietic cells and the expression continues in the
less primitive CD34+ Thy- cell compartment. The highly sensitive real time PCR
approach confirmed the previous findings. Interestingly, the quantitative real time
PCR data showed an up-regulation of Notch1 in CML samples. This up-regulation
was significant in the more primitive CD34+ Thy+ cell subset in the bone marrow.
Apart from gene array expression profiling studies, expression of Notch receptor
genes has not been fully characterised before in CML. Bruchova et al (2002) used an
array technology to study the gene expression profile of hundreds of genes in the
chronic phase of CML and showed that Notch1 is down-regulated in CML
mononuclear cells. However, their findings cannot be compared with the results of
this study because of differences in sampling and techniques between the two studies.
The current study looked at Notch1 expression only in the CD34+ cell subsets in
CML including the mostly enriched stem cell CD34+ Thy+ cell subset whereas
Bruchova group sample was rather heterogeneous and included all mononuclear cells.
The finding that Notch1 is significantly up-regulated in the most primitive CD34+
Thy+ in the chronic phase of CML is interesting. This raises the possibility that Notch
signalling is involved in the survival or self-renewal of leukaemic stem cells in CML.
This possibility is supported by a recent study which demonstrated that leukaemic
stem cells in CML are dependent for their self-renewal on the Wnt pathway, a
pathway that like the Notch pathway is important for normal haemopoietic stem cell
108
-/-
survival and self-renewal. Zhao et al (2007) showed, using a conditional β-catenin
mouse, that in vivo chronic myeloid leukaemia progression is dependant on β-catenin
and that loss of β-catenin significantly reduces BCR-ABL- induced CML
development.
As for Notch2, normal bone marrow samples (NBM) showed very weak expression in
all samples when the PCR reaction was performed at 28 cycles. Interestingly, at 30
cycles, the expression of Notch2 appeared to be expressed in NBM and CML samples
with no obvious favoured expression in one of the three cell subsets studied here.
Although Notch2 was difficult to detect by conventional PCR, real time PCR data
showed clearly an up-regulation of Notch2 by more than 100 fold in all of the three
CD34+ cell subsets tested here. Although there was no obvious favoured expression
in any one of the three cell subsets, the over-expression of Notch2 was significant in
the CD34+ Thy+ and in the total CD34+ cell subset.
The transcripts of Notch3 could not be detected in normal bone marrow and CML
samples. Primer specificities and PCR reaction conditions for Notch3 were validated
by applying the same conditions on human genomic DNA and Jurkat cells (a human T
cell lymphoblast-like cell line). The results showed clear bands for Notch3 in both
genomic DNA and Jurkat cells which confirms the finding that Notch3 is absent in
CD34+ cells in both normal marrow and in CML patients in chronic phase (Data not
shown).
The presence of Notch1 and Notch2 genes on normal CD34+ haemopoietic cells is
consistent with previous reports (Milner and Bigas, 1999; Vercauteren and
109
Sutherland, 2004). Notch3 expression could not be detected in normal CD34+ cells
under the conditions described here which is consistent with the results of Singh et al.
(2000). In contrast, Vercauteren and Sutherland (2004) reported a low expression of
Notch3 transcripts in normal CD34+ cells in bone marrow from normal healthy
individuals. This discrepancy between this study results and those of Vercauteren and
Sutherland could be explained by differences in the sensitivity of primers used in the
two experiments. In addition, it could be that the Notch3 transcripts may be under the
level of detection in normal CD34+ cells in the samples studied here.
The PCR results presented here demonstrated the presence of Notch4 in some normal
CD34+ haemopoietic cell samples. This expression is in line with the findings of
others (Vercauteren and Sutherland, 2004). The current data that shows the presence
of Notch4 in normal CD34+ haemopoietic cells is interesting because Notch4 has
previously been thought to be an endothelial specific gene (Uyttendaele et al. 1996).
110
CD34+ cell subsets. Activation of Notch signalling in CML reported here can be
attributed to in vivo stimulation of Notch signalling by Notch ligands expressed on the
cell surface of stromal cells or on haemopoietic progenitors. It is also possible that
mutations in the Notch receptor genes may induce activations of Notch signalling
independent of ligand binding. However, it remains to be investigated if Notch is
mutated in chronic phase CML.
111
The use of flow cytometry in the investigation of Notch1 protein allowed the
characterisation of the expression levels of human Notch1 receptor on different
haemopoietic progenitors within the CD34+ population in CML.
Study of the expression patterns of Notch1 in CD34+ cells from cord blood samples
was performed previously by Dr. Porttilo and these data were used here as normal
control for the expression of Notch1. The flow cytometric staining results in CML
samples demonstrated the expression of Notch1 in 35 % of gated CD34+ cells
compared with only 21 % of CD34+ cells in cord blood. The presence of low
expression of Notch1 protein has been reported before in normal CD34+ cells in
normal bone marrow (Ohishi et al. 2000) and in embryonic liver (Dando et al.
20005).
Notch1 was expressed in lymphoid and myeloid haemopoietic progenitors within the
CD34+ cells in CML samples. Notch1 was also detected in the very primitive CD34+
Thy+ and CD34+ CD38- populations in CML samples. The percentage of CD34+
Thy+ cells expressing Notch1 in CML samples was 21.6 ± 2.3 (n=3) compared with
12 % ± 3 in cord blood samples. The difference in Notch1 expression between the
CD34+ Thy+ cell subset in CML and that in cord blood was not significant by the
Mann-Whitney statistical test. Because of this and because of the low number of CML
samples analysed here no conclusions could be drawn from this variation.
The expression of Notch1 was also confirmed in another stem cell enriched subset in
CML which is the CD34+ CD38- cell subset. The mean percentage of cells expressing
Notch1 in this primitive compartment was 15.3 % (n=2) compared with 15 % in
CD34+ cells in cord blood suggesting that the expression was similar between normal
and CML cells.
There were very low or undetectable numbers of CD34+ CD3+ and CD34+ CD19+
cells in the CML samples tested here which did not allow the study of Notch1 in these
two populations. This low level of expression was in correlation with the
immunophenotype of CD34+ cells in CML in chronic phase (Normann et al. 2003).
However, it is documented that these populations express Notch1 in cord blood
samples (Dr. V. Porttilo, personal communication).
112
FACS analysis showed the presence of Notch1 in CD34+ myeloid progenitors
including CD34+ CD14+ cells and CD34+ CD33+ cells. It is not clear why only
about 20% of CD34+ CD33+ myeloid cells express Notch1 in contrast to the CD34+
CD14+ cells in which most of them co-express Notch1. CD16+ cells could not be
detected whereas the total number of granulocytes (CD15+) in CML samples was
unexpectedly very low (3-5 %). It is not clear whether this is normal in cryopreserved
CML samples or whether this is an artificial event due to possible prolonged
cryopreservation or thawing and handling of CML specimens.
The data also showed the co-expression of the lymphoid marker CD7 on CD34+
CML in approximately 40% of gated CD34+ cells, a finding that has been shown to
be of prognostic importance in CML patients in chronic phase (Normann et al. 2003).
24.5 % (±9.6) of the CD34+ CD7+ cells expressed Notch1 on their surface. CD7 is
not only expressed in mature T- and natural killer (NK) cells, but it is regarded as an
early haemopietic marker (Normann et al. 2003). It has been suggested that CD34+
CD7+ cells may include very primitive stem/progenitor cells capable of
differentiating into lymphoid and myeloid lineages (Chabbanon et al. 1992).
Recently, it has been suggested that CD34+ CD7+ cells may be involved in
maintenance and clonal progression of Ph-positive cells in CML patients in chronic
phase (Kosugi et al. 2005). It can be speculated, therefore, that the expression of
Notch1 in the primitive CD34+ CD7+ population is of clinical significance.
No clear conclusions can be drawn from the study of Notch1 protein in CML samples
in terms of the presence of elevated Notch1 expression in CML. Even if Notch1
upregulation in CML at the m-RNA level did not clearly translate into increased
protein levels this does not contradict with the finding that Notch signalling is
activated in CML as assessed by Hes1 up-regulation. The activation of Notch
signalling does not necessarily occur via ligand dependant mechanisms. For instance,
Mutations in Notch1 in T-ALL render Notch1 susceptible to ligand-indpendant
cleavage at S2 site and subsequently be constitutively active regardless the fact it is
not overexpressed on the cell surface (Aster et al. 2008). Mizuno et al. (2008) have
reported that Notch1 is a common retroviral integration site in which retrovirus
integration formed a constitutively active form of Notch and accelerated leukaemia
113
development in a CML mouse model. Considering the fact Notch1 mutations have not
been examined yet in CML, such mutations may explain the hyperactivity of Notch in
CML reported in this study. Moreover, fusion oncoproteins PML/RAR and
AML1/ETO in AML have been associated with activation of Notch signalling which
may confer self-renewal properties to leukaemic stem cells in AML (Alcalay et al.
2003). It is tempting therefore to propose that BCR-ABL fusion protein may cross-
talk with Notch signalling to confer survival signals in CML.
Nonetheless, this is the first time the presence of Notch1 protein is reported in the
CD34+ population in blood samples of CML patients in chronic phase. Moreover, the
expression of Notch1 at the protein level in the CD34+ Thy+ and CD34+ CD38- cell
subsets is interesting because these populations are enriched for leukaemic stem cells
in CML.
4.1Introduction
114
The data from chapter three showed that Notch signalling, as assessed by levels of
Hes1 expression, is upregulated in CD34+ cells, including the more primitive CD34+
THY-1 + cell subset in chronic phase CML patients as compared to CD34+ cells from
normal donors. Activation of the Notch pathway has been shown to confer cell
survival properties on normal haemopoietic stem cells (Stier et al. 2002; and Carlesso
et al. 1999) and this raises the possibility that leukaemic stem cells (LSCs) in chronic
phase CML may benefit from activated Notch signalling conferring survival signals.
It has been found that inhibition of BCR-ABL alone by imatinib mesylate (IM) does
not result in loss of self renewal capacity or cell death within the primitive CD34+
CD38- cell compartment in chronic phase CML in vitro (Copland et al. 2006). This
has led some researchers to propose a model which suggests that BCR-ABL requires
cooperating genetic events at the stem and/or progenitor level to establish a Ph+
leukaemia (Burchert et al. 2007). Recently, Mizuno et al. (2008) have demonstrated
that overexpression or enhanced kinase activity of BCR/ABL and altered expression
of Notch1 synergises to induce acute leukemia in a transgenic model for CML. This
finding and previous genetic interaction evidence of ABL and Notch synergism in
Drosophila development (Giniger, 1998; and Crowner et al. 2003) may justify the
need to investigate the hypothesis of possible cross-talk between BCR-ABL and
Notch in CML.
A range of model systems including cell lines derived from leukaemia patients and
animals engineered to express BCR-ABL have been used in the past to study the
molecular interactions between BCR-ABL and other signalling pathways (Ren, 2005).
In this project leukaemic cell lines will be investigated as possible candidate models
to explore the proposed interaction of BCR-ABL and Notch signalling in human CML
cells. A good candidate model for the study of BCR-ABL and Notch cross-talk should
fulfill the basic criteria of having an intact BCR-ABL and Notch components, and to
have a demonstrable response to Notch and BCR-ABL pathways modulators. CML
cell lines present a suitable model system in which to investigate the molecular
mechanisms underlying signalling pathways involved in the pathogenesis of CML and
to identify potential therapeutic targets. In fact, much of our understanding of the
115
basic biology of CML comes from studies that have used BCR-ABL+ cell lines. One
draw back is that all the available CML cell lines are derived from the blastic phase of
the disease and, thus, contain genetic lesions in addition to BCR-ABL. The K562 line
has been used in the cloning and analysis of the t(9;22)(q34;q11) breakpoints which
involve the genes ABL and BCR (Drexler et al. 1999). In addition, many of the
signalling pathways downstream of BCR-ABL and the proteins that interact with
BCR-ABL were identified in BCR-ABL+ cell lines (Ren, 2005). An important
advantage of the CML cell lines is that most of them remain dependent on BCR-ABL
tyrosine kinase activity for their proliferation and survival, as shown by their
susceptibility to the effects of BCR-ABL inhibitors (Deininger et al. 2000). This is a
very useful criterion of the BCR-ABL+ cell lines as in vitro model systems in which
the BCR-ABL tyrosine kinase activity can be turned off with imatinib to study
activity of other signalling pathways.
Due to its specificity and stability, the expression of P-crkl has been accepted as a
reliable method to assess BCR-ABL status and have proved to be a vital practical
method for evaluating the effect of imatinib treatment on BCR-ABL kinase activity in
CML cell lines and in primary CML cells (Gorre et al. 2001; and Singer et al. 2006).
In all of the studies cited so far Western blotting was used as a method to assess P-
crkl expression in BCR-ABL expressing cell lines and primary CML cells. However,
this approach is time consuming and requires large number of cells which may not be
116
achievable in the more primitive cell populations in primary CML cells. The recent
availability of phosphorylation-specific antibody that detects only phosphorylated crkl
in BCR-ABL + cells has made it possible to use flow cytometry instead of Western
blotting to measure P-crkl levels in CML cells (Wetzel et al. 2005). However, this
approach has only been used by two groups to date. The P-crkl flow cytometry based
assay therefore will be validated in this chapter with a view to its use as a tool for the
assessment of BCR-ABL activity in the context of BCR-ABL and Notch cross-talk.
Upregulation of the Notch target gene Hes1 has been shown to occur as a result of
Notch activation and association with the transcription factor RBP-Jk (Jarriault et al..
1995). Since then the expression of Hes1 has been widely used and accepted as an
indicator of Notch activity (Kageyama et al. 2000). Hes1expression therefore will be
used in this project to assess Notch signalling in cell lines as well as in primary cells.
4.2 Results
4.2.1 Validation of the P-crkl intracellular FACS assay in K562 cells
117
The ability to detect phosphotyrosine proteins in BCR-ABL+ cell lines by flow
cytometry was first published by Desplat et al. (2004). The authors used a
Phosphotyrosine (p-tyr) monoclonal antibody to analyse by FACS the intracellular
level of the tyrosine hyperphosphorylation of cellular proteins induced by BCR-ABL
in BCR-ABL+ cell lines. This approach was further improved by the availability of a
monoclonal antibody which specifically recognises phosphorylated crkl, a nuclear
adaptor protein and a substrate of BCR-ABL that is constitutively phosphorylated in
CML. P-crkl expression levels have been accepted as a surrogate assay to assess the
constitutive BCR-ABL tyrosine kinase activity in BCR-ABL+ cells. At the time of
this project two groups had attempted, with different protocols, to analyse P-crkl
expression in BCR-ABL+ cells by flow cytometry (Wetzel et al. 2005; and Hamilton
et al. 2006). To use the FACS based P-crkl assay as a method for the assessment of
BCR-ABL activity in this project, it was essential to validate the assay and optimise
its parameters and controls.
The K562 cell line is a CML-derived leukemia cell line, established in 1970 from the
pleural effusion of a 53-year-old woman with CML in myeloid blast crisis (Drexler et
al. 1999). K562 cells were used as a positive control and as a model to validate the
various staining steps and conditions of the intracellular FACS staining of P-crkl. This
is because K562 cells are BCR-ABL+ and have been shown to have high levels of
phosphorylated crkl (Hoeve et al. 1994). To control for non specific binding a rabbit
IgG polyclonal antibody at equivalent concentration of the P-crkl antibody was used
as an isotype control in each experiment. To stain for P-crkl in K562 cells the cells
were re-suspended in 100 µl of fixative (Fix and Perm kit, Caltag, UK) for 15 minutes
and washed next with 3 ml of HBSS (5% FBS) before being incubated for 40 minutes
with 25 µl permeabilising reagent and the primary anti-P-crkl antibody (New England
Biolabs (UK) Ltd, Hitchin, UK).Cells were then washed twice and incubated for 40
minutes with a PE conjugated anti rabbit secondary antibody (BD, UK). The wash
step was repeated twice and the cells were analysed by flow cytometry. Parallel
intracellular staining experiments were also performed in K562 cells to investigate the
effect of critical staining conditions such as fixation, secondary antibody background
signal, and optimal concentration for primary antibody. The data showed that fixation
and permeabilisation of K562 cells alone without antibody staining showed higher
background fluorescence signal than that of unfixed cells (Fig. 4.1). K562 cells
118
stained with the P-crkl antibody and the PE conjugated anti rabbit secondary antibody
(BD) showed a distinct fluorescence signal that was clearly distinguishable from the
isotype control signal. Interestingly, the staining of K562 cells with only the
secondary antibody showed a low background signal as compared with the isotype
control. In another experiment the P-crkl antibody was titrated to determine the lowest
concentration at which the antibody can be used. This showed that the P-crkl antibody
can be still used at 1:40 dilution without obvious loss of fluorescence signal intensity
as compared to 1:10 dilution recommended by the manufacturer (Fig 4.1).
Selection of the best secondary antibody can improve immunostaining and reduce
false positive or negative staining. Therefore, the specificity and fluorescence
intensity of four commercial anti rabbit secondary antibodies in the P-crkl assay was
investigated. K562 cells were fixed and permeabilised as described above. Cells were
then stained with P-crkl primary antibody diluted 1:40 and then stained with one of
the following secondary antibodies: PE F(ab')2 Donkey anti-Rabbit IgG (BD), PE
polyclonal donkey anti-rabbit antibody (Abcam), FITC monoclonal mouse anti-rabbit
antibody (Sigma), FITC polyclonal goat anti-rabbit antibody (Caltag) (Fig. 4.2). The
FACS analysis showed that the PE conjugated secondary antibody from BD was
superior to the Abcam antibody in terms of specificity and signal intensity. The
Abcam PE secondary antibody showed little P-crkl expression in K562 cells and this
expression was less specific as demonstrated by the overlap between the fluorescence
peak of the P-crkl stained cells and that of the isotype control. K562 cells stained with
P-crkl and the Sigma FITC secondary antibody showed a staining pattern similar to
that of the BD PE secondary antibody in terms of specificity. However, the
fluorescence signal was lower than that observed with the BD PE secondary antibody.
In contrast, K562 cells stained with P-crkl and the Caltag FITC secondary antibody
showed very strong fluorescence signal but with low specificity as compared with the
Sigma FITC secondary antibody (Fig 4.2). The staining patterns of the previous
secondary antibodies showed clearly that only the BD PE and Sigma FITC secondary
antibodies are suitable to be used in the FACS based P-crkl assay with the advantage
of the former in terms of fluorescence signal intensity. It can bee seen from previous
data that the optimum staining conditions were obtained with the primary P-crkl
antibody at 1:40 dilution (2.25 µg/ ml) and with the use of the BD PE secondary
antibody. As for fixation and peremeabilisation methods, several kits were evaluated
119
including Caltag fix and perm kit, BD Cytofix/ Cytoperm kit (cat. No 554722). In
addition, different fixing times and temperatures and other permeabilisation methods
were attempted such as cold 90% methanol for 30 minutes on ice. There was no
obvious difference between all these fixation and permeabilisation methods in terms
of P-crkl expression in K562 cells (data not shown). Therefore, an optimised staining
protocol was used in all P-crkl assay experiments performed in this chapter which
involves the use of the Caltag fix & perm kit followed by probing with primary P-crkl
antibody at 1:40 dilution and then staining with BD PE secondary antibody.
C
•Unstained
•Isotype control
•1:10 dilution
•1:20 dilution
•1:40
120 dilution
Fig 4.1. Validation of P-crkl intracellular flow cytometry assay in K562
cells. Critical staining conditions in the P-crkl intracellular staining were
validated in K562 cells. (A) FACS analysis of the effect of fixation on
background staining for P-crkl in K562 cells. Background staining on
unfixed-unstained cells is shown in blue, and on fixed-unstained cells in
green. P-crkl expression as determined after fixation is shown in red. (B)
A B
Analysis of effect of secondary antibody staining in P-crkl assay.
Background staining on unfixed-unstained cells is shown in blue, and on
BD PE
fixed cells stained only with PE anti rabbit secondary Abcam
antibodyPEin ligh blue.
Fixed cells stained with rabbit IgG (isotype control) and the secondary
antibody are shown in green and P-crkl expression is shown in red. (C)
Titration of the primary P-crkl antibody. Cells were fixed and stained with
different dilutions of the primary P-crkl antibody (red, green, and light blue
histograms). Unstained-unfixed cells and isotype control (in concentration
equivalent to the primary antibody dilution) are shown in blue and purple
PE respectively. PE
C D
Sigma FITC Caltag FITC
121
FITC FITC
A
Unstained K562
Isotype control
P-crkl PE
Fig 4.2. Comparison of four commercial anti rabbit secondary antibodies used
in the P-crkl assay. K562 cells were fixed, permeabilised and stained with P-crkl
primary antibody diluted 1:40 and then stained with: (A) PE polyclonal donkey anti-
rabbit antibody (BD) (B) PE polyclonal donkey anti-rabbit antibody (Abcam) (C)
FITC monoclonal mouse anti-rabbit antibody (Sigma) (D) FITC polyclonal goat
anti-rabbit antibody (Caltag). In each panel the P-crkl staining patterns of the
PE
secondary antibodies is shown in pink. Staining signals of unstained cells and cells
B stained with the isotype control are shown in blue and green respectively.
