You are on page 1of 10

1. Cmo est formada la molcula de ADN?

El ADN est formado por dos cadenas complementarias de polinucletidos dispuestas en forma de doble hlice
antiparalelas. El esqueleto de azcar-fosfato se dispone en el exterior de la hlice y las bases nitrogenadas se
apilan en el interior. Las dos cadenas estn unidas entre s mediante puentes de hidrgeno que se establecen
entre bases complementarias. La adenina (A) se aparea siempre con la timina (T) mediante dos puentes de
hidrgeno, y la guanina (G) con la citosina (C) mediante tres puentes de hidrgeno. En sntesis el ADN est
formado, por un azcar (pentosa desoxirribosa), una base nitrogenada (Timina, Adenina, Guanina, Citosina) y un
grupo fosfato.

2. Cules son las protenas asociadas al ADN?

Las protenas asociadas al ADN se conocen colectivamente con el nombre de histonas. Son polipptidos
relativamente cortos cargados positivamente (bsicos) y por lo tanto son atrados por las cargas negativas del ADN
(cidas). Las histonas son sintetizadas en cantidad durante la fase S del ciclo celular.
Una de las funciones de estas protenas est relacionada con el empaquetamiento del ADN en la forma de
cromosoma. Se conocen 5 tipos de histonas: H1, H2A, H2B, H3 y H4 (8 molculas en total, formando un
octmero).

3. Cmo se replica el ADN?

1. La doble hlice se desdobla de manera que las dos cadenas de nucletidos quedan paralelas. Se rompen
los enlaces entre las bases de las molculas de ADN. Las dos cadenas de nucletidos se separan,
empezando en un extremo y abrindose hasta el otro.

2. Cada mitad de ADN sirve como patrn para la formacin de una nueva mitad de la molcula de ADN. Las
bases de los nucletidos libres se unen con las bases correspondientes en las dos cadenas expuestas
de nucletidos: adenina-timina, citosina-guanina. Este pareo asegura que las copias nuevas de ADN sean
copias exactas del ADN original.

3. Se forman enlaces entre los fosfatos y las azcares de los nucletidos que se han pareado con las
cadenas de ADN.

4. Las dos muevas molculas de ADN se enroscan y de nuevo toman forma de una doble hlice.


4. Qu es un gen? Cules son los tipos de genes? Cmo estn estructurados?

El gen es un segmento de ADN que da la clave para una protena en particular. Los genes son las unidades de
herencia y controlan las caractersticas del individuo: color del pelo, tipo de sangre, color de la piel y color de los
ojos. Un gen contiene la informacin suficiente para formar una protena, la misma que ser usada para las
necesidades celulares o del organismo. Es considerado como la unidad de almacenamiento de informacin y
unidad de herencia al transmitir esa informacin a la descendencia. Los genes son parte de los cromosomas.



Los tipos de genes son los siguientes:
1. Genes estructurales: que codifican para protenas, que podran ser reguladoras de genes, o codifican
ARN especficos que slo se transcriben. Muchos genes se encuentran constituidos por regiones
codificantes (exones) interrumpidas por regiones no codificantes (intrones) que son eliminadas en la
formacin del ARN. La secuencia de bases presente en el ARN determina la secuencia de aminocidos de
la protena por medio del cdigo gentico.

2. Genes reguladores sin transcriptos, como:
Genes o secuencias de replicacin que especifican el sitio de iniciacin y terminacin de la replicacin
del ADN.
Genes de recombinacin que proporcionan los sitios de unin para las enzimas de recombinacin.
Genes de segregacin que son los sitios especficos para que las fibras del huso mittico durante la
meiosis se adhieran a los cromosomas durante la segregacin en mitosis y meiosis.
Genes de secuencias del ADN que reconocen e interactan con protenas, hormonas y otras
molculas.
Secuencias de repeticin y secuencias sin sentido.
Los genes estn estructurados por:
Exones (Regiones codificantes del ADN): son las regiones de un gen que no son separadas durante el
proceso de splicing y, por tanto, se mantienen en el ARN mensajero maduro. En los genes que codifican una
protena, son los exones los que contienen la informacin para producir la protena codificada en el gen. En
estos casos, cada exn codifica una porcin especfica de la protena completa, de manera que el conjunto
de exones forma la regin codificante del gen.

