You are on page 1of 16

© The American Genetic Association 2014. All rights reserved.

For permissions, please e-mail: journals.permissions@oup.com
723
Unraveling Low-Level Gamma
Radiation–Responsive Changes in
Expression of Early and Late Genes
in Leaves of Rice Seedlings at litate
Village, Fukushima
GOHEI HAYASHI, JUNKO SHIBATO, TETSUJI IMANAKA, KYOUNGWON CHO, AKIHIRO KUBO, SHOSHI KIKUCHI,
KOUJI SATOH, SHINZO KIMURA, SHOJI OZAWA, SATOSHI FUKUTANI, SATORU ENDO, KATSUKI ICHIKAWA,
GANESH KUMAR AGRAWAL, SEIJI SHIODA, MANABU FUKUMOTO, AND RANDEEP RAKWAL
From the Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan (Hayashi and Fukumoto); Research
Reactor Institute, Kyoto University, Osaka, Japan (Hayashi, Imanaka, and Fukutani); the Department of Anatomy I, School of
Medicine, Showa University, Shinagawa, Tokyo, Japan (Shibato, Shioda, and Rakwal); the Laboratory of Exercise Biochemistry
& Neuroendocrinology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Japan
(Shibato); the Seoul Center, Korea Basic Science Institute (KBSI), Seoul, South Korea (Cho); the Environmental Stress
Mechanisms Section, Center for Environmental Biology and Ecosystem Studies, National Institute for Environmental
Studies, Tsukuba, Ibaraki, Japan (Kubo); the Plant Genome Research Unit, Agrogenomics Research Center, National
Institute of Agrobiological Sciences (NIAS), Tsukuba, Ibaraki, Japan (Kikuchi and Satoh); the Laboratory of International
Epidemiology, Center for International Cooperation, Dokkyo Medical University, Tochigi, Japan (Kimura); 91372–7 Kusabana,
Akiruno, Tokyo, Japan (Ozawa); the Quantam Energy Applications, Graduate School of Engineering, Hiroshima University,
Higashi-Hiroshima, Japan (Endo); the Offce Brain, Tama Tsurumaki, Tokyo, Japan (Ichikawa); the Research Laboratory
for Biotechnology and Biochemistry (RLABB), Kathmandu, Nepal (Agrawal and Rakwal); the GRADE Academy Private
Limited, Birgunj, Nepal (Agrawal and Rakwal); and the Organization for Educational Initiatives, University of Tsukuba, 1-1-1
Tennoudai, Tsukuba, Ibaraki 305–8577, Japan (Rakwal).
Address correspondence to Randeep Rakwal at the address above, or e-mail: plantproteomics@gmail.com.
Abstract
In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we
examined the effects of gamma radiation on rice at a highly contaminated feld of Iitate village in Fukushima, Japan. We
investigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gamma
radiation up to 4 µSv h
−1
, about 80 times higher than natural background level. After exposure to gamma rays, expression
profles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions
were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6,
12, 24, 48, and 72 h). For example, OsPCNA mRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells responded
to radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoid
pathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We next
profled the transcriptome using a customized rice whole-genome 4 × 44K DNA microarray at early (6 h) and late (72 h) time
periods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at
6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulated
gene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma
ray exposure. An inventory of a large number of gamma radiation–responsive genes provides new information on novel
regulatory processes in rice.
Subject areas: Genomics and gene mapping
Key words: DNA repair, gamma radiation, Oryza sativa, OsPCNA, seedling leaf, stress response
Journal of Heredity 2014:105(5):723–738
doi:10.1093/jhered/esu025

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
724
Living organisms are affected by numerous environmen-
tal factors related with normal growth and development.
Radiation, in particular radioactive contamination—both
external and internal, is a stress factor that is highly damaging
to life on this planet (Bertell 1985). Radiation has the capacity
to severely affect growth and development of cells, tissues/
organs, and organisms, although much of the current focus is
on mammalian models for obvious reasons of anxiety related
to the effects of radiation on humans (Smirnova 2010). What
is the effect of radiation on plants was the question that this
research by Rakwal and Agrawal sought to address in the year
2003. Our first study on the effects of ultralow-level dose of
gamma radiation (Kimura et al. 2008) examined specifically
the morphological and molecular genetic levels in the cereal
crop/grass model rice, Oryza sativa L., using the japonica cul-
tivar Nipponbare—a model genome (Goff et al. 2002; Yu
et al. 2002; Kikuchi et al. 2003; Kikuchi 2008; International
Rice Genome Sequencing Project 2005; Agrawal and Rakwal
2006, 2011). To remind the readers, rice is the crop that feeds
the world, and rice is life (2004 was the International Year of
Rice, http://www.fao.org/rice2004/index_en.htm; http://
www.fao.org/rice2004/en/concept.htm). Considering the
above characteristics of rice plant biology and a move toward
understanding rice as a whole, the rice species has become a
model on par with the human/mammalian models to study
environmental stress, including the effects of radiation.
How does gamma radiation affect rice or how do rice
plants respond to the environment with abnormal radiation?
Our first 2 studies (Kimura et al. 2008; Rakwal et al. 2009)
used ultralow-dose gamma radiation exposure on leaves of
rice seedlings, for which the 2-week-old rice seedling model
system was established to demonstrate the stress responses at
the molecular level (Jwa et al. 2006). Initial studies examined
the effects of external radiation exposure on rice plants, in par-
ticular on cut leaf segments, for a short period of 72 h. In the
first study, early genome-wide transcriptional profiling data in
rice leaf segments exposed to gamma radiation (5.34 µGy/
day; 10.90-fold relative to natural background control level)
emitted from contaminated soil sample (Masany, 10 km from
the Chernobyl nuclear reactor) revealed 516 differentially
expressed genes that were categorized into the following 3
main functions: Information storage and processing, cellular
processes and signaling, and metabolism (Kimura et al. 2008).
The second study was built up on the incredulous claim of
the first study (Kimura et al. 2008) that ultralow-level gamma
radiation affects rice self-defense mechanisms and repli-
cated the experiment using an in-lab fabricated gamma ray
137
Cs source at 6 dose rates (13 ± 1, 25 ± 2, 45 ± 2, 110 ± 10,
190 ± 10, and 380 ± 20 µGy/3 days) on leaves of rice seed-
lings (Rakwal et al. 2009). The results arising from the use
of both naturally emitting and in-lab fabricated gamma ray
sources provided the first evidence for ultralow-level gamma
radiation triggering changes at the molecular level in the mul-
tilayered defense/stress-related biological processes in rice
leaves, laying the foundation for future studies. Meanwhile,
our group has carried out additional research using whole
plants exposed to high-dose ionizing radiation, such as car-
bon ion beams (Rakwal et al. 2008), gamma rays, and X-rays
(Rakwal R, unpublished data). These data are yet to be pub-
lished, but they indicate a wide-ranging response (related to
defense/stress) at the level of the genome in rice leaves after
exposure to high-dose radiation.
The events following the 11 March 2011 nuclear
accident at the Fukushima Daiichi Nuclear Power Plant
(FDNPP) after the Great Tohoku Earthquake unexpect-
edly provided an opportunity to initiate a new research
project with fellow physicists/radiation experts at the
highly contaminated fields in Iitate village of Fukushima
Prefecture, Japan (Imanaka et al. 2012). The highly con-
taminated Iitate Farm (ITF), which is located 31 km from
the damaged nuclear power plant and has a field radia-
tion level more than 100 times (~5 µSv/h) higher than the
natural background level, was the designated place for the
reexamination of low-level gamma radiation experiments
using rice as a model system (Figure 1). Because our group
had a decade of experience, in addition to data on the
effects of gamma radiation on leaf segments (Kimura et al.
2008; Rakwal et al. 2009), the experiment was designed in
such a way as to expose whole rice plants to gamma radia-
tion being emitted from the contaminated ground and
examine the morphological and molecular genetic changes
in the leaves after growth under varying radiation doses.
The experiment was performed 3 times in July, August,
and September 2012. Results presented here provided the
first support to our previous research conducted in the
laboratory using cut rice leaf segments (in vitro experi-
ment), which revealed gamma radiation–induced self-
defense response. Second, the current research provided
new details on the genomewide response of rice plants to
low-level gamma radiation in a radioactively contaminated
field environment. This is the first article in a series of
research reports that will examine, present, and discuss
how rice plants behave in response to low-level gamma
radiation directly in the field.
Materials and Methods
Rice Seedling Growth and ITF
Japonica type rice (Oryza sativa L.) cv. Nipponbare was
used as the test material. The seeds were received from
the National Institute for Environmental Studies (NIES),
Tsukuba, Japan. Rice seedlings were grown in the green-
house facility at NIES (Supplementary Figure 1). Briefly,
the healthy seeds of cv. Nipponbare were allowed to imbibe
water for 1–2 days under darkness at 30 °C and allowed to
germinate. Similarly germinated seeds were placed in neat
rows in seedling pots (4 rows per pot having 10–12 seeds
each) having commercial soil (nursery soil for rice seedling
growth and transplantation, purchased from JA Zen-Noh,
Japan; https://www.zennoh.or.jp/) with recommended
NPK (nitrogen, phosphorus, and potassium) doses in a
controlled (25 °C, 70% relative humidity, and natural light
conditions) greenhouse at NIES, Tsukuba, Japan during July,
August, and September 2012. At the age of 14 days (from
start of germination protocol), healthy rice seedlings were