Unstained K562
Isotype control
P-crkl PE
PE
C
Unstained K562
Isotype control
P-crkl PE
122
PE
Fig. 4.3. The effect of cell passage number on the expression
of P-crkl in K562 cell line. K562 cells were taken out from
liquid nitrogen and maintained in culture for 12 weeks. Cells were
passaged every 3-4 days and P-crkl expression was assessed by
flow cytometry every two weeks. (A) FACS staining of P-crkl in
K562 cells kept between 2-8 weeks in culture (passage 4-16). (B)
FACS staining of P-crkl in K562 cells in week 10 (passage 20).
(C) FACS staining of P-crkl in K562 cells passaged for more than
12 weeks (> 24 Passages). In each panel unstained k562 cells are
shown in blue, isotype control in green, and k562 cells stained
with PE conjugated P-crkl antibody in red.
4.2.3
Following the establishment of the optimal staining conditions and the appropriate
controls for the P-crkl flow cytometry assay in K562 cells the P-crkl expression was
investigated in three other leukaemic cell lines: the BCR-ABL+ NALM-1, the ABL
activated SIL-ALL, and the BCR-ABL negative JURKAT cell lines.
The NALM-1 cells are BCR-ABL+ cells which were established from the blastic
phase of a CML patient. Phenotypically the NALM-1 cells express the lymphoid
markers CD19, CD20 and the plasma cell marker CD138 (Wetzel et al. 2005). This
CML cell line may offer an additional in vitro model for the study of BCR-ABL and
Notch cross-talk if both BCR-ABL and Notch activity were confirmed. Therefore,
123
BCR-ABL activity was assessed in NALM-1 cells by the P-crkl assay. However, crkl
phosphorylation could not be detected in NALM-1 cells when these cells were
intracellularly stained with P-crkl antibody and the BD PE conjugated secondary
antibody (Fig. 4.4). The P-crkl assay was repeated three times with the same finding.
The SIL-ALL cells (also known as ALL-SIL) were established from a T cell Acute
Lymphoblastic Leukaemia (T-ALL) patient. The SIL-ALL cells express the novel
NUP214-ABL1 fusion gene with hyper ABL kinase activity. In addition, these cells
have Notch1 activating mutations which result in constitutive active Notch signalling
(Quinta´s-Cardama et al. 2008). The reported activation of both ABL and Notch
signalling pathways in SIL-ALL cell line makes it a possible in vitro model for the
study of the cross-talk of ABL and Notch. Therefore, the P-crkl expression was
assessed in the SIL-ALL cells. SIL-ALL cells were intracellularly stained with P-crkl
antibody as decribed above before being analysed by flow cytometry. Results showed
the expression of P-crkl in SIL-ALL cells in three separate experiments (Fig.4.4).
This expression was lower than the P-crkl expression in K562 cells.
Finally it was important to confirm the specificity of the P-crkl assay in a BCR-ABL
negative cell line. The Jurkat cells were assessed for P-crkl expression by the P-crkl
assay and results showed the absence of phosphorylated crkl in theses cells (Fig. 4.4)
This finding further confirms the specificity of P-crkl assay in detecting crkl
phosphorylation in BCR-ABL+ or ABL+ cells.
A K562 B NALM-1
C SIL-ALL D JURKAT
124
PE
Fig 4.4. Assessment of P-crkl expression in four leukaemic cell lines. The expression
of P-crkl protein as assessed by flow cytometry is shown for the BCR-ABL positive cell
line K562 (A), nalm-1 (B), the ABL positive cell line ALL-SIL (C) and the BCR-ABL
negative cell line Jurkat (D). In all experiment the BD PE conjugated secondary antibody
was used with an isotype control (in green) and P-crkl antibody (in red). The filled
histogram in dark blue represent the background signal of unstained cells.
Imatinib mesylate (IM) has been developed as a potent inhibitor of the ABL protein
tyrosine kinases (Holtz et al. 2002). In the past, the inhibitory effect of IM on BCR-
ABL kinase activity has been demonstrated as a reduction of P-crkl expression
detected by western blotting (Chu et al. 2004). Expression of P-crkl following IM
treatment has also been investigated recently by flow cytometry in K562 cells
(Hamilton et al. 2006). In order to validate IM as a BCR-ABL inhibitor in the context
of ABL and Notch cross-talk the effect of IM was investigated in K562 cells by the
FACS based P-crkl assay using the same P-crkl assay parameters which have been
established earlier in this chapter. K562 cells were cultured in decreasing
concentrations of IM (10, 5, 1, 0.5, and 0.1 µM) for 48 h before being assayed for the
125
expression of P-Crkl by FACS as described above. Treated cells showed dose
dependent inhibition of P-crkl expression as compared to untreated cells (Fig 4.5-a).
The reduction of crkl phosphorylation post IM can be seen as a shift to the left of the
fluorescence histogram to the fluorescence channel of the isotype control. The
reduction of P-crkl post IM exposure was also shown as a reduction of the mean
fluorescence intensity (MFI). The MFI was calculated for treated cells and for the no
drug control cells as relative MFI to the isotype control in each condition in order to
accurately determine the specific fluorescence signal in the reaction. The MFI of IM
treated cells was then compared with the MFI of the no drug control cells (Fig. 4.5-b).
This result was confirmed in another two experiments with similar outcomes.
To confirm the specificity of the P-crkl antibody in the FACS-based P-crkl assay, the
effect of IM on P-crkL was also assessed by Western blot on K562 cells. K562 cells
were cultured in the presence or absence of IM for 48 h. Western blot was performed
as described in materials and methods with the same specific anti-P-crkl primary
antibody (1:1000) (New England Biolabs) and an anti-rabbit IgG, horseradish
peroxidase-linked secondary antibody (1:2000) (New England Biolabs). The
A-1 A-2
membranes were then stripped in 1 X Stripping Solution (Thermo scientific) for 15
min at RT and re-probed with anti actin antibody (1:1000) (New England Biolabs) in
10µM 5 µM
5% BSA/phosphate buffered saline with BSA, to confirm equal sample loading.
Results were similar to those obtained with the FACS based P-crkl assay and a dose
dependent reduction of P-crkl expression was observed post 48h treatment with IM
(Fig. 4.6).
A-3 A-4
1 µM 0.5 µM
A-5
0.1 µM
126
PE
Fig. 4.5-a. Assessment of imatinib mesylate (IM) efficacy in K562 cells using a
flow based P-crkl assay. K562 cells cultured in decreasing concentrations of IM
(10, 5, 1, 0.5, and 0.1µM) for 48 h were assayed for the expression of P-Crkl by
FACS (A1-5) P-crkl expression in cells treated with imatinib mesylate is shown in
green and in untreated cells in red. The histograms in purple represent the isotype
control in each experiment. Data shown is from one experiment representative of
three separate experiments (n=3).
110
Mean flourescence intensity
100
90
80
70
60
50
40
30
20
10
0
0 0.1 0.5 1 5 10
127
IM (µM)
Fig. 4.5-b. Dose dependant effect of imatinib mesylate (IM) on the expression of
P-crkl in k562 cells post 48h. P-crkl expression of (IM) treated and untreated K562
cells represented as mean flourescence intensity (MFI). MFI presented here was
measured by subtracting the MFI of treated or untreated cells from the MFI of the
isotype control in each condition. Dose of IM is plotted in X axis and MFI of IM
treated cells relative to MFI of no drug control cells in Y axis. Data shown is from one
experiment representative of three separate experiments (n=3).
K562 Jurkat
0.1 µM IM
0 µM IM
0.5 µM IM
10 µM IM
5 µM IM
5 µM IM
0 µM IM
1 µM IM
P-crkl
Actin 128
Fig. 4.6. Effect of concentration of imatinib mesylates (IM) on P-crkl protein
levels. K562 and Jurkat cells cultured in decreasing concentrations of IM (10, 5, 1,
0.5, and 0.1µM) for 48 h were harvested for analysis of P-Crkl protein levels by
western blot (upper panel). The blot was reprobed with an anti-pan-actin antibody to
compare sample loading (lower panel).
The well preserved BCR-ABL kinase activity in K562 cells offers an opportunity to
investigate possible interaction between BCR-ABL and other signalling pathways.
This cell line may present a good in vitro model system to study the possible cross-
talk between BCR-ABL and Notch if the Notch signalling components were proven to
be intact. Therefore, Notch signalling was investigated in K562 cells at the mRNA
and protein levels in order to evaluate the activity of Notch in these blast phase CML
cells.
The semi-quantitative RT-PCR was performed in cDNA prepared from K562 cells
and this showed clearly the expression of Notch1 (Fig. 4.7). However, the Notch
target gene Hes1 could not be detected even after increasing the number of PCR
129
amplification cycles to 32 cycles. CEM cells were used as a positive control since
they represent a cell line with markedly enhanced Notch-1 levels (Weng et al. 2004).
Next, Notch1 receptor protein expression was investigated by flow cytometry. FACS
analysis showed that the extra cellular domain of Notch1 (ECN1) was partially
expressed as detected by the EA1 antibody which specifically detects the ECN1 (Fig.
4.8). To investigate the intracellular domain of Notch1 (ICN1) K562 cells were fixed
and permeabilised before being stained with the b-tan20 antibody. FACS ananlysis
showed that the ICN1 was highly expressed in K562 cells (Fig. 4.8).
K562 CEM
Notch1
Hes1
BCR-ABL 130
Fig. 4.7 Expression of Notch1 and Hes1 genes in K562 cell line. cDNA was
prepared from K562 cells, and from a cell line known to have active Notch
signalling (CEM). Transcript levels were measured by RT-PCR. RTPCR products
were resolved by agarose gel electrophoresis and visualised by vistra green.
Duplicate RT-PCR data is shown for the expression of Notch1 and Hes1 in K562
cells (upper two panels). The lower panel shows BCR-ABL expression in K562
cells. Data shown is from one experiment representative of three independent
experiments (n=3). The number of PCR amplification cycles was 32 for all three
genes.
1% ± 0.1
< 1% ± 0.05
EA1 FITC
IgG1 FITC
Fig. 4.8. FACS analysis of Notch1 expression in K562 cells. K562 cells were
stained with EA1 antibody which detectes the extracellular domain of Notch1
(ECN1) and the protein expression was analysed by FACS (upper right panel).
K562 cells subjected to fixation and permeabilisation, then b-tan
stained 20
with b-tan
FITC
IgG1 FITC
20 antibody which recognise the intracellular domain of Notch1 (ICN1) are
shown in the lower right panel. Appropriate isotype controls were used in each
staining (upper and lower left panels). Data shown is from one experiment
representative of three separate experiments (n=3). The mean percentage of
cells positive for each staining with the associated standard error of the mean is
shown in each panel 131
4.2.6 Constitutive expression of Notch1 ΔE in K562 cells
Since Notch activation in K562 cells was not evident as assessed by the expression of
Hes1 by conventional PCR, a gain of function approach was needed to further
investigate the cross-talk of Notch and BCR-ABL in K562 cells. Therefore, it was
decided to establish a K562 cells that are stably transfected with Notch1ΔE plasmid.
This gain of function approach was used before to constitutively activate Notch
signalling in cell lines (Chadwick et al. 2008). Unlike the intra cellular Notch1
domain (ICN1), Notch1ΔE construct have a membrane tether region upstream of the
start of the ICN region and is constitutively activated by gamma secretase, which
enables the use of GSI to inhibit Notch activity.
The inhibitable Notch1ΔE used here was previously cloned into transfection vectors
and tested by Dr Nicholas Chadwick (Faculty of Life Sciences, University of
Manchester). In order to establish a stable source of K562 cells with hyperactive
Notch activity, K562 cells were retroviral transfected with either the Notch1ΔE or the
empty vector pMX and maintained in culture for weeks in order to use these cells in
future Notch and BCR-ABL cross-talk studies. However, the number of K562 cells
transfected with Notch1ΔE showed a steady decrease in culture when monitored
every 48-72h by GFP expression by flow cytometry. To see whether the constitutive
expression of Notch affected the survival of K562 cells, GSI was added at 10 µM to
both the K562 cells that were transfected with Notch1ΔE and to the K562 cells that
were transduced with the empty pMX vector. Cell survival in the culture was then
monitored for both conditions every week by counting the live cells using GFP
132
expression and FACS analysis. Results demonstrated that the GSI rescue the
Notch1ΔE transfected cells from being lost in culture as compared to K562 cells
transfected with the empty vector (Fig. 4.9).
68 % 70%
N1ΔE N1 ΔE + GSI
32 % 47 %
GFP
GFP
Fig. 4.9. Constitutive expression of N1ΔE in K562 cells. K562 cells were
transfected with either N1ΔE or the Pmx empty vector and kept in culture for three
weeks in the absence (left panel) or presence (right panel) of gamma secretase
inhibitor (GSI). Cell survival in the culture was monitored every week by GFP
expression and shown as the percentage of gated live cells in each condition.
133
4.2.7 The effect of Valproic acid on BCR-ABL and Notch signalling
in K562 cells
The last approach failed to produce cells with hyperactive Notch signalling that can
be maintained in culture for long periods or can be frozen for future experiments.
Therefore, the search continued for another approach to activate Notch in K562 cells.
Until now no small-molecule activators of Notch-1 signaling in haemopoietic cells
have been described. However, it has been shown recently that Valproic acid (VPA)
treatment of human gastrointestinal and pulmonary carcinoid tumor cell lines resulted
in Notch-1 signaling activation which was associated with increase in the expression
of both full-length Notch-1 and the active Notch-1 intracellular domain (NICD)
(Greenblatt et al. 2008). In addition, VPA treatment activates Notch1 signaling in
Small cell lung cancer (SCLC) cells and inhibits proliferation in SCLC cells (Platta et
al. 2008). Similar Notch activation effect was described in neuroblastoma cell lines in
which VPA treatment led to activation of Notch signalling as shown by increased
levels of intracellular Notch-1 and Hes-1 protein expression (Stockhausen et al.
2005).
In all of the previous tumors Notch activity was observed only at baseline levels or as
transient up-regulation of Hes1 and treatment with VPA, which is a well-established
histone deacetylase (HDAC) inhibitor, resulted in activation of Notch signalling.
Since Notch signalling was shown to be reduced in the blastic phase of CML as
compared to the chronic phase of the disease (Sengupta et al. 2007) and that K562
134
cells were established from the blastic phase of CML It was hypothesized that VPA
may activate Notch signalling in K562 cells.
To investigate whether treatment of K562 cells with VPA can activate Notch
signalling or not, K562 cells were cultured in the presence or absence of 4 mM VPA
for 72h and the gene expression of Hes1 was measured by real time PCR. Results
showed a significant down-regulation of Hes1, an effect similar to that of GSI (Fig.
4.10). This finding was confirmed in three different experiments.
1.2
Relative gene expression
0.8 Control
0.6
+ VPA
0.4
0.2
*
0
Fig. 4.10 Hes1 expression in K562 cells post valproic acid (VPA) tratment.
K562 cells were treated with 4mM VPA for 72h and the gene expression of Hes1
was measured by real time PCR. Gene expression was normalised to the GAPDH
house keeping gene and represented as DCt values. Comparison of gene
expression between treated (red bar) and untreated cells (blue bar) was derived
from subtraction of untreated K562 cells DCt values from treated K562 cells DCt
values to give a DDCt value, and relative gene expression was calculated as 2-
DDCt. The result shown here is from one experiment representative of three
different experiments (n=3). Statistical significance was calculated using student t-
135
test. (* = P ≤0.05).
Next the effect of VPA induced inhibition of Notch was examined on the BCR-ABL
activity in K562 cells. To investigate this K562 cells were cultured with or without 4
mM VPA for 72h and the P-crkl assay was performed to assess the BCR-ABL activity
following VPA treatment. FACS analysis showed an increase in P-crkl expression as
compared with P-crkl levels in untreated cells (Fig. 4.11). This result was reproduced
in three separate experiments.
To find if VPA effect on Notch signalling was associated with any effect on the
differentiation of the erythroleukaemic K562 cells the erythroid differentiation was
evaluated on K562 cells following exposure to VPA. K562 cells were cultured with or
without 4 mM VPA for 72h and the cells were then incubated with FITC conjugated
glycophorin A (GPA) as a marker of erythroid differentiation for 30 minutes at RT.
Cells where then washed with 3 ml of HBSS (5% FBS) before being analysed by flow
cytometry. Appropriate isotype control was included in the experiment to control for
non specific binding. Results showed that treatment of K562 cells with VPA for 72h
markedly decreased the expression of GPA (Fig 4.12). This effect was confirmed in
three independent experiments
136
Isotype control
Untreated cells
VPA treated
P-crkl (PE)
Fig. 4.11. Effect of Valproic acid (VPA) on BCR-ABL activity in K562 cells.
K562 cells were treated with 4mM VPA for 72h and the activity of BCR-ABL
was assessed by FACS analysis of P-crkl expression (green). P-crkl expression
of untreated cells and background flourescence of isotype control are shown in
red and blue respectively. The data shown is from one experiment representative
of three independent experiments (n=3).
137
A
49% 29%
B
Isotype control
VPA treated
Untreated
Glycophorin-A (FITC)
Fig. 4.12. Effect of Valproic acid (VPA) on erythroid diffrentiation in K562 cells.
K562 cells were treated with 4mM VPA for 72h and the expression of glycophorin-A
(GPA) was analysed by FACS. An appropriate isotype control (first plot in A) was
utilised to only include positive cells for GPA among untreated cells (middle plot in A)
and treated cells (last plot in A) . Fluorescence intensity of GPA from the same
conditions in (A) is represented in histogram format in (B). Data is from one experiment
representative of three independent experiments (n=3).
138
was reproducible in three separate experiments. This data suggests that Notch
signalling is active in K562 cells and that these cells may therefore be a suitable
model for investigating cross talk with BCR-ABL.
139
1.2
0.8
Control
0.6
+ GSI
0.4
0.2
**
Results from this chapter suggest that the BCR-ABL+ K562 cells may offer an in
vitro model system to investigate the cross-talk between BCR-ABL and Notch.
Beside the constitutive activity of BCR-ABL in K562 cells which can be inhibited by
imatinib the K562 cells express the Notch target genes Hes1 at levels that can be
inhibited by the Notch inhibitor GSI. Therefore the possible interaction between
BCR-ABL and Notch in CML can be investigated by using inhibitors of either
pathway before looking at changes in downstream target gene or protein expression.
In order to avoid possible loss of BCR-ABL activity in culture only K562 cells with
less than 12 passages were used in all K562 experiments.
140
4.2.9.1 The effect of imatinib induced BCR-ABL inhibition on Notch
signalling in K562 cells
K562 cells were cultured in the presence or absence of 10 µM imatinib for 48h.
Following the confirmation of P-crkl inhibition in K562 cells by flow cytometry the
RNA was extracted and the cDNA was prepared using the High Capacity cDNA
Archive Kit (Applied Biosystems). Results showed that Hes1 was upregulated in
K562 cells after 48h treatment with 10 µM imatinib (Fig 4.14). This up-regulation
was significant in three different experiments (P≤ 0.01).
141
1.8
** Control
1.6
+ IM
Relative gene expression
1.4
1.2
1
0.8
0.6
0.4
0.2 142
0
Fig. 4.14. Expression of Hes1 in K562 cells post 48h treatment of imatinib mesylate
(IM). Real time PCR of the Notch target gene Hes1 in K562 cells after 48h treatment
with 10 µM imatinib mesylate (IM). Gene expression was normalised to the GAPDH
house keeping gene and represented as DCt values. Comparison of gene expression
between treated (red bar) and untreated cells (blue bar) was derived from subtraction of
untreated K562 cells DCt values from treated SIL cells DCt values to give a DDCt
value, and relative gene expression was calculated as 2-DDCt. The result shown here is
from one experiment representative of three different experiments (n=3). Statistical
significance was calculated using student t-test. (** = P≤ 0.01).
•Isotype control
•Untreated
•+ GSI
143
P- crkl PE
Fig. 4.15. The effect of Notch inhibition on BCR-ABL activity in K562 cells. K562
cells were cultured for 24h in the presence or absence of gamma secretase inhibitor (GSI)
and BCR-ABL activity was assessed by P-crkl assay. P-crkl expression for cells treated
with 10 µM GSI for 24h is shown in red. P-crkl expression of untreated cells and
background flourescence of isotype control are shown in green and blue respectively. The
data shown is from one experiment representative of three independent experiments (n=3).
