Spatio-temporal analysis of cellulose synthesis during cell

plate formation in Arabidopsis
Fabien Miart

, Thierry Desprez, Eric Biot, Halima Morin, Katia Belcram, Herman H€ ofte, Martine Gonneau and Samantha
Vernhettes*
1
INRA, UMR1318, Institut Jean-Pierre Bourgin, Saclay Plant Sciences, AgroParisTech, RD10, F-78000 Versailles, France
Received 19 December 2012; revised 7 October 2013; accepted 18 October 2013; published online 22 October 2013.
*For correspondence (e-mail samantha.vernhettes@versailles.inra.fr).

Present address: EA 3900-BIOPI, Universit e de Picardie Jules Verne, Biologie des plantes et Innovation 33 rue Leu 80039, Amiens Cedex, France.
SUMMARY
During cytokinesis a new crosswall is rapidly laid down. This process involves the formation at the cell
equator of a tubulo-vesicular membrane network (TVN). This TVN evolves into a tubular network (TN) and a
planar fenestrated sheet, which extends at its periphery before fusing to the mother cell wall. The role of
cell wall polymers in cell plate assembly is poorly understood. We used specific stains and GFP-labelled cel-
lulose synthases (CESAs) to show that cellulose, as well as three distinct CESAs, accumulated in the cell
plate already at the TVN stage. This early presence suggests that cellulose is extruded into the tubular
membrane structures of the TVN. Co-localisation studies using GFP–CESAs suggest the delivery of cellulose
synthase complexes (CSCs) to the cell plate via phragmoplast-associated vesicles. In the more mature TN
part of the cell plate, we observed delivery of GFP–CESA from doughnut-shaped organelles, presumably
Golgi bodies. During the conversion of the TN into a planar fenestrated sheet, the GFP–CESA density dimin-
ished, whereas GFP–CESA levels remained high in the TVN zone at the periphery of the expanding cell
plate. We observed retrieval of GFP–CESA in clathrin-containing structures from the central zone of the cell
plate and from the plasma membrane of the mother cell, which may contribute to the recycling of CESAs to
the peripheral growth zone of the cell plate. These observations, together with mutant phenotypes of cellu-
lose-deficient mutants and pharmacological experiments, suggest a key role for cellulose synthesis already
at early stages of cell plate assembly.
Keywords: cellulose synthase, cell wall, cytokinesis, cell plate, phragmoplast microtubule, membrane
trafficking, Arabidopsis thaliana.
INTRODUCTION
Cytokinesis, the partitioning of the daughter cytoplasm
after mitosis, involves in higher plants the de novo con-
struction of a cell wall (Moore and Staehelin, 1988; Samu-
els et al., 1995). This remarkable process is initiated during
late anaphase with the assembly of the phragmoplast, a
plant-specific cytoskeletal configuration, which consists of
a double array of dense, parallel-oriented microtubules,
actin filaments and a ribosome-excluding cell plate assem-
bly matrix. The phragmoplast provides a scaffold for the
transport of Golgi-derived cell plate-building vesicles to
the cell equator (Samuels et al., 1995; Segui-Simarro et al.,
2004). These vesicles undergo homotypic fusion within
the cell plate assembly matrix. The resulting membra-
nous compartments are constricted by dynamin-like
springs into dumbbell-shaped tubular structures, which
fuse with incoming vesicles thus forming a ~200-nm-thick
tubulo-vesicular network (TVN). This TVN subsequently
evolves into a tubular network (TN), and a fenestrated
sheet (FS), before turning into the new cell wall (Samuels
et al., 1995; Segui-Simarro et al., 2004). This succession of
events starts in the cell centre and then progresses centrifu-
gally towards the cell cortex. The TVN to TN transition
coincides with the concentric displacement of the phragmo-
plast, whereas the FS is initiated at the centre of the cell plate
after its fusion with the mother cell wall (Strompen et al.,
2002; Sasabe and Machida, 2006; Sasabe et al., 2006).
A large body of literature deals with membrane traffic
involved in cell plate formation. The number of Golgi stacks,
which deliver cell plate-building vesicles, doubles prior to
the formation of the phragmoplast (Segui-Simarro and
Staehelin, 2006). During cell plate maturation, about 70% of
the membrane surface is removed by clathrin-mediated
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd
71
The Plant Journal (2014) 77, 71–84 doi: 10.1111/tpj.12362
vesicle retrieval (Otegui and Staehelin, 2004; Segui-Simar-
ro et al., 2004; Segui-Simarro and Staehelin, 2006). Such
vesicle retrieval as well as endocytosis from the plasma
membrane may contribute to the recycling of cell plate
components as suggested by the presence of endosomes
in a belt at the periphery of the growing cell plate (Vermeer
et al., 2006). The importance of endocytosis for cell plate
formation was questioned by the observation that pharma-
cological inhibition of endocytosis did not impair cytokine-
sis (Reichardt et al., 2007). The latter study suggested that
endocytosis is not essential for cell plate formation but
may contribute to speeding up the process.
The content of the membranous compartments also
plays a critical role in cell plate formation. Extensins and
matrix polysaccharides (pectin and hemicellulose) are
respectively synthesized in the endoplasmic reticulum (ER)
and Golgi apparatus and targeted to the cell plate (Moore
and Staehelin, 1988; Samuels et al., 1995; Cannon et al.,
2008). In addition, callose is produced from membrane-
bound callose synthases and transiently fills the lumen of
the tubules, thus presumably contributing to the formation
of the FS (Samuels et al., 1995). The essential role for cal-
lose in cell plate formation is shown by the incomplete cell
plates in a seedling-lethal, callose synthase mutant (Thiele
et al., 2009). In this study we focused on the role of cellu-
lose synthesis in cell plate formation. Cellulose synthesis
has been intensively studied in rapidly growing cells of
dark-grown Arabidopsis hypocotyls. In these cells, cellu-
lose is synthesized in the plasma membrane by large hexa-
meric CSC (for review see (Guerriero et al., 2010), which
contains three non-redundant classes of catalytic subunits
(CESA1, CESA3 and CESA6-like; Desprez et al., 2007; Pers-
son et al., 2007). Functional fluorescent protein-tagged
CSCs were shown to be secreted to the plasma membrane
via Golgi stacks and/or microtubule-associated compart-
ments (MASC or SmaCCs; Crowell et al., 2009; Gutierrez
et al., 2009) and to migrate along linear trajectories in the
plasma membrane propelled by the polymerisation of the
glucan chains (Paredez et al., 2006; Desprez et al., 2007).
Cellulose synthesis is essential for cell plate formation as
shown by the aborted cell plates in certain cellulose-defi-
cient mutants (Zuo et al., 2000; Beeckman et al., 2002).
Exactly at what stage of cell plate formation cellulose syn-
thesis plays a role remains to be determined. So far, cellu-
lose has been observed at later stages of cell plate
formation (from the TN stage on) and suggests a role in its
consolidation (Samuels et al., 1995). How cellulose is syn-
thesized in dividing cells is also not known. Indeed CSC
composition can vary in different cell types or in changing
environments (Bischoff et al., 2011; Mendu et al., 2011). In
addition, in certain cell types, members of the cellulose
synthase-like family D (ex. CSLD3) can substitute for
CESAs in the synthesis of cellulose (Park et al., 2011).
CESA1 plays a role in cell plate formation, given the
aborted cell plates in the strong allele cesa1
rsw1–20
. Instead,
mutant alleles for CESA3 and CESA6 did not show a cell
plate phenotype, shedding doubt on the implication of
these isoforms in cell plate assembly.