Intrones (Regiones no codificantes del ADN): es un fragmento de ADN que est presente en un gen pero que
no codifica ningn fragmento de la protena. Los intrones son eliminados en el proceso de maduracin del ARN.







5. Cules son las regiones reguladoras y distales del gen?
Un promotor se define como la secuencia continua de ADN que es suficiente para dirigir la correcta iniciacin de la
transcripcin de un gen mediada por la RNA polimerasa II (RNA pol-II). Estas secuencias suelen encontrarse
cercanas al sitio de inicio de la transcripcin dentro de un intervalo que va de +20 a 30 en relacin con el sitio de
inicio de la transcripcin (tambin conocido como el +1) las cuales se denominan elementos "core" del promotor
.En las secuencias promotoras, existen diferentes motivos consenso de unin al ADN entre los ms comunes
encontramos a la caja TATA, los elementos iniciadores (Inr), los elementos de reconocimiento para el factor TFIIB
(BRE) y los elementos promotores ro abajo (DPE).

Estos motivos de unin al ADN, suelen encontrarse en las secuencias promotoras, ya sea de manera individual o
en diferentes combinaciones o acompaadas de otras secuencias que se mencionaran ms adelante. Distintas
combinaciones de estas secuencias constituyen los que se conoce como la "arquitectura" del promotor la cual
permite establecer una combinacin nica y selectiva para el reconocimiento de molculas reguladoras.

Un segundo grupo de las secuencias de regulacin, es conocido como elementos distales de regulacin gnica.
stos participan en la regulacin otorgando una expresin en el tiempo y tejido especficos. Entre estas secuencias
encontramos a los potenciadores, los silenciadores y los elementos aisladores.

Potenciadores: son elementos reguladores ms que actan aumentando la actividad del promotor aunque no
tienen actividad de promotor de por s. As diferencia de los promotores no son esenciales para la transcripcin,
poseen tres contactos que los diferencian de los promotores:

a. Pueden estar situados a grandes distancias de los genes que regulan.
b. Funcionan en una orientacin normal o invertida en el gen.
c. Pueden estar localizado en una posicin ascendente, descendente o dentro fe los intrones de un gen.

Silenciadores: son regiones de control dl ADN que como los potenciadores pueden estar situados a cien pares de
bases de los genes que controlan, cuando los factores de transcripcin se les une la expresin de los genes que
controlan se reprimen.

Aisladores: Son segmentos de ADN situados entre potenciadores y promotor de genes o grupos de genes
adyacentes, su funcin es evitar que un gen pueda ser influenciado por la activacin de sus vecinos, asegura que
la activacin de un gen no se extender a otra.

6. Mencione los tipos de ARN, y describa cual es su funcin.

Encontramos tres tipos de ARN:

1. El ARN mensajero o ARNm lleva las instrucciones para hacer una protena en particular, desde el ADN
en el ncleo hasta los ribosomas. Las molculas de ARNm se disponen segn el cdigo contenido en el
ADN.

2. El ARN de transferencia o ARNt.-lleva los aminocidos a los ribosomas. El ARNt se encuentra en el
citoplasma de las clulas.

3. El ARN ribosomal o ARNr, es una de las sustancias qumicas de las que estn compuestos los
ribosomas.

7. Cmo sucede la transcripcin, y la sntesis de ARN?

1. La porcin de ADN que contiene el cdigo para la protena que se necesita se desdobla y se separa,
exponiendo las bases. Proceso similar a la replicacin del ADN.

2. Los nucletidos de ARN libres que estn en el ncleo, se aparean con las bases expuestas del ADN. El
uracilo se aparea con la adenina. Como resultado de las tripletas del ADN, se forman tripletas
complementarias en la molcula de ARNm.