The reported activity of ABL and Notch signalling in ALL-SIL cell line makes it a
further possible in vitro model for the study of the cross-talk of ABL and Notch. The
FACS based P-ckrl assay showed the expression of P-crkl as a marker for the ABL
kinase activity in ALL-SIL cells. To see if the ABL activity can be switched off by
the ABL inhibitor imatinib mesylate (IM) and to ask whether the P-crkl assay can be
utilised as an IM sensitivity assay the effect of IM was investigated on ALL-SIL cells
by P-crkl assay. ALL-SIL cells were cultured in the presence or absence of 10 µM
imatinib mesylate (IM) for 48h. The cells were then stained with P-crkl primary
antibody and PE secondary antibody (BD) as described above. K562 cells were used
in this experiment as a positive control for the P-crkl assay and for the efficacy of IM.
Results showed that ABL kinase is active in ALL-SIL cells and this activity is evident
144
by the phosphorylation of crkl in the absence of IM (Fig 4.16). Treatment of ALL-SIL
cells with IM resulted in clear reduction of P-crkl expression to levels equivalent to
those of the isotype control. This experiment was repeated three times with similar
results.
The finding that ABL is active in ALL-SIL cells and that this activity can be switched
off by IM made it possible to investigate the effect of ABL inhibition on Notch
signalling in ALL-SIL cells. To assess Notch activity in ALL-SIL cells following
ABL inhibition with IM the expression of the Notch target gene Hes1 was
investigated by real time PCR. ALL-SIL cells were cultured in the presence or
absence of 10 µM imatinib for 48h and then one aliquot of the cells from each
condition was harvested to perform the FACS based P-crkl assay and the other aliquot
was used for RNA extraction. Following the confirmation of P-crkl inhibition in
ALL-SIL cells by flow cytometry the RNA from same experiment was reverse
transcribed and cDNA was prepared using the High Capacity cDNA Archive Kit
A
(Applied Biosystems). Results showed that Hes1 was upregulated in ALL-SIL cells
after 48h treatment with 10 µM imatinib (Fig 4.17). This up-regulation was
P-crkl untreated
significant in three different experiments (P≤ 0.05).
Isotype
P-crkl IM treated
Isotype
P-crkl-untreated
IM treated
145
Fig. 4.16. Evaluation of the ALL-SIL cell line as a model for ABL-
Notch cross-talk. FACS analysis of P-crkl levels in the ALL-SIL cell
line. ALL-SIL cells stained with P-crkl primary antibody and PE
secondary antibody (BD) (in red) and isotype control (in blue) (A).
Expression of P-Crkl in ALL-SIL cells after incubating the cells for
48h with 10 µM imatinib mesylate (IM) is shown in green and isotype
control in blue (B) . P-crkl expression of IM treated cells is shown in
green as compared to untreated cells in red (C). The data shown is from
one experiment representative of three independent experiments (n=3).
18
Relative gene expression
16 *
14 Control
12 + IM
10
8
6
4
2
0 146
Fig. 4.17. Expression of Hes1 in ALL-SIL cells post 48h treatment of imatinib
mesylate (IM). Real time PCR of the Notch target gene Hes1 in ALL-SIL cells
after 48h treatment with 10 µM imatinib mesylate (IM). Gene expression was
normalised to the GAPDH house keeping gene and represented as DCt values.
Comparison of gene expression between treated (red bar) and untreated cells (blue
bar) was derived from subtraction of untreated SIL cells DCt values from treated
SIL cells DCt values to give a DDCt value, and relative gene expression was
calculated as 2-DDCt. The result shown here is from one experiment
representative of three different experiments (n=3). Statistical significance was
calculated using student t-test. (* = P ≤0.05).
4.3 Discussion
4.3.1 The FACS based P-crkl assay as a surrogate assay for ABL
kinase activity
Data from this chapter showed that the P-crkl assay is a fast and reliable method to
assess the ABL kinase activity and response to imatinib (IM) in cell line models.
Certain technical aspects of the assay, however, may affect the interpretation of the
data and need to be addressed. For example it was evident that the choice of the
appropriate isotype control was critical for obtaining the right levels of P-crkl
expression and that the use of secondary antibody alone as a substitute of the rabbit
IgG isotype control may yield false increase in the P-crkl expression in the tested
cells. The well established method of analyzing levels of phosphorylated proteins by
flow cytometry is by subtracting the mean fluorescence intensity (MFI) of the
147
phospho antibody–labeled sample from the MFI of the corresponding isotypic control
(Desplat et al. 2004). Therefore, using secondary antibody as a negative control
would result in a lower MFI as compared to the MFI of the IgG isotype control and
this incorrectly would results in higher estimation of the P-crkl content in the P-crkl
labeled sample.
The P-crkl validation experiments performed here suggest that the BD PE F(ab')2 anti
rabbit secondary antibody is superior to other secondary antibodies tested in K562
cells in terms of fluorescence intensity and specificity. This was the only antibody
among the others tested here which was recommended by the manufacturer for
intracellular flow cytometric staining. The Fc-mediated non-specific binding of this
antibody to Fc receptor-bearing cells was reduced by removing the whole IgG and Fc
fragments which resulted in more specific binding to the P-crkl primary antibody.
The Sigma FITC secondary antibody showed a staining pattern similar to that of the
BD PE secondary antibody in terms of specificity. This specificity may be explained
by the fact that this antibody is a monoclonal antibody to rabbit IgG which is devoid
of binding to other species. Although the BD PE secondary antibody was brighter
than the Sigma FITC secondary antibody in terms of fluorescence intensity, they both
represent a good choice to use as secondary antibodies in the P-crkl assay. This is
particularly important when investigating the P-crkl levels in certain cell subsets
where surface staining of other cell surface markers is also required in the P-crkl
assay.
This data is in agreement with Hamilton et al. (2006) who showed the positive
expression of P-crkl in K562 cells when they intracellularly stained K562 cells with
the P-crkl primary antibody and the Sigma FITC secondary antibody. However, the P-
crkl levels in K562 cells reported by Hamilton and co-workers were higher than the
isotype control used in their study by about two fluorescence channels. We only found
one fluorescence channel difference between the isotype control and the P-crkl
labeled cells even when the BD PE secondary antibody was used in the assay. Our
results are similar to those of the manufacturer of the P-crkl antibody in terms of the
relative fluorescence difference between the isotype control and the P-crkl labeled
K562 cells.
148
K562 cells proved to be a good positive control that can be used in the FACS based P-
crkl assay. However, careful monitoring of the BCR-ABL kinase activity by the P-
crkl assay over a long time period demonstrated gradual reduction of P-crkl content in
K562 cells. The data showed that K562 cells should not be used as a control in the P-
crkl assay if the cells were cultured for more than 20 passages. The passage number
effect on the protein expression of cell lines has been reported before. For example,
the expression and activity of the multidrug resistance protein (MDR1) in Caco-2 cell
line has been demonstrated to be higher in lower passages and then decline at higher
passage numbers (Siissalo et al. 2007). In addition, alkaline phosphatase activity was
reduced signficantly in high-passage Caco-2 cells compared to low-passage cells (Yu
et al. 1997). In another study, it has been shown that low and high passage RAW
264.7 cells can be transfected equally but protein expression is significantly reduced
in the high-passage cells (Jacobsen1 and Hughes, 2007).
The reduced expression of phosphorylated crkl in high passage K562 cells can be
explained by two possible mechanisms. Firstly, it is possible that K562 cells may
undergo differentiation after certain passage numbers and this may reduce the kinase
activity of BCR-ABL. It has been reported that myeloid differentiation is associated
with down-regulation of BCR-ABL tyrosine activity (Oda et al. 1994). The second
mechanism which may explain the reduction of phosphorylated crkl may be the
presence of elevated levels of tyrosine phosphatases in differentiated K562 cells
which may mediate a dephosphorylation reaction. In support of this is the finding that
differentiation of K562 cells was associated with the expression of protein tyrosine
phosphatase SHP-1 which results in dephosphorylation of a specific set of tyrosyl
phosphoproteins down stream of BCR-ABL (Bruecher-Encke et al. 2001).
149
finding may suggest that the NALM-1 cell line is not a suitable model to investigate
the cross-talk of Notch and BCR-ABL. The P-crkl assay of the BCR-ABL negative
Jurkat cell line did not show positive expression of P-crkl which further confirms the
specificity of the P-crkl assay and that the Jurkat cells can be utilised as a negative
control in the P-crkl assay.
The finding that P-crkl is clearly expressed in the ALL-SIL cells confirms the intact
activity of the ABL kinase in the ALL-SIL cells and shows that crkl protein is also a
substrate down stream of the NUP214-ABL1 fusion protien. This is the first time that
the P-crkl expression is demonstrated in ALL-SIL cell line by the FACS based P-crkl
assay. The level of P-crkl expression in ALL-SIL cells was relatively low compared
to that demonstrated in K562 cells. This finding is in agreement with the recent
finding that the NUP214-ABL1 fusion protein has a lower in vitro tyrosine kinase
activity than the kinase activity observed with BCR-ABL (De Keersmaecker et al.
2008b). Since the Notch activity is well documented in ALL-SIL cells (Graux et al.
2004; and Keersmaecker et al. 2008), the finding that the ABL fusion protien exhibits
a constitutive tyrosine kinase activity that can be assessed by the P-crkl assay may
make the ALL-SIL cell line a possible experimental model to study the cross-talk
between Notch and ABL signalling pathways.
150
In order to establish whether K562 was a suitable model of the activated Notch profile
seen in primary CD34+ CML cells, the expression of the Notch-1 receptor and the
Notch target, Hes-1 was investigated in K562 cells. The study of Notch signalling in
K562 cells showed that the intracellular domain of Notch1 (ICN1) is highly expressed
in K562 cells. However, the extra cellular domain of Notch1 (ECN1) could not be
detected by FACS analysis using the EA1 monoclonal antibody. Gene expression
profiling using the conventional PCR technique showed the presence of Notch1 at the
mRNA level in K562 cells. The failure to detect the Notch1 expression on the cell
surface of K562 cells is not surprising as the ECN1 could not be detected in our lab in
other cell lines including CEM and TFI cell lines which exhibit active Notch
signalling (Dr. N.Chadwick, personal communication). It is unlikely that the
specificity of the EA1 antibody was responsible for the failure to detect ECN1 in
K562 cells because we were able to detect ECN1 in primary CML cells as shown in
chapter 3. In addition, ECN1 was detected before in our lab in the HEK293 cells
transfected with full-length Notch1 (Dr. V. Portillo, personal communication). It
therefore appears that Notch-1 is expressed at very low levels on the surface of the
K562 cells, possibly because only low levels are normally expressed in this cell type,
or perhaps as a result of the type of mutation seen in T-ALL where the extracellular
domain is not stably expressed. Another possible explanation for the inability to
detect ECN1 in K562 cells is that Notch1 may be modulated at the cell surface by
glycosylation. As described in chapter one glycosylation is a process in which a
glycosyltransferase protein modifies the EGF repeats on the ECN1 to modulate
various activities of Notch such as Notch-ligand interaction, Notch folding and
intracellular trafficking of Notch (Acar et al. 2008). Modification of the EGF repeats
by glycosylation regulates the specificity of Notch binding to different ligands and it
is tempting therefore to speculate that glycosylation of the extra cellular domain of
Notch1 in K562 cells may mask the EA1 binding to its epitope on ECN1. In support
of this notion, glycosylation modification of the AT1 receptor (Angiotensin II
receptor subtype I) in COS-7 cells caused a dramatic decrease in cell surface
expression of AT1 receptor (Lanctot et al. 2005).
The activity of Notch in K562 cells was initially assessed by Hes1 expression by
conventional RT-PCR. This approach showed no Hes1 expression at the message
level which is similar to the result reported by Yin et al. (2008) who also used the
151
conventional RT-PCR method to measure the gene expression of Hes1 in K562 cells.
However, Hes1 expression was clearly detected by using the more sensitive real time
PCR method. The discrepancy between Hes1 gene expression data obtained by the
RT-PCR and that obtained by real time PCR can be attributed to the fact that the latter
is far more sensitive than the former due to the use of more sensitive fluorescent dyes
in the PCR reaction and the ability to detect the target gene at the exponential stage of
amplification. The expression of Hes1 in K562 cells was further confirmed by using a
gamma secretase inhibitor which induced down-regulation of Hes1 expression as
demonstrated by real time PCR. Taken together, the previous findings show that K562
cell line fulfills the basic criteria as a good candidate model for the study of BCR-
ABL and Notch cross-talk in terms of having intact and inhabitable activity of both
signalling pathways.
152
that none of these studies were performed in haemopoietic cells or leukaemic cell
lines and therefore the action of VPA on Notch signalling may be cell context
dependant. The data showed that inhibition of Notch in K562 cells by VPA was
associated by repression of erythroid differentiation as assessed by the expression of
glycophorin-A. This is in agreement with a recent study in which ectopic Notch
activation in FDCP-mix cells accelerated differentiation along the erythroid lineage
(Henning et al. 2007). This effect of VPA on erythroid differentiation may be
mediated by Wnt signalling as VPA has been reported to activate Wnt signalling
(Wiltse, 2005). Since Wnt activation has been shown to block erythroid
differentiation in mice (Kirstetter et al. 2006), it is possible that VPA may inhibit
erythroid differentiation in K562 cells by activating Wnt signalling.
The exact mechanism by which IM up-regulates Notch activity in K562 cells remain
to be elucidated. GSK3β is a serine/threonine kinase and is a component of the Wnt
signaling pathway. It has been shown in cell line models that GSK3β positively
modulate Notch signalling by protecting the intracellular domain of Notch1 (ICN1)
from proteasome degradation (Foltz et al. 2002). It has also been reported that GSK3β
153
is inhibited by the protein serine-threonine kinases Akt which is a down stream
substrate of the BCR-ABL oncoprotien in CML (Cantley, 2002). It is possible
therefore that IM may activate GSK3β by inhibiting BCR-ABL and that the activated
GSK3β may subsequently stabilises the ICN1 and thereby up-regulates the Notch
target gene Hes1.
The inhibition of Notch signalling in K562 cells by GSI resulted in a marked increase
in P-crkl expression. This effect implies that Notch signalling may negatively regulate
BCR-ABL in the K562 cell line and that down-regulation of Notch may directly or
indirectly enhance the activity of BCR-ABL. K562 cells are in the blsatic phase of
CML and the association between Notch downregulation and progression to the
blastic phase has been proposed recently (Sengupta et al. 2008).
154
and BCR-ABL. It can been seen that this in vitro model system fulfills the basic
criteria to investigate the interaction between Notch and BCR-ABL signalling in
terms of the well documented active and inhabitable Notch signalling (Graux et al.
2004; and Keersmaecker et al. 2008) and in terms of the presence of a constitutively
activated tyrosine kinase which is sensitive to the ABL kinase inhibitor IM. The
findings of P-crkl expression and inhibition of the P-crkl levels by IM in the ALL-SIL
cells as assessed here by the FACS based P-crkl assay are in agreement with the data
reported by Graux et al. (2004) and those by Quinta´s-Cardama et al. (2008) who
used western blotting to demonstrate P-crkl expression and the effect of IM on crkl
phoshphorylation in the ALL-SIL cells. The previous results indicate that NUP214-
ABL1 is a constitutively activated tyrosine kinase that may activate similar pathways
as BCR-ABL.
155
Chapter 5: Cross-talk between Notch and BCR-
ABL in primary CD34+ CML cells
5.1 Introduction
The rare leukaemic stem cells (LSCs) in chronic phase CML remain a challenge to the
currently available BCR-ABL targeted treatment options (Elrick et al. 2005). BCR-
ABL + CD34+ CD38- cells which are enriched with LSCs do not respond to imatinib
mesylate (IM) in vitro (Graham et al. 2002). In vivo, LSCs are most likely to be
responsible for the minimal residual disease seen in most patients who were treated
with IM and achieved complete cytogenic response (Jorgensen and Holyoake, 2007).
Current knowledge suggests that resistance to IM in chronic phase CML patients may
be due to either ABL tyrosine kinase mutations and/ or persistence of disease due to
156
BCR-ABL independent mechanisms (Deininger and Holyoake, 2005). In line with
this notion, LSCs in CML have been shown to be resistant to Dasatinib, a novel SRC/
BCR-ABL inhibitor, which is reported to inhibit the majority of kinase mutations in
IM-resistant CML (Copland et al. 2006). These findings raise the possibility that
LSCs in CML, beside their dependence on BCR-ABL, may depend on other survival
pathways that were underestimated by current CML molecular targeted therapy.
Since the LSCs in CML have the same phenotypic and functional characteristics of
normal haemopoeitic stem cells (HSCs), it is very likely that they also share the same
self-renewal and survival pathways such as the Notch, Wnt, and Hedgehog signalling
pathways. Recently, it has been reported that Wnt and Hedgehog signalling pathways
are essential for the survival of LSCs in CML.
157
Data from chapter three shows clearly that Notch signalling is hyperactive in the most
primitive LSCs as well as in CD34+ progenitor cells in the chronic phase of CML
patients. Knowing that Notch signalling is essential for the survival and self-renewal
of normal HSCs and possibly LSCs in CML, it was intriguing therefore to ask if there
is cross-talk between Notch and BCR-ABL signalling pathways. This is particularly
important to elucidate possible active survival pathways in CML LSCs that are BCR-
ABL independent and are not targeted yet by ABL kinase inhibitors alone. The
results shown in chapter four indicates that there may be cross-talk between ABL and
Notch signalling in ABL+ leukaemic cell lines.
This chapter aims first to apply the p-crkl FACS based assay to monitor the BCR-
ABL activity in primary CML cells. It also aims to investigate the nature of Notch and
BCR-ABL interaction in CD34+ chronic phase CML cells by two approaches. Firstly,
by inhibition of BCR-ABL kinase activity by the kinase inhibitor imatinib and
determining the effect of that on Notch signalling by real time PCR. Secondly, by
inhibiting Notch signalling by a gamma secretase inhibitor (GSI) and looking at the
BCR-ABL kinase activity by the p-crkl assay.
5.2: Results
The P-crkl FACS based assay has been used as a surrogate marker to monitor the
BCR-ABL kinase activity in CML and other malignancies and as a parameter for the
efficacy of imatinib and other tyrosine kinase inhibitors (Copland et al. 2006). The P-
crkl assay was validated in K562 cells in chapter four and the staining conditions were
assessed before application of the assay to primary CD34+ CML cells.
In initial experiments CD34+ CML cells from frozen CML samples were fixed and
stained with anti-P-crkl primary antibody and PE secondary antibody as established
for K562 cells in chapter four. However, no positive P-crkl staining was seen using
this method in primary cells. This finding led to a re-evaluation of the staining method
158
for use with primary cells. Firstly, the experiment was performed on cells thawed and
stained on the same day, whereas others have cultured primary in cytokines before
assessing P-crkl expression (Dr. Sophia Hatziieremia, University of Glasgow,
personal communication). CD34+ cells where therefore cultured overnight in serum
free medium supplemented with cytokine cocktail comprising 100 ng/ mL Flt3-
ligand, 100 ng/ mL stem cell factor, and 20 ng/ mL each of interleukin (IL)–3, IL-6
and granulocyte-colony stimulating factor (G-CSF) for 24 hours before assay.
However, under these conditions CD34+ cells still did not show P-crkl expression
when stained with anti-P-crkl primary antibody and PE secondary antibody. Therefore
modifications of the staining conditions including fixation and permeabilisation
procedures, primary antibody concentration, and type of secondary antibody used in
the assay were reassessed. It was found that P-crkl could not be detected when the PE
secondary antibody (BD) was used but was detected when Sigma FITC secondary
antibody was used (Figure. 5.1). This observation was only evident with the primary
CD34+ CML cells as parallel experiments on K562 cells showed positive P-crkl
expression with both PE as well as FITC anti-rabbit secondary antibodies, which is
consistent with experiments results reported in chapter four. Therefore, a protocol
using FITC anti rabbit secondary antibody was adopted for the remaining experiments
to detect P-crkl in primary CD34+ cells.
A
Unstained ▲
PE
B
Isotype control ▲
P-crkl ▲
K562 CML
159
FITC
Fig. 5.1. Application of P-CrKl assay to primary chronic myeloid leukaemia
(CML) samples. Mononuclear cells from frozen aliquots of primary CML cells were
cultured for 24h in cytokines cocktail before being fixed and stained with P-crkl
primary antibody and either PE (A) or FITC (B) conjugated anti-rabbit secondary
antibodies. The P-crkl staining patterns in CML samples are shown in the right hand
side plots in A and B and K562 cells which were run as a positive control are shown in
the left plots. Cells stained with P-crkl PE are shown in red, whereas unstained cells
and isotype control are shown in blue and green respectively (panel A). The P-crkl
FITC stained cells are depicted in green and isotype control in red (panel B). CML
data shown is from one primary CML sample representative of three separate samples
from CML patients.