Here we used GFP-tagged proteins expressed from their
endogenous promoters to observe the presence of all three
CESA isoforms in the developing cell plate. The CSCs
appear to be active in the developing cell plate as shown
by the presence of cellulose as early as the TVN stage. We
also observed GFP–CESAs associated with the phragmo-
plast, a finding that suggested that phragmoplast-associ-
ated vesicles are involved in the delivery of the CSCs to
the cell plate. Instead, in the more mature zone of the cell
plate we observed delivery of GFP–CESAs from doughnut-
shaped organelles, presumably Golgi bodies. During matu-
ration of the cell plate, GFP–CESA density decreased in the
central zone and remained high in the TVN at the periph-
eral growth zone. Clathrin-mediated CESA retrieval from
the central zone of the cell plate and from the plasma
membrane of the mother cell was observed and might
contribute to the recycling of the CSCs to the peripheral
growth zone. The spatio-temporal pattern of CESA accu-
mulation suggests a role for cellulose synthesis already
during the formation of the TVN.
RESULTS
Three distinct GFP-labelled cellulose synthases
accumulate in the developing cell plate
The cellulose synthase catalytic subunit CESA1 is required
for cytokinesis as shown by the presence of incomplete
cell plates in loss-of-function mutants (Beeckman et al.,
2002). To study the subcellular localisation of this protein
in dividing cells, we expressed a green fluorescent protein
(GFP)–CESA1 fusion protein from its own promoter in a
cesa1 mutant background. This construct complemented
the mutant phenotype and hence is functional (Figure S1).
We studied the localisation of GFP–CESA1 in cortical and
epidermal cells of 4-day-old roots using laser scanning
confocal microscopy (LSCM) after staining of the plasma
membrane and developing cell plate with the styryl dye
FM4–64. In interphase cells, GFP–CESA1 was present in the
plasma membrane and in different subcellular compart-
ments. The doughnut-shaped GFP–CESA1 organelles were
previously identified as Golgi stacks (Figure 1a; Crowell
et al., 2009; Gutierrez et al., 2009). In dividing cells, GFP–-
CESA1 was strongly enriched in mature cell plates as com-
pared with the plasma membrane of the mother cells
(Figure 1a,b), indicating the existence of a mechanism that
selectively concentrates CSCs to the cell plate in dividing
cells. To further investigate this finding, we followed the
presence of GFP–CESA1 during cell plate formation. Inter-
estingly, GFP–CESA1 was already present at early stages
of cell plate formation and further accumulated at the
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
72 Fabien Miart et al.
periphery of the growing cell plate (Figure 1c–e). The com-
position of CSCs can change during development (Persson
et al., 2007; Bischoff et al., 2011) and it is not known
whether the two other primary cell wall cellulose synthases
CESA3 and CESA6 are also required in cell plate formation
since no cytokinesis defects were observed in the respec-
tive partial loss-of-function mutants. We therefore studied
the localisation of the respective GFP-fusion proteins
(Desprez et al., 2007). Interestingly both GFP–CESA3 (Fig-
ure 1f–h) and GFP–CESA6 (Figure 1i–k), expressed from
their own 5′ upstream regions, showed accumulation pat-
terns similar to those of GFP–CESA1, suggesting that the
cell plate-associated CSCs, like those present in interphase
cells, comprise all three subunits. To monitor cellulose
synthesis during cell plate formation, it is essential to pre-
cisely determine the stage of cell plate formation. The TVN
corresponds to the zone of the developing cell plate at the
equator of the phragmoplast. As soon as the phragmoplast
moves away centrifugally, the central phragmoplast-free
zone turns into the TN, which upon fusion of the cell plate
with the mother cell plasma membrane, turns into a FS
before turning into the mature cell plate. In Figure 2, we
labelled microtubules with anti-a-tubulin antibodies, the
DNA with DAPI and the membrane networks that support
cell plate formation with anti-syntaxin KNOLLE antibodies
(Lauber et al., 1997). During the prophase and metaphase,
KNOLLE, GFP–CESA3 and GFP–CESA1 were present in
intracellular compartments surrounding the nucleus
(arrowheads in Figure 2a,b,f,g,k) and there was no label-
ling at the equatorial plane (Figure 2b,g,k). At the transition
anaphase/telophase, when the chromosomes were sepa-
rated and still condensed, KNOLLE labelled the cell
(a)
(c)
(d)
(e)
(f)
(g)
(h)
(i)
(j)
(k)
(b)
Figure 1. Three distinct cellulose synthases accumulate in the developing cell plate.
(a) Merge of confocal images from root cells expressing GFP–CESA1 (green), labelled with FM4–64 (red). GFP–CESA1 label is enriched in the cell plate. Also note
the presence of GFP–CESA1-labelled Golgi stacks (arrow). (b) Fluorescence intensity profiles along the white line on image A. The fluorescence intensity of
GFP–CESA1 is higher at the plasma membrane just after the formation of the cell plate (peak 3) than at parental plasma membranes (peaks 1, 2 and 4). (c–e)
GFP–CESA1 (left panel), FM4–64 (middle panel) and merge (right panel) at successive stages of cell plate formation. (f–h) Merge of GFP–CESA3 (green) and
FM4–64 (red). (i–k) Merge of GFP–CESA6 (green) and FM4–64 (red). Scale bar = 10 lm.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 73
equator, corresponding to the phragmoplast-surrounded
TVN (Figure 2c). At this stage, GFP–CESA3 was already
present in the developing cell plate (Figure 2h). As judged
from the still condensed chromosomes, GFP–CESA1 also
colocalised with the FM4–64-labelled TVN (Figure 2l). Dur-
ing telophase, the nucleus had evolved into an ovoid shape
with partially decondensed DNA, the phragmoplast microtu-
bules had moved away centrifugally and KNOLLE was still
present throughout the cell plate (Figure 2d). At this stage
both GFP–CESA3 (Figure 2i) and GFP–CESA1 (Figure 2m)
were present in the phragmoplast-depleted TN but the label
was stronger at the peripheral, phragmoplast-surrounded,
TVN zone of the cell plate. At the late telophase, large nucle-
oli were visible in the nucleus (Figure 2e,n) and phragmo-
plast microtubules disappeared where the cell plate reached
the parental plasma membrane (arrowheads in Figure 2e,j).
At this stage GFP–CESA3 and GFP–CESA6 remained more
abundant at the cell plate periphery. In conclusion, both
GFP–CESA1 and GFP–CESA3 were present in the cell plate
at as early as at the TVN phase.
Cellulose deposition starts at the TVN stage
The presence of CSCs at the TVN stage precedes the previ-
ously reported observation of cellulose from the TN stage
on (Samuels et al., 1995). We therefore investigated
whether these CSCs also synthesize cellulose. To this end,
we used the cellulose-specific fluorescent dye Pontamine
Fast Scarlet 4B (S4B; Anderson et al., 2010) and the crystal-
line cellulose-binding module CBM3a (Blake et al., 2006) to
label whole-mount preparations of roots. S4B showed a
strong transverse fibrillar staining pattern, corresponding
to cellulose microfibrils, in all root cell walls (Figure 3a and
Movie S1). As expected, this staining was significantly
reduced in roots treated with the cellulose synthesis inhibi-
tor isoxaben or in roots of the cellulose-deficient mutant
kor1–2 (Zuo et al., 2000) (Figures 3g–i and S2a,b), both of
which displayed radially expanded cells. Interestingly, in
dividing cells, S4B also stained the developing cell plate
even at stages as early as at the TVN stage as shown by
the flattened nucleus with still condensed chromosomes
(a) (b) (c) (d) (e)
(f) (g) (h) (i) (j)
(k) (l) (m) (n)
Figure 2. GFP–CESA are present in the cell plate as early as at the TVN phase.