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
725
transported to designated experimental sites at ITF (Iitate
village, Fukushima, Japan) for initiating the experiment. To
know the radiation levels during growth and transport of
the rice to ITF, accumulated radiation dose was calculated
using a MYDOSE mini electronic pocket dosimeter (model
PDM-222–52, ALOKA, Japan) (Supplementary Figure 1).
To observe the gene expression level in leaves of seedlings
after reaching ITF, leaves were sampled at 05.00 AM (called
the 0-h NIES sample), the time just before departure to
Iitate village. The rice leaves were also sampled on reaching
ITF (09:40 AM); this sample was called the 0-h ITF sample
and marked the start of gamma radiation exposure). In this
study, the results of the experiment performed in July 2012
are presented and discussed.
Plot Design, Gamma Radiation Exposure, and Sampling
The plot design is schematically presented in Figure 2. At the
ITF, a leveled ground was overlaid with a blue tarpaulin sheet
in the designated area that had an average contamination level
(ground
137
Cs) of −700 kBq/m
2
(Supplementary Figure 2)
and that emitted a constant radiation dose of ~5 µSv/h. This
area was defined as a low-level gamma field. As shown in
Figure 2A,B, the 3 cylindrical boxes were placed at a distance
of 2 m apart and were shielded with a recently fabricated
shielding material (Nihon Matai Co., Ltd., Moriyama, Shiga,
Japan; http://www.matai.co.jp/r02_factory/s_sheet.html) to
control the amount of radiation reaching the target in the
target area, namely, rice seedlings at the center of the box.
The effect of the shielding material around and below the
boxes 1 (double shield, ~1.6 µSv/h: low dose) and 2 (single
shield, ~2.6 µSv/h: middle dose) can be seen by the amount
of gamma ray dose reaching inside (Figure 2C). Box number
3 was not shielded and served as the high-dose (~4.2 µSv/h)
condition. The rice plants in the 3 cases of exposures were
placed in the center of each box, and the gamma ray dose was
recorded by 2 MYDOSE mini electronic pocket dosimeters
placed near the 3rd fully formed leaf. Gamma ray exposure
times were set at 6, 12, 24, 48, and 72 h after arrival at ITF,
and the rice leaves at the 3rd position (from the base) from 6
to 10 seedlings were sampled, by cutting the 3rd fully formed
leaf at the base of attachment to the sheath, for each dose
(low, middle, and high). Postcutting, the leaves were placed
in an aluminum foil under dry ice and immediately stored
in dry ice packs in the deep freezer (−30 °C). Photographs
of the leaves were taken by a digital camera (Coolpix S9100,
Nikon, Tokyo, Japan). As a control, rice leaves were sampled
in Tsukuba (NIES) and immediately after arrival at ITF; a
sample set was also taken at 72 h from healthy rice seedlings
in the greenhouse in NIES. Samples were taken back to the
laboratory and analyzed.
Grinding of Leaf Samples in Liquid Nitrogen
Prior to the downstream molecular analyses for gene expres-
sion changes, rice leaf powders were prepared as described
in the study by Agrawal et al. (2013). Individual leaves taken
from each seedling under each dose condition were pooled
to give a sample for each treatment condition dose—low,
middle, and high, prior to grinding; to repeat, data presented
below are for pooled samples from the experiment carried
out in July 2012. Rice leaves were ground to a very fine pow-
der with a prechilled mortar and pestle in liquid nitrogen
and stored at −80 °C until further analysis (Supplementary
Figure 3). The advantage of preparing fine powders is their
use in extracting total RNA (gene expression analysis), pro-
tein, and metabolites from the same sample and in extremely
low amounts (Agrawal et al. 2013).
Figure 1. Iitate village in Fukushima Prefecture, and the location of the Iitate farm (ITF). (A) Part of Fukushima Prefecture is
shown. (B) Enlarged view of Iitate village, and contours (µSv/h) of measured radiation dose (each dot represents the point of the
survey) on 23 March 2012; for details, see Imanaka et al. (2012). The location of ITF is marked by a colored circle.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
726
Total RNA Extraction and Quantity and Quality
Control Analyses
Fine powders were used for extracting total RNA fol-
lowing a previously published protocol (Cho et al. 2012).
Briefly, the RNeasy Plant Mini Kit (QIAGEN, MD) was
used as per manufacturer’s instructions. A detailed step-by-
step protocol is schematically presented in Supplementary
Figure 4. The quality of RNA, the yield, and its purity
were determined spectrophotometrically (NanoDrop,
Wilmington, DE) and were visually confirmed using for-
maldehyde–agarose gel electrophoresis (Supplementary
Figure 5).
Complementary DNA Synthesis and Reverse
Transcription–Polymerase Chain Reaction
Prior to the gene expression analyses using reverse transcrip-
tion–polymerase chain reaction (RT-PCR) and the DNA
microarray chip analysis, complementary DNA (cDNA) was
synthesized, and to check the quality of synthesized cDNA,
RT-PCR was performed on the beta-actin (AK100267)
gene using the following primer pairs: RJSR43 forward, 5′–
CTCCTAGCAGCATGAAGATCAA–3′; and RJSR44 reverse
5′–ATGATAACAGATAGGCCGGTTG–3′ (Cho et al.
2012; Cho et al. 2013). Total RNA samples were first treated
with RNase-free DNase (Stratagene, Agilent Technologies,
Figure 2. Experimental plot and placement of the shielded boxes containing rice plants. (A) The dimensions of the plot of
land, measured radiation levels, and distances between each shielded box [1, double shield (++); 2, single shield (+); 3, no shield
(−)] that contained the rice seedlings. (B) Enlarged view of a circular box (and its dimensions) showing the placement of the
seedling box within, and the points where each radiation dose was measured. (C) The actual photograph of the experimental plot
showing the 3 circular boxes used in the experiment. (D) The measured radiation dose data in each box (1, 2, and 3) at the bottom
(B), center (C), and top (T) as indicated by the crossed lines, and at each direction (South, S; North, N; East, E; and West, W)
including in the center of the box, indicated by black flled circles. Details are mentioned in the text.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
727
La Jolla, CA). First-strand cDNA was then synthesized in a
20-μL reaction mixture with an AffinityScript QPCR cDNA
Synthesis Kit (Stratagene) according to the protocol provided
by the manufacturer using 1 μg of total RNA. The reaction
conditions were 25 °C for 5 min, 42 °C for 5 min, 55 °C for
40 min, and 95 °C for 5 min. The synthesized cDNA was
made up to a volume of 50 μL with sterile water supplied in
the kit. The reaction mixture contained 0.6 μL of the first-
strand cDNA, 7 pmols of each primer set, and 6.0 μL of the
Emerald Amp PCR Master Mix (2× premix) (TaKaRa Shuzo,
Shiga, Japan) in a total volume of 12 μL. Thermal cycling
(Applied Biosystems, Tokyo, Japan) parameters were as fol-
lows: After an initial denaturation at 97 °C for 5 min, samples
were subjected to a cycling regime of 20–40 cycles at 95 °C
for 45 s, 55 °C for 45 s, and 72 °C for 1 min. At the end of the
final cycle, an additional extension step was carried out for
10 min at 72 °C. After completion of the PCR, the total reac-
tion mixture was spun down and mixed (3 μL), before being
loaded into the wells of a 1.2/1.8% agarose (Agarose [fine
powder] Cat no. 02468-95, Nacalai Tesque, Kyoto, Japan) gel.
Electrophoresis was then performed for ~22 min at 100 V
in 1× TAE buffer using a Mupid-ex electrophoresis system
(ADVANCE, Tokyo, Japan). The gels were stained (8 μL of
10 mg/mL ethidium bromide in 200 mL 1× TAE buffer)
for ~7 min, and the stained bands were visualized with the
ChemiDoc XRS+ imaging system (Bio-Rad) (Supplementary
Figure 6). RT-PCR analysis was also carried out on selected
genes based on previous experiments (Kimura et al. 2008;
Rakwal et al. 2008, 2009) and unpublished data (Rakwal R)
and are listed in Table 1. Each gene candidate was analyzed
by RT-PCR more than once to confirm and reconfirm the
data on expression change, and finally, a representative data
set from each analysis is shown as the relative abundance of
mRNA. Moreover, based on the RT-PCR data, the middle
dose sample was selected for global gene expression analysis.
Whole-Genome DNA Microarray Analysis and GEO
Accession
A rice 4 × 44K custom (eARRAY, AMAdid-017845) oligo-
DNA microarray chip (G2514F, Agilent Technologies, Palo
Alto, CA) was used for genomewide gene profiling of expres-
sions of early (6 h) and late (72 h) genes, as described previ-
ously (Satoh et al. 2010; Cho et al. 2012, 2013). Total RNA
(900 ng) was labeled with either Cy3 or Cy5 using a Low
RNA Input Fluorescent Linear Amplification Kit (Agilent).
Fluorescently labeled targets of control (0 h at ITF and at
NIES greenhouse, prior to transport to ITF) and treated (rice
exposed to gamma rays for 6 and 72 h, middle dose) sam-
ples were hybridized to the same microarray slide contain-
ing 60-mer probes. Supplementary Figure 7 shows the chip
design used here. A flip-labeling (dye swap or reverse labeling
with Cy3 and Cy5 dyes) procedure was followed in order to
nullify the dye bias associated with unequal incorporation of
the 2 Cy dyes into cDNA. To select differentially expressed
genes by the dye-swap approach, we considered genes that
were upregulated in chip 1 (Cy3 and Cy5 label for control and
treatment, respectively) but downregulated in chip 2 (Cy3
and Cy5 label for treatment and control, respectively). The
use of a dye-swap approach has 2 benefits. First and most
importantly, it provides a highly stringent selection condition
for changed gene expression profiling over use of a single/2-
color approach (Rosenzweig et al. 2004; Altman 2005).
Second, it provides 2 technical chip replicates on the same
slide for 1 sample set (Supplementary Figure 7). Additionally,
it avoids the prohibitively high cost of a DNA microarray
chip in such an experiment, where statistically significant 7–8
replications using 7–8 individual chips are impractical.
Hybridization and wash processes were performed
according to the manufacturer’s instructions (Agilent), and
hybridized microarray slides were scanned using an Agilent
microarray scanner G2505C. For detection of significantly
differentially expressed genes between control and treatment,
each slide image was processed by Agilent Feature Extraction
Software (version 11.0.1.1). The program measures Cy3 and
Cy5 signal intensities of whole probes. Dye bias tends to be
dependent on signal intensity; therefore, the software selects
probes using a set by rank consistency filter for dye normali-
zation. The said normalization was performed by LOWESS
(locally weighted linear regression) that calculates the log
ratio of dye-normalized Cy3 and Cy5 signals, as well as the
final error of log ratio. The significance (P) value is based
on the propagated error and universal error models. In this
analysis, the threshold of significant differentially expressed
genes was < 0.01 (for the confidence that the feature was not
differentially expressed). In addition, erroneous data gener-
ated due to artifacts were eliminated prior to data analysis
using the software. The gamma radiation–responsive up- and
downregulated gene lists (≥2.0-fold, ≥ 0.5-fold) are detailed
in Supplementary Tables 1 (6 h up), 2 (6 h down), 3 (72 h
down), 4 (72 h down), 5 (0 h ITF up), 6 (0 h ITF down), 7
(72 h NIES up), and 8 (72 h NIES down).
The data discussed in this publication have been depos-
ited in NCBI’s Gene Expression Omnibus (GEO) and are
accessible through GEO Series accession number GSE53055
(http://www.ncbi.nlm.nih.gov/geo/info/linking.html).
Functional Classifcation of Differentially
Expressed Genes
Due to the large number of differentially expressed genes,
we further selected the highly up- and downregulated genes
based on simple criteria highlighting those genes that were
only differentially expressed after exposure to gamma radia-
tion (middle dose) at ITF for 6 and 72 h. This implies that
those genes that were expressed between the time period of
5 AM (NIES 0-h greenhouse sample) to 10 AM (ITF 0-h
sample) and after 3 days (NIES 72-h greenhouse sample),
that is, time- and growth-dependent gene expressions, were
subtracted from the total number of genes up- and down-
regulated using data from chips 1 and 2 (Supplementary
Figure 8). These genes are listed in Supplementary Tables 9
(highly up at 6 h), 10 (up at 6 h), 11 (highly down at 6 h), 12
(down at 6 h), 13 (highly up at 72 h), 14 (up at 72 h), 15 (highly
down at 72 h), and 16 (down at 72 h). The nonredundant
gamma radiation–highly responsive up- and down-regulated