Inhibition of BCR-ABL activity was the first approach taken to investigate cross-talk
between Notch and BCR-ABL. It has been shown in chapter four that imatinib
mesylate (IM) can inhibit BCR-ABL kinase activity in the CML cell line K562. Since
this chapter aims to study the cross-talk between Notch and BCR-ABL in primary
CD34+ CML cells, the efficacy of IM on primary CD34+ CML was tested by using
the FACS based P-crkl assay. CML samples from leukapheresis products from
patients with chronic phase CML (n=5) were highly enriched for CD34+ and cultured
for 24h in serum free medium (SFM) which was supplemented with the five growth
factor cocktail described in section 5.2.1. CML cells were then treated with Imatinib
mesylayte (10 uM) for 72h and the inhibitory effect of IM on CD34+ CML cells was
assessed by the P-crkl flow cytometric assay. At the time of assessment of P-crkl
160
content most of the samples were found to be > 90% CD34+. In two samples in which
the CD34+ percentage was 70% the CD34 gating strategy at time of analysis was used
to ensure that only CD34+ cells assessed for P-crkl expression. To control for the
sensitivity of the P-crkl assay and the efficacy of IM, the assay was performed on
untreated and IM treated K562 cells in parallel with the P-crkl assay on primary CML
cells. Figure 5.2 and 5.3 show the inhibitory effect of IM on BCR-ABL in CML
samples. Expression of P-crkl was clearly reduced on CD34+ from three CML
samples as compared to untreated samples. However, there was some expression of P-
crkl in two CML samples after 72h of IM treatment (Figure 5.3) suggesting a level of
resistance to IM in these two patients.
To ask if Hes1 up-regulation was only found in IM sensitive CD34+ CML cells the
expression of Hes1 was also investigated in CD34+ from the two CML samples that
showed resistance to IM (CML2 and 4). In both CML samples Hes1 expression in IM
treated CD34+ cells was minimally reduced or similar to untreated cells (Figure 5.5)
with no significant difference in gene expression observed in either samples. It can be
concluded therefore that only CD34+ CML cells that were IM sensitive showed
161
activation of Notch, as assessed by induction of Hes1 gene expression, when BCR-
ABL is inhibited.
A CML-untreated B CML + IM
C K562- untreated
D K562 + IM
1
ND
162
P-crkl (FITC)
Fig. 5.2. Inhibition of BCR-ABL activity by imatinib mesylate (IM) in CD34+ cells
isolated from CML patients. Primary CD34+ cells were isolated from three CML
patients (CML3,CML6, and CML1) and cultured overnight with growth factors alone
before being kept in the absence (A) or presence (B) of 10 µM IM for 72h. CD34+ cells
were then harvested and the P-crkl assay was performed by FACS to assess the activity
of BCR-ABL in treated and untreated cells. In each case at least 70% of cells analysed
for P-crkl expression were CD34+. Where possible, P-crkl staining of untreated K562
cells (C) and IM treated K562 cells (D was performed at the same time as positive
controls for the P-crkl assay and imatinib mesylate efficacy. The P-crkl FITC stained
cells are shown in green and isotype control in red in all plots.
2
ND
P-crkl (FITC)
163
Fig 5.3. Evidence of resistance to imatinib mesylate (IM) in CD34+ from two CML
patients. CD34+ cells from two CML patients (CML4 and CML2) were isolated and
cultured for 24h before being treated with 10 µM IM for 72h. CD34+ cells were then
harvested and the P-crkl assay was performed by FACS on untreated (A) and IM treated
cells (B) to assess the response to IM. In each case at least 70% of cells analysed for P-
crkl expression were CD34+. In one case P-crkl staining of untreated K562 cells (C) and
IM treated K562 cells (D) was performed CML1
at the same time as positive controls for the P-
Relative gene expression
crkl assay
3.5
and imatinib mesylate efficacy. The P-crkl FITC stained cells are shown in
green and isotype control in red in all plots.
3 **
2.5
2 Control
1.5 + IM
0.5
CML3
Relative gene expression
7 ***
6
5
Control
4
+ IM
3
CML 6
Relative gene expression
5 *
4
Control
3
+ IM
2
0
164
Fig. 5.4. Hes1 gene expression post imatinib mesylate (IM) treatment
in CD34+ cells isolated from imatinib sensitive CML pateints. CD34+
cells isolated from the same CML patients shown in fig. 5.2 were
cultured in the presence (light bar) or absence (blue bar) of 10 µM IM for
72h. Live CD34+ cells were then sorted and the gene expression profile
of the Notch target gene Hes1 was investigated by real time PCR.
CML2
Relative gene expression was calculated using the DDCt method.
Statistical significance was calculated using student t-test. (* = P ≤0.05,
Relative gene expression
0.8 Control
0.6 + IM
0.4
0.2
CML4
1.2
Relative gene expression
0.8
Control
0.6
+ IM
0.4
0.2
0 165
Fig. 5.5. Hes1 gene expression post imatinib mesylate (IM) treatment
in CD34+ cells isolated from IM resistant CML pateints. CD34+ cells
isolated from the same CML patients shown in fig. 5.3 were cultured in the
presence (light bar) or absence (blue bar) of 10 µM IM for 72h. Live
CD34+ cells were then sorted and the gene expression profile of the Notch
target gene Hes1 was investigated by real time PCR. Relative gene
expression was calculated using the DDCt method. Student t-test in both
CML samples showed no significant difference in Hes1 expression
between treated and untreated cells.
166
activity status following GSI treatment. Therefore, Hes1 expression post GSI
treatment was investigated as an assay for the efficacy of GSI on Notch activity in
CD34+ CML cells.
CD34+ CML cells from five patients were cultured as described above with a five
growth factor cocktail (as described in section 5.2.1) for 72h in the presence or
absence of 10 µM GSI before carrying out real time PCR for the Notch target gene
Hes1. Figure 5.6 shows that CD34+ cells in three CML samples (CML2, 4, and 5)
responded very well to the inhibitory action of GSI as evident by down-regulation of
Hes1. This down-regulation was significant in two samples and not significant in one
sample (P= 0.09).
CML2
CD34+ cells1.4from two CML samples (CML1 and 6) showed no evidence of a
Relative gene expression
1.2
response to GSI treatment as assessed by a decrease in the expression of Hes1 mRNA
1
(figure 5.7). To confirm these findings the real time PCR experiments were repeated
0.8 Control
with more concentrated
0.6
cDNA samples but this again showed no significant
+ GSI
difference of0.4Hes1 gene expression between untreated and GSI treated CD34+ CML
cells. 0.2
*
0
CML4
1.2
Relative gene expression
P=0.09
1
0 .8
Control
0 .6
+ GSI
0 .4
0 .2
CML5
1.2
Relative gene expression
0.8
Control
0.6
+ GSI
*
0.4
0.2 167
0
Fig. 5.6. Hes1 gene expression after gamma secretase inhibitor (GSI)
treatment in CD34+ cells isolated from CML patients 2, 4, and 5. CD34+
cells were isolated from CML patients and cultured in the presence (red bar) or
absence (blue bar) of 10 µM GSI for 72h. Live CD34+ cells were then sorted
and the gene expression of the Notch target gene Hes1 was investigated by real
time PCR. Relative gene expression was calculated using the DDCt method.
Data shown is from three CML CML1 samples (n=3). Statistical significance was
calculated using student t-test. (* = P ≤0.05).
1.8
Relative gene expression
1.6
1.4
1.2
1 Control
0.8 + GSI
0.6
0.4
0.2
CML6
1.8
Relative gene expression
1.6
1.4
1.2
1 Control
0.8 + GSI
0.6
0.4
0.2
0
168
Fig. 5.7. Hes1 gene expression after gamma secretase inhibitor (GSI)
treatment in CD34+ cells isolated from pateint 1 and 6. CD34+ cells were
isolated from CML patients and cultured in the presence (red bar) or absence
(blue bar) of 10 µM GSI for 72h. Live CD34+ cells were then sorted and the
gene expression of the Notch target gene Hes1 was investigated by real time
PCR. Relative gene expression was calculated using the DDCt method. Student
t-test in both CML samples showed no significant difference in Hes1 expression
between treated and untreated cells.
5.2.4.2 Non GSI responding CD34+ CML cells express high mRNA levels of
Hes1
The finding that GSI treatment failed to downregulate Hes1 in CD34+ cells from two
CML samples was interesting given the finding in chapter three of high levels of
Hes1 expression in CD34+ cells from CML patients as compared with NBM. It was
not possible to perform GSI inhibition experiments on the CML samples which were
used to demonstrate upregulation of Hes1 in the CD34+ populations (chapter three).
The CML cells tested in section 5.2.4.1 were from frozen material from CML patients
whose Notch signalling activity was not confirmed. It was possible that the observed
failure to respond to GSI treatment in the two CML samples described here may be
due to low Hes1 transcript levels to start with. Therefore, Hes1 gene expression was
measured in the CD34+ cells in all CML samples used in this chapter by real time
PCR and compared to CD34+ cell from normal bone marrow. It was found that Hes1
expression was upregulated in CD34+ cells in all six CML samples as compared to
normal CD34+ cells from normal bone marrow. This upregulation was statistically
significant (P ≤0.01) and confirmed the findings in chapter three. This data exclude
169
the possibility that failure of CD34+ cells to respond to GSI in samples 2 and 4 was
due to low levels of Hes1 mRNA in the starting material. Taken together these
observations also suggest that the high levels of Hes1 in some of these samples are the
result of gamma secretase independent Notch signalling.
5.2.4.3 Gamma secretase inhibitor (GSI) increases the kinase activity of BCR-
ABL in CD34+ CML cells
To further explore the cross-talk between Notch and BCR-ABL, the effect of the
Notch inhibitor GSI on BCR-ABL activity was investigated in CD34+ CML cells.
CD34+ CML cells from five patients were cultured as described before with a five
growth factors cocktail (as described in section 5.1) for 72h in the presence or absence
of 10 µM GSI before measuring BCR-ABL activity by the FACS based P-crkl assay.
At the time of P-crkl assay the percentage of CD34+ cells in the culture was measured
and counted to be between 70-90% in all samples. CD34+ gating strategy was applied
at the time of the P-crkl assay to samples which were found to have < 90% CD34+
cells in order to have at least 90% CD34+ cells in all CML samples analysed for their
P-crkl expression. The BCR-ABL positive K562 cells were used as a positive control
for the P-crkl assay in each case.
To calculate the change in P-crkl expression the mean fluorescence intensity (MFI) of
GSI treated or untreated CD34+ cells was first determined by subtracting the MFI of
P-crkl stained cells from the MFI of isotype control in each condition. The MFI of
GSI treated cells was then compared to the MFI of untreated cells and the change in
P-crkl expression was reported as percentage.
Interestingly, FACS data showed that GSI treatment increased the P-crkl expression
in CD34+ cells between 18-42 % as compared to total P-crkl in untreated CD34+
cells. Figure 5.9 shows increase in the P-crkl expression in CD34+ CML cells from
GSI responsive CML samples (CML2, 4, and 5) that showed downregulation of Hes1
mRNA post GSI treatment. This data suggests that the increase in P-crkl expression
on these samples is most likely Notch dependant. However, it appears that the other
two CML samples which did not show Notch inhibition by PCR post GSI treatment
(CML 1 and 6) also exhibited an 18- 40% increase in crkl phosphorylation (figure
170
5.10). The increase in P-crkl in CD34+ CML cells (n=5) was statistically significant
as shown in figure 5.11 (P< 0.01).
5.2.4.4 Gamma secretase inhibitor (GSI) decreased the kinase activity of BCR-
ABL in CD34+ CML cells from one CML patient
In contrast to the results shown earlier for five CML patients, GSI treatment of
CD34+ cells from one CML patient (CML3) showed inhibition of BCR-ABL activity
as can be seen from the reduction of P-crkl expression by 30% as compared to no-
drug control (figure 5.12). CD34+ cells from this sample responded very well to the
GSI induced inhibition and showed downregulation of Hes1 post 72h GSI treatment.
Therefore, the effect of GSI treatment on BCR-ABL activity on CD34+ cells from
this sample is most likely a Notch mediated effect. Interestingly, CD34+ cells from
the same patient were sensitive to imatinib treatment since after 72h incubation with
10 µM IM the P-crkl expression was markedly reduced as compared to untreated cells
(figure 5.12). Imatinib treatment caused significant upregulation of Hes1 in CD34+
cells (P< 0.001). This is the only CML sample which showed BCR-ABL inhibition
following the inhibition of Notch signalling by GSI.
The findings of Notch and BCR-ABL cross-talk from all six CML patients tested here
are summarised in table 5.12.
1000000
NBM
** **
100000
** CML
** **
Log fold change in gene expression
10000 **
1000
100
10
171
1
CML1 CML2 CML3 CML4 CML5 CML6
Fig. 5.8. Hes1 gene expression in CD34+ CML cells. The gene
expression profiles of the Notch target gene Hes1 was investigated by
real time PCR. Data is shown from CD34+ cells isolated from six CML
patients in chronic phase and CD34+ control cells from three normal
bone marrow (NBM) samples. Relative gene expression was calculated
using the DDCt method. The log fold change in Hes1 gene expression in
each CML sample is plotted against the mean of Hes1 expresion in the
three NBM samples. Statistical significance was calculated using the
Mann-Whitney test. (** = P ≤0.01).
2 40%
4 42%
5 18%
172
P-crkl (FITC)
Fig. 5.9. Assessment of P-crkl in CD34+ CML cells following inhibition of Notch
by gamma secretase inhibitor (GSI). Primary CD34+ cells were isolated from three
CML patients (CML2, CML4, and CML5) and cultured overnight with growth
factors alone before being kept in the absence (A) or presence (B) of 10 µM GSI for
72h. CD34+ cells were then harvested and the P-crkl assay was performed by FACS
to assess the activity of BCR-ABL in treated and untreated cells. At least 90% of cells
analysed for P-crkl expression were CD34+. In each case P-crkl staining of untreated
K562 cells (C) was performed at the same time as a positive control for the P-crkl
assay. The increase in P-crkl expression in GSI treated versus untreated cells is shown
as a percentage. The P-crkl FITC stained cells are shown in green and isotype control
in red in all plots. The GSI induced inhibition of Notch in all CML samples shown
here was confirmed by real time PCR (see Fig.5.6).
40%
1
18%
6
173
P-crkl (FITC)
45
40
35 **
Mean % P -crkl
30
25 control
20 + GSI
15
10
5
0
174
Fig. 5.11. P-crkl in CD34+ CML cells treated with gammas
secretase inhibitor (GSI). CD34+ cells from five CML patients in
chronic phase were cultured in the absence (blue bar) or presence (red
bar) of 10 µM GSI for 72h. The change in BCR-ABL activity was
assessed by the FACS based P-crkl assay. P-crkl expression was
measured by mean fluoresnece intensity (MFI) units in each condition.
MFI of P-crkl in GSI treated CD34+ cells was compared to no-drug
control in each sample and the percentage of increase in P-crkl was
calculated. Data shown here represent the mean of five CML samples.
Statistical significance was calculated using student t-test (** = P
≤0.01).
175
A Untreated +GSI +IM
- 30%
P-crkl (FITC)
B 1.2
Relative gene expression
0.8
0.6 Control
** + GSI
0.4
0.2
C 8
Relative gene expression
7
6
***
5
Control
4
+ IM
3
2
1
0
176
Figure 5.12. GSI treatment induced both Notch and BCR-ABL
inhibition in CD34+ cells from one CML sample. CD34+ cells from
CML 3 patient were cultured overnight with cytokines and then treated
with GSI or IM for 72h before assessing P-crkl expression (A). The
increase in P-crkl expression in GSI treated versus untreated cells is shown
as a percentage. The P-crkl FITC stained cells are shown in green and
isotype control in red in all plots. Hes1 gene expression was investigated
by real time PCR on CD34+ cells treated for 72h with GSI (B) or with IM
(C). Relative gene expression was calculated using the DDCt method.
Statistical significance was calculated using student t-test. (** = P ≤0.01,
*** = P ≤0.001).
Table 5.1. Summary of Notch- BCR-ABL cross-talk data following treatment of CD34+
CML cells from six CML patients with GSI and IM.
177
5.3: Discussion
Cross-talk between BCR-ABL and Notch has been investigated in cell lines in chapter
four. Although most of the interactions between BCR-ABL and other signalling
pathways have been described in blastic phase cell lines, this may not represent the
behaviour of this oncoprotien in chronic phase disease in vivo (Marley and Gordon,
2005). Therefore, it was important to use patient derived material to investigate the
possible cross-talk between BCR-ABL and Notch signalling in chronic phase CML.
The activity of BCR-ABL has been shown to be responsible for initiating and
maintaining the leukaemic clone in the chronic phase of CML (Quintás-Cardama and
Cortes, 2008). Western blotting and immunoprecipitation have proven technically
challenging tools to monitor BCR-ABL interactions with other signalling molecules
and/or substrates in primary CML cells (Marley and Gordon, 2005). The development
of the FACS based P-crkl assay to monitor BCR-ABL activity provides a more
reliable method to monitor BCR-ABL activity and its response to drugs in CML
patients. This intracellular flow cytometric assay which detects phophorylated crkl by
using an anti-phospho crkl (P-crkl) antibody, only requires small cell numbers from
patient samples and, unlike western blotting, can be performed in few hours
(Hamilton et al. 2006).
178
The P-crkl assay was validated in K562 cells in chapter four but has to be validated in
primary CML samples before it can be used as a marker for BCR-ABL activity in
patient samples. Data from this chapter shows that the choice of secondary antibody
is a critical step in P-crkl staining of primary CD34+ CML cells. P-crkl expression
could not be detected in CD34+ cells from chronic CML patients when the PE
(Becton Dickinson) conjugated anti rabbit antibody was used. This is in contrast to the
blastic phase CML cell line K562 which showed very bright P-crkl expression with
PE conjugated secondary antibody (see chapter four). This discrepancy is most likely
due to inherent differences between primary chronic phase CD34+ CML cells and the
blastic phase K562 cells. The CD34+ CML cells are relatively small cells (Jørgensen
and Holyoake, 2007). It is possible that uptake of PE fluorochrome, a 240-kDa
protein, by the CD34+ CML cells is difficult to achieve due to the large molecular
weight of PE molecule as compared to FITC fluorochrome which has a molecular
weight of only 389 daltons.
A thorough literature search showed that only few studies have attempted the
intracellular flow cytometric P-crkl assay to monitor BCR-ABL in CML patients. In
most of these studies, the FITC conjugated anti rabbit secondary antibody was used
against P-crkl primary antibody in CD34+ CML cells (Jiang et al. 2007b; Hamilton et
al. 2006; and Copland et al. 2006). In contrast, Jilani et al (2008) have used a PE
conjugated secondary antibody (Santa Cruz Biotechnology) to detect crkl
phosphorylation in imatinib-treated versus imatinib-naïve CML patient peripheral
blood cells. Although the authors showed a positive PE fluorescence signal in the
naïve CML cells, they used mononuclear cells from CML patients rather than limiting
their study to the more primitive CD34+ cells. In addition to studying cell population
other than the CD34+ cells studied here, Jilani and co-workers used a different
permeabilisation reagent and a secondary antibody from different supplier which
makes comparison between their findings and data reported here more difficult.
Nonetheless, within the conditions described here, the use of the PE conjugated
secondary antibody (BD) to detect crkl phosphorylation in CD34+ CML cells did not
show positive P-crkl signal.
Data on P-crkl FACS staining showed higher levels of P-crkl expression on K562
cells as compared to primary CD34+ CML cells when cells stained with P-crkl
179
antibody and the FITC conjugated secondary antibody. It is well documented that
levels of crkl phosphorylation correlates well with the levels of BCR-ABL expression
(Hoeve et al. 1994). It has been shown that BCR-ABL expression and activity as well
as crkl phosphorylation is higher in progenitor cells of patients in blast crisis than in
those of chronic phase patients (Barnes et al. 2005). Therefore it is perhaps not
surprising to see higher P-crkl expression in the blastic phase CML cell line K562 as
compared to CD34+ chronic CML cells.
One of the approaches used in this chapter to study BCR-ABL and Notch cross-talk in
chronic phase CML was to investigate the effect of BCR-ABL inhibition on Notch
activity. Therefore, the BCR-ABL inhibitor imatinib mesylate (IM) was utilised in
this chapter as a tool to inhibit BCR-ABL activity in CD34+ cells.
The results showed that BCR-ABL activity was inhibited by IM in CD34+ cells of 4/6
patients. This effect was shown as marked reduction of crkl phosphorylation post 72h
of 10 µM IM treatment (n=4). This is in agreement with Chu et al (2004) who showed
that imatinib exposure in doses between 1-5 µM resulted in inhibition of crkl
phosphorylation in CML CD34+ cells in a dose-dependent manner and as early as
after two hours of IM treatment. The authors used western blot analysis to examine
the IM effect on crkl phosphorylation, a method which was found to correlate very
well with the FACS based P-crkl assay used in this project (see chapter four).