Confocal (a–e, k–n) and spinning disk (f–j) images of root cells. (a–e) To observe specific mitotic stages, the nucleus cycle stained by DAPI (blue), the membrane net-
works formation immunolabelled by an anti-KNOLLE antibody (green), microtubules immunolabelled by an anti-tubulin antibody (red in (a–j)) were followed during
root cell division. To more precisely stage the formation of the cell plate, stably transformed lines expressing both GFP–CESA3 (green) and the microtubule marker
mCherry-MBD (red) were used (f–j) as well as a line expressing GFP–CESA1 (green) labelled with FM4–64 (red) and DAPI (blue) (k–n). See text for a more detailed
description. Scale bars = 5 lm. During the prophase and metaphase, GFP-CESA were present in intracellular compartments surrounding the nucleus (arrowheads in
a, b, f, g, k). At late telophase, phragmoplast microtubules disappeared where the cell plate reached the parental plasma membrane (arrowheads in e, j).
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
74 Fabien Miart et al.
(Figure 3a,b,d and Movie S1). This staining was not due to
autofluorescence as shown by the unlabelled control (Fig-
ure S2(c)). At the same stage, the staining was weaker in
the isoxaben-treated plants and at background levels in
kor1–2 roots (Figure 3g–i) confirming the specificity of the
stain for cellulose. The presence of cellulose in developing
cell plates was confirmed by whole-mount immunolabel-
ling with CBM3a. Again, cellulose was detected at the tran-
sition anaphase/telophase (Figure S3c) and mature cell
plates (Figure S3d) with no labelling at the metaphase (Fig-
ure S3b). The labelling was weaker in the isoxaben-treated
plants compared with untreated seedlings (Figure S3e–g).
Our data show that cellulose is present from the TVN stage
on, which is consistent with the early appearance of the
GFP–CESAs in the developing cell plate.
GFP–CESA is delivered to the cell plate via different routes
Cell plate formation is initiated by the formation of dense
phragmoplast microtubule arrays. Along these arrays
Golgi-derived membrane vesicles migrate to the equatorial
plane, where they form membranous compartments
through homotypic fusion inside the cell plate assembly
matrix (Segui-Simarro et al., 2004). These compartments
form tubular structures, which grow and coalesce, thus
forming the TVN (Samuels et al., 1995). Here we observed
that at the anaphase/telophase transition, GFP–CESA-con-
taining compartments moved throughout the cell but were
excluded from the growing cell plate by the dense phrag-
moplast microtubule arrays (Figures 2h, 4a and Movie S2).
The exclusion from the cell plate of Golgi stacks and other
(a)
(c)
(d)
(e)
(f)
(b)
(g)
(h)
(i)
Figure 3. Cellulose is deposited already at the TVN stage.
Confocal images of root cells expressing GFP–CESA1. (a) View of root cell stained by Pontamine Fast Scarlet 4B (S4B) (red) and DAPI (blue). Note that S4B labels
the cell plate at the TVN stage (arrowhead). (b) Views from two angles of 3D reconstructions from a Z-stack of confocal images from a dividing cell stained with
S4B and DAPI. (c–f) Detailed view of S4B staining of cellulose: DAPI (left panel) S4B (middle panel) and merge (right panel) at metaphase (c), at the transition
anaphase/telophase (d), telophase (e) and mature cell plate (f). (g,h) Confocal images of isoxaben-treated (g) and kor1–2 (h) root cells at the transition anaphase/
telophase labelled by DAPI (left panel) and S4B (middle panel), merge (right panel). Note that there is a weak cell plate staining in isoxaben-treated cells (g)
(arrowhead) and nearly no staining in kor1–2 mutant (h). (i) Relative S4B signal intensity at the cell plate in unlabelled, untreated, isoxaben-treated and kor1-2
root cells. The signal was significantly higher in Col0 than in Col0 + isoxaben (t-test, P-value = 10
À5
) and kor1-2 (P-value = 10
À7
). The unlabelled control signal
was lower than Col0 (P-value = 10
À7
) and Col0 + isoxaben (P-value = 10
À5
), but not significantly different from kor1-2. Scale bars = 10 lm.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 75
organelles by phragmoplast microtubules has been
observed previously (Samuels et al., 1995; Nebenfuhr et al.,
2000). We investigated whether CSCs were associated with
the phragmoplast using transgenic lines expressing both
GFP–CESA3 and mCherry-MBD. Using spinning disk micros-
copy and image processing, we detected a faint but repro-
ducible GFP–CESA3 signal overlapping with the microtubule
signal at early and late telophase (Figure 4c,e, n > 50). Treat-
ment with the microtubule-stabilising drug taxol further
enhanced the phragmoplast-associated GFP–CESA3 signal
(Figure 4d,f, n > 50). Together, these results suggest that
CSCs are present in phragmoplast-associated vesicles,
which presumably are on their way to the cell plate.
During telophase, the phragmoplast-depleted central
zone becomes accessible to organelles (Segui-Simarro
et al., 2004). A 3D reconstruction of a late telophase
phragmoplast clearly shows the close proximity of GFP–
CESA3-containing compartments to the central microtu-
bule-free zone (Figure 4b and Movie S3). Time-lapse
movies showed that in this zone, doughnut-shaped com-
partments (presumably Golgi stacks) frequently paused
(up to 30s, n > 30) and made contact with the cell plate. In
some cases we also observed the delivery of fluorescent
material from the compartment to the cell plate (Figure 4g
n = 10 and Movie S4). Finally, after fusion of the cell plate
with the mother cell plasma membrane, GFP–CESA1
punctae were shown to migrate directly from the plasma
membrane to the cell plate via the plasma membrane-cell
plate junction (Figure 4h,i and Movie S5). In conclusion,
GFP-labelled CSCs appeared to reach the cell plate at least
through three distinct pathways (Figure 7): via (1) phrag-
moplast-associated compartments; (2) direct or indirect
(via vesicles) delivery from mobile compartments (pre-
sumably Golgi stacks) to microtubule-free zones of the
growing cell plate; or (3) through plasma membrane-cell
plate junctions.
GFP–CESA levels diminish during cell plate maturation
Time-lapse imaging of maturing cell plates showed that the
GFP–CESA1 signal, which initially had a more or less uni-
form distribution throughout the cell plate, rapidly dimin-
ished in the central zone and increased in the peripheral
phragmoplast-covered zone (Figure 5a,b, n = 20 out of 60
observed cell plates). We next investigated whether the
depletion of GFP–CESA1 from the central zone was the
result of active vesicle retrieval, which is a process topo-
logically equivalent to endocytosis from the plasma mem-
brane. To this end, we studied the effect of the ARF-GEF
inhibitor brefeldin A (BFA) on cells coexpressing GFP–
CESA1 and the early endosome marker mCherry-RabA1 g
(Geldner et al., 2009). BFA triggers in Arabidopsis the
aggregation of endosomal compartments and inhibits
recycling from endosome to plasma membrane (Geldner
et al., 2001, 2003; Baluska et al., 2002; Grebe et al., 2002,
2003; Samaj et al., 2004; Murphy et al., 2005; Paciorek
et al., 2005). In untreated seedlings, mCherry-RabA1 g
labelled intracellular punctae (early endosomes) as well as
the cell plate, as described before (Geldner et al., 2009).