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
728
T
a
b
l
e
 
1

T
h
e

p
r
i
m
e
r

p
a
i
r
s

u
s
e
d

f
o
r

a
n
a
l
y
z
i
n
g

g
e
n
e

e
x
p
r
e
s
s
i
o
n

c
h
a
n
g
e
s

i
n

r
i
c
e

b
y

R
T

P
C
R

u
s
i
n
g

s
p
e
c
i
f
c

p
r
i
m
e
r

p
a
i
r
s
F
o
r
w
a
r
d

p
r
i
m
e
r
R
e
v
e
r
s
e

p
r
i
m
e
r
P
r
o
d
u
c
t

s
i
z
e

(
b
p
)
D
e
s
c
r
i
p
t
i
o
n
A
c
c
e
s
s
i
o
n

(
g
e
n
e
)
P
r
i
m
e
r

n
a
m
e
N
u
c
l
e
o
t
i
d
e

s
e
q
u
e
n
c
e

(
5


3

)
P
r
i
m
e
r

n
a
m
e
N
u
c
l
e
o
t
i
d
e

s
e
q
u
e
n
c
e

(
5


3

)
A
K
1
0
0
2
6
7
R
J
S
R
4
3
C
T
C
C
T
A
G
C
A
G
C
A
T
G
A
A
G
A
T
C
A
A
R
J
S
R
4
4
A
T
G
A
T
A
A
C
A
G
A
T
A
G
G
C
C
G
G
T
T
G
2
9
4
A
c
t
i
n
A
B
0
3
7
1
4
4
R
J
S
R
6
6
5
A
A
G
C
A
G
A
A
A
C
A
A
G
A
T
G
G
A
G
G
A
G
R
J
S
R
6
6
6
A
T
T
A
C
T
G
G
A
C
C
A
T
C
C
A
A
C
C
A
A
C
3
2
3
O
s
U
V
-
D
D
B
1
A
B
1
1
1
9
4
4
R
J
S
R
6
6
7
G
A
T
C
A
G
C
T
T
C
C
A
A
T
C
A
C
A
C
A
T
C
R
J
S
R
6
6
8
A
C
T
G
G
T
A
G
T
C
A
G
G
T
T
T
C
A
G
C
A
C
2
7
9
O
s
C
S
B
X
5
4
0
4
6
R
J
S
R
6
6
9
G
T
C
A
C
T
A
A
C
C
T
T
T
G
C
C
C
T
G
A
G
G
T
A
C
A
R
J
S
R
6
7
0
G
G
T
A
A
A
A
G
C
A
T
T
C
C
G
T
C
G
T
A
A
G
3
0
5
O
s
P
C
N
A
A
K
1
1
1
4
1
8
R
J
S
R
6
6
3
A
A
C
T
T
C
T
G
C
T
A
T
T
A
C
C
A
A
C
C
T
C
R
J
S
R
6
6
4
C
T
G
G
T
C
C
A
C
T
A
G
T
C
C
A
T
T
C
T
A
G
2
5
1
C
D
P

p
h
o
t
o
l
y
a
s
e
A
B
0
2
1
6
6
6
R
J
S
R
6
7
3
C
C
G
A
T
G
A
G
G
A
A
G
G
T
C
T
T
G
T
A
G
A
G
T
R
J
S
R
6
7
4
C
A
G
G
A
G
G
T
C
T
T
G
T
T
G
A
T
G
A
A
T
G
2
7
6
O
s
F
E
N
-
1
a
A
B
0
4
2
4
1
5
R
J
S
R
6
7
9
A
C
C
C
T
C
G
G
T
T
T
G
C
A
G
A
C
A
C
R
J
S
R
6
8
0
A
C
G
A
G
C
G
A
G
C
A
G
C
T
G
A
T
A
G
A
G
T
A
G
2
2
4
O
s
R
P
A
7
0
a
A
K
0
6
0
5
8
2
R
J
S
R
6
8
1
G
T
G
A
T
G
A
C
A
G
T
T
A
C
C
T
T
C
T
C
A
A
R
J
S
R
6
8
2
C
A
T
G
G
A
C
T
C
T
T
C
A
A
G
C
T
T
C
A
C
C
2
2
6
O
s
R
P
A
7
0
b
A
B
0
3
7
1
4
5
R
J
S
R
6
7
1
G
C
A
C
A
T
T
G
A
T
G
A
A
A
T
C
G
T
G
A
A
G
R
J
S
R
6
7
2
T
G
T
A
A
T
T
T
C
A
C
T
G
G
A
T
G
G
A
G
C
A
2
8
5
O
s
R
P
A
3
2
A
B
0
3
7
1
3
5
R
J
S
R
6
7
5
G
C
A
A
G
C
T
T
G
G
T
G
A
A
G
G
T
A
A
G
A
T
R
J
S
R
6
7
6
C
C
T
T
C
G
A
G
T
C
G
A
T
A
T
C
T
T
T
T
G
G
3
0
0
O
s
O
R
C
1
D
4
5
4
2
3
R
J
S
R
3
4
3
G
A
C
A
A
G
A
A
A
C
C
C
T
C
T
G
C
A
G
T
T
T
R
J
S
R
3
4
4
G
T
A
G
T
C
T
G
C
T
G
G
T
T
C
A
C
A
C
T
G
G
3
0
5
O
s
A
P
X
1