3. La molcula de ARNm se completa por la formacin de enlaces entre los nucletidos del ARN. La molcula
de ARNm se separa de las molcula de ADN. La molcula completa de ARNm, que lleva un cdigo para
hacer un solo tipo de protena, sale del ncleo, pasa por la membrana nuclear y se dirige a los ribosomas del
citoplasma.

8. Qu es el cdigo gentico?

Es el conjunto de normas por las que la informacin es codificada en el material gentico (secuencias de ADN o
ARN) se traduce en protenas (secuencias de aminocidos) en las clulas vivas. El cdigo gentico lo componen
palabras de tres letras formadas por las bases. (AGC, CGT, sucesivamente) obteniendo 64 grupos o palabras
diferentes.

9. Indique, Qu es un codn y seale en cul de las molculas de ARN contiene los codones?

Se le denomina codn a la sucesin de tres bases de nucletidos (GCU ACG) en una molcula de ARNm.

10. Indique, Qu es un anticodn y seale en cul de las molculas de ARN contiene los anticodones?

Es una secuencia de tres nucletidos (GCU ACG) ubicada en el ARNt, complementaria al codn ubicado en el
ARNm.


11. Enumere todos los elementos implicados en la traduccin

Se denomina traduccin porque comprende el cambio del lenguaje de cidos nucleicos (sucesin de nucletidos)
al lenguaje de las protenas (sucesin de aminocidos).
Los principales elementos participantes en la traduccin, son:

- ARNm (mensajero-codn)
- ARNt (transferente-anticodn)
- ARNr (ribosmico y protenas ribosomales)
- Ribosomas
- Aminocidos libres en el citosol.
- Enzimas
- Factores proteicos
- Nucletidos trifosfato (ATP, GTP)

1. Un extremo del ARNm se pega al ribosoma.
2. Las molculas de ARNt que estn en el citoplasma recogen ciertos aminocidos. Con los aminocidos
pegados, las molculas de ARNt se mueven hacia el punto donde el ARNm est pegado al ribosoma.
3. Una molcula de ARNt con el anticodn correcto, se enlaza con el codn complementario den el ARNm.
4. A medida que el ARNm se mueve a lo largo del ribosoma, el siguiente codn hace contacto con el ribosoma. El
siguiente ARNt se mueve a su posicin con su aminocido. Los aminocidos adyacentes se enlazan por medio
de un enlace peptdico.
5. Se desprende la primera molcula de ARNt. El siguiente codn se mueve a su posicin y el siguiente
aminocido se coloca en su posicin.
6. Los pasos 3 al 5 se repiten hasta que se ha traducido el mensaje completo. De esta manera se forma una
cadena de aminocidos
7. Como una protena es una cadena de aminocidos, se construye entonces una protena.
8. En resumen, el ADN codifica para ARN mensajero, el ARN mensajero lleva la informacin necesaria para la
sntesis de la protena a los ribosomas, donde se hace la protena.

12. Mencione Cul es el azcar pentosa del nucletido del ADN y ARN?

ADN: La azcar de esta molcula es la desoxirribosa. Se llama as ya que carece de un tomo de oxigeno en la
posicin 2, lo que la hace ms estable.

ARN: Por lo tanto la azcar de esta molcula es la ribosa, que si tiene el tomo de oxigeno que la desoxirribosa
del ADN no tiene y por consiguiente la hace menos estable.


13. Seale diferencias estructurales entre las molculas de ADN y ARN, en cuanto a lo indicado en el
siguiente cuadro.

ADN ARN
Numero de cadenas polinucleotidas 2 cadenas polipeptdiccas, en forma
de doble hlice (bicatenaria).
1 cadena sencilla (monocatenaria).
Direccin de las cadenas De 5 a 3 y tambin de 3 a 5 De 3 a 5
Empaquetamiento de las bases A-T y G-C A-U y G-C
Propiedad: Replicacin,
transcripcin, traduccin.
Replicacin y transcripcin. Traduccin.