GFP–CESA1 partially overlapped with mCherry-RabA1 g in
the cell plate and endosomes (Figure 5c). Upon BFA treat-
ment for 30 min, GFP–CESA1 was found in mCherry-
RabA1 g-containing endosomal aggregates, and in the
doughnut-shaped compartments that surrounded these
aggregates. These aggregates were present at both ends
of the early stage cell plate, presumably excluded from the
central zone by the phragmoplast microtubules (Figure 5d,
n = 22 out of 54 early cell plates). At later stages however,
they were located primarily around the microtubule-free
central zone (Figure 5e, n = 54 out of 120 cell plates). This
finding suggests that the retrieval of CSCs occured
primarily in zones of the cell plate not covered by the
phragmoplast. To investigate whether CSC retrieval was
clathrin-mediated, we used a line that co-expressed GFP–
CESA1 and the clathrin large subunit (CLC) fused to mOr-
ange. Both markers were present at the cell plate from late
anaphase to telophase. CLC-mOrange was present in the
central zone and less abundant in the peripheral zone (Fig-
ure 5f, n = 15 out of 35 cells plates) in line with a previous
study, which showed increased numbers of clathrin-coated
vesicles (CCVs) in the microtubule-free area (Segui-Simar-
ro et al., 2004). GFP–CESA1, in contrast, showed a stronger
signal at the periphery of the cell plate. Next, we used
time-lapse imaging to track the retrieval of clathrin-coated
GFP–CSC-containing punctae. We indeed observed the
Figure 4. CSCs are delivered to the cell plate via distinct routes.
(a,b) 3D reconstructions from Z-stacks of confocal images from cells expressing GFP–CESA1 labelled with FM4–64 (red) at the transition anaphase/telophase (a),
and late telophase (b). Views from two angles (left and middle panels) and an overview of the areas delimited by white squares (right panel) are shown. The
putative positions of phragmoplasts at the division plane are drawn in blue, GFP–CESA1 signal in organelles (yellow) and at the cell plate (green). GFP–CESA1-
labelled compartments cluster around the phragmoplasts, which exclude them from the cell plate at the transition anaphase/telophase (a). At late telophase,
GFP–labelled organelles reach the microtubule-free central zone of the cell plate (b). (c–f) Spinning disk images from root cells expressing GFP–CESA3 (left
panel), mCherry-MBD (middle panel) and merge (right panel) treated with DMSO (c,e) or 8 lM taxol during 2 h (d,f). Detailed view at anaphase from DMSO (e)
and taxol treated seedlings (f). Note the stronger phragmoplast-associated GFP–CESA3-label in taxol treated cells (arrowhead), arrows in figure 4d compared to
the ones observed for the control [arrows in figure 4 C]. (g) Spinning disk images from a time series showing a GFP–CESA1-labelled doughnut-shaped organ-
elles (presumably Golgi stacks) approaching the cell plate and transferring fluorescent material (arrows) to the cell plate. (h) Spinning disk image of a cell plate
labelled by GFP–CESA1, which has reached the mother cell plasma membrane. GFP–CESA1 also labels the area of the mother cell plasma membrane surround-
ing the attachment site. Overview of the area delimited by the white square in figure 4 h. (i) Images from a spinning disk time series showing a GFP–CESA1
puncta moving from the parental membrane to the cell plate (arrows). Scale bars = 10 lm (c,d) and 5 lm (e–j).
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
76 Fabien Miart et al.
(a)
(b)
(c)
(d)
(e) (f)
(g)
(h) (i)
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 77
(a)
(b)
(c)
(d)
(e)
(f)
(g)
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
78 Fabien Miart et al.
retrieval of CLC-mOrange/GFP–CESA1 punctae from the
cell plate with a corresponding decrease of fluorescence at
the cell plate (Figure 6a, Movie S6, n = 12). We also
observed retrieval of doubly labelled punctae from the
parental plasma membrane (Figure 6b, n = 10, Movie S7).
At late telophase, many of the phragmoplast arrays were
surrounded by multiple doubly labelled punctae (Fig-
ure 6c,d), the presence of CLC-mOrange suggested that
these GFP–CESA-containing compartments were generated
by clathrin-mediated retrieval from the cell plate center or
the parental plasma membrane (Figure 6c,d). It is possible
but not proven that these phragmoplast-associated com-
partments mediate the recycling of CSCs to the peripheral
growth zone of the cell plate (Figure 7).
The accumulation patterns of CESAs and the DRP1a in the
developing cell plate suggest a role for both cellulose
synthesis and dynamin in tubulo-vesicular network
formation
Dynamins form springs around membrane compartments
causing them to constrict (Otegui et al., 2001; Segui-Simar-
ro et al., 2004; Verma and Hong, 2005). They play a role in
clathrin-mediated endocytosis (Fujimoto et al., 2010) but
also in the formation of tubular structures of the TVN
(Segui-Simarro et al., 2004). One family member, DRP1a, is
essential for cell plate formation as shown by the ran-
domly oriented incomplete cell plates in a loss-of-function
mutant (Collings et al., 2008). To investigate the role of
DRP1a in cell plate formation, we generated an Arabidop-
sis line expressing both DRP1a-mOrange and GFP–CESA1.
Both proteins accumulated in the cell plate and were relo-
calised from the center to the peripheral zone during cell
plate maturation (Figure 5g). As tubule formation takes
place in this peripheral zone and clathrin-mediated endocy-
tosis preferentially in the central zone, the DRP1a accumu-
lation pattern suggests a role primarily in TVN formation.
Similarly, the GFP–CESA1 accumulation pattern also
suggests a role for cellulose synthesis during TVN forma-
tion and/or its transition into the TN, rather than in the
subsequent maturation into the FS.
DISCUSSION
We show here that three GFP–labelled CESAs accumulate
in the developing cell plate, suggesting that here, the
composition of the CSCs does not differ from those in
interphase cells (Desprez et al., 2007; Persson et al., 2007).
The cesa1
rsw1–20
mutant phenotype with incomplete cell
plates indeed indicates an essential role for this isoform
(Beeckman et al., 2002), however, no aborted cell plates
have been observed in cesa3 and cesa6 mutants despite
the fact that they are severely dwarfed. This observation
presumably is due to the leakiness of the cesa3 alleles
studied and the partial redundancy of CESA6 with CESA2,
5 and 9 (Desprez et al., 2007; Persson et al., 2007). These
results suggest that smaller amounts of cellulose are
required for forming a cell plate as compared to the
amounts needed to sustain growth of interphase cells.
We also showed that CSC accumulation in developing
cell plates follows a precise spatio-temporal pattern, which
may involve several processes (Figure 7): (1) delivery to
the cell equator by phragmoplast-associated vesicles; (2)
direct or indirect (via vesicles) delivery from doughnut-
shaped organelles (presumably Golgi bodies) to phragmo-
plast-free areas of the cell plate; (3) direct transfer from the
plasma membrane after fusion to the cell plate; and (4)
clathrin-mediated retrieval primarily at the central zone of
the cell plate and the mother cell plasma membrane. The
life-time of the clathrin coat on GFP–CESA-containing
structures varied from 20s to 90s, which is longer than that
expected for CCV-mediated endocytosis from the plasma
membrane, keeping in mind that the kinetics of CCV-medi-
ated endocytosis in plants still remains to be rigorously
calculated. The CLC1-mOrange/GFP–CESA compartments
appeared much larger than CCVs and might correspond to
structures similar to the larger clathrin-coated buds and
tubules that are involved in synaptic membrane retrieval
(Takei et al., 1996). It remains to be shown whether endo-
cytosed CSCs are recycled back to the periphery of the cell
plate. The observation of compartments doubly labelled
with CLC-mCherry and GFP–CESA1 in close proximity to
the phragmoplast microtubules suggests but does not
prove that this may be the case.