A
B
0
5
3
2
9
7
R
J
S
R
3
4
5
G
A
C
A
A
G
A
A
A
C
C
C
T
C
T
G
C
A
G
T
T
T
R
J
S
R
3
4
6
G
T
A
G
T
C
T
G
C
T
G
G
T
T
C
A
C
A
C
T
G
G
3
0
2
O
s
A
P
X
2
A
K
0
9
9
9
2
3
R
J
S
R
1
0
3
G
A
C
G
A
T
A
C
A
C
A
A
G
C
A
G
A
A
C
G
A
C
R
J
S
R
1
0
4
T
G
A
C
A
T
T
G
T
C
T
G
G
C
C
T
T
A
T
T
T
G
2
9
9
O
s
C
A
T
c
A
K
1
0
6
1
0
9
R
J
S
R
1
1
C
A
C
T
C
C
G
A
C
C
A
G
G
A
G
C
T
C
T
A
C
R
J
S
R
1
2
C
G
T
T
G
C
G
C
A
C
T
T
A
T
A
C
A
T
A
T
C
G
3
1
0
O
s
P
O
X
8
.
1
A
K
0
7
3
2
0
2
R
J
S
R
1
2
3
A
C
A
A
C
G
C
C
T
A
C
T
A
C
A
G
C
A
A
C
C
T
R
J
S
R
1
2
4
T
A
T
A
T
G
T
G
G
T
G
T
G
G
C
C
C
G
T
T
T
A
3
0
6
O
s
P
O
X
2
2
.
3
A
K
0
6
2
7
7
2
R
J
S
R
8
4
9
T
G
C
A
C
C
C
C
T
G
T
A
C
A
A
G
T
A
T
C
T
G
R
J
S
R
8
5
0
A
T
A
A
G
G
A
T
T
C
A
G
G
A
T
G
C
A
A
G
G
A
3
1
2
O
s
G
P
X
1
N
C
_
0
0
1
3
2
0
R
J
S
R
9
1
9
G
G
C
C
T
A
C
T
T
C
T
T
C
A
C
A
T
T
C
A
C
C
R
J
S
R
9
2
0
A
T
C
T
C
C
A
A
A
G
A
T
T
T
C
G
G
T
C
A
G
A
3
2
7
O
s
R
B
S

L
S
U
A
Y
4
4
5
6
2
7
R
J
S
R
9
2
1
G
C
T
A
A
C
T
A
A
C
T
A
C
G
T
G
G
C
T
A
T
G
G
R
J
S
R
9
2
2
A
C
T
T
G
G
A
T
C
G
A
A
G
C
A
G
G
T
A
C
T
C
2
7
2
O
s
R
B
S

S
S
U
X
8
7
9
4
6
R
J
S
R
3
5
1
C
G
A
T
T
C
C
C
A
G
C
A
G
A
A
T
C
A
C
C
R
J
S
R
3
5
2
G
C
C
T
C
C
A
C
A
C
T
C
C
A
C
T
G
T
T
A
T
T
2
5
4
O
s
P
A
L
2
X
8
9
8
5
9
R
J
S
R
3
7
C
T
G
G
A
C
A
A
G
G
A
G
A
G
G
A
T
G
A
G
G
R
J
S
R
3
8
A
T
A
A
A
A
G
A
T
G
A
C
G
T
G
T
G
G
C
G
T
A
2
9
0
O
s
C
H
S
1
A
K
0
6
0
0
0
5
R
J
S
R
2
9
G
G
A
G
A
A
G
G
G
C
T
C
C
T
A
C
G
A
C
T
A
C
R
J
S
R
3
0
G
C
G
C
A
T
A
T
A
T
A
T
C
T
A
C
Y
G
A
G
A
G
C
A
3
1
4
O
s
P
R
1
b
A
K
0
7
1
6
1
3
R
J
S
R
4
9
3
A
G
T
C
G
G
A
T
G
T
G
C
T
C
G
A
G
G
C
A
G
A
A
R
J
S
R
4
9
4
A
T
A
G
A
G
G
C
A
G
T
A
T
T
C
C
T
C
T
T
C
A
2
6
0
O
s
P
R
1
0
a

(
P
B
Z
1
)
O
s
,

O
r
y
z
a

s
a
t
i
v
a
;

U
V
,

u
l
t
r
a
v
i
o
l
e
t
;

D
D
B
,

d
a
m
a
g
e
d

D
N
A

b
i
n
d
i
n
g

;

C
S
B
,

C
o
c
k
a
y
n
e

s
y
n
d
r
o
m
e

g
r
o
u
p

B
;

P
C
N
A
,

p
r
o
l
i
f
e
r
a
t
i
n
g

c
e
l
l

n
u
c
l
e
a
r

a
n
t
i
g
e
n
;

C
D
P
,

c
y
c
l
o
b
u
t
a
n
e

p
y
r
i
m
i
d
i
n
e

d
i
m
e
r
;

F
E
N
,

f
a
p

e
n
d
o
n
u
c
l
e
a
s
e
;

R
P
A
,

r
e
p
l
i
c
a
t
i
o
n

p
r
o
t
e
i
n

A
;

O
R
C
,

o
r
i
g
i
n

r
e
c
o
g
n
i
t
i
o
n

c
o
m
p
l
e
x
;

A
P
X
,

a
s
c
o
r
b
a
t
e

p
e
r
o
x
i
d
a
s
e
;

C
A
T
,

c
a
t
a
l
a
s
e
;

P
O
X
,

p
e
r
o
x
i
d
a
s
e
;

G
P
X
,

g
l
u
t
a
t
h
i
o
n
e

p
e
r
o
x
i
d
a
s
e
;

R
B
S
,

r
i
b
u
l
o
s
e
-
1
,
5
-
b
i
s
p
h
o
s
p
h
a
t
e

c
a
r
b
o
x
y
l
a
s
e
/
o
x
y
g
e
n
a
s
e
;

L
S
U
,

l
a
r
g
e

s
u
b
u
n
i
t
;

S
S
U
,

s
m
a
l
l

s
u
b
u
n
i
t
;

P
A
L
,

p
h
e
n
y
l
a
l
a
n
i
n
e

a
m
m
o
n
i
a
-
l
y
a
s
e
;

C
H
S
,

c
h
a
l
c
o
n
e

s
y
n
t
h
a
s
e
;

P
R
,

p
a
t
h
o
g
e
n
e
s
i
s
-
r
e
l
a
t
e
d
;