Copland and colleagues (2006) showed that the majority of CD34+ CML cells were
sensitive to 5 µM IM at 16 hours and showed clear reduction of P-crkl. However, they
also reported that the surviving CD34+ cells showed minimal reduction in P-crkl at 72
hours. The authors interpreted this as enrichment of IM resistant population post 72h
of IM treatment. Data presented in this chapter showed also two CML samples that
did not respond to IM at 72h and showed minimal reduction of crkl phosphorylation
(Figure 5.3) which may reflect the time point used. In fact, the 72h time point was
180
chosen in our study in order to have enhanced IM mediated inhibition of BCR-ABL
activity. Holtz et al (2002) reported that IM induced more significant suppression of
CML CFCs after a 96-hour exposure as compared with 24-hour exposure.
Data presented here and by others shows that IM has an immediate effect on CD34+
CML cells on most chronic phase patients. CD34+ cells that were confirmed by the
FACS based P-crkl assay to be IM sensitive were used to study the effect of BCR-
ABL inhibition on Notch signalling activity.
181
Real time PCR data showed that IM induced inhibition of BCR-ABL in CD34+ cells
resulted in significant up-regulation of Hes1, the Notch target gene, in three CML
patients. This finding is interesting as it shows for the first time that BCR-ABL
signalling pathway may interact with the Notch signalling pathway in CD34+ chronic
CML cells. This effect was observed only in CML samples which were IM sensitive
(CML1, CML3, and CML6) and a similar effect was not obsereved in IM resistant
samples. It should be noted also that IM does not target Notch directly and does not
influence gamma secretase activity in vitro (Eisele et al. 2007). Therefore it can be
concluded that up-regulation of Hes1 post imatinib treatment was a BCR-ABL
mediated effect.
The concentration of growth factors (GF) used in culturing CD34+ CML cells is
critical to the interpretation of drug responses and biological activities of this cell
population. For example, Chu et al (2004) showed that imatinib led to unexpected
activation of MAPK pathway in CD34+ CML cells and demonstrated by comparing
high and low concentrations GF conditions that the increased MAPK activity was
growth factor dependent effect. In addition, it may be speculated that CD34+ cells
may proceed toward terminal differentiation under high-concentration GF conditions.
The concentration of growth factors used in this study is regarded by some groups as
a "high concentration" growth factor cocktail (Jiang et al. 2007b; Copland et al.
2008). This was used for the short term cultures used in this study in order to
stimulate cell division and achieve BCR-ABL inhibition in CD34+ CML cells as
these cells showed much more increased resistance to imatinib when cultured in low
growth factors concentrations (Jiang et al. 2007b). The intra cellular domain of Notch
receptors have been shown to have a cytokine response region (NCR) which could
modulate the activity of Notch in response to different cytokines (Bigas et al. 1998).
If Notch activation reported here was in response to cytokines in the culture then it
should have occurred in both IM treated and untreated CD34+ CML cells. However,
Notch activation was only observed in IM treated CD34+ cells.
182
via its anti-proliferative effects. Moreover, careful precautions were taken to ensure
that IM induced effect reported here was limited to the CD34+ cell population. For
example, PCR experiments were performed on cDNA from either CD34+ sorted cells
or cells that were enriched by magnetic selection and confirmed to have > 95%
CD34+ cells at the end of IM culture. In addition, the CD34 expression of cultured
cells was monitored every day by FACS and results showed an enrichment of CD34+
cells at the end of 72h culture (data not shown). Therefore, it is unlikely that the
imatinib effect on Notch activation was due to growth factors induced differentiation
of CML cells.
Imatinib did not have significant effects on crkl phosphorylation in normal CD34+
cells (Chu et al. 2004; and Hamilton et al. 2006). This suggests that enhanced Notch
signalling post imatinib treatment may be specific to CD34+ CML cells. This effect
of imatinib on Notch activity was previously shown in the CML cell line K562 as
well as in the ABL+ cell line SIL-ALL (chapter four).
The mechanism by which imatinib induces activation of Notch in CD34+ CML cells
is remain to be investigated. Dishevelled is a an essential cytoplasmic component and
key player in the Wnt signalling pathway in which its phosphorylation leads to
stabilisation of β-catenin and activation of Wnt signalling (Katoh and Katoh, 2007).
In contrast, there is evidence that Dishevelled binds physically to Notch and serves to
down-regulate Notch signalling in Drosophila (Panin and Irvineseminars, 1998).
Since imatinib has been shown to inhibit Wnt signalling in CML cells (Coluccia et al.
2007), it is possible that imatinib up-regulates Notch signalling by inhibiting
Dishevelled and thus abolish the inhibitory effect of Dishevelled on Notch signalling.
183
BCR/ABL tyrosine activity in CD34+ CML cells. In fact, Notch activation post IM
treatment may explain the enrichment of CD34+ cells reported here and by others at
the end of CD34+ culture. In support of this hypothesis is the finding that Notch1
activation inhibits differentiation of hematopoietic stem cells both in vitro and in vivo
and results in enhanced stem cells numbers (Stier et al. 2002). Moreover, activation of
Notch4 in normal human marrow or cord blood cells resulted in enhanced stem cell
activity and reduced differentiation (Vercauteren and Sutherland, 2004).
Gamma secretase inhibitor (GSI) treatment of CD34+ CML cells resulted in Hes1
down-regulation in most CML samples studied here. However, GSI treatment failed
to show a decrease in Hes1 mRNA in CD34+ cells from two CML patients. This was
unexpected as GSI has been shown to inhibit Notch signalling in normal CD34+ cells
and in T-ALL cell lines (Chadwick et al. 2007; Kogoshi et al. 2207). However, failure
to inhibit Notch activity by GSI treatment was reported in cancer cells by two groups.
Kogoshi et al (2007) showed that GSI did not decrease Hes1 mRNA in two leukaemic
cell lines including one myeloid cell line. Zhang et al (2008) studied the role of
Notch in osteosarcoma and confirmed the activation of Notch pathway genes and
target genes including Hes1 in osteosarcoma cell lines. However, GSI did not down-
regulate Hes1 mRNA in the osteosarcoma cell line COL. These findings and the data
reported here can be explained by two possible mechanisms. Firstly, it is likely that
Hes1 expression in cells that fail to show Hes1 response to GSI is Notch receptor
independent and therefore cannot be down-regulated by GSI. For example, it has been
184
shown in Raji B-lymphoma cells that EBNA2 protein activates the transcription factor
RBP-J and activates Notch signaling while bypassing the Notch protein (He et al.
2008). The other possibility is that GSI non responding cells may have an as-yet
uncharacterised activating mutation in the Notch pathway. Such mutations may result
in truncated forms of Notch receptors that do not require ligand binding or gamma
secretase activity for nuclear translocation and active signalling. An example is the
t(7,9) translocation found in 1% of T-ALL cases and results in the formation of the
truncated active Notch1 (TAN1) which is constitutively active and not inhibited by
GSI (Grabher et al. 2006).
Interestingly, CD34+ cells from those two CML patients who did not respond to GSI
showed significant up-regulation of Hes1 when BCR-ABL activity was inhibited by
imatinib. It is possible therefore that BCR-ABL may act as a Notch repressor and its
inhibition activates down stream proteins which activates the transcription factor
RBP-J directly and results in Notch activation while bypassing the Notch receptor.
This hypothesis may be supported by the finding presented in chapter three that Notch
proteins are not over-expressed in CML.
Since Notch signalling was postulated here as a possible candidate for BCR-ABL
independent resistance to imatinib, it was anticipated that GSI treatment would result
in reduction of BCR-ABL activity. However, it appears that GSI treatment
significantly enhanced crkl phosphorylation in CD34+ CML cells. This effect on
BCR-ABL activity was observed in most CML samples treated with GSI (n=5)
regardless of the effectiveness of GSI in inhibiting the Notch pathway activity. It can
be seen therefore that GSI cannot be used in drug combinations to overcome imatinib
resistance in CD34+ cells in CML.
185
see an increase in ABL phosphorylation by western blotting following GSI treatment,
the data presented here shows, through an unidentified mechanism yet, a significant
increase in P-crkl phosphorylation in CD34+ CML cells post GSI treatment. This may
suggest that Notch antagonises ABL in CML and inhibition of Notch may increase
the activity of BCR-ABL in the contest of CD34+ cells in CML.
Similar interaction between Notch and ABL was described in Drosophila. Genetic
interaction studies on the mechanisms that regulate the ISNb motor nerve
development in Drosophila have shown that Notch and ABL, via unknown
mechanism, act antagonistically and that their gain- and loss-of-function phenotypes
equally suppress one another in ISNb (Crowner et al. 2003). The mechanism by
which Notch antagonises ABL in CML is not yet clear and further research is required
to elucidate other signals or pathways that control this interaction.
Gamma secreatse inhibitors may also inhibit other targets like the amyloid precursor
protein (APP), ErbB4, E-cadherin, and CD44 (Tian et al. 2003). However, a link
between the inhibition of any of these substrates and increased BCR-ABL activity in
CML seems unlikely.
186
Chapter 6: Final discussion
The Notch signalling pathway has been suggested to play a vital role in HSC survival
and self renewal (Duncan et al. 2005). Aberrant NOTCH1 expression has been
identified as a causative factor in the development of a subset of T-cell acute
lymphoblastic leukemia (T-ALL) (Ellisen et al. 1991) and activating mutations in
Notch1 have been identified in more than 50% of human T-ALL (Weng et al. 2004).
However, the role of Notch signalling in other leukaemias is not well established. The
data from this project demonstrates for the first time that expression of Notch1 and
Notch2 at the mRNA level is up-regulated in CD34+ cells from chronic phase CML
patients as compared with CD34+ cells from normal donors. Furthermore Notch
signalling, as assessed by Hes1 expression, is also up-regulated in this cell subset in
chronic phase CML patients, indicating a hyperactivation of the Notch signalling
pathway.
187
increased signalling seen in this study. Consequently it would be intriguing to
examine in future studies whether activating Notch1 mutations are found in CML.
A second possibility is that Notch activity is high in CML CD34+ cells as a result of
changes in ligand concentration in the leukaemic microenvironment. It does not
appear likely that there would be alterations in Notch ligand expression on non-
leukaemic cells in the microenvironment, but there remains the possibility that an up
regulation of ligand on neighboring leukaemic cells is occurring. A detailed analysis
of ligand expression on CML and normal cells would indicate whether this was the
case.
A third possibility is that Notch signalling is up regulated as a result of cross talk with
the BCR-ABL signalling pathway and this possibility was investigated in the present
study. The interaction between Notch and ABL has been observed before in
Drosophila where Notch and abl mutations interact synergistically to produce
synthetic lethality and defects in axon extension (Giniger, 1998). The author has also
shown in another study that Notch and its ligand Delta function in the ISNb motor
nerve patterning in Drosophila mainly to antagonise ABL (Crowner et al. 2003). This
shows clearly that the cross-talk between Notch and ABL may be synergistic or
antagonistic depending on the developmental context. Most recently Mizuno et al.
(2008) have demonstrated that over-expression or enhanced kinase activity of BCR-
ABL and altered expression of Notch1 synergises to induce acute leukemia in a
transgenic model for CML. To test the hypothesis that Notch and BCR-ABL may
interact in CML, leukaemic cell line models were characterised for the expression of
intact and inhibitable Notch and ABL activity. After establishing the optimised
parameters for the FACS based P-crkl assay in this project as a surrogate marker of
ABL kinase activity and by utilizing the BCR-ABL inhibitor imatinib mesylate (IM)
it was confirmed that K562 and ALL-SIL cell lines have a constitutive active ABL
kinase activity that can be blocked by IM enabling a study of the effects of BCR-ABL
on the Notch signalling pathway. On the other hand, Notch activity was evident in
K562 cells as assessed by the expression of Hes1 by real time PCR and this activity
was responsive to the inhibition induced by GSI allowing the study of the effects of
Notch signalling on BCR-ABL activity. Active Notch signalling in the ALL-SIL cells
is well documented by others (Quinta´s-Cardama et al.. 2008; and De Keersmaecker
188
et al.. 2008). It can be concluded therefore that both K562 and ALL-SIL cell lines
may offer themselves as suitable in vitro models to investigate the cross-talk between
Notch and ABL signalling pathways. By using inhibitors of both Notch and ABL
signalling, it was found for the first time that the Notch and ABL pathways antagonise
each other in K562 and ALL-SIL leukaemic cell lines.
These data were then confirmed in primary CD34+ cells isolated from chronic phase
CML patients. The treatment of CD34+ CML cells with IM resulted in significant
upregulation of the Notch target gene Hes1 in three out of the four CML samples that
responded to IM treatment. Likewise FACS data showed that GSI treatment
significantly increased the P-crkl expression in CML CD34+ cells. Taken together
this data implies that Notch and BCR-ABL antagonise each other in primary tissue
from chronic phase CML patients. The exact mechanisms underlying the GSI induced
activation of BCR-ABL signalling and the IM induced activation of Notch signalling
are unknown.
Giniger at al. (1998) suggested two possible mechanisms to explain the cross talk
observed between Notch and ABL in Drosophila. He proposed that Notch may
directly bind to ABL (or possibly bind via an adapter protein) and through this direct
physical association the two pathways may regulate each other. Alternatively the two
molecules may not physically interact but may interact at the level of the downstream
components of the pathway. The proposed interaction in this project between Notch
and BCR-ABL in chronic phase CML warrants further investigation including co-
immunoprecipitation studies to explore the molecular level at which this interaction
occurs and whether this interaction is direct or requires other cellular mediators or
common signalling pathways.
189
demonstrated in chapter 4. It is possible, therefore, that Hes1 up-regulation following
IM exposure in CML cells may also activate the PI3K/AKT pathway and confer anti
apoptotic signals to CML cells regardless of the BCR-ABL repressed activity (Fig.
6.1). More work is needed to investigate whether the activation of the PI3K pathway
by Notch signalling reported in T-ALL also occurs in CML cells.
Although IM has been shown to inhibit BCR-ABL activity in CD34+ chronic phase
CML cells, only a mild increase in apoptosis was demonstrated in these cells (Chu et
al. 2004). Moreover, it has been shown that IM treatment activated the PI3K/ Akt/
mammalian target of rapamycin (mTor)- anti apoptotic pathway in chronic phase
CML patients as well as in BCR-ABL+ Lama cells (Burchert et al. 2005). This was
unexpected because BCR-ABL is upstream of the PI3K/AKT pathway and blocking
the BCR-ABL activity by IM was anticipated to repress the anti-apoptotic activity of
the PI3K signalling and induce apoptosis. The authors proposed that the IM-induced
compensatory PI3K-Akt/mTor activation may represent a novel mechanism for the
persistence of BCR/ABL-positive cells in IM treated CML patients. In fact, the IM
induced activation of Notch signalling reported in this project may also help to
explain why blocking BCR-ABL activity by IM is not enough to switch off the
PI3K/AKT/mTor anti apoptotic activity.
It is also possible that the antagonistic effects between Notch and BCR-ABL
signalling seen in this study are a reflection of the involvement of additional pathways
active in the CML cells. In the experiments presented here modulation of the Notch
and BCR-ABL pathways have been investigated. However, haematopoietic progenitor
cells have been reported to secrete Wnt (Duncan et al. 2005) and the possibility that
this pathway may therefore be active in these experiments cannot be ruled out. IM has
been shown to inhibit Wnt signalling in CML cells (Coluccia et al. 2007) and in the
murine myeloid progenitor cell line 32Dcl3 (Tickenbrock et al.. 2008) in a way that
may involve inhibition of Dishevelled and activation of GSK3β, both of which are
key players in the canonical Wnt signalling pathway. Dishevelled has been reported to
bind to Notch and down-regulate Notch signalling in Drosophila (Panin and
Irvineseminars, 1998). In contrast, it has been shown in cell line models that GSK3β
positively modulates Notch signalling by protecting the intracellular domain of
Notch1 (ICN1) from proteasome degradation (Foltz et al. 2002). Taken together, IM
may activate Notch signalling by modulating the Wnt components Dishevelled and
190
GSK3β (Fig. 6.1). It is also possible that IM may activate Notch signalling by
blocking the inhibitory action of BCR-ABL on its downstream substrate GSK3β.
Although the in vitro inhibitor based loss of function approaches described here
suggest that Notch and BCR-ABL antagonise each other, the co-existence of activated
Notch and BCR-ABL in vivo in chronic phase CML suggest a cooperative interaction
between the two signalling pathways. One possibility is that both BCR-ABL and
Notch signalling are equally critical for CML cell survival and resistance to apoptosis
and that in vitro inhibition of one of the two signalling pathways may trigger a
compensatory activation of the other pathway to compensate for the loss of total
survival signals (Fig. 6.2). This hypothetical model would require regulatory
molecules in the cytoplasm to sense the reduction of the survival signals from one
pathway and respond by increasing the activity of the other pathway to compensate
for the reduction in total anti-apoptotic signals in BCR-ABL+ cells. These regulatory
molecules themselves may be part of a feedback loop of Notch and BRC-ABL
signalling targets. This model may also explain the activation of Notch signalling in
chronic phase CD34+ CML cells before any manipulation of these pathways.
The outcome of Notch signalling is known to be highly cell context specific. For
example it may lead to resistance to apoptosis in some cell contexts (Sade et al.
2004), and lead to sensitivity to apoptosis in other cell types (Zweidler-McKay et al.
2005). In this study BCR-ABL and Notch cross-talk has been investigated in the
context of CD34+ cells from chronic phase CML patients and it was confirmed in
chapter three that Notch signalling was hyperactive in these cells. Notch signalling
was also upregulated in the more primitive CD34+Thy+ compartment. Most available
BCR-ABL inhibitors have been shown to be effective against CD34+ CML cells but
not against the more primitive CD34+ CD38- cell subset in chronic phase CML
(Copland et al.. 2006). It would therefore be important in future work to investigate
the effect of Notch inhibition on BCR-ABL activity in the context of the CD34+
CD38-/Thy+ cell subset by including an extra CD34 and CD38/Thy surface staining
step in the P-crkl assay, enabling thereby the measurement of P-crkl content in the
FACS gated CD34+ CD38-/Thy+ cell subset. Similarly, the effect of BCR-ABL
inhibition on Notch activity within the CD34+ CD38-/Thy+ cell subset could be
191
attempted in the future by using a BCR-ABL inhibitor that is effective against the
primitive CD34+ CD38-/Thy+ cells such as Dasatinib (Copland et al. 2006).
Whether survival and self renewal of CML stem cells is critically dependant on intact
Notch signalling remains an open question. This question could be addressed by
assessing the proliferation and apoptosis status of the cells following the treatments
with inhibitors outlined in this study. This could also be investigated in vivo in a
mouse model by generating a mouse in which Notch signalling is inactivated by either
a dominant-negative version of the RBPJ protein (DNRBPJ) or a dominant negative
version of the co-activator MAML (DNMAML) (Maillard et al. 2008). Stem cell
enriched cells from control or Notch inactive mice could be then transfected with
control retroviruses or viruses carrying the p210 BCR-ABL and transplanted into
lethally irradiated mice to test the requirement of Notch signalling in induction and
maintenance of CML in vivo.
Clearly many more functional studies are required to investigate the biological and
cellular events that result from the activation of Notch signalling in chronic phase
CML. If Notch signalling was proven to be critical for the survival or proliferation of
chronic phase CML cells, as observed in T-ALL, a more detailed model for the role of
Notch in CML progression could be established. One possibility is that in the context
of the chronic phase of CML Notch is activated and confers proliferation and cell
survival of CD34+ CML cells. Progression to the blastic phase of CML is then
associated with down-regulation of Notch (Sengupta et al. 2007). This fits very well
with the finding in this project that activation of Notch in the blastic phase CML
K562 cells resulted in inhibition of proliferation and by the recent findings that this
may induce apoptosis in K562 cells (Yin et al. 2008). Therefore, it can be postulated
that the outcome of Notch signalling in CML will depend on the cellular context.
192
Activation
Inhibition ICN1 Dishevelled
IM
Hes1
GSK3β
IM
++
PTEN PI3K
P
BCR ABL β-catenin
P
AKT
GSK3β
mTOR
β-catenin accumulation
NOTCH
P GSI
BCR-ABL NOTCH P P
BCR-ABL
Survival signals
Survival signals
IM
B
BCR-ABL
P
BCR-ABL NOTCH IM
NOTCH
Survival signals
Survival signals
195
11 Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999) Notch
signaling: cell fate control and signal integration in development.
Science 284, 770-776
12 Aster, J. C., Pear, W. S. and Blacklow, S. C. (2008) Notch signaling in
leukemia. Annu Rev Pathol 3, 587-613
13 Avigdor, A., Goichberg, P., Shivtiel, S., Dar, A., Peled, A., Samira, S.,
Kollet, O., Hershkoviz, R., Alon, R., Hardan, I., Ben-Hur, H., Naor, D.,
Nagler, A. and Lapidot, T. (2004) CD44 and hyaluronic acid cooperate
with SDF-1 in the trafficking of human CD34+ stem/progenitor cells to
bone marrow. Blood 103, 2981-2989
14 Barnes, D. J., Palaiologou, D., Panousopoulou, E., Schultheis, B.,
Yong, A. S., Wong, A., Pattacini, L., Goldman, J. M. and Melo, J. V.