This report also suggests a role of cellulose synthesis in
the formation of the TVN. GFP-labelled CSCs were present
and active (as shown by the S4B and CBM3a staining) dur-
ing the formation of the TVN and gradually disappeared
during its maturation into a planar FS. These findings
extend observations by Samuels et al., 1995; who showed
Figure 5. Accumulation of GFP–CESA1 to the peripheral growth zone during cell plate maturation.
(a,b) Root cells expressing GFP–CESA1 (green), labelled with FM4–64 (red). (a) Merge of a time series of confocal images showing the gradual accumulation of
GFP–CESA1 at the periphery of the cell plate during telophase. The outer borders of the cell plate are delimited by the two set of arrows. (b) Views from two
angles of orthogonally projected Z-stacks showing the enrichment of GFP–CESA1 signal at the periphery of the cell plate. (c,e) Confocal images of a root cell co-
expressing GFP–CESA1 (green, left panel) and mCherry-RabA1 g (red, middle panel), merge (right panel). (c) In untreated conditions. GFP–CESA1 colocalised at
the cell plate and in intracellular compartments with RABA1 g-mCherry. (d,e) After BFA treatments, GFP–CESA1 and RABA1 g-mCherry co-localize in BFA aggre-
gates at both ends of the growing cell plate at early stages (d) and in the central zone of the division plane at telophase (e).
(f) Confocal images of a root cell coexpressing GFP–CESA1 (green, left panel) and CLC-mOrange (red, middle panel), merge (the right panel).
(g) Confocal images of a root cell: GFP–CESA1 (green, left panel), DRP1A-mOrange (red, middle panel) and merge (right panel). Both labels preferentially accu-
mulate at the periphery of the cell plate at telophase. Scale bars = 10 lm for (a, c–g) and 6 lm for (b). In f and g white squares represent the peripheries of the
cell plate.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 79
(a) (b)
(c) (d)
Figure 6. GFP–CESA endocytosis from cell plate and parental plasma membrane in clathrin-containing compartments.
Time series of spinning disk images of a root cell: GFP–CESA1 (green, left panel), CLC-mOrange (red, middle panel) and merge (right panel) showing the retrie-
val of a doubly labelled puncta from the cell plate (a) (arrow) or from the parental plasma membrane (b) (arrowhead). (c) Doubly labelled compartments accu-
mulate around an area occupied by phragmoplast microtubule arrays as shown in (d). (d) GFP–CESA3 (green, left panel), mCherry-MBD (red, middle panel) and
merge (right panel). GFP–CESA3 compartments accumulate around mCherry-MBD-labelled microtubule arrays. Scale bars = 10 lm.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
80 Fabien Miart et al.
the accumulation of cellulose from the TN stage on. This
discrepancy may reflect differences in the sensitivity of
the detection methods used (S4B staining and confocal
microscopy on living cells vs. TEM on fixed material).
CSCs are large complexes with a diameter of around
25 nm observable in the plasma membrane (Kimura et al.,
1999). These CSCs are delivered by 25 nm or 50 nm secre-
tory vesicles, which fuse into a membranous compart-
ment (Giddings et al., 1980). Dynamin constricts this
compartment into a dumbbell shape, which is expected to
chase the large CSCs into the bulbous zone of the dumb-
bell. These CSCs produce crystalline microfibrils, as
detected by S4B and CBM3a. Microfibrils are rigid rods
and upon extrusion, they are expected to orient preferen-
tially parallel to the long axis of the tubules. It will be
interesting to see whether the presence of cellulose some-
how can contribute to the maintenance of the tubular
shape after removal of the dynamin springs, perhaps
through interaction with callose, which is also present at
this stage (Samuels et al., 1995), and explain the compara-
ble aborted cell plate phenotype both in the dynamin
(drp1a
rsw1–3
) and cellulose-deficient mutants (kor1–2 and
cesa1
rsw1–20
).
EXPERIMENTAL PROCEDURES
Plant material and in vitro growth conditions
Seeds of Arabidopsis thaliana ecotype Columbia (Col0) were pro-
vided by K. Feldman (University of Arizona, Tucson, AZ, USA),
and GFP–CESA6 and GFP–CESA3 line and their complementation
tests were described previously (Desprez et al., 2007). DRP1A-
mOrange and CLC-mOrange were kindly provided by Steven Back-
ues and Sebastian Bednarek (Konopka and Bednarek, 2008),
mCherry-RabA1 g by N. Geldner (Geldner et al., 2009), kor1–2 by
N Chua (Zuo et al., 2000). For imaging, seedlings were cultured on
vertical petri dishes on MS medium (Murashige and Skoog, 1962).
Seeds were cold-treated at 4°C for 48 h and at 23°C with a 8 h dark
per 16 h light cycle for 3 to 4 days. The lengths of hypocotyls fixed
with 0.2% formaldehyde were measured in IMAGEJ.
Generation of transgenic lines
Pollen from GFP–CESA1-expressing plants in cesa1
rsw1–10
back-
ground (Desprez et al., 2007) was used to fertilise plants express-
ing CLC-mOrange or DRP1A-mOrange or mCherry-RABA1 g.
Pollen from GFP–CESA3-expressing plants in cesa3
je5
background
(Desprez et al., 2007) was used to fertilise plants expressing
mCherry-MBD. F1 seeds were collected and amplified. F2 seed-
lings were screened by polymerase chain reaction (PCR) for the
presence of both markers and the respective mutations.
F3-selected seedlings were used for imaging.
(a) (b)
Figure 7. Overview of the possible routes for CSC transport during cell plate formation.
At the TVN stage (a), the presence of the phragmoplast microtubules limits the access of Golgi and endosomal organelles to the cell plate (direct interactions
are only possible at the periphery of the cell plate) and CSCs appear to be delivered from the Golgi stacks to the cell plate primarily via phragmoplast-associated
vesicles. During late telophase (b), microtubules are cleared from the central zone of the cell plate. Here Golgi stacks and/or post-Golgi organelles can reach the
cell plate and deliver CSC-containing vesicles. CSCs are removed from the microtubule-free zone and from the mother cell plasma membrane through clathrin-
containing vesicles. This might contribute to the recycling of CSCs to the cell plate periphery via phragmoplast-associated vesicles. The preferential accumula-
tion of CSCs at the TVN stage suggests a role for cellulose synthesis in TVN assembly.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 81
Plant expression vectors
Standard molecular cloning techniques were performed essen-
tially as described (Sambrook and Russel, 2001). Constructs
were made by using Gateway cloning technology (Invitrogen,
Carlsbad, CA, USA, http://www.lifetechnologies.com). A 1.16-kb
fragment of the CESA1 promoter upstream of the initiation
codon was amplified by PCR with specific primers that con-
tained HindIII and XbaI restriction sites (Table 1) and cloned into
the HindIII-blunted XbaI site of the pGWB6 vector after the
removal of the 35S promoter. The cDNA of CESA1 was ampli-
fied used specific primers (Table 1) and Gateway reactions were
performed to obtain the promoter CESA1–GFP–CESA1 construct
(GFP–CESA1). The cDNA of MBD kindly provided by M. Pastu-
glia was introduced into the Gateway vector p35S-mCherry from
Clontech.
Each final expression vector was electroporated in Agrobacte-
rium tumefaciens. GFP–CESA1 and mCherry-MBD constructs
were introduced, respectively, into cesa1
rsw1–10
mutant (Desprez
et al., 2007) and Col0 using A. tumefaciens-mediated transforma-
tion. Primary transformants were selected on kanamycin, and F2
progenies were used for the visualization of the fluorescent
protein.