P
B
Z
,

p
r
o
b
e
n
a
z
o
l
e
.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
729
genes listed in Supplementary Tables 9, 11, 13, and 15 were
further considered candidate genes for specific bioinformat-
ics analysis using the MapMan program, version 3.1.1, at the
Max Plant Institute of Molecular Plant Physiology, Germany
(Thimm et al. 2004; Usadel et al. 2009). Gene expression fold
values were transformed to Log
2
(fold), and then their means
were calculated. These nonredundant genes were classified
into MapMan BINs, and their annotated functions were
visualized using the MapMan program, based on a newly
constructed rice mapping file for all the genes on Agilent
4 × 44K rice DNA chip. The mapping file was established
by automated searches using the systematic names (as locus
identifiers) of all the genes on the DNA chip released from
the GeneSpring program (version GX 10, Agilent) and a
MapCave tool (http://mapman.gabipd.org/web/guest/
mapcave), which is linked with 6 different databases, such
as Arabidopsis thaliana TAIR8, Arabidopsis thaliana TAIR9,
Hordeum vulgare, Oryza sativa TIGR5, SwissProt/PPAP, and
Vitis vinifera Gene Index R5.
Results and Discussion
Rationale and Experimental Strategy
On the basis of previously conducted experiments, the effect
of ultralow, low, and high doses of ionizing radiation in rice
plants was apparent at the morphological and molecular
genetic levels (Kimura et al. 2008; Rakwal et al. 2008, 2009;
Rakwal R, unpublished data). In the case of gamma radia-
tion—our main focus—the effects of ultralow- and low-level
gamma rays were examined in cut leaf segments obtained
from 2-week-old rice seedlings, whereby the experiment
could be considered in vitro, that is, “Petri dish” experiments.
Considering the fact that it was not feasible to conduct such
a low radiation dose experiment in the laboratory and this
being what we wished to examine at the whole plant level
or in vivo, the ill-fated FDNPP accident in March 2011 pro-
vided such an unexpected opportunity. Being able to visit,
see, and meet up with physicist colleagues at Iitate village
(Fukushima) was a starting point for the ongoing project
under the Iitate-mura (=village) Society for Radioecology
(http://iitate-sora.net/). The experimental site was cho-
sen at ITF based on the continuous emission of gamma
rays (~5 µSv/h; 100 times greater than natural background
level) from the highly contaminated soil there (Imanaka
et al. 2012). The radiation dose was similar to the previously
conducted in-house experiment with fabricated gamma ray–
emitting sources (Rakwal et al. 2009) and formed the basis
for a 3-dose (~1.5/2.5/4.5 µSv/h) experiment to confirm
previous findings and provide new information on gamma
radiation–exposed whole rice plants. As diagrammatically
depicted in Figure 2A, there was no direct contact between
the seedlings and the contaminated soil, thus ensuring that
we primarily observed the effects of gamma radiation alone.
The 3rd leaf was used as the experimental sample. Each
dose—low, middle, and high—was determined as described
in the Materials and Methods, and the data are graphically
presented in Figure 3 for the months of July, August, and
September 2012. The experimental strategy from the design
of the experiment to the sampling, methodology, and analy-
ses steps that led to the list of identified gamma radiation–
responsive molecular factors is presented in Figure 4.
Selection of July 2012 Experiment for Downstream
Analysis Based on Climate Parameters and Leaf
Morphology
Three independent experiments were carried out in the
months of July, August, and September 2012. On the basis
of the ground (field) conditions of temperature, humidity,
light, and rain, along with observations of the leaf mor-
phology after 3-day exposure to gamma radiation, the July
experiment was selected for further molecular analyses. The
ground and interior (boxes containing seedlings) tempera-
tures (°C), humidity (%), and light intensity (lux) are graphi-
cally shown in Supplementary Figure 9 for the time periods
of the experiment. In the month of July, the temperature
in Iitate village hovered around 26 °C for the month of
July, except for day 1, when the temperature was measured
as being around 33.5 °C in the experimental field at ITF.
Similar readings were obtained for the temperature inside
the sample boxes. Additionally, the July sky was clear and
sunny, and there was no rain. On the other hand, the tem-
perature increased to around 40.8 °C at the maximum on
day 1 and decreased to 31.8 °C on day 2 in August, and
due to rain, the boxes were placed under a greenhouse with
only the top cover with open sides. In September, the tem-
perature dropped down to around 19 °C, and there was
heavy rain, resulting in use of an almost fully closed-type
greenhouse during the final 2 days. The humidity also varied
with each month, and compared with the levels in July and
August, the humidity peaked in September due to the use of
the greenhouse. For light intensity, similar lux readings were
obtained in July and August compared with the relatively low
intensity measured in September. In addition, the optimum
temperature, humidity, and light conditions in the control
greenhouse (NIES, Tsukuba), where a part of the seedlings
were left to grow, were almost similar to that of the July
experimental period.
After exposure to gamma radiation, the 3rd leaves were
examined for changes in morphology. As seen in Figure 5,
the tips of the 3rd leaves (fully formed) showed drying/
withering at the dose (~241 µSv/3 days) in the unshielded
box (Figure 5A). Following removal of the seedlings from
ITF and placement back in the greenhouse in Tsukuba, the
tips further withered, as seen in Figure 5B. In comparison,
healthy seedlings (Figure 5C) showed no such damage on the
leaves, suggesting that the drying at the tips could be due to
radiation exposure. The observed leaf tip damage was also
seen in the case of high-dose gamma ray and ionizing radia-
tion in previous experiments (Rakwal et al. 2008; Rakwal R,
unpublished data). Unfortunately, we could not observe such
symptoms on leaves during August and September. One
reason might be the changes in temperature, humidity, and
light/rain, due to which we had to cover the seedlings by
enclosing within a greenhouse.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
730
Figure 3. Accumulated radiation dose for each day of the experimental periods in July, August, and September of 2012. In
each month, the values indicated at the right-hand side of each point line indicate the maximum accumulated dose that was
measured at the last time point sampled. Details are mentioned in the text.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
731
Prior to downstream molecular analysis using RT-PCR
and DNA microarray, the leaves were ground in liquid nitro-
gen to yield fine powders (Figure 4). In the following sec-
tions, the results of these gene expression analyses using 2
different approaches are presented and discussed.
RT-PCR Analysis of Selected Candidate Genes
On the basis of previously conducted experiments, we had a
general idea of the genes that might be differentially affected
by ionizing radiation (Kimura et al. 2008; Rakwal et al. 2008,
2009; Rakwal R, unpublished data). Therefore, we first exam-
ined whether these genes indeed are affected by gamma
radiation exposure using RT-PCR. The gene names and
primers are described in Table 1. The RT-PCR experiment
was conducted using blind samples, and once the results were
obtained, the data were reformatted to the time-course series
from 0 to 72 h. The gene expression results are graphically
presented in Figure 6. Five groups of gene functions were
examined: Genes related to DNA replication/repair, oxi-
dative stress, photosynthesis, secondary metabolism, and
defense/stress (see Table 1). Although for most of the genes,
a correlation with the dose (low, middle, and high) was found,
we are not able to discuss that feature (dose dependency)
in detail in this article. Therefore, we will mainly discuss the
increase or decrease in gene expression following gamma
radiation exposure relative to the 0-h start at ITF using some
examples from each above-mentioned functional category.
In the DNA replication/repair category, the clearest
change/increase in abundance of gene expression was seen
at the early time points for OsCSB, OsPCNA, CDP photolyase,
OsFEN-1a, OsRPA70a, OsRPA70b, OsRPA32, and OsORC1
(Kimura et al. 2004). This is also in line with previous experi-
ments, wherein high-dose gamma radiation and ionizing
radiation increased their expressions (Rakwal et al. 2008;
Rakwal R, unpublished data). In particular, we identified
Figure 4. Experimental design and strategy for measuring the effect of low-level dose of gamma radiation on rice plants.
A 2-week-old seedling model system was used. Briefy, the upper panel shows the rice plants at the start of the experiment before
transporting the rice seedlings from Tsukuba to ITF in Iitate village. The middle panel shows a representative sampling photo
of rice leaf cutting and storage in dry ice and a deep freezer. The lower set of photographs shows ground rice leaf powder in
a mortar and pestle in liquid nitrogen; flled area in the 3 microtubes represents the amount of powdered sample just above the
triangular base. Further details are in the text.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
732
Figure 5. Gamma radiation affects the tips of rice seedling leaves. (A) Leaf tips at 3 days after exposure to gamma radiation;
3rd leaves are marked by arrows. (B) 3-day-exposed seedlings showing the progression of the drying of the leaf (3rd) tips (marked
by arrows) at 30 days postgermination, in the control greenhouse (NIES, Tsukuba). (C) Healthy seedlings show no such damage
to the 3rd leaf or any other leaf.
Figure 6. Gene expression analysis of 22 selected genes. Beta-actin gene was used to check the quality of cDNA and as a
positive control. Relative abundance of gene expression calculated from the bands on agarose gels (see Materials and methods and
Supplementary Figure 6 for further details) were plotted against treatment (gamma radiation) time and dose. Details are mentioned
in the text.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
733
that the OsPCNA gene expression was very high only during
the early time period (6, 12, and 24 h) of gamma radiation
exposure (Figure 6). Interestingly, OsPCNA is the only well-
studied and reported gene in rice among other DNA rep-
lication/repair genes (Kimura et al. 2001, 2004; Yamamoto
et al. 2005; Strzalka and Ziemienowicz 2011). In rice plants,
PCNA has been shown to interact with DnaJ that is induced
under DNA damage (Yamamoto et al. 2005) and recently
also with X-ray repair cross-complementing 1 (XRCC1), a
well-known base excision repair protein (Uchiyama et al.
2008). Although we could not find the previously reported
DnaJ gene (Yamamoto et al. 2005) from among the 163
probes corresponding to numerous DnaJ-related genes in the
rice genome, we found that the XRCC1 gene was induced in
the 6-h sample but suppressed in the 72-h sample used for
microarray analysis (data are available under the GEO series
accession number GSE53055) described below. Similarly, the
OsPCNA gene was found to be induced and suppressed at
6 and 72 h, respectively, based on the obtained DNA micro-
array data (GSE53055). This shows a preconfirmation of
the gene expression–profiling data obtained using DNA
microarray chip discussed below. On the basis of our pre-
sent finding, it can be suggested that OsPCNA is involved
in DNA repair processes in gamma ray–exposed cells in the
rice leaves. On the other hand, the OsUV-DDB1 gene did not
show any strong change in expression. To date, the OsUV-
DDB1 gene, along with OsUV-DDB2, has been shown to
be responsive to treatment with ultraviolet radiation in rice
seedlings (Ishibashi et al. 2003). The expression of OsUV-
DDB genes was correlated with cell proliferation, and its
expression might be necessary for predominantly undergo-
ing DNA repair during DNA replication. These results sug-
gest that gamma radiation specifically alters the expression
of certain known genes involved in DNA replication/repair,
which might be accelerated due to the gamma rays penetrat-
ing the cells. Moreover, this response is early, within 6–24 h,
and not late, again suggesting the specificity of the observed
effect (radiation).
In the category of oxidative stress–related genes, the
genes encoding ascorbate peroxidases (APX), catalase
(CAT), peroxidases (POX), and glutathione peroxidase
(GPX) were found to be differentially expressed, indicating
their individual time-dependent responses to the gamma
radiation (Figure 6). In particular, OsAPX1/2 genes showed
a slight increase in expression from 0 to 72 h, peaking around
24 and 48 h postexposure. The OsAPX1/2 genes are the
most well characterized among the genes examined herein
and have been shown to be responsive to oxidative and abi-
otic stresses in rice (Morita et al. 1997, 2011; Lu et al. 2005).
The OsCATc gene showed a downregulation at 24 and 48 h,
followed by a recovery at 72 h postexposure. Interesting, the
OsPOX8.1/22.3 genes showed a strong decrease in expres-
sion, except for a peak at 12 h, compared with the 0-h control
for OsPOX8.1. The OsGPX1 gene was induced relative to
the 0-h control prominently at 6 and 24 h postexposure. The
OsGPX gene family has been recently shown to be induced
in response to exogenous hydrogen peroxide (H
2
O
2
) and
cold stress (Passaia et al. 2013). These results suggest that the
exposed leaves have oxidative stress response mechanisms,
resulting in the differential expression of the genes encod-
ing the antioxidant enzymes. From these data, it is clear that
both induction (OsAPX1/2 and OsGPX) and suppression
(OsCATc and OsPOZ8.1/22.3) of gene expression occur
in cells and that the effect may depend on the variety and
amount of free radicals being generated. In future studies,
the production of free radicals, such as H
2
O
2
, would have
to be examined along with the activities of the antioxidant
enzymes in the gamma-irradiated leaves.
For the photosynthesis-related genes, OsRBS (ribulose
bisphosphate carboxylase/oxygenase) encoding the large
subunit (LSU) and small subunit (SSU), no clear differences
were observed until 24 h, but at 48 and 72 h, an increase in
gene expression was seen (Figure 6). In general, climatic fac-
tors cause variation in RuBisCO content and activity (Galmes
et al. 2013). It is difficult to explain the results obtained here,
but under field conditions, multiple environmental factors
are working together. Thus, the increased transcription of
RuBisCO observed at late time periods may be due to the
plant’s response to the low-level stress being perceived,
but with no major damage to the chloroplastic apparatus,
which is a major cause of reduced RuBisCO transcription,
translation, and activity. Compared with other major abiotic
stresses, wherein the general trend is reduction of RuBisCO,
a major effect is on depression of photosynthesis (Galmes
et al. 2013), which may not be the case in the current stress
condition of gamma ray exposure because the leaves are
healthy except for the symptom of drying at the extreme
tip (Figure 5). As a next step, we are conducting proteom-
ics analysis to see how the proteins, especially the RuBisCO
subunits, behave under gamma irradiation.
Both the secondary metabolism–related genes OsPAL2
and OsCHS1 examined here showed a strong increase in
expression after exposure to gamma radiation (Figure 6),
which is expected under both abiotic and biotic stresses. The
OsPAL2 gene has been reported to be both developmentally
regulated and stress inducible (Zhu et al. 1995; Hyun et al.
2011). The OsCHS1 gene expression was below the detect-
able limit of the RT-PCR experiment at 0 h, but it showed a
strong increase at 6 h and thereafter, making it an interesting
candidate for further investigation as a specific gamma ray–
responsive gene. DNA microarray analysis (see below) also
revealed the high fold induction of 15 and 9 and 8 and 11
OsPAL and OsCHS genes at 6 and 72 h, respectively, again
providing preconfirmation of PAL and CHS gene expres-
sion at the whole-genome level. Chalcone synthase (CHS)
is a key enzyme of the flavonoid/isoflavonoid biosynthe-
sis pathway, and in addition to being developmentally regu-
lated similar to the PAL genes, it is known to be induced
in response to stress conditions, including ultraviolet light
and pathogen attack (Dao et al. 2011). OsCHS1 (Scheffler
et al. 1995) encodes a naringenin CHS, which is mostly likely
behind the production of antimicrobial phytoalexins includ-
ing sakuranetin; we also previously identified this gene in rice
leaves exposed to ultralow-level dose of gamma radiation
emitted from contaminated soil obtained from the exclusion
zone around the Chernobyl reactor site (Rakwal et al. 2009).