(2005) Bcr-Abl expression levels determine the rate of development of
resistance to imatinib mesylate in chronic myeloid leukemia. Cancer
Res 65, 8912-8919
15 Baron, M. (2003) An overview of the Notch signalling pathway. Semin
Cell Dev Biol 14, 113-119
16 Bellavia, D., Campese, A. F., Alesse, E., Vacca, A., Felli, M. P.,
Balestri, A., Stoppacciaro, A., Tiveron, C., Tatangelo, L., Giovarelli, M.,
Gaetano, C., Ruco, L., Hoffman, E. S., Hayday, A. C., Lendahl, U.,
Frati, L., Gulino, A. and Screpanti, I. (2000) Constitutive activation of
NF-kappaB and T-cell leukemia/lymphoma in Notch3 transgenic mice.
Embo J 19, 3337-3348
17 Bellavia, D., Campese, A. F., Checquolo, S., Balestri, A., Biondi, A.,
Cazzaniga, G., Lendahl, U., Fehling, H. J., Hayday, A. C., Frati, L., von
Boehmer, H., Gulino, A. and Screpanti, I. (2002) Combined expression
of pTalpha and Notch3 in T cell leukemia identifies the requirement of
preTCR for leukemogenesis. Proc Natl Acad Sci U S A 99, 3788-3793
18 Bellavia, D., Campese, A. F., Vacca, A., Gulino, A. and Screpanti, I.
(2003) Notch3, another Notch in T cell development. Semin Immunol
15, 107-112
19 Bhardwaj, G., Murdoch, B., Wu, D., Baker, D. P., Williams, K. P.,
Chadwick, K., Ling, L. E., Karanu, F. N. and Bhatia, M. (2001) Sonic
hedgehog induces the proliferation of primitive human hematopoietic
cells via BMP regulation. Nat Immunol 2, 172-180
20 Bhatia, M., Bonnet, D., Murdoch, B., Gan, O. I. and Dick, J. E. (1998) A
newly discovered class of human hematopoietic cells with SCID-
repopulating activity. Nat Med 4, 1038-1045
21 Bhatia, R., Holtz, M., Niu, N., Gray, R., Snyder, D. S., Sawyers, C. L.,
Arber, D. A., Slovak, M. L. and Forman, S. J. (2003) Persistence of
malignant hematopoietic progenitors in chronic myelogenous leukemia
patients in complete cytogenetic remission following imatinib mesylate
treatment. Blood 101, 4701-4707
22 Bigas, A., Martin, D. I. and Milner, L. A. (1998) Notch1 and Notch2
inhibit myeloid differentiation in response to different cytokines. Mol
Cell Biol 18, 2324-2333
23 Bonde, J., Hess, D. A. and Nolta, J. A. (2004) Recent advances in
hematopoietic stem cell biology. Curr Opin Hematol 11, 392-398
24 Bonnet, D. (2003) Biology of human bone marrow stem cells. Clin Exp
Med 3, 140-149
196
25 Brady, G. and Iscove, N. N. (1993) Construction of cDNA libraries from
single cells. Methods Enzymol 225, 611-623
26 Bruchova, H., Borovanova, T., Klamova, H. and Brdicka, R. (2002)
Gene expression profiling in chronic myeloid leukemia patients treated
with hydroxyurea. Leuk Lymphoma 43, 1289-1295
27 Bruecher-Encke, B., Griffin, J. D., Neel, B. G. and Lorenz, U. (2001)
Role of the tyrosine phosphatase SHP-1 in K562 cell differentiation.
Leukemia 15, 1424-1432
28 Burchert, A. (2007) Roots of imatinib resistance: a question of self-
renewal? Drug Resist Updat 10, 152-161
29 Burchert, A., Wang, Y., Cai, D., von Bubnoff, N., Paschka, P., Muller-
Brusselbach, S., Ottmann, O. G., Duyster, J., Hochhaus, A. and
Neubauer, A. (2005) Compensatory PI3-kinase/Akt/mTor activation
regulates imatinib resistance development. Leukemia 19, 1774-1782
30 Callahan, R. and Raafat, A. (2001) Notch signaling in mammary gland
tumorigenesis. J Mammary Gland Biol Neoplasia 6, 23-36
31 Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D.
P., Knight, M. C., Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F.
R., Milner, L. A., Kronenberg, H. M. and Scadden, D. T. (2003)
Osteoblastic cells regulate the haematopoietic stem cell niche. Nature
425, 841-846
32 Cantley, L. C. (2002) The phosphoinositide 3-kinase pathway. Science
296, 1655-1657
33 Carlesso, N., Aster, J. C., Sklar, J. and Scadden, D. T. (1999) Notch1-
induced delay of human hematopoietic progenitor cell differentiation is
associated with altered cell cycle kinetics. Blood 93, 838-848
34 Chabannon, C., Wood, P. and Torok-Storb, B. (1992) Expression of
CD7 on normal human myeloid progenitors. J Immunol 149, 2110-2113
35 Chadwick, N., Fennessy, C., Nostro, M. C., Baron, M., Brady, G. and
Buckle, A. M. (2008) Notch induces cell cycle arrest and apoptosis in
human erythroleukaemic TF-1 cells. Blood Cells Mol Dis 41, 270-277
36 Chadwick, N., Nostro, M. C., Baron, M., Mottram, R., Brady, G. and
Buckle, A. M. (2007) Notch signaling induces apoptosis in primary
human CD34+ hematopoietic progenitor cells. Stem Cells 25, 203-210
37 Chai, S. K., Nichols, G. L. and Rothman, P. (1997) Constitutive
activation of JAKs and STATs in BCR-Abl-expressing cell lines and
peripheral blood cells derived from leukemic patients. J Immunol 159,
4720-4728
38 Cheng, T., Rodrigues, N., Dombkowski, D., Stier, S. and Scadden, D.
T. (2000) Stem cell repopulation efficiency but not pool size is
governed by p27(kip1). Nat Med 6, 1235-1240
39 Chiaramonte, R., Basile, A., Tassi, E., Calzavara, E., Cecchinato, V.,
Rossi, V., Biondi, A. and Comi, P. (2005) A wide role for NOTCH1
signaling in acute leukemia. Cancer Lett 219, 113-120
40 Christ, O., Gunthert, U., Haas, R. and Zoller, M. (2001) Importance of
CD44v7 isoforms for homing and seeding of hematopoietic progenitor
cells. J Leukoc Biol 69, 343-352
41 Chu, S., Holtz, M., Gupta, M. and Bhatia, R. (2004) BCR/ABL kinase
inhibition by imatinib mesylate enhances MAP kinase activity in chronic
myelogenous leukemia CD34+ cells. Blood 103, 3167-3174
197
42 Clarkson, B., Strife, A., Wisniewski, D., Lambek, C. L. and Liu, C.
(2003) Chronic myelogenous leukemia as a paradigm of early cancer
and possible curative strategies. Leukemia 17, 1211-1262
43 Clarkson, B. D., Strife, A., Wisniewski, D., Lambek, C. and Carpino, N.
(1997) New understanding of the pathogenesis of CML: a prototype of
early neoplasia. Leukemia 11, 1404-1428
44 Collins, B. J., Kleeberger, W. and Ball, D. W. (2004) Notch in lung
development and lung cancer. Semin Cancer Biol 14, 357-364
45 Coluccia, A. M., Vacca, A., Dunach, M., Mologni, L., Redaelli, S.,
Bustos, V. H., Benati, D., Pinna, L. A. and Gambacorti-Passerini, C.
(2007) Bcr-Abl stabilizes beta-catenin in chronic myeloid leukemia
through its tyrosine phosphorylation. Embo J 26, 1456-1466
46 Copland, M., Hamilton, A., Elrick, L. J., Baird, J. W., Allan, E. K.,
Jordanides, N., Barow, M., Mountford, J. C. and Holyoake, T. L. (2006)
Dasatinib (BMS-354825) targets an earlier progenitor population than
imatinib in primary CML but does not eliminate the quiescent fraction.
Blood 107, 4532-4539
47 Copland, M., Pellicano, F., Richmond, L., Allan, E. K., Hamilton, A.,
Lee, F. Y., Weinmann, R. and Holyoake, T. L. (2008) BMS-214662
potently induces apoptosis of chronic myeloid leukemia stem and
progenitor cells and synergizes with tyrosine kinase inhibitors. Blood
111, 2843-2853
48 Coulombel, L. (2004) Identification of hematopoietic stem/progenitor
cells: strength and drawbacks of functional assays. Oncogene 23,
7210-7222
49 Craddock, C. F., Nakamoto, B., Andrews, R. G., Priestley, G. V. and
Papayannopoulou, T. (1997) Antibodies to VLA4 integrin mobilize long-
term repopulating cells and augment cytokine-induced mobilization in
primates and mice. Blood 90, 4779-4788
50 Crowner, D., Le Gall, M., Gates, M. A. and Giniger, E. (2003) Notch
steers Drosophila ISNb motor axons by regulating the Abl signaling
pathway. Curr Biol 13, 967-972
51 Dando, J. S., Tavian, M., Catelain, C., Poirault, S., Bennaceur-Griscelli,
A., Sainteny, F., Vainchenker, W., Peault, B. and Lauret, E. (2005)
Notch/Delta4 interaction in human embryonic liver CD34+ CD38- cells:
positive influence on BFU-E production and LTC-IC potential
maintenance. Stem Cells 23, 550-560
52 Das, I., Craig, C., Funahashi, Y., Jung, K. M., Kim, T. W., Byers, R.,
Weng, A. P., Kutok, J. L., Aster, J. C. and Kitajewski, J. (2004) Notch
oncoproteins depend on gamma-secretase/presenilin activity for
processing and function. J Biol Chem 279, 30771-30780
53 Davis, R. L. and Turner, D. L. (2001) Vertebrate hairy and Enhancer of
split related proteins: transcriptional repressors regulating cellular
differentiation and embryonic patterning. Oncogene 20, 8342-8357
54 De Keersmaecker, K., Lahortiga, I., Mentens, N., Folens, C., Van
Neste, L., Bekaert, S., Vandenberghe, P., Odero, M. D., Marynen, P.
and Cools, J. (2008a) In vitro validation of gamma-secretase inhibitors
alone or in combination with other anti-cancer drugs for the treatment
of T-cell acute lymphoblastic leukemia. Haematologica 93, 533-542
198
55 De Keersmaecker, K., Versele, M., Cools, J., Superti-Furga, G. and
Hantschel, O. (2008b) Intrinsic differences between the catalytic
properties of the oncogenic NUP214-ABL1 and BCR-ABL1 fusion
protein kinases. Leukemia
56 Deftos, M. L. and Bevan, M. J. (2000) Notch signaling in T cell
development. Curr Opin Immunol 12, 166-172
57 Deininger, M. W., Goldman, J. M. and Melo, J. V. (2000) The molecular
biology of chronic myeloid leukemia. Blood 96, 3343-3356
58 Deininger, M. W. and Holyoake, T. L. (2005) Can we afford to let
sleeping dogs lie? Blood 105, 1840-1841
59 Delforge, M., Boogaerts, M. A., McGlave, P. B. and Verfaillie, C. M.
(1999) BCR/ABL- CD34(+)HLA-DR- progenitor cells in early chronic
phase, but not in more advanced phases, of chronic myelogenous
leukemia are polyclonal. Blood 93, 284-292
60 Desplat, V., Lagarde, V., Belloc, F., Chollet, C., Leguay, T., Pasquet, J.
M., Praloran, V. and Mahon, F. X. (2004) Rapid detection of
phosphotyrosine proteins by flow cytometric analysis in Bcr-Abl-
positive cells. Cytometry A 62, 35-45
61 Dierks, C., Beigi, R., Guo, G. R., Zirlik, K., Stegert, M. R., Manley, P.,
Trussell, C., Schmitt-Graeff, A., Landwerlin, K., Veelken, H. and
Warmuth, M. (2008) Expansion of Bcr-Abl-positive leukemic stem cells
is dependent on Hedgehog pathway activation. Cancer Cell 14, 238-
249
62 Drexler, H. G., MacLeod, R. A. and Uphoff, C. C. (1999) Leukemia cell
lines: in vitro models for the study of Philadelphia chromosome-positive
leukemia. Leuk Res 23, 207-215
63 Druker, B. J., Guilhot, F., O'Brien, S. G., Gathmann, I., Kantarjian, H.,
Gattermann, N., Deininger, M. W., Silver, R. T., Goldman, J. M., Stone,
R. M., Cervantes, F., Hochhaus, A., Powell, B. L., Gabrilove, J. L.,
Rousselot, P., Reiffers, J., Cornelissen, J. J., Hughes, T., Agis, H.,
Fischer, T., Verhoef, G., Shepherd, J., Saglio, G., Gratwohl, A.,
Nielsen, J. L., Radich, J. P., Simonsson, B., Taylor, K., Baccarani, M.,
So, C., Letvak, L. and Larson, R. A. (2006) Five-year follow-up of
patients receiving imatinib for chronic myeloid leukemia. N Engl J Med
355, 2408-2417
64 Druker, B. J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G. M.,
Fanning, S., Zimmermann, J. and Lydon, N. B. (1996) Effects of a
selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl
positive cells. Nat Med 2, 561-566
65 Dube, I. D., Arlin, Z. A., Kalousek, D. K., Eaves, C. J. and Eaves, A. C.
(1984) Nonclonal hemopoietic progenitor cells detected in long-term
marrow cultures from a Turner syndrome mosaic with chronic myeloid
leukemia. Blood 64, 1284-1287
66 Duechler, M., Shehata, M., Schwarzmeier, J. D., Hoelbl, A., Hilgarth,
M. and Hubmann, R. (2005) Induction of apoptosis by proteasome
inhibitors in B-CLL cells is associated with downregulation of CD23 and
inactivation of Notch2. Leukemia 19, 260-267
67 Duncan, A. W., Rattis, F. M., DiMascio, L. N., Congdon, K. L.,
Pazianos, G., Zhao, C., Yoon, K., Cook, J. M., Willert, K., Gaiano, N.
199
and Reya, T. (2005) Integration of Notch and Wnt signaling in
hematopoietic stem cell maintenance. Nat Immunol 6, 314-322
68 Effros, R. B. and Globerson, A. (2002) Hematopoietic cells and
replicative senescence. Exp Gerontol 37, 191-196
69 Eisele, Y. S., Baumann, M., Klebl, B., Nordhammer, C., Jucker, M. and
Kilger, E. (2007) Gleevec increases levels of the amyloid precursor
protein intracellular domain and of the amyloid-beta degrading enzyme
neprilysin. Mol Biol Cell 18, 3591-3600
70 Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C.,
Smith, S. D. and Sklar, J. (1991) TAN-1, the human homolog of the
Drosophila notch gene, is broken by chromosomal translocations in T
lymphoblastic neoplasms. Cell 66, 649-661
71 Elrick, L. J., Jorgensen, H. G., Mountford, J. C. and Holyoake, T. L.
(2005) Punish the parent not the progeny. Blood 105, 1862-1866
72 Fang, B., Zheng, C., Liao, L., Han, Q., Sun, Z., Jiang, X. and Zhao, R.
C. (2005) Identification of human chronic myelogenous leukemia
progenitor cells with hemangioblastic characteristics. Blood 105, 2733-
2740
73 Fetscher, S., Mertelsmann, R. (2002.) Haematopoietic geowth factors:
therapeutic uses. In Nature Encyclopedia of Life Sciences., Nature
publishing group.
200
suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes
Dev 10, 1930-1944
84 Goldsby, R. A. and Goldsby, R. A. K. i. (2003) Immunology. W.H.
Freeman, New York ; Houndmills
85 Gordon, M. Y., Dowding, C. R., Riley, G. P., Goldman, J. M. and
Greaves, M. F. (1989) Adhesive defects in chronic myeloid leukemia.
Curr Top Microbiol Immunol 149, 151-155
86 Gorre, M. E., Mohammed, M., Ellwood, K., Hsu, N., Paquette, R., Rao,
P. N. and Sawyers, C. L. (2001) Clinical resistance to STI-571 cancer
therapy caused by BCR-ABL gene mutation or amplification. Science
293, 876-880
87 Grabher, C., von Boehmer, H. and Look, A. T. (2006) Notch 1
activation in the molecular pathogenesis of T-cell acute lymphoblastic
leukaemia. Nat Rev Cancer 6, 347-359
88 Graham, S. M., Jorgensen, H. G., Allan, E., Pearson, C., Alcorn, M. J.,
Richmond, L. and Holyoake, T. L. (2002) Primitive, quiescent,
Philadelphia-positive stem cells from patients with chronic myeloid
leukemia are insensitive to STI571 in vitro. Blood 99, 319-325
89 Grand, F. H., Marley, S. B., Chase, A., Titley, I., Healy, L., Spencer, A.,
Reiter, A., Goldman, J. M. and Gordon, M. Y. (1997) BCR/ABL-
negative progenitors are enriched in the adherent fraction of CD34+
cells circulating in the blood of chronic phase chronic myeloid leukemia
patients. Leukemia 11, 1486-1492
90 Graux, C., Cools, J., Melotte, C., Quentmeier, H., Ferrando, A., Levine,
R., Vermeesch, J. R., Stul, M., Dutta, B., Boeckx, N., Bosly, A.,
Heimann, P., Uyttebroeck, A., Mentens, N., Somers, R., MacLeod, R.
A., Drexler, H. G., Look, A. T., Gilliland, D. G., Michaux, L.,
Vandenberghe, P., Wlodarska, I., Marynen, P. and Hagemeijer, A.
(2004) Fusion of NUP214 to ABL1 on amplified episomes in T-cell
acute lymphoblastic leukemia. Nat Genet 36, 1084-1089
91 Greenblatt, D. Y., Vaccaro, A. M., Jaskula-Sztul, R., Ning, L., Haymart,
M., Kunnimalaiyaan, M. and Chen, H. (2007) Valproic acid activates
notch-1 signaling and regulates the neuroendocrine phenotype in
carcinoid cancer cells. Oncologist 12, 942-951
92 Gridley, T. (2004) Kick it up a Notch: NOTCH1 activation in T-ALL.
Cancer Cell 6, 431-432
93 Guidos, C. J. (2002) Notch signaling in lymphocyte development.
Semin Immunol 14, 395-404
94 Guo, M., Jan, L. Y. and Jan, Y. N. (1996) Control of daughter cell fates
during asymmetric division: interaction of Numb and Notch. Neuron 17,
27-41
95 Hamilton, A., Elrick, L., Myssina, S., Copland, M., Jorgensen, H., Melo,
J. V. and Holyoake, T. (2006) BCR-ABL activity and its response to
drugs can be determined in CD34+ CML stem cells by CrkL
phosphorylation status using flow cytometry. Leukemia 20, 1035-1039
96 Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K., Yoshimoto, M.,
Nakahata, T., Ikuta, K. and Honjo, T. (2002) Inducible gene knockout of
transcription factor recombination signal binding protein-J reveals its
essential role in T versus B lineage decision. Int Immunol 14, 637-645
201
97 Han, W., Ye, Q. and Moore, M. A. S. (2000) A soluble form of human
Delta-like-1 inhibits differentiation of hematopoietic progenitor cells.
Blood 95, 1616-1625
98 Hao, S. X. and Ren, R. (2000) Expression of interferon consensus
sequence binding protein (ICSBP) is downregulated in Bcr-Abl-induced
murine chronic myelogenous leukemia-like disease, and forced
coexpression of ICSBP inhibits Bcr-Abl-induced myeloproliferative
disorder. Mol Cell Biol 20, 1149-1161
99 He, F., Wang, L., Hu, X. B., Yin, D. D., Zhang, P., Li, G. H., Wang, Y.
C., Huang, S. Y., Liang, Y. M. and Han, H. (2008) Notch and BCR
signaling synergistically promote the proliferation of Raji B-lymphoma
cells. Leuk Res
100 Henning, K., Schroeder, T., Schwanbeck, R., Rieber, N., Bresnick, E.
H. and Just, U. (2007) mNotch1 signaling and erythropoietin cooperate
in erythroid differentiation of multipotent progenitor cells and upregulate
beta-globin. Exp Hematol 35, 1321-1332
101 Holtz, M. S., Slovak, M. L., Zhang, F., Sawyers, C. L., Forman, S. J.
and Bhatia, R. (2002) Imatinib mesylate (STI571) inhibits growth of
primitive malignant progenitors in chronic myelogenous leukemia
through reversal of abnormally increased proliferation. Blood 99, 3792-
3800
102 Holyoake, T. L., Jiang, X., Jorgensen, H. G., Graham, S., Alcorn, M. J.,
Laird, C., Eaves, A. C. and Eaves, C. J. (2001) Primitive quiescent
leukemic cells from patients with chronic myeloid leukemia
spontaneously initiate factor-independent growth in vitro in association
with up-regulation of expression of interleukin-3. Blood 97, 720-728
103 Honda, H., Oda, H., Suzuki, T., Takahashi, T., Witte, O. N., Ozawa, K.,
Ishikawa, T., Yazaki, Y. and Hirai, H. (1998) Development of acute
lymphoblastic leukemia and myeloproliferative disorder in transgenic
mice expressing p210bcr/abl: a novel transgenic model for human Ph1-
positive leukemias. Blood 91, 2067-2075
104 Hows, J. (2005) Adult stem cell therapy beyond haemopoietic stem cell
transplantation? An update. Transpl Immunol 14, 221-223
105 Hu, Y., Chen, Y., Douglas, L. and Li, S. (2008) beta-Catenin is
essential for survival of leukemic stem cells insensitive to kinase
inhibition in mice with BCR-ABL-induced chronic myeloid leukemia.