Drugs and staining treatments
Incubation of Arabidopsis seedlings with various chemicals was
carried out in 6-well cell culture plates in liquid Arabidopsis
medium (Duchefa Biochimie, Haarlem, the Netherlands, http://
www.duchefa-biochimie.nl). The initial stocks of isoxaben, taxol
and BFA were in dimethyl sulphoxide (DMSO), and to obtain the
appropriate concentration in the culture medium, the stocks were
diluted at least 1000-fold. Treatments were performed with 8 lM
Taxol for 2 h or 50 lM BFA for 30 min. The products are from
Sigma Aldrich Corporation, St Louis MO, USA, http://www.
sigmaalrich.com. For the isoxaben treatment, seedlings were
grown on 10 nM isoxaben during 4 days.
Cells in living roots were stained with 50 lM FM4–64 (Molecular
Probes). For visualizing nuclei in living Arabidopsis cells, the
seedlings were incubated with one drop of anti-fading solution
(Vectashield, Vector Laboratories, Burlingame, CA, USA, http://
www.vectorlabs.com) with 4′,6-diamidino-2-phenylindole (DAPI)
solution (100 lM; Roche Applied Science, Penzberg, Germany,
http://www.roche-applied-science.com). For Pontamine Fast Scar-
let 4B staining, 5 day-old Arabidopsis seedlings were fixed under
vacuum in 4% paraformaldehyde, 0.5 9 MTSB buffer (25 mM
PIPES, 2.5 mM EGTA, 2.5 mM MgSO
4
, adjusted to pH 7 with KOH)
and 0.1% Triton for 1 h. Samples were then washed with 1 9 PBS,
0.1% Triton for 10 min. Samples were incubated for 60 h with S4B
at room temperature (not done for the unlabelled cells). The initial
stock of S4B was 0.1% in 1 9 PBS and it was diluted at 33-fold.
After staining, samples were washed for 10 min with 1 9 PBS.
Samples were mounted in Citifluor/DAPI 20 lg mL
À1
.
Immunolocalization using indirect immunofluorescence
analysis
For the CBM3a immunolabelling, seedlings were incubated with
95% pentane during 10 min to remove the cuticle and washed
with MTSBT buffer (50 mM PIPES, 2 mM EGTA, 2 mM MgSO
4
,
0.05% Triton). Seedlings were fixed in 1.5% formaldehyde (v/v),
0.5% glutaraldehyde (v/v) in MTSBT overnight followed by a 1 h
vacuum treatment. After three washes with MTSBT, the tissues
were digested by pectolyase 0.05% and cellulase 0.05% in
MTSBT that contained 0.4 M of mannitol for 1 h at 30°C. After
three washes in MTSB, they were digested by driselase 2.5%
(resuspended in water) for 45 min at 37°C under agitation. After
three washes in MTSB, seedlings were incubated in methanol
for 10 min at –20°C followed by 1 9 PBS for 10 min and
1 9 PBS with 1% BSA and 50 mM glycine (solution 1) for
30 min. After three washes with 1 9 PBS with 50 mM glycine
(solution 2) they were incubated in 1 9 PBS with 50 mM glycine
and Triton X100 0.5% during 1 h. After a wash in solution 2,
CBM3a antibody diluted at 1:100 was added in 1 9 PBS with
50 mM glycine and 1% BSA overnight at 4°C (Plant Probes) (not
done for the unlabelled cells). After three washes in solution 2,
monoclonal antibody polyhistidine (Sigma) produced in mouse
diluted at 1:100 was added in solution 1 for 3 h at room temper-
ature and after three washes in solution 2, goat anti-mouse IgG
conjugated with Alexa 488 (Fisher, Illkirsch, France, http://
www.fr;fisherscience) was added in solution 1. After three
washes, samples were mounted in Citifluor/DAPI 20 lg mL
À1
.
For the Figure 2, seedlings were fixed under vacuum in 4%
paraformaldehyde, 0.5 9 MTSB buffer (25 mM PIPES, 2.5 mM
EGTA, 2.5 mM MgSO4, adjusted to pH 7 with KOH) and 0.1% Tri-
ton X100 for 1 h. Samples were then washed with 0.5 9 MTSB,
0.1% Triton X100 for 10 min. For cell wall permeabilization, sam-
ples were treated for 10 min with 80% methanol, washed with
1 9 PBS and then digested (MES 25 mM pH 5.5, CaCl
2
8 mM, man-
nitol 600 mM, pectolyase 0.02%, macerozyme 0.1%) for 30 min at
37°C. Samples were incubated with primary antibody (the B-5–1-2
monoclonal anti-a-tubulin 1:1000 (Sigma–Aldrich) and the anti-
KNOLLE antibody 1:500 (kind gift of G. J€ urgens)) overnight at 4°C
and for 1 h at 37°C with the secondary antibody (Alexa 488 goat
anti-mouse for the anti-a-tubulin, 1:1000; Molecular Probes,
A21432 and Alexa 555 goat anti-rabbit for the anti-knolle, 1:1000;
Molecular Probes (Invitrogen, Carlsbad, CA, USA, http://www.life
technologies.com), A21428). After each antibody treatment,
samples were washed for 10 min with glycine 50 mM/1 9 PBS.
Samples were mounted in Citifluor/DAPI 20 lg mL
À1
.
Microscopy and image analysis
Spinning disk microscopy. Imaging of 3- or 4-day-old, living
seedlings was performed on an Axiovert 200M microscope (Zeiss)
equipped with an Axio Observer Z1 Zeiss microscope (Zeiss,
Oberkochen, Germany, http://www.zeiss.com) equipped with a
Table 1 Primers used for pCESA1:GFPCESA1 construct
Primers Sequence 5′ ? 3′
CESA1 promoter amplification GCTCTAGACGCAGCCACCGACACACA
CCAAGCTTATGAATAATGATTACCCTTA
cDNA1 CESA1 amplification GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGAGGCCAGTGCCGGCTT
GGGGACCACTTTGTACAAGAAAGCTGGGTCCATGGAAAAGACACCTCCTTTGCCAT
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
82 Fabien Miart et al.
Yokogawa CSU-X1 spinning disk, Zeiss 3100/1.4 numerical aper-
ture oil objective, and Roper EMCCD Quantum 512C. A 488-nm
diode-pumped solid-state laser was used for excitation of GFP,
and emission was collected using a band-pass 500/550 nm
(Semrock, Rochester, NY, USA, http://www.semrock.com). A 561-
nm diode-pumped solid-state laser was use for excitation of
mCherry and emission was collected using a band-pass 598–
660 nm. Z-stacks were acquired with an interval of 0.3 lm. Time
series were acquired with a maximal time interval. Time exposure
was 500 msec. The intensity of the laser was modulated according
to the experiments.
Confocal scanning laser microscopy and image analy-
sis. Root-tip cells were imaged with a Zeiss LSM710 confocal
microscope using a 405 nm diode laser line exciting DAPI, a
488 nm argon laser line exciting Alexa Fluor 488 and GFP, FM4–
64, a 561 nm diode laser line exciting mOrange and Alexa Fluor
555 and a 514 nm diode laser line exciting Scarlet 4B. Fluores-
cence emission was detected between 410 and 480 nm for DAPI,
aniline blue, 495–530 nm for Alexa Fluor 488, GFP, 650–700 nm
for FM4–64, and 565–600 nm for mOrange, Alexa Fluor 555, 605–
640 nm for S4B. In multi-labelling studies, detection was per-
formed in a sequential line-scanning mode with a line average of
eight. The quality of the images were improved by subtracting the
noise using IMAGEJ software (F. Cordeli eres, Curie; W. Rasban,
National Institutes of Health, Bethesda, MD, USA). Kymograph
analysis was also carried out with a plug-in made by F. Cordel-
i eres. From the Z-stacks, orthogonal view or 3D reconstruction
were used in IMAGEJ. For the 3D reconstruction, cell envelopes
were delineated using a semi-automatic method whereby a user-
provided coarse initial contour automatically adjusts to the cell
wall. Cell surfaces are reconstructed from the piling-up of 2D con-
tours. The GFP–CESA1 punctae were manually segmented.