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
734
It would also be interesting to identify the proteins catalyzing
these reactions toward phytoalexin production in rice leaves
in our ongoing proteomics analysis. Nonetheless, differential
induction of secondary metabolism–related genes by gamma
radiation indicates activation of the self-defense mechanism
in rice leaves.
Finally, 2 genes related to the biotic and abiotic stress
responses were examined. The OsPR1b gene is a pathogen-
esis-related gene induced by pathogens and numerous other
elicitors (Jwa et al. 2006). However, we could only observe
an induction in its mRNA level predominantly at 12 h, and at
other time points, there was a general decrease in expression
(Figure 6). On the other hand, OsPR10a (also known as the
probenazole-inducible protein, PBZ1) was strongly induced
starting at 6 h, followed by a decline at 12 h, but thereafter
showing a strong increase until 72 h. The PBZ1 gene has pre-
viously been shown to be strongly induced in response to
ultralow-level dose of gamma radiation (Rakwal et al. 2009)
and by other stresses (Jwa et al. 2006). Recently, the PBZ1
protein having RNase activity was suggested to play a key
role in cell death in plants (Kim et al. 2011).
Taken together, the above results indicate that gamma
radiation affects rice by causing the transcriptional activation
of genes involved in rice self-defense mechanisms, including
genes involved in DNA repair, antioxidant defense, photo-
synthesis, secondary metabolism, and cell death, in the leaves.
It is emphasized that the genes selected above, although
based on previous ionizing radiation exposure experiments,
are also modulated by other biotic and abiotic stress factors.
Therefore, gamma radiation as an environmental stimulus
adds to the growing list of stresses being examined in rice
and therein provides the ability to discern the expression
and regulation of each gene under various differential stress
conditions. Moreover, RT-PCR analysis of gene expression
provided us with initial confirmatory data showing that these
rice plants are uniquely gamma ray stressed.
DNA Microarray Analyses Reveal Numerous
Differentially Expressed Genes Involved in the Early
and Late Stress Responses
The data on the expression levels of the above-mentioned
selected genes clearly revealed that gamma radiation triggers
the differential expression of genes with diverse functions in
a time-dependent manner, and these genes can be broadly cat-
egorized as early- and late-responsive genes (Figure 6). These
data provided us further confidence to examine in detail the
genomewide expression profiles in the same samples with an
aim to unravel the pathways operating downstream in gamma
radiation–stressed rice. DNA microarray analysis was per-
formed as described in Materials and Methods (Supplementary
Figure 7). Two chips were used to generate the lists of dif-
ferentially expressed genes at 6 and 72 h time points postex-
posure and to also know the changed gene expression levels
at 0 h, the start of the experiment at ITF, relative to the 0-h
control at the greenhouse (NIES) in Tsukuba, and after 72 h
in the NIES greenhouse (Supplementary Figure 8). The up-
and downregulated genes at 6 and 72 h and at 0 h at ITF and
at 72 h at the greenhouse are listed in Supplementary Tables
1–8. These gene inventories revealed that gamma radiation
exposure causes the modulation of diverse gene functions.
The gene resources for this experiment are available to the
scientific community for study and scrutiny at the GEO data-
base with accession number GSE53055.
On the basis of the criteria specified for identifying genes
that were assumed to be more specific to the gamma radia-
tion exposure, 4481 (upregulated) and 3740 (downregulated)
genes were selected for the early—6 h—response period,
compared with the 2291 (upregulated) and 1474 (downreg-
ulated) genes selected for the late—72 h—response period
(Supplementary Tables 9–16). Among these, the nonredun-
dant highly gamma radiation–responsive up- and downregu-
lated genes are listed in Supplementary Table 9 (184 genes),
11 (225 genes), 13 (235 genes), and 15 (203 genes). Let us
look at a few examples of the identified highly changed genes.
At 6 h, the LOC_Os01g12440, a gene encoding the
AP2 domain–containing protein was identified at the high-
est induction: Average fold value of 87.69 (Supplementary
Table 9). The AP2 (APETALA2) and EREBPs (ethylene-
responsive element–binding proteins) are plant-specific
transcription factors that contain the AP2 DNA-binding
domain and are key regulators of several developmental pro-
cesses and, importantly, part of mechanisms used by plants
to respond to environmental stress factors (Riechmann
and Meyerowitz 1998; Gutterson and Reuber 2004). This
becomes the first report of an AP2-EREBP family member
to be induced by gamma radiation. Among the highly down-
regulated genes, the top hit was a 1,3;1,4-beta glucanase (Gns1;
LOC_Os05g31140), which showed the lowest suppres-
sion: Average fold value of 0.00 (Supplementary Table 11).
The Gns1 gene is known to be highly inducible by ethylene,
wounding, salicylic acid, and fungal elicitors (Simmons et al.
1992); in transgenic plants that overexpress this gene and
are associated with lesions on the leaves and that are under
pathogen infection (Nishizawa et al. 2003); and by brown
plant hopper attack (Wei et al. 2009). Our results indicate
that for some reason unknown at present, gamma radiation
strongly suppresses Gns1, which is involved in carbohydrate
metabolism. At 72 h, the most highly upregulated (average
fold value of 404.11) gene was LOC_Os04g55159, a pro-
tease inhibitor/seed storage/LTP family protein precursor
(Supplementary Table 13). These are small cysteine peptides
resembling antimicrobial peptides, which have been under-
predicted in plants (Silverstein et al. 2007). These are known
to be induced under diverse environmental stresses, but this
may be the first report of its strong induction by gamma ray.
The highly downregulated (average fold value of 0.00) gene
at 72 h was LOC_Os10g26940 (Supplementary Table 15),
which encodes a polygalacturonase, a hydrolase responsible
for cell wall pectin degradation, organ consenescence, and
biotic stress in plants (Liu et al. 2013, and references therein).
Interestingly, the gene OsBURP16 (LOC_Os10g26940)
encoding a PG1β subunit precursor was investigated at
the transgenic level, and the results showed that its over-
expression caused pectin degradation that affected the cell
wall integrity as well as transpiration rate, which decreased