14. Seale semejanzas y diferencias entre la sntesis del ADN y del ARN, en cuanto a lo indicado en el
siguiente cuadro.

ADN ARN
Propiedad o mecanismo por el cual
se sintetiza.
Replicacin Transcripcin
Molcula molde que utiliza Cadena complementaria de ADN. Cadena de ADN.
Nucletido trifosfatos que necesitan dATP, dCTP, de dTTP ydGTP rATP; rCTP; rGTP; rUTP
Direccin de la sntesis De 5 a 3 De 5 a 3
Enzimas de polimerizacin que
utilizan
ADN polimerasas ARN polimerasas
Numero de molculas que origina 2 1

15. Explique cules son las protenas o enzimas que requiere la replicacin de ADN.

a. Helicasas: Son las enzimas encargadas de separar las dos hebras del ADN. Estas enzimas son responsables
de la ruptura de las uniones puente de Hidrgeno que se establecen entre las bases de las dos cadenas del ADN.
Para poder separar las dos hebras del ADN se necesitar energa, que es obtenida de la hidrlisis del ATP.
Porcada dos pares de bases que separan, se gastan dos molculas de ATP.

b. Protenas estabilizadoras de la cadena: Una vez que las cadenas del ADN son separadas, la estabilidad de
las mismas disminuye considerablemente. El ADN tiende a reasociarse y, son estas protenas quienes impiden que
el ADN vuelva a su conformacin inicial. Su presencia es fundamental para mantener las cadenas estiradas.

c. Topoisomerasas: Las topoisomerasas cortan la doble hlice, rotan el ADN y vuelven a unirlo, evitando as que
aumente la tensin por delante de la horquilla de replicacin. En consecuencia, encontraremos a las
Topoisomerasas por delante del lugar donde se est produciendo la duplicacin.

d. ARN polimerasa o Primasa: Esta enzima es la que sintetiza el cebador, un primordio de ARN necesario para
que la ADN polimerasa pueda iniciar la sntesis de las nuevas cadenas. El cebador es una pequea porcin de
ARN de 10 a 12 ribonucletidos de largo que se mantendr unido a la cadena de ADN molde hasta que sea
removido.

16. Seale para la siguiente secuencia de ADN:

3 AGGGCCAATAGCTTTCCGATAGAC 5

a) Cul sera la cadena polinucletida del ADN complementaria a ella?

5 TCCCGGTTATCGAAAGGCTATCTG 3

b) Cul sera la cadena polinucletida de ARN que originaria esta secuencia despus de la transcripcin?

5 AGGGCCAAUAGCUUUCCGAUAGAC 3



Bibliografa


- Cdigo gentico y protenas / Leonardo David Lomanto Daz, scar Leonel Ortiz Cala, Csar Orlando
Bretn Pinto, lvaro Ivn Gmez Lizcano, Viviana Matilde Mesa Cornejo, Biol., PhD / Med UNAB, Artculo
estudiantil / documento pdf.


- Proteinas de unin al ADN / Karla Y. Acosta-Viana, Jorge E. Zavala-Castro / Centro de Investigaciones
Regionales "Dr. Hideyo Noguchi", Universidad Autnoma de Yucatn. Mrida,Yucatn, Mxico / Rev
Biomed 1996; 7:163-172 /documento pdf.


UNIVERSIDAD NACIONAL AUTNOMA DE NICARAGUA
UNAN-Len


Facultad de Ciencias Mdicas


Escuela de Bioanlisis Clnico









Componente:Gentica.

Tema:Seminario N 2


Elaborado por:

RonnierIsmark Meza Martnez No. 19



Dra. Edel Paredes


A la libertad por la Universidad


Len, Lunes 10 de Octubre del 2011.


UNIVERSIDAD NACIONAL AUTNOMA DE NICARAGUA
UNAN-Len


Facultad de Ciencias Mdicas


Escuela de Bioanlisis Clnico









Componente:Gentica.

Tema:Gentica Poblacional


Elaborado por:

RonnierIsmark Meza Martnez No. 19



Dra. Edel Paredes


A la libertad por la Universidad


Len, Lunes 10 de Octubre del 2011.