Finally, graphical models displaying the spatial distribution of
objects of interest within individual cells are generated and inter-
actively visualized. Algorithm development and 3D model visuali-
zation rely on the C++ image and shape libraries and on the FREE-D
reconstruction software (Andrey and Maurin, 2005). For all the
quantifications, three independent experiments were realised. The
S4B or CBM3a signal at the cell plate was quantified (n = 10) using
IMAGEJ. The relative signal intensity was measured and divided by
the background relative signal intensity.
ACKNOWLEDGEMENTS
Part of the work was financed by ANR projects IMACEL and
MECHASTEM and EU FP7 project ‘Agronomics’.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online ver-
sion of this article.
Figure S1. Complementation of the short hypocotyl phenotype of
cesa1
rsw1–10
by GFP-CESA1 expressed from its endogenous pro-
moter.
Figure S2. S4B staining is reduced upon chemical or genetic inhi-
bition of cellulose synthesis.
Figure S3. CBM3a labeling of cellulose in the developing cell
plate.
Movie S1. A Z-stack of root cell labeled by Pontamine Fast Scarlet
4B.
Movie S2. 3D reconstruction of a dividing cell expressing GFP-
CESA1 and labeled with FM4–64 at the transition anaphase/telo-
phase.
Movie S3. 3D reconstruction of a dividing cell expressing GFP-
CESA1 and labeled with FM4–64 at the late telophase.
Movie S4. GFP-CESA1-labeled Golgi stack directly or indirectly
(via vesicle) secretes fluorescent material to the cell plate.
Movie S5. GFP-CESA1 punctae directly migrate through the
plasma membrane-cell plate junction.
Movie S6. Retrieval of doubly GFP-CESA1/CLC-mOrange-labeled
vesicles from the cell plate.
Movie S7. Retrieval of doubly GFP-CESA1/CLC-mOrange-labeled
from the parental plasma membrane adjacent to the phragmoplast.
REFERENCES
Anderson, C.T., Carroll, A., Akhmetova, L. and Somerville, C. (2010)
Real-time imaging of cellulose reorientation during cell wall expansion
in Arabidopsis roots. Plant Physiol. 152, 787–796.
Andrey, P. and Maurin, Y. (2005) Free-D: an integrated environment for
three-dimensional reconstruction from serial sections. J. Neurosci. Meth-
ods 145, 233–244.
Baluska, F., Hlavacka, A., Samaj, J., Palme, K., Robinson, D.G., Matoh, T.,
McCurdy, D.W., Menzel, D. and Volkmann, D. (2002) F-actin-dependent
endocytosis of cell wall pectins in meristematic root cells. Insights from
brefeldin A-induced compartments. Plant Physiol. 130, 422–431.
Beeckman, T., Przemeck, G.K., Stamatiou, G., Lau, R., Terryn, N., De Rycke,
R., Inze, D. and Berleth, T. (2002) Genetic complexity of cellulose syn-
thase a gene function in Arabidopsis embryogenesis. Plant Physiol. 130,
1883–1893.
Bischoff, V., Desprez, T., Mouille, G., Vernhettes, S., Gonneau, M. and
Hofte, H. (2011) Phytochrome regulation of cellulose synthesis in Arabid-
opsis. Curr. Biol. 21, 1822–1827.
Blake, A.W., McCartney, L., Flint, J.E., Bolam, D.N., Boraston, A.B., Gilbert,
H.J. and Knox, J.P. (2006) Understanding the biological rationale for the
diversity of cellulose-directed carbohydrate-binding modules in prokary-
otic enzymes. J. Biol. Chem. 281, 29321–29329.
Cannon, M.C., Terneus, K., Hall, Q., Tan, L., Wang, Y., Wegenhart, B.L.,
Chen, L., Lamport, D.T., Chen, Y. and Kieliszewski, M.J. (2008)
Self-assembly of the plant cell wall requires an extensin scaffold. Proc.
Natl. Acad. Sci. U.S.A. 105, 2226–2231.
Collings, D.A., Gebbie, L.K., Howles, P.A., Hurley, U.A., Birch, R.J., Cork,
A.H., Hocart, C.H., Arioli, T. and Williamson, R.E. (2008) Arabidopsis dyn-
amin-like protein DRP1A: a null mutant with widespread defects in endo-
cytosis, cellulose synthesis, cytokinesis, and cell expansion. J. Exp. Bot.
59, 361–376.
Crowell, E.F., Bischoff, V., Desprez, T., Rolland, A., Stierhof, Y.D., Schum-
acher, K., Gonneau, M., Hofte, H. and Vernhettes, S. (2009) Pausing of
Golgi bodies on microtubules regulates secretion of cellulose synthase
complexes in Arabidopsis. Plant Cell, 21, 1141–1154.
Desprez, T., Juraniec, M., Crowell, E.F., Jouy, H., Pochylova, Z., Parcy, F.,
Hofte, H., Gonneau, M. and Vernhettes, S. (2007) Organization of cellu-
lose synthase complexes involved in primary cell wall synthesis in Ara-
bidopsis thaliana. Proc. Natl. Acad. Sci. U.S.A., 104, 15572–15577.
Fujimoto, M., Arimura, S., Ueda, T., Takanashi, H., Hayashi, Y., Nakano, A.
and Tsutsumi, N. (2010) Arabidopsis dynamin-related proteins DRP2B
and DRP1A participate together in clathrin-coated vesicle formation dur-
ing endocytosis. Proc. Natl. Acad. Sci. U.S.A. 107, 6094–6099.
Geldner, N., Friml, J., Stierhof, Y.D., Jurgens, G. and Palme, K. (2001) Auxin
transport inhibitors block PIN1 cycling and vesicle trafficking. Nature,
413, 425–428.
Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P.,
Delbarre, A., Ueda, T., Nakano, A. and Jurgens, G. (2003) The Arabidop-
sis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and
auxin-dependent plant growth. Cell, 112, 219–230.
Geldner, N., Denervaud-Tendon, V., Hyman, D.L., Mayer, U., Stierhof, Y.D.
and Chory, J. (2009) Rapid, combinatorial analysis of membrane compart-
ments in intact plants with a multicolor marker set. Plant J. 59, 169–178.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
Cellulose synthase trafficking during cell plate formation 83
Giddings, T.H. Jr, Brower, D.L. and Staehelin, L.A. (1980) Visualization of
particle complexes in the plasma membrane of Micrasterias denticulata
associated with the formation of cellulose fibrils in primary and second-
ary cell walls. J. Cell Biol. 84, 327–339.
Grebe, M., Friml, J., Swarup, R., Ljung, K., Sandberg, G., Terlou, M., Palme, K.,
Bennett, M.J. and Scheres, B. (2002) Cell polarity signaling in Arabidopsis
involves a BFA-sensitive auxin influx pathway. Curr. Biol. 12, 329–334.
Grebe, M., Xu, J., Mobius, W., Ueda, T., Nakano, A., Geuze, H.J., Rook,
M.B. and Scheres, B. (2003) Arabidopsis sterol endocytosis involves
actin-mediated trafficking via ARA6-positive early endosomes. Curr. Biol.
13, 1378–1387.