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
735
tolerance to abiotic stress (Liu et al. 2013). We cannot explain
the reason for OsBURP16 gene downregulation, but consid-
ering the results obtained above, protecting against possible
cell damage may be a possibility.
General View of Gamma Radiation Response Pathways
in Rice Cells
The above-mentioned highly changed genes (Supplementary
Tables 9, 11, 13, and 15) were analyzed using the MapMan
program and were functionally categorized into 35 groups,
wherein the frequency of genes in each class was calculated as
a percentage (Table 2). Looking at the categories that changed
at 6 and 72 h, protein functions were abundantly represented
at 6 h than at 72 h, followed by RNA and DNA functions that
were almost similarly represented at both time points but with a
lower percentage for DNA. The stress category was also found
to be highly represented at both 6 and 72 h. In the case of sign-
aling function, the genes were more mobile at the 72-h period,
indicating the occurrence of secondary stress responses. On
the other hand, miscellaneous and unassigned functions were
highly represented, suggesting that many rice genes need to
be annotated by further experiments. Understanding these
gene functions will provide greater insight into the mecha-
nisms operating behind gamma ray–induced rice self-defense
mechanisms. Finally, to understand different gamma radiation
responses in leaves, the expression levels of genes categorized
into each subBINs were compared and visualized, as shown in
Figure 7. A glance of the mapped genes and their expressions
on various regulatory events presented major differences in
the presence/absence of fundamental regulatory processes of
hormonal and other signaling pathways, transcription factors,
Table 2 The functional category of highly expressed gamma-responsive rice genes at 6 and 72 h determined by MAPMAN analysis
BIN Functional category
6 h_up 6 h_down 72 h_up 72 h_down
Count % Count % Count % Count %
1 PS (photosynthesis) 2 1.1 1 0.4 1 0.4 0 0.0
2 Major CHO
(carbohydrate)
metabolism
0 0.0 3 1.3 3 1.3 0 0.0
3 Minor CHO
(carbohydrate)
metabolism
1 0.5 5 2.2 1 0.4 1 0.5
4 Glycolysis 1 0.5 0 0.0 1 0.4 0 0.0
5 Fermentation 1 0.5 0 0.0 0 0.0 1 0.5
7 OPP (oxidative
pentose phosphate
pathway)
0 0.0 1 0.4 0 0.0 0 0.0
8 TCA (tricarboxylic
acid cycle) / org.
transformation
1 0.5 1 0.4 0 0.0 3 1.5
10 Cell wall 1 0.5 5 2.2 6 2.6 1 0.5
11 Lipid metabolism 2 1.1 5 2.2 6 2.6 1 0.5
12 N-metabolism 1 0.5 0 0.0 0 0.0 0 0.0
13 Amino acid
metabolism
1 0.5 2 0.9 4 1.7 0 0.0
15 Metal handling 0 0.0 1 0.4 1 0.4 2 1.0
16 Secondary metabolism 2 1.1 3 1.3 11 4.7 4 2.0
17 Hormone metabolism 4 2.2 2 0.9 10 4.3 12 5.9
18 Co-factor and vitamine
metabolism
0 0.0 1 0.4 1 0.4 1 0.5
19 Tetrapyrrole synthesis 0 0.0 0 0.0 2 0.9 0 0.0
20 Stress 7 3.8 11 4.9 5 2.1 16 7.9
21 Redox regulation 2 1.1 0 0.0 3 1.3 1 0.5
22 Polyamine metabolism 1 0.5 0 0.0 0 0.0 0 0.0
23 Nucleotide metabolism 0 0.0 0 0.0 2 0.9 1 0.5
26 Miscellaneous 11 6.0 14 6.2 23 9.8 22 10.8
27 RNA 17 9.2 16 7.1 15 6.4 20 9.9
28 DNA 3 1.6 2 0.9 2 0.9 0 0.0
29 Protein 45 24.5 19 8.4 25 10.6 11 5.4
30 Signaling 3 1.6 22 9.8 15 6.4 19 9.4
31 Cell 1 0.5 6 2.7 5 2.1 2 1.0
33 Development 3 1.6 2 0.9 1 0.4 4 2.0
34 Transport 6 3.3 7 3.1 9 3.8 6 3.0
35 Not assigned 69 37.5 101 44.9 89 37.9 79 38.9
The number of
nonredundant genes
184 100 225 100 235 100 203 100