Leukemia
106 Hubmann, R., Schwarzmeier, J. D., Shehata, M., Hilgarth, M.,
Duechler, M., Dettke, M. and Berger, R. (2002) Notch2 is involved in
the overexpression of CD23 in B-cell chronic lymphocytic leukemia.
Blood 99, 3742-3747
107 Huettner, C. S., Zhang, P., Van Etten, R. A. and Tenen, D. G. (2000)
Reversibility of acute B-cell leukaemia induced by BCR-ABL1. Nat
Genet 24, 57-60
108 Inokuchi, K. (2006) Chronic myelogenous leukemia: from molecular
biology to clinical aspects and novel targeted therapies. J Nippon Med
Sch 73, 178-192
109 Ishiko, E., Matsumura, I., Ezoe, S., Gale, K., Ishiko, J., Satoh, Y.,
Tanaka, H., Shibayama, H., Mizuki, M., Era, T., Enver, T. and
Kanakura, Y. (2005) Notch Signals Inhibit the Development of
202
Erythroid/Megakaryocytic Cells by Suppressing GATA-1 Activity
through the Induction of HES1. J Biol Chem 280, 4929-4939
110 Iso, T., Kedes, L. and Hamamori, Y. (2003) HES and HERP families:
multiple effectors of the Notch signaling pathway. J Cell Physiol 194,
237-255
111 Izon, D. J., Aster, J. C., He, Y., Weng, A., Karnell, F. G., Patriub, V.,
Xu, L., Bakkour, S., Rodriguez, C., Allman, D. and Pear, W. S. (2002)
Deltex1 redirects lymphoid progenitors to the B cell lineage by
antagonizing Notch1. Immunity 16, 231-243
112 Jacobsen, L. and Hughes, P. (2007) Effects of Passage Number on
Cell Line Transfection. Biochemica. 3, 32
113 Jamieson, C. H., Ailles, L. E., Dylla, S. J., Muijtjens, M., Jones, C.,
Zehnder, J. L., Gotlib, J., Li, K., Manz, M. G., Keating, A., Sawyers, C.
L. and Weissman, I. L. (2004) Granulocyte-macrophage progenitors as
candidate leukemic stem cells in blast-crisis CML. N Engl J Med 351,
657-667
114 Jarriault, S., Brou, C., Logeat, F., Schroeter, E. H., Kopan, R. and
Israel, A. (1995) Signalling downstream of activated mammalian Notch.
Nature 377, 355-358
115 Jiang, X., Saw, K. M., Eaves, A. and Eaves, C. (2007a) Instability of
BCR-ABL gene in primary and cultured chronic myeloid leukemia stem
cells. J Natl Cancer Inst 99, 680-693
116 Jiang, X., Zhao, Y., Smith, C., Gasparetto, M., Turhan, A., Eaves, A.
and Eaves, C. (2007b) Chronic myeloid leukemia stem cells possess
multiple unique features of resistance to BCR-ABL targeted therapies.
Leukemia 21, 926-935
117 Jonsson, J. I., Xiang, Z., Pettersson, M., Lardelli, M. and Nilsson, G.
(2001) Distinct and regulated expression of Notch receptors in
hematopoietic lineages and during myeloid differentiation. Eur J
Immunol 31, 3240-3247
118 Jordan, C. T. and Guzman, M. L. (2004) Mechanisms controlling
pathogenesis and survival of leukemic stem cells. Oncogene 23, 7178-
7187
119 Jorgensen, H. G. and Holyoake, T. L. (2007) Characterization of
cancer stem cells in chronic myeloid leukaemia. Biochem Soc Trans
35, 1347-1351
120 Joutel, A., Dodick, D. D., Parisi, J. E., Cecillon, M., Tournier-Lasserve,
E. and Bousser, M. G. (2000) De novo mutation in the Notch3 gene
causing CADASIL. Ann Neurol 47, 388-391
121 Jundt, F., Anagnostopoulos, I., Forster, R., Mathas, S., Stein, H. and
Dorken, B. (2002) Activated Notch1 signaling promotes tumor cell
proliferation and survival in Hodgkin and anaplastic large cell
lymphoma. Blood 99, 3398-3403
122 Jundt, F., Probsting, K. S., Anagnostopoulos, I., Muehlinghaus, G.,
Chatterjee, M., Mathas, S., Bargou, R. C., Manz, R., Stein, H. and
Dorken, B. (2004) Jagged1-induced Notch signaling drives proliferation
of multiple myeloma cells. Blood 103, 3511-3515
123 Kabarowski, J. H. and Witte, O. N. (2000) Consequences of BCR-ABL
expression within the hematopoietic stem cell in chronic myeloid
leukemia. Stem Cells 18, 399-408
203
124 Kageyama, R., Ohtsuka, T. and Tomita, K. (2000) The bHLH gene
Hes1 regulates differentiation of multiple cell types. Mol Cells 10, 1-7
125 Kantarjian, H. M., Talpaz, M., Giles, F., O'Brien, S. and Cortes, J.
(2006) New insights into the pathophysiology of chronic myeloid
leukemia and imatinib resistance. Ann Intern Med 145, 913-923
126 Karanu, F. N., Murdoch, B., Gallacher, L., Wu, D. M., Koremoto, M.,
Sakano, S. and Bhatia, M. (2000) The Notch Ligand Jagged-1
Represents a Novel Growth Factor of Human Hematopoietic Stem
Cells. J. Exp. Med. 192, 1365-1372
127 Katoh, M. and Katoh, M. (2007) WNT signaling pathway and stem cell
signaling network. Clin Cancer Res 13, 4042-4045
128 Kerkela, R., Grazette, L., Yacobi, R., Iliescu, C., Patten, R., Beahm, C.,
Walters, B., Shevtsov, S., Pesant, S., Clubb, F. J., Rosenzweig, A.,
Salomon, R. N., Van Etten, R. A., Alroy, J., Durand, J. B. and Force, T.
(2006) Cardiotoxicity of the cancer therapeutic agent imatinib mesylate.
Nat Med 12, 908-916
129 Kidd, S., Lockett, T. J. and Young, M. W. (1983) The Notch locus of
Drosophila melanogaster. Cell 34, 421-433
130 Kim, H. K. and Siu, G. (1998) The notch pathway intermediate HES-1
silences CD4 gene expression. Mol Cell Biol 18, 7166-7175
131 Koch, U., Lacombe, T. A., Holland, D., Bowman, J. L., Cohen, B. L.,
Egan, S. E. and Guidos, C. J. (2001) Subversion of the T/B lineage
decision in the thymus by lunatic fringe-mediated inhibition of Notch-1.
Immunity 15, 225-236
132 Kogoshi, H., Sato, T., Koyama, T., Nara, N. and Tohda, S. (2007)
Gamma-secretase inhibitors suppress the growth of leukemia and
lymphoma cells. Oncol Rep 18, 77-80
133 Kojika, S. and Griffin, J. D. (2001) Notch receptors and hematopoiesis.
Exp Hematol 29, 1041-1052
134 Kollet, O., Peled, A., Byk, T., Ben-Hur, H., Greiner, D., Shultz, L. and
Lapidot, T. (2000) beta2 microglobulin-deficient (B2m(null)) NOD/SCID
mice are excellent recipients for studying human stem cell function.
Blood 95, 3102-3105
135 Kondo, M., Wagers, A. J., Manz, M. G., Prohaska, S. S., Scherer, D.
C., Beilhack, G. F., Shizuru, J. A. and Weissman, I. L. (2003) Biology of
hematopoietic stem cells and progenitors: implications for clinical
application. Annu Rev Immunol 21, 759-806
136 Kosugi, N., Ebihara, Y., Nakahata, T., Saisho, H., Asano, S. and Tojo,
A. (2005) CD34+CD7+ leukemic progenitor cells may be involved in
maintenance and clonal evolution of chronic myeloid leukemia. Clin
Cancer Res 11, 505-511
137 Krause, D. S. (2002) Regulation of hematopoietic stem cell fate.
Oncogene 21, 3262-3269
138 Lai, E. C. (2004) Notch signaling: control of cell communication and cell
fate. Development 131, 965-973
139 Lam, L. T., Ronchini, C., Norton, J., Capobianco, A. J. and Bresnick, E.
H. (2000) Suppression of erythroid but not megakaryocytic
differentiation of human K562 erythroleukemic cells by notch-1. J Biol
Chem 275, 19676-19684
204
140 Lanctot, P. M., Leclerc, P. C., Clement, M., Auger-Messier, M., Escher,
E., Leduc, R. and Guillemette, G. (2005) Importance of N-glycosylation
positioning for cell-surface expression, targeting, affinity and quality
control of the human AT1 receptor. Biochem J 390, 367-376
141 Larsson, J. and Karlsson, S. (2005) The role of Smad signaling in
hematopoiesis. Oncogene 24, 5676-5692
142 Lataillade, J. J., Clay, D., David, C., Boutin, L., Guerton, B., Drouet, M.,
Herodin, F. and Le Bousse-Kerdiles, M. C. (2005) Phenotypic and
functional characteristics of CD34+ cells are related to their anatomical
environment: is their versatility a prerequisite for their bio-availability? J
Leukoc Biol
143 Li, L., Milner, L. A., Deng, Y., Iwata, M., Banta, A., Graf, L., Marcovina,
S., Friedman, C., Trask, B. J., Hood, L. and Torok-Storb, B. (1998) The
human homolog of rat Jagged1 expressed by marrow stroma inhibits
differentiation of 32D cells through interaction with Notch1. Immunity 8,
43-55
144 Livak, K. J. and Schmittgen, T. D. (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-Delta
Delta C(T)) Method. Methods 25, 402-408
145 Lundell, B. I., McCarthy, J. B., Kovach, N. L. and Verfaillie, C. M.
(1997) Activation of beta1 integrins on CML progenitors reveals
cooperation between beta1 integrins and CD44 in the regulation of
adhesion and proliferation. Leukemia 11, 822-829
146 Maciejewski, J., Selleri, C., Anderson, S. and Young, N. S. (1995) Fas
antigen expression on CD34+ human marrow cells is induced by
interferon gamma and tumor necrosis factor alpha and potentiates
cytokine-mediated hematopoietic suppression in vitro. Blood 85, 3183-
3190
147 Maguer-Satta, V., Petzer, A. L., Eaves, A. C. and Eaves, C. J. (1996)
BCR-ABL expression in different subpopulations of functionally
characterized Ph+ CD34+ cells from patients with chronic myeloid
leukemia. Blood 88, 1796-1804
148 Maillard, I., Adler, S. H. and Pear, W. S. (2003) Notch and the immune
system. Immunity 19, 781-791
149 Maillard, I., Koch, U., Dumortier, A., Shestova, O., Xu, L., Sai, H.,
Pross, S. E., Aster, J. C., Bhandoola, A., Radtke, F. and Pear, W. S.
(2008) Canonical notch signaling is dispensable for the maintenance of
adult hematopoietic stem cells. Cell Stem Cell 2, 356-366
150 Mancuso, P., Burlini, A., Pruneri, G., Goldhirsch, A., Martinelli, G. and
Bertolini, F. (2001) Resting and activated endothelial cells are
increased in the peripheral blood of cancer patients. Blood 97, 3658-
3661
151 Marley, S. B. and Gordon, M. Y. (2005) Chronic myeloid leukaemia:
stem cell derived but progenitor cell driven. Clin Sci (Lond) 109, 13-25
152 Martinez Arias, A., Zecchini, V. and Brennan, K. (2002) CSL-
independent Notch signalling: a checkpoint in cell fate decisions during
development? Curr Opin Genet Dev 12, 524-533
153 Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and
Artavanis-Tsakonas, S. (1995) Deltex acts as a positive regulator of
205
Notch signaling through interactions with the Notch ankyrin repeats.
Development 121, 2633-2644
154 Mayerhofer, M., Valent, P., Sperr, W. R., Griffin, J. D. and Sillaber, C.
(2002) BCR/ABL induces expression of vascular endothelial growth
factor and its transcriptional activator, hypoxia inducible factor-1alpha,
through a pathway involving phosphoinositide 3-kinase and the
mammalian target of rapamycin. Blood 100, 3767-3775
155 McGill, M. A. and McGlade, C. J. (2003) Mammalian numb proteins
promote Notch1 receptor ubiquitination and degradation of the Notch1
intracellular domain. J Biol Chem 278, 23196-23203
156 Melo, J. (2001) Inviting leukemic cells to waltz with the devil. Nat Med
7, 156-157
157 Milner, L. A. and Bigas, A. (1999) Notch as a mediator of cell fate
determination in hematopoiesis: evidence and speculation. Blood 93,
2431-2448
158 Milner, L. A., Bigas, A., Kopan, R., Brashem-Stein, C., Bernstein, I. D.
and Martin, D. I. (1996) Inhibition of granulocytic differentiation by
mNotch1. Proc Natl Acad Sci U S A 93, 13014-13019
159 Milner, L. A., Kopan, R., Martin, D. I. and Bernstein, I. D. (1994) A
human homologue of the Drosophila developmental gene, Notch, is
expressed in CD34+ hematopoietic precursors. Blood 83, 2057-2062
160 Miyazato, A., Ueno, S., Ohmine, K., Ueda, M., Yoshida, K., Yamashita,
Y., Kaneko, T., Mori, M., Kirito, K., Toshima, M., Nakamura, Y., Saito,
K., Kano, Y., Furusawa, S., Ozawa, K. and Mano, H. (2001)
Identification of myelodysplastic syndrome-specific genes by DNA
microarray analysis with purified hematopoietic stem cell fraction.
Blood 98, 422-427
161 Mizuno, T., Yamasaki, N., Miyazaki, K., Tazaki, T., Koller, R., Oda, H.,
Honda, Z. I., Ochi, M., Wolff, L. and Honda, H. (2008)
Overexpression/enhanced kinase activity of BCR/ABL and altered
expression of Notch1 induced acute leukemia in p210BCR/ABL
transgenic mice. Oncogene 27, 3465-3474
162 Mumm, J. S. and Kopan, R. (2000) Notch signaling: from the outside
in. Dev Biol 228, 151-165
163 Nagar, B. (2007) c-Abl tyrosine kinase and inhibition by the cancer
drug imatinib (Gleevec/STI-571). J Nutr 137, 1518S-1523S; discussion
1548S
164 Nam, Y., Aster, J. C. and Blacklow, S. C. (2002) Notch signaling as a
therapeutic target. Curr Opin Chem Biol 6, 501-509
165 Nefedova, Y., Cheng, P., Alsina, M., Dalton, W. S. and Gabrilovich, D.
I. (2004) Involvement of Notch-1 signaling in bone marrow stroma-
mediated de novo drug resistance of myeloma and other malignant
lymphoid cell lines. Blood 103, 3503-3510
166 Nervi, B., Link, D. C. and DiPersio, J. F. (2006) Cytokines and
hematopoietic stem cell mobilization. J Cell Biochem 99, 690-705
167 Neshat, M. S., Raitano, A. B., Wang, H. G., Reed, J. C. and Sawyers,
C. L. (2000) The survival function of the Bcr-Abl oncogene is mediated
by Bad-dependent and -independent pathways: roles for
phosphatidylinositol 3-kinase and Raf. Mol Cell Biol 20, 1179-1186
206
168 Nicolas, M., Wolfer, A., Raj, K., Kummer, J. A., Mill, P., van Noort, M.,
Hui, C. C., Clevers, H., Dotto, G. P. and Radtke, F. (2003) Notch1
functions as a tumor suppressor in mouse skin. Nat Genet 33, 416-421
169 Normann, A. P., Egeland, T., Madshus, I. H., Heim, S. and Tjonnfjord,
G. E. (2003) CD7 expression by CD34+ cells in CML patients, of
prognostic significance? Eur J Haematol 71, 266-275
170 Nutt, S. L., Eberhard, D., Horcher, M., Rolink, A. G. and Busslinger, M.
(2001) Pax5 determines the identity of B cells from the beginning to the
end of B-lymphopoiesis. Int Rev Immunol 20, 65-82
171 Oda, T., Heaney, C., Hagopian, J. R., Okuda, K., Griffin, J. D. and
Druker, B. J. (1994) Crkl is the major tyrosine-phosphorylated protein in
neutrophils from patients with chronic myelogenous leukemia. J Biol
Chem 269, 22925-22928
172 Oertel, J., Oertel, B., Schleicher, J. and Huhn, D. (1996) Immunotyping
of blasts in human bone marrow. Ann Hematol 72, 125-129
173 Ohishi, K., Katayama, N., Shiku, H., Varnum-Finney, B. and Bernstein,
I. D. (2003) Notch signalling in hematopoiesis. Semin Cell Dev Biol 14,
143-150
174 Ohishi, K., Varnum-Finney, B., Flowers, D., Anasetti, C., Myerson, D.
and Bernstein, I. D. (2000) Monocytes express high amounts of Notch
and undergo cytokine specific apoptosis following interaction with the
Notch ligand, Delta-1. Blood 95, 2847-2854
175 O'Neil, J., Calvo, J., McKenna, K., Krishnamoorthy, V., Aster, J. C.,
Bassing, C. H., Alt, F. W., Kelliher, M. and Look, A. T. (2006) Activating
Notch1 mutations in mouse models of T-ALL. Blood 107, 781-785
176 Ostrowska, B., Sacha, T., Szostek, M., Zawada, M., Skotnicki, A.,
Laidler, P. (2003) The involvement of Abl and Bcr-Abl proteins in Notch
signalling pathway in haematopoietic normal and CML CD34+ cells.
177 Oswald, F., Liptay, S., Adler, G. and Schmid, R. M. (1998) NF-kappaB2
is a putative target gene of activated Notch-1 via RBP-Jkappa. Mol Cell
Biol 18, 2077-2088
178 Pallister, C. (1998) Blood : physiology and pathophysiology.
Butterworth-Heinemann, Oxford
179 Palomero, T., Sulis, M. L., Cortina, M., Real, P. J., Barnes, K., Ciofani,
M., Caparros, E., Buteau, J., Brown, K., Perkins, S. L., Bhagat, G.,
Agarwal, A. M., Basso, G., Castillo, M., Nagase, S., Cordon-Cardo, C.,
Parsons, R., Zuniga-Pflucker, J. C., Dominguez, M. and Ferrando, A.
A. (2007) Mutational loss of PTEN induces resistance to NOTCH1
inhibition in T-cell leukemia. Nat Med 13, 1203-1210
180 Panin, V. M. and Irvine, K. D. (1998) Modulators of Notch signaling.
Semin Cell Dev Biol 9, 609-617
181 Pear, W. S., Aster, J. C., Scott, M. L., Hasserjian, R. P., Soffer, B.,
Sklar, J. and Baltimore, D. (1996) Exclusive development of T cell
neoplasms in mice transplanted with bone marrow expressing
activated Notch alleles. J Exp Med 183, 2283-2291
182 Pear, W. S. and Radtke, F. (2003) Notch signaling in lymphopoiesis.
Semin Immunol 15, 69-79
183 Petzer, A. L., Eaves, C. J., Lansdorp, P. M., Ponchio, L., Barnett, M. J.
and Eaves, A. C. (1996) Characterization of primitive subpopulations of
normal and leukemic cells present in the blood of patients with newly
207
diagnosed as well as established chronic myeloid leukemia. Blood 88,
2162-2171
184 Petzer, A. L. and Gunsilius, E. (2003) Hematopoietic stem cells in
chronic myeloid leukemia. Arch Med Res 34, 496-506
185 Platta, C. S., Greenblatt, D. Y., Kunnimalaiyaan, M. and Chen, H.
(2008) Valproic acid induces Notch1 signaling in small cell lung cancer
cells. J Surg Res 148, 31-37
186 Pui, J. C., Allman, D., Xu, L., DeRocco, S., Karnell, F. G., Bakkour, S.,
Lee, J. Y., Kadesch, T., Hardy, R. R., Aster, J. C. and Pear, W. S.