Guerriero, G., Fugelstad, J. and Bulone, V. (2010) What do we really know
about cellulose biosynthesis in higher plants? J. Integr. Plant Biol. 52,
161–175.
Gutierrez, R., Lindeboom, J.J., Paredez, A.R., Emons, A.M. and Ehrhardt,
D.W. (2009) Arabidopsis cortical microtubules position cellulose
synthase delivery to the plasma membrane and interact with cellulose
synthase trafficking compartments. Nat. Cell Biol. 11, 797–806.
Kimura, S., Laosinchai, W., Itoh, T., Cui, X., Linder, C.R. and Brown, R.M. Jr
(1999) Immunogold labeling of rosette terminal cellulose-synthesizing
complexes in the vascular plant vigna angularis. Plant Cell, 11, 2075–
2086.
Konopka, C.A. and Bednarek, S.Y. (2008) Comparison of the dynamics and
functional redundancy of the Arabidopsis dynamin-related isoforms
DRP1A and DRP1C during plant development. Plant Physiol. 147, 1590–
1602.
Lauber, M.H., Waizenegger, I., Steinmann, T., Schwarz, H., Mayer, U.,
Hwang, I., Lukowitz, W. and Jurgens, G. (1997) The Arabidopsis
KNOLLE protein is a cytokinesis-specific syntaxin. J. Cell Biol. 139,
1485–1493.
Mendu, V., Griffiths, J.S., Persson, S., Stork, J., Downie, A.B., Voiniciuc, C.,
Haughn, G.W. and DeBolt, S. (2011) Subfunctionalization of cellulose
synthases in seed coat epidermal cells mediates secondary radial wall
synthesis and mucilage attachment. Plant Physiol. 157, 441–453.
Moore, P.J. and Staehelin, L.A. (1988) Immunogold localization of the cell--
wall-matrix polysaccharides rhamnogalacturonan I and xyloglucan dur-
ing cell expansion and cytokinesis in Trifolium pratense L.; implication
for secretory pathways. Planta, 174, 433–445.
Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473–497.
Murphy, A.S., Bandyopadhyay, A., Holstein, S.E. and Peer, W.A. (2005)
Endocytotic cycling of PM proteins. Annu. Rev. Plant Biol. 56, 221–251.
Nebenfuhr, A., Frohlick, J.A. and Staehelin, L.A. (2000) Redistribution of
Golgi stacks and other organelles during mitosis and cytokinesis in plant
cells. Plant Physiol. 124, 135–151.
Otegui, M.S. and Staehelin, L.A. (2004) Electron tomographic analysis of
post-meiotic cytokinesis during pollen development in Arabidopsis thali-
ana. Planta, 218, 501–515.
Otegui, M.S., Mastronarde, D.N., Kang, B.H., Bednarek, S.Y. and Staehelin,
L.A. (2001) Three-dimensional analysis of syncytial-type cell plates dur-
ing endosperm cellularization visualized by high resolution electron
tomography. Plant Cell, 13, 2033–2051.
Paciorek, T., Zazimalova, E., Ruthardt, N. et al. (2005) Auxin inhibits
endocytosis and promotes its own efflux from cells. Nature, 435, 1251–
1256.
Paredez, A.R., Somerville, C.R. and Ehrhardt, D.W. (2006) Visualization of
cellulose synthase demonstrates functional association with microtu-
bules. Science, 312, 1491–1495.
Park, S., Szumlanski, A.L., Gu, F., Guo, F. and Nielsen, E. (2011) A role for
CSLD3 during cell-wall synthesis in apical plasma membranes of
tip-growing root-hair cells. Nat. Cell Biol. 13, 973–980.
Persson, S., Paredez, A., Carroll, A., Palsdottir, H., Doblin, M., Poindexter,
P., Khitrov, N., Auer, M. and Somerville, C.R. (2007) Genetic evidence for
three unique components in primary cell-wall cellulose synthase com-
plexes in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A., 104, 15566–15571.
Reichardt, I., Stierhof, Y.D., Mayer, U., Richter, S., Schwarz, H., Schumach-
er, K. and Jurgens, G. (2007) Plant cytokinesis requires de novo secretory
trafficking but not endocytosis. Curr. Biol. 17, 2047–2053.
Samaj, J., Baluska, F., Voigt, B., Schlicht, M., Volkmann, D. and Menzel, D.
(2004) Endocytosis, actin cytoskeleton, and signaling. Plant Physiol. 135,
1150–1161.
Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory
Manual. E.C.S.H.L. Press: Cold Spring Harbor, NY.
Samuels, A.L., Giddings, T.H. Jr and Staehelin, L.A. (1995) Cytokinesis in
tobacco BY-2 and root tip cells: a new model of cell plate formation in
higher plants. J. Cell Biol. 130, 1345–1357.
Sasabe, M. and Machida, Y. (2006) MAP65: a bridge linking a MAP kinase to
microtubule turnover. Curr. Opin. Plant Biol. 9, 563–570.
Sasabe, M., Soyano, T., Takahashi, Y., Sonobe, S., Igarashi, H., Itoh, T.J.,
Hidaka, M. and Machida, Y. (2006) Phosphorylation of NtMAP65–1 by a
MAP kinase down-regulates its activity of microtubule bundling and
stimulates progression of cytokinesis of tobacco cells. Genes Dev. 20,
1004–1014.
Segui-Simarro, J.M. and Staehelin, L.A. (2006) Cell cycle-dependent
changes in Golgi stacks, vacuoles, clathrin-coated vesicles and multive-
sicular bodies in meristematic cells of Arabidopsis thaliana: a quantita-
tive and spatial analysis. Planta, 223, 223–236.
Segui-Simarro, J.M., Austin, J.R. 2nd, White, E.A. and Staehelin, L.A. (2004)
Electron tomographic analysis of somatic cell plate formation in meriste-
matic cells of Arabidopsis preserved by high-pressure freezing. Plant
Cell, 16, 836–856.
Strompen, G., El Kasmi, F., Richter, S., Lukowitz, W., Assaad, F.F., Jurgens,
G. and Mayer, U. (2002) The Arabidopsis HINKEL gene encodes a kine-
sin-related protein involved in cytokinesis and is expressed in a cell
cycle-dependent manner. Curr. Biol. 12, 153–158.
Takei, K., Mundigl, O., Daniell, L. and De Camilli, P. (1996) The synaptic vesi-
cle cycle: a single vesicle budding step involving clathrin and dynamin.
J. Cell Biol. 133, 1237–1250.
Thiele, K., Wanner, G., Kindzierski, V., Jurgens, G., Mayer, U., Pachl, F. and
Assaad, F.F. (2009) The timely deposition of callose is essential for cyto-
kinesis in Arabidopsis. Plant J. 58, 13–26.
Verma, D.P. and Hong, Z. (2005) The ins and outs in membrane dynamics:
tubulation and vesiculation. Trends Plant Sci. 10, 159–165.
Vermeer, J.E., van Leeuwen, W., Tobena-Santamaria, R., Laxalt, A.M.,
Jones, D.R., Divecha, N., Gadella, T.W. Jr and Munnik, T. (2006) Visuali-
zation of PtdIns3P dynamics in living plant cells. Plant J. 47, 687–700.
Zuo, J., Niu, Q.W., Nishizawa, N., Wu, Y., Kost, B. and Chua, N.H. (2000)
KORRIGAN, an Arabidopsis endo-1,4-beta-glucanase, localizes to the cell
plate by polarized targeting and is essential for cytokinesis. Plant Cell,
12, 1137–1152.
© 2013 The Authors
The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 71–84
84 Fabien Miart et al.