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
736
biotic and abiotic stress, redox reactions, and development at
early (6 h) and late (72 h) periods. Without discussing the details
of each gene here, we would like to show that first, abiotic
stress–related gene processes are more induced at 72 h than
at 6 h, compared with a strongly induced redox process at 6 h
relative to that at 72 h, which correlates well with the strong
expression of glutathione S-transferase early in the exposure
period. Secondly, hormonal processes are more active at the
6-h period compared with the 72-h period. However, other
signaling processes are more widely expressed at 72 h, indicat-
ing secondary stress responses at later stages of gamma radia-
tion exposure. Thirdly, transcription factors are differentially
expressed at 6 h (ERF/MYB strongly up), compared with the
expression of bZIP and WRKY, strongly expressed at 72 h,
which might be directly related to the perception of gamma
radiation itself. Fourthly, developmental processes are more
highly expressed at 72 h, which may be linked to the later-
observed drying of the 3rd leaves (Figure 5). In this context,
although the OsBURP16 gene shows strongly reduced expres-
sion at 72 h, other cell wall–related genes are highly induced at
72 h, which might lead us to speculate on their involvement in
the observed leaf tip–drying phenomenon. Finally, heat shock
proteins and secondary metabolites are strongly regulated at
72 h, which can be correlated with the induction of secondary
stress responses and the production of phytoalexins in leaves.
Concluding Remarks
The herein-presented results provide an overview of the
low-level gamma radiation–responsive rice transcriptome,
showing both specific and common (to other abiotic stress)
modulations of gene expression in the rice plant. Two impor-
tant points can be highlighted from this study: 1) The experi-
mental design and strategy provide a new way to study the
effects of gamma radiation in cereal model systems, although
the effects of dose dependency remain to be clarified, and
2) the large inventory of differentially expressed genes pro-
vides a great resource for genes that might be uniquely mod-
ulated by ionizing radiation. Considering the large number
of changed genes, it will be possible to clarify the gamma
ray response completely only by further experimentation and
detailed bioinformatics analysis. Future studies will involve
analyzing the leaf proteome to complement the genomics
data reported here and to observe the effects of gamma radi-
ation from the whole plant to the level of the seed.
Supplementary Material
Supplementary material can be found at http://www.jhered.
oxfordjournals.org/.
Funding
There were no external funding sources for this work.
Acknowledgments
Authors appreciate the help of Mr K. Matsumoto (NIES, Tsukuba) for man-
aging the growth of the rice seedlings used in these experiments. Authors
thank the people of Iitate village (Fukushima) and all other people involved
Figure 7. Molecular events and potential components for cellular response against gamma radiation stress in rice leaves.
Gene expression changes are depicted in MapMan format, version 3.1.1, where (A) 6 h posttreatment and (B) 72 h posttreatment
indicate the early- and late-responsive gene expressions; each square represents a gene. Red and blue colors indicate up- and
downregulation in gene expression, respectively.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Hayashi et al. • Low-Level Gamma Radiation–Triggered Rice Gene Expression
737
in this study at various parts of the experiment for their support and encour-
agement, without which this work could not have seen light. We also appre-
ciate the support of Iitate-mura Society for Radioecology (IISORA) (http://
iitate-sora.net/).
References
Agrawal GK, Jwa NS, Jung YH, Kim ST, Kim DW, Cho K, Shibato J, Rakwal
R. 2013. Rice proteomic analysis: sample preparation for protein identifca-
tion. Methods Mol Biol. 956:151–184.
Agrawal GK, Rakwal R. 2006. Rice proteomics: a cornerstone for cereal
food crop proteomes. Mass Spectrom Rev. 25:1–53.
Agrawal GK, Rakwal R. 2011. Rice proteomics: a move toward expanded
proteome coverage to comparative and functional proteomics uncovers the
mysteries of rice and plant biology. Proteomics. 11:1630–1649.
Altman N. 2005. Replication, variation and normalisation in microarray
experiments. Appl Bioinformatics. 4:33–44.
Bertell R. 1985. The problem: nuclear radiation and its biological effects. In:
Bertell R, editor. No immediate danger, prognosis for a radioactive Earth.
Part I. Summertown (TN): The Book Publishing Company. p. 15–63.
Cho K, Kubo A, Shibato J, Agrawal GK, Saji H, Rakwal R. 2012. Global
identifcation of potential gene biomarkers associated with ozone-induced
foliar injury in rice seedling leaves by correlating their symptom severity with
transcriptome profling. Int J Life Sci. 6:1–13.
Cho K, Shibato J, Kubo A, Kohno Y, Satoh K, Kikuchi S, Agrawal GK,
Sarkar A, Rakwal R. 2013. Genome-wide mapping of the ozone-responsive
transcriptomes in rice panicle and seed tissues reveals novel insight into their
regulatory events. Biotechnol Lett. 35:647–656.
Dao TT, Linthorst HJ, Verpoorte R. 2011. Chalcone synthase and its func-
tions in plant resistance. Phytochem Rev. 10:397–412.
Galmés J, Aranjuelo I, Medrano H, Flexas J. 2013. Variation in Rubisco
content and activity under variable climatic factors. Photosynth Res.
117:73–90.
Goff SA, Ricke D, Lan TH, Presting G, Wang R, Dunn M, Glazebrook
J, Sessions A, Oeller P, Varma H, et al. 2002. A draft sequence of the rice
genome (Oryza sativa L. ssp. japonica). Science. 296:92–100.
Gutterson N, Reuber TL. 2004. Regulation of disease resistance pathways by
AP2/ERF transcription factors. Curr Opin Plant Biol. 7:465–471.
Hyun MW, Yun YH, Kim JY, Kim SH. 2011. Fungal and plant Phenylalanine
Ammonia-lyase. Mycobiology. 39:257–265.
Imanaka T, Endo S, Sugai M, Ozawa S, Shizuma K, Yamamoto M. 2012.
Early radiation survey of Iitate village, which was heavily contaminated
by the Fukushima Daiichi accident, conducted on 28 and 29 March 2011.
Health Phys. 102:680–686.
International Rice Genome Sequencing Project. 2005. The map based
sequence of the rice genome. Nature. 436:793–800.
Ishibashi T, Kimura S, Yamamoto T, Furukawa T, Takata K, Uchiyama
Y, Hashimoto J, Sakaguchi K. 2003. Rice UV-damaged DNA binding
protein homologues are most abundant in proliferating tissues. Gene.
308:79–87.
Jwa NS, Agrawal GK, Tamogami S, Yonekura M, Han O, Iwahashi H,
Rakwal R. 2006. Role of defense/stress-related marker genes, proteins
and secondary metabolites in defning rice self-defense mechanisms. Plant
Physiol Biochem. 44:261–273.
Kikuchi S. 2008. High-throughput transcriptome analysis in rice from a
genomic perspective. In: Hirano H-Y,Sano Y, Hirai A, Sasaki T, editors. Rice
biology in the genomics era, biotechnology in agriculture and forestry 62.
Berlin (Germany): Springer-Verlag. section 1.5.
Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N,
Yazaki J, Ishikawa M, Yamada H, Ooka H, et al. 2003. Collection, mapping,
and annotation of over 28,000 cDNA clones from japonica rice. Science.
301:376–379.
Kim SG, Kim ST, Wang Y, Yu S, Choi IS, Kim YC, Kim WT, Agrawal GK,
Rakwal R, Kang KY. 2011. The RNase activity of rice probenazole-induced
protein1 (PBZ1) plays a key role in cell death in plants. Mol Cells. 31:25–31.
Kimura S, Shibato J, Agrawal GK, Kim YK, Nahm BH, Jwa NS, Iwahashi
H, Rakwal R 2008. Microarray analysis of rice leaf response to contaminated
(radioactive) Chernobyl soil. Rice Genet Newsletter (RGN). 24:52–54.
Kimura S, Suzuki T, Yanagawa Y, Yamamoto T, Nakagawa H, Tanaka I,
Hashimoto J, Sakaguchi K. 2001. Characterization of plant proliferating cell
nuclear antigen (PCNA) and fap endonuclease-1 (FEN-1), and their distri-
bution in mitotic and meiotic cell cycles. Plant J. 28:643–653.
Kimura S, Tahira Y, Ishibashi T, Mori Y, Mori T, Hashimoto J, Sakaguchi
K. 2004. DNA repair in higher plants: photoreactivation is the major DNA
repair pathway in non-proliferating cells while excision repair (nucleotide
excision repair and base excision repair) is active in proliferating cells.
Nucleic Acid Res. 28:643–653.
Liu H, Ma Y, Chen N, Guo S, Liu H, Guo X, Chong K, Xu Y. 2014.
Overexpression of stress-inducible OsBURP16, the beta-subunit of polyga-
lacturonase 1, decreases pectin contents and cell adhesion, and increases abi-
otic stress sensitivity in rice. Plant Cell Environ. 37:1144–1158.
Lu Z, Takano T, Liu S. 2005. Purifcation and characterization of two ascor-
bate peroxidases of rice (Oryza sativa L.) expressed in Escherichia coli.
Biotechnol Lett. 27:63–67.
Morita S, Kaminaka H, Yokoi H, Masumura T, Tanaka K. 1997. Cloning
and characterization of cytosolic ascorbate peroxidase cDNA from rice
(PGR97-012). Plant Physiol. 113:306–306.
Morita S, Nakatani S, Koshiba T, Masumura T, Ogihara Y, Tanaka K. 2011.
Differential expression of two cytosolic ascorbate peroxidase and two
superoxide dismutase genes in response to abiotic stress in rice. Rice Sci.
18:157–166.
Nishizawa Y, Saruta M, Nakazono K, Nishio Z, Soma M, Yoshida T,
Nakajima E, Hibi T. 2003. Characterization of transgenic rice plants over-
expressing the stress-inducible beta-glucanase gene Gns1. Plant Mol Biol.
51:143–152.
Passaia G, Fonini LS, Caverzan A, Jardim-Messeder D, Christoff AP, Gaeta
ML, de Araujo Mariath JE, Margis R, Margis-Pinheiro M. 2013. The mito-
chondrial glutathione peroxidase GPX3 is essential for H2O2 homeostasis
and root and shoot development in rice. Plant Sci. 208:93–101.
Rakwal R, Agrawal GK, Shibato J, Imanaka T, Fukutani S, Tamogami S,
Endo S, Sahoo SK, Masuo Y, Kimura S. 2009. Ultra low-dose radiation:
stress responses and impacts using rice as a grass model. Int J Mol Sci.
10:1215–1225.
Rakwal R, Kimura S, Shibato J, Nojima K, Kim YK, Nahm BH, Jwa NS,
Endo S, Tanaka K, Iwahashi H. 2008. Growth retardation and death of rice
plants irradiated with carbon ion beams is preceded by very early dose- and
time-dependent gene expression changes. Mol Cells. 25:272–278.
Riechmann JL, Meyerowitz EM. 1998. The AP2/EREBP family of plant
transcription factors. Biol Chem. 379:633–646.
Rosenzweig BA, Pine PS, Domon OE, Morris SM, Chen JJ, Sistare FD.
2004. Dye bias correction in dual-labeled cDNA microarray gene expression
measurements. Environ Health Perspect. 112:480–487.
Satoh K, Kondoh H, Sasaya T, Shimizu T, Choi IR, Omura T, Kikuchi S.
2010. Selective modifcation of rice (Oryza sativa) gene expression by rice
stripe virus infection. J Gen Virol. 91(Pt 1):294–305.
Scheffer BE, Reddy A, Hoffmann I, Wienand U. 1995. Chalcone synthase
cDNA from rice (Oryza sativa). Plant Physiol. 109:722.
Silverstein KA, Moskal WA Jr, Wu HC, Underwood BA, Graham MA,
Town CD, VandenBosch KA. 2007. Small cysteine-rich peptides resem-
bling antimicrobial peptides have been under-predicted in plants. Plant J.
51:262–280.

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m

Journal of Heredity
738
Simmons CR, Litts JC, Huang N, Rodriguez RL. 1992. Structure of a rice
beta-glucanase gene regulated by ethylene, cytokinin, wounding, salicylic
acid and fungal elicitors. Plant Mol Biol. 18:33–45.
Smirnova OA. 2010. Environmental radiation effects on mammals.
A dynamic modeling approach. New York: Springer. p. 286.
Strzalka W, Ziemienowicz A. 2011. Proliferating cell nuclear antigen
(PCNA): a key factor in DNA replication and cell cycle regulation. Ann Bot.
107:1127–1140.
Thimm O, Bläsing O, Gibon Y, Nagel A, Meyer S, Krüger P, Selbig J, Müller
LA, Rhee SY, Stitt M. 2004. MAPMAN: a user-driven tool to display genom-
ics data sets onto diagrams of metabolic pathways and other biological pro-
cesses. Plant J. 37:914–939.
Uchiyama Y, Suzuki Y, Sakaguchi K. 2008. Characterization of plant
XRCC1 and its interaction with proliferating cell nuclear antigen. Planta.
227:1233–1241.
Usadel B, Poree F, Nagel A, Lohse M, Czedik-Eysenberg A, Stitt M. 2009.
A guide to using MapMan to visualize and compare Omics data in plants:
a case study in the crop species, Maize. Plant Cell Environ. 32:1211–1229.
Wei Z, Hu W, Lin Q, Cheng X, Tong M, Zhu L, Chen R, He G. 2009.
Understanding rice plant resistance to the Brown Planthopper (Nilaparvata
lugens): a proteomic approach. Proteomics. 9:2798–2808.
Yamamoto T, Mori Y, Ishibashi T, Uchiyama Y, Ueda T, Ando T, Hashimoto
J, Kimura S, Sakaguchi K. 2005. Interaction between proliferating cell
nuclear antigen (PCNA) and a DnaJ induced by DNA damage. J Plant Res.
118:91–97.
Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang
X, et al. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp.
indica). Science. 296:79–92.
Zhu Q, Dabi T, Beeche A, Yamamoto R, Lawton MA, Lamb C. 1995.
Cloning and properties of a rice gene encoding phenylalanine ammonia-
lyase. Plant Mol Biol. 29:535–550.
Received December 11, 2013; First decision January 21, 2014;
Accepted March 24, 2014
Corresponding editor: Tomoko Steen

b
y

g
u
e
s
t

o
n

A
u
g
u
s
t

1
6
,

2
0
1
4
h
t
t
p
:
/
/
j
h
e
r
e
d
.
o
x
f
o
r
d
j
o
u
r
n
a
l
s
.
o
r
g
/
D
o
w
n
l
o
a
d
e
d

f
r
o
m