(1999) Notch1 expression in early lymphopoiesis influences B versus T
lineage determination. Immunity 11, 299-308
187 Quintas-Cardama, A. and Cortes, J. (2008) Molecular biology of BCR-
ABL1-positive chronic myeloid leukemia. Blood
188 Quintas-Cardama, A., Tong, W., Manshouri, T., Vega, F., Lennon, P.
A., Cools, J., Gilliland, D. G., Lee, F., Cortes, J., Kantarjian, H. and
Garcia-Manero, G. (2008) Activity of tyrosine kinase inhibitors against
human NUP214-ABL1-positive T cell malignancies. Leukemia 22,
1117-1124
189 Radtke, F. and Raj, K. (2003) THE ROLE OF NOTCH IN
TUMORIGENESIS: ONCOGENE OR TUMOUR SUPPRESSOR?
Nature Reviews Cancer
Nat Rev Cancer 3, 756-767
190 Radtke, F., Wilson, A. and MacDonald, H. R. (2004) Notch signaling in
T- and B-cell development. Curr Opin Immunol 16, 174-179
191 Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J.,
MacDonald, H. R. and Aguet, M. (1999) Deficient T cell fate
specification in mice with an induced inactivation of Notch1. Immunity
10, 547-558
192 Rao, M. S. and Mattson, M. P. (2001) Stem cells and aging: expanding
the possibilities. Mech Ageing Dev 122, 713-734
193 Reizis, B. and Leder, P. (2002) Direct induction of T lymphocyte-
specific gene expression by the mammalian Notch signaling pathway.
Genes Dev 16, 295-300
194 Ren, R. (2005) Mechanisms of BCR-ABL in the pathogenesis of
chronic myelogenous leukaemia. Nat Rev Cancer 5, 172-183
195 Reya, T., Duncan, A. W., Ailles, L., Domen, J., Scherer, D. C., Willert,
K., Hintz, L., Nusse, R. and Weissman, I. L. (2003) A role for Wnt
signalling in self-renewal of haematopoietic stem cells. Nature 423,
409-414
196 Rhodes, J., York, R. D., Tara, D., Tajinda, K. and Druker, B. J. (2000)
CrkL functions as a nuclear adaptor and transcriptional activator in Bcr-
Abl-expressing cells. Exp Hematol 28, 305-310
197 Rizo, A., Vellenga, E., de Haan, G. and Schuringa, J. J. (2006)
Signaling pathways in self-renewing hematopoietic and leukemic stem
cells: do all stem cells need a niche? Hum Mol Genet 15 Spec No 2,
R210-219
198 Robert-Moreno, A., Espinosa, L., Sanchez, M. J., de la Pompa, J. L.
and Bigas, A. (2007) The notch pathway positively regulates
programmed cell death during erythroid differentiation. Leukemia 21,
1496-1503
208
199 Robey, E., Chang, D., Itano, A., Cado, D., Alexander, H., Lans, D.,
Weinmaster, G. and Salmon, P. (1996) An activated form of Notch
influences the choice between CD4 and CD8 T cell lineages. Cell 87,
483-492
200 Roche-Lestienne, C., Soenen-Cornu, V., Grardel-Duflos, N., Lai, J. L.,
Philippe, N., Facon, T., Fenaux, P. and Preudhomme, C. (2002)
Several types of mutations of the Abl gene can be found in chronic
myeloid leukemia patients resistant to STI571, and they can pre-exist
to the onset of treatment. Blood 100, 1014-1018
201 Sade, H., Krishna, S. and Sarin, A. (2004) The anti-apoptotic effect of
Notch-1 requires p56lck-dependent, Akt/PKB-mediated signaling in T
cells. J Biol Chem 279, 2937-2944
202 Saglio, G. and Cilloni, D. (2004) Abl: the prototype of oncogenic fusion
proteins. Cell Mol Life Sci 61, 2897-2911
203 Saito, T., Chiba, S., Ichikawa, M., Kunisato, A., Asai, T., Shimizu, K.,
Yamaguchi, T., Yamamoto, G., Seo, S., Kumano, K., Nakagami-
Yamaguchi, E., Hamada, Y., Aizawa, S. and Hirai, H. (2003) Notch2 is
preferentially expressed in mature B cells and indispensable for
marginal zone B lineage development. Immunity 18, 675-685
204 Salesse, S. and Verfaillie, C. M. (2002) Mechanisms underlying
abnormal trafficking and expansion of malignant progenitors in CML:
BCR/ABL-induced defects in integrin function in CML. Oncogene 21,
8605-8611
205 Satoh, Y., Matsumura, I., Tanaka, H., Ezoe, S., Sugahara, H., Mizuki,
M., Shibayama, H., Ishiko, E., Ishiko, J., Nakajima, K. and Kanakura,
Y. (2004) Roles for c-Myc in self-renewal of hematopoietic stem cells. J
Biol Chem 279, 24986-24993
206 Sattler, M., Mohi, M. G., Pride, Y. B., Quinnan, L. R., Malouf, N. A.,
Podar, K., Gesbert, F., Iwasaki, H., Li, S., Van Etten, R. A., Gu, H.,
Griffin, J. D. and Neel, B. G. (2002) Critical role for Gab2 in
transformation by BCR/ABL. Cancer Cell 1, 479-492
207 Sattler, M., Salgia, R., Okuda, K., Uemura, N., Durstin, M. A., Pisick,
E., Xu, G., Li, J. L., Prasad, K. V. and Griffin, J. D. (1996) The proto-
oncogene product p120CBL and the adaptor proteins CRKL and c-
CRK link c-ABL, p190BCR/ABL and p210BCR/ABL to the
phosphatidylinositol-3' kinase pathway. Oncogene 12, 839-846
208 Schroeder, T. and Just, U. (2000) Notch signalling via RBP-J promotes
myeloid differentiation. Embo J 19, 2558-2568
209 Schroeder, T., Kohlhof, H., Rieber, N. and Just, U. (2003) Notch
signaling induces multilineage myeloid differentiation and up-regulates
PU.1 expression. J Immunol 170, 5538-5548
210 Schwartz, M. A., Schaller, M. D. and Ginsberg, M. H. (1995) Integrins:
emerging paradigms of signal transduction. Annu Rev Cell Dev Biol 11,
549-599
211 Schweisguth, F. (2004) Notch signaling activity. Curr Biol 14, R129-138
212 Screpanti, I., Bellavia, D., Campese, A. F., Frati, L. and Gulino, A.
(2003) Notch, a unifying target in T-cell acute lymphoblastic leukemia?
Trends Mol Med 9, 30-35
213 Sengupta, A., Banerjee, D., Chandra, S., Banerji, S. K., Ghosh, R.,
Roy, R. and Banerjee, S. (2007) Deregulation and cross talk among
209
Sonic hedgehog, Wnt, Hox and Notch signaling in chronic myeloid
leukemia progression. Leukemia 21, 949-955
214 Shet, A. S., Jahagirdar, B. N. and Verfaillie, C. M. (2002) Chronic
myelogenous leukemia: mechanisms underlying disease progression.
Leukemia 16, 1402-1411
215 Shizuru, J. A., Negrin, R. S. and Weissman, I. L. (2005) Hematopoietic
stem and progenitor cells: clinical and preclinical regeneration of the
hematolymphoid system. Annu Rev Med 56, 509-538
216 Siissalo, S., Laitinen, L., Koljonen, M., Vellonen, K. S., Kortejarvi, H.,
Urtti, A., Hirvonen, J. and Kaukonen, A. M. (2007) Effect of cell
differentiation and passage number on the expression of efflux proteins
in wild type and vinblastine-induced Caco-2 cell lines. Eur J Pharm
Biopharm 67, 548-554
217 Simpson, P. (1998) Introduction: Notch signalling and choice of cell
fates in development. Semin Cell Dev Biol 9, 581-582
218 Singer, C. F., Hudelist, G., Lamm, W., Mueller, R., Handl, C., Kubista,
E. and Czerwenka, K. (2006) Active (p)CrkL is overexpressed in
human malignancies: potential role as a surrogate parameter for
therapeutic tyrosine kinase inhibition. Oncol Rep 15, 353-359
219 Singh, N., Phillips, R. A., Iscove, N. N. and Egan, S. E. (2000)
Expression of notch receptors, notch ligands, and fringe genes in
hematopoiesis. Exp Hematol 28, 527-534
220 Smith, C. (2003) Hematopoietic stem cells and hematopoiesis. Cancer
Control 10, 9-16
221 Smith, D. L., Burthem, J. and Whetton, A. D. (2003) Molecular
pathogenesis of chronic myeloid leukaemia. Expert Rev Mol Med 5, 1-
27
222 Staal, F. J. T. and Clevers, H. C. (2005) WNT SIGNALLING AND
HAEMATOPOIESIS: A WNT-WNT SITUATION. Nature Reviews
Immunology
Nat Rev Immunol 5, 21-30
223 Steidl, U., Kronenwett, R., Martin, S. and Haas, R. (2003) Molecular
biology of hematopoietic stem cells. Vitam Horm 66, 1-28
224 Stein, M. I., Zhu, J. and Emerson, S. G. (2004) Molecular pathways
regulating the self-renewal of hematopoietic stem cells. Exp Hematol
32, 1129-1136
225 Stier, S., Cheng, T., Dombkowski, D., Carlesso, N. and Scadden, D. T.
(2002) Notch1 activation increases hematopoietic stem cell self-
renewal in vivo and favors lymphoid over myeloid lineage outcome.
Blood 99, 2369-2378
226 Stockhausen, M. T., Sjolund, J., Manetopoulos, C. and Axelson, H.
(2005) Effects of the histone deacetylase inhibitor valproic acid on
Notch signalling in human neuroblastoma cells. Br J Cancer 92, 751-
759
227 Sun, X. and Artavanis-Tsakonas, S. (1997) Secreted forms of DELTA
and SERRATE define antagonists of Notch signaling in Drosophila.
Development 124, 3439-3448
228 Szilvassy, S. J. (2003) The biology of hematopoietic stem cells. Arch
Med Res 34, 446-460
210
229 Takahashi, N., Miura, I., Saitoh, K. and Miura, A. B. (1998) Lineage
involvement of stem cells bearing the philadelphia chromosome in
chronic myeloid leukemia in the chronic phase as shown by a
combination of fluorescence-activated cell sorting and fluorescence in
situ hybridization. Blood 92, 4758-4763
230 Talora, C., Sgroi, D. C., Crum, C. P. and Dotto, G. P. (2002) Specific
down-modulation of Notch1 signaling in cervical cancer cells is
required for sustained HPV-E6/E7 expression and late steps of
malignant transformation. Genes Dev 16, 2252-2263
231 Tanigaki, K., Han, H., Yamamoto, N., Tashiro, K., Ikegawa, M., Kuroda,
K., Suzuki, A., Nakano, T. and Honjo, T. (2002) Notch-RBP-J signaling
is involved in cell fate determination of marginal zone B cells. Nat
Immunol 3, 443-450
232 Tax, F. E., Yeargers, J. J. and Thomas, J. H. (1994) Sequence of C.
elegans lag-2 reveals a cell-signalling domain shared with Delta and
Serrate of Drosophila. Nature 368, 150-154
233 ten Hoeve, J., Arlinghaus, R. B., Guo, J. Q., Heisterkamp, N. and
Groffen, J. (1994) Tyrosine phosphorylation of CRKL in Philadelphia+
leukemia. Blood 84, 1731-1736
234 Tian, G., Ghanekar, S. V., Aharony, D., Shenvi, A. B., Jacobs, R. T.,
Liu, X. and Greenberg, B. D. (2003) The mechanism of gamma-
secretase: multiple inhibitor binding sites for transition state analogs
and small molecule inhibitors. J Biol Chem 278, 28968-28975
235 Tickenbrock, L., Hehn, S., Sargin, B., Evers, G., Ng, P. R., Choudhary,
C., Berdel, W. E., Muller-Tidow, C. and Serve, H. (2008) Activation of
Wnt signaling in cKit-ITD mediated transformation and imatinib
sensitivity in acute myeloid leukemia. Int J Hematol 88, 174-180
236 Tohda, S., Murata-Ohsawa, M., Sakano, S. and Nara, N. (2003) Notch
ligands, Delta-1 and Delta-4 suppress the self-renewal capacity and
long-term growth of two myeloblastic leukemia cell lines. Int J Oncol
22, 1073-1079
237 Tsai, S., Fero, J. and Bartelmez, S. (2000) Mouse Jagged2 is
differentially expressed in hematopoietic progenitors and endothelial
cells and promotes the survival and proliferation of hematopoietic
progenitors by direct cell-to-cell contact. Blood 96, 950-957
238 Uyttendaele, H., Marazzi, G., Wu, G., Yan, Q., Sassoon, D. and
Kitajewski, J. (1996) Notch4/int-3, a mammary proto-oncogene, is an
endothelial cell-specific mammalian Notch gene. Development 122,
2251-2259
239 Varnum-Finney, B., Xu, L., Brashem-Stein, C., Nourigat, C., Flowers,
D., Bakkour, S., Pear, W. S. and Bernstein, I. D. (2000) Pluripotent,
cytokine-dependent, hematopoietic stem cells are immortalized by
constitutive Notch1 signaling. Nat Med 6, 1278-1281
240 Vercauteren, S. M. and Sutherland, H. J. (2004) Constitutively active
Notch4 promotes early human hematopoietic progenitor cell
maintenance while inhibiting differentiation and causes lymphoid
abnormalities in vivo. Blood 104, 2315-2322
241 Verfaillie, C. M., Miller, W. J., Boylan, K. and McGlave, P. B. (1992)
Selection of benign primitive hematopoietic progenitors in chronic
211
myelogenous leukemia on the basis of HLA-DR antigen expression.
Blood 79, 1003-1010
242 Visnjic, D., Kalajzic, Z., Rowe, D. W., Katavic, V., Lorenzo, J. and
Aguila, H. L. (2004) Hematopoiesis is severely altered in mice with an
induced osteoblast deficiency. Blood 103, 3258-3264
243 Walker, L., Carlson, A., Tan-Pertel, H. T., Weinmaster, G. and Gasson,
J. (2001) The notch receptor and its ligands are selectively expressed
during hematopoietic development in the mouse. Stem Cells 19, 543-
552
244 Walker, L., Lynch, M., Silverman, S., Fraser, J., Boulter, J.,
Weinmaster, G. and Gasson, J. C. (1999) The Notch/Jagged pathway
inhibits proliferation of human hematopoietic progenitors in vitro. Stem
Cells 17, 162-171
245 Washburn, T., Schweighoffer, E., Gridley, T., Chang, D., Fowlkes, B.
J., Cado, D. and Robey, E. (1997) Notch activity influences the
alphabeta versus gammadelta T cell lineage decision. Cell 88, 833-843
246 Weijzen, S., Rizzo, P., Braid, M., Vaishnav, R., Jonkheer, S. M., Zlobin,
A., Osborne, B. A., Gottipati, S., Aster, J. C., Hahn, W. C., Rudolf, M.,
Siziopikou, K., Kast, W. M. and Miele, L. (2002) Activation of Notch-1
signaling maintains the neoplastic phenotype in human Ras-
transformed cells. Nat Med 8, 979-986
247 Weijzen, S., Zlobin, A., Braid, M., Miele, L. and Kast, W. M. (2003)
HPV16 E6 and E7 oncoproteins regulate Notch-1 expression and
cooperate to induce transformation. J Cell Physiol 194, 356-362
248 Weng, A. P. and Aster, J. C. (2004) Multiple niches for Notch in cancer:
context is everything. Curr Opin Genet Dev 14, 48-54
249 Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. t., Silverman, L. B.,
Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T. and Aster, J. C.
(2004) Activating mutations of NOTCH1 in human T cell acute
lymphoblastic leukemia. Science 306, 269-271
250 Wetzel, R., Goss, V. L., Norris, B., Popova, L., Melnick, M. and Smith,
B. L. (2005) Evaluation of CML model cell lines and imatinib mesylate
response: determinants of signaling profiles. J Immunol Methods 305,
59-66
251 Wickremasinghe, R. G. and Hoffbrand, A. V. (1999) Biochemical and
Genetic Control of Apoptosis: Relevance to Normal Hematopoiesis and
Hematological Malignancies. Blood 93, 3587-3600
252 Wilson, A., MacDonald, H. R. and Radtke, F. (2001) Notch 1-deficient
common lymphoid precursors adopt a B cell fate in the thymus. J Exp
Med 194, 1003-1012
253 Wolfer, A., Bakker, T., Wilson, A., Nicolas, M., Ioannidis, V., Littman, D.
R., Lee, P. P., Wilson, C. B., Held, W., MacDonald, H. R. and Radtke,
F. (2001) Inactivation of Notch 1 in immature thymocytes does not
perturb CD4 or CD8T cell development. Nat Immunol 2, 235-241
254 Wolfer, A., Wilson, A., Nemir, M., MacDonald, H. R. and Radtke, F.
(2002) Inactivation of Notch1 impairs VDJbeta rearrangement and
allows pre-TCR-independent survival of early alpha beta Lineage
Thymocytes. Immunity 16, 869-879
212
255 Wu, L., Sun, T., Kobayashi, K., Gao, P. and Griffin, J. D. (2002)
Identification of a family of mastermind-like transcriptional coactivators
for mammalian notch receptors. Mol Cell Biol 22, 7688-7700
256 Yamamoto, N., Yamamoto, S., Inagaki, F., Kawaichi, M., Fukamizu, A.,
Kishi, N., Matsuno, K., Nakamura, K., Weinmaster, G., Okano, H. and
Nakafuku, M. (2001) Role of Deltex-1 as a transcriptional regulator
downstream of the Notch receptor. J Biol Chem 276, 45031-45040
257 Ye, Q., Shieh, J. H., Morrone, G. and Moore, M. A. (2004) Expression
of constitutively active Notch4 (Int-3) modulates myeloid proliferation
and differentiation and promotes expansion of hematopoietic
progenitors. Leukemia 18, 777-787
258 Yin, D. D., Fan, F. Y., Hu, X. B., Hou, L. H., Zhang, X. P., Liu, L., Liang,
Y. M. and Han, H. (2008) Notch signaling inhibits the growth of the
human chronic myeloid leukemia cell line K562. Leuk Res
259 Yu, H., Cook, T. J. and Sinko, P. J. (1997) Evidence for diminished
functional expression of intestinal transporters in Caco-2 cell
monolayers at high passages. Pharm Res 14, 757-762
260 Zanjani, E. D., Almeida-Porada, G., Livingston, A. G., Flake, A. W. and
Ogawa, M. (1998) Human bone marrow CD34- cells engraft in vivo and
undergo multilineage expression that includes giving rise to CD34+
cells. Exp Hematol 26, 353-360
261 Zhang, J., Niu, C., Ye, L., Huang, H., He, X., Tong, W. G., Ross, J.,
Haug, J., Johnson, T., Feng, J. Q., Harris, S., Wiedemann, L. M.,
Mishina, Y. and Li, L. (2003) Identification of the haematopoietic stem
cell niche and control of the niche size. Nature 425, 836-841
262 Zhang, P., Yang, Y., Zweidler-McKay, P. A. and Hughes, D. P. (2008)
Critical role of notch signaling in osteosarcoma invasion and
metastasis. Clin Cancer Res 14, 2962-2969
263 Zhao, C., Blum, J., Chen, A., Kwon, H. Y., Jung, S. H., Cook, J. M.,
Lagoo, A. and Reya, T. (2007) Loss of beta-catenin impairs the
renewal of normal and CML stem cells in vivo. Cancer Cell 12, 528-541
264 Zhao, S., Zoller, K., Masuko, M., Rojnuckarin, P., Yang, X. O.,
Parganas, E., Kaushansky, K., Ihle, J. N., Papayannopoulou, T.,
Willerford, D. M., Clackson, T. and Blau, C. A. (2002) JAK2,
complemented by a second signal from c-kit or flt-3, triggers extensive
self-renewal of primary multipotential hemopoietic cells. Embo J 21,
2159-2167
265 Zweidler-McKay, P. A., He, Y., Xu, L., Rodriguez, C. G., Karnell, F. G.,
Carpenter, A. C., Aster, J. C., Allman, D. and Pear, W. S. (2005) Notch
signaling is a potent inducer of growth arrest and apoptosis in a wide
range of B-cell malignancies. Blood 106, 3898-3906
266 Zweidler-McKay, P. A. and Pear, W. S. (2004) Notch and T cell
malignancy. Semin Cancer Biol 14, 329-340
213
Appendex1
A-
i ii
kDa kDa
1 2 3 4 1 2 3 4
300 300
180
120
B-
1 9 11 89
ICN1
Isotype(IgG)
IgG1 ECN1
B- HEK293 cells were transfected with full-length N1 and stained with ECN1 and ICN1
antibodies.
